id	sid	tid	token	lemma	pos
chd-99	1	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	VERB
chd-99	1	2	e1	e1	NOUN
chd-99	1	3	cancer	cancer	NOUN
chd-99	1	4	health	health	NOUN
chd-99	1	5	disparities	disparity	NOUN
chd-99	1	6	research	research	PROPN
chd-99	1	7	microrna	microrna	PROPN
chd-99	1	8	204	204	NUM
chd-99	1	9	mediated	mediate	VERB
chd-99	1	10	negative	negative	ADJ
chd-99	1	11	regulation	regulation	NOUN
chd-99	1	12	of	of	ADP
chd-99	1	13	the	the	DET
chd-99	1	14	igf2r	igf2r	PROPN
chd-99	1	15	promotes	promote	VERB
chd-99	1	16	breast	breast	NOUN
chd-99	1	17	cancer	cancer	NOUN
chd-99	1	18	progression	progression	NOUN
chd-99	1	19	and	and	CCONJ
chd-99	1	20	is	be	AUX
chd-99	1	21	a	a	DET
chd-99	1	22	potential	potential	ADJ
chd-99	1	23	mechanism	mechanism	NOUN
chd-99	1	24	driving	drive	VERB
chd-99	1	25	breast	breast	NOUN
chd-99	1	26	cancer	cancer	NOUN
chd-99	1	27	disparity	disparity	NOUN
chd-99	1	28	lourdes	lourdes	PROPN
chd-99	1	29	m	m	VERB
chd-99	1	30	nogueira1,4	nogueira1,4	PROPN
chd-99	1	31	,	,	PUNCT
chd-99	1	32	clare	clare	NOUN
chd-99	1	33	e	e	PROPN
chd-99	1	34	burton1	burton1	PROPN
chd-99	1	35	,	,	PUNCT
chd-99	1	36	laurel	laurel	NOUN
chd-99	1	37	black1	black1	PROPN
chd-99	1	38	,	,	PUNCT
chd-99	1	39	jasmine	jasmine	PROPN
chd-99	1	40	d	d	PROPN
chd-99	1	41	fox6	fox6	PROPN
chd-99	1	42	,	,	PUNCT
chd-99	1	43	kristi	kristi	PROPN
chd-99	1	44	l	l	PROPN
chd-99	1	45	helke1	helke1	PROPN
chd-99	1	46	,	,	PUNCT
chd-99	1	47	elizabeth	elizabeth	PROPN
chd-99	1	48	garrettmayer3	garrettmayer3	PROPN
chd-99	1	49	-	-	PUNCT
chd-99	1	50	5	5	NUM
chd-99	1	51	,	,	PUNCT
chd-99	1	52	dennis	dennis	PROPN
chd-99	1	53	k	k	PROPN
chd-99	1	54	watson1,4,5	watson1,4,5	PROPN
chd-99	1	55	,	,	PUNCT
chd-99	1	56	david	david	PROPN
chd-99	1	57	p	p	PROPN
chd-99	1	58	turner1,4,5	turner1,4,5	NOUN
chd-99	1	59	and	and	CCONJ
chd-99	1	60	victoria	victoria	PROPN
chd-99	1	61	j	j	PROPN
chd-99	1	62	findlay1,4,5	findlay1,4,5	PROPN
chd-99	1	63	*	*	PROPN
chd-99	1	64	department	department	NOUN
chd-99	1	65	of	of	ADP
chd-99	1	66	1pathology	1pathology	PROPN
chd-99	1	67	&	&	CCONJ
chd-99	1	68	laboratory	laboratory	NOUN
chd-99	1	69	medicine	medicine	NOUN
chd-99	1	70	,	,	PUNCT
chd-99	1	71	2biochemistry	2biochemistry	NUM
chd-99	1	72	&	&	CCONJ
chd-99	1	73	molecular	molecular	ADJ
chd-99	1	74	biology	biology	NOUN
chd-99	1	75	,	,	PUNCT
chd-99	1	76	3public	3public	NUM
chd-99	1	77	health	health	NOUN
chd-99	1	78	sciences	science	NOUN
chd-99	1	79	;	;	PUNCT
chd-99	1	80	4college	4college	NUM
chd-99	1	81	of	of	ADP
chd-99	1	82	medicine	medicine	NOUN
chd-99	1	83	,	,	PUNCT
chd-99	1	84	5hollings	5hollings	NUM
chd-99	1	85	cancer	cancer	NOUN
chd-99	1	86	center	center	NOUN
chd-99	1	87	,	,	PUNCT
chd-99	1	88	medical	medical	ADJ
chd-99	1	89	university	university	PROPN
chd-99	1	90	of	of	ADP
chd-99	1	91	south	south	PROPN
chd-99	1	92	carolina	carolina	PROPN
chd-99	1	93	,	,	PUNCT
chd-99	1	94	charleston	charleston	PROPN
chd-99	1	95	,	,	PUNCT
chd-99	1	96	sc	sc	PROPN
chd-99	1	97	,	,	PUNCT
chd-99	1	98	usa	usa	PROPN
chd-99	1	99	.	.	PROPN
chd-99	2	1	6south	6south	PROPN
chd-99	2	2	carolina	carolina	PROPN
chd-99	2	3	state	state	PROPN
chd-99	2	4	university	university	PROPN
chd-99	2	5	,	,	PUNCT
chd-99	2	6	orangeburg	orangeburg	PROPN
chd-99	2	7	,	,	PUNCT
chd-99	2	8	sc	sc	PROPN
chd-99	2	9	,	,	PUNCT
chd-99	2	10	usa	usa	PROPN
chd-99	2	11	.	.	PROPN
chd-99	3	1	*	*	PUNCT
chd-99	3	2	corresponding	correspond	VERB
chd-99	3	3	author	author	NOUN
chd-99	3	4	’s	’s	PART
chd-99	3	5	email	email	NOUN
chd-99	3	6	:	:	PUNCT
chd-99	3	7	findlay@musc.edu	findlay@musc.edu	X
chd-99	3	8	abstract	abstract	ADJ
chd-99	3	9	in	in	ADP
chd-99	3	10	the	the	DET
chd-99	3	11	us	us	PROPN
chd-99	3	12	,	,	PUNCT
chd-99	3	13	african	african	ADJ
chd-99	3	14	american	american	ADJ
chd-99	3	15	women	woman	NOUN
chd-99	3	16	have	have	VERB
chd-99	3	17	a	a	DET
chd-99	3	18	significantly	significantly	ADV
chd-99	3	19	higher	high	ADJ
chd-99	3	20	rate	rate	NOUN
chd-99	3	21	of	of	ADP
chd-99	3	22	mortality	mortality	NOUN
chd-99	3	23	due	due	ADP
chd-99	3	24	to	to	ADP
chd-99	3	25	breast	breast	NOUN
chd-99	3	26	cancer	cancer	NOUN
chd-99	3	27	compared	compare	VERB
chd-99	3	28	to	to	ADP
chd-99	3	29	caucasian	caucasian	ADJ
chd-99	3	30	american	american	ADJ
chd-99	3	31	women	woman	NOUN
chd-99	3	32	.	.	PUNCT
chd-99	4	1	molecular	molecular	ADJ
chd-99	4	2	differences	difference	NOUN
chd-99	4	3	in	in	ADP
chd-99	4	4	tumor	tumor	NOUN
chd-99	4	5	biology	biology	NOUN
chd-99	4	6	exist	exist	VERB
chd-99	4	7	between	between	ADP
chd-99	4	8	racial	racial	ADJ
chd-99	4	9	groups	group	NOUN
chd-99	4	10	;	;	PUNCT
chd-99	4	11	however	however	ADV
chd-99	4	12	,	,	PUNCT
chd-99	4	13	their	their	PRON
chd-99	4	14	contribution	contribution	NOUN
chd-99	4	15	to	to	ADP
chd-99	4	16	cancer	cancer	NOUN
chd-99	4	17	disparity	disparity	NOUN
chd-99	4	18	is	be	AUX
chd-99	4	19	not	not	PART
chd-99	4	20	well	well	ADV
chd-99	4	21	understood	understand	VERB
chd-99	4	22	.	.	PUNCT
chd-99	5	1	our	our	PRON
chd-99	5	2	studies	study	NOUN
chd-99	5	3	have	have	AUX
chd-99	5	4	identified	identify	VERB
chd-99	5	5	a	a	DET
chd-99	5	6	race	race	NOUN
chd-99	5	7	-	-	PUNCT
chd-99	5	8	specific	specific	ADJ
chd-99	5	9	,	,	PUNCT
chd-99	5	10	mechanistic	mechanistic	ADJ
chd-99	5	11	link	link	NOUN
chd-99	5	12	between	between	ADP
chd-99	5	13	microrna-204	microrna-204	NOUN
chd-99	5	14	and	and	CCONJ
chd-99	5	15	the	the	DET
chd-99	5	16	igf2r	igf2r	PROPN
chd-99	5	17	.	.	PUNCT
chd-99	6	1	the	the	DET
chd-99	6	2	igf2r	igf2r	PROPN
chd-99	6	3	is	be	AUX
chd-99	6	4	a	a	DET
chd-99	6	5	tumor	tumor	NOUN
chd-99	6	6	suppressor	suppressor	NOUN
chd-99	6	7	gene	gene	NOUN
chd-99	6	8	in	in	ADP
chd-99	6	9	several	several	ADJ
chd-99	6	10	cancers	cancer	NOUN
chd-99	6	11	including	include	VERB
chd-99	6	12	breast	breast	NOUN
chd-99	6	13	cancer	cancer	NOUN
chd-99	6	14	and	and	CCONJ
chd-99	6	15	igf2r	igf2r	PROPN
chd-99	6	16	levels	level	NOUN
chd-99	6	17	are	be	AUX
chd-99	6	18	found	find	VERB
chd-99	6	19	at	at	ADP
chd-99	6	20	significantly	significantly	ADV
chd-99	6	21	lower	low	ADJ
chd-99	6	22	levels	level	NOUN
chd-99	6	23	in	in	ADP
chd-99	6	24	african	african	ADJ
chd-99	6	25	american	american	ADJ
chd-99	6	26	women	woman	NOUN
chd-99	6	27	with	with	ADP
chd-99	6	28	breast	breast	NOUN
chd-99	6	29	cancer	cancer	NOUN
chd-99	6	30	when	when	SCONJ
chd-99	6	31	compared	compare	VERB
chd-99	6	32	to	to	ADP
chd-99	6	33	their	their	PRON
chd-99	6	34	caucasian	caucasian	ADJ
chd-99	6	35	counterparts	counterpart	NOUN
chd-99	6	36	.	.	PUNCT
chd-99	7	1	we	we	PRON
chd-99	7	2	observed	observe	VERB
chd-99	7	3	elevated	elevated	ADJ
chd-99	7	4	levels	level	NOUN
chd-99	7	5	of	of	ADP
chd-99	7	6	mir-204	mir-204	NOUN
chd-99	7	7	in	in	ADP
chd-99	7	8	serum	serum	NOUN
chd-99	7	9	of	of	ADP
chd-99	7	10	african	african	ADJ
chd-99	7	11	american	american	ADJ
chd-99	7	12	women	woman	NOUN
chd-99	7	13	with	with	ADP
chd-99	7	14	breast	breast	NOUN
chd-99	7	15	cancer	cancer	NOUN
chd-99	7	16	when	when	SCONJ
chd-99	7	17	compared	compare	VERB
chd-99	7	18	to	to	ADP
chd-99	7	19	caucasian	caucasian	ADJ
chd-99	7	20	american	american	ADJ
chd-99	7	21	women	woman	NOUN
chd-99	7	22	and	and	CCONJ
chd-99	7	23	identified	identify	VERB
chd-99	7	24	igf2r	igf2r	PROPN
chd-99	7	25	as	as	ADP
chd-99	7	26	a	a	DET
chd-99	7	27	direct	direct	ADJ
chd-99	7	28	target	target	NOUN
chd-99	7	29	of	of	ADP
chd-99	7	30	mir204	mir204	PROPN
chd-99	7	31	.	.	PUNCT
chd-99	8	1	we	we	PRON
chd-99	8	2	show	show	VERB
chd-99	8	3	mechanistically	mechanistically	ADV
chd-99	8	4	that	that	SCONJ
chd-99	8	5	mir-204	mir-204	NOUN
chd-99	8	6	mediated	mediate	VERB
chd-99	8	7	inhibition	inhibition	NOUN
chd-99	8	8	of	of	ADP
chd-99	8	9	igf2r	igf2r	PROPN
chd-99	8	10	leads	lead	NOUN
chd-99	8	11	to	to	ADP
chd-99	8	12	activation	activation	NOUN
chd-99	8	13	of	of	ADP
chd-99	8	14	the	the	DET
chd-99	8	15	igf1r	igf1r	PROPN
chd-99	8	16	signaling	signal	VERB
chd-99	8	17	pathway	pathway	NOUN
chd-99	8	18	resulting	result	VERB
chd-99	8	19	in	in	ADP
chd-99	8	20	increased	increase	VERB
chd-99	8	21	proliferation	proliferation	NOUN
chd-99	8	22	,	,	PUNCT
chd-99	8	23	migration	migration	NOUN
chd-99	8	24	and	and	CCONJ
chd-99	8	25	invasion	invasion	NOUN
chd-99	8	26	,	,	PUNCT
chd-99	8	27	processes	process	NOUN
chd-99	8	28	that	that	PRON
chd-99	8	29	are	be	AUX
chd-99	8	30	required	require	VERB
chd-99	8	31	for	for	ADP
chd-99	8	32	tumor	tumor	NOUN
chd-99	8	33	progression	progression	NOUN
chd-99	8	34	.	.	PUNCT
chd-99	9	1	we	we	PRON
chd-99	9	2	developed	develop	VERB
chd-99	9	3	a	a	DET
chd-99	9	4	unique	unique	ADJ
chd-99	9	5	doxycycline	doxycycline	NOUN
chd-99	9	6	-	-	PUNCT
chd-99	9	7	inducible	inducible	ADJ
chd-99	9	8	mir-204	mir-204	NOUN
chd-99	9	9	transgenic	transgenic	NOUN
chd-99	9	10	mouse	mouse	NOUN
chd-99	9	11	model	model	NOUN
chd-99	9	12	to	to	PART
chd-99	9	13	define	define	VERB
chd-99	9	14	in	in	ADP
chd-99	9	15	vivo	vivo	VERB
chd-99	9	16	the	the	DET
chd-99	9	17	oncogenic	oncogenic	ADJ
chd-99	9	18	potential	potential	NOUN
chd-99	9	19	of	of	ADP
chd-99	9	20	mir-204	mir-204	NOUN
chd-99	9	21	and	and	CCONJ
chd-99	9	22	the	the	DET
chd-99	9	23	mechanism	mechanism	NOUN
chd-99	9	24	and	and	CCONJ
chd-99	9	25	functional	functional	ADJ
chd-99	9	26	consequences	consequence	NOUN
chd-99	9	27	of	of	ADP
chd-99	9	28	igf2r	igf2r	PROPN
chd-99	9	29	loss	loss	NOUN
chd-99	9	30	.	.	PUNCT
chd-99	10	1	we	we	PRON
chd-99	10	2	observed	observe	VERB
chd-99	10	3	a	a	DET
chd-99	10	4	significant	significant	ADJ
chd-99	10	5	increase	increase	NOUN
chd-99	10	6	in	in	ADP
chd-99	10	7	tumor	tumor	NOUN
chd-99	10	8	growth	growth	NOUN
chd-99	10	9	and	and	CCONJ
chd-99	10	10	increased	increase	VERB
chd-99	10	11	metastasis	metastasis	NOUN
chd-99	10	12	in	in	ADP
chd-99	10	13	these	these	DET
chd-99	10	14	animals	animal	NOUN
chd-99	10	15	when	when	SCONJ
chd-99	10	16	compared	compare	VERB
chd-99	10	17	to	to	ADP
chd-99	10	18	non	non	ADJ
chd-99	10	19	-	-	ADJ
chd-99	10	20	transgenic	transgenic	ADJ
chd-99	10	21	controls	control	NOUN
chd-99	10	22	.	.	PUNCT
chd-99	11	1	this	this	PRON
chd-99	11	2	is	be	AUX
chd-99	11	3	the	the	DET
chd-99	11	4	first	first	ADJ
chd-99	11	5	characterization	characterization	NOUN
chd-99	11	6	of	of	ADP
chd-99	11	7	mir-204	mir-204	NOUN
chd-99	11	8	in	in	ADP
chd-99	11	9	an	an	DET
chd-99	11	10	in	in	ADP
chd-99	11	11	vivo	vivo	NOUN
chd-99	11	12	model	model	NOUN
chd-99	11	13	.	.	PUNCT
chd-99	12	1	these	these	DET
chd-99	12	2	data	datum	NOUN
chd-99	12	3	support	support	VERB
chd-99	12	4	a	a	DET
chd-99	12	5	mechanism	mechanism	NOUN
chd-99	12	6	whereby	whereby	SCONJ
chd-99	12	7	mir-204	mir-204	NOUN
chd-99	12	8	promotes	promote	VERB
chd-99	12	9	tumor	tumor	NOUN
chd-99	12	10	aggression	aggression	NOUN
chd-99	12	11	through	through	ADP
chd-99	12	12	the	the	DET
chd-99	12	13	igf2	igf2	PROPN
chd-99	12	14	-	-	PUNCT
chd-99	12	15	mediated	mediate	VERB
chd-99	12	16	hyperactivation	hyperactivation	NOUN
chd-99	12	17	of	of	ADP
chd-99	12	18	the	the	DET
chd-99	12	19	igf1r	igf1r	PROPN
chd-99	12	20	signaling	signal	VERB
chd-99	12	21	pathway	pathway	NOUN
chd-99	12	22	in	in	ADP
chd-99	12	23	response	response	NOUN
chd-99	12	24	to	to	PART
chd-99	12	25	direct	direct	VERB
chd-99	12	26	negative	negative	ADJ
chd-99	12	27	regulation	regulation	NOUN
chd-99	12	28	of	of	ADP
chd-99	12	29	the	the	DET
chd-99	12	30	tumor	tumor	NOUN
chd-99	12	31	suppressor	suppressor	NOUN
chd-99	12	32	igf2r	igf2r	PROPN
chd-99	13	1	and	and	CCONJ
chd-99	13	2	that	that	SCONJ
chd-99	13	3	this	this	PRON
chd-99	13	4	could	could	AUX
chd-99	13	5	be	be	AUX
chd-99	13	6	a	a	DET
chd-99	13	7	potential	potential	ADJ
chd-99	13	8	mechanism	mechanism	NOUN
chd-99	13	9	promoting	promote	VERB
chd-99	13	10	breast	breast	NOUN
chd-99	13	11	cancer	cancer	NOUN
chd-99	13	12	disparity	disparity	NOUN
chd-99	13	13	.	.	PUNCT
chd-99	14	1	keywords	keyword	NOUN
chd-99	14	2	:	:	PUNCT
chd-99	15	1	oncogenes	oncogene	NOUN
chd-99	15	2	,	,	PUNCT
chd-99	15	3	igf2	igf2	PROPN
chd-99	15	4	,	,	PUNCT
chd-99	15	5	breast	breast	NOUN
chd-99	15	6	neoplasms	neoplasm	NOUN
chd-99	15	7	,	,	PUNCT
chd-99	15	8	transgenic	transgenic	NOUN
chd-99	15	9	mice	mouse	NOUN
chd-99	15	10	,	,	PUNCT
chd-99	15	11	igf1r	igf1r	PROPN
chd-99	15	12	citation	citation	NOUN
chd-99	15	13	:	:	PUNCT
chd-99	16	1	nogueira	nogueira	PROPN
chd-99	16	2	lm	lm	INTJ
chd-99	16	3	et	et	PROPN
chd-99	16	4	al	al	PROPN
chd-99	16	5	(	(	PUNCT
chd-99	16	6	2019	2019	NUM
chd-99	16	7	)	)	PUNCT
chd-99	16	8	microrna	microrna	PROPN
chd-99	16	9	204	204	NUM
chd-99	16	10	mediated	mediate	VERB
chd-99	16	11	negative	negative	ADJ
chd-99	16	12	regulation	regulation	NOUN
chd-99	16	13	of	of	ADP
chd-99	16	14	the	the	DET
chd-99	16	15	igf2r	igf2r	PROPN
chd-99	16	16	promotes	promote	VERB
chd-99	16	17	breast	breast	NOUN
chd-99	16	18	cancer	cancer	NOUN
chd-99	16	19	progression	progression	NOUN
chd-99	16	20	and	and	CCONJ
chd-99	16	21	is	be	AUX
chd-99	16	22	a	a	DET
chd-99	16	23	potential	potential	ADJ
chd-99	16	24	mechanism	mechanism	NOUN
chd-99	16	25	driving	drive	VERB
chd-99	16	26	breast	breast	NOUN
chd-99	16	27	cancer	cancer	NOUN
chd-99	16	28	disparity	disparity	NOUN
chd-99	16	29	.	.	PUNCT
chd-99	17	1	cancer	cancer	NOUN
chd-99	17	2	health	health	NOUN
chd-99	17	3	disparities	disparity	NOUN
chd-99	17	4	3	3	NUM
chd-99	17	5	:	:	PUNCT
chd-99	17	6	e1	e1	NOUN
chd-99	17	7	-	-	PUNCT
chd-99	17	8	e19	e19	NOUN
chd-99	17	9	.	.	PUNCT
chd-99	18	1	doi:10.9777	doi:10.9777	PROPN
chd-99	18	2	/	/	SYM
chd-99	18	3	chd.2019.1016	chd.2019.1016	PROPN
chd-99	18	4	.	.	PROPN
chd-99	18	5	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	PROPN
chd-99	18	6	e2	e2	PROPN
chd-99	18	7	cancer	cancer	NOUN
chd-99	18	8	health	health	NOUN
chd-99	18	9	disparities	disparity	NOUN
chd-99	18	10	research	research	NOUN
chd-99	18	11	introduction	introduction	NOUN
chd-99	18	12	breast	breast	NOUN
chd-99	18	13	cancer	cancer	NOUN
chd-99	18	14	(	(	PUNCT
chd-99	18	15	bc	bc	PROPN
chd-99	18	16	)	)	PUNCT
chd-99	18	17	is	be	AUX
chd-99	18	18	a	a	DET
chd-99	18	19	worldwide	worldwide	ADJ
chd-99	18	20	health	health	NOUN
chd-99	18	21	issue	issue	NOUN
chd-99	18	22	as	as	SCONJ
chd-99	18	23	it	it	PRON
chd-99	18	24	represents	represent	VERB
chd-99	18	25	the	the	DET
chd-99	18	26	leading	lead	VERB
chd-99	18	27	cause	cause	NOUN
chd-99	18	28	of	of	ADP
chd-99	18	29	cancer	cancer	NOUN
chd-99	18	30	and	and	CCONJ
chd-99	18	31	remains	remain	VERB
chd-99	18	32	the	the	DET
chd-99	18	33	second	second	ADJ
chd-99	18	34	leading	leading	ADJ
chd-99	18	35	cause	cause	NOUN
chd-99	18	36	of	of	ADP
chd-99	18	37	cancerrelated	cancerrelate	VERB
chd-99	18	38	mortality	mortality	NOUN
chd-99	18	39	in	in	ADP
chd-99	18	40	women	woman	NOUN
chd-99	18	41	.	.	PUNCT
chd-99	19	1	in	in	ADP
chd-99	19	2	the	the	DET
chd-99	19	3	us	us	PROPN
chd-99	19	4	,	,	PUNCT
chd-99	19	5	african	african	ADJ
chd-99	19	6	american	american	PROPN
chd-99	19	7	(	(	PUNCT
chd-99	19	8	aa	aa	NOUN
chd-99	19	9	)	)	PUNCT
chd-99	19	10	women	woman	NOUN
chd-99	19	11	have	have	VERB
chd-99	19	12	a	a	DET
chd-99	19	13	significantly	significantly	ADV
chd-99	19	14	higher	high	ADJ
chd-99	19	15	rate	rate	NOUN
chd-99	19	16	of	of	ADP
chd-99	19	17	bc	bc	PROPN
chd-99	19	18	mortality	mortality	NOUN
chd-99	19	19	compared	compare	VERB
chd-99	19	20	to	to	ADP
chd-99	19	21	caucasian	caucasian	PROPN
chd-99	19	22	american	american	PROPN
chd-99	19	23	(	(	PUNCT
chd-99	19	24	ca	ca	NOUN
chd-99	19	25	)	)	PUNCT
chd-99	19	26	women	woman	NOUN
chd-99	19	27	.	.	PUNCT
chd-99	20	1	recent	recent	ADJ
chd-99	20	2	studies	study	NOUN
chd-99	20	3	have	have	AUX
chd-99	20	4	highlighted	highlight	VERB
chd-99	20	5	the	the	DET
chd-99	20	6	need	need	NOUN
chd-99	20	7	for	for	ADP
chd-99	20	8	understanding	understand	VERB
chd-99	20	9	the	the	DET
chd-99	20	10	molecular	molecular	ADJ
chd-99	20	11	basis	basis	NOUN
chd-99	20	12	of	of	ADP
chd-99	20	13	cancer	cancer	NOUN
chd-99	20	14	disparities	disparity	NOUN
chd-99	20	15	as	as	SCONJ
chd-99	20	16	these	these	PRON
chd-99	20	17	contribute	contribute	VERB
chd-99	20	18	to	to	ADP
chd-99	20	19	the	the	DET
chd-99	20	20	observed	observe	VERB
chd-99	20	21	differences	difference	NOUN
chd-99	20	22	in	in	ADP
chd-99	20	23	mortality	mortality	NOUN
chd-99	20	24	that	that	PRON
chd-99	20	25	we	we	PRON
chd-99	20	26	observe	observe	VERB
chd-99	20	27	in	in	ADP
chd-99	20	28	hormonally	hormonally	ADV
chd-99	20	29	driven	drive	VERB
chd-99	20	30	cancers	cancer	NOUN
chd-99	20	31	(	(	PUNCT
chd-99	20	32	albain	albain	VERB
chd-99	20	33	et	et	PROPN
chd-99	20	34	al	al	PROPN
chd-99	20	35	.	.	PROPN
chd-99	20	36	,	,	PUNCT
chd-99	20	37	2009	2009	NUM
chd-99	20	38	)	)	PUNCT
chd-99	20	39	.	.	PUNCT
chd-99	21	1	the	the	DET
chd-99	21	2	insulin	insulin	NOUN
chd-99	21	3	-	-	PUNCT
chd-99	21	4	like	like	ADJ
chd-99	21	5	growth	growth	NOUN
chd-99	21	6	factor	factor	NOUN
chd-99	21	7	2	2	NUM
chd-99	21	8	receptor	receptor	NOUN
chd-99	21	9	(	(	PUNCT
chd-99	21	10	igf2r	igf2r	PROPN
chd-99	21	11	)	)	PUNCT
chd-99	21	12	is	be	AUX
chd-99	21	13	a	a	DET
chd-99	21	14	transmembrane	transmembrane	ADJ
chd-99	21	15	receptor	receptor	NOUN
chd-99	21	16	that	that	PRON
chd-99	21	17	binds	bind	VERB
chd-99	21	18	insulin	insulin	NOUN
chd-99	21	19	-	-	PUNCT
chd-99	21	20	like	like	ADJ
chd-99	21	21	growth	growth	NOUN
chd-99	21	22	factor	factor	NOUN
chd-99	21	23	(	(	PUNCT
chd-99	21	24	igf-2	igf-2	NOUN
chd-99	21	25	)	)	PUNCT
chd-99	21	26	,	,	PUNCT
chd-99	21	27	resulting	result	VERB
chd-99	21	28	in	in	ADP
chd-99	21	29	its	its	PRON
chd-99	21	30	degradation	degradation	NOUN
chd-99	21	31	via	via	ADP
chd-99	21	32	internalization	internalization	NOUN
chd-99	21	33	and	and	CCONJ
chd-99	21	34	transport	transport	NOUN
chd-99	21	35	to	to	ADP
chd-99	21	36	lysosomes	lysosome	NOUN
chd-99	21	37	(	(	PUNCT
chd-99	21	38	oka	oka	NOUN
chd-99	21	39	et	et	PROPN
chd-99	21	40	al	al	PROPN
chd-99	21	41	.	.	PROPN
chd-99	21	42	,	,	PUNCT
chd-99	21	43	1985	1985	NUM
chd-99	21	44	)	)	PUNCT
chd-99	21	45	.	.	PUNCT
chd-99	22	1	removal	removal	NOUN
chd-99	22	2	of	of	ADP
chd-99	22	3	igf-2	igf-2	PUNCT
chd-99	22	4	from	from	ADP
chd-99	22	5	the	the	DET
chd-99	22	6	extracellular	extracellular	ADJ
chd-99	22	7	environment	environment	NOUN
chd-99	22	8	precludes	preclude	VERB
chd-99	22	9	activation	activation	NOUN
chd-99	22	10	of	of	ADP
chd-99	22	11	the	the	DET
chd-99	22	12	insulin	insulin	NOUN
chd-99	22	13	-	-	PUNCT
chd-99	22	14	like	like	ADJ
chd-99	22	15	growth	growth	NOUN
chd-99	22	16	factor	factor	NOUN
chd-99	22	17	1	1	NUM
chd-99	22	18	receptor	receptor	NOUN
chd-99	22	19	(	(	PUNCT
chd-99	22	20	igf1r	igf1r	PROPN
chd-99	22	21	)	)	PUNCT
chd-99	22	22	;	;	PUNCT
chd-99	22	23	thus	thus	ADV
chd-99	22	24	the	the	DET
chd-99	22	25	igf2r	igf2r	PROPN
chd-99	22	26	is	be	AUX
chd-99	22	27	believed	believe	VERB
chd-99	22	28	to	to	PART
chd-99	22	29	reduce	reduce	VERB
chd-99	22	30	the	the	DET
chd-99	22	31	mitogenic	mitogenic	ADJ
chd-99	22	32	effects	effect	NOUN
chd-99	22	33	of	of	ADP
chd-99	22	34	igf-2	igf-2	NOUN
chd-99	22	35	.	.	PUNCT
chd-99	23	1	igf2r	igf2r	PROPN
chd-99	23	2	is	be	AUX
chd-99	23	3	also	also	ADV
chd-99	23	4	involved	involve	VERB
chd-99	23	5	in	in	ADP
chd-99	23	6	the	the	DET
chd-99	23	7	activation	activation	NOUN
chd-99	23	8	of	of	ADP
chd-99	23	9	transforming	transform	VERB
chd-99	23	10	growth	growth	NOUN
chd-99	23	11	factor	factor	NOUN
chd-99	24	1	beta	beta	NOUN
chd-99	24	2	(	(	PUNCT
chd-99	24	3	tgf	tgf	PROPN
chd-99	24	4	-	-	PUNCT
chd-99	24	5	β	β	NOUN
chd-99	24	6	)	)	PUNCT
chd-99	24	7	(	(	PUNCT
chd-99	24	8	dennis	dennis	PROPN
chd-99	24	9	and	and	CCONJ
chd-99	24	10	rifkin	rifkin	PROPN
chd-99	24	11	,	,	PUNCT
chd-99	24	12	1991	1991	NUM
chd-99	24	13	)	)	PUNCT
chd-99	25	1	and	and	CCONJ
chd-99	25	2	may	may	AUX
chd-99	25	3	be	be	AUX
chd-99	25	4	a	a	DET
chd-99	25	5	high	high	ADJ
chd-99	25	6	affinity	affinity	NOUN
chd-99	25	7	binding	bind	VERB
chd-99	25	8	receptor	receptor	NOUN
chd-99	25	9	for	for	ADP
chd-99	25	10	retinoic	retinoic	ADJ
chd-99	25	11	acid	acid	NOUN
chd-99	25	12	,	,	PUNCT
chd-99	25	13	an	an	DET
chd-99	25	14	agent	agent	NOUN
chd-99	25	15	known	know	VERB
chd-99	25	16	to	to	PART
chd-99	25	17	have	have	VERB
chd-99	25	18	diverse	diverse	ADJ
chd-99	25	19	biological	biological	ADJ
chd-99	25	20	effects	effect	NOUN
chd-99	25	21	in	in	ADP
chd-99	25	22	both	both	DET
chd-99	25	23	embryogenesis	embryogenesis	NOUN
chd-99	25	24	and	and	CCONJ
chd-99	25	25	oncogenesis	oncogenesis	NOUN
chd-99	25	26	(	(	PUNCT
chd-99	25	27	kang	kang	PROPN
chd-99	25	28	et	et	PROPN
chd-99	25	29	al	al	PROPN
chd-99	25	30	.	.	PROPN
chd-99	25	31	,	,	PUNCT
chd-99	25	32	1997	1997	NUM
chd-99	25	33	)	)	PUNCT
chd-99	25	34	.	.	PUNCT
chd-99	26	1	thus	thus	ADV
chd-99	26	2	,	,	PUNCT
chd-99	26	3	important	important	ADJ
chd-99	26	4	homeostatic	homeostatic	ADJ
chd-99	26	5	controls	control	NOUN
chd-99	26	6	regulating	regulate	VERB
chd-99	26	7	cell	cell	NOUN
chd-99	26	8	proliferation	proliferation	NOUN
chd-99	26	9	and	and	CCONJ
chd-99	26	10	apoptosis	apoptosis	NOUN
chd-99	26	11	would	would	AUX
chd-99	26	12	be	be	AUX
chd-99	26	13	lost	lose	VERB
chd-99	26	14	with	with	ADP
chd-99	26	15	the	the	DET
chd-99	26	16	inactivation	inactivation	NOUN
chd-99	26	17	of	of	ADP
chd-99	26	18	igf2r	igf2r	PROPN
chd-99	26	19	,	,	PUNCT
chd-99	26	20	suggesting	suggest	VERB
chd-99	26	21	that	that	SCONJ
chd-99	26	22	this	this	DET
chd-99	26	23	receptor	receptor	NOUN
chd-99	26	24	normally	normally	ADV
chd-99	26	25	functions	function	VERB
chd-99	26	26	to	to	PART
chd-99	26	27	inhibit	inhibit	VERB
chd-99	26	28	tumor	tumor	NOUN
chd-99	26	29	formation	formation	NOUN
chd-99	26	30	.	.	PUNCT
chd-99	27	1	indeed	indeed	ADV
chd-99	27	2	,	,	PUNCT
chd-99	27	3	loss	loss	NOUN
chd-99	27	4	of	of	ADP
chd-99	27	5	heterozygosity	heterozygosity	NOUN
chd-99	27	6	(	(	PUNCT
chd-99	27	7	loh	loh	PROPN
chd-99	27	8	)	)	PUNCT
chd-99	27	9	at	at	ADP
chd-99	27	10	the	the	DET
chd-99	27	11	igf2r	igf2r	PROPN
chd-99	27	12	locus	locus	NOUN
chd-99	27	13	has	have	AUX
chd-99	27	14	been	be	AUX
chd-99	27	15	reported	report	VERB
chd-99	27	16	in	in	ADP
chd-99	27	17	breast	breast	NOUN
chd-99	27	18	carcinomas	carcinoma	NOUN
chd-99	27	19	,	,	PUNCT
chd-99	27	20	and	and	CCONJ
chd-99	27	21	somatic	somatic	ADJ
chd-99	27	22	missense	missense	NOUN
chd-99	27	23	mutations	mutation	NOUN
chd-99	27	24	of	of	ADP
chd-99	27	25	the	the	DET
chd-99	27	26	remaining	remain	VERB
chd-99	27	27	allele	allele	NOUN
chd-99	27	28	have	have	AUX
chd-99	27	29	altered	alter	VERB
chd-99	27	30	ligand	ligand	ADJ
chd-99	27	31	binding	bind	VERB
chd-99	27	32	(	(	PUNCT
chd-99	27	33	hu	hu	PROPN
chd-99	27	34	et	et	PROPN
chd-99	27	35	al	al	PROPN
chd-99	27	36	.	.	PROPN
chd-99	27	37	,	,	PUNCT
chd-99	27	38	2006	2006	NUM
chd-99	27	39	;	;	PUNCT
chd-99	27	40	iwamoto	iwamoto	PROPN
chd-99	27	41	et	et	PROPN
chd-99	27	42	al	al	PROPN
chd-99	27	43	.	.	PROPN
chd-99	27	44	,	,	PUNCT
chd-99	27	45	2006	2006	NUM
chd-99	27	46	;	;	PUNCT
chd-99	27	47	tsujiuchi	tsujiuchi	PROPN
chd-99	27	48	et	et	PROPN
chd-99	27	49	al	al	PROPN
chd-99	27	50	.	.	PROPN
chd-99	27	51	,	,	PUNCT
chd-99	27	52	2004	2004	NUM
chd-99	27	53	)	)	PUNCT
chd-99	27	54	.	.	PUNCT
chd-99	28	1	the	the	DET
chd-99	28	2	igf2r	igf2r	PROPN
chd-99	28	3	has	have	AUX
chd-99	28	4	been	be	AUX
chd-99	28	5	proposed	propose	VERB
chd-99	28	6	to	to	PART
chd-99	28	7	be	be	AUX
chd-99	28	8	a	a	DET
chd-99	28	9	tumor	tumor	NOUN
chd-99	28	10	suppressor	suppressor	NOUN
chd-99	28	11	gene	gene	NOUN
chd-99	28	12	given	give	VERB
chd-99	28	13	its	its	PRON
chd-99	28	14	antagonist	antagonist	NOUN
chd-99	28	15	role	role	NOUN
chd-99	28	16	on	on	ADP
chd-99	28	17	cellular	cellular	ADJ
chd-99	28	18	growth	growth	NOUN
chd-99	28	19	and	and	CCONJ
chd-99	28	20	evidence	evidence	NOUN
chd-99	28	21	of	of	ADP
chd-99	28	22	loh	loh	PROPN
chd-99	28	23	and	and	CCONJ
chd-99	28	24	loss	loss	NOUN
chd-99	28	25	-	-	PUNCT
chd-99	28	26	of	of	ADP
chd-99	28	27	-	-	PUNCT
chd-99	28	28	function	function	NOUN
chd-99	28	29	mutations	mutation	NOUN
chd-99	28	30	in	in	ADP
chd-99	28	31	several	several	ADJ
chd-99	28	32	cancers	cancer	NOUN
chd-99	28	33	including	include	VERB
chd-99	28	34	breast	breast	NOUN
chd-99	28	35	cancer	cancer	NOUN
chd-99	28	36	(	(	PUNCT
chd-99	28	37	chappell	chappell	NOUN
chd-99	28	38	et	et	PROPN
chd-99	28	39	al	al	PROPN
chd-99	28	40	.	.	PROPN
chd-99	28	41	,	,	PUNCT
chd-99	28	42	1997	1997	NUM
chd-99	28	43	;	;	PUNCT
chd-99	29	1	chen	chen	PROPN
chd-99	29	2	et	et	PROPN
chd-99	29	3	al	al	PROPN
chd-99	29	4	.	.	PROPN
chd-99	29	5	,	,	PUNCT
chd-99	29	6	2002	2002	NUM
chd-99	29	7	;	;	PUNCT
chd-99	29	8	hankins	hankins	PROPN
chd-99	29	9	et	et	PROPN
chd-99	29	10	al	al	PROPN
chd-99	29	11	.	.	PROPN
chd-99	29	12	,	,	PUNCT
chd-99	29	13	1996	1996	NUM
chd-99	29	14	;	;	PUNCT
chd-99	29	15	oates	oates	PROPN
chd-99	29	16	et	et	PROPN
chd-99	29	17	al	al	PROPN
chd-99	29	18	.	.	PROPN
chd-99	29	19	,	,	PUNCT
chd-99	29	20	1998	1998	NUM
chd-99	29	21	)	)	PUNCT
chd-99	29	22	.	.	PUNCT
chd-99	30	1	more	more	ADV
chd-99	30	2	recently	recently	ADV
chd-99	30	3	,	,	PUNCT
chd-99	30	4	studies	study	NOUN
chd-99	30	5	have	have	AUX
chd-99	30	6	shown	show	VERB
chd-99	30	7	that	that	SCONJ
chd-99	30	8	reduced	reduce	VERB
chd-99	30	9	igf2r	igf2r	PART
chd-99	30	10	expression	expression	NOUN
chd-99	30	11	correlates	correlate	VERB
chd-99	30	12	with	with	ADP
chd-99	30	13	poor	poor	ADJ
chd-99	30	14	patient	patient	ADJ
chd-99	30	15	prognosis	prognosis	NOUN
chd-99	30	16	in	in	ADP
chd-99	30	17	bc	bc	PROPN
chd-99	30	18	patients	patient	NOUN
chd-99	30	19	(	(	PUNCT
chd-99	30	20	yu	yu	PROPN
chd-99	30	21	et	et	PROPN
chd-99	30	22	al	al	PROPN
chd-99	30	23	.	.	PROPN
chd-99	30	24	,	,	PUNCT
chd-99	30	25	1996	1996	NUM
chd-99	30	26	)	)	PUNCT
chd-99	30	27	and	and	CCONJ
chd-99	30	28	that	that	PRON
chd-99	30	29	decreased	decrease	VERB
chd-99	30	30	igf2r	igf2r	PROPN
chd-99	30	31	expression	expression	NOUN
chd-99	30	32	may	may	AUX
chd-99	30	33	contribute	contribute	VERB
chd-99	30	34	to	to	ADP
chd-99	30	35	bc	bc	PROPN
chd-99	30	36	disparity	disparity	NOUN
chd-99	30	37	(	(	PUNCT
chd-99	30	38	kalla	kalla	PROPN
chd-99	30	39	singh	singh	PROPN
chd-99	30	40	et	et	PROPN
chd-99	30	41	al	al	PROPN
chd-99	30	42	.	.	PROPN
chd-99	30	43	,	,	PUNCT
chd-99	30	44	2010	2010	NUM
chd-99	30	45	)	)	PUNCT
chd-99	30	46	.	.	PUNCT
chd-99	31	1	this	this	DET
chd-99	31	2	study	study	NOUN
chd-99	31	3	shows	show	VERB
chd-99	31	4	that	that	SCONJ
chd-99	31	5	circulating	circulate	VERB
chd-99	31	6	igf2	igf2	PROPN
chd-99	31	7	levels	level	NOUN
chd-99	31	8	,	,	PUNCT
chd-99	31	9	a	a	DET
chd-99	31	10	potent	potent	ADJ
chd-99	31	11	mitogen	mitogen	NOUN
chd-99	31	12	that	that	PRON
chd-99	31	13	signals	signal	VERB
chd-99	31	14	through	through	ADP
chd-99	31	15	the	the	DET
chd-99	31	16	igf1r	igf1r	PROPN
chd-99	31	17	,	,	PUNCT
chd-99	31	18	are	be	AUX
chd-99	31	19	higher	high	ADJ
chd-99	31	20	in	in	ADP
chd-99	31	21	breast	breast	NOUN
chd-99	31	22	tissue	tissue	NOUN
chd-99	31	23	from	from	ADP
chd-99	31	24	aa	aa	ADJ
chd-99	31	25	women	woman	NOUN
chd-99	31	26	when	when	SCONJ
chd-99	31	27	compared	compare	VERB
chd-99	31	28	to	to	ADP
chd-99	31	29	ca	ca	NOUN
chd-99	31	30	women	woman	NOUN
chd-99	31	31	.	.	PUNCT
chd-99	32	1	they	they	PRON
chd-99	32	2	further	far	ADV
chd-99	32	3	went	go	VERB
chd-99	32	4	on	on	ADP
chd-99	32	5	to	to	PART
chd-99	32	6	show	show	VERB
chd-99	32	7	that	that	SCONJ
chd-99	32	8	igf2r	igf2r	PROPN
chd-99	32	9	levels	level	NOUN
chd-99	32	10	were	be	AUX
chd-99	32	11	significantly	significantly	ADV
chd-99	32	12	lower	low	ADJ
chd-99	32	13	in	in	ADP
chd-99	32	14	aa	aa	PROPN
chd-99	32	15	breast	breast	NOUN
chd-99	32	16	tumor	tumor	NOUN
chd-99	32	17	samples	sample	NOUN
chd-99	32	18	,	,	PUNCT
chd-99	32	19	important	important	ADJ
chd-99	32	20	as	as	ADP
chd-99	32	21	igf2r	igf2r	PROPN
chd-99	32	22	acts	act	NOUN
chd-99	32	23	as	as	ADP
chd-99	32	24	a	a	DET
chd-99	32	25	non	non	ADJ
chd-99	32	26	-	-	ADJ
chd-99	32	27	signaling	signaling	ADJ
chd-99	32	28	sink	sink	NOUN
chd-99	32	29	for	for	ADP
chd-99	32	30	igf2	igf2	PROPN
chd-99	32	31	thereby	thereby	ADV
chd-99	32	32	preventing	prevent	VERB
chd-99	32	33	its	its	PRON
chd-99	32	34	pro	pro	ADJ
chd-99	32	35	-	-	ADJ
chd-99	32	36	survival	survival	ADJ
chd-99	32	37	signaling	signal	VERB
chd-99	32	38	function	function	NOUN
chd-99	32	39	.	.	PUNCT
chd-99	33	1	importantly	importantly	ADV
chd-99	33	2	,	,	PUNCT
chd-99	33	3	igf2	igf2	PROPN
chd-99	33	4	can	can	AUX
chd-99	33	5	also	also	ADV
chd-99	33	6	signal	signal	VERB
chd-99	33	7	through	through	ADP
chd-99	33	8	the	the	DET
chd-99	33	9	a	a	DET
chd-99	33	10	isoform	isoform	NOUN
chd-99	33	11	of	of	ADP
chd-99	33	12	the	the	DET
chd-99	33	13	insulin	insulin	NOUN
chd-99	33	14	receptor	receptor	NOUN
chd-99	33	15	(	(	PUNCT
chd-99	33	16	ir	ir	NOUN
chd-99	33	17	-	-	NOUN
chd-99	33	18	a	a	NOUN
chd-99	33	19	)	)	PUNCT
chd-99	33	20	in	in	ADP
chd-99	33	21	many	many	ADJ
chd-99	33	22	tumor	tumor	NOUN
chd-99	33	23	types	type	NOUN
chd-99	33	24	including	include	VERB
chd-99	33	25	breast	breast	NOUN
chd-99	33	26	cancer	cancer	NOUN
chd-99	33	27	resulting	result	VERB
chd-99	33	28	in	in	ADP
chd-99	33	29	tumor	tumor	NOUN
chd-99	33	30	promoting	promote	VERB
chd-99	33	31	effects	effect	NOUN
chd-99	33	32	(	(	PUNCT
chd-99	33	33	frasca	frasca	X
chd-99	33	34	et	et	PROPN
chd-99	33	35	al	al	PROPN
chd-99	33	36	.	.	PROPN
chd-99	33	37	,	,	PUNCT
chd-99	33	38	1999	1999	NUM
chd-99	33	39	;	;	PUNCT
chd-99	33	40	ulanet	ulanet	PROPN
chd-99	33	41	et	et	PROPN
chd-99	33	42	al	al	PROPN
chd-99	33	43	.	.	PROPN
chd-99	33	44	,	,	PUNCT
chd-99	33	45	2010	2010	NUM
chd-99	33	46	)	)	PUNCT
chd-99	33	47	.	.	PUNCT
chd-99	34	1	micrornas	microrna	NOUN
chd-99	34	2	(	(	PUNCT
chd-99	34	3	mirnas	mirna	NOUN
chd-99	34	4	)	)	PUNCT
chd-99	34	5	are	be	AUX
chd-99	34	6	small	small	ADJ
chd-99	34	7	non	non	ADJ
chd-99	34	8	-	-	ADJ
chd-99	34	9	coding	coding	ADJ
chd-99	34	10	rnas	rna	NOUN
chd-99	34	11	that	that	PRON
chd-99	34	12	are	be	AUX
chd-99	34	13	generally	generally	ADV
chd-99	34	14	involved	involve	VERB
chd-99	34	15	in	in	ADP
chd-99	34	16	the	the	DET
chd-99	34	17	negative	negative	ADJ
chd-99	34	18	regulation	regulation	NOUN
chd-99	34	19	of	of	ADP
chd-99	34	20	mrna	mrna	PROPN
chd-99	34	21	through	through	ADP
chd-99	34	22	seed	seed	NOUN
chd-99	34	23	sequences	sequence	NOUN
chd-99	34	24	present	present	ADJ
chd-99	34	25	within	within	ADP
chd-99	34	26	the	the	DET
chd-99	34	27	3’utr	3’utr	NOUN
chd-99	34	28	of	of	ADP
chd-99	34	29	protein	protein	NOUN
chd-99	34	30	coding	code	VERB
chd-99	34	31	genes	gene	NOUN
chd-99	34	32	.	.	PUNCT
chd-99	35	1	they	they	PRON
chd-99	35	2	have	have	AUX
chd-99	35	3	been	be	AUX
chd-99	35	4	studied	study	VERB
chd-99	35	5	in	in	ADP
chd-99	35	6	mammalian	mammalian	ADJ
chd-99	35	7	species	specie	NOUN
chd-99	35	8	for	for	ADP
chd-99	35	9	almost	almost	ADV
chd-99	35	10	two	two	NUM
chd-99	35	11	decades	decade	NOUN
chd-99	35	12	and	and	CCONJ
chd-99	35	13	have	have	AUX
chd-99	35	14	been	be	AUX
chd-99	35	15	shown	show	VERB
chd-99	35	16	to	to	PART
chd-99	35	17	be	be	AUX
chd-99	35	18	involved	involve	VERB
chd-99	35	19	in	in	ADP
chd-99	35	20	most	most	ADJ
chd-99	35	21	all	all	PRON
chd-99	35	22	cellular	cellular	ADJ
chd-99	35	23	processes	process	NOUN
chd-99	35	24	.	.	PUNCT
chd-99	36	1	each	each	DET
chd-99	36	2	mirna	mirna	PROPN
chd-99	36	3	has	have	VERB
chd-99	36	4	multiple	multiple	ADJ
chd-99	36	5	targets	target	NOUN
chd-99	36	6	and	and	CCONJ
chd-99	36	7	each	each	DET
chd-99	36	8	3’utr	3’utr	NOUN
chd-99	36	9	can	can	AUX
chd-99	36	10	be	be	AUX
chd-99	36	11	targeted	target	VERB
chd-99	36	12	by	by	ADP
chd-99	36	13	multiple	multiple	ADJ
chd-99	36	14	mirnas	mirna	NOUN
chd-99	36	15	.	.	PUNCT
chd-99	37	1	understanding	understand	VERB
chd-99	37	2	the	the	DET
chd-99	37	3	regulation	regulation	NOUN
chd-99	37	4	of	of	ADP
chd-99	37	5	these	these	DET
chd-99	37	6	small	small	ADJ
chd-99	37	7	molecules	molecule	NOUN
chd-99	37	8	is	be	AUX
chd-99	37	9	complex	complex	ADJ
chd-99	37	10	;	;	PUNCT
chd-99	37	11	however	however	ADV
chd-99	37	12	,	,	PUNCT
chd-99	37	13	great	great	ADJ
chd-99	37	14	strides	stride	NOUN
chd-99	37	15	have	have	AUX
chd-99	37	16	been	be	AUX
chd-99	37	17	made	make	VERB
chd-99	37	18	in	in	ADP
chd-99	37	19	a	a	DET
chd-99	37	20	relatively	relatively	ADV
chd-99	37	21	short	short	ADJ
chd-99	37	22	amount	amount	NOUN
chd-99	37	23	of	of	ADP
chd-99	37	24	time	time	NOUN
chd-99	37	25	.	.	PUNCT
chd-99	38	1	it	it	PRON
chd-99	38	2	should	should	AUX
chd-99	38	3	be	be	AUX
chd-99	38	4	noted	note	VERB
chd-99	38	5	that	that	SCONJ
chd-99	38	6	controversy	controversy	NOUN
chd-99	38	7	surrounds	surround	VERB
chd-99	38	8	the	the	DET
chd-99	38	9	role	role	NOUN
chd-99	38	10	of	of	ADP
chd-99	38	11	mir-204	mir-204	NOUN
chd-99	38	12	in	in	ADP
chd-99	38	13	breast	breast	NOUN
chd-99	38	14	cancer	cancer	NOUN
chd-99	38	15	,	,	PUNCT
chd-99	38	16	with	with	ADP
chd-99	38	17	some	some	DET
chd-99	38	18	authors	author	NOUN
chd-99	38	19	reporting	report	VERB
chd-99	38	20	mir-204	mir-204	NOUN
chd-99	38	21	as	as	ADP
chd-99	38	22	a	a	DET
chd-99	38	23	tumor	tumor	NOUN
chd-99	38	24	suppressor	suppressor	NOUN
chd-99	38	25	(	(	PUNCT
chd-99	38	26	imam	imam	PROPN
chd-99	38	27	et	et	PROPN
chd-99	38	28	al	al	PROPN
chd-99	38	29	.	.	PROPN
chd-99	38	30	,	,	PUNCT
chd-99	38	31	2012	2012	NUM
chd-99	38	32	;	;	PUNCT
chd-99	38	33	li	li	PROPN
chd-99	38	34	et	et	PROPN
chd-99	38	35	al	al	PROPN
chd-99	38	36	.	.	PROPN
chd-99	38	37	,	,	PUNCT
chd-99	38	38	2014	2014	NUM
chd-99	38	39	)	)	PUNCT
chd-99	38	40	and	and	CCONJ
chd-99	38	41	others	other	NOUN
chd-99	38	42	,	,	PUNCT
chd-99	38	43	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	VERB
chd-99	38	44	e3	e3	NOUN
chd-99	38	45	cancer	cancer	NOUN
chd-99	38	46	health	health	NOUN
chd-99	38	47	disparities	disparity	NOUN
chd-99	38	48	research	research	NOUN
chd-99	38	49	including	include	VERB
chd-99	38	50	our	our	PRON
chd-99	38	51	group	group	NOUN
chd-99	38	52	,	,	PUNCT
chd-99	38	53	reporting	report	VERB
chd-99	38	54	it	it	PRON
chd-99	38	55	as	as	ADP
chd-99	38	56	an	an	DET
chd-99	38	57	oncogenic	oncogenic	ADJ
chd-99	38	58	mirna	mirna	NOUN
chd-99	38	59	or	or	CCONJ
chd-99	38	60	“	"	PUNCT
chd-99	38	61	oncomir	oncomir	PROPN
chd-99	38	62	”	"	PUNCT
chd-99	38	63	(	(	PUNCT
chd-99	38	64	findlay	findlay	PROPN
chd-99	38	65	et	et	PROPN
chd-99	38	66	al	al	PROPN
chd-99	38	67	.	.	PROPN
chd-99	38	68	,	,	PUNCT
chd-99	38	69	2008	2008	NUM
chd-99	38	70	)	)	PUNCT
chd-99	38	71	.	.	PUNCT
chd-99	39	1	micrornas	microrna	NOUN
chd-99	39	2	,	,	PUNCT
chd-99	39	3	by	by	ADP
chd-99	39	4	their	their	PRON
chd-99	39	5	nature	nature	NOUN
chd-99	39	6	,	,	PUNCT
chd-99	39	7	have	have	AUX
chd-99	39	8	been	be	AUX
chd-99	39	9	shown	show	VERB
chd-99	39	10	to	to	PART
chd-99	39	11	play	play	VERB
chd-99	39	12	many	many	ADJ
chd-99	39	13	different	different	ADJ
chd-99	39	14	roles	role	NOUN
chd-99	39	15	in	in	ADP
chd-99	39	16	different	different	ADJ
chd-99	39	17	cellular	cellular	ADJ
chd-99	39	18	contexts	context	NOUN
chd-99	39	19	including	include	VERB
chd-99	39	20	both	both	DET
chd-99	39	21	tumor	tumor	NOUN
chd-99	39	22	suppressive	suppressive	NOUN
chd-99	39	23	and	and	CCONJ
chd-99	39	24	oncogenic	oncogenic	ADJ
chd-99	39	25	roles	role	NOUN
chd-99	39	26	.	.	PUNCT
chd-99	40	1	classic	classic	ADJ
chd-99	40	2	examples	example	NOUN
chd-99	40	3	of	of	ADP
chd-99	40	4	other	other	ADJ
chd-99	40	5	mirnas	mirna	NOUN
chd-99	40	6	that	that	PRON
chd-99	40	7	have	have	AUX
chd-99	40	8	been	be	AUX
chd-99	40	9	shown	show	VERB
chd-99	40	10	to	to	PART
chd-99	40	11	have	have	VERB
chd-99	40	12	context	context	NOUN
chd-99	40	13	dependent	dependent	ADJ
chd-99	40	14	tumor	tumor	NOUN
chd-99	40	15	suppressive	suppressive	NOUN
chd-99	40	16	and	and	CCONJ
chd-99	40	17	oncogenic	oncogenic	ADJ
chd-99	40	18	effects	effect	NOUN
chd-99	40	19	in	in	ADP
chd-99	40	20	breast	breast	NOUN
chd-99	40	21	cancer	cancer	NOUN
chd-99	40	22	include	include	VERB
chd-99	40	23	mir-205	mir-205	NOUN
chd-99	40	24	and	and	CCONJ
chd-99	40	25	mir-27	mir-27	PROPN
chd-99	40	26	(	(	PUNCT
chd-99	40	27	vimalraj	vimalraj	VERB
chd-99	40	28	et	et	PROPN
chd-99	40	29	al	al	PROPN
chd-99	40	30	.	.	PROPN
chd-99	40	31	,	,	PUNCT
chd-99	40	32	2013	2013	NUM
chd-99	40	33	)	)	PUNCT
chd-99	40	34	.	.	PUNCT
chd-99	41	1	a	a	DET
chd-99	41	2	recent	recent	ADJ
chd-99	41	3	review	review	NOUN
chd-99	41	4	details	detail	VERB
chd-99	41	5	the	the	DET
chd-99	41	6	dual	dual	ADJ
chd-99	41	7	nature	nature	NOUN
chd-99	41	8	of	of	ADP
chd-99	41	9	mir-204	mir-204	NOUN
chd-99	41	10	in	in	ADP
chd-99	41	11	cancer	cancer	NOUN
chd-99	41	12	(	(	PUNCT
chd-99	41	13	li	li	PROPN
chd-99	41	14	et	et	PROPN
chd-99	41	15	al	al	PROPN
chd-99	41	16	.	.	PROPN
chd-99	41	17	,	,	PUNCT
chd-99	41	18	2016	2016	NUM
chd-99	41	19	)	)	PUNCT
chd-99	41	20	.	.	PUNCT
chd-99	42	1	this	this	DET
chd-99	42	2	study	study	NOUN
chd-99	42	3	describes	describe	VERB
chd-99	42	4	a	a	DET
chd-99	42	5	mechanistic	mechanistic	ADJ
chd-99	42	6	link	link	NOUN
chd-99	42	7	between	between	ADP
chd-99	42	8	mir-204	mir-204	NOUN
chd-99	42	9	and	and	CCONJ
chd-99	42	10	a	a	DET
chd-99	42	11	novel	novel	ADJ
chd-99	42	12	direct	direct	ADJ
chd-99	42	13	target	target	NOUN
chd-99	42	14	igf2r	igf2r	PROPN
chd-99	42	15	.	.	PUNCT
chd-99	43	1	we	we	PRON
chd-99	43	2	developed	develop	VERB
chd-99	43	3	a	a	DET
chd-99	43	4	unique	unique	ADJ
chd-99	43	5	inducible	inducible	ADJ
chd-99	43	6	mir-204	mir-204	NOUN
chd-99	43	7	transgenic	transgenic	NOUN
chd-99	43	8	mouse	mouse	NOUN
chd-99	43	9	model	model	NOUN
chd-99	43	10	to	to	PART
chd-99	43	11	examine	examine	VERB
chd-99	43	12	for	for	ADP
chd-99	43	13	the	the	DET
chd-99	43	14	first	first	ADJ
chd-99	43	15	time	time	NOUN
chd-99	43	16	,	,	PUNCT
chd-99	43	17	in	in	ADP
chd-99	43	18	an	an	DET
chd-99	43	19	intact	intact	ADJ
chd-99	43	20	system	system	NOUN
chd-99	43	21	,	,	PUNCT
chd-99	43	22	the	the	DET
chd-99	43	23	oncogenic	oncogenic	ADJ
chd-99	43	24	potential	potential	NOUN
chd-99	43	25	of	of	ADP
chd-99	43	26	mir-204	mir-204	NOUN
chd-99	43	27	and	and	CCONJ
chd-99	43	28	we	we	PRON
chd-99	43	29	show	show	VERB
chd-99	43	30	data	datum	NOUN
chd-99	43	31	to	to	PART
chd-99	43	32	support	support	VERB
chd-99	43	33	a	a	DET
chd-99	43	34	role	role	NOUN
chd-99	43	35	for	for	ADP
chd-99	43	36	mir-204	mir-204	NOUN
chd-99	43	37	mediated	mediate	VERB
chd-99	43	38	activation	activation	NOUN
chd-99	43	39	of	of	ADP
chd-99	43	40	the	the	DET
chd-99	43	41	igf1r	igf1r	PRON
chd-99	43	42	signaling	signal	VERB
chd-99	43	43	pathway	pathway	NOUN
chd-99	43	44	and	and	CCONJ
chd-99	43	45	propose	propose	VERB
chd-99	43	46	that	that	SCONJ
chd-99	43	47	this	this	PRON
chd-99	43	48	could	could	AUX
chd-99	43	49	be	be	AUX
chd-99	43	50	a	a	DET
chd-99	43	51	potential	potential	ADJ
chd-99	43	52	biological	biological	ADJ
chd-99	43	53	mechanism	mechanism	NOUN
chd-99	43	54	driving	drive	VERB
chd-99	43	55	aggressive	aggressive	ADJ
chd-99	43	56	tumor	tumor	NOUN
chd-99	43	57	growth	growth	NOUN
chd-99	43	58	.	.	PUNCT
chd-99	44	1	materials	material	NOUN
chd-99	44	2	and	and	CCONJ
chd-99	44	3	methods	method	NOUN
chd-99	44	4	cell	cell	NOUN
chd-99	44	5	culture	culture	NOUN
chd-99	44	6	and	and	CCONJ
chd-99	44	7	reagents	reagent	NOUN
chd-99	44	8	all	all	DET
chd-99	44	9	cell	cell	NOUN
chd-99	44	10	lines	line	NOUN
chd-99	44	11	were	be	AUX
chd-99	44	12	cultured	cultured	ADJ
chd-99	44	13	and	and	CCONJ
chd-99	44	14	maintained	maintain	VERB
chd-99	44	15	at	at	ADP
chd-99	44	16	37	37	NUM
chd-99	44	17	°	°	ADP
chd-99	44	18	c	c	NOUN
chd-99	44	19	with	with	ADP
chd-99	44	20	5	5	NUM
chd-99	44	21	%	%	NOUN
chd-99	44	22	co2	co2	NOUN
chd-99	44	23	.	.	PUNCT
chd-99	45	1	mda	mda	PROPN
chd-99	45	2	-	-	PUNCT
chd-99	45	3	mb-231	mb-231	PROPN
chd-99	45	4	and	and	CCONJ
chd-99	45	5	hek293	hek293	PROPN
chd-99	45	6	cells	cell	NOUN
chd-99	45	7	were	be	AUX
chd-99	45	8	grown	grow	VERB
chd-99	45	9	in	in	ADP
chd-99	45	10	dmem	dmem	ADJ
chd-99	45	11	media	medium	NOUN
chd-99	45	12	supplemented	supplement	VERB
chd-99	45	13	with	with	ADP
chd-99	45	14	10	10	NUM
chd-99	45	15	%	%	NOUN
chd-99	45	16	fetal	fetal	ADJ
chd-99	45	17	bovine	bovine	NOUN
chd-99	45	18	serum	serum	NOUN
chd-99	45	19	(	(	PUNCT
chd-99	45	20	fbs	fbs	PROPN
chd-99	45	21	)	)	PUNCT
chd-99	45	22	and	and	CCONJ
chd-99	45	23	100	100	NUM
chd-99	45	24	u	u	NOUN
chd-99	45	25	of	of	ADP
chd-99	45	26	penicillin	penicillin	PROPN
chd-99	45	27	/	/	SYM
chd-99	45	28	streptomycin	streptomycin	PROPN
chd-99	45	29	(	(	PUNCT
chd-99	45	30	p	p	X
chd-99	45	31	/	/	SYM
chd-99	45	32	s	s	NOUN
chd-99	45	33	)	)	PUNCT
chd-99	45	34	.	.	PUNCT
chd-99	46	1	bt549	bt549	PROPN
chd-99	46	2	cells	cell	NOUN
chd-99	46	3	were	be	AUX
chd-99	46	4	grown	grow	VERB
chd-99	46	5	in	in	ADP
chd-99	46	6	rpmi	rpmi	NOUN
chd-99	46	7	media	medium	NOUN
chd-99	46	8	supplemented	supplement	VERB
chd-99	46	9	with	with	ADP
chd-99	46	10	10	10	NUM
chd-99	46	11	%	%	NOUN
chd-99	46	12	fbs	fbs	ADJ
chd-99	46	13	and	and	CCONJ
chd-99	46	14	100	100	NUM
chd-99	46	15	u	u	NOUN
chd-99	46	16	of	of	ADP
chd-99	46	17	p	p	X
chd-99	46	18	/	/	SYM
chd-99	46	19	s.	s.	PROPN
chd-99	46	20	mcf10a	mcf10a	PROPN
chd-99	46	21	and	and	CCONJ
chd-99	46	22	mcf12a	mcf12a	ADP
chd-99	46	23	cells	cell	NOUN
chd-99	46	24	were	be	AUX
chd-99	46	25	grown	grow	VERB
chd-99	46	26	in	in	ADP
chd-99	46	27	dmem	dmem	ADJ
chd-99	46	28	:	:	PUNCT
chd-99	46	29	f12	f12	NOUN
chd-99	46	30	(	(	PUNCT
chd-99	46	31	50:50	50:50	NUM
chd-99	46	32	)	)	PUNCT
chd-99	46	33	media	medium	NOUN
chd-99	46	34	supplemented	supplement	VERB
chd-99	46	35	with	with	ADP
chd-99	46	36	2	2	NUM
chd-99	46	37	mm	mm	NOUN
chd-99	46	38	l	l	NOUN
chd-99	46	39	-	-	NOUN
chd-99	46	40	glutamine	glutamine	NOUN
chd-99	46	41	,	,	PUNCT
chd-99	46	42	5	5	NUM
chd-99	46	43	%	%	NOUN
chd-99	46	44	horse	horse	NOUN
chd-99	46	45	serum	serum	NOUN
chd-99	46	46	,	,	PUNCT
chd-99	46	47	10µg	10µg	NOUN
chd-99	46	48	/	/	SYM
chd-99	46	49	ml	ml	NOUN
chd-99	46	50	insulin	insulin	NOUN
chd-99	46	51	,	,	PUNCT
chd-99	46	52	20ng	20ng	NOUN
chd-99	46	53	/	/	SYM
chd-99	46	54	ml	ml	ADP
chd-99	46	55	epidermal	epidermal	ADJ
chd-99	46	56	growth	growth	NOUN
chd-99	46	57	factor	factor	NOUN
chd-99	46	58	(	(	PUNCT
chd-99	46	59	egf	egf	PROPN
chd-99	46	60	)	)	PUNCT
chd-99	46	61	,	,	PUNCT
chd-99	46	62	500ng	500ng	PROPN
chd-99	46	63	/	/	SYM
chd-99	46	64	ml	ml	X
chd-99	46	65	hydrocortisone	hydrocortisone	NOUN
chd-99	46	66	,	,	PUNCT
chd-99	46	67	and	and	CCONJ
chd-99	46	68	10µg	10µg	ADJ
chd-99	46	69	/	/	SYM
chd-99	46	70	ml	ml	ADP
chd-99	46	71	cholera	cholera	NOUN
chd-99	46	72	toxin	toxin	NOUN
chd-99	46	73	.	.	PUNCT
chd-99	47	1	the	the	DET
chd-99	47	2	mcf10a	mcf10a	NOUN
chd-99	47	3	with	with	ADP
chd-99	47	4	(	(	PUNCT
chd-99	47	5	control	control	NOUN
chd-99	47	6	)	)	PUNCT
chd-99	47	7	and	and	CCONJ
chd-99	47	8	without	without	ADP
chd-99	47	9	igf1r	igf1r	PROPN
chd-99	47	10	stably	stably	ADV
chd-99	47	11	overexpressed	overexpresse	VERB
chd-99	47	12	were	be	AUX
chd-99	47	13	a	a	DET
chd-99	47	14	kind	kind	ADJ
chd-99	47	15	gift	gift	NOUN
chd-99	47	16	of	of	ADP
chd-99	47	17	adrian	adrian	PROPN
chd-99	47	18	lee	lee	PROPN
chd-99	47	19	(	(	PUNCT
chd-99	47	20	university	university	PROPN
chd-99	47	21	of	of	ADP
chd-99	47	22	pittsburgh	pittsburgh	PROPN
chd-99	47	23	,	,	PUNCT
chd-99	47	24	pa	pa	PROPN
chd-99	47	25	)	)	PUNCT
chd-99	47	26	.	.	PUNCT
chd-99	48	1	all	all	DET
chd-99	48	2	other	other	ADJ
chd-99	48	3	lines	line	NOUN
chd-99	48	4	were	be	AUX
chd-99	48	5	obtained	obtain	VERB
chd-99	48	6	from	from	ADP
chd-99	48	7	atcc	atcc	ADJ
chd-99	48	8	.	.	PUNCT
chd-99	49	1	ethical	ethical	ADJ
chd-99	49	2	approval	approval	NOUN
chd-99	49	3	for	for	ADP
chd-99	49	4	our	our	PRON
chd-99	49	5	work	work	NOUN
chd-99	49	6	with	with	ADP
chd-99	49	7	human	human	ADJ
chd-99	49	8	breast	breast	NOUN
chd-99	49	9	cancer	cancer	NOUN
chd-99	49	10	cell	cell	NOUN
chd-99	49	11	lines	line	NOUN
chd-99	49	12	was	be	AUX
chd-99	49	13	not	not	PART
chd-99	49	14	required	require	VERB
chd-99	49	15	for	for	ADP
chd-99	49	16	our	our	PRON
chd-99	49	17	in	in	X
chd-99	49	18	vitro	vitro	X
chd-99	49	19	studies	study	NOUN
chd-99	49	20	.	.	PUNCT
chd-99	50	1	all	all	DET
chd-99	50	2	tissue	tissue	NOUN
chd-99	50	3	culture	culture	NOUN
chd-99	50	4	reagents	reagent	NOUN
chd-99	50	5	were	be	AUX
chd-99	50	6	purchased	purchase	VERB
chd-99	50	7	from	from	ADP
chd-99	50	8	invitrogen	invitrogen	PROPN
chd-99	50	9	(	(	PUNCT
chd-99	50	10	carlsbad	carlsbad	PROPN
chd-99	50	11	,	,	PUNCT
chd-99	50	12	ca	ca	NOUN
chd-99	50	13	)	)	PUNCT
chd-99	50	14	.	.	PUNCT
chd-99	51	1	shigf1r	shigf1r	PROPN
chd-99	51	2	vectors	vector	NOUN
chd-99	51	3	were	be	AUX
chd-99	51	4	obtained	obtain	VERB
chd-99	51	5	from	from	ADP
chd-99	51	6	the	the	DET
chd-99	51	7	hollings	holling	NOUN
chd-99	51	8	cancer	cancer	NOUN
chd-99	51	9	center	center	NOUN
chd-99	51	10	genomics	genomics	PROPN
chd-99	51	11	/	/	SYM
chd-99	51	12	shrna	shrna	NOUN
chd-99	51	13	shared	share	VERB
chd-99	51	14	technology	technology	NOUN
chd-99	51	15	resource	resource	NOUN
chd-99	51	16	.	.	PUNCT
chd-99	52	1	the	the	DET
chd-99	52	2	igf2r	igf2r	PROPN
chd-99	52	3	construct	construct	NOUN
chd-99	52	4	was	be	AUX
chd-99	52	5	a	a	DET
chd-99	52	6	kind	kind	ADJ
chd-99	52	7	gift	gift	NOUN
chd-99	52	8	of	of	ADP
chd-99	52	9	lukas	lukas	NOUN
chd-99	52	10	mach	mach	NOUN
chd-99	52	11	(	(	PUNCT
chd-99	52	12	university	university	NOUN
chd-99	52	13	of	of	ADP
chd-99	52	14	natural	natural	ADJ
chd-99	52	15	resources	resource	NOUN
chd-99	52	16	and	and	CCONJ
chd-99	52	17	life	life	NOUN
chd-99	52	18	sciences	sciences	PROPN
chd-99	52	19	,	,	PUNCT
chd-99	52	20	vienna	vienna	NOUN
chd-99	52	21	(	(	PUNCT
chd-99	52	22	boku	boku	NOUN
chd-99	52	23	)	)	PUNCT
chd-99	52	24	)	)	PUNCT
chd-99	52	25	.	.	PUNCT
chd-99	53	1	transgenic	transgenic	NOUN
chd-99	53	2	mice	mouse	NOUN
chd-99	53	3	animal	animal	NOUN
chd-99	53	4	care	care	NOUN
chd-99	53	5	and	and	CCONJ
chd-99	53	6	procedures	procedure	NOUN
chd-99	53	7	were	be	AUX
chd-99	53	8	approved	approve	VERB
chd-99	53	9	by	by	ADP
chd-99	53	10	the	the	DET
chd-99	53	11	institutional	institutional	ADJ
chd-99	53	12	animal	animal	NOUN
chd-99	53	13	care	care	NOUN
chd-99	53	14	and	and	CCONJ
chd-99	53	15	use	use	VERB
chd-99	53	16	committee	committee	NOUN
chd-99	53	17	at	at	ADP
chd-99	53	18	the	the	DET
chd-99	53	19	medical	medical	ADJ
chd-99	53	20	university	university	PROPN
chd-99	53	21	of	of	ADP
chd-99	53	22	south	south	PROPN
chd-99	53	23	carolina	carolina	PROPN
chd-99	53	24	,	,	PUNCT
chd-99	53	25	approval	approval	NOUN
chd-99	53	26	#	#	NOUN
chd-99	53	27	arc-2995	arc-2995	NOUN
chd-99	53	28	.	.	PUNCT
chd-99	54	1	to	to	PART
chd-99	54	2	generate	generate	VERB
chd-99	54	3	the	the	DET
chd-99	54	4	tet	tet	NOUN
chd-99	54	5	-	-	ADJ
chd-99	54	6	regulatable	regulatable	ADJ
chd-99	54	7	mir-204	mir-204	NOUN
chd-99	54	8	transgenic	transgenic	NOUN
chd-99	54	9	mice	mouse	NOUN
chd-99	54	10	,	,	PUNCT
chd-99	54	11	the	the	DET
chd-99	54	12	0.5	0.5	NUM
chd-99	54	13	-	-	PUNCT
chd-99	54	14	kb	kb	NOUN
chd-99	54	15	region	region	NOUN
chd-99	54	16	surrounding	surround	VERB
chd-99	54	17	mir-204	mir-204	NOUN
chd-99	54	18	was	be	AUX
chd-99	54	19	amplified	amplify	VERB
chd-99	54	20	by	by	ADP
chd-99	54	21	pcr	pcr	PROPN
chd-99	54	22	from	from	ADP
chd-99	54	23	the	the	DET
chd-99	54	24	human	human	ADJ
chd-99	54	25	genome	genome	NOUN
chd-99	54	26	using	use	VERB
chd-99	54	27	the	the	DET
chd-99	54	28	following	follow	VERB
chd-99	54	29	primers	primer	NOUN
chd-99	54	30	:	:	PUNCT
chd-99	54	31	teto	teto	VERB
chd-99	54	32	204f	204f	PROPN
chd-99	54	33	5’-gcgcatcgatttggacccaga	5’-gcgcatcgatttggacccaga	PROPN
chd-99	54	34	actattag-3	actattag-3	NUM
chd-99	54	35	’	'	PUNCT
chd-99	54	36	and	and	CCONJ
chd-99	54	37	teto	teto	VERB
chd-99	54	38	204r	204r	NUM
chd-99	54	39	5’-gcgca	5’-gcgca	NUM
chd-99	54	40	ctagtggacagggtgatggagagg-3	ctagtggacagggtgatggagagg-3	NUM
chd-99	54	41	’	'	PUNCT
chd-99	54	42	and	and	CCONJ
chd-99	54	43	cloned	clone	VERB
chd-99	54	44	into	into	ADP
chd-99	54	45	the	the	DET
chd-99	54	46	pteto	pteto	NOUN
chd-99	54	47	splice	splice	NOUN
chd-99	54	48	vector	vector	NOUN
chd-99	54	49	(	(	PUNCT
chd-99	54	50	a	a	DET
chd-99	54	51	kind	kind	ADJ
chd-99	54	52	gift	gift	NOUN
chd-99	54	53	of	of	ADP
chd-99	54	54	dr	dr	PROPN
chd-99	54	55	.	.	PROPN
chd-99	54	56	tracy	tracy	PROPN
chd-99	54	57	vargo	vargo	PROPN
chd-99	54	58	-	-	PUNCT
chd-99	54	59	gogola	gogola	PROPN
chd-99	54	60	,	,	PUNCT
chd-99	54	61	indiana	indiana	PROPN
chd-99	54	62	university	university	PROPN
chd-99	54	63	school	school	NOUN
chd-99	54	64	of	of	ADP
chd-99	54	65	medicine	medicine	NOUN
chd-99	54	66	)	)	PUNCT
chd-99	54	67	.	.	PUNCT
chd-99	55	1	the	the	DET
chd-99	55	2	clones	clone	NOUN
chd-99	55	3	were	be	AUX
chd-99	55	4	screened	screen	VERB
chd-99	55	5	for	for	ADP
chd-99	55	6	mir204	mir204	PROPN
chd-99	55	7	induction	induction	NOUN
chd-99	55	8	and	and	CCONJ
chd-99	55	9	minimal	minimal	ADJ
chd-99	55	10	leaky	leaky	ADJ
chd-99	55	11	expression	expression	NOUN
chd-99	55	12	by	by	ADP
chd-99	55	13	transfection	transfection	NOUN
chd-99	55	14	into	into	ADP
chd-99	55	15	the	the	DET
chd-99	55	16	mcf7	mcf7	PROPN
chd-99	55	17	teto	teto	NOUN
chd-99	55	18	cell	cell	NOUN
chd-99	55	19	line	line	NOUN
chd-99	55	20	(	(	PUNCT
chd-99	55	21	a	a	DET
chd-99	55	22	kind	kind	ADJ
chd-99	55	23	gift	gift	NOUN
chd-99	55	24	of	of	ADP
chd-99	55	25	dr	dr	PROPN
chd-99	55	26	.	.	PROPN
chd-99	55	27	tracy	tracy	PROPN
chd-99	55	28	vargo	vargo	PROPN
chd-99	55	29	-	-	PUNCT
chd-99	55	30	gogola	gogola	PROPN
chd-99	55	31	,	,	PUNCT
chd-99	55	32	indiana	indiana	PROPN
chd-99	55	33	university	university	PROPN
chd-99	55	34	school	school	NOUN
chd-99	55	35	of	of	ADP
chd-99	55	36	medicine	medicine	NOUN
chd-99	55	37	)	)	PUNCT
chd-99	55	38	.	.	PUNCT
chd-99	56	1	the	the	DET
chd-99	56	2	resultant	resultant	NOUN
chd-99	56	3	vector	vector	NOUN
chd-99	56	4	was	be	AUX
chd-99	56	5	confirmed	confirm	VERB
chd-99	56	6	by	by	ADP
chd-99	56	7	sequencing	sequence	VERB
chd-99	56	8	and	and	CCONJ
chd-99	56	9	was	be	AUX
chd-99	56	10	subsequently	subsequently	ADV
chd-99	56	11	microinjected	microinjecte	VERB
chd-99	56	12	into	into	ADP
chd-99	56	13	the	the	DET
chd-99	56	14	pronuclei	pronucleus	NOUN
chd-99	56	15	of	of	ADP
chd-99	56	16	fertilized	fertilized	ADJ
chd-99	56	17	fvb	fvb	PROPN
chd-99	56	18	/	/	SYM
chd-99	57	1	n	n	CCONJ
chd-99	57	2	oocytes	oocyte	NOUN
chd-99	57	3	by	by	ADP
chd-99	57	4	the	the	DET
chd-99	57	5	medical	medical	ADJ
chd-99	57	6	university	university	PROPN
chd-99	57	7	of	of	ADP
chd-99	57	8	south	south	PROPN
chd-99	57	9	carolina	carolina	PROPN
chd-99	57	10	transgenic	transgenic	PROPN
chd-99	57	11	mouse	mouse	NOUN
chd-99	57	12	core	core	NOUN
chd-99	57	13	,	,	PUNCT
chd-99	57	14	yielding	yield	VERB
chd-99	57	15	6	6	NUM
chd-99	57	16	potential	potential	ADJ
chd-99	57	17	founder	founder	NOUN
chd-99	57	18	lines	line	NOUN
chd-99	57	19	.	.	PUNCT
chd-99	58	1	mice	mouse	NOUN
chd-99	58	2	were	be	AUX
chd-99	58	3	maintained	maintain	VERB
chd-99	58	4	on	on	ADP
chd-99	58	5	an	an	DET
chd-99	58	6	inbred	inbred	ADJ
chd-99	58	7	fvb	fvb	NOUN
chd-99	58	8	/	/	SYM
chd-99	58	9	n	n	PRON
chd-99	58	10	background	background	NOUN
chd-99	58	11	.	.	PUNCT
chd-99	59	1	bigenic	bigenic	ADJ
chd-99	59	2	mice	mouse	NOUN
chd-99	59	3	were	be	AUX
chd-99	59	4	obtained	obtain	VERB
chd-99	59	5	by	by	ADP
chd-99	59	6	breeding	breed	VERB
chd-99	59	7	teto-204	teto-204	ADJ
chd-99	59	8	mice	mouse	NOUN
chd-99	59	9	to	to	ADP
chd-99	59	10	mtb	mtb	PROPN
chd-99	59	11	(	(	PUNCT
chd-99	59	12	mmtv	mmtv	NOUN
chd-99	59	13	-	-	PUNCT
chd-99	59	14	rtta	rtta	NOUN
chd-99	59	15	)	)	PUNCT
chd-99	59	16	mice	mouse	NOUN
chd-99	59	17	(	(	PUNCT
chd-99	59	18	a	a	DET
chd-99	59	19	kind	kind	ADJ
chd-99	59	20	gift	gift	NOUN
chd-99	59	21	of	of	ADP
chd-99	59	22	dr	dr	PROPN
chd-99	59	23	.	.	PROPN
chd-99	59	24	lewis	lewis	PROPN
chd-99	59	25	chodosh	chodosh	PROPN
chd-99	59	26	,	,	PUNCT
chd-99	59	27	perelman	perelman	PROPN
chd-99	59	28	school	school	NOUN
chd-99	59	29	of	of	ADP
chd-99	59	30	medicine	medicine	NOUN
chd-99	59	31	,	,	PUNCT
chd-99	59	32	university	university	NOUN
chd-99	59	33	of	of	ADP
chd-99	59	34	pennsylvania	pennsylvania	PROPN
chd-99	59	35	)	)	PUNCT
chd-99	59	36	,	,	PUNCT
chd-99	59	37	which	which	PRON
chd-99	59	38	contain	contain	VERB
chd-99	59	39	the	the	DET
chd-99	59	40	reverse	reverse	ADJ
chd-99	59	41	tet	tet	NOUN
chd-99	59	42	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	PART
chd-99	59	43	e4	e4	PROPN
chd-99	59	44	cancer	cancer	NOUN
chd-99	59	45	health	health	NOUN
chd-99	59	46	disparities	disparity	NOUN
chd-99	59	47	research	research	NOUN
chd-99	59	48	transactivator	transactivator	NOUN
chd-99	59	49	under	under	ADP
chd-99	59	50	the	the	DET
chd-99	59	51	control	control	NOUN
chd-99	59	52	of	of	ADP
chd-99	59	53	the	the	DET
chd-99	59	54	mmtv	mmtv	NOUN
chd-99	59	55	promoter	promoter	NOUN
chd-99	59	56	(	(	PUNCT
chd-99	59	57	gunther	gunther	PROPN
chd-99	59	58	et	et	PROPN
chd-99	59	59	al	al	PROPN
chd-99	59	60	.	.	PROPN
chd-99	59	61	,	,	PUNCT
chd-99	59	62	2002	2002	NUM
chd-99	59	63	)	)	PUNCT
chd-99	59	64	.	.	PUNCT
chd-99	60	1	the	the	DET
chd-99	60	2	teto204	teto204	PROPN
chd-99	60	3	/	/	SYM
chd-99	60	4	mtb	mtb	NOUN
chd-99	60	5	bigenic	bigenic	ADJ
chd-99	60	6	mice	mouse	NOUN
chd-99	60	7	were	be	AUX
chd-99	60	8	bred	breed	VERB
chd-99	60	9	to	to	ADP
chd-99	60	10	mmtv	mmtv	NOUN
chd-99	60	11	-	-	PUNCT
chd-99	60	12	neu	neu	NOUN
chd-99	60	13	transgenic	transgenic	NOUN
chd-99	60	14	mice	mouse	NOUN
chd-99	60	15	(	(	PUNCT
chd-99	60	16	002376	002376	NUM
chd-99	60	17	;	;	PUNCT
chd-99	60	18	jackson	jackson	PROPN
chd-99	60	19	laboratories	laboratory	NOUN
chd-99	60	20	,	,	PUNCT
chd-99	60	21	bar	bar	NOUN
chd-99	60	22	harbor	harbor	NOUN
chd-99	60	23	,	,	PUNCT
chd-99	60	24	maine	maine	PROPN
chd-99	60	25	)	)	PUNCT
chd-99	60	26	to	to	PART
chd-99	60	27	obtain	obtain	VERB
chd-99	60	28	trigenic	trigenic	ADJ
chd-99	60	29	teto204	teto204	NOUN
chd-99	60	30	/	/	SYM
chd-99	60	31	mtb	mtb	NOUN
chd-99	60	32	/	/	SYM
chd-99	60	33	mmtv	mmtv	NOUN
chd-99	60	34	-	-	PUNCT
chd-99	60	35	neu	neu	NOUN
chd-99	60	36	and	and	CCONJ
chd-99	60	37	control	control	NOUN
chd-99	60	38	mice	mouse	NOUN
chd-99	60	39	.	.	PUNCT
chd-99	61	1	all	all	DET
chd-99	61	2	mice	mouse	NOUN
chd-99	61	3	were	be	AUX
chd-99	61	4	maintained	maintain	VERB
chd-99	61	5	on	on	ADP
chd-99	61	6	an	an	DET
chd-99	61	7	fvb	fvb	NOUN
chd-99	61	8	/	/	SYM
chd-99	61	9	n	n	PRON
chd-99	61	10	background	background	NOUN
chd-99	61	11	.	.	PUNCT
chd-99	62	1	for	for	ADP
chd-99	62	2	genotyping	genotyping	NOUN
chd-99	62	3	,	,	PUNCT
chd-99	62	4	pcr	pcr	ADJ
chd-99	62	5	amplification	amplification	NOUN
chd-99	62	6	of	of	ADP
chd-99	62	7	the	the	DET
chd-99	62	8	mtb	mtb	NOUN
chd-99	62	9	and	and	CCONJ
chd-99	62	10	204	204	NUM
chd-99	62	11	transgenes	transgene	NOUN
chd-99	62	12	was	be	AUX
chd-99	62	13	performed	perform	VERB
chd-99	62	14	on	on	ADP
chd-99	62	15	genomic	genomic	ADJ
chd-99	62	16	dna	dna	PROPN
chd-99	62	17	prepared	prepare	VERB
chd-99	62	18	from	from	ADP
chd-99	62	19	tail	tail	NOUN
chd-99	62	20	cuts	cut	NOUN
chd-99	62	21	using	use	VERB
chd-99	62	22	the	the	DET
chd-99	62	23	following	follow	VERB
chd-99	62	24	oligonucleotide	oligonucleotide	NOUN
chd-99	62	25	pairs	pair	NOUN
chd-99	62	26	:	:	PUNCT
chd-99	62	27	for	for	ADP
chd-99	62	28	teto-204	teto-204	NOUN
chd-99	62	29	,	,	PUNCT
chd-99	62	30	5’cacgaaattgcttctggtggc-3	5’cacgaaattgcttctggtggc-3	NUM
chd-99	62	31	’	'	PUNCT
chd-99	62	32	and	and	CCONJ
chd-99	62	33	5’tcgaagatgttggggtgttgg-3	5’tcgaagatgttggggtgttgg-3	NUM
chd-99	62	34	’	'	PUNCT
chd-99	62	35	;	;	PUNCT
chd-99	62	36	reaction	reaction	NOUN
chd-99	62	37	conditions	condition	NOUN
chd-99	62	38	were	be	AUX
chd-99	62	39	98	98	NUM
chd-99	62	40	°	°	ADP
chd-99	62	41	c	c	NOUN
chd-99	62	42	for	for	ADP
chd-99	62	43	3	3	NUM
chd-99	62	44	minutes	minute	NOUN
chd-99	62	45	followed	follow	VERB
chd-99	62	46	by	by	ADP
chd-99	62	47	40	40	NUM
chd-99	62	48	cycles	cycle	NOUN
chd-99	62	49	of	of	ADP
chd-99	62	50	98	98	NUM
chd-99	62	51	°	°	ADP
chd-99	62	52	c	c	NOUN
chd-99	62	53	for	for	ADP
chd-99	62	54	30	30	NUM
chd-99	62	55	seconds	second	NOUN
chd-99	62	56	,	,	PUNCT
chd-99	62	57	62	62	NUM
chd-99	62	58	°	°	SYM
chd-99	62	59	c	c	NOUN
chd-99	62	60	for	for	ADP
chd-99	62	61	30	30	NUM
chd-99	62	62	sec	sec	PROPN
chd-99	62	63	.	.	PROPN
chd-99	62	64	,	,	PUNCT
chd-99	62	65	72	72	NUM
chd-99	62	66	°	°	NUM
chd-99	62	67	c	c	NOUN
chd-99	62	68	for	for	ADP
chd-99	62	69	1	1	NUM
chd-99	62	70	min	min	NOUN
chd-99	62	71	.	.	PROPN
chd-99	62	72	,	,	PUNCT
chd-99	62	73	followed	follow	VERB
chd-99	62	74	by	by	ADP
chd-99	62	75	a	a	DET
chd-99	62	76	10	10	NUM
chd-99	62	77	min	min	NOUN
chd-99	62	78	.	.	NOUN
chd-99	62	79	extension	extension	NOUN
chd-99	62	80	at	at	ADP
chd-99	62	81	72	72	NUM
chd-99	62	82	°	°	NOUN
chd-99	62	83	c	c	NOUN
chd-99	62	84	;	;	PUNCT
chd-99	62	85	for	for	ADP
chd-99	62	86	mtb	mtb	NOUN
chd-99	62	87	5’tccaagggcatcggtaaaca-3	5’tccaagggcatcggtaaaca-3	NOUN
chd-99	62	88	’	'	PUNCT
chd-99	62	89	and	and	CCONJ
chd-99	62	90	5’gcatcaagtcgctaaagaag-3	5’gcatcaagtcgctaaagaag-3	NUM
chd-99	62	91	’	'	PUNCT
chd-99	62	92	;	;	PUNCT
chd-99	62	93	reaction	reaction	NOUN
chd-99	62	94	conditions	condition	NOUN
chd-99	62	95	were	be	AUX
chd-99	62	96	98	98	NUM
chd-99	62	97	°	°	ADP
chd-99	62	98	c	c	NOUN
chd-99	62	99	for	for	ADP
chd-99	62	100	3	3	NUM
chd-99	62	101	min	min	NOUN
chd-99	62	102	.	.	PROPN
chd-99	62	103	followed	follow	VERB
chd-99	62	104	by	by	ADP
chd-99	62	105	30	30	NUM
chd-99	62	106	cycles	cycle	NOUN
chd-99	62	107	of	of	ADP
chd-99	62	108	98	98	NUM
chd-99	62	109	°	°	ADP
chd-99	62	110	c	c	NOUN
chd-99	62	111	for	for	ADP
chd-99	62	112	30	30	NUM
chd-99	62	113	sec	sec	PROPN
chd-99	62	114	.	.	PROPN
chd-99	62	115	,	,	PUNCT
chd-99	63	1	58	58	NUM
chd-99	63	2	°	°	NUM
chd-99	63	3	c	c	NOUN
chd-99	63	4	for	for	ADP
chd-99	63	5	30	30	NUM
chd-99	63	6	sec	sec	PROPN
chd-99	63	7	,	,	PUNCT
chd-99	63	8	72	72	NUM
chd-99	63	9	°	°	NUM
chd-99	63	10	c	c	NOUN
chd-99	63	11	for	for	ADP
chd-99	63	12	30	30	NUM
chd-99	63	13	sec	sec	PROPN
chd-99	63	14	.	.	PROPN
chd-99	63	15	,	,	PUNCT
chd-99	63	16	followed	follow	VERB
chd-99	63	17	by	by	ADP
chd-99	63	18	a	a	DET
chd-99	63	19	10	10	NUM
chd-99	63	20	min	min	NOUN
chd-99	63	21	.	.	NOUN
chd-99	63	22	extension	extension	NOUN
chd-99	63	23	at	at	ADP
chd-99	63	24	72	72	NUM
chd-99	63	25	°	°	NOUN
chd-99	63	26	c	c	NOUN
chd-99	63	27	.	.	PUNCT
chd-99	64	1	neu	neu	NOUN
chd-99	64	2	mice	mouse	NOUN
chd-99	64	3	were	be	AUX
chd-99	64	4	genotyped	genotype	VERB
chd-99	64	5	following	follow	VERB
chd-99	64	6	protocols	protocol	NOUN
chd-99	64	7	supplied	supply	VERB
chd-99	64	8	by	by	ADP
chd-99	64	9	jackson	jackson	PROPN
chd-99	64	10	laboratories	laboratory	NOUN
chd-99	64	11	.	.	PUNCT
chd-99	65	1	to	to	PART
chd-99	65	2	induce	induce	VERB
chd-99	65	3	transgene	transgene	ADJ
chd-99	65	4	expression	expression	NOUN
chd-99	65	5	,	,	PUNCT
chd-99	65	6	mice	mouse	NOUN
chd-99	65	7	were	be	AUX
chd-99	65	8	fed	feed	VERB
chd-99	65	9	doxycycline	doxycycline	NOUN
chd-99	65	10	-	-	PUNCT
chd-99	65	11	containing	contain	VERB
chd-99	65	12	chow	chow	NOUN
chd-99	65	13	(	(	PUNCT
chd-99	65	14	2g	2g	NOUN
chd-99	65	15	/	/	SYM
chd-99	65	16	kg	kg	PROPN
chd-99	65	17	ad	ad	NOUN
chd-99	65	18	libitum	libitum	PROPN
chd-99	65	19	)	)	PUNCT
chd-99	65	20	for	for	ADP
chd-99	65	21	the	the	DET
chd-99	65	22	duration	duration	NOUN
chd-99	65	23	of	of	ADP
chd-99	65	24	the	the	DET
chd-99	65	25	study	study	NOUN
chd-99	65	26	.	.	PUNCT
chd-99	66	1	immunohistochemistry	immunohistochemistry	PROPN
chd-99	66	2	ihc	ihc	PROPN
chd-99	66	3	was	be	AUX
chd-99	66	4	performed	perform	VERB
chd-99	66	5	as	as	SCONJ
chd-99	66	6	described	describe	VERB
chd-99	66	7	(	(	PUNCT
chd-99	66	8	guo	guo	PROPN
chd-99	66	9	et	et	PROPN
chd-99	66	10	al	al	PROPN
chd-99	66	11	.	.	PROPN
chd-99	66	12	,	,	PUNCT
chd-99	66	13	2013	2013	NUM
chd-99	66	14	)	)	PUNCT
chd-99	66	15	.	.	PUNCT
chd-99	67	1	the	the	DET
chd-99	67	2	ki67	ki67	PROPN
chd-99	67	3	antibody	antibody	NOUN
chd-99	67	4	was	be	AUX
chd-99	67	5	used	use	VERB
chd-99	67	6	at	at	ADP
chd-99	67	7	a	a	DET
chd-99	67	8	1:200	1:200	NUM
chd-99	67	9	dilution	dilution	NOUN
chd-99	67	10	.	.	PUNCT
chd-99	68	1	quantitative	quantitative	ADJ
chd-99	68	2	real	real	ADJ
chd-99	68	3	time	time	NOUN
chd-99	68	4	pcr	pcr	PROPN
chd-99	68	5	total	total	NOUN
chd-99	68	6	rna	rna	NOUN
chd-99	68	7	from	from	ADP
chd-99	68	8	cell	cell	NOUN
chd-99	68	9	lines	line	NOUN
chd-99	68	10	was	be	AUX
chd-99	68	11	extracted	extract	VERB
chd-99	68	12	using	use	VERB
chd-99	68	13	the	the	DET
chd-99	68	14	rneasyplus	rneasyplus	ADJ
chd-99	68	15	mini	mini	ADJ
chd-99	68	16	kit	kit	NOUN
chd-99	68	17	(	(	PUNCT
chd-99	68	18	qiagen	qiagen	PROPN
chd-99	68	19	;	;	PUNCT
chd-99	68	20	valencia	valencia	PROPN
chd-99	68	21	,	,	PUNCT
chd-99	68	22	ca	ca	NOUN
chd-99	68	23	)	)	PUNCT
chd-99	68	24	.	.	PUNCT
chd-99	69	1	qpcr	qpcr	ADV
chd-99	69	2	was	be	AUX
chd-99	69	3	performed	perform	VERB
chd-99	69	4	on	on	ADP
chd-99	69	5	a	a	DET
chd-99	69	6	roche	roche	NOUN
chd-99	69	7	light	light	PROPN
chd-99	69	8	cycler	cycler	PROPN
chd-99	69	9	480	480	NUM
chd-99	69	10	as	as	SCONJ
chd-99	69	11	previously	previously	ADV
chd-99	69	12	described	describe	VERB
chd-99	69	13	(	(	PUNCT
chd-99	69	14	guo	guo	PROPN
chd-99	69	15	et	et	PROPN
chd-99	69	16	al	al	PROPN
chd-99	69	17	.	.	PROPN
chd-99	69	18	,	,	PUNCT
chd-99	69	19	2013	2013	NUM
chd-99	69	20	)	)	PUNCT
chd-99	69	21	.	.	PUNCT
chd-99	70	1	primer	primer	NOUN
chd-99	70	2	sequences	sequence	NOUN
chd-99	70	3	and	and	CCONJ
chd-99	70	4	upl	upl	PROPN
chd-99	70	5	probe	probe	NOUN
chd-99	70	6	numbers	number	NOUN
chd-99	70	7	are	be	AUX
chd-99	70	8	listed	list	VERB
chd-99	70	9	in	in	ADP
chd-99	70	10	table	table	NOUN
chd-99	70	11	1	1	NUM
chd-99	70	12	.	.	PUNCT
chd-99	71	1	for	for	ADP
chd-99	71	2	microrna	microrna	PROPN
chd-99	71	3	analysis	analysis	PROPN
chd-99	71	4	rna	rna	NOUN
chd-99	71	5	was	be	AUX
chd-99	71	6	extracted	extract	VERB
chd-99	71	7	from	from	ADP
chd-99	71	8	cell	cell	NOUN
chd-99	71	9	lines	line	NOUN
chd-99	71	10	using	use	VERB
chd-99	71	11	the	the	DET
chd-99	71	12	rneasyplus	rneasyplus	ADJ
chd-99	71	13	mini	mini	ADJ
chd-99	71	14	kit	kit	NOUN
chd-99	71	15	from	from	ADP
chd-99	71	16	qiagen	qiagen	PROPN
chd-99	71	17	(	(	PUNCT
chd-99	71	18	valencia	valencia	PROPN
chd-99	71	19	,	,	PUNCT
chd-99	71	20	ca	ca	NOUN
chd-99	71	21	)	)	PUNCT
chd-99	71	22	.	.	PUNCT
chd-99	72	1	10ng	10ng	ADJ
chd-99	72	2	total	total	ADJ
chd-99	72	3	rna	rna	NOUN
chd-99	72	4	was	be	AUX
chd-99	72	5	reverse	reverse	ADJ
chd-99	72	6	transcribed	transcribe	VERB
chd-99	72	7	using	use	VERB
chd-99	72	8	mir-204	mir-204	NOUN
chd-99	72	9	specific	specific	ADJ
chd-99	72	10	primers	primer	NOUN
chd-99	72	11	using	use	VERB
chd-99	72	12	the	the	DET
chd-99	72	13	applied	apply	VERB
chd-99	72	14	biosystems	biosystem	NOUN
chd-99	72	15	reverse	reverse	VERB
chd-99	72	16	transcription	transcription	NOUN
chd-99	72	17	kit	kit	NOUN
chd-99	72	18	as	as	ADP
chd-99	72	19	per	per	ADP
chd-99	72	20	the	the	DET
chd-99	72	21	manufacturer	manufacturer	NOUN
chd-99	72	22	's	's	PART
chd-99	72	23	instructions	instruction	NOUN
chd-99	72	24	.	.	PUNCT
chd-99	73	1	real	real	ADJ
chd-99	73	2	time	time	NOUN
chd-99	73	3	pcr	pcr	PROPN
chd-99	73	4	was	be	AUX
chd-99	73	5	performed	perform	VERB
chd-99	73	6	with	with	ADP
chd-99	73	7	1µl	1µl	NOUN
chd-99	73	8	of	of	ADP
chd-99	73	9	reverse	reverse	ADJ
chd-99	73	10	transcribed	transcribe	VERB
chd-99	73	11	cdna	cdna	PROPN
chd-99	73	12	using	use	VERB
chd-99	73	13	the	the	DET
chd-99	73	14	taqman	taqman	NOUN
chd-99	73	15	assay	assay	VERB
chd-99	73	16	from	from	ADP
chd-99	73	17	applied	apply	VERB
chd-99	73	18	biosystems	biosystem	NOUN
chd-99	73	19	as	as	ADP
chd-99	73	20	per	per	ADP
chd-99	73	21	the	the	DET
chd-99	73	22	manufacturer	manufacturer	NOUN
chd-99	73	23	's	's	PART
chd-99	73	24	instructions	instruction	NOUN
chd-99	73	25	on	on	ADP
chd-99	73	26	the	the	DET
chd-99	73	27	roche	roche	PROPN
chd-99	73	28	lightcycler	lightcycler	PROPN
chd-99	73	29	480	480	NUM
chd-99	73	30	(	(	PUNCT
chd-99	73	31	nutley	nutley	PROPN
chd-99	73	32	,	,	PUNCT
chd-99	73	33	nj	nj	PROPN
chd-99	73	34	)	)	PUNCT
chd-99	73	35	.	.	PUNCT
chd-99	74	1	triplicate	triplicate	VERB
chd-99	74	2	reactions	reaction	NOUN
chd-99	74	3	were	be	AUX
chd-99	74	4	run	run	VERB
chd-99	74	5	for	for	ADP
chd-99	74	6	each	each	DET
chd-99	74	7	sample	sample	NOUN
chd-99	74	8	.	.	PUNCT
chd-99	75	1	the	the	DET
chd-99	75	2	relative	relative	ADJ
chd-99	75	3	expression	expression	NOUN
chd-99	75	4	of	of	ADP
chd-99	75	5	each	each	DET
chd-99	75	6	gene	gene	NOUN
chd-99	75	7	was	be	AUX
chd-99	75	8	quantified	quantify	VERB
chd-99	75	9	on	on	ADP
chd-99	75	10	the	the	DET
chd-99	75	11	basis	basis	NOUN
chd-99	75	12	of	of	ADP
chd-99	75	13	ct	ct	NUM
chd-99	75	14	value	value	NOUN
chd-99	75	15	measured	measure	VERB
chd-99	75	16	against	against	ADP
chd-99	75	17	an	an	DET
chd-99	75	18	internal	internal	ADJ
chd-99	75	19	standard	standard	ADJ
chd-99	75	20	curve	curve	NOUN
chd-99	75	21	for	for	ADP
chd-99	75	22	each	each	DET
chd-99	75	23	specific	specific	ADJ
chd-99	75	24	set	set	NOUN
chd-99	75	25	of	of	ADP
chd-99	75	26	primers	primer	NOUN
chd-99	75	27	using	use	VERB
chd-99	75	28	the	the	DET
chd-99	75	29	software	software	NOUN
chd-99	75	30	(	(	PUNCT
chd-99	75	31	2nd	2nd	ADJ
chd-99	75	32	derivative	derivative	ADJ
chd-99	75	33	max	max	PROPN
chd-99	75	34	)	)	PUNCT
chd-99	75	35	provided	provide	VERB
chd-99	75	36	by	by	ADP
chd-99	75	37	the	the	DET
chd-99	75	38	instrument	instrument	NOUN
chd-99	75	39	manufacturer	manufacturer	NOUN
chd-99	75	40	(	(	PUNCT
chd-99	75	41	roche	roche	PROPN
chd-99	75	42	,	,	PUNCT
chd-99	75	43	nutley	nutley	PROPN
chd-99	75	44	,	,	PUNCT
chd-99	75	45	nj	nj	PROPN
chd-99	75	46	)	)	PUNCT
chd-99	75	47	.	.	PUNCT
chd-99	76	1	table	table	NOUN
chd-99	76	2	1	1	NUM
chd-99	76	3	.	.	PUNCT
chd-99	77	1	primers	primer	NOUN
chd-99	77	2	(	(	PUNCT
chd-99	77	3	forward	forward	ADV
chd-99	77	4	(	(	PUNCT
chd-99	77	5	f	f	X
chd-99	77	6	)	)	PUNCT
chd-99	77	7	and	and	CCONJ
chd-99	77	8	reverse	reverse	VERB
chd-99	77	9	(	(	PUNCT
chd-99	77	10	r	r	NOUN
chd-99	77	11	)	)	PUNCT
chd-99	77	12	)	)	PUNCT
chd-99	77	13	and	and	CCONJ
chd-99	77	14	probes	probe	NOUN
chd-99	77	15	used	use	VERB
chd-99	77	16	in	in	ADP
chd-99	77	17	the	the	DET
chd-99	77	18	study	study	NOUN
chd-99	77	19	.	.	PUNCT
chd-99	78	1	primer	primer	NOUN
chd-99	78	2	name	name	NOUN
chd-99	78	3	primer	primer	NOUN
chd-99	78	4	sequence	sequence	NOUN
chd-99	78	5	(	(	PUNCT
chd-99	78	6	5	5	NUM
chd-99	78	7	’	'	PUNCT
chd-99	78	8	–	–	PUNCT
chd-99	78	9	3	3	NUM
chd-99	78	10	’	'	PUNCT
chd-99	78	11	)	)	PUNCT
chd-99	78	12	amplicon	amplicon	NOUN
chd-99	78	13	length	length	NOUN
chd-99	78	14	(	(	PUNCT
chd-99	78	15	nt	not	PART
chd-99	78	16	)	)	PUNCT
chd-99	78	17	probe	probe	NOUN
chd-99	78	18	#	#	NOUN
chd-99	78	19	igf2r	igf2r	PROPN
chd-99	78	20	(	(	PUNCT
chd-99	78	21	f	f	X
chd-99	78	22	)	)	PUNCT
chd-99	78	23	gagcgatacctctcaagtcaaag	gagcgatacctctcaagtcaaag	NOUN
chd-99	78	24	(	(	PUNCT
chd-99	78	25	r	r	NOUN
chd-99	78	26	)	)	PUNCT
chd-99	78	27	gtgaggtctccatccgaatatc	gtgaggtctccatccgaatatc	NOUN
chd-99	78	28	75	75	NUM
chd-99	78	29	4	4	NUM
chd-99	78	30	igf1r	igf1r	X
chd-99	78	31	(	(	PUNCT
chd-99	78	32	f	f	X
chd-99	78	33	)	)	PUNCT
chd-99	78	34	ttcagcgctgctgatgtg	ttcagcgctgctgatgtg	NOUN
chd-99	78	35	(	(	PUNCT
chd-99	78	36	r	r	NOUN
chd-99	78	37	)	)	PUNCT
chd-99	78	38	aagttcccggctcatggt	aagttcccggctcatggt	VERB
chd-99	78	39	75	75	NUM
chd-99	78	40	7	7	NUM
chd-99	78	41	puma	puma	NOUN
chd-99	78	42	(	(	PUNCT
chd-99	78	43	f	f	X
chd-99	78	44	)	)	PUNCT
chd-99	78	45	ctgcctcaccttcatcagg	ctgcctcaccttcatcagg	PROPN
chd-99	78	46	(	(	PUNCT
chd-99	78	47	r	r	NOUN
chd-99	78	48	)	)	PUNCT
chd-99	78	49	gcagagcacaggattcacag	gcagagcacaggattcacag	VERB
chd-99	78	50	61	61	NUM
chd-99	78	51	79	79	NUM
chd-99	78	52	noxa	noxa	NOUN
chd-99	78	53	(	(	PUNCT
chd-99	78	54	f	f	X
chd-99	78	55	)	)	PUNCT
chd-99	78	56	ggagatgcctgggaagaag	ggagatgcctgggaagaag	VERB
chd-99	78	57	(	(	PUNCT
chd-99	78	58	r	r	NOUN
chd-99	78	59	)	)	PUNCT
chd-99	78	60	cctgagttgagtagcacactcg	cctgagttgagtagcacactcg	NOUN
chd-99	78	61	94	94	NUM
chd-99	78	62	67	67	NUM
chd-99	78	63	gapdh	gapdh	NOUN
chd-99	78	64	(	(	PUNCT
chd-99	78	65	f	f	X
chd-99	78	66	)	)	PUNCT
chd-99	78	67	agccacatcgctcagacac	agccacatcgctcagacac	NOUN
chd-99	78	68	(	(	PUNCT
chd-99	78	69	r	r	NOUN
chd-99	78	70	)	)	PUNCT
chd-99	78	71	gcccaatacgaccaaatcc	gcccaatacgaccaaatcc	NOUN
chd-99	78	72	66	66	NUM
chd-99	78	73	60	60	NUM
chd-99	78	74	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	78	75	e5	e5	PROPN
chd-99	78	76	cancer	cancer	NOUN
chd-99	78	77	health	health	NOUN
chd-99	78	78	disparities	disparity	NOUN
chd-99	78	79	research	research	NOUN
chd-99	78	80	transfection	transfection	NOUN
chd-99	78	81	of	of	ADP
chd-99	78	82	cell	cell	NOUN
chd-99	78	83	lines	line	NOUN
chd-99	78	84	the	the	DET
chd-99	78	85	cloning	cloning	NOUN
chd-99	78	86	of	of	ADP
chd-99	78	87	mir-204	mir-204	NOUN
chd-99	78	88	into	into	ADP
chd-99	78	89	psuppressor	psuppressor	NOUN
chd-99	78	90	-	-	PUNCT
chd-99	78	91	neo	neo	NOUN
chd-99	78	92	vector	vector	NOUN
chd-99	78	93	is	be	AUX
chd-99	78	94	already	already	ADV
chd-99	78	95	described	describe	VERB
chd-99	78	96	(	(	PUNCT
chd-99	78	97	findlay	findlay	PROPN
chd-99	78	98	et	et	PROPN
chd-99	78	99	al	al	PROPN
chd-99	78	100	.	.	PROPN
chd-99	78	101	,	,	PUNCT
chd-99	78	102	2008	2008	NUM
chd-99	78	103	)	)	PUNCT
chd-99	78	104	.	.	PUNCT
chd-99	79	1	for	for	ADP
chd-99	79	2	the	the	DET
chd-99	79	3	generation	generation	NOUN
chd-99	79	4	of	of	ADP
chd-99	79	5	clonal	clonal	ADJ
chd-99	79	6	stable	stable	ADJ
chd-99	79	7	mcf12a	mcf12a	ADP
chd-99	79	8	cells	cell	NOUN
chd-99	79	9	overexpressing	overexpresse	VERB
chd-99	79	10	mir-204	mir-204	NOUN
chd-99	79	11	(	(	PUNCT
chd-99	79	12	204	204	NUM
chd-99	79	13	-	-	SYM
chd-99	79	14	1	1	NUM
chd-99	79	15	;	;	PUNCT
chd-99	79	16	204	204	NUM
chd-99	79	17	-	-	SYM
chd-99	79	18	2	2	NUM
chd-99	79	19	)	)	PUNCT
chd-99	79	20	,	,	PUNCT
chd-99	79	21	psuppressor	psuppressor	NOUN
chd-99	79	22	-	-	PUNCT
chd-99	79	23	neo	neo	NOUN
chd-99	79	24	vector	vector	NOUN
chd-99	79	25	(	(	PUNCT
chd-99	79	26	imgenex	imgenex	PROPN
chd-99	79	27	;	;	PUNCT
chd-99	79	28	san	san	PROPN
chd-99	79	29	diego	diego	PROPN
chd-99	79	30	,	,	PUNCT
chd-99	79	31	ca	ca	AUX
chd-99	79	32	)	)	PUNCT
chd-99	79	33	expressing	express	VERB
chd-99	79	34	mir-204	mir-204	NOUN
chd-99	79	35	was	be	AUX
chd-99	79	36	transfected	transfecte	VERB
chd-99	79	37	into	into	ADP
chd-99	79	38	mcf12a	mcf12a	ADP
chd-99	79	39	cells	cell	NOUN
chd-99	79	40	and	and	CCONJ
chd-99	79	41	stable	stable	ADJ
chd-99	79	42	cells	cell	NOUN
chd-99	79	43	were	be	AUX
chd-99	79	44	selected	select	VERB
chd-99	79	45	in	in	ADP
chd-99	79	46	medium	medium	NOUN
chd-99	79	47	containing	contain	VERB
chd-99	79	48	g418	g418	PROPN
chd-99	79	49	.	.	PUNCT
chd-99	80	1	mcf10a	mcf10a	PROPN
chd-99	80	2	cells	cell	NOUN
chd-99	80	3	were	be	AUX
chd-99	80	4	transiently	transiently	ADV
chd-99	80	5	transfected	transfecte	VERB
chd-99	80	6	with	with	ADP
chd-99	80	7	the	the	DET
chd-99	80	8	psuppressor	psuppressor	NOUN
chd-99	80	9	-	-	PUNCT
chd-99	80	10	neo	neo	NOUN
chd-99	80	11	vector	vector	NOUN
chd-99	80	12	.	.	PUNCT
chd-99	81	1	for	for	ADP
chd-99	81	2	inhibition	inhibition	NOUN
chd-99	81	3	studies	study	NOUN
chd-99	81	4	,	,	PUNCT
chd-99	81	5	cells	cell	NOUN
chd-99	81	6	were	be	AUX
chd-99	81	7	transiently	transiently	ADV
chd-99	81	8	transfected	transfecte	VERB
chd-99	81	9	with	with	ADP
chd-99	81	10	antisenseoligoribonucleotides	antisenseoligoribonucleotide	NOUN
chd-99	81	11	(	(	PUNCT
chd-99	81	12	aso	aso	NOUN
chd-99	81	13	)	)	PUNCT
chd-99	81	14	specific	specific	NOUN
chd-99	81	15	for	for	ADP
chd-99	81	16	mir-204	mir-204	NOUN
chd-99	81	17	(	(	PUNCT
chd-99	81	18	aso-204	aso-204	NOUN
chd-99	81	19	)	)	PUNCT
chd-99	81	20	or	or	CCONJ
chd-99	81	21	scrambled	scramble	VERB
chd-99	81	22	controls	control	NOUN
chd-99	81	23	(	(	PUNCT
chd-99	81	24	scr	scr	NOUN
chd-99	81	25	)	)	PUNCT
chd-99	81	26	.	.	PUNCT
chd-99	82	1	cells	cell	NOUN
chd-99	82	2	were	be	AUX
chd-99	82	3	transfected	transfecte	VERB
chd-99	82	4	with	with	ADP
chd-99	82	5	x	x	NOUN
chd-99	82	6	-	-	NOUN
chd-99	82	7	tremegenetm	tremegenetm	ADJ
chd-99	82	8	sirna	sirna	PROPN
chd-99	82	9	transfection	transfection	PROPN
chd-99	82	10	reagent	reagent	NOUN
chd-99	82	11	(	(	PUNCT
chd-99	82	12	roche	roche	PROPN
chd-99	82	13	,	,	PUNCT
chd-99	82	14	nutley	nutley	PROPN
chd-99	82	15	,	,	PUNCT
chd-99	82	16	nj	nj	PROPN
chd-99	82	17	)	)	PUNCT
chd-99	82	18	.	.	PUNCT
chd-99	83	1	luciferase	luciferase	VERB
chd-99	83	2	assays	assay	VERB
chd-99	83	3	the	the	DET
chd-99	83	4	igf2r	igf2r	PROPN
chd-99	83	5	3′utr	3′utr	ADJ
chd-99	83	6	luciferase	luciferase	ADJ
chd-99	83	7	reporter	reporter	NOUN
chd-99	83	8	vector	vector	NOUN
chd-99	83	9	(	(	PUNCT
chd-99	83	10	pmirtarget	pmirtarget	NOUN
chd-99	83	11	)	)	PUNCT
chd-99	83	12	was	be	AUX
chd-99	83	13	purchased	purchase	VERB
chd-99	83	14	from	from	ADP
chd-99	83	15	origene	origene	NOUN
chd-99	83	16	(	(	PUNCT
chd-99	83	17	rockville	rockville	PROPN
chd-99	83	18	,	,	PUNCT
chd-99	83	19	md	md	PROPN
chd-99	83	20	)	)	PUNCT
chd-99	83	21	.	.	PUNCT
chd-99	84	1	the	the	DET
chd-99	84	2	sequence	sequence	NOUN
chd-99	84	3	complementary	complementary	ADJ
chd-99	84	4	to	to	ADP
chd-99	84	5	the	the	DET
chd-99	84	6	seed	seed	NOUN
chd-99	84	7	of	of	ADP
chd-99	84	8	mir-204	mir-204	NOUN
chd-99	84	9	was	be	AUX
chd-99	84	10	deleted	delete	VERB
chd-99	84	11	with	with	ADP
chd-99	84	12	the	the	DET
chd-99	84	13	primers	primer	NOUN
chd-99	84	14	igf2rmutf	igf2rmutf	PROPN
chd-99	84	15	5’-gcttctataacagaaactttcaaga	5’-gcttctataacagaaactttcaaga	NUM
chd-99	84	16	gtttttgtgatgggggagaggg-3	gtttttgtgatgggggagaggg-3	NOUN
chd-99	84	17	’	'	PUNCT
chd-99	84	18	and	and	CCONJ
chd-99	84	19	igf2rmutr	igf2rmutr	PROPN
chd-99	84	20	5’-ccctctcccccatcacaaaaac	5’-ccctctcccccatcacaaaaac	NUM
chd-99	84	21	tcttgaaagtttctgttatagaagc-3	tcttgaaagtttctgttatagaagc-3	NUM
chd-99	84	22	’	'	PUNCT
chd-99	84	23	using	use	VERB
chd-99	84	24	a	a	DET
chd-99	84	25	quikchange	quikchange	NOUN
chd-99	84	26	site	site	NOUN
chd-99	84	27	-	-	PUNCT
chd-99	84	28	directed	direct	VERB
chd-99	84	29	mutagenesis	mutagenesis	NOUN
chd-99	84	30	kit	kit	NOUN
chd-99	84	31	(	(	PUNCT
chd-99	84	32	stratagene	stratagene	NOUN
chd-99	84	33	;	;	PUNCT
chd-99	84	34	la	la	PROPN
chd-99	84	35	jolla	jolla	PROPN
chd-99	84	36	,	,	PUNCT
chd-99	84	37	ca	ca	NOUN
chd-99	84	38	)	)	PUNCT
chd-99	84	39	.	.	PUNCT
chd-99	85	1	mutated	mutate	VERB
chd-99	85	2	sequences	sequence	NOUN
chd-99	85	3	were	be	AUX
chd-99	85	4	validated	validate	VERB
chd-99	85	5	by	by	ADP
chd-99	85	6	sequencing	sequence	VERB
chd-99	85	7	at	at	ADP
chd-99	85	8	mwg	mwg	PROPN
chd-99	85	9	operon	operon	PROPN
chd-99	85	10	(	(	PUNCT
chd-99	85	11	huntsville	huntsville	PROPN
chd-99	85	12	,	,	PUNCT
chd-99	85	13	al	al	PROPN
chd-99	85	14	)	)	PUNCT
chd-99	85	15	.	.	PUNCT
chd-99	86	1	mcf12a	mcf12a	ADP
chd-99	86	2	cells	cell	NOUN
chd-99	86	3	were	be	AUX
chd-99	86	4	plated	plate	VERB
chd-99	86	5	at	at	ADP
chd-99	86	6	50,000	50,000	NUM
chd-99	86	7	cells	cell	NOUN
chd-99	86	8	per	per	ADP
chd-99	86	9	well	well	ADV
chd-99	86	10	in	in	ADP
chd-99	86	11	a	a	DET
chd-99	86	12	24	24	NUM
chd-99	86	13	-	-	PUNCT
chd-99	86	14	well	well	NOUN
chd-99	86	15	plate	plate	NOUN
chd-99	86	16	.	.	PUNCT
chd-99	87	1	the	the	DET
chd-99	87	2	pmirtarget	pmirtarget	NOUN
chd-99	87	3	reporter	reporter	NOUN
chd-99	87	4	constructs	construct	VERB
chd-99	87	5	(	(	PUNCT
chd-99	87	6	0.5μg	0.5μg	PROPN
chd-99	87	7	,	,	PUNCT
chd-99	87	8	firefly	firefly	NOUN
chd-99	87	9	luciferase	luciferase	NOUN
chd-99	87	10	)	)	PUNCT
chd-99	87	11	were	be	AUX
chd-99	87	12	co	co	VERB
chd-99	87	13	-	-	VERB
chd-99	87	14	transfected	transfecte	VERB
chd-99	87	15	with	with	ADP
chd-99	87	16	prl	prl	PROPN
chd-99	87	17	–	–	PUNCT
chd-99	87	18	tk	tk	PROPN
chd-99	87	19	(	(	PUNCT
chd-99	87	20	0.05μg	0.05μg	NUM
chd-99	87	21	,	,	PUNCT
chd-99	87	22	renilla	renilla	NOUN
chd-99	87	23	luciferase	luciferase	NOUN
chd-99	87	24	)	)	PUNCT
chd-99	87	25	using	use	VERB
chd-99	87	26	xtremegene	xtremegene	ADJ
chd-99	87	27	hp	hp	ADJ
chd-99	87	28	reagent	reagent	NOUN
chd-99	87	29	as	as	ADP
chd-99	87	30	per	per	ADP
chd-99	87	31	the	the	DET
chd-99	87	32	manufacturer	manufacturer	NOUN
chd-99	87	33	’s	’s	PART
chd-99	87	34	instructions	instruction	NOUN
chd-99	87	35	(	(	PUNCT
chd-99	87	36	roche	roche	NOUN
chd-99	87	37	)	)	PUNCT
chd-99	87	38	.	.	PUNCT
chd-99	88	1	luciferase	luciferase	ADJ
chd-99	88	2	activity	activity	NOUN
chd-99	88	3	was	be	AUX
chd-99	88	4	measured	measure	VERB
chd-99	88	5	after	after	ADP
chd-99	88	6	48h	48h	NOUN
chd-99	88	7	using	use	VERB
chd-99	88	8	the	the	DET
chd-99	88	9	dual	dual	ADJ
chd-99	88	10	luciferase	luciferase	NOUN
chd-99	88	11	reporter	reporter	NOUN
chd-99	88	12	assay	assay	NOUN
chd-99	88	13	system	system	NOUN
chd-99	88	14	(	(	PUNCT
chd-99	88	15	promega	promega	PROPN
chd-99	88	16	,	,	PUNCT
chd-99	88	17	madison	madison	PROPN
chd-99	88	18	,	,	PUNCT
chd-99	88	19	wi	wi	PROPN
chd-99	88	20	)	)	PUNCT
chd-99	88	21	.	.	PUNCT
chd-99	89	1	firefly	firefly	NOUN
chd-99	89	2	luciferase	luciferase	PROPN
chd-99	89	3	activity	activity	NOUN
chd-99	89	4	was	be	AUX
chd-99	89	5	normalized	normalize	VERB
chd-99	89	6	to	to	ADP
chd-99	89	7	renilla	renilla	NOUN
chd-99	89	8	luciferase	luciferase	VERB
chd-99	89	9	activity	activity	NOUN
chd-99	89	10	for	for	ADP
chd-99	89	11	each	each	DET
chd-99	89	12	transfected	transfecte	VERB
chd-99	89	13	well	well	ADV
chd-99	89	14	.	.	PUNCT
chd-99	90	1	western	western	ADJ
chd-99	90	2	blot	blot	NOUN
chd-99	90	3	analysis	analysis	NOUN
chd-99	90	4	cell	cell	NOUN
chd-99	90	5	lysate	lysate	NOUN
chd-99	90	6	preparation	preparation	NOUN
chd-99	90	7	and	and	CCONJ
chd-99	90	8	western	western	ADJ
chd-99	90	9	blot	blot	NOUN
chd-99	90	10	analysis	analysis	NOUN
chd-99	90	11	using	use	VERB
chd-99	90	12	enhanced	enhanced	ADJ
chd-99	90	13	chemiluminescence	chemiluminescence	NOUN
chd-99	90	14	were	be	AUX
chd-99	90	15	performed	perform	VERB
chd-99	90	16	as	as	SCONJ
chd-99	90	17	described	describe	VERB
chd-99	90	18	previously	previously	ADV
chd-99	90	19	(	(	PUNCT
chd-99	90	20	findlay	findlay	PROPN
chd-99	90	21	et	et	PROPN
chd-99	90	22	al	al	PROPN
chd-99	90	23	.	.	PROPN
chd-99	90	24	,	,	PUNCT
chd-99	90	25	2008	2008	NUM
chd-99	90	26	)	)	PUNCT
chd-99	90	27	.	.	PUNCT
chd-99	91	1	experimental	experimental	ADJ
chd-99	91	2	antibodies	antibody	NOUN
chd-99	91	3	include	include	VERB
chd-99	91	4	igf2r	igf2r	PROPN
chd-99	91	5	(	(	PUNCT
chd-99	91	6	santa	santa	PROPN
chd-99	91	7	cruz	cruz	PROPN
chd-99	91	8	biotechnology	biotechnology	PROPN
chd-99	91	9	,	,	PUNCT
chd-99	91	10	dallas	dallas	PROPN
chd-99	91	11	,	,	PUNCT
chd-99	91	12	tx	tx	PROPN
chd-99	91	13	)	)	PUNCT
chd-99	91	14	,	,	PUNCT
chd-99	91	15	igf1r	igf1r	PROPN
chd-99	91	16	,	,	PUNCT
chd-99	91	17	irs-1	irs-1	NOUN
chd-99	91	18	,	,	PUNCT
chd-99	91	19	p	p	PROPN
chd-99	91	20	-	-	PUNCT
chd-99	91	21	akt	akt	PROPN
chd-99	91	22	,	,	PUNCT
chd-99	91	23	akt	akt	PROPN
chd-99	91	24	,	,	PUNCT
chd-99	91	25	p	p	PROPN
chd-99	91	26	-	-	PUNCT
chd-99	91	27	erk	erk	PROPN
chd-99	91	28	and	and	CCONJ
chd-99	91	29	erk	erk	PROPN
chd-99	91	30	,	,	PUNCT
chd-99	91	31	p	p	PROPN
chd-99	91	32	-	-	PUNCT
chd-99	91	33	igf1r	igf1r	ADJ
chd-99	91	34	,	,	PUNCT
chd-99	91	35	p	p	NOUN
chd-99	91	36	-	-	PUNCT
chd-99	91	37	irs1	irs1	NOUN
chd-99	91	38	(	(	PUNCT
chd-99	91	39	cell	cell	NOUN
chd-99	91	40	signaling	signal	VERB
chd-99	91	41	technology	technology	NOUN
chd-99	91	42	,	,	PUNCT
chd-99	91	43	danvers	danver	NOUN
chd-99	91	44	,	,	PUNCT
chd-99	91	45	ma	ma	PROPN
chd-99	91	46	)	)	PUNCT
chd-99	91	47	and	and	CCONJ
chd-99	91	48	p	p	PROPN
chd-99	91	49	-	-	PUNCT
chd-99	91	50	ir	ir	PROPN
chd-99	91	51	and	and	CCONJ
chd-99	91	52	ir	ir	PROPN
chd-99	91	53	(	(	PUNCT
chd-99	91	54	abcam	abcam	PROPN
chd-99	91	55	,	,	PUNCT
chd-99	91	56	cambridge	cambridge	PROPN
chd-99	91	57	,	,	PUNCT
chd-99	91	58	ma	ma	PROPN
chd-99	91	59	)	)	PUNCT
chd-99	91	60	.	.	PUNCT
chd-99	92	1	gapdh	gapdh	NOUN
chd-99	92	2	(	(	PUNCT
chd-99	92	3	santa	santa	PROPN
chd-99	92	4	cruz	cruz	PROPN
chd-99	92	5	biotechnology	biotechnology	PROPN
chd-99	92	6	)	)	PUNCT
chd-99	92	7	was	be	AUX
chd-99	92	8	used	use	VERB
chd-99	92	9	as	as	ADP
chd-99	92	10	a	a	DET
chd-99	92	11	loading	loading	NOUN
chd-99	92	12	control	control	NOUN
chd-99	92	13	.	.	PUNCT
chd-99	93	1	transwell	transwell	NOUN
chd-99	93	2	migration	migration	NOUN
chd-99	93	3	and	and	CCONJ
chd-99	93	4	invasion	invasion	NOUN
chd-99	93	5	assay	assay	VERB
chd-99	93	6	assays	assay	NOUN
chd-99	93	7	were	be	AUX
chd-99	93	8	performed	perform	VERB
chd-99	93	9	as	as	ADP
chd-99	93	10	previously	previously	ADV
chd-99	93	11	described	describe	VERB
chd-99	93	12	(	(	PUNCT
chd-99	93	13	guo	guo	PROPN
chd-99	93	14	et	et	PROPN
chd-99	93	15	al	al	PROPN
chd-99	93	16	.	.	PROPN
chd-99	93	17	,	,	PUNCT
chd-99	93	18	2013	2013	NUM
chd-99	93	19	)	)	PUNCT
chd-99	93	20	.	.	PUNCT
chd-99	94	1	images	image	NOUN
chd-99	94	2	were	be	AUX
chd-99	94	3	taken	take	VERB
chd-99	94	4	at	at	ADP
chd-99	94	5	a	a	DET
chd-99	94	6	40x	40x	NOUN
chd-99	94	7	objective	objective	NOUN
chd-99	94	8	for	for	ADP
chd-99	94	9	analysis	analysis	NOUN
chd-99	94	10	.	.	PUNCT
chd-99	95	1	statistical	statistical	ADJ
chd-99	95	2	analysis	analysis	NOUN
chd-99	95	3	sample	sample	NOUN
chd-99	95	4	size	size	NOUN
chd-99	95	5	for	for	ADP
chd-99	95	6	mouse	mouse	NOUN
chd-99	95	7	experiments	experiment	NOUN
chd-99	95	8	n	n	PRON
chd-99	95	9	≥	≥	NOUN
chd-99	95	10	9	9	NUM
chd-99	95	11	.	.	PUNCT
chd-99	96	1	for	for	ADP
chd-99	96	2	statistical	statistical	ADJ
chd-99	96	3	testing	testing	NOUN
chd-99	96	4	,	,	PUNCT
chd-99	96	5	two	two	NUM
chd-99	96	6	-	-	PUNCT
chd-99	96	7	sided	sided	ADJ
chd-99	96	8	paired	pair	VERB
chd-99	96	9	(	(	PUNCT
chd-99	96	10	in	in	ADP
chd-99	96	11	vitro	vitro	X
chd-99	96	12	assays	assay	NOUN
chd-99	96	13	)	)	PUNCT
chd-99	96	14	and	and	CCONJ
chd-99	96	15	two	two	NUM
chd-99	96	16	-	-	PUNCT
chd-99	96	17	sample	sample	NOUN
chd-99	96	18	(	(	PUNCT
chd-99	96	19	in	in	ADP
chd-99	96	20	vivo	vivo	ADJ
chd-99	96	21	assays	assay	NOUN
chd-99	96	22	)	)	PUNCT
chd-99	96	23	student	student	NOUN
chd-99	96	24	's	's	PART
chd-99	96	25	t	t	NOUN
chd-99	96	26	-	-	PUNCT
chd-99	96	27	tests	test	NOUN
chd-99	96	28	were	be	AUX
chd-99	96	29	performed	perform	VERB
chd-99	96	30	using	use	VERB
chd-99	96	31	excel	excel	NOUN
chd-99	96	32	(	(	PUNCT
chd-99	96	33	in	in	ADP
chd-99	96	34	vitro	vitro	X
chd-99	96	35	assays	assay	NOUN
chd-99	96	36	)	)	PUNCT
chd-99	96	37	and	and	CCONJ
chd-99	96	38	graphpad	graphpad	NOUN
chd-99	96	39	prism	prism	NOUN
chd-99	96	40	(	(	PUNCT
chd-99	96	41	in	in	ADP
chd-99	96	42	vivo	vivo	ADJ
chd-99	96	43	assays	assay	NOUN
chd-99	96	44	)	)	PUNCT
chd-99	96	45	.	.	PUNCT
chd-99	97	1	p	p	X
chd-99	97	2	-	-	PUNCT
chd-99	97	3	values	value	NOUN
chd-99	97	4	are	be	AUX
chd-99	97	5	reported	report	VERB
chd-99	97	6	for	for	ADP
chd-99	97	7	each	each	DET
chd-99	97	8	individual	individual	ADJ
chd-99	97	9	experiment	experiment	NOUN
chd-99	97	10	.	.	PUNCT
chd-99	98	1	error	error	NOUN
chd-99	98	2	bars	bar	NOUN
chd-99	98	3	represent	represent	VERB
chd-99	98	4	standard	standard	ADJ
chd-99	98	5	deviations	deviation	NOUN
chd-99	98	6	(	(	PUNCT
chd-99	98	7	sd	sd	NOUN
chd-99	98	8	)	)	PUNCT
chd-99	98	9	of	of	ADP
chd-99	98	10	three	three	NUM
chd-99	98	11	independent	independent	ADJ
chd-99	98	12	experiments	experiment	NOUN
chd-99	98	13	unless	unless	SCONJ
chd-99	98	14	indicated	indicate	VERB
chd-99	98	15	otherwise	otherwise	ADV
chd-99	98	16	.	.	PUNCT
chd-99	99	1	time	time	NOUN
chd-99	99	2	to	to	PART
chd-99	99	3	event	event	NOUN
chd-99	99	4	outcomes	outcome	NOUN
chd-99	99	5	were	be	AUX
chd-99	99	6	assessed	assess	VERB
chd-99	99	7	using	use	VERB
chd-99	99	8	kaplan	kaplan	PROPN
chd-99	99	9	-	-	PUNCT
chd-99	99	10	meier	meier	PROPN
chd-99	99	11	curves	curve	NOUN
chd-99	99	12	and	and	CCONJ
chd-99	99	13	distributions	distribution	NOUN
chd-99	99	14	compared	compare	VERB
chd-99	99	15	between	between	ADP
chd-99	99	16	groups	group	NOUN
chd-99	99	17	using	use	VERB
chd-99	99	18	the	the	DET
chd-99	99	19	peto	peto	NOUN
chd-99	99	20	-	-	PUNCT
chd-99	99	21	peto	peto	NOUN
chd-99	99	22	test	test	NOUN
chd-99	99	23	which	which	PRON
chd-99	99	24	is	be	AUX
chd-99	99	25	less	less	ADV
chd-99	99	26	sensitive	sensitive	ADJ
chd-99	99	27	to	to	ADP
chd-99	99	28	late	late	ADJ
chd-99	99	29	differences	difference	NOUN
chd-99	99	30	than	than	ADP
chd-99	99	31	the	the	DET
chd-99	99	32	traditional	traditional	ADJ
chd-99	99	33	log	log	NOUN
chd-99	99	34	rank	rank	NOUN
chd-99	99	35	test	test	NOUN
chd-99	99	36	.	.	PUNCT
chd-99	100	1	for	for	ADP
chd-99	100	2	hypothesis	hypothesis	NOUN
chd-99	100	3	testing	testing	NOUN
chd-99	100	4	,	,	PUNCT
chd-99	100	5	the	the	DET
chd-99	100	6	alpha	alpha	NOUN
chd-99	100	7	level	level	NOUN
chd-99	100	8	was	be	AUX
chd-99	100	9	set	set	VERB
chd-99	100	10	at	at	ADP
chd-99	100	11	0.05	0.05	NUM
chd-99	100	12	.	.	PUNCT
chd-99	101	1	results	result	NOUN
chd-99	101	2	mir-204	mir-204	NOUN
chd-99	101	3	modulates	modulate	VERB
chd-99	101	4	migration	migration	NOUN
chd-99	101	5	and	and	CCONJ
chd-99	101	6	invasion	invasion	NOUN
chd-99	101	7	in	in	ADP
chd-99	101	8	nontransformed	nontransformed	ADJ
chd-99	101	9	and	and	CCONJ
chd-99	101	10	invasive	invasive	ADJ
chd-99	101	11	breast	breast	NOUN
chd-99	101	12	cancer	cancer	NOUN
chd-99	101	13	cell	cell	NOUN
chd-99	101	14	lines	line	NOUN
chd-99	101	15	.	.	PUNCT
chd-99	102	1	our	our	PRON
chd-99	102	2	group	group	NOUN
chd-99	102	3	has	have	AUX
chd-99	102	4	shown	show	VERB
chd-99	102	5	previously	previously	ADV
chd-99	102	6	that	that	SCONJ
chd-99	102	7	overexpression	overexpression	NOUN
chd-99	102	8	of	of	ADP
chd-99	102	9	mir-204	mir-204	NOUN
chd-99	102	10	was	be	AUX
chd-99	102	11	able	able	ADJ
chd-99	102	12	to	to	PART
chd-99	102	13	increase	increase	VERB
chd-99	102	14	migration	migration	NOUN
chd-99	102	15	and	and	CCONJ
chd-99	102	16	invasion	invasion	NOUN
chd-99	102	17	in	in	ADP
chd-99	102	18	the	the	DET
chd-99	102	19	non	non	ADJ
chd-99	102	20	-	-	ADJ
chd-99	102	21	invasive	invasive	ADJ
chd-99	102	22	breast	breast	NOUN
chd-99	102	23	cancer	cancer	NOUN
chd-99	102	24	cell	cell	NOUN
chd-99	102	25	line	line	NOUN
chd-99	102	26	mcf7	mcf7	NOUN
chd-99	102	27	(	(	PUNCT
chd-99	102	28	findlay	findlay	PROPN
chd-99	102	29	et	et	PROPN
chd-99	102	30	al	al	PROPN
chd-99	102	31	.	.	PROPN
chd-99	102	32	,	,	PUNCT
chd-99	102	33	2008	2008	NUM
chd-99	102	34	)	)	PUNCT
chd-99	102	35	.	.	PUNCT
chd-99	103	1	however	however	ADV
chd-99	103	2	,	,	PUNCT
chd-99	103	3	in	in	ADP
chd-99	103	4	order	order	NOUN
chd-99	103	5	to	to	PART
chd-99	103	6	explore	explore	VERB
chd-99	103	7	this	this	DET
chd-99	103	8	function	function	NOUN
chd-99	103	9	further	far	ADV
chd-99	103	10	,	,	PUNCT
chd-99	103	11	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	103	12	e6	e6	VERB
chd-99	103	13	cancer	cancer	NOUN
chd-99	103	14	health	health	NOUN
chd-99	103	15	disparities	disparity	NOUN
chd-99	103	16	research	research	NOUN
chd-99	103	17	we	we	PRON
chd-99	103	18	wanted	want	VERB
chd-99	103	19	to	to	PART
chd-99	103	20	assess	assess	VERB
chd-99	103	21	the	the	DET
chd-99	103	22	role	role	NOUN
chd-99	103	23	of	of	ADP
chd-99	103	24	mir-204	mir-204	NOUN
chd-99	103	25	as	as	ADP
chd-99	103	26	an	an	DET
chd-99	103	27	oncomir	oncomir	PROPN
chd-99	103	28	in	in	ADP
chd-99	103	29	both	both	DET
chd-99	103	30	non	non	ADJ
chd-99	103	31	-	-	ADJ
chd-99	103	32	transformed	transform	VERB
chd-99	103	33	breast	breast	NOUN
chd-99	103	34	cells	cell	NOUN
chd-99	103	35	as	as	ADV
chd-99	103	36	well	well	ADV
chd-99	103	37	as	as	ADP
chd-99	103	38	invasive	invasive	ADJ
chd-99	103	39	breast	breast	NOUN
chd-99	103	40	cancer	cancer	NOUN
chd-99	103	41	cells	cell	NOUN
chd-99	103	42	.	.	PUNCT
chd-99	104	1	a	a	DET
chd-99	104	2	breast	breast	NOUN
chd-99	104	3	cell	cell	NOUN
chd-99	104	4	line	line	NOUN
chd-99	104	5	screen	screen	NOUN
chd-99	104	6	demonstrated	demonstrate	VERB
chd-99	104	7	that	that	SCONJ
chd-99	104	8	non	non	ADJ
chd-99	104	9	-	-	ADJ
chd-99	104	10	transformed	transform	VERB
chd-99	104	11	mcf10a	mcf10a	NOUN
chd-99	104	12	and	and	CCONJ
chd-99	104	13	mcf12a	mcf12a	ADP
chd-99	104	14	cells	cell	NOUN
chd-99	104	15	had	have	VERB
chd-99	104	16	the	the	DET
chd-99	104	17	lowest	low	ADJ
chd-99	104	18	expression	expression	NOUN
chd-99	104	19	levels	level	NOUN
chd-99	104	20	of	of	ADP
chd-99	104	21	mir-204	mir-204	NOUN
chd-99	104	22	and	and	CCONJ
chd-99	104	23	the	the	DET
chd-99	104	24	invasive	invasive	ADJ
chd-99	104	25	breast	breast	NOUN
chd-99	104	26	cancer	cancer	NOUN
chd-99	104	27	cell	cell	NOUN
chd-99	104	28	lines	line	NOUN
chd-99	104	29	mda	mda	PROPN
chd-99	104	30	-	-	PUNCT
chd-99	104	31	mb-231	mb-231	PROPN
chd-99	104	32	and	and	CCONJ
chd-99	104	33	bt549	bt549	PROPN
chd-99	104	34	had	have	VERB
chd-99	104	35	the	the	DET
chd-99	104	36	highest	high	ADJ
chd-99	104	37	expression	expression	NOUN
chd-99	104	38	levels	level	NOUN
chd-99	104	39	of	of	ADP
chd-99	104	40	mir-204	mir-204	NOUN
chd-99	104	41	(	(	PUNCT
chd-99	104	42	supplemental	supplemental	ADJ
chd-99	104	43	figure	figure	NOUN
chd-99	104	44	1b	1b	NUM
chd-99	104	45	)	)	PUNCT
chd-99	104	46	.	.	PUNCT
chd-99	105	1	therefore	therefore	ADV
chd-99	105	2	,	,	PUNCT
chd-99	105	3	we	we	PRON
chd-99	105	4	examined	examine	VERB
chd-99	105	5	migration	migration	NOUN
chd-99	105	6	and	and	CCONJ
chd-99	105	7	invasion	invasion	NOUN
chd-99	105	8	in	in	ADP
chd-99	105	9	non	non	ADJ
chd-99	105	10	-	-	ADJ
chd-99	105	11	transformed	transform	VERB
chd-99	105	12	mcf10a	mcf10a	NOUN
chd-99	105	13	and	and	CCONJ
chd-99	105	14	mcf12a	mcf12a	ADP
chd-99	105	15	breast	breast	NOUN
chd-99	105	16	cell	cell	NOUN
chd-99	105	17	lines	line	NOUN
chd-99	105	18	in	in	ADP
chd-99	105	19	which	which	PRON
chd-99	105	20	mir-204	mir-204	NOUN
chd-99	105	21	had	have	AUX
chd-99	105	22	been	be	AUX
chd-99	105	23	overexpressed	overexpresse	VERB
chd-99	105	24	either	either	CCONJ
chd-99	105	25	transiently	transiently	ADV
chd-99	105	26	(	(	PUNCT
chd-99	105	27	mcf10a	mcf10a	ADJ
chd-99	105	28	)	)	PUNCT
chd-99	105	29	or	or	CCONJ
chd-99	105	30	stably	stably	ADV
chd-99	105	31	(	(	PUNCT
chd-99	105	32	mcf12a	mcf12a	NOUN
chd-99	105	33	)	)	PUNCT
chd-99	105	34	(	(	PUNCT
chd-99	105	35	supplemental	supplemental	ADJ
chd-99	105	36	figure	figure	NOUN
chd-99	105	37	1d	1d	NUM
chd-99	105	38	&	&	CCONJ
chd-99	105	39	e	e	NOUN
chd-99	105	40	)	)	PUNCT
chd-99	105	41	.	.	PUNCT
chd-99	106	1	we	we	PRON
chd-99	106	2	observed	observe	VERB
chd-99	106	3	that	that	SCONJ
chd-99	106	4	mir-204	mir-204	NOUN
chd-99	106	5	expression	expression	NOUN
chd-99	106	6	was	be	AUX
chd-99	106	7	able	able	ADJ
chd-99	106	8	to	to	PART
chd-99	106	9	significantly	significantly	ADV
chd-99	106	10	increase	increase	VERB
chd-99	106	11	both	both	DET
chd-99	106	12	migration	migration	NOUN
chd-99	106	13	and	and	CCONJ
chd-99	106	14	invasion	invasion	NOUN
chd-99	106	15	of	of	ADP
chd-99	106	16	non	non	ADJ
chd-99	106	17	-	-	ADJ
chd-99	106	18	transformed	transform	VERB
chd-99	106	19	breast	breast	NOUN
chd-99	106	20	cells	cell	NOUN
chd-99	106	21	(	(	PUNCT
chd-99	106	22	mcf10a	mcf10a	X
chd-99	106	23	&	&	CCONJ
chd-99	106	24	mcf12a	mcf12a	NOUN
chd-99	106	25	)	)	PUNCT
chd-99	106	26	when	when	SCONJ
chd-99	106	27	overexpressed	overexpresse	VERB
chd-99	106	28	(	(	PUNCT
chd-99	106	29	figure	figure	NOUN
chd-99	106	30	1a	1a	PROPN
chd-99	106	31	&	&	CCONJ
chd-99	106	32	b	b	NOUN
chd-99	106	33	)	)	PUNCT
chd-99	106	34	.	.	PUNCT
chd-99	107	1	we	we	PRON
chd-99	107	2	also	also	ADV
chd-99	107	3	examined	examine	VERB
chd-99	107	4	migration	migration	NOUN
chd-99	107	5	and	and	CCONJ
chd-99	107	6	invasion	invasion	NOUN
chd-99	107	7	in	in	ADP
chd-99	107	8	the	the	DET
chd-99	107	9	invasive	invasive	ADJ
chd-99	107	10	breast	breast	NOUN
chd-99	107	11	cancer	cancer	NOUN
chd-99	107	12	cell	cell	NOUN
chd-99	107	13	lines	line	NOUN
chd-99	107	14	mda	mda	PROPN
chd-99	107	15	-	-	PUNCT
chd-99	107	16	mb231	mb231	PROPN
chd-99	107	17	&	&	CCONJ
chd-99	107	18	bt549	bt549	PROPN
chd-99	107	19	,	,	PUNCT
chd-99	107	20	in	in	ADP
chd-99	107	21	which	which	PRON
chd-99	107	22	mir-204	mir-204	NOUN
chd-99	107	23	was	be	AUX
chd-99	107	24	inhibited	inhibit	VERB
chd-99	107	25	(	(	PUNCT
chd-99	107	26	supplemental	supplemental	ADJ
chd-99	107	27	figure	figure	NOUN
chd-99	107	28	1f	1f	PROPN
chd-99	107	29	&	&	CCONJ
chd-99	107	30	g	g	NOUN
chd-99	107	31	)	)	PUNCT
chd-99	107	32	.	.	PUNCT
chd-99	108	1	we	we	PRON
chd-99	108	2	observed	observe	VERB
chd-99	108	3	that	that	SCONJ
chd-99	108	4	migration	migration	NOUN
chd-99	108	5	and	and	CCONJ
chd-99	108	6	invasion	invasion	NOUN
chd-99	108	7	was	be	AUX
chd-99	108	8	inhibited	inhibit	VERB
chd-99	108	9	in	in	ADP
chd-99	108	10	two	two	NUM
chd-99	108	11	invasive	invasive	ADJ
chd-99	108	12	breast	breast	NOUN
chd-99	108	13	cancer	cancer	NOUN
chd-99	108	14	cell	cell	NOUN
chd-99	108	15	lines	line	NOUN
chd-99	108	16	in	in	ADP
chd-99	108	17	which	which	PRON
chd-99	108	18	mir-204	mir-204	NOUN
chd-99	108	19	had	have	AUX
chd-99	108	20	been	be	AUX
chd-99	108	21	suppressed	suppress	VERB
chd-99	108	22	(	(	PUNCT
chd-99	108	23	figure	figure	NOUN
chd-99	108	24	1c	1c	NUM
chd-99	108	25	&	&	CCONJ
chd-99	108	26	d	d	NOUN
chd-99	108	27	)	)	PUNCT
chd-99	108	28	.	.	PUNCT
chd-99	109	1	these	these	DET
chd-99	109	2	data	datum	NOUN
chd-99	109	3	lend	lend	VERB
chd-99	109	4	further	further	ADJ
chd-99	109	5	support	support	NOUN
chd-99	109	6	to	to	ADP
chd-99	109	7	the	the	DET
chd-99	109	8	proposed	propose	VERB
chd-99	109	9	oncogenic	oncogenic	ADJ
chd-99	109	10	role	role	NOUN
chd-99	109	11	of	of	ADP
chd-99	109	12	mir-204	mir-204	NOUN
chd-99	109	13	in	in	ADP
chd-99	109	14	breast	breast	NOUN
chd-99	109	15	cancer	cancer	NOUN
chd-99	109	16	.	.	PUNCT
chd-99	110	1	we	we	PRON
chd-99	110	2	also	also	ADV
chd-99	110	3	observed	observe	VERB
chd-99	110	4	that	that	SCONJ
chd-99	110	5	mir-204	mir-204	NOUN
chd-99	110	6	increases	increase	VERB
chd-99	110	7	proliferation	proliferation	NOUN
chd-99	110	8	in	in	ADP
chd-99	110	9	the	the	DET
chd-99	110	10	non	non	ADJ
chd-99	110	11	-	-	ADJ
chd-99	110	12	invasive	invasive	ADJ
chd-99	110	13	mcf10a	mcf10a	NOUN
chd-99	110	14	(	(	PUNCT
chd-99	110	15	figure	figure	NOUN
chd-99	110	16	1e	1e	NOUN
chd-99	110	17	)	)	PUNCT
chd-99	110	18	and	and	CCONJ
chd-99	110	19	mcf12a	mcf12a	PROPN
chd-99	110	20	(	(	PUNCT
chd-99	110	21	figure	figure	NOUN
chd-99	110	22	1f	1f	NUM
chd-99	110	23	)	)	PUNCT
chd-99	110	24	cells	cell	NOUN
chd-99	110	25	,	,	PUNCT
chd-99	110	26	similar	similar	ADJ
chd-99	110	27	to	to	ADP
chd-99	110	28	that	that	PRON
chd-99	110	29	observed	observe	VERB
chd-99	110	30	in	in	ADP
chd-99	110	31	mcf7	mcf7	NOUN
chd-99	110	32	cells	cell	NOUN
chd-99	110	33	(	(	PUNCT
chd-99	110	34	findlay	findlay	PROPN
chd-99	110	35	et	et	PROPN
chd-99	110	36	al	al	PROPN
chd-99	110	37	.	.	PROPN
chd-99	110	38	,	,	PUNCT
chd-99	110	39	2008	2008	NUM
chd-99	110	40	)	)	PUNCT
chd-99	110	41	.	.	PUNCT
chd-99	111	1	figure	figure	VERB
chd-99	111	2	1	1	NUM
chd-99	111	3	:	:	PUNCT
chd-99	111	4	mir-204	mir-204	NOUN
chd-99	111	5	regulates	regulate	VERB
chd-99	111	6	migration	migration	NOUN
chd-99	111	7	and	and	CCONJ
chd-99	111	8	invasion	invasion	NOUN
chd-99	111	9	.	.	PUNCT
chd-99	112	1	transwell	transwell	NOUN
chd-99	112	2	migration	migration	NOUN
chd-99	112	3	(	(	PUNCT
chd-99	112	4	a	a	PRON
chd-99	112	5	&	&	CCONJ
chd-99	112	6	c	c	NOUN
chd-99	112	7	)	)	PUNCT
chd-99	112	8	,	,	PUNCT
chd-99	112	9	invasion	invasion	NOUN
chd-99	112	10	(	(	PUNCT
chd-99	112	11	b	b	PROPN
chd-99	112	12	&	&	CCONJ
chd-99	112	13	d	d	NOUN
chd-99	112	14	)	)	PUNCT
chd-99	112	15	and	and	CCONJ
chd-99	112	16	proliferation	proliferation	NOUN
chd-99	112	17	(	(	PUNCT
chd-99	112	18	e	e	X
chd-99	112	19	&	&	CCONJ
chd-99	112	20	f	f	PROPN
chd-99	112	21	)	)	PUNCT
chd-99	112	22	assays	assay	NOUN
chd-99	112	23	of	of	ADP
chd-99	112	24	various	various	ADJ
chd-99	112	25	breast	breast	NOUN
chd-99	112	26	cell	cell	NOUN
chd-99	112	27	lines	line	NOUN
chd-99	112	28	with	with	ADP
chd-99	112	29	either	either	DET
chd-99	112	30	overexpression	overexpression	NOUN
chd-99	112	31	(	(	PUNCT
chd-99	112	32	a	a	DET
chd-99	112	33	,	,	PUNCT
chd-99	112	34	b	b	NOUN
chd-99	112	35	,	,	PUNCT
chd-99	112	36	e	e	PROPN
chd-99	112	37	&	&	CCONJ
chd-99	112	38	f	f	PROPN
chd-99	112	39	)	)	PUNCT
chd-99	112	40	or	or	CCONJ
chd-99	112	41	inhibition	inhibition	NOUN
chd-99	112	42	(	(	PUNCT
chd-99	112	43	c	c	PROPN
chd-99	112	44	&	&	CCONJ
chd-99	112	45	d	d	PROPN
chd-99	112	46	;	;	PUNCT
chd-99	112	47	aso-204	aso-204	X
chd-99	112	48	)	)	PUNCT
chd-99	112	49	of	of	ADP
chd-99	112	50	mir-204	mir-204	NOUN
chd-99	112	51	compared	compare	VERB
chd-99	112	52	to	to	ADP
chd-99	112	53	scrambled	scramble	VERB
chd-99	112	54	(	(	PUNCT
chd-99	112	55	scr	scr	NOUN
chd-99	112	56	)	)	PUNCT
chd-99	112	57	control	control	NOUN
chd-99	112	58	.	.	PUNCT
chd-99	113	1	mcf10a	mcf10a	ADV
chd-99	113	2	,	,	PUNCT
chd-99	113	3	mda	mda	PROPN
chd-99	113	4	-	-	PUNCT
chd-99	113	5	mb-231	mb-231	PROPN
chd-99	113	6	and	and	CCONJ
chd-99	113	7	bt549	bt549	PROPN
chd-99	113	8	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	113	9	e7	e7	PROPN
chd-99	113	10	cancer	cancer	NOUN
chd-99	113	11	health	health	NOUN
chd-99	113	12	disparities	disparity	NOUN
chd-99	113	13	research	research	NOUN
chd-99	113	14	cells	cell	NOUN
chd-99	113	15	were	be	AUX
chd-99	113	16	transiently	transiently	ADV
chd-99	113	17	transfected	transfecte	VERB
chd-99	113	18	.	.	PUNCT
chd-99	114	1	mcf12a	mcf12a	ADP
chd-99	114	2	cells	cell	NOUN
chd-99	114	3	were	be	AUX
chd-99	114	4	stably	stably	ADV
chd-99	114	5	transfected	transfecte	VERB
chd-99	114	6	.	.	PUNCT
chd-99	115	1	aso-204	aso-204	INTJ
chd-99	115	2	–	–	PUNCT
chd-99	115	3	antisenseoligoribonucleotides	antisenseoligoribonucleotide	NOUN
chd-99	115	4	(	(	PUNCT
chd-99	115	5	mir-204	mir-204	NOUN
chd-99	115	6	inhibitors	inhibitor	NOUN
chd-99	115	7	)	)	PUNCT
chd-99	115	8	.	.	PUNCT
chd-99	116	1	mir-204	mir-204	PROPN
chd-99	116	2	is	be	AUX
chd-99	116	3	racially	racially	ADV
chd-99	116	4	disparate	disparate	ADJ
chd-99	116	5	and	and	CCONJ
chd-99	116	6	elevated	elevate	VERB
chd-99	116	7	in	in	ADP
chd-99	116	8	breast	breast	NOUN
chd-99	116	9	cancer	cancer	NOUN
chd-99	116	10	to	to	PART
chd-99	116	11	further	far	ADV
chd-99	116	12	explore	explore	VERB
chd-99	116	13	potential	potential	ADJ
chd-99	116	14	targets	target	NOUN
chd-99	116	15	of	of	ADP
chd-99	116	16	mir-204	mir-204	NOUN
chd-99	116	17	that	that	PRON
chd-99	116	18	may	may	AUX
chd-99	116	19	mediate	mediate	VERB
chd-99	116	20	its	its	PRON
chd-99	116	21	role	role	NOUN
chd-99	116	22	as	as	ADP
chd-99	116	23	an	an	DET
chd-99	116	24	oncomir	oncomir	PROPN
chd-99	116	25	in	in	ADP
chd-99	116	26	breast	breast	NOUN
chd-99	116	27	cancer	cancer	NOUN
chd-99	116	28	,	,	PUNCT
chd-99	116	29	we	we	PRON
chd-99	116	30	performed	perform	VERB
chd-99	116	31	a	a	DET
chd-99	116	32	bioinformatical	bioinformatical	ADJ
chd-99	116	33	search	search	NOUN
chd-99	116	34	of	of	ADP
chd-99	116	35	potential	potential	ADJ
chd-99	116	36	targets	target	NOUN
chd-99	116	37	in	in	ADP
chd-99	116	38	publically	publically	ADV
chd-99	116	39	available	available	ADJ
chd-99	116	40	databases	database	NOUN
chd-99	116	41	(	(	PUNCT
chd-99	116	42	targetscan	targetscan	NOUN
chd-99	116	43	and	and	CCONJ
chd-99	116	44	mirbase	mirbase	PROPN
chd-99	116	45	)	)	PUNCT
chd-99	116	46	and	and	CCONJ
chd-99	116	47	identified	identify	VERB
chd-99	116	48	igf2r	igf2r	PROPN
chd-99	116	49	as	as	ADP
chd-99	116	50	a	a	DET
chd-99	116	51	predicted	predict	VERB
chd-99	116	52	target	target	NOUN
chd-99	116	53	,	,	PUNCT
chd-99	116	54	which	which	PRON
chd-99	116	55	has	have	AUX
chd-99	116	56	been	be	AUX
chd-99	116	57	semi	semi	ADV
chd-99	116	58	-	-	ADJ
chd-99	116	59	validated	validated	ADJ
chd-99	116	60	for	for	ADP
chd-99	116	61	mir-204	mir-204	NOUN
chd-99	116	62	in	in	ADP
chd-99	116	63	human	human	ADJ
chd-99	116	64	trabecular	trabecular	ADJ
chd-99	116	65	meshwork	meshwork	NOUN
chd-99	116	66	(	(	PUNCT
chd-99	116	67	htm	htm	PROPN
chd-99	116	68	)	)	PUNCT
chd-99	116	69	cells	cell	NOUN
chd-99	116	70	(	(	PUNCT
chd-99	116	71	li	li	PROPN
chd-99	116	72	et	et	PROPN
chd-99	116	73	al	al	PROPN
chd-99	116	74	.	.	PROPN
chd-99	116	75	,	,	PUNCT
chd-99	116	76	2011	2011	NUM
chd-99	116	77	)	)	PUNCT
chd-99	116	78	.	.	PUNCT
chd-99	117	1	igf2r	igf2r	PROPN
chd-99	117	2	is	be	AUX
chd-99	117	3	proposed	propose	VERB
chd-99	117	4	as	as	ADP
chd-99	117	5	a	a	DET
chd-99	117	6	tumor	tumor	NOUN
chd-99	117	7	suppressor	suppressor	NOUN
chd-99	117	8	and	and	CCONJ
chd-99	117	9	studies	study	NOUN
chd-99	117	10	have	have	AUX
chd-99	117	11	shown	show	VERB
chd-99	117	12	that	that	SCONJ
chd-99	117	13	reduced	reduce	VERB
chd-99	117	14	igf2r	igf2r	PART
chd-99	117	15	expression	expression	NOUN
chd-99	117	16	correlates	correlate	VERB
chd-99	117	17	with	with	ADP
chd-99	117	18	poor	poor	ADJ
chd-99	117	19	patient	patient	ADJ
chd-99	117	20	prognosis	prognosis	NOUN
chd-99	117	21	in	in	ADP
chd-99	117	22	bc	bc	PROPN
chd-99	117	23	patients	patient	NOUN
chd-99	117	24	.	.	PUNCT
chd-99	118	1	therefore	therefore	ADV
chd-99	118	2	,	,	PUNCT
chd-99	118	3	we	we	PRON
chd-99	118	4	wanted	want	VERB
chd-99	118	5	to	to	PART
chd-99	118	6	explore	explore	VERB
chd-99	118	7	its	its	PRON
chd-99	118	8	role	role	NOUN
chd-99	118	9	as	as	ADP
chd-99	118	10	a	a	DET
chd-99	118	11	direct	direct	ADJ
chd-99	118	12	target	target	NOUN
chd-99	118	13	of	of	ADP
chd-99	118	14	mir-204	mir-204	NOUN
chd-99	118	15	in	in	ADP
chd-99	118	16	breast	breast	NOUN
chd-99	118	17	cancer	cancer	NOUN
chd-99	118	18	.	.	PUNCT
chd-99	119	1	to	to	PART
chd-99	119	2	examine	examine	VERB
chd-99	119	3	whether	whether	SCONJ
chd-99	119	4	igf2r	igf2r	PROPN
chd-99	119	5	expression	expression	NOUN
chd-99	119	6	is	be	AUX
chd-99	119	7	repressed	repress	VERB
chd-99	119	8	by	by	ADP
chd-99	119	9	mir-204	mir-204	NOUN
chd-99	119	10	through	through	ADP
chd-99	119	11	the	the	DET
chd-99	119	12	predicted	predict	VERB
chd-99	119	13	elements	element	NOUN
chd-99	119	14	,	,	PUNCT
chd-99	119	15	a	a	DET
chd-99	119	16	luciferase	luciferase	NOUN
chd-99	119	17	reporter	reporter	NOUN
chd-99	119	18	construct	construct	VERB
chd-99	119	19	containing	contain	VERB
chd-99	119	20	the	the	DET
chd-99	119	21	3′	3′	NUM
chd-99	119	22	utr	utr	NOUN
chd-99	119	23	of	of	ADP
chd-99	119	24	igf2r	igf2r	PROPN
chd-99	119	25	was	be	AUX
chd-99	119	26	transfected	transfecte	VERB
chd-99	119	27	into	into	ADP
chd-99	119	28	breast	breast	NOUN
chd-99	119	29	cancer	cancer	NOUN
chd-99	119	30	cells	cell	NOUN
chd-99	119	31	.	.	PUNCT
chd-99	120	1	cells	cell	NOUN
chd-99	120	2	were	be	AUX
chd-99	120	3	co	co	VERB
chd-99	120	4	-	-	VERB
chd-99	120	5	transfected	transfecte	VERB
chd-99	120	6	with	with	ADP
chd-99	120	7	either	either	CCONJ
chd-99	120	8	mir-204	mir-204	NOUN
chd-99	120	9	or	or	CCONJ
chd-99	120	10	an	an	DET
chd-99	120	11	empty	empty	ADJ
chd-99	120	12	vector	vector	NOUN
chd-99	120	13	(	(	PUNCT
chd-99	120	14	ev	ev	NOUN
chd-99	120	15	)	)	PUNCT
chd-99	120	16	control	control	NOUN
chd-99	120	17	.	.	PUNCT
chd-99	121	1	the	the	DET
chd-99	121	2	overexpression	overexpression	NOUN
chd-99	121	3	of	of	ADP
chd-99	121	4	mir-204	mir-204	NOUN
chd-99	121	5	led	lead	VERB
chd-99	121	6	to	to	ADP
chd-99	121	7	a	a	DET
chd-99	121	8	~30	~30	NOUN
chd-99	121	9	%	%	NOUN
chd-99	121	10	decrease	decrease	NOUN
chd-99	121	11	in	in	ADP
chd-99	121	12	luciferase	luciferase	ADJ
chd-99	121	13	activity	activity	NOUN
chd-99	121	14	when	when	SCONJ
chd-99	121	15	compared	compare	VERB
chd-99	121	16	to	to	ADP
chd-99	121	17	ev	ev	PRON
chd-99	121	18	control	control	NOUN
chd-99	121	19	(	(	PUNCT
chd-99	121	20	figure	figure	NOUN
chd-99	121	21	2a	2a	NUM
chd-99	121	22	)	)	PUNCT
chd-99	121	23	.	.	PUNCT
chd-99	122	1	to	to	PART
chd-99	122	2	show	show	VERB
chd-99	122	3	that	that	SCONJ
chd-99	122	4	the	the	DET
chd-99	122	5	predicted	predict	VERB
chd-99	122	6	mir-204	mir-204	NOUN
chd-99	122	7	seed	seed	NOUN
chd-99	122	8	sequence	sequence	NOUN
chd-99	122	9	within	within	ADP
chd-99	122	10	the	the	DET
chd-99	122	11	igf2r	igf2r	PROPN
chd-99	122	12	3’utr	3’utr	PROPN
chd-99	122	13	was	be	AUX
chd-99	122	14	functional	functional	ADJ
chd-99	122	15	we	we	PRON
chd-99	122	16	mutated	mutate	VERB
chd-99	122	17	the	the	DET
chd-99	122	18	seed	seed	NOUN
chd-99	122	19	sequence	sequence	NOUN
chd-99	122	20	of	of	ADP
chd-99	122	21	mir-204	mir-204	NOUN
chd-99	122	22	in	in	ADP
chd-99	122	23	the	the	DET
chd-99	122	24	luciferase	luciferase	ADJ
chd-99	122	25	reporter	reporter	NOUN
chd-99	122	26	construct	construct	VERB
chd-99	122	27	.	.	PUNCT
chd-99	123	1	co	co	NOUN
chd-99	123	2	-	-	NOUN
chd-99	123	3	transfection	transfection	NOUN
chd-99	123	4	of	of	ADP
chd-99	123	5	cells	cell	NOUN
chd-99	123	6	with	with	ADP
chd-99	123	7	the	the	DET
chd-99	123	8	mutated	mutate	VERB
chd-99	123	9	luciferase	luciferase	NOUN
chd-99	123	10	reporter	reporter	NOUN
chd-99	123	11	construct	construct	NOUN
chd-99	123	12	(	(	PUNCT
chd-99	123	13	mut	mut	PROPN
chd-99	123	14	3’utr	3’utr	NUM
chd-99	123	15	)	)	PUNCT
chd-99	123	16	and	and	CCONJ
chd-99	123	17	mir-204	mir-204	NOUN
chd-99	123	18	did	do	AUX
chd-99	123	19	not	not	PART
chd-99	123	20	result	result	VERB
chd-99	123	21	in	in	ADP
chd-99	123	22	a	a	DET
chd-99	123	23	decrease	decrease	NOUN
chd-99	123	24	in	in	ADP
chd-99	123	25	luciferase	luciferase	ADJ
chd-99	123	26	activity	activity	NOUN
chd-99	123	27	(	(	PUNCT
chd-99	123	28	figure	figure	NOUN
chd-99	123	29	2a	2a	NUM
chd-99	123	30	)	)	PUNCT
chd-99	123	31	suggesting	suggest	VERB
chd-99	123	32	that	that	SCONJ
chd-99	123	33	mir204	mir204	PROPN
chd-99	123	34	directly	directly	ADV
chd-99	123	35	binds	bind	VERB
chd-99	123	36	to	to	ADP
chd-99	123	37	the	the	DET
chd-99	123	38	predicted	predict	VERB
chd-99	123	39	site	site	NOUN
chd-99	123	40	within	within	ADP
chd-99	123	41	the	the	DET
chd-99	123	42	3’utr	3’utr	NOUN
chd-99	123	43	of	of	ADP
chd-99	123	44	igf2r	igf2r	PROPN
chd-99	123	45	to	to	PART
chd-99	123	46	negatively	negatively	ADV
chd-99	123	47	regulate	regulate	VERB
chd-99	123	48	its	its	PRON
chd-99	123	49	expression	expression	NOUN
chd-99	123	50	.	.	PUNCT
chd-99	124	1	with	with	ADP
chd-99	124	2	respect	respect	NOUN
chd-99	124	3	to	to	ADP
chd-99	124	4	cancer	cancer	NOUN
chd-99	124	5	disparities	disparity	NOUN
chd-99	124	6	,	,	PUNCT
chd-99	124	7	a	a	DET
chd-99	124	8	study	study	NOUN
chd-99	124	9	showed	show	VERB
chd-99	124	10	significantly	significantly	ADV
chd-99	124	11	higher	high	ADJ
chd-99	124	12	levels	level	NOUN
chd-99	124	13	of	of	ADP
chd-99	124	14	igf2r	igf2r	PROPN
chd-99	124	15	in	in	ADP
chd-99	124	16	ca	ca	NOUN
chd-99	124	17	compared	compare	VERB
chd-99	124	18	to	to	ADP
chd-99	124	19	aa	aa	PROPN
chd-99	124	20	tumor	tumor	NOUN
chd-99	124	21	samples	sample	NOUN
chd-99	124	22	,	,	PUNCT
chd-99	124	23	suggesting	suggest	VERB
chd-99	124	24	that	that	PRON
chd-99	124	25	decreased	decrease	VERB
chd-99	124	26	igf2r	igf2r	PROPN
chd-99	124	27	expression	expression	NOUN
chd-99	124	28	may	may	AUX
chd-99	124	29	contribute	contribute	VERB
chd-99	124	30	to	to	ADP
chd-99	124	31	bc	bc	PROPN
chd-99	124	32	disparity	disparity	NOUN
chd-99	124	33	(	(	PUNCT
chd-99	124	34	kalla	kalla	PROPN
chd-99	124	35	singh	singh	PROPN
chd-99	124	36	et	et	PROPN
chd-99	124	37	al	al	PROPN
chd-99	124	38	.	.	PROPN
chd-99	124	39	,	,	PUNCT
chd-99	124	40	2010	2010	NUM
chd-99	124	41	)	)	PUNCT
chd-99	124	42	.	.	PUNCT
chd-99	125	1	therefore	therefore	ADV
chd-99	125	2	,	,	PUNCT
chd-99	125	3	we	we	PRON
chd-99	125	4	wanted	want	VERB
chd-99	125	5	to	to	PART
chd-99	125	6	examine	examine	VERB
chd-99	125	7	whether	whether	SCONJ
chd-99	125	8	mir-204	mir-204	NOUN
chd-99	125	9	levels	level	NOUN
chd-99	125	10	differed	differ	VERB
chd-99	125	11	by	by	ADP
chd-99	125	12	aa	aa	PROPN
chd-99	125	13	ancestry	ancestry	PROPN
chd-99	125	14	in	in	ADP
chd-99	125	15	bc	bc	PROPN
chd-99	125	16	patients	patient	NOUN
chd-99	125	17	by	by	ADP
chd-99	125	18	performing	perform	VERB
chd-99	125	19	quantitative	quantitative	ADJ
chd-99	125	20	pcr	pcr	NOUN
chd-99	125	21	(	(	PUNCT
chd-99	125	22	qpcr	qpcr	ADV
chd-99	125	23	)	)	PUNCT
chd-99	125	24	for	for	ADP
chd-99	125	25	mir-204	mir-204	NOUN
chd-99	125	26	on	on	ADP
chd-99	125	27	serum	serum	NOUN
chd-99	125	28	samples	sample	NOUN
chd-99	125	29	.	.	PUNCT
chd-99	126	1	we	we	PRON
chd-99	126	2	first	first	ADV
chd-99	126	3	found	find	VERB
chd-99	126	4	that	that	SCONJ
chd-99	126	5	mir-204	mir-204	NOUN
chd-99	126	6	levels	level	NOUN
chd-99	126	7	were	be	AUX
chd-99	126	8	elevated	elevate	VERB
chd-99	126	9	in	in	ADP
chd-99	126	10	high	high	ADJ
chd-99	126	11	grade	grade	NOUN
chd-99	126	12	when	when	SCONJ
chd-99	126	13	compared	compare	VERB
chd-99	126	14	to	to	ADP
chd-99	126	15	low	low	ADJ
chd-99	126	16	grade	grade	NOUN
chd-99	126	17	in	in	ADP
chd-99	126	18	both	both	CCONJ
chd-99	126	19	aa	aa	NOUN
chd-99	126	20	and	and	CCONJ
chd-99	126	21	ca	can	AUX
chd-99	126	22	women	woman	NOUN
chd-99	126	23	(	(	PUNCT
chd-99	126	24	figure	figure	NOUN
chd-99	126	25	2b	2b	NOUN
chd-99	126	26	)	)	PUNCT
chd-99	126	27	.	.	PUNCT
chd-99	127	1	however	however	ADV
chd-99	127	2	,	,	PUNCT
chd-99	127	3	it	it	PRON
chd-99	127	4	was	be	AUX
chd-99	127	5	observed	observe	VERB
chd-99	127	6	that	that	SCONJ
chd-99	127	7	mir-204	mir-204	NOUN
chd-99	127	8	levels	level	NOUN
chd-99	127	9	were	be	AUX
chd-99	127	10	significantly	significantly	ADV
chd-99	127	11	elevated	elevate	VERB
chd-99	127	12	in	in	ADP
chd-99	127	13	aa	aa	NOUN
chd-99	127	14	compared	compare	VERB
chd-99	127	15	to	to	ADP
chd-99	127	16	ca	can	AUX
chd-99	127	17	women	woman	NOUN
chd-99	127	18	in	in	ADP
chd-99	127	19	the	the	DET
chd-99	127	20	low	low	ADJ
chd-99	127	21	grade	grade	NOUN
chd-99	127	22	cohort	cohort	NOUN
chd-99	127	23	of	of	ADP
chd-99	127	24	bc	bc	PROPN
chd-99	127	25	patients	patient	NOUN
chd-99	127	26	,	,	PUNCT
chd-99	127	27	but	but	CCONJ
chd-99	127	28	not	not	PART
chd-99	127	29	observed	observe	VERB
chd-99	127	30	in	in	ADP
chd-99	127	31	the	the	DET
chd-99	127	32	high	high	ADJ
chd-99	127	33	grade	grade	NOUN
chd-99	127	34	cohort	cohort	NOUN
chd-99	127	35	.	.	PUNCT
chd-99	128	1	we	we	PRON
chd-99	128	2	also	also	ADV
chd-99	128	3	performed	perform	VERB
chd-99	128	4	data	datum	NOUN
chd-99	128	5	mining	mining	NOUN
chd-99	128	6	in	in	ADP
chd-99	128	7	oncomine	oncomine	NOUN
chd-99	128	8	for	for	ADP
chd-99	128	9	breast	breast	NOUN
chd-99	128	10	cancer	cancer	NOUN
chd-99	128	11	using	use	VERB
chd-99	128	12	trpm3	trpm3	PROPN
chd-99	128	13	as	as	ADP
chd-99	128	14	a	a	DET
chd-99	128	15	surrogate	surrogate	ADJ
chd-99	128	16	marker	marker	NOUN
chd-99	128	17	for	for	ADP
chd-99	128	18	mir-204	mir-204	NOUN
chd-99	128	19	,	,	PUNCT
chd-99	128	20	as	as	SCONJ
chd-99	128	21	(	(	PUNCT
chd-99	128	22	1	1	X
chd-99	128	23	)	)	PUNCT
chd-99	128	24	mir-204	mir-204	NOUN
chd-99	128	25	is	be	AUX
chd-99	128	26	encoded	encode	VERB
chd-99	128	27	in	in	ADP
chd-99	128	28	the	the	DET
chd-99	128	29	sixth	sixth	ADJ
chd-99	128	30	intron	intron	NOUN
chd-99	128	31	of	of	ADP
chd-99	128	32	trpm3	trpm3	PROPN
chd-99	128	33	,	,	PUNCT
chd-99	128	34	(	(	PUNCT
chd-99	128	35	2	2	X
chd-99	128	36	)	)	PUNCT
chd-99	128	37	the	the	DET
chd-99	128	38	expression	expression	NOUN
chd-99	128	39	of	of	ADP
chd-99	128	40	both	both	DET
chd-99	128	41	genes	gene	NOUN
chd-99	128	42	is	be	AUX
chd-99	128	43	driven	drive	VERB
chd-99	128	44	by	by	ADP
chd-99	128	45	the	the	DET
chd-99	128	46	same	same	ADJ
chd-99	128	47	promoter	promoter	NOUN
chd-99	128	48	,	,	PUNCT
chd-99	128	49	and	and	CCONJ
chd-99	128	50	(	(	PUNCT
chd-99	128	51	3	3	X
chd-99	128	52	)	)	PUNCT
chd-99	128	53	the	the	DET
chd-99	128	54	expression	expression	NOUN
chd-99	128	55	of	of	ADP
chd-99	128	56	both	both	DET
chd-99	128	57	genes	gene	NOUN
chd-99	128	58	is	be	AUX
chd-99	128	59	positively	positively	ADV
chd-99	128	60	correlated	correlate	VERB
chd-99	128	61	both	both	CCONJ
chd-99	128	62	in	in	ADP
chd-99	128	63	vitro	vitro	X
chd-99	128	64	(	(	PUNCT
chd-99	128	65	courboulin	courboulin	PROPN
chd-99	128	66	et	et	PROPN
chd-99	128	67	al	al	PROPN
chd-99	128	68	.	.	PROPN
chd-99	128	69	,	,	PUNCT
chd-99	128	70	2011	2011	NUM
chd-99	128	71	;	;	PUNCT
chd-99	129	1	ying	ying	PROPN
chd-99	129	2	et	et	PROPN
chd-99	129	3	al	al	PROPN
chd-99	129	4	.	.	PROPN
chd-99	129	5	,	,	PUNCT
chd-99	129	6	2013	2013	NUM
chd-99	129	7	)	)	PUNCT
chd-99	129	8	and	and	CCONJ
chd-99	129	9	in	in	ADP
chd-99	129	10	vivo	vivo	NOUN
chd-99	129	11	(	(	PUNCT
chd-99	129	12	ding	ding	NOUN
chd-99	129	13	et	et	PROPN
chd-99	129	14	al	al	PROPN
chd-99	129	15	.	.	PROPN
chd-99	129	16	,	,	PUNCT
chd-99	129	17	2015	2015	NUM
chd-99	129	18	)	)	PUNCT
chd-99	129	19	.	.	PUNCT
chd-99	130	1	we	we	PRON
chd-99	130	2	found	find	VERB
chd-99	130	3	that	that	SCONJ
chd-99	130	4	in	in	ADP
chd-99	130	5	this	this	DET
chd-99	130	6	dataset	dataset	NOUN
chd-99	130	7	that	that	PRON
chd-99	130	8	could	could	AUX
chd-99	130	9	be	be	AUX
chd-99	130	10	examined	examine	VERB
chd-99	130	11	by	by	ADP
chd-99	130	12	race	race	NOUN
chd-99	130	13	,	,	PUNCT
chd-99	130	14	trpm3	trpm3	ADJ
chd-99	130	15	levels	level	NOUN
chd-99	130	16	were	be	AUX
chd-99	130	17	higher	high	ADJ
chd-99	130	18	in	in	ADP
chd-99	130	19	aa	aa	ADJ
chd-99	130	20	women	woman	NOUN
chd-99	130	21	when	when	SCONJ
chd-99	130	22	compared	compare	VERB
chd-99	130	23	to	to	ADP
chd-99	130	24	ca	can	AUX
chd-99	130	25	women	woman	NOUN
chd-99	130	26	with	with	ADP
chd-99	130	27	breast	breast	NOUN
chd-99	130	28	cancer	cancer	NOUN
chd-99	130	29	.	.	PUNCT
chd-99	131	1	of	of	ADP
chd-99	131	2	interest	interest	NOUN
chd-99	131	3	,	,	PUNCT
chd-99	131	4	this	this	DET
chd-99	131	5	dataset	dataset	NOUN
chd-99	131	6	showed	show	VERB
chd-99	131	7	strikingly	strikingly	ADV
chd-99	131	8	decreased	decrease	VERB
chd-99	131	9	levels	level	NOUN
chd-99	131	10	of	of	ADP
chd-99	131	11	trpm3	trpm3	NOUN
chd-99	131	12	in	in	ADP
chd-99	131	13	women	woman	NOUN
chd-99	131	14	of	of	ADP
chd-99	131	15	asian	asian	ADJ
chd-99	131	16	descent	descent	NOUN
chd-99	131	17	(	(	PUNCT
chd-99	131	18	figure	figure	NOUN
chd-99	131	19	2c	2c	NUM
chd-99	131	20	)	)	PUNCT
chd-99	131	21	.	.	PUNCT
chd-99	132	1	igf2r	igf2r	PROPN
chd-99	132	2	is	be	AUX
chd-99	132	3	a	a	DET
chd-99	132	4	direct	direct	ADJ
chd-99	132	5	target	target	NOUN
chd-99	132	6	of	of	ADP
chd-99	132	7	mir-204	mir-204	NOUN
chd-99	132	8	in	in	ADP
chd-99	132	9	breast	breast	NOUN
chd-99	132	10	cancer	cancer	NOUN
chd-99	132	11	cells	cell	NOUN
chd-99	132	12	and	and	CCONJ
chd-99	132	13	tissue	tissue	NOUN
chd-99	132	14	to	to	PART
chd-99	132	15	validate	validate	VERB
chd-99	132	16	igf2r	igf2r	PROPN
chd-99	132	17	as	as	ADP
chd-99	132	18	a	a	DET
chd-99	132	19	mir-204	mir-204	NOUN
chd-99	132	20	target	target	NOUN
chd-99	132	21	in	in	ADP
chd-99	132	22	breast	breast	NOUN
chd-99	132	23	cancer	cancer	NOUN
chd-99	132	24	cell	cell	NOUN
chd-99	132	25	lines	line	NOUN
chd-99	132	26	,	,	PUNCT
chd-99	132	27	mir-204	mir-204	PROPN
chd-99	132	28	was	be	AUX
chd-99	132	29	overexpressed	overexpresse	VERB
chd-99	132	30	in	in	ADP
chd-99	132	31	mcf10a	mcf10a	NOUN
chd-99	132	32	and	and	CCONJ
chd-99	132	33	mcf12a	mcf12a	ADP
chd-99	132	34	cells	cell	NOUN
chd-99	132	35	by	by	ADP
chd-99	132	36	either	either	CCONJ
chd-99	132	37	transient	transient	ADJ
chd-99	132	38	or	or	CCONJ
chd-99	132	39	stable	stable	ADJ
chd-99	132	40	transfection	transfection	NOUN
chd-99	132	41	.	.	PUNCT
chd-99	133	1	in	in	ADP
chd-99	133	2	each	each	DET
chd-99	133	3	case	case	NOUN
chd-99	133	4	the	the	DET
chd-99	133	5	increased	increase	VERB
chd-99	133	6	expression	expression	NOUN
chd-99	133	7	of	of	ADP
chd-99	133	8	mir-204	mir-204	NOUN
chd-99	133	9	inhibited	inhibit	VERB
chd-99	133	10	endogenous	endogenous	ADJ
chd-99	133	11	igf2r	igf2r	PROPN
chd-99	133	12	expression	expression	NOUN
chd-99	133	13	(	(	PUNCT
chd-99	133	14	figure	figure	NOUN
chd-99	133	15	2d	2d	NOUN
chd-99	133	16	)	)	PUNCT
chd-99	133	17	.	.	PUNCT
chd-99	134	1	mrna	mrna	PROPN
chd-99	134	2	levels	level	NOUN
chd-99	134	3	of	of	ADP
chd-99	134	4	igf2r	igf2r	PROPN
chd-99	134	5	were	be	AUX
chd-99	134	6	assessed	assess	VERB
chd-99	134	7	by	by	ADP
chd-99	134	8	qpcr	qpcr	ADV
chd-99	134	9	and	and	CCONJ
chd-99	134	10	analysis	analysis	NOUN
chd-99	134	11	indicated	indicate	VERB
chd-99	134	12	that	that	SCONJ
chd-99	134	13	the	the	DET
chd-99	134	14	levels	level	NOUN
chd-99	134	15	of	of	ADP
chd-99	134	16	igf2r	igf2r	PROPN
chd-99	134	17	mrna	mrna	PROPN
chd-99	134	18	did	do	AUX
chd-99	134	19	not	not	PART
chd-99	134	20	decrease	decrease	VERB
chd-99	134	21	,	,	PUNCT
chd-99	134	22	which	which	PRON
chd-99	134	23	is	be	AUX
chd-99	134	24	what	what	PRON
chd-99	134	25	we	we	PRON
chd-99	134	26	would	would	AUX
chd-99	134	27	expect	expect	VERB
chd-99	134	28	if	if	SCONJ
chd-99	134	29	mir	mir	PROPN
chd-99	134	30	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	PROPN
chd-99	134	31	e8	e8	PROPN
chd-99	134	32	cancer	cancer	PROPN
chd-99	134	33	health	health	NOUN
chd-99	134	34	disparities	disparity	NOUN
chd-99	134	35	research	research	NOUN
chd-99	134	36	204	204	NUM
chd-99	134	37	was	be	AUX
chd-99	134	38	regulating	regulate	VERB
chd-99	134	39	igf2r	igf2r	VERB
chd-99	134	40	by	by	ADP
chd-99	134	41	transcriptional	transcriptional	ADJ
chd-99	134	42	degradation	degradation	NOUN
chd-99	134	43	.	.	PUNCT
chd-99	135	1	in	in	ADP
chd-99	135	2	some	some	DET
chd-99	135	3	cases	case	NOUN
chd-99	135	4	,	,	PUNCT
chd-99	135	5	we	we	PRON
chd-99	135	6	observed	observe	VERB
chd-99	135	7	an	an	DET
chd-99	135	8	increase	increase	NOUN
chd-99	135	9	in	in	ADP
chd-99	135	10	igf2r	igf2r	PROPN
chd-99	135	11	mrna	mrna	PROPN
chd-99	135	12	transcript	transcript	NOUN
chd-99	135	13	levels	level	NOUN
chd-99	135	14	,	,	PUNCT
chd-99	135	15	suggesting	suggest	VERB
chd-99	135	16	that	that	SCONJ
chd-99	135	17	mir-204	mir-204	NOUN
chd-99	135	18	regulates	regulate	VERB
chd-99	135	19	igf2r	igf2r	PROPN
chd-99	135	20	through	through	ADP
chd-99	135	21	translational	translational	ADJ
chd-99	135	22	repression	repression	NOUN
chd-99	135	23	(	(	PUNCT
chd-99	135	24	figure	figure	NOUN
chd-99	135	25	2e	2e	NUM
chd-99	135	26	)	)	PUNCT
chd-99	135	27	.	.	PUNCT
chd-99	136	1	mda	mda	PROPN
chd-99	136	2	-	-	PUNCT
chd-99	136	3	mb-231	mb-231	PROPN
chd-99	136	4	and	and	CCONJ
chd-99	136	5	bt549	bt549	PROPN
chd-99	136	6	cells	cell	NOUN
chd-99	136	7	,	,	PUNCT
chd-99	136	8	two	two	NUM
chd-99	136	9	invasive	invasive	ADJ
chd-99	136	10	breast	breast	NOUN
chd-99	136	11	cancer	cancer	NOUN
chd-99	136	12	cell	cell	NOUN
chd-99	136	13	lines	line	NOUN
chd-99	136	14	,	,	PUNCT
chd-99	136	15	were	be	AUX
chd-99	136	16	used	use	VERB
chd-99	136	17	as	as	ADP
chd-99	136	18	a	a	DET
chd-99	136	19	model	model	NOUN
chd-99	136	20	to	to	PART
chd-99	136	21	inhibit	inhibit	VERB
chd-99	136	22	mir-204	mir-204	NOUN
chd-99	136	23	expression	expression	NOUN
chd-99	136	24	.	.	PUNCT
chd-99	137	1	transfection	transfection	NOUN
chd-99	137	2	of	of	ADP
chd-99	137	3	antisense	antisense	NOUN
chd-99	137	4	oligoribonucleotides	oligoribonucleotide	NOUN
chd-99	137	5	(	(	PUNCT
chd-99	137	6	aso	aso	NOUN
chd-99	137	7	)	)	PUNCT
chd-99	137	8	targeted	target	VERB
chd-99	137	9	against	against	ADP
chd-99	137	10	mir204	mir204	PROPN
chd-99	137	11	(	(	PUNCT
chd-99	137	12	aso	aso	NOUN
chd-99	137	13	204	204	NUM
chd-99	137	14	)	)	PUNCT
chd-99	137	15	in	in	ADP
chd-99	137	16	mda	mda	PROPN
chd-99	137	17	-	-	PUNCT
chd-99	137	18	mb-231	mb-231	PROPN
chd-99	137	19	and	and	CCONJ
chd-99	137	20	bt549	bt549	PROPN
chd-99	137	21	cells	cell	NOUN
chd-99	137	22	resulted	result	VERB
chd-99	137	23	in	in	ADP
chd-99	137	24	an	an	DET
chd-99	137	25	increase	increase	NOUN
chd-99	137	26	in	in	ADP
chd-99	137	27	igf2r	igf2r	PROPN
chd-99	137	28	protein	protein	NOUN
chd-99	137	29	(	(	PUNCT
chd-99	137	30	figure	figure	NOUN
chd-99	137	31	2f	2f	NUM
chd-99	137	32	)	)	PUNCT
chd-99	137	33	and	and	CCONJ
chd-99	137	34	mrna	mrna	PROPN
chd-99	137	35	levels	level	NOUN
chd-99	137	36	(	(	PUNCT
chd-99	137	37	figure	figure	NOUN
chd-99	137	38	2	2	NUM
chd-99	137	39	g	g	NOUN
chd-99	137	40	)	)	PUNCT
chd-99	137	41	.	.	PUNCT
chd-99	138	1	figure	figure	NOUN
chd-99	138	2	2	2	NUM
chd-99	138	3	:	:	PUNCT
chd-99	138	4	mir-204	mir-204	NOUN
chd-99	138	5	directly	directly	ADV
chd-99	138	6	targets	target	VERB
chd-99	138	7	igf2r	igf2r	PUNCT
chd-99	138	8	and	and	CCONJ
chd-99	138	9	is	be	AUX
chd-99	138	10	racially	racially	ADV
chd-99	138	11	disparate	disparate	ADJ
chd-99	138	12	in	in	ADP
chd-99	138	13	breast	breast	NOUN
chd-99	138	14	cancer	cancer	NOUN
chd-99	138	15	.	.	PUNCT
chd-99	139	1	(	(	PUNCT
chd-99	139	2	a	a	X
chd-99	139	3	)	)	PUNCT
chd-99	139	4	upper	upper	ADJ
chd-99	139	5	panel	panel	NOUN
chd-99	139	6	:	:	PUNCT
chd-99	139	7	schematic	schematic	ADJ
chd-99	139	8	representation	representation	NOUN
chd-99	139	9	of	of	ADP
chd-99	139	10	the	the	DET
chd-99	139	11	binding	bind	VERB
chd-99	139	12	site	site	NOUN
chd-99	139	13	and	and	CCONJ
chd-99	139	14	complementary	complementary	ADJ
chd-99	139	15	seed	seed	NOUN
chd-99	139	16	sequence	sequence	NOUN
chd-99	139	17	(	(	PUNCT
chd-99	139	18	upper	upper	ADJ
chd-99	139	19	case	case	NOUN
chd-99	139	20	bold	bold	ADJ
chd-99	139	21	letters	letter	NOUN
chd-99	139	22	)	)	PUNCT
chd-99	139	23	of	of	ADP
chd-99	139	24	mir-204	mir-204	NOUN
chd-99	139	25	within	within	ADP
chd-99	139	26	the	the	DET
chd-99	139	27	3’utr	3’utr	NUM
chd-99	139	28	of	of	ADP
chd-99	139	29	igf2r	igf2r	PROPN
chd-99	139	30	.	.	PUNCT
chd-99	140	1	lower	low	ADJ
chd-99	140	2	panel	panel	NOUN
chd-99	140	3	:	:	PUNCT
chd-99	140	4	luciferase	luciferase	VERB
chd-99	140	5	activity	activity	NOUN
chd-99	140	6	of	of	ADP
chd-99	140	7	breast	breast	NOUN
chd-99	140	8	cells	cell	NOUN
chd-99	140	9	transiently	transiently	ADV
chd-99	140	10	cotransfected	cotransfecte	VERB
chd-99	140	11	with	with	ADP
chd-99	140	12	igf2r	igf2r	PROPN
chd-99	140	13	3’utr	3’utr	NUM
chd-99	140	14	(	(	PUNCT
chd-99	140	15	wt	wt	NOUN
chd-99	140	16	3’utr	3’utr	NUM
chd-99	140	17	)	)	PUNCT
chd-99	140	18	or	or	CCONJ
chd-99	140	19	mutated	mutate	VERB
chd-99	140	20	igf2r	igf2r	PROPN
chd-99	140	21	3’utr	3’utr	NUM
chd-99	140	22	(	(	PUNCT
chd-99	140	23	mut	mut	PROPN
chd-99	140	24	3’utr	3’utr	NUM
chd-99	140	25	)	)	PUNCT
chd-99	140	26	and	and	CCONJ
chd-99	140	27	mir-204	mir-204	NOUN
chd-99	140	28	(	(	PUNCT
chd-99	140	29	204	204	NUM
chd-99	140	30	)	)	PUNCT
chd-99	140	31	or	or	CCONJ
chd-99	140	32	ev	ev	X
chd-99	140	33	and	and	CCONJ
chd-99	140	34	renilla	renilla	NOUN
chd-99	140	35	as	as	ADP
chd-99	140	36	a	a	DET
chd-99	140	37	control	control	NOUN
chd-99	140	38	.	.	PUNCT
chd-99	141	1	(	(	PUNCT
chd-99	141	2	b	b	X
chd-99	141	3	)	)	PUNCT
chd-99	141	4	qpcr	qpcr	ADJ
chd-99	141	5	analysis	analysis	NOUN
chd-99	141	6	of	of	ADP
chd-99	141	7	mir-204	mir-204	NOUN
chd-99	141	8	expression	expression	NOUN
chd-99	141	9	in	in	ADP
chd-99	141	10	serum	serum	NOUN
chd-99	141	11	samples	sample	NOUN
chd-99	141	12	from	from	ADP
chd-99	141	13	(	(	PUNCT
chd-99	141	14	n=19	n=19	ADJ
chd-99	141	15	)	)	PUNCT
chd-99	141	16	african	african	ADJ
chd-99	141	17	american	american	PROPN
chd-99	141	18	(	(	PUNCT
chd-99	141	19	aa	aa	PROPN
chd-99	141	20	)	)	PUNCT
chd-99	141	21	and	and	CCONJ
chd-99	141	22	(	(	PUNCT
chd-99	141	23	n=17	n=17	PROPN
chd-99	141	24	)	)	PUNCT
chd-99	141	25	caucasian	caucasian	PROPN
chd-99	141	26	american	american	PROPN
chd-99	141	27	(	(	PUNCT
chd-99	141	28	ca	ca	NOUN
chd-99	141	29	)	)	PUNCT
chd-99	141	30	women	woman	NOUN
chd-99	141	31	with	with	ADP
chd-99	141	32	either	either	CCONJ
chd-99	141	33	low	low	ADJ
chd-99	141	34	grade	grade	NOUN
chd-99	141	35	(	(	PUNCT
chd-99	141	36	lg	lg	NOUN
chd-99	141	37	)	)	PUNCT
chd-99	141	38	or	or	CCONJ
chd-99	141	39	high	high	ADJ
chd-99	141	40	grade	grade	NOUN
chd-99	141	41	(	(	PUNCT
chd-99	141	42	hg	hg	NOUN
chd-99	141	43	)	)	PUNCT
chd-99	141	44	breast	breast	NOUN
chd-99	141	45	cancer	cancer	NOUN
chd-99	141	46	.	.	PUNCT
chd-99	142	1	(	(	PUNCT
chd-99	142	2	c	c	X
chd-99	142	3	)	)	PUNCT
chd-99	142	4	trpm3	trpm3	NOUN
chd-99	142	5	mrna	mrna	PROPN
chd-99	142	6	levels	level	NOUN
chd-99	142	7	in	in	ADP
chd-99	142	8	breast	breast	NOUN
chd-99	142	9	cancer	cancer	NOUN
chd-99	142	10	patients	patient	NOUN
chd-99	142	11	of	of	ADP
chd-99	142	12	asian	asian	ADJ
chd-99	142	13	,	,	PUNCT
chd-99	142	14	aa	aa	NOUN
chd-99	142	15	and	and	CCONJ
chd-99	142	16	ca	can	AUX
chd-99	142	17	race	race	NOUN
chd-99	142	18	/	/	SYM
chd-99	142	19	ethnicity	ethnicity	NOUN
chd-99	142	20	(	(	PUNCT
chd-99	142	21	bittner	bittner	PROPN
chd-99	142	22	data	datum	NOUN
chd-99	142	23	set	set	PROPN
chd-99	142	24	,	,	PUNCT
chd-99	142	25	oncomine	oncomine	NOUN
chd-99	142	26	;	;	PUNCT
chd-99	142	27	(	(	PUNCT
chd-99	142	28	rhodes	rhode	NOUN
chd-99	142	29	et	et	PROPN
chd-99	142	30	al	al	PROPN
chd-99	142	31	.	.	PROPN
chd-99	142	32	,	,	PUNCT
chd-99	142	33	2004	2004	NUM
chd-99	142	34	)	)	PUNCT
chd-99	142	35	)	)	PUNCT
chd-99	142	36	.	.	PUNCT
chd-99	143	1	western	western	ADJ
chd-99	143	2	blot	blot	NOUN
chd-99	143	3	(	(	PUNCT
chd-99	143	4	d	d	PROPN
chd-99	143	5	&	&	CCONJ
chd-99	143	6	f	f	PROPN
chd-99	143	7	)	)	PUNCT
chd-99	143	8	and	and	CCONJ
chd-99	143	9	qpcr	qpcr	ADV
chd-99	143	10	(	(	PUNCT
chd-99	143	11	e	e	NOUN
chd-99	143	12	&	&	CCONJ
chd-99	143	13	g	g	NOUN
chd-99	143	14	)	)	PUNCT
chd-99	143	15	analysis	analysis	NOUN
chd-99	143	16	of	of	ADP
chd-99	143	17	igf2r	igf2r	PROPN
chd-99	143	18	in	in	ADP
chd-99	143	19	breast	breast	NOUN
chd-99	143	20	cells	cell	NOUN
chd-99	143	21	either	either	CCONJ
chd-99	143	22	transiently	transiently	ADV
chd-99	143	23	transfected	transfecte	VERB
chd-99	143	24	with	with	ADP
chd-99	143	25	mir-204	mir-204	NOUN
chd-99	143	26	expression	expression	NOUN
chd-99	143	27	vector	vector	NOUN
chd-99	143	28	(	(	PUNCT
chd-99	143	29	mcf10a	mcf10a	ADJ
chd-99	143	30	)	)	PUNCT
chd-99	143	31	,	,	PUNCT
chd-99	143	32	or	or	CCONJ
chd-99	143	33	antisense	antisense	NOUN
chd-99	143	34	oligonucleotides	oligonucleotide	NOUN
chd-99	143	35	to	to	ADP
chd-99	143	36	mir-204	mir-204	PROPN
chd-99	143	37	(	(	PUNCT
chd-99	143	38	aso	aso	NOUN
chd-99	143	39	204	204	NUM
chd-99	143	40	;	;	PUNCT
chd-99	143	41	mda	mda	PROPN
chd-99	143	42	-	-	PUNCT
chd-99	143	43	mb-231	mb-231	PROPN
chd-99	143	44	&	&	CCONJ
chd-99	143	45	bt549	bt549	NOUN
chd-99	143	46	)	)	PUNCT
chd-99	143	47	or	or	CCONJ
chd-99	143	48	stably	stably	ADV
chd-99	143	49	transfected	transfecte	VERB
chd-99	143	50	with	with	ADP
chd-99	143	51	mir-204	mir-204	NOUN
chd-99	143	52	(	(	PUNCT
chd-99	143	53	204	204	NUM
chd-99	143	54	-	-	SYM
chd-99	143	55	1	1	NUM
chd-99	143	56	,	,	PUNCT
chd-99	143	57	204	204	NUM
chd-99	143	58	-	-	SYM
chd-99	143	59	2	2	NUM
chd-99	143	60	)	)	PUNCT
chd-99	143	61	or	or	CCONJ
chd-99	143	62	scrambled	scramble	VERB
chd-99	143	63	(	(	PUNCT
chd-99	143	64	scr	scr	NOUN
chd-99	143	65	)	)	PUNCT
chd-99	143	66	control	control	NOUN
chd-99	143	67	(	(	PUNCT
chd-99	143	68	mcf12a	mcf12a	NOUN
chd-99	143	69	)	)	PUNCT
chd-99	143	70	.	.	PUNCT
chd-99	144	1	*	*	PUNCT
chd-99	144	2	p	p	X
chd-99	144	3	<	<	X
chd-99	144	4	0.05	0.05	NUM
chd-99	144	5	to	to	PART
chd-99	144	6	examine	examine	VERB
chd-99	144	7	whether	whether	SCONJ
chd-99	144	8	mir-204	mir-204	NOUN
chd-99	144	9	regulates	regulate	VERB
chd-99	144	10	igf2r	igf2r	PROPN
chd-99	144	11	in	in	ADP
chd-99	144	12	vivo	vivo	NOUN
chd-99	144	13	,	,	PUNCT
chd-99	144	14	we	we	PRON
chd-99	144	15	generated	generate	VERB
chd-99	144	16	a	a	DET
chd-99	144	17	tet	tet	NOUN
chd-99	144	18	-	-	ADJ
chd-99	144	19	regulatable	regulatable	ADJ
chd-99	144	20	mir-204	mir-204	NOUN
chd-99	144	21	transgenic	transgenic	NOUN
chd-99	144	22	(	(	PUNCT
chd-99	144	23	mir-204	mir-204	NOUN
chd-99	144	24	tg	tg	PROPN
chd-99	144	25	)	)	PUNCT
chd-99	144	26	mouse	mouse	PROPN
chd-99	144	27	(	(	PUNCT
chd-99	144	28	see	see	VERB
chd-99	144	29	methods	method	NOUN
chd-99	144	30	)	)	PUNCT
chd-99	144	31	.	.	PUNCT
chd-99	145	1	six	six	NUM
chd-99	145	2	founder	founder	NOUN
chd-99	145	3	lines	line	NOUN
chd-99	145	4	were	be	AUX
chd-99	145	5	generated	generate	VERB
chd-99	145	6	and	and	CCONJ
chd-99	145	7	assessed	assess	VERB
chd-99	145	8	for	for	ADP
chd-99	145	9	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	145	10	e9	e9	PROPN
chd-99	145	11	cancer	cancer	NOUN
chd-99	145	12	health	health	NOUN
chd-99	145	13	disparities	disparity	NOUN
chd-99	145	14	research	research	NOUN
chd-99	145	15	germline	germline	NOUN
chd-99	145	16	transmission	transmission	NOUN
chd-99	145	17	of	of	ADP
chd-99	145	18	the	the	DET
chd-99	145	19	transgene	transgene	NOUN
chd-99	145	20	and	and	CCONJ
chd-99	145	21	leaky	leaky	ADJ
chd-99	145	22	expression	expression	NOUN
chd-99	145	23	of	of	ADP
chd-99	145	24	mir-204	mir-204	NOUN
chd-99	145	25	in	in	ADP
chd-99	145	26	the	the	DET
chd-99	145	27	absence	absence	NOUN
chd-99	145	28	of	of	ADP
chd-99	145	29	dox	dox	NOUN
chd-99	145	30	.	.	PUNCT
chd-99	146	1	we	we	PRON
chd-99	146	2	also	also	ADV
chd-99	146	3	assessed	assess	VERB
chd-99	146	4	inducible	inducible	ADJ
chd-99	146	5	expression	expression	NOUN
chd-99	146	6	of	of	ADP
chd-99	146	7	mir-204	mir-204	NOUN
chd-99	146	8	by	by	ADP
chd-99	146	9	breeding	breed	VERB
chd-99	146	10	the	the	DET
chd-99	146	11	mir-204	mir-204	NOUN
chd-99	146	12	tg	tg	PROPN
chd-99	146	13	founder	founder	NOUN
chd-99	146	14	mice	mouse	NOUN
chd-99	146	15	to	to	PART
chd-99	146	16	mouse	mouse	VERB
chd-99	146	17	mammary	mammary	ADJ
chd-99	146	18	tumor	tumor	NOUN
chd-99	146	19	virus	virus	NOUN
chd-99	146	20	(	(	PUNCT
chd-99	146	21	mmtv)-rtta	mmtv)-rtta	PROPN
chd-99	146	22	(	(	PUNCT
chd-99	146	23	mtb	mtb	NOUN
chd-99	146	24	)	)	PUNCT
chd-99	146	25	mice	mouse	NOUN
chd-99	146	26	that	that	PRON
chd-99	146	27	express	express	VERB
chd-99	146	28	the	the	DET
chd-99	146	29	reverse	reverse	ADJ
chd-99	146	30	tet	tet	NOUN
chd-99	146	31	transactivator	transactivator	PROPN
chd-99	146	32	(	(	PUNCT
chd-99	146	33	rtta	rtta	PROPN
chd-99	146	34	)	)	PUNCT
chd-99	146	35	in	in	ADP
chd-99	146	36	the	the	DET
chd-99	146	37	mammary	mammary	ADJ
chd-99	146	38	epithelium	epithelium	NOUN
chd-99	146	39	under	under	ADP
chd-99	146	40	the	the	DET
chd-99	146	41	control	control	NOUN
chd-99	146	42	of	of	ADP
chd-99	146	43	the	the	DET
chd-99	146	44	mouse	mouse	NOUN
chd-99	146	45	mmtv	mmtv	PROPN
chd-99	146	46	long	long	PROPN
chd-99	146	47	terminal	terminal	ADJ
chd-99	146	48	repeat	repeat	NOUN
chd-99	146	49	(	(	PUNCT
chd-99	146	50	figure	figure	NOUN
chd-99	146	51	3a	3a	NUM
chd-99	146	52	)	)	PUNCT
chd-99	146	53	(	(	PUNCT
chd-99	146	54	gunther	gunther	PROPN
chd-99	146	55	et	et	PROPN
chd-99	146	56	al	al	PROPN
chd-99	146	57	.	.	PROPN
chd-99	146	58	,	,	PUNCT
chd-99	146	59	2002	2002	NUM
chd-99	146	60	)	)	PUNCT
chd-99	146	61	.	.	PUNCT
chd-99	147	1	bigenic	bigenic	ADJ
chd-99	147	2	mice	mouse	NOUN
chd-99	147	3	were	be	AUX
chd-99	147	4	fed	feed	VERB
chd-99	147	5	mouse	mouse	NOUN
chd-99	147	6	chow	chow	NOUN
chd-99	147	7	containing	contain	VERB
chd-99	147	8	the	the	DET
chd-99	147	9	tet	tet	NOUN
chd-99	147	10	analog	analog	PROPN
chd-99	147	11	doxycycline	doxycycline	NOUN
chd-99	147	12	(	(	PUNCT
chd-99	147	13	dox	dox	NOUN
chd-99	147	14	)	)	PUNCT
chd-99	147	15	ad	ad	NOUN
chd-99	147	16	libitum	libitum	NOUN
chd-99	147	17	to	to	PART
chd-99	147	18	induce	induce	VERB
chd-99	147	19	transgene	transgene	ADJ
chd-99	147	20	expression	expression	NOUN
chd-99	147	21	.	.	PUNCT
chd-99	148	1	the	the	DET
chd-99	148	2	mice	mouse	NOUN
chd-99	148	3	were	be	AUX
chd-99	148	4	sacrificed	sacrifice	VERB
chd-99	148	5	,	,	PUNCT
chd-99	148	6	and	and	CCONJ
chd-99	148	7	the	the	DET
chd-99	148	8	mammary	mammary	ADJ
chd-99	148	9	glands	gland	NOUN
chd-99	148	10	were	be	AUX
chd-99	148	11	extracted	extract	VERB
chd-99	148	12	and	and	CCONJ
chd-99	148	13	either	either	CCONJ
chd-99	148	14	fresh	fresh	ADJ
chd-99	148	15	frozen	frozen	ADJ
chd-99	148	16	for	for	ADP
chd-99	148	17	rna	rna	NOUN
chd-99	148	18	extraction	extraction	NOUN
chd-99	148	19	or	or	CCONJ
chd-99	148	20	fixed	fix	VERB
chd-99	148	21	and	and	CCONJ
chd-99	148	22	embedded	embed	VERB
chd-99	148	23	for	for	ADP
chd-99	148	24	immunohistochemical	immunohistochemical	ADJ
chd-99	148	25	analysis	analysis	NOUN
chd-99	148	26	.	.	PUNCT
chd-99	149	1	qpcr	qpcr	ADV
chd-99	149	2	analysis	analysis	NOUN
chd-99	149	3	on	on	ADP
chd-99	149	4	rna	rna	NOUN
chd-99	149	5	from	from	ADP
chd-99	149	6	the	the	DET
chd-99	149	7	dox	dox	NOUN
chd-99	149	8	-	-	PUNCT
chd-99	149	9	fed	feed	VERB
chd-99	149	10	mice	mouse	NOUN
chd-99	149	11	(	(	PUNCT
chd-99	149	12	for	for	ADP
chd-99	149	13	7	7	NUM
chd-99	149	14	days	day	NOUN
chd-99	149	15	)	)	PUNCT
chd-99	149	16	showed	show	VERB
chd-99	149	17	that	that	SCONJ
chd-99	149	18	we	we	PRON
chd-99	149	19	achieved	achieve	VERB
chd-99	149	20	a	a	DET
chd-99	149	21	15	15	NUM
chd-99	149	22	30	30	NUM
chd-99	149	23	fold	fold	NOUN
chd-99	149	24	increase	increase	NOUN
chd-99	149	25	in	in	ADP
chd-99	149	26	expression	expression	NOUN
chd-99	149	27	of	of	ADP
chd-99	149	28	mir-204	mir-204	NOUN
chd-99	149	29	in	in	ADP
chd-99	149	30	the	the	DET
chd-99	149	31	mir-204	mir-204	NOUN
chd-99	149	32	tg	tg	PROPN
chd-99	149	33	mice	mouse	NOUN
chd-99	149	34	when	when	SCONJ
chd-99	149	35	compared	compare	VERB
chd-99	149	36	to	to	ADP
chd-99	149	37	the	the	DET
chd-99	149	38	control	control	NOUN
chd-99	149	39	non	non	ADJ
chd-99	149	40	transgenic	transgenic	NOUN
chd-99	149	41	(	(	PUNCT
chd-99	149	42	non	non	X
chd-99	149	43	tg	tg	ADJ
chd-99	149	44	)	)	PUNCT
chd-99	149	45	mice	mouse	NOUN
chd-99	149	46	(	(	PUNCT
chd-99	149	47	figure	figure	NOUN
chd-99	149	48	3b	3b	NUM
chd-99	149	49	)	)	PUNCT
chd-99	149	50	.	.	PUNCT
chd-99	150	1	we	we	PRON
chd-99	150	2	also	also	ADV
chd-99	150	3	examined	examine	VERB
chd-99	150	4	the	the	DET
chd-99	150	5	mammary	mammary	ADJ
chd-99	150	6	tissue	tissue	NOUN
chd-99	150	7	for	for	ADP
chd-99	150	8	igf2r	igf2r	PROPN
chd-99	150	9	expression	expression	NOUN
chd-99	150	10	and	and	CCONJ
chd-99	150	11	observed	observe	VERB
chd-99	150	12	a	a	DET
chd-99	150	13	significant	significant	ADJ
chd-99	150	14	decrease	decrease	NOUN
chd-99	150	15	in	in	ADP
chd-99	150	16	igf2r	igf2r	ADJ
chd-99	150	17	protein	protein	NOUN
chd-99	150	18	levels	level	NOUN
chd-99	150	19	in	in	ADP
chd-99	150	20	the	the	DET
chd-99	150	21	mir-204	mir-204	NOUN
chd-99	150	22	tg	tg	PROPN
chd-99	150	23	mice	mouse	NOUN
chd-99	150	24	when	when	SCONJ
chd-99	150	25	compared	compare	VERB
chd-99	150	26	to	to	ADP
chd-99	150	27	non	non	ADJ
chd-99	150	28	tg	tg	PROPN
chd-99	150	29	control	control	NOUN
chd-99	150	30	mice	mouse	NOUN
chd-99	150	31	(	(	PUNCT
chd-99	150	32	figure	figure	NOUN
chd-99	150	33	3c	3c	NUM
chd-99	150	34	)	)	PUNCT
chd-99	150	35	,	,	PUNCT
chd-99	150	36	suggesting	suggest	VERB
chd-99	150	37	that	that	SCONJ
chd-99	150	38	mir-204	mir-204	NOUN
chd-99	150	39	negatively	negatively	ADV
chd-99	150	40	regulates	regulate	VERB
chd-99	150	41	igf2r	igf2r	PROPN
chd-99	150	42	in	in	ADP
chd-99	150	43	vivo	vivo	NOUN
chd-99	150	44	.	.	PUNCT
chd-99	151	1	interestingly	interestingly	ADV
chd-99	151	2	,	,	PUNCT
chd-99	151	3	we	we	PRON
chd-99	151	4	observed	observe	VERB
chd-99	151	5	no	no	DET
chd-99	151	6	significant	significant	ADJ
chd-99	151	7	decrease	decrease	NOUN
chd-99	151	8	in	in	ADP
chd-99	151	9	igf2r	igf2r	PROPN
chd-99	151	10	mrna	mrna	PROPN
chd-99	151	11	levels	level	NOUN
chd-99	151	12	when	when	SCONJ
chd-99	151	13	mir-204	mir-204	PROPN
chd-99	151	14	was	be	AUX
chd-99	151	15	overexpressed	overexpresse	VERB
chd-99	151	16	in	in	ADP
chd-99	151	17	vivo	vivo	NOUN
chd-99	151	18	(	(	PUNCT
chd-99	151	19	figure	figure	NOUN
chd-99	151	20	3d	3d	NUM
chd-99	151	21	)	)	PUNCT
chd-99	151	22	,	,	PUNCT
chd-99	151	23	suggesting	suggest	VERB
chd-99	151	24	that	that	SCONJ
chd-99	151	25	mir-204	mir-204	NOUN
chd-99	151	26	regulates	regulate	VERB
chd-99	151	27	igf2r	igf2r	PROPN
chd-99	151	28	by	by	ADP
chd-99	151	29	translational	translational	ADJ
chd-99	151	30	repression	repression	NOUN
chd-99	151	31	,	,	PUNCT
chd-99	151	32	similar	similar	ADJ
chd-99	151	33	to	to	ADP
chd-99	151	34	that	that	PRON
chd-99	151	35	observed	observe	VERB
chd-99	151	36	in	in	ADP
chd-99	151	37	vitro	vitro	X
chd-99	151	38	.	.	PUNCT
chd-99	152	1	mir-204	mir-204	NOUN
chd-99	152	2	transgene	transgene	ADJ
chd-99	152	3	expression	expression	NOUN
chd-99	152	4	in	in	ADP
chd-99	152	5	the	the	DET
chd-99	152	6	mammary	mammary	ADJ
chd-99	152	7	epithelium	epithelium	NOUN
chd-99	152	8	of	of	ADP
chd-99	152	9	mmtv	mmtv	NOUN
chd-99	152	10	-	-	PUNCT
chd-99	152	11	neu	neu	NOUN
chd-99	152	12	mice	mice	NOUN
chd-99	152	13	increases	increase	VERB
chd-99	152	14	tumor	tumor	NOUN
chd-99	152	15	growth	growth	NOUN
chd-99	152	16	and	and	CCONJ
chd-99	152	17	metastasis	metastasis	NOUN
chd-99	152	18	to	to	PART
chd-99	152	19	examine	examine	VERB
chd-99	152	20	the	the	DET
chd-99	152	21	effects	effect	NOUN
chd-99	152	22	of	of	ADP
chd-99	152	23	mir-204	mir-204	NOUN
chd-99	152	24	overexpression	overexpression	NOUN
chd-99	152	25	on	on	ADP
chd-99	152	26	mammary	mammary	ADJ
chd-99	152	27	tumor	tumor	NOUN
chd-99	152	28	growth	growth	NOUN
chd-99	152	29	,	,	PUNCT
chd-99	152	30	mir-204	mir-204	NOUN
chd-99	152	31	tg	tg	PROPN
chd-99	152	32	mice	mouse	NOUN
chd-99	152	33	were	be	AUX
chd-99	152	34	bred	breed	VERB
chd-99	152	35	to	to	ADP
chd-99	152	36	the	the	DET
chd-99	152	37	mmtv	mmtv	NOUN
chd-99	152	38	-	-	PUNCT
chd-99	152	39	neu	neu	NOUN
chd-99	152	40	mice	mouse	NOUN
chd-99	152	41	(	(	PUNCT
chd-99	152	42	see	see	VERB
chd-99	152	43	methods	method	NOUN
chd-99	152	44	)	)	PUNCT
chd-99	152	45	.	.	PUNCT
chd-99	153	1	this	this	DET
chd-99	153	2	model	model	NOUN
chd-99	153	3	was	be	AUX
chd-99	153	4	chosen	choose	VERB
chd-99	153	5	since	since	SCONJ
chd-99	153	6	we	we	PRON
chd-99	153	7	have	have	AUX
chd-99	153	8	observed	observe	VERB
chd-99	153	9	a	a	DET
chd-99	153	10	significant	significant	ADJ
chd-99	153	11	increase	increase	NOUN
chd-99	153	12	in	in	ADP
chd-99	153	13	the	the	DET
chd-99	153	14	expression	expression	NOUN
chd-99	153	15	levels	level	NOUN
chd-99	153	16	of	of	ADP
chd-99	153	17	mir204	mir204	PROPN
chd-99	153	18	in	in	ADP
chd-99	153	19	tumors	tumor	NOUN
chd-99	153	20	derived	derive	VERB
chd-99	153	21	from	from	ADP
chd-99	153	22	these	these	DET
chd-99	153	23	mice	mouse	NOUN
chd-99	153	24	when	when	SCONJ
chd-99	153	25	compared	compare	VERB
chd-99	153	26	to	to	ADP
chd-99	153	27	mammary	mammary	ADJ
chd-99	153	28	tissue	tissue	NOUN
chd-99	153	29	from	from	ADP
chd-99	153	30	normal	normal	ADJ
chd-99	153	31	‘	'	PUNCT
chd-99	153	32	nontumor	nontumor	ADJ
chd-99	153	33	’	'	PUNCT
chd-99	153	34	mice	mouse	NOUN
chd-99	153	35	(	(	PUNCT
chd-99	153	36	supplemental	supplemental	ADJ
chd-99	153	37	figure	figure	NOUN
chd-99	153	38	1c	1c	NOUN
chd-99	153	39	)	)	PUNCT
chd-99	153	40	.	.	PUNCT
chd-99	154	1	mice	mouse	NOUN
chd-99	154	2	were	be	AUX
chd-99	154	3	fed	feed	VERB
chd-99	154	4	dox	dox	NOUN
chd-99	154	5	chow	chow	PROPN
chd-99	154	6	from	from	ADP
chd-99	154	7	3	3	NUM
chd-99	154	8	weeks	week	NOUN
chd-99	154	9	of	of	ADP
chd-99	154	10	age	age	NOUN
chd-99	154	11	to	to	PART
chd-99	154	12	induce	induce	VERB
chd-99	154	13	transgene	transgene	ADJ
chd-99	154	14	expression	expression	NOUN
chd-99	154	15	in	in	ADP
chd-99	154	16	the	the	DET
chd-99	154	17	trigenic	trigenic	ADJ
chd-99	154	18	mice	mouse	NOUN
chd-99	154	19	and	and	CCONJ
chd-99	154	20	to	to	PART
chd-99	154	21	control	control	VERB
chd-99	154	22	for	for	ADP
chd-99	154	23	any	any	DET
chd-99	154	24	effects	effect	NOUN
chd-99	154	25	of	of	ADP
chd-99	154	26	dox	dox	NOUN
chd-99	154	27	on	on	ADP
chd-99	154	28	mammary	mammary	ADJ
chd-99	154	29	tumorigenesis	tumorigenesis	NOUN
chd-99	154	30	and	and	CCONJ
chd-99	154	31	progression	progression	NOUN
chd-99	154	32	in	in	ADP
chd-99	154	33	the	the	DET
chd-99	154	34	bigenic	bigenic	ADJ
chd-99	154	35	control	control	NOUN
chd-99	154	36	groups	group	NOUN
chd-99	154	37	.	.	PUNCT
chd-99	155	1	mice	mouse	NOUN
chd-99	155	2	were	be	AUX
chd-99	155	3	palpated	palpate	VERB
chd-99	155	4	weekly	weekly	ADV
chd-99	155	5	at	at	ADP
chd-99	155	6	5	5	NUM
chd-99	155	7	months	month	NOUN
chd-99	155	8	of	of	ADP
chd-99	155	9	age	age	NOUN
chd-99	155	10	to	to	PART
chd-99	155	11	detect	detect	VERB
chd-99	155	12	tumors	tumor	NOUN
chd-99	155	13	,	,	PUNCT
chd-99	155	14	and	and	CCONJ
chd-99	155	15	the	the	DET
chd-99	155	16	age	age	NOUN
chd-99	155	17	of	of	ADP
chd-99	155	18	onset	onset	NOUN
chd-99	155	19	and	and	CCONJ
chd-99	155	20	location	location	NOUN
chd-99	155	21	of	of	ADP
chd-99	155	22	the	the	DET
chd-99	155	23	tumor	tumor	NOUN
chd-99	155	24	were	be	AUX
chd-99	155	25	recorded	record	VERB
chd-99	155	26	.	.	PUNCT
chd-99	156	1	we	we	PRON
chd-99	156	2	found	find	VERB
chd-99	156	3	that	that	SCONJ
chd-99	156	4	mir-204	mir-204	NOUN
chd-99	156	5	overexpression	overexpression	NOUN
chd-99	156	6	did	do	AUX
chd-99	156	7	not	not	PART
chd-99	156	8	affect	affect	VERB
chd-99	156	9	tumor	tumor	NOUN
chd-99	156	10	latency	latency	NOUN
chd-99	156	11	(	(	PUNCT
chd-99	156	12	supplemental	supplemental	ADJ
chd-99	156	13	figure	figure	NOUN
chd-99	156	14	2a	2a	NUM
chd-99	156	15	)	)	PUNCT
chd-99	156	16	.	.	PUNCT
chd-99	157	1	the	the	DET
chd-99	157	2	median	median	ADJ
chd-99	157	3	time	time	NOUN
chd-99	157	4	to	to	PART
chd-99	157	5	tumor	tumor	NOUN
chd-99	157	6	onset	onset	NOUN
chd-99	157	7	for	for	ADP
chd-99	157	8	non	non	ADJ
chd-99	157	9	tg	tg	PROPN
chd-99	157	10	mice	mouse	NOUN
chd-99	157	11	was	be	AUX
chd-99	157	12	37.5	37.5	NUM
chd-99	157	13	weeks	week	NOUN
chd-99	157	14	(	(	PUNCT
chd-99	157	15	95	95	NUM
chd-99	157	16	%	%	NOUN
chd-99	157	17	ci	ci	NOUN
chd-99	157	18	:	:	PUNCT
chd-99	157	19	35,47	35,47	NUM
chd-99	157	20	)	)	PUNCT
chd-99	157	21	and	and	CCONJ
chd-99	157	22	for	for	ADP
chd-99	157	23	mir-204	mir-204	NOUN
chd-99	157	24	tg	tg	PROPN
chd-99	157	25	mice	mouse	NOUN
chd-99	157	26	was	be	AUX
chd-99	157	27	39.0	39.0	NUM
chd-99	157	28	weeks	week	NOUN
chd-99	157	29	(	(	PUNCT
chd-99	157	30	95	95	NUM
chd-99	157	31	%	%	NOUN
chd-99	157	32	ci	ci	NOUN
chd-99	157	33	:	:	PUNCT
chd-99	157	34	35,inf	35,inf	NUM
chd-99	157	35	)	)	PUNCT
chd-99	157	36	as	as	SCONJ
chd-99	157	37	determined	determine	VERB
chd-99	157	38	by	by	ADP
chd-99	157	39	kaplan	kaplan	PROPN
chd-99	157	40	-	-	PUNCT
chd-99	157	41	meier	meier	PROPN
chd-99	157	42	analysis	analysis	NOUN
chd-99	157	43	(	(	PUNCT
chd-99	157	44	p=0.55	p=0.55	NOUN
chd-99	157	45	)	)	PUNCT
chd-99	157	46	.	.	PUNCT
chd-99	158	1	however	however	ADV
chd-99	158	2	,	,	PUNCT
chd-99	158	3	once	once	SCONJ
chd-99	158	4	tumors	tumor	NOUN
chd-99	158	5	formed	form	VERB
chd-99	158	6	(	(	PUNCT
chd-99	158	7	tumor	tumor	NOUN
chd-99	158	8	onset	onset	NOUN
chd-99	158	9	)	)	PUNCT
chd-99	158	10	,	,	PUNCT
chd-99	158	11	time	time	NOUN
chd-99	158	12	to	to	PART
chd-99	158	13	sacrifice	sacrifice	VERB
chd-99	158	14	was	be	AUX
chd-99	158	15	shorter	short	ADJ
chd-99	158	16	in	in	ADP
chd-99	158	17	the	the	DET
chd-99	158	18	mir-204	mir-204	NOUN
chd-99	158	19	tg	tg	PROPN
chd-99	158	20	mice	mouse	NOUN
chd-99	158	21	(	(	PUNCT
chd-99	158	22	2.0	2.0	NUM
chd-99	158	23	weeks	week	NOUN
chd-99	158	24	(	(	PUNCT
chd-99	158	25	95%ci	95%ci	NUM
chd-99	158	26	:	:	PUNCT
chd-99	158	27	2	2	NUM
chd-99	158	28	,	,	PUNCT
chd-99	158	29	inf	inf	NOUN
chd-99	158	30	)	)	PUNCT
chd-99	158	31	)	)	PUNCT
chd-99	158	32	than	than	ADP
chd-99	158	33	in	in	ADP
chd-99	158	34	the	the	DET
chd-99	158	35	non	non	ADJ
chd-99	159	1	tg	tg	PROPN
chd-99	159	2	mice	mouse	NOUN
chd-99	159	3	(	(	PUNCT
chd-99	159	4	5.5	5.5	NUM
chd-99	159	5	weeks	week	NOUN
chd-99	159	6	(	(	PUNCT
chd-99	159	7	95	95	NUM
chd-99	159	8	%	%	NOUN
chd-99	159	9	ci	ci	NOUN
chd-99	159	10	:	:	PUNCT
chd-99	159	11	4	4	NUM
chd-99	159	12	,	,	PUNCT
chd-99	159	13	inf	inf	NOUN
chd-99	159	14	)	)	PUNCT
chd-99	159	15	)	)	PUNCT
chd-99	159	16	(	(	PUNCT
chd-99	159	17	p=0.02	p=0.02	NOUN
chd-99	159	18	)	)	PUNCT
chd-99	159	19	(	(	PUNCT
chd-99	159	20	figure	figure	NOUN
chd-99	159	21	3e	3e	NOUN
chd-99	159	22	)	)	PUNCT
chd-99	159	23	.	.	PUNCT
chd-99	160	1	there	there	PRON
chd-99	160	2	was	be	VERB
chd-99	160	3	no	no	DET
chd-99	160	4	statistical	statistical	ADJ
chd-99	160	5	difference	difference	NOUN
chd-99	160	6	in	in	ADP
chd-99	160	7	either	either	PRON
chd-99	160	8	multiplicity	multiplicity	NOUN
chd-99	160	9	or	or	CCONJ
chd-99	160	10	tumor	tumor	NOUN
chd-99	160	11	location	location	NOUN
chd-99	160	12	between	between	ADP
chd-99	160	13	the	the	DET
chd-99	160	14	groups	group	NOUN
chd-99	160	15	(	(	PUNCT
chd-99	160	16	supplemental	supplemental	ADJ
chd-99	160	17	figure	figure	NOUN
chd-99	160	18	2b	2b	NOUN
chd-99	160	19	)	)	PUNCT
chd-99	160	20	.	.	PUNCT
chd-99	161	1	histological	histological	ADJ
chd-99	161	2	examination	examination	NOUN
chd-99	161	3	of	of	ADP
chd-99	161	4	the	the	DET
chd-99	161	5	tumors	tumor	NOUN
chd-99	161	6	revealed	reveal	VERB
chd-99	161	7	differences	difference	NOUN
chd-99	161	8	between	between	ADP
chd-99	161	9	the	the	DET
chd-99	161	10	non	non	ADJ
chd-99	161	11	tg	tg	PROPN
chd-99	161	12	and	and	CCONJ
chd-99	161	13	mir-204	mir-204	NOUN
chd-99	161	14	tg	tg	PROPN
chd-99	161	15	mice	mouse	NOUN
chd-99	161	16	(	(	PUNCT
chd-99	161	17	figure	figure	NOUN
chd-99	161	18	3f	3f	PROPN
chd-99	161	19	)	)	PUNCT
chd-99	161	20	.	.	PUNCT
chd-99	162	1	tumors	tumor	NOUN
chd-99	162	2	from	from	ADP
chd-99	162	3	mir-204	mir-204	PROPN
chd-99	162	4	tg	tg	PROPN
chd-99	162	5	mice	mouse	NOUN
chd-99	162	6	displayed	display	VERB
chd-99	162	7	cells	cell	NOUN
chd-99	162	8	arranged	arrange	VERB
chd-99	162	9	in	in	ADP
chd-99	162	10	nests	nest	NOUN
chd-99	162	11	and	and	CCONJ
chd-99	162	12	packets	packet	NOUN
chd-99	162	13	with	with	ADP
chd-99	162	14	increased	increase	VERB
chd-99	162	15	numbers	number	NOUN
chd-99	162	16	of	of	ADP
chd-99	162	17	pseudo	pseudo	NOUN
chd-99	162	18	-	-	PUNCT
chd-99	162	19	rosettes	rosette	NOUN
chd-99	162	20	surrounding	surround	VERB
chd-99	162	21	blood	blood	NOUN
chd-99	162	22	vessels	vessel	NOUN
chd-99	162	23	.	.	PUNCT
chd-99	163	1	these	these	DET
chd-99	163	2	tumors	tumor	NOUN
chd-99	163	3	also	also	ADV
chd-99	163	4	displayed	display	VERB
chd-99	163	5	more	more	ADV
chd-99	163	6	abundant	abundant	ADJ
chd-99	163	7	vasculature	vasculature	NOUN
chd-99	163	8	,	,	PUNCT
chd-99	163	9	and	and	CCONJ
chd-99	163	10	peripherally	peripherally	ADV
chd-99	163	11	,	,	PUNCT
chd-99	163	12	the	the	DET
chd-99	163	13	cells	cell	NOUN
chd-99	163	14	appeared	appear	VERB
chd-99	163	15	more	more	ADV
chd-99	163	16	spindloid	spindloid	ADJ
chd-99	163	17	in	in	ADP
chd-99	163	18	shape	shape	NOUN
chd-99	163	19	with	with	ADP
chd-99	163	20	looser	loose	ADJ
chd-99	163	21	arrangement	arrangement	NOUN
chd-99	163	22	of	of	ADP
chd-99	163	23	cells	cell	NOUN
chd-99	163	24	centrally	centrally	ADV
chd-99	163	25	.	.	PUNCT
chd-99	164	1	altogether	altogether	ADV
chd-99	164	2	,	,	PUNCT
chd-99	164	3	these	these	DET
chd-99	164	4	changes	change	NOUN
chd-99	164	5	in	in	ADP
chd-99	164	6	the	the	DET
chd-99	164	7	mir-204	mir-204	NOUN
chd-99	164	8	tg	tg	PROPN
chd-99	164	9	derived	derive	VERB
chd-99	164	10	tumors	tumor	NOUN
chd-99	164	11	are	be	AUX
chd-99	164	12	consistent	consistent	ADJ
chd-99	164	13	with	with	ADP
chd-99	164	14	neuroendocrine	neuroendocrine	ADJ
chd-99	164	15	differentiation	differentiation	NOUN
chd-99	164	16	.	.	PUNCT
chd-99	165	1	the	the	DET
chd-99	165	2	tumors	tumor	NOUN
chd-99	165	3	from	from	ADP
chd-99	165	4	the	the	DET
chd-99	165	5	non	non	ADJ
chd-99	165	6	tg	tg	PROPN
chd-99	165	7	derived	derive	VERB
chd-99	165	8	mice	mouse	NOUN
chd-99	165	9	are	be	AUX
chd-99	165	10	arranged	arrange	VERB
chd-99	165	11	in	in	ADP
chd-99	165	12	solid	solid	ADJ
chd-99	165	13	sheets	sheet	NOUN
chd-99	165	14	.	.	PUNCT
chd-99	166	1	few	few	ADJ
chd-99	166	2	mitoses	mitose	NOUN
chd-99	166	3	are	be	AUX
chd-99	166	4	present	present	ADJ
chd-99	166	5	,	,	PUNCT
chd-99	166	6	and	and	CCONJ
chd-99	166	7	most	most	ADJ
chd-99	166	8	cells	cell	NOUN
chd-99	166	9	are	be	AUX
chd-99	166	10	monomorphic	monomorphic	ADJ
chd-99	166	11	with	with	ADP
chd-99	166	12	no	no	DET
chd-99	166	13	evidence	evidence	NOUN
chd-99	166	14	of	of	ADP
chd-99	166	15	differentiation	differentiation	NOUN
chd-99	166	16	.	.	PUNCT
chd-99	167	1	a	a	DET
chd-99	167	2	few	few	ADJ
chd-99	167	3	apoptotic	apoptotic	ADJ
chd-99	167	4	cells	cell	NOUN
chd-99	167	5	were	be	AUX
chd-99	167	6	observed	observe	VERB
chd-99	167	7	scattered	scatter	VERB
chd-99	167	8	throughout	throughout	ADP
chd-99	167	9	the	the	DET
chd-99	167	10	tumors	tumor	NOUN
chd-99	167	11	.	.	PUNCT
chd-99	168	1	no	no	DET
chd-99	168	2	major	major	ADJ
chd-99	168	3	differences	difference	NOUN
chd-99	168	4	were	be	AUX
chd-99	168	5	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	168	6	e10	e10	NUM
chd-99	168	7	cancer	cancer	NOUN
chd-99	168	8	health	health	NOUN
chd-99	168	9	disparities	disparity	NOUN
chd-99	168	10	research	research	NOUN
chd-99	168	11	observed	observe	VERB
chd-99	168	12	in	in	ADP
chd-99	168	13	mir-204	mir-204	NOUN
chd-99	168	14	expression	expression	NOUN
chd-99	168	15	between	between	ADP
chd-99	168	16	the	the	DET
chd-99	168	17	non	non	ADJ
chd-99	168	18	tg	tg	PROPN
chd-99	168	19	and	and	CCONJ
chd-99	168	20	204	204	NUM
chd-99	168	21	tg	tg	PROPN
chd-99	168	22	tumors	tumor	NOUN
chd-99	168	23	as	as	SCONJ
chd-99	168	24	expected	expect	VERB
chd-99	168	25	at	at	ADP
chd-99	168	26	the	the	DET
chd-99	168	27	endpoint	endpoint	NOUN
chd-99	168	28	of	of	ADP
chd-99	168	29	analysis	analysis	NOUN
chd-99	168	30	,	,	PUNCT
chd-99	168	31	as	as	SCONJ
chd-99	168	32	we	we	PRON
chd-99	168	33	have	have	AUX
chd-99	168	34	previously	previously	ADV
chd-99	168	35	described	describe	VERB
chd-99	168	36	that	that	SCONJ
chd-99	168	37	this	this	DET
chd-99	168	38	model	model	NOUN
chd-99	168	39	increases	increase	VERB
chd-99	168	40	expression	expression	NOUN
chd-99	168	41	of	of	ADP
chd-99	168	42	mir-204	mir-204	NOUN
chd-99	168	43	during	during	ADP
chd-99	168	44	tumorigenesis	tumorigenesis	NOUN
chd-99	168	45	.	.	PUNCT
chd-99	169	1	as	as	SCONJ
chd-99	169	2	the	the	DET
chd-99	169	3	tumors	tumor	NOUN
chd-99	169	4	displayed	display	VERB
chd-99	169	5	a	a	DET
chd-99	169	6	more	more	ADV
chd-99	169	7	aggressive	aggressive	ADJ
chd-99	169	8	phenotype	phenotype	NOUN
chd-99	169	9	once	once	ADV
chd-99	169	10	formed	form	VERB
chd-99	169	11	,	,	PUNCT
chd-99	169	12	we	we	PRON
chd-99	169	13	assessed	assess	VERB
chd-99	169	14	proliferation	proliferation	NOUN
chd-99	169	15	by	by	ADP
chd-99	169	16	immunostaining	immunostaine	VERB
chd-99	169	17	with	with	ADP
chd-99	169	18	ki67	ki67	PROPN
chd-99	169	19	(	(	PUNCT
chd-99	169	20	figure	figure	NOUN
chd-99	169	21	3f	3f	PROPN
chd-99	169	22	)	)	PUNCT
chd-99	169	23	.	.	PUNCT
chd-99	170	1	although	although	SCONJ
chd-99	170	2	we	we	PRON
chd-99	170	3	observed	observe	VERB
chd-99	170	4	a	a	DET
chd-99	170	5	trend	trend	NOUN
chd-99	170	6	towards	towards	ADP
chd-99	170	7	an	an	DET
chd-99	170	8	increase	increase	NOUN
chd-99	170	9	in	in	ADP
chd-99	170	10	the	the	DET
chd-99	170	11	mir-204	mir-204	NOUN
chd-99	170	12	tg	tg	PROPN
chd-99	170	13	tumors	tumor	NOUN
chd-99	170	14	,	,	PUNCT
chd-99	170	15	quantitative	quantitative	ADJ
chd-99	170	16	analysis	analysis	NOUN
chd-99	170	17	showed	show	VERB
chd-99	170	18	that	that	SCONJ
chd-99	170	19	the	the	DET
chd-99	170	20	observed	observed	ADJ
chd-99	170	21	increase	increase	NOUN
chd-99	170	22	did	do	AUX
chd-99	170	23	not	not	PART
chd-99	170	24	reach	reach	VERB
chd-99	170	25	statistical	statistical	ADJ
chd-99	170	26	significance	significance	NOUN
chd-99	170	27	(	(	PUNCT
chd-99	170	28	p=0.17	p=0.17	NOUN
chd-99	170	29	)	)	PUNCT
chd-99	170	30	when	when	SCONJ
chd-99	170	31	compared	compare	VERB
chd-99	170	32	to	to	ADP
chd-99	170	33	the	the	DET
chd-99	170	34	non	non	ADJ
chd-99	170	35	tg	tg	PROPN
chd-99	170	36	controls	control	NOUN
chd-99	170	37	(	(	PUNCT
chd-99	170	38	figure	figure	NOUN
chd-99	170	39	3	3	NUM
chd-99	170	40	g	g	NOUN
chd-99	170	41	)	)	PUNCT
chd-99	170	42	.	.	PUNCT
chd-99	171	1	to	to	PART
chd-99	171	2	determine	determine	VERB
chd-99	171	3	whether	whether	SCONJ
chd-99	171	4	mir-204	mir-204	NOUN
chd-99	171	5	overexpression	overexpression	NOUN
chd-99	171	6	altered	alter	VERB
chd-99	171	7	tumor	tumor	NOUN
chd-99	171	8	metastasis	metastasis	NOUN
chd-99	171	9	,	,	PUNCT
chd-99	171	10	the	the	DET
chd-99	171	11	number	number	NOUN
chd-99	171	12	of	of	ADP
chd-99	171	13	micrometastatic	micrometastatic	ADJ
chd-99	171	14	lesions	lesion	NOUN
chd-99	171	15	was	be	AUX
chd-99	171	16	analyzed	analyze	VERB
chd-99	171	17	in	in	ADP
chd-99	171	18	serial	serial	ADJ
chd-99	171	19	sections	section	NOUN
chd-99	171	20	of	of	ADP
chd-99	171	21	lungs	lung	NOUN
chd-99	171	22	from	from	ADP
chd-99	171	23	tumor	tumor	NOUN
chd-99	171	24	bearing	bear	VERB
chd-99	171	25	mice	mouse	NOUN
chd-99	171	26	.	.	PUNCT
chd-99	172	1	we	we	PRON
chd-99	172	2	observed	observe	VERB
chd-99	172	3	an	an	DET
chd-99	172	4	increase	increase	NOUN
chd-99	172	5	in	in	ADP
chd-99	172	6	the	the	DET
chd-99	172	7	total	total	ADJ
chd-99	172	8	number	number	NOUN
chd-99	172	9	of	of	ADP
chd-99	172	10	lung	lung	NOUN
chd-99	172	11	micrometastases	micrometastase	NOUN
chd-99	172	12	in	in	ADP
chd-99	172	13	the	the	DET
chd-99	172	14	mir-204	mir-204	NOUN
chd-99	172	15	tg	tg	INTJ
chd-99	172	16	(	(	PUNCT
chd-99	172	17	27.1	27.1	NUM
chd-99	172	18	±	±	NUM
chd-99	172	19	2.0	2.0	NUM
chd-99	172	20	sd	sd	NOUN
chd-99	172	21	)	)	PUNCT
chd-99	172	22	mice	mouse	NOUN
chd-99	172	23	when	when	SCONJ
chd-99	172	24	compared	compare	VERB
chd-99	172	25	to	to	ADP
chd-99	172	26	the	the	DET
chd-99	172	27	non	non	ADJ
chd-99	172	28	tg	tg	PROPN
chd-99	172	29	(	(	PUNCT
chd-99	172	30	51.9	51.9	NUM
chd-99	172	31	±	±	NUM
chd-99	172	32	5.7	5.7	NUM
chd-99	172	33	sd	sd	NOUN
chd-99	172	34	)	)	PUNCT
chd-99	172	35	control	control	NOUN
chd-99	172	36	mice	mouse	NOUN
chd-99	172	37	(	(	PUNCT
chd-99	172	38	p<0.001	p<0.001	PROPN
chd-99	172	39	)	)	PUNCT
chd-99	172	40	(	(	PUNCT
chd-99	172	41	figure	figure	VERB
chd-99	172	42	3h	3h	NUM
chd-99	172	43	)	)	PUNCT
chd-99	172	44	.	.	PUNCT
chd-99	173	1	figure	figure	VERB
chd-99	173	2	3	3	NUM
chd-99	173	3	:	:	PUNCT
chd-99	173	4	mir-204	mir-204	NOUN
chd-99	173	5	drives	drive	VERB
chd-99	173	6	aggressive	aggressive	ADJ
chd-99	173	7	tumor	tumor	NOUN
chd-99	173	8	growth	growth	NOUN
chd-99	173	9	in	in	ADP
chd-99	173	10	vivo	vivo	NOUN
chd-99	173	11	.	.	PUNCT
chd-99	174	1	(	(	PUNCT
chd-99	174	2	a	a	X
chd-99	174	3	)	)	PUNCT
chd-99	174	4	a	a	DET
chd-99	174	5	schematic	schematic	ADJ
chd-99	174	6	of	of	ADP
chd-99	174	7	the	the	DET
chd-99	174	8	two	two	NUM
chd-99	174	9	constructs	construct	NOUN
chd-99	174	10	used	use	VERB
chd-99	174	11	to	to	PART
chd-99	174	12	generate	generate	VERB
chd-99	174	13	bigenic	bigenic	ADJ
chd-99	174	14	tet	tet	NOUN
chd-99	174	15	-	-	ADJ
chd-99	174	16	regulatable	regulatable	ADJ
chd-99	174	17	mir-204	mir-204	NOUN
chd-99	174	18	transgenic	transgenic	NOUN
chd-99	174	19	mice	mouse	NOUN
chd-99	174	20	(	(	PUNCT
chd-99	174	21	adapted	adapt	VERB
chd-99	174	22	from	from	ADP
chd-99	174	23	(	(	PUNCT
chd-99	174	24	vargo	vargo	NOUN
chd-99	174	25	-	-	PUNCT
chd-99	174	26	gogola	gogola	PROPN
chd-99	174	27	et	et	PROPN
chd-99	174	28	al	al	PROPN
chd-99	174	29	.	.	PROPN
chd-99	174	30	,	,	PUNCT
chd-99	174	31	2006	2006	NUM
chd-99	174	32	)	)	PUNCT
chd-99	174	33	)	)	PUNCT
chd-99	174	34	.	.	PUNCT
chd-99	175	1	(	(	PUNCT
chd-99	175	2	b	b	X
chd-99	175	3	)	)	PUNCT
chd-99	175	4	qpcr	qpcr	ADJ
chd-99	175	5	analysis	analysis	NOUN
chd-99	175	6	of	of	ADP
chd-99	175	7	mir-204	mir-204	NOUN
chd-99	175	8	transgene	transgene	NOUN
chd-99	175	9	expression	expression	NOUN
chd-99	175	10	in	in	ADP
chd-99	175	11	mammary	mammary	ADJ
chd-99	175	12	glands	gland	NOUN
chd-99	175	13	from	from	ADP
chd-99	175	14	control	control	NOUN
chd-99	175	15	and	and	CCONJ
chd-99	175	16	dox	dox	NOUN
chd-99	175	17	-	-	PUNCT
chd-99	175	18	induced	induce	VERB
chd-99	175	19	(	(	PUNCT
chd-99	175	20	for	for	ADP
chd-99	175	21	7	7	NUM
chd-99	175	22	days	day	NOUN
chd-99	175	23	;	;	PUNCT
chd-99	175	24	6	6	NUM
chd-99	175	25	week	week	NOUN
chd-99	175	26	old	old	ADJ
chd-99	175	27	)	)	PUNCT
chd-99	175	28	mice	mouse	NOUN
chd-99	175	29	.	.	PUNCT
chd-99	176	1	(	(	PUNCT
chd-99	176	2	c	c	X
chd-99	176	3	)	)	PUNCT
chd-99	176	4	immunohistochemistry	immunohistochemistry	NOUN
chd-99	176	5	of	of	ADP
chd-99	176	6	igf2r	igf2r	PROPN
chd-99	176	7	in	in	ADP
chd-99	176	8	non	non	ADJ
chd-99	176	9	-	-	ADJ
chd-99	176	10	transgenic	transgenic	ADJ
chd-99	176	11	(	(	PUNCT
chd-99	176	12	non	non	X
chd-99	176	13	tg	tg	PROPN
chd-99	176	14	)	)	PUNCT
chd-99	176	15	and	and	CCONJ
chd-99	176	16	mir-204	mir-204	PROPN
chd-99	176	17	bigenic	bigenic	ADJ
chd-99	176	18	(	(	PUNCT
chd-99	176	19	mir-204	mir-204	NOUN
chd-99	176	20	tg	tg	PROPN
chd-99	176	21	)	)	PUNCT
chd-99	176	22	mice	mouse	NOUN
chd-99	176	23	fed	feed	VERB
chd-99	176	24	dox	dox	NOUN
chd-99	176	25	for	for	ADP
chd-99	176	26	4	4	NUM
chd-99	176	27	days	day	NOUN
chd-99	176	28	.	.	PUNCT
chd-99	177	1	(	(	PUNCT
chd-99	177	2	d	d	X
chd-99	177	3	)	)	PUNCT
chd-99	177	4	qpcr	qpcr	ADJ
chd-99	177	5	analysis	analysis	NOUN
chd-99	177	6	of	of	ADP
chd-99	177	7	igf2r	igf2r	PROPN
chd-99	177	8	levels	level	NOUN
chd-99	177	9	in	in	ADP
chd-99	177	10	rna	rna	NOUN
chd-99	177	11	extracted	extract	VERB
chd-99	177	12	from	from	ADP
chd-99	177	13	glands	gland	NOUN
chd-99	177	14	illustrated	illustrate	VERB
chd-99	177	15	in	in	ADP
chd-99	177	16	panel	panel	NOUN
chd-99	177	17	c.	c.	PROPN
chd-99	177	18	(	(	PUNCT
chd-99	177	19	e	e	NOUN
chd-99	177	20	)	)	PUNCT
chd-99	177	21	time	time	NOUN
chd-99	177	22	to	to	PART
chd-99	177	23	sacrifice	sacrifice	VERB
chd-99	177	24	from	from	ADP
chd-99	177	25	time	time	NOUN
chd-99	177	26	of	of	ADP
chd-99	177	27	onset	onset	NOUN
chd-99	177	28	in	in	ADP
chd-99	177	29	non	non	ADJ
chd-99	177	30	tg	tg	PROPN
chd-99	177	31	(	(	PUNCT
chd-99	177	32	black	black	ADJ
chd-99	177	33	lines	line	NOUN
chd-99	177	34	)	)	PUNCT
chd-99	177	35	and	and	CCONJ
chd-99	177	36	mir-204	mir-204	X
chd-99	177	37	tg	tg	PROPN
chd-99	177	38	(	(	PUNCT
chd-99	177	39	red	red	ADJ
chd-99	177	40	lines	line	NOUN
chd-99	177	41	)	)	PUNCT
chd-99	177	42	mice	mouse	NOUN
chd-99	177	43	.	.	PUNCT
chd-99	178	1	(	(	PUNCT
chd-99	178	2	f	f	X
chd-99	178	3	)	)	PUNCT
chd-99	178	4	representative	representative	ADJ
chd-99	178	5	images	image	NOUN
chd-99	178	6	of	of	ADP
chd-99	178	7	h&e	h&e	PROPN
chd-99	178	8	and	and	CCONJ
chd-99	178	9	ki67	ki67	PROPN
chd-99	178	10	ihc	ihc	PROPN
chd-99	178	11	.	.	PUNCT
chd-99	179	1	quantitation	quantitation	PROPN
chd-99	179	2	of	of	ADP
chd-99	179	3	(	(	PUNCT
chd-99	179	4	g	g	NOUN
chd-99	179	5	)	)	PUNCT
chd-99	179	6	ki67	ki67	PROPN
chd-99	179	7	and	and	CCONJ
chd-99	179	8	(	(	PUNCT
chd-99	179	9	h	h	NOUN
chd-99	179	10	)	)	PUNCT
chd-99	179	11	lung	lung	NOUN
chd-99	179	12	metastases	metastasis	NOUN
chd-99	179	13	in	in	ADP
chd-99	179	14	non	non	ADJ
chd-99	179	15	tg	tg	PROPN
chd-99	179	16	(	(	PUNCT
chd-99	179	17	black	black	ADJ
chd-99	179	18	circles	circle	NOUN
chd-99	179	19	)	)	PUNCT
chd-99	179	20	and	and	CCONJ
chd-99	179	21	mir-204	mir-204	X
chd-99	179	22	tg	tg	PROPN
chd-99	179	23	(	(	PUNCT
chd-99	179	24	black	black	ADJ
chd-99	179	25	squares	square	NOUN
chd-99	179	26	)	)	PUNCT
chd-99	179	27	mice	mouse	NOUN
chd-99	179	28	.	.	PUNCT
chd-99	180	1	bars	bar	NOUN
chd-99	180	2	represent	represent	VERB
chd-99	180	3	the	the	DET
chd-99	180	4	mean	mean	PROPN
chd-99	180	5	±	±	NUM
chd-99	180	6	sem	sem	PROPN
chd-99	180	7	.	.	PUNCT
chd-99	181	1	exogenous	exogenous	ADJ
chd-99	181	2	igf2r	igf2r	PART
chd-99	181	3	expression	expression	NOUN
chd-99	181	4	inhibits	inhibit	VERB
chd-99	181	5	mir-204mediated	mir-204mediate	VERB
chd-99	181	6	cell	cell	NOUN
chd-99	181	7	migration	migration	NOUN
chd-99	181	8	and	and	CCONJ
chd-99	181	9	invasion	invasion	NOUN
chd-99	181	10	mirnas	mirna	NOUN
chd-99	181	11	have	have	VERB
chd-99	181	12	multiple	multiple	ADJ
chd-99	181	13	targets	target	NOUN
chd-99	181	14	,	,	PUNCT
chd-99	181	15	and	and	CCONJ
chd-99	181	16	therefore	therefore	ADV
chd-99	181	17	,	,	PUNCT
chd-99	182	1	the	the	DET
chd-99	182	2	effects	effect	NOUN
chd-99	182	3	observed	observe	VERB
chd-99	182	4	after	after	SCONJ
chd-99	182	5	mir-204	mir-204	NOUN
chd-99	182	6	expression	expression	NOUN
chd-99	182	7	may	may	AUX
chd-99	182	8	be	be	AUX
chd-99	182	9	the	the	DET
chd-99	182	10	result	result	NOUN
chd-99	182	11	of	of	ADP
chd-99	182	12	the	the	DET
chd-99	182	13	decreased	decrease	VERB
chd-99	182	14	igf2r	igf2r	PROPN
chd-99	182	15	protein	protein	NOUN
chd-99	182	16	,	,	PUNCT
chd-99	182	17	as	as	ADV
chd-99	182	18	well	well	ADV
chd-99	182	19	as	as	ADP
chd-99	182	20	non	non	ADJ
chd-99	182	21	igf2r	igf2r	ADV
chd-99	182	22	-	-	PUNCT
chd-99	182	23	related	relate	VERB
chd-99	182	24	mir-204	mir-204	NOUN
chd-99	182	25	effects	effect	NOUN
chd-99	182	26	.	.	PUNCT
chd-99	183	1	one	one	NUM
chd-99	183	2	way	way	NOUN
chd-99	183	3	to	to	PART
chd-99	183	4	evaluate	evaluate	VERB
chd-99	183	5	these	these	DET
chd-99	183	6	possibilities	possibility	NOUN
chd-99	183	7	is	be	AUX
chd-99	183	8	to	to	PART
chd-99	183	9	examine	examine	VERB
chd-99	183	10	the	the	DET
chd-99	183	11	phenotypes	phenotype	NOUN
chd-99	183	12	in	in	ADP
chd-99	183	13	cells	cell	NOUN
chd-99	183	14	in	in	ADP
chd-99	183	15	which	which	PRON
chd-99	183	16	a	a	DET
chd-99	183	17	non	non	ADJ
chd-99	183	18	-	-	ADJ
chd-99	183	19	targeted	targeted	ADJ
chd-99	183	20	igf2r	igf2r	VERB
chd-99	183	21	is	be	AUX
chd-99	183	22	expressed	express	VERB
chd-99	183	23	.	.	PUNCT
chd-99	184	1	to	to	PART
chd-99	184	2	test	test	VERB
chd-99	184	3	this	this	DET
chd-99	184	4	possibility	possibility	NOUN
chd-99	184	5	,	,	PUNCT
chd-99	184	6	the	the	DET
chd-99	184	7	open	open	ADJ
chd-99	184	8	reading	reading	NOUN
chd-99	184	9	frame	frame	NOUN
chd-99	184	10	(	(	PUNCT
chd-99	184	11	orf	orf	PROPN
chd-99	184	12	)	)	PUNCT
chd-99	184	13	of	of	ADP
chd-99	184	14	igf2r	igf2r	PROPN
chd-99	184	15	was	be	AUX
chd-99	184	16	transiently	transiently	ADV
chd-99	184	17	transfected	transfecte	VERB
chd-99	184	18	into	into	ADP
chd-99	184	19	mcf10a	mcf10a	ADJ
chd-99	184	20	cells	cell	NOUN
chd-99	184	21	stably	stably	ADV
chd-99	184	22	infected	infect	VERB
chd-99	184	23	with	with	ADP
chd-99	184	24	mir-204	mir-204	NOUN
chd-99	184	25	(	(	PUNCT
chd-99	184	26	supplemental	supplemental	ADJ
chd-99	184	27	figure	figure	NOUN
chd-99	184	28	3	3	NUM
chd-99	184	29	)	)	PUNCT
chd-99	184	30	.	.	PUNCT
chd-99	185	1	as	as	SCONJ
chd-99	185	2	we	we	PRON
chd-99	185	3	have	have	AUX
chd-99	185	4	previously	previously	ADV
chd-99	185	5	observed	observe	VERB
chd-99	185	6	,	,	PUNCT
chd-99	185	7	the	the	DET
chd-99	185	8	protein	protein	NOUN
chd-99	185	9	levels	level	NOUN
chd-99	185	10	of	of	ADP
chd-99	185	11	igf2r	igf2r	PROPN
chd-99	185	12	were	be	AUX
chd-99	185	13	reduced	reduce	VERB
chd-99	185	14	in	in	ADP
chd-99	185	15	the	the	DET
chd-99	185	16	mir-204	mir-204	NOUN
chd-99	185	17	expressing	express	VERB
chd-99	185	18	cells	cell	NOUN
chd-99	185	19	.	.	PUNCT
chd-99	186	1	in	in	ADP
chd-99	186	2	contrast	contrast	NOUN
chd-99	186	3	,	,	PUNCT
chd-99	186	4	a	a	DET
chd-99	186	5	smaller	small	ADJ
chd-99	186	6	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	186	7	e11	e11	NOUN
chd-99	186	8	cancer	cancer	NOUN
chd-99	186	9	health	health	NOUN
chd-99	186	10	disparities	disparity	NOUN
chd-99	186	11	research	research	NOUN
chd-99	186	12	reduction	reduction	NOUN
chd-99	186	13	of	of	ADP
chd-99	186	14	igf2r	igf2r	PROPN
chd-99	186	15	was	be	AUX
chd-99	186	16	observed	observe	VERB
chd-99	186	17	in	in	ADP
chd-99	186	18	the	the	DET
chd-99	186	19	cells	cell	NOUN
chd-99	186	20	expressing	express	VERB
chd-99	186	21	the	the	DET
chd-99	186	22	non	non	ADJ
chd-99	186	23	-	-	ADJ
chd-99	186	24	targetable	targetable	ADJ
chd-99	186	25	(	(	PUNCT
chd-99	186	26	orf	orf	ADJ
chd-99	186	27	)	)	PUNCT
chd-99	186	28	form	form	NOUN
chd-99	186	29	of	of	ADP
chd-99	186	30	igf2r	igf2r	PROPN
chd-99	186	31	(	(	PUNCT
chd-99	186	32	figure	figure	NOUN
chd-99	186	33	4a	4a	NUM
chd-99	186	34	)	)	PUNCT
chd-99	186	35	.	.	PUNCT
chd-99	187	1	when	when	SCONJ
chd-99	187	2	we	we	PRON
chd-99	187	3	assessed	assess	VERB
chd-99	187	4	migration	migration	NOUN
chd-99	187	5	and	and	CCONJ
chd-99	187	6	invasion	invasion	NOUN
chd-99	187	7	in	in	ADP
chd-99	187	8	the	the	DET
chd-99	187	9	igf2r	igf2r	PROPN
chd-99	187	10	overexpressing	overexpresse	VERB
chd-99	187	11	cells	cell	NOUN
chd-99	187	12	,	,	PUNCT
chd-99	187	13	we	we	PRON
chd-99	187	14	did	do	AUX
chd-99	187	15	not	not	PART
chd-99	187	16	observe	observe	VERB
chd-99	187	17	an	an	DET
chd-99	187	18	increase	increase	NOUN
chd-99	187	19	in	in	ADP
chd-99	187	20	either	either	DET
chd-99	187	21	migration	migration	NOUN
chd-99	187	22	(	(	PUNCT
chd-99	187	23	figure	figure	NOUN
chd-99	187	24	4b	4b	X
chd-99	187	25	)	)	PUNCT
chd-99	187	26	or	or	CCONJ
chd-99	187	27	invasion	invasion	NOUN
chd-99	187	28	(	(	PUNCT
chd-99	187	29	figure	figure	NOUN
chd-99	187	30	4c	4c	NOUN
chd-99	187	31	)	)	PUNCT
chd-99	187	32	when	when	SCONJ
chd-99	187	33	mir-204	mir-204	NOUN
chd-99	187	34	was	be	AUX
chd-99	187	35	coexpressed	coexpresse	VERB
chd-99	187	36	suggesting	suggest	VERB
chd-99	187	37	that	that	SCONJ
chd-99	187	38	mir-204	mir-204	NOUN
chd-99	187	39	does	do	AUX
chd-99	187	40	increase	increase	VERB
chd-99	187	41	migration	migration	NOUN
chd-99	187	42	and	and	CCONJ
chd-99	187	43	invasion	invasion	NOUN
chd-99	187	44	through	through	ADP
chd-99	187	45	the	the	DET
chd-99	187	46	negative	negative	ADJ
chd-99	187	47	regulation	regulation	NOUN
chd-99	187	48	of	of	ADP
chd-99	187	49	igf2r	igf2r	PROPN
chd-99	187	50	.	.	PUNCT
chd-99	188	1	igf2	igf2	PROPN
chd-99	188	2	stimulates	stimulate	VERB
chd-99	188	3	the	the	DET
chd-99	188	4	igf1r	igf1r	NUM
chd-99	188	5	signaling	signal	VERB
chd-99	188	6	pathway	pathway	NOUN
chd-99	188	7	when	when	SCONJ
chd-99	188	8	igf2r	igf2r	PROPN
chd-99	188	9	is	be	AUX
chd-99	188	10	inhibited	inhibit	VERB
chd-99	188	11	by	by	ADP
chd-99	188	12	mir-204	mir-204	PROPN
chd-99	188	13	igf2	igf2	PROPN
chd-99	188	14	preferentially	preferentially	ADV
chd-99	188	15	binds	bind	VERB
chd-99	188	16	to	to	ADP
chd-99	188	17	the	the	DET
chd-99	188	18	igf2r	igf2r	PROPN
chd-99	188	19	;	;	PUNCT
chd-99	188	20	however	however	ADV
chd-99	188	21	,	,	PUNCT
chd-99	188	22	it	it	PRON
chd-99	188	23	is	be	AUX
chd-99	188	24	also	also	ADV
chd-99	188	25	known	know	VERB
chd-99	188	26	to	to	PART
chd-99	188	27	act	act	VERB
chd-99	188	28	as	as	ADP
chd-99	188	29	an	an	DET
chd-99	188	30	autocrine	autocrine	NOUN
chd-99	188	31	and	and	CCONJ
chd-99	188	32	paracrine	paracrine	NOUN
chd-99	188	33	regulator	regulator	NOUN
chd-99	188	34	of	of	ADP
chd-99	188	35	igf1r	igf1r	PROPN
chd-99	188	36	,	,	PUNCT
chd-99	188	37	leading	lead	VERB
chd-99	188	38	to	to	ADP
chd-99	188	39	downstream	downstream	ADJ
chd-99	188	40	activation	activation	NOUN
chd-99	188	41	of	of	ADP
chd-99	188	42	the	the	DET
chd-99	188	43	pi3k	pi3k	PROPN
chd-99	188	44	and	and	CCONJ
chd-99	188	45	mapk	mapk	PROPN
chd-99	188	46	/	/	SYM
chd-99	188	47	erk	erk	PROPN
chd-99	188	48	signaling	signal	VERB
chd-99	188	49	pathways	pathway	NOUN
chd-99	188	50	and	and	CCONJ
chd-99	188	51	cell	cell	NOUN
chd-99	188	52	proliferation	proliferation	NOUN
chd-99	188	53	/	/	SYM
chd-99	188	54	survival	survival	NOUN
chd-99	188	55	(	(	PUNCT
chd-99	188	56	flanigan	flanigan	PROPN
chd-99	188	57	et	et	PROPN
chd-99	188	58	al	al	PROPN
chd-99	188	59	.	.	PROPN
chd-99	188	60	,	,	PUNCT
chd-99	188	61	2013	2013	NUM
chd-99	188	62	;	;	PUNCT
chd-99	188	63	leroith	leroith	NOUN
chd-99	188	64	and	and	CCONJ
chd-99	188	65	roberts	roberts	PROPN
chd-99	188	66	,	,	PUNCT
chd-99	188	67	2003	2003	NUM
chd-99	188	68	)	)	PUNCT
chd-99	188	69	.	.	PUNCT
chd-99	189	1	therefore	therefore	ADV
chd-99	189	2	,	,	PUNCT
chd-99	189	3	to	to	PART
chd-99	189	4	determine	determine	VERB
chd-99	189	5	whether	whether	SCONJ
chd-99	189	6	igf2	igf2	PROPN
chd-99	189	7	stimulates	stimulate	VERB
chd-99	189	8	the	the	DET
chd-99	189	9	igf1r	igf1r	NUM
chd-99	189	10	signaling	signal	VERB
chd-99	189	11	pathway	pathway	NOUN
chd-99	189	12	preferentially	preferentially	ADV
chd-99	189	13	in	in	ADP
chd-99	189	14	the	the	DET
chd-99	189	15	presence	presence	NOUN
chd-99	189	16	of	of	ADP
chd-99	189	17	mir-204	mir-204	NOUN
chd-99	189	18	(	(	PUNCT
chd-99	189	19	or	or	CCONJ
chd-99	189	20	in	in	ADP
chd-99	189	21	the	the	DET
chd-99	189	22	absence	absence	NOUN
chd-99	189	23	of	of	ADP
chd-99	189	24	igf2r	igf2r	PROPN
chd-99	189	25	)	)	PUNCT
chd-99	189	26	,	,	PUNCT
chd-99	189	27	we	we	PRON
chd-99	189	28	treated	treat	VERB
chd-99	189	29	mcf10a	mcf10a	NOUN
chd-99	189	30	cells	cell	NOUN
chd-99	189	31	expressing	express	VERB
chd-99	189	32	mir-204	mir-204	NOUN
chd-99	189	33	with	with	ADP
chd-99	189	34	igf2	igf2	PROPN
chd-99	189	35	and	and	CCONJ
chd-99	189	36	performed	perform	VERB
chd-99	189	37	western	western	ADJ
chd-99	189	38	blot	blot	NOUN
chd-99	189	39	analysis	analysis	NOUN
chd-99	189	40	to	to	PART
chd-99	189	41	assess	assess	VERB
chd-99	189	42	the	the	DET
chd-99	189	43	igf1r	igf1r	PRON
chd-99	189	44	signaling	signal	VERB
chd-99	189	45	pathway	pathway	NOUN
chd-99	189	46	(	(	PUNCT
chd-99	189	47	supplemental	supplemental	ADJ
chd-99	189	48	figure	figure	NOUN
chd-99	189	49	4ac	4ac	NOUN
chd-99	189	50	)	)	PUNCT
chd-99	189	51	.	.	PUNCT
chd-99	190	1	we	we	PRON
chd-99	190	2	observed	observe	VERB
chd-99	190	3	a	a	DET
chd-99	190	4	decrease	decrease	NOUN
chd-99	190	5	in	in	ADP
chd-99	190	6	igf2r	igf2r	ADJ
chd-99	190	7	protein	protein	NOUN
chd-99	190	8	expression	expression	NOUN
chd-99	190	9	when	when	SCONJ
chd-99	190	10	control	control	NOUN
chd-99	190	11	cells	cell	NOUN
chd-99	190	12	were	be	AUX
chd-99	190	13	treated	treat	VERB
chd-99	190	14	with	with	ADP
chd-99	190	15	igf2	igf2	PROPN
chd-99	190	16	;	;	PUNCT
chd-99	190	17	however	however	ADV
chd-99	190	18	,	,	PUNCT
chd-99	190	19	no	no	DET
chd-99	190	20	further	further	ADJ
chd-99	190	21	decrease	decrease	NOUN
chd-99	190	22	in	in	ADP
chd-99	190	23	igf2r	igf2r	ADJ
chd-99	190	24	expression	expression	NOUN
chd-99	190	25	was	be	AUX
chd-99	190	26	observed	observe	VERB
chd-99	190	27	in	in	ADP
chd-99	190	28	the	the	DET
chd-99	190	29	mir-204	mir-204	NOUN
chd-99	190	30	expressing	express	VERB
chd-99	190	31	cells	cell	NOUN
chd-99	190	32	treated	treat	VERB
chd-99	190	33	with	with	ADP
chd-99	190	34	igf2	igf2	PROPN
chd-99	190	35	(	(	PUNCT
chd-99	190	36	figure	figure	NOUN
chd-99	190	37	4d	4d	NUM
chd-99	190	38	)	)	PUNCT
chd-99	190	39	.	.	PUNCT
chd-99	191	1	importantly	importantly	ADV
chd-99	191	2	,	,	PUNCT
chd-99	191	3	we	we	PRON
chd-99	191	4	observed	observe	VERB
chd-99	191	5	more	more	ADV
chd-99	191	6	robust	robust	ADJ
chd-99	191	7	activation	activation	NOUN
chd-99	191	8	of	of	ADP
chd-99	191	9	the	the	DET
chd-99	191	10	igf1r	igf1r	DET
chd-99	191	11	signaling	signal	VERB
chd-99	191	12	pathway	pathway	NOUN
chd-99	191	13	upon	upon	SCONJ
chd-99	191	14	igf2	igf2	PROPN
chd-99	191	15	treatment	treatment	NOUN
chd-99	191	16	when	when	SCONJ
chd-99	191	17	mir-204	mir-204	PROPN
chd-99	191	18	was	be	AUX
chd-99	191	19	overexpressed	overexpresse	VERB
chd-99	191	20	as	as	SCONJ
chd-99	191	21	illustrated	illustrate	VERB
chd-99	191	22	by	by	ADP
chd-99	191	23	increased	increase	VERB
chd-99	191	24	phosphorylation	phosphorylation	NOUN
chd-99	191	25	of	of	ADP
chd-99	191	26	irs-1	irs-1	DET
chd-99	191	27	,	,	PUNCT
chd-99	191	28	an	an	DET
chd-99	191	29	intracellular	intracellular	ADJ
chd-99	191	30	signaling	signal	VERB
chd-99	191	31	adaptor	adaptor	NOUN
chd-99	191	32	protein	protein	NOUN
chd-99	191	33	and	and	CCONJ
chd-99	191	34	the	the	DET
chd-99	191	35	main	main	ADJ
chd-99	191	36	substrate	substrate	NOUN
chd-99	191	37	of	of	ADP
chd-99	191	38	the	the	DET
chd-99	191	39	igf1r	igf1r	X
chd-99	191	40	(	(	PUNCT
chd-99	191	41	dearth	dearth	NOUN
chd-99	191	42	et	et	PROPN
chd-99	191	43	al	al	PROPN
chd-99	191	44	.	.	PROPN
chd-99	191	45	,	,	PUNCT
chd-99	191	46	2007	2007	NUM
chd-99	191	47	)	)	PUNCT
chd-99	191	48	,	,	PUNCT
chd-99	191	49	and	and	CCONJ
chd-99	191	50	akt	akt	PROPN
chd-99	191	51	(	(	PUNCT
chd-99	191	52	figure	figure	NOUN
chd-99	191	53	4e	4e	PROPN
chd-99	191	54	)	)	PUNCT
chd-99	191	55	.	.	PUNCT
chd-99	192	1	we	we	PRON
chd-99	192	2	did	do	AUX
chd-99	192	3	not	not	PART
chd-99	192	4	observe	observe	VERB
chd-99	192	5	increased	increased	ADJ
chd-99	192	6	activation	activation	NOUN
chd-99	192	7	of	of	ADP
chd-99	192	8	the	the	DET
chd-99	192	9	erk	erk	PROPN
chd-99	192	10	pathway	pathway	NOUN
chd-99	192	11	in	in	ADP
chd-99	192	12	204	204	NUM
chd-99	192	13	-	-	PUNCT
chd-99	192	14	expressing	express	VERB
chd-99	192	15	cells	cell	NOUN
chd-99	192	16	in	in	ADP
chd-99	192	17	response	response	NOUN
chd-99	192	18	to	to	ADP
chd-99	192	19	stimulation	stimulation	VERB
chd-99	192	20	with	with	ADP
chd-99	192	21	igf2	igf2	PROPN
chd-99	192	22	.	.	PUNCT
chd-99	193	1	figure	figure	VERB
chd-99	193	2	4	4	NUM
chd-99	193	3	:	:	PUNCT
chd-99	193	4	mir-204	mir-204	NOUN
chd-99	193	5	drives	drive	VERB
chd-99	193	6	igf2	igf2	PROPN
chd-99	193	7	mediated	mediate	VERB
chd-99	193	8	activation	activation	NOUN
chd-99	193	9	of	of	ADP
chd-99	193	10	the	the	DET
chd-99	193	11	igf1r	igf1r	PRON
chd-99	193	12	signaling	signal	VERB
chd-99	193	13	pathway	pathway	NOUN
chd-99	193	14	.	.	PUNCT
chd-99	194	1	western	western	ADJ
chd-99	194	2	blot	blot	NOUN
chd-99	194	3	(	(	PUNCT
chd-99	194	4	a	a	NOUN
chd-99	194	5	)	)	PUNCT
chd-99	194	6	and	and	CCONJ
chd-99	194	7	transwell	transwell	NOUN
chd-99	194	8	migration	migration	NOUN
chd-99	194	9	(	(	PUNCT
chd-99	194	10	b	b	NOUN
chd-99	194	11	)	)	PUNCT
chd-99	194	12	and	and	CCONJ
chd-99	194	13	invasion	invasion	NOUN
chd-99	194	14	(	(	PUNCT
chd-99	194	15	c	c	NOUN
chd-99	194	16	)	)	PUNCT
chd-99	194	17	assays	assay	NOUN
chd-99	194	18	of	of	ADP
chd-99	194	19	mir-204	mir-204	NOUN
chd-99	194	20	stably	stably	ADV
chd-99	194	21	infected	infect	VERB
chd-99	194	22	mcf10a	mcf10a	ADJ
chd-99	194	23	cells	cell	NOUN
chd-99	194	24	transiently	transiently	ADV
chd-99	194	25	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	VERB
chd-99	194	26	e12	e12	NOUN
chd-99	194	27	cancer	cancer	NOUN
chd-99	194	28	health	health	NOUN
chd-99	194	29	disparities	disparity	NOUN
chd-99	194	30	research	research	NOUN
chd-99	194	31	transfected	transfecte	VERB
chd-99	194	32	with	with	ADP
chd-99	194	33	igf2r	igf2r	PROPN
chd-99	194	34	or	or	CCONJ
chd-99	194	35	empty	empty	ADJ
chd-99	194	36	vector	vector	NOUN
chd-99	194	37	(	(	PUNCT
chd-99	194	38	ev	ev	NOUN
chd-99	194	39	)	)	PUNCT
chd-99	194	40	.	.	PUNCT
chd-99	195	1	western	western	ADJ
chd-99	195	2	blot	blot	NOUN
chd-99	195	3	analysis	analysis	NOUN
chd-99	195	4	(	(	PUNCT
chd-99	195	5	d	d	NOUN
chd-99	195	6	&	&	CCONJ
chd-99	195	7	e	e	NOUN
chd-99	195	8	)	)	PUNCT
chd-99	195	9	of	of	ADP
chd-99	195	10	the	the	DET
chd-99	195	11	igf1r	igf1r	PRON
chd-99	195	12	signaling	signal	VERB
chd-99	195	13	pathway	pathway	NOUN
chd-99	195	14	and	and	CCONJ
chd-99	195	15	qpcr	qpcr	ADJ
chd-99	195	16	analysis	analysis	NOUN
chd-99	195	17	of	of	ADP
chd-99	195	18	puma	puma	NOUN
chd-99	195	19	and	and	CCONJ
chd-99	195	20	noxa	noxa	NOUN
chd-99	195	21	(	(	PUNCT
chd-99	195	22	f	f	X
chd-99	195	23	)	)	PUNCT
chd-99	195	24	in	in	ADP
chd-99	195	25	mcf12a	mcf12a	ADP
chd-99	195	26	cells	cell	NOUN
chd-99	195	27	stably	stably	ADV
chd-99	195	28	infected	infect	VERB
chd-99	195	29	with	with	ADP
chd-99	195	30	mir-204	mir-204	NOUN
chd-99	195	31	or	or	CCONJ
chd-99	195	32	scr	scr	NOUN
chd-99	195	33	control	control	NOUN
chd-99	195	34	and	and	CCONJ
chd-99	195	35	treated	treat	VERB
chd-99	195	36	with	with	ADP
chd-99	195	37	(	(	PUNCT
chd-99	195	38	+	+	NOUN
chd-99	195	39	)	)	PUNCT
chd-99	195	40	or	or	CCONJ
chd-99	195	41	without	without	ADP
chd-99	195	42	(	(	PUNCT
chd-99	195	43	-	-	PUNCT
chd-99	195	44	)	)	PUNCT
chd-99	195	45	50	50	NUM
chd-99	195	46	nm	nm	PROPN
chd-99	195	47	igf2	igf2	PROPN
chd-99	195	48	for	for	ADP
chd-99	195	49	5	5	NUM
chd-99	195	50	minutes	minute	NOUN
chd-99	195	51	.	.	PUNCT
chd-99	196	1	puma	puma	PROPN
chd-99	196	2	(	(	PUNCT
chd-99	196	3	p53	p53	NOUN
chd-99	196	4	upregulated	upregulate	VERB
chd-99	196	5	modulator	modulator	NOUN
chd-99	196	6	of	of	ADP
chd-99	196	7	apoptosis	apoptosis	NOUN
chd-99	196	8	)	)	PUNCT
chd-99	196	9	and	and	CCONJ
chd-99	196	10	noxa	noxa	NOUN
chd-99	196	11	(	(	PUNCT
chd-99	196	12	phorbol-12	phorbol-12	PROPN
chd-99	196	13	-	-	PUNCT
chd-99	196	14	myristate-13	myristate-13	ADV
chd-99	196	15	-	-	ADJ
chd-99	196	16	acetateinduced	acetateinduce	VERB
chd-99	196	17	protein	protein	NOUN
chd-99	196	18	1	1	NUM
chd-99	196	19	)	)	PUNCT
chd-99	196	20	are	be	AUX
chd-99	196	21	proteins	protein	NOUN
chd-99	196	22	that	that	PRON
chd-99	196	23	play	play	VERB
chd-99	196	24	a	a	DET
chd-99	196	25	key	key	ADJ
chd-99	196	26	role	role	NOUN
chd-99	196	27	in	in	ADP
chd-99	196	28	apoptotic	apoptotic	ADJ
chd-99	196	29	signaling	signaling	NOUN
chd-99	196	30	and	and	CCONJ
chd-99	196	31	have	have	AUX
chd-99	196	32	been	be	AUX
chd-99	196	33	shown	show	VERB
chd-99	196	34	to	to	PART
chd-99	196	35	be	be	AUX
chd-99	196	36	negatively	negatively	ADV
chd-99	196	37	regulated	regulate	VERB
chd-99	196	38	by	by	ADP
chd-99	196	39	igf1r	igf1r	PROPN
chd-99	196	40	/	/	SYM
chd-99	196	41	irs-1	irs-1	NOUN
chd-99	196	42	/	/	SYM
chd-99	196	43	akt	akt	NOUN
chd-99	196	44	signaling	signal	VERB
chd-99	196	45	pathway	pathway	NOUN
chd-99	196	46	in	in	ADP
chd-99	196	47	response	response	NOUN
chd-99	196	48	to	to	ADP
chd-99	196	49	certain	certain	ADJ
chd-99	196	50	stimuli	stimulus	NOUN
chd-99	196	51	to	to	PART
chd-99	196	52	increase	increase	VERB
chd-99	196	53	cell	cell	NOUN
chd-99	196	54	survival	survival	NOUN
chd-99	196	55	and	and	CCONJ
chd-99	196	56	proliferation	proliferation	NOUN
chd-99	196	57	(	(	PUNCT
chd-99	196	58	bean	bean	NOUN
chd-99	196	59	et	et	PROPN
chd-99	196	60	al	al	PROPN
chd-99	196	61	.	.	PROPN
chd-99	196	62	,	,	PUNCT
chd-99	196	63	2013	2013	NUM
chd-99	196	64	;	;	PUNCT
chd-99	196	65	you	you	PRON
chd-99	196	66	et	et	VERB
chd-99	196	67	al	al	PROPN
chd-99	196	68	.	.	PROPN
chd-99	196	69	,	,	PUNCT
chd-99	196	70	2006	2006	NUM
chd-99	196	71	)	)	PUNCT
chd-99	196	72	.	.	PUNCT
chd-99	197	1	we	we	PRON
chd-99	197	2	performed	perform	VERB
chd-99	197	3	qpcr	qpcr	ADV
chd-99	197	4	to	to	PART
chd-99	197	5	assess	assess	VERB
chd-99	197	6	puma	puma	PROPN
chd-99	197	7	and	and	CCONJ
chd-99	197	8	noxa	noxa	NOUN
chd-99	197	9	levels	level	NOUN
chd-99	197	10	in	in	ADP
chd-99	197	11	response	response	NOUN
chd-99	197	12	to	to	ADP
chd-99	197	13	igf2	igf2	PROPN
chd-99	197	14	stimulation	stimulation	NOUN
chd-99	197	15	in	in	ADP
chd-99	197	16	mir-204	mir-204	NOUN
chd-99	197	17	expressing	express	VERB
chd-99	197	18	cells	cell	NOUN
chd-99	197	19	.	.	PUNCT
chd-99	198	1	in	in	ADP
chd-99	198	2	contrast	contrast	NOUN
chd-99	198	3	to	to	ADP
chd-99	198	4	cells	cell	NOUN
chd-99	198	5	with	with	ADP
chd-99	198	6	an	an	DET
chd-99	198	7	intact	intact	ADJ
chd-99	198	8	igf2r	igf2r	NOUN
chd-99	198	9	‘	'	PUNCT
chd-99	198	10	sink	sink	NOUN
chd-99	198	11	’	'	PUNCT
chd-99	198	12	for	for	ADP
chd-99	198	13	igf2	igf2	PROPN
chd-99	198	14	,	,	PUNCT
chd-99	198	15	we	we	PRON
chd-99	198	16	observe	observe	VERB
chd-99	198	17	a	a	DET
chd-99	198	18	significant	significant	ADJ
chd-99	198	19	decrease	decrease	NOUN
chd-99	198	20	in	in	ADP
chd-99	198	21	puma	puma	PROPN
chd-99	198	22	and	and	CCONJ
chd-99	198	23	noxa	noxa	NOUN
chd-99	198	24	transcripts	transcript	NOUN
chd-99	198	25	when	when	SCONJ
chd-99	198	26	stimulated	stimulate	VERB
chd-99	198	27	with	with	ADP
chd-99	198	28	igf2	igf2	PROPN
chd-99	198	29	in	in	ADP
chd-99	198	30	mir-204	mir-204	NOUN
chd-99	198	31	expressing	express	VERB
chd-99	198	32	cells	cell	NOUN
chd-99	198	33	(	(	PUNCT
chd-99	198	34	figure	figure	NOUN
chd-99	198	35	4f	4f	NUM
chd-99	198	36	)	)	PUNCT
chd-99	198	37	.	.	PUNCT
chd-99	199	1	mir-204	mir-204	PROPN
chd-99	199	2	mediates	mediate	VERB
chd-99	199	3	migration	migration	NOUN
chd-99	199	4	through	through	ADP
chd-99	199	5	activation	activation	NOUN
chd-99	199	6	of	of	ADP
chd-99	199	7	the	the	DET
chd-99	199	8	igf1r	igf1r	PROPN
chd-99	199	9	signaling	signal	VERB
chd-99	199	10	pathway	pathway	NOUN
chd-99	199	11	to	to	PART
chd-99	199	12	determine	determine	VERB
chd-99	199	13	whether	whether	SCONJ
chd-99	199	14	mir-204	mir-204	NOUN
chd-99	199	15	mediates	mediate	VERB
chd-99	199	16	its	its	PRON
chd-99	199	17	functional	functional	ADJ
chd-99	199	18	effects	effect	NOUN
chd-99	199	19	through	through	ADP
chd-99	199	20	activation	activation	NOUN
chd-99	199	21	of	of	ADP
chd-99	199	22	the	the	PRON
chd-99	199	23	igf1r	igf1r	X
chd-99	199	24	we	we	PRON
chd-99	199	25	transiently	transiently	ADV
chd-99	199	26	transfected	transfecte	VERB
chd-99	199	27	igf1r	igf1r	ADJ
chd-99	199	28	expressing	expressing	NOUN
chd-99	199	29	,	,	PUNCT
chd-99	199	30	or	or	CCONJ
chd-99	199	31	control	control	NOUN
chd-99	199	32	,	,	PUNCT
chd-99	199	33	mcf10a	mcf10a	NOUN
chd-99	199	34	cells	cell	NOUN
chd-99	199	35	(	(	PUNCT
chd-99	199	36	kim	kim	PROPN
chd-99	199	37	et	et	PROPN
chd-99	199	38	al	al	PROPN
chd-99	199	39	.	.	PROPN
chd-99	199	40	,	,	PUNCT
chd-99	199	41	2007	2007	NUM
chd-99	199	42	)	)	PUNCT
chd-99	199	43	with	with	ADP
chd-99	199	44	mir204	mir204	PROPN
chd-99	199	45	(	(	PUNCT
chd-99	199	46	supplemental	supplemental	ADJ
chd-99	199	47	figure	figure	NOUN
chd-99	199	48	4d	4d	PROPN
chd-99	199	49	&	&	CCONJ
chd-99	199	50	e	e	NOUN
chd-99	199	51	)	)	PUNCT
chd-99	199	52	.	.	PUNCT
chd-99	200	1	we	we	PRON
chd-99	200	2	observed	observe	VERB
chd-99	200	3	activation	activation	NOUN
chd-99	200	4	of	of	ADP
chd-99	200	5	akt	akt	PROPN
chd-99	200	6	in	in	ADP
chd-99	200	7	the	the	DET
chd-99	200	8	igf1r	igf1r	PROPN
chd-99	200	9	expressing	express	VERB
chd-99	200	10	cells	cell	NOUN
chd-99	200	11	alone	alone	ADV
chd-99	200	12	,	,	PUNCT
chd-99	200	13	but	but	CCONJ
chd-99	200	14	no	no	DET
chd-99	200	15	additional	additional	ADJ
chd-99	200	16	increase	increase	NOUN
chd-99	200	17	when	when	SCONJ
chd-99	200	18	mir-204	mir-204	PROPN
chd-99	200	19	was	be	AUX
chd-99	200	20	co	co	VERB
chd-99	200	21	-	-	VERB
chd-99	200	22	expressed	express	VERB
chd-99	200	23	(	(	PUNCT
chd-99	200	24	figure	figure	NOUN
chd-99	200	25	5a	5a	NUM
chd-99	200	26	)	)	PUNCT
chd-99	200	27	.	.	PUNCT
chd-99	201	1	as	as	SCONJ
chd-99	201	2	expected	expect	VERB
chd-99	201	3	,	,	PUNCT
chd-99	201	4	both	both	CCONJ
chd-99	201	5	mir-204	mir-204	NOUN
chd-99	201	6	and	and	CCONJ
chd-99	201	7	igf1r	igf1r	X
chd-99	201	8	expression	expression	NOUN
chd-99	201	9	alone	alone	ADV
chd-99	201	10	increased	increase	VERB
chd-99	201	11	migration	migration	NOUN
chd-99	201	12	;	;	PUNCT
chd-99	201	13	however	however	ADV
chd-99	201	14	,	,	PUNCT
chd-99	201	15	no	no	DET
chd-99	201	16	additional	additional	ADJ
chd-99	201	17	increase	increase	NOUN
chd-99	201	18	in	in	ADP
chd-99	201	19	migration	migration	NOUN
chd-99	201	20	was	be	AUX
chd-99	201	21	observed	observe	VERB
chd-99	201	22	when	when	SCONJ
chd-99	201	23	they	they	PRON
chd-99	201	24	were	be	AUX
chd-99	201	25	coexpressed	coexpresse	VERB
chd-99	201	26	(	(	PUNCT
chd-99	201	27	figure	figure	NOUN
chd-99	201	28	5b	5b	NUM
chd-99	201	29	)	)	PUNCT
chd-99	201	30	,	,	PUNCT
chd-99	201	31	suggesting	suggest	VERB
chd-99	201	32	that	that	SCONJ
chd-99	201	33	igf1r	igf1r	PROPN
chd-99	201	34	and	and	CCONJ
chd-99	201	35	mir-204	mir-204	NOUN
chd-99	201	36	function	function	VERB
chd-99	201	37	through	through	ADP
chd-99	201	38	the	the	DET
chd-99	201	39	same	same	ADJ
chd-99	201	40	signaling	signal	VERB
chd-99	201	41	pathway	pathway	NOUN
chd-99	201	42	to	to	PART
chd-99	201	43	increase	increase	VERB
chd-99	201	44	migration	migration	NOUN
chd-99	201	45	.	.	PUNCT
chd-99	202	1	to	to	PART
chd-99	202	2	assess	assess	VERB
chd-99	202	3	whether	whether	SCONJ
chd-99	202	4	igf1r	igf1r	PROPN
chd-99	202	5	is	be	AUX
chd-99	202	6	required	require	VERB
chd-99	202	7	for	for	ADP
chd-99	202	8	mir-204	mir-204	NOUN
chd-99	202	9	mediated	mediate	VERB
chd-99	202	10	increase	increase	NOUN
chd-99	202	11	in	in	ADP
chd-99	202	12	migration	migration	NOUN
chd-99	202	13	,	,	PUNCT
chd-99	202	14	we	we	PRON
chd-99	202	15	inhibited	inhibit	VERB
chd-99	202	16	igf1r	igf1r	DET
chd-99	202	17	expression	expression	NOUN
chd-99	202	18	in	in	ADP
chd-99	202	19	mcf12a	mcf12a	ADP
chd-99	202	20	cells	cell	NOUN
chd-99	202	21	with	with	ADP
chd-99	202	22	and	and	CCONJ
chd-99	202	23	without	without	ADP
chd-99	202	24	mir-204	mir-204	NOUN
chd-99	202	25	expression	expression	NOUN
chd-99	202	26	with	with	ADP
chd-99	202	27	two	two	NUM
chd-99	202	28	short	short	ADJ
chd-99	202	29	hairpins	hairpin	NOUN
chd-99	202	30	specific	specific	ADJ
chd-99	202	31	to	to	ADP
chd-99	202	32	igf1r	igf1r	PROPN
chd-99	202	33	(	(	PUNCT
chd-99	202	34	figure	figure	NOUN
chd-99	202	35	5c	5c	NUM
chd-99	202	36	)	)	PUNCT
chd-99	202	37	.	.	PUNCT
chd-99	203	1	as	as	SCONJ
chd-99	203	2	expected	expect	VERB
chd-99	203	3	,	,	PUNCT
chd-99	203	4	we	we	PRON
chd-99	203	5	observed	observe	VERB
chd-99	203	6	a	a	DET
chd-99	203	7	significant	significant	ADJ
chd-99	203	8	decrease	decrease	NOUN
chd-99	203	9	in	in	ADP
chd-99	203	10	migration	migration	NOUN
chd-99	203	11	when	when	SCONJ
chd-99	203	12	igf1r	igf1r	PROPN
chd-99	203	13	was	be	AUX
chd-99	203	14	inhibited	inhibit	VERB
chd-99	203	15	in	in	ADP
chd-99	203	16	the	the	DET
chd-99	203	17	mcf12a	mcf12a	NOUN
chd-99	203	18	control	control	NOUN
chd-99	203	19	cells	cell	NOUN
chd-99	203	20	.	.	PUNCT
chd-99	204	1	however	however	ADV
chd-99	204	2	,	,	PUNCT
chd-99	204	3	when	when	SCONJ
chd-99	204	4	mir-204	mir-204	PROPN
chd-99	204	5	was	be	AUX
chd-99	204	6	expressed	express	VERB
chd-99	204	7	in	in	ADP
chd-99	204	8	the	the	DET
chd-99	204	9	presence	presence	NOUN
chd-99	204	10	of	of	ADP
chd-99	204	11	the	the	DET
chd-99	204	12	igf1r	igf1r	PROPN
chd-99	204	13	inhibitor	inhibitor	NOUN
chd-99	204	14	,	,	PUNCT
chd-99	204	15	no	no	DET
chd-99	204	16	increase	increase	NOUN
chd-99	204	17	in	in	ADP
chd-99	204	18	migration	migration	NOUN
chd-99	204	19	was	be	AUX
chd-99	204	20	observed	observe	VERB
chd-99	204	21	suggesting	suggest	VERB
chd-99	204	22	that	that	SCONJ
chd-99	204	23	igf1r	igf1r	PROPN
chd-99	204	24	is	be	AUX
chd-99	204	25	required	require	VERB
chd-99	204	26	for	for	ADP
chd-99	204	27	mir-204	mir-204	NOUN
chd-99	204	28	mediated	mediate	VERB
chd-99	204	29	migration	migration	NOUN
chd-99	204	30	in	in	ADP
chd-99	204	31	breast	breast	NOUN
chd-99	204	32	cells	cell	NOUN
chd-99	204	33	(	(	PUNCT
chd-99	204	34	figure	figure	NOUN
chd-99	204	35	5d	5d	NUM
chd-99	204	36	)	)	PUNCT
chd-99	204	37	.	.	PUNCT
chd-99	205	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	205	2	e13	e13	PROPN
chd-99	205	3	cancer	cancer	NOUN
chd-99	205	4	health	health	NOUN
chd-99	205	5	disparities	disparity	NOUN
chd-99	205	6	research	research	NOUN
chd-99	205	7	figure	figure	NOUN
chd-99	205	8	5	5	NUM
chd-99	205	9	:	:	PUNCT
chd-99	205	10	mir-204	mir-204	NOUN
chd-99	205	11	mediates	mediate	VERB
chd-99	205	12	migration	migration	NOUN
chd-99	205	13	through	through	ADP
chd-99	205	14	activation	activation	NOUN
chd-99	205	15	of	of	ADP
chd-99	205	16	the	the	DET
chd-99	205	17	igf1r	igf1r	PRON
chd-99	205	18	signaling	signal	VERB
chd-99	205	19	pathway	pathway	NOUN
chd-99	205	20	.	.	PUNCT
chd-99	206	1	western	western	ADJ
chd-99	206	2	blot	blot	NOUN
chd-99	206	3	(	(	PUNCT
chd-99	206	4	a	a	NOUN
chd-99	206	5	)	)	PUNCT
chd-99	206	6	and	and	CCONJ
chd-99	206	7	transwell	transwell	NOUN
chd-99	206	8	migration	migration	NOUN
chd-99	206	9	(	(	PUNCT
chd-99	206	10	b	b	NOUN
chd-99	206	11	)	)	PUNCT
chd-99	206	12	assays	assay	NOUN
chd-99	206	13	of	of	ADP
chd-99	206	14	igf1r	igf1r	DET
chd-99	206	15	stably	stably	ADV
chd-99	206	16	infected	infect	VERB
chd-99	206	17	mcf10a	mcf10a	NOUN
chd-99	206	18	cells	cell	NOUN
chd-99	206	19	transiently	transiently	ADV
chd-99	206	20	transfected	transfecte	VERB
chd-99	206	21	with	with	ADP
chd-99	206	22	mir204	mir204	NOUN
chd-99	206	23	or	or	CCONJ
chd-99	206	24	scr	scr	NOUN
chd-99	206	25	control	control	NOUN
chd-99	206	26	.	.	PUNCT
chd-99	207	1	western	western	ADJ
chd-99	207	2	blot	blot	NOUN
chd-99	207	3	(	(	PUNCT
chd-99	207	4	c	c	NOUN
chd-99	207	5	)	)	PUNCT
chd-99	207	6	and	and	CCONJ
chd-99	207	7	transwell	transwell	NOUN
chd-99	207	8	migration	migration	NOUN
chd-99	207	9	(	(	PUNCT
chd-99	207	10	d	d	NOUN
chd-99	207	11	)	)	PUNCT
chd-99	207	12	assays	assay	NOUN
chd-99	207	13	of	of	ADP
chd-99	207	14	mcf12a	mcf12a	NOUN
chd-99	207	15	cells	cell	NOUN
chd-99	207	16	stably	stably	ADV
chd-99	207	17	infected	infect	VERB
chd-99	207	18	with	with	ADP
chd-99	207	19	mir-204	mir-204	NOUN
chd-99	207	20	or	or	CCONJ
chd-99	207	21	scr	scr	NOUN
chd-99	207	22	control	control	NOUN
chd-99	207	23	and	and	CCONJ
chd-99	207	24	transiently	transiently	ADV
chd-99	207	25	transfected	transfecte	VERB
chd-99	207	26	with	with	ADP
chd-99	207	27	short	short	ADJ
chd-99	207	28	hairpin	hairpin	NOUN
chd-99	207	29	constructs	construct	NOUN
chd-99	207	30	to	to	ADP
chd-99	207	31	igf1r	igf1r	PROPN
chd-99	207	32	(	(	PUNCT
chd-99	207	33	sh	sh	NOUN
chd-99	207	34	#	#	SYM
chd-99	207	35	1	1	NUM
chd-99	207	36	&	&	CCONJ
chd-99	207	37	sh	sh	NOUN
chd-99	207	38	#	#	SYM
chd-99	207	39	2	2	NUM
chd-99	207	40	)	)	PUNCT
chd-99	207	41	.	.	PUNCT
chd-99	208	1	igf1r	igf1r	PROPN
chd-99	209	1	in	in	ADP
chd-99	209	2	panel	panel	NOUN
chd-99	209	3	c	c	PROPN
chd-99	209	4	is	be	AUX
chd-99	209	5	shown	show	VERB
chd-99	209	6	for	for	ADP
chd-99	209	7	both	both	CCONJ
chd-99	209	8	a	a	DET
chd-99	209	9	short	short	ADJ
chd-99	209	10	(	(	PUNCT
chd-99	209	11	upper	upper	ADJ
chd-99	209	12	panel	panel	NOUN
chd-99	209	13	)	)	PUNCT
chd-99	209	14	and	and	CCONJ
chd-99	209	15	long	long	ADV
chd-99	209	16	(	(	PUNCT
chd-99	209	17	lower	low	ADJ
chd-99	209	18	panel	panel	NOUN
chd-99	209	19	)	)	PUNCT
chd-99	209	20	exposure	exposure	NOUN
chd-99	209	21	time	time	NOUN
chd-99	209	22	.	.	PUNCT
chd-99	210	1	discussion	discussion	NOUN
chd-99	210	2	mir-204	mir-204	PROPN
chd-99	210	3	,	,	PUNCT
chd-99	210	4	the	the	DET
chd-99	210	5	mirna	mirna	NOUN
chd-99	210	6	of	of	ADP
chd-99	210	7	interest	interest	NOUN
chd-99	210	8	in	in	ADP
chd-99	210	9	this	this	DET
chd-99	210	10	proposal	proposal	NOUN
chd-99	210	11	,	,	PUNCT
chd-99	210	12	is	be	AUX
chd-99	210	13	located	locate	VERB
chd-99	210	14	on	on	ADP
chd-99	210	15	chromosome	chromosome	NOUN
chd-99	210	16	9q21	9q21	NOUN
chd-99	210	17	,	,	PUNCT
chd-99	210	18	a	a	DET
chd-99	210	19	region	region	NOUN
chd-99	210	20	that	that	PRON
chd-99	210	21	is	be	AUX
chd-99	210	22	reported	report	VERB
chd-99	210	23	to	to	PART
chd-99	210	24	be	be	AUX
chd-99	210	25	amplified	amplify	VERB
chd-99	210	26	in	in	ADP
chd-99	210	27	cancer	cancer	NOUN
chd-99	210	28	(	(	PUNCT
chd-99	210	29	bussemakers	bussemaker	NOUN
chd-99	210	30	et	et	PROPN
chd-99	210	31	al	al	PROPN
chd-99	210	32	.	.	PROPN
chd-99	210	33	,	,	PUNCT
chd-99	210	34	1999	1999	NUM
chd-99	210	35	)	)	PUNCT
chd-99	210	36	.	.	PUNCT
chd-99	211	1	there	there	PRON
chd-99	211	2	are	be	VERB
chd-99	211	3	multiple	multiple	ADJ
chd-99	211	4	studies	study	NOUN
chd-99	211	5	that	that	PRON
chd-99	211	6	have	have	AUX
chd-99	211	7	investigated	investigate	VERB
chd-99	211	8	the	the	DET
chd-99	211	9	role	role	NOUN
chd-99	211	10	of	of	ADP
chd-99	211	11	mir-204	mir-204	NOUN
chd-99	211	12	in	in	ADP
chd-99	211	13	solid	solid	ADJ
chd-99	211	14	cancers	cancer	NOUN
chd-99	211	15	,	,	PUNCT
chd-99	211	16	including	include	VERB
chd-99	211	17	melanoma	melanoma	NOUN
chd-99	211	18	,	,	PUNCT
chd-99	211	19	glioma	glioma	NOUN
chd-99	211	20	,	,	PUNCT
chd-99	211	21	nsclc	nsclc	NOUN
chd-99	211	22	,	,	PUNCT
chd-99	211	23	bladder	bladder	NOUN
chd-99	211	24	cancer	cancer	NOUN
chd-99	211	25	,	,	PUNCT
chd-99	211	26	gastric	gastric	ADJ
chd-99	211	27	cancer	cancer	NOUN
chd-99	211	28	,	,	PUNCT
chd-99	211	29	head	head	NOUN
chd-99	211	30	and	and	CCONJ
chd-99	211	31	neck	neck	NOUN
chd-99	211	32	cancer	cancer	NOUN
chd-99	211	33	,	,	PUNCT
chd-99	211	34	and	and	CCONJ
chd-99	211	35	endometrial	endometrial	ADJ
chd-99	211	36	cancer	cancer	NOUN
chd-99	211	37	.	.	PUNCT
chd-99	212	1	these	these	DET
chd-99	212	2	studies	study	NOUN
chd-99	212	3	have	have	AUX
chd-99	212	4	all	all	PRON
chd-99	212	5	reported	report	VERB
chd-99	212	6	reduced	reduced	ADJ
chd-99	212	7	levels	level	NOUN
chd-99	212	8	of	of	ADP
chd-99	212	9	mir-204	mir-204	NOUN
chd-99	212	10	in	in	ADP
chd-99	212	11	these	these	DET
chd-99	212	12	solid	solid	ADJ
chd-99	212	13	cancers	cancer	NOUN
chd-99	212	14	(	(	PUNCT
chd-99	212	15	chung	chung	PROPN
chd-99	212	16	et	et	PROPN
chd-99	212	17	al	al	PROPN
chd-99	212	18	.	.	PROPN
chd-99	212	19	,	,	PUNCT
chd-99	212	20	2012	2012	NUM
chd-99	212	21	;	;	PUNCT
chd-99	212	22	lam	lam	PROPN
chd-99	212	23	et	et	PROPN
chd-99	212	24	al	al	PROPN
chd-99	212	25	.	.	PROPN
chd-99	212	26	,	,	PUNCT
chd-99	212	27	2011	2011	NUM
chd-99	212	28	;	;	PUNCT
chd-99	212	29	schultz	schultz	PROPN
chd-99	212	30	et	et	PROPN
chd-99	212	31	al	al	PROPN
chd-99	212	32	.	.	PROPN
chd-99	212	33	,	,	PUNCT
chd-99	212	34	2008	2008	NUM
chd-99	212	35	;	;	PUNCT
chd-99	212	36	xia	xia	PROPN
chd-99	212	37	et	et	PROPN
chd-99	212	38	al	al	PROPN
chd-99	212	39	.	.	PROPN
chd-99	212	40	,	,	PUNCT
chd-99	212	41	2014	2014	NUM
chd-99	212	42	)	)	PUNCT
chd-99	212	43	.	.	PUNCT
chd-99	213	1	however	however	ADV
chd-99	213	2	,	,	PUNCT
chd-99	213	3	with	with	ADP
chd-99	213	4	respect	respect	NOUN
chd-99	213	5	to	to	ADP
chd-99	213	6	hormonally	hormonally	ADV
chd-99	213	7	driven	drive	VERB
chd-99	213	8	cancers	cancer	NOUN
chd-99	213	9	,	,	PUNCT
chd-99	213	10	e.g.	e.g.	ADV
chd-99	213	11	,	,	PUNCT
chd-99	213	12	prostate	prostate	NOUN
chd-99	213	13	and	and	CCONJ
chd-99	213	14	breast	breast	NOUN
chd-99	213	15	,	,	PUNCT
chd-99	213	16	the	the	DET
chd-99	213	17	story	story	NOUN
chd-99	213	18	appears	appear	VERB
chd-99	213	19	to	to	PART
chd-99	213	20	be	be	AUX
chd-99	213	21	more	more	ADV
chd-99	213	22	complex	complex	ADJ
chd-99	213	23	.	.	PUNCT
chd-99	214	1	our	our	PRON
chd-99	214	2	group	group	NOUN
chd-99	214	3	and	and	CCONJ
chd-99	214	4	others	other	NOUN
chd-99	214	5	have	have	AUX
chd-99	214	6	shown	show	VERB
chd-99	214	7	that	that	SCONJ
chd-99	214	8	mir-204	mir-204	NOUN
chd-99	214	9	levels	level	NOUN
chd-99	214	10	are	be	AUX
chd-99	214	11	significantly	significantly	ADV
chd-99	214	12	elevated	elevate	VERB
chd-99	214	13	in	in	ADP
chd-99	214	14	breast	breast	NOUN
chd-99	214	15	cancer	cancer	NOUN
chd-99	214	16	samples	sample	NOUN
chd-99	214	17	compared	compare	VERB
chd-99	214	18	to	to	ADP
chd-99	214	19	normal	normal	ADJ
chd-99	214	20	controls	control	NOUN
chd-99	214	21	(	(	PUNCT
chd-99	214	22	findlay	findlay	PROPN
chd-99	214	23	et	et	PROPN
chd-99	214	24	al	al	PROPN
chd-99	214	25	.	.	PROPN
chd-99	214	26	,	,	PUNCT
chd-99	214	27	2008	2008	NUM
chd-99	214	28	;	;	PUNCT
chd-99	215	1	mattie	mattie	PROPN
chd-99	215	2	et	et	PROPN
chd-99	215	3	al	al	PROPN
chd-99	215	4	.	.	PROPN
chd-99	215	5	,	,	PUNCT
chd-99	215	6	2006	2006	NUM
chd-99	215	7	)	)	PUNCT
chd-99	215	8	.	.	PUNCT
chd-99	216	1	published	publish	VERB
chd-99	216	2	studies	study	NOUN
chd-99	216	3	also	also	ADV
chd-99	216	4	suggest	suggest	VERB
chd-99	216	5	its	its	PRON
chd-99	216	6	role	role	NOUN
chd-99	216	7	as	as	ADP
chd-99	216	8	a	a	DET
chd-99	216	9	tumor	tumor	NOUN
chd-99	216	10	suppressor	suppressor	NOUN
chd-99	216	11	in	in	ADP
chd-99	216	12	breast	breast	NOUN
chd-99	216	13	cancer	cancer	NOUN
chd-99	216	14	(	(	PUNCT
chd-99	216	15	li	li	PROPN
chd-99	216	16	et	et	PROPN
chd-99	216	17	al	al	PROPN
chd-99	216	18	.	.	PROPN
chd-99	216	19	,	,	PUNCT
chd-99	216	20	2014	2014	NUM
chd-99	216	21	)	)	PUNCT
chd-99	216	22	.	.	PUNCT
chd-99	217	1	more	more	ADV
chd-99	217	2	recently	recently	ADV
chd-99	217	3	,	,	PUNCT
chd-99	217	4	two	two	NUM
chd-99	217	5	studies	study	NOUN
chd-99	217	6	were	be	AUX
chd-99	217	7	published	publish	VERB
chd-99	217	8	by	by	ADP
chd-99	217	9	independent	independent	ADJ
chd-99	217	10	groups	group	NOUN
chd-99	217	11	that	that	PRON
chd-99	217	12	support	support	VERB
chd-99	217	13	the	the	DET
chd-99	217	14	role	role	NOUN
chd-99	217	15	of	of	ADP
chd-99	217	16	mir204	mir204	PROPN
chd-99	217	17	acting	act	VERB
chd-99	217	18	as	as	ADP
chd-99	217	19	an	an	DET
chd-99	217	20	oncogene	oncogene	NOUN
chd-99	217	21	,	,	PUNCT
chd-99	217	22	or	or	CCONJ
chd-99	217	23	“	"	PUNCT
chd-99	217	24	oncomir	oncomir	PROPN
chd-99	217	25	”	"	PUNCT
chd-99	217	26	,	,	PUNCT
chd-99	217	27	in	in	ADP
chd-99	217	28	cancer	cancer	NOUN
chd-99	217	29	(	(	PUNCT
chd-99	217	30	lee	lee	PROPN
chd-99	217	31	et	et	PROPN
chd-99	217	32	al	al	PROPN
chd-99	217	33	.	.	PROPN
chd-99	217	34	,	,	PUNCT
chd-99	217	35	2016	2016	NUM
chd-99	217	36	;	;	PUNCT
chd-99	217	37	todorova	todorova	X
chd-99	217	38	et	et	PROPN
chd-99	217	39	al	al	PROPN
chd-99	217	40	.	.	PROPN
chd-99	217	41	,	,	PUNCT
chd-99	217	42	2016	2016	NUM
chd-99	217	43	)	)	PUNCT
chd-99	217	44	.	.	PUNCT
chd-99	218	1	the	the	DET
chd-99	218	2	first	first	ADJ
chd-99	218	3	was	be	AUX
chd-99	218	4	a	a	DET
chd-99	218	5	study	study	NOUN
chd-99	218	6	aimed	aim	VERB
chd-99	218	7	at	at	ADP
chd-99	218	8	solving	solve	VERB
chd-99	218	9	the	the	DET
chd-99	218	10	controversy	controversy	NOUN
chd-99	218	11	surrounding	surround	VERB
chd-99	218	12	the	the	DET
chd-99	218	13	seemingly	seemingly	ADV
chd-99	218	14	opposing	opposing	ADJ
chd-99	218	15	effects	effect	NOUN
chd-99	218	16	of	of	ADP
chd-99	218	17	mir-204	mir-204	NOUN
chd-99	218	18	in	in	ADP
chd-99	218	19	breast	breast	NOUN
chd-99	218	20	cancer	cancer	NOUN
chd-99	218	21	(	(	PUNCT
chd-99	218	22	lee	lee	PROPN
chd-99	218	23	et	et	PROPN
chd-99	218	24	al	al	PROPN
chd-99	218	25	.	.	PROPN
chd-99	218	26	,	,	PUNCT
chd-99	218	27	2016	2016	NUM
chd-99	218	28	)	)	PUNCT
chd-99	218	29	.	.	PUNCT
chd-99	219	1	they	they	PRON
chd-99	219	2	performed	perform	VERB
chd-99	219	3	genome	genome	NOUN
chd-99	219	4	wide	wide	ADJ
chd-99	219	5	pathway	pathway	NOUN
chd-99	219	6	analysis	analysis	NOUN
chd-99	219	7	and	and	CCONJ
chd-99	219	8	showed	show	VERB
chd-99	219	9	definitively	definitively	ADV
chd-99	219	10	that	that	SCONJ
chd-99	219	11	many	many	ADJ
chd-99	219	12	of	of	ADP
chd-99	219	13	the	the	DET
chd-99	219	14	mir-204	mir-204	NOUN
chd-99	219	15	target	target	NOUN
chd-99	219	16	genes	gene	NOUN
chd-99	219	17	are	be	AUX
chd-99	219	18	tumor	tumor	NOUN
chd-99	219	19	suppressors	suppressor	NOUN
chd-99	219	20	.	.	PUNCT
chd-99	220	1	it	it	PRON
chd-99	220	2	is	be	AUX
chd-99	220	3	this	this	DET
chd-99	220	4	characteristic	characteristic	ADJ
chd-99	220	5	that	that	PRON
chd-99	220	6	drives	drive	VERB
chd-99	220	7	the	the	DET
chd-99	220	8	breast	breast	NOUN
chd-99	220	9	cells	cell	NOUN
chd-99	220	10	towards	towards	ADP
chd-99	220	11	being	be	AUX
chd-99	220	12	oncogenic	oncogenic	ADJ
chd-99	220	13	.	.	PUNCT
chd-99	221	1	however	however	ADV
chd-99	221	2	,	,	PUNCT
chd-99	221	3	they	they	PRON
chd-99	221	4	agree	agree	VERB
chd-99	221	5	and	and	CCONJ
chd-99	221	6	support	support	VERB
chd-99	221	7	the	the	DET
chd-99	221	8	idea	idea	NOUN
chd-99	221	9	that	that	SCONJ
chd-99	221	10	context	context	NOUN
chd-99	221	11	is	be	AUX
chd-99	221	12	important	important	ADJ
chd-99	221	13	,	,	PUNCT
chd-99	221	14	and	and	CCONJ
chd-99	221	15	the	the	DET
chd-99	221	16	potential	potential	ADJ
chd-99	221	17	dual	dual	ADJ
chd-99	221	18	activity	activity	NOUN
chd-99	221	19	requires	require	VERB
chd-99	221	20	further	further	ADJ
chd-99	221	21	investigation	investigation	NOUN
chd-99	221	22	.	.	PUNCT
chd-99	222	1	the	the	DET
chd-99	222	2	second	second	ADJ
chd-99	222	3	paper	paper	NOUN
chd-99	222	4	,	,	PUNCT
chd-99	222	5	recently	recently	ADV
chd-99	222	6	published	publish	VERB
chd-99	222	7	,	,	PUNCT
chd-99	222	8	investigated	investigate	VERB
chd-99	222	9	specifically	specifically	ADV
chd-99	222	10	the	the	DET
chd-99	222	11	proposed	propose	VERB
chd-99	222	12	dual	dual	ADJ
chd-99	222	13	role	role	NOUN
chd-99	222	14	of	of	ADP
chd-99	222	15	mir-204	mir-204	NOUN
chd-99	222	16	in	in	ADP
chd-99	222	17	cancer	cancer	NOUN
chd-99	222	18	(	(	PUNCT
chd-99	222	19	todorova	todorova	X
chd-99	222	20	et	et	PROPN
chd-99	222	21	al	al	PROPN
chd-99	222	22	.	.	PROPN
chd-99	222	23	,	,	PUNCT
chd-99	222	24	2016	2016	NUM
chd-99	222	25	)	)	PUNCT
chd-99	222	26	.	.	PUNCT
chd-99	223	1	this	this	DET
chd-99	223	2	study	study	NOUN
chd-99	223	3	showed	show	VERB
chd-99	223	4	that	that	SCONJ
chd-99	223	5	the	the	DET
chd-99	223	6	genomic	genomic	ADJ
chd-99	223	7	instability	instability	NOUN
chd-99	223	8	incurred	incur	VERB
chd-99	223	9	rearrangement	rearrangement	NOUN
chd-99	223	10	could	could	AUX
chd-99	223	11	turn	turn	VERB
chd-99	223	12	tumor	tumor	NOUN
chd-99	223	13	suppressor	suppressor	NOUN
chd-99	223	14	mirnas	mirna	NOUN
chd-99	223	15	into	into	ADP
chd-99	223	16	pro	pro	ADJ
chd-99	223	17	-	-	ADJ
chd-99	223	18	oncogenic	oncogenic	ADJ
chd-99	223	19	ones	one	NOUN
chd-99	223	20	,	,	PUNCT
chd-99	223	21	using	use	VERB
chd-99	223	22	metastatic	metastatic	ADJ
chd-99	223	23	prostate	prostate	NOUN
chd-99	223	24	cancer	cancer	NOUN
chd-99	223	25	as	as	ADP
chd-99	223	26	a	a	DET
chd-99	223	27	model	model	NOUN
chd-99	223	28	system	system	NOUN
chd-99	223	29	.	.	PUNCT
chd-99	224	1	both	both	DET
chd-99	224	2	studies	study	NOUN
chd-99	224	3	clearly	clearly	ADV
chd-99	224	4	demonstrate	demonstrate	VERB
chd-99	224	5	a	a	DET
chd-99	224	6	dual	dual	ADJ
chd-99	224	7	role	role	NOUN
chd-99	224	8	for	for	ADP
chd-99	224	9	mir-204	mir-204	NOUN
chd-99	224	10	depending	depend	VERB
chd-99	224	11	on	on	ADP
chd-99	224	12	context	context	NOUN
chd-99	224	13	.	.	PUNCT
chd-99	225	1	furthermore	furthermore	ADV
chd-99	225	2	,	,	PUNCT
chd-99	225	3	a	a	DET
chd-99	225	4	study	study	NOUN
chd-99	225	5	in	in	ADP
chd-99	225	6	prostate	prostate	NOUN
chd-99	225	7	cancer	cancer	NOUN
chd-99	225	8	showed	show	VERB
chd-99	225	9	a	a	DET
chd-99	225	10	dual	dual	ADJ
chd-99	225	11	role	role	NOUN
chd-99	225	12	for	for	ADP
chd-99	225	13	mir-204	mir-204	NOUN
chd-99	225	14	depending	depend	VERB
chd-99	225	15	additionally	additionally	ADV
chd-99	225	16	on	on	ADP
chd-99	225	17	the	the	DET
chd-99	225	18	subtype	subtype	NOUN
chd-99	225	19	of	of	ADP
chd-99	225	20	prostate	prostate	NOUN
chd-99	225	21	cancer	cancer	NOUN
chd-99	225	22	in	in	ADP
chd-99	225	23	which	which	PRON
chd-99	225	24	it	it	PRON
chd-99	225	25	was	be	AUX
chd-99	225	26	expressed	express	VERB
chd-99	225	27	(	(	PUNCT
chd-99	225	28	ding	ding	NOUN
chd-99	225	29	et	et	PROPN
chd-99	225	30	al	al	PROPN
chd-99	225	31	.	.	PROPN
chd-99	225	32	,	,	PUNCT
chd-99	225	33	2015	2015	NUM
chd-99	225	34	)	)	PUNCT
chd-99	225	35	.	.	PUNCT
chd-99	226	1	in	in	ADP
chd-99	226	2	brief	brief	NOUN
chd-99	226	3	,	,	PUNCT
chd-99	226	4	the	the	DET
chd-99	226	5	authors	author	NOUN
chd-99	226	6	show	show	VERB
chd-99	226	7	that	that	SCONJ
chd-99	226	8	in	in	ADP
chd-99	226	9	the	the	DET
chd-99	226	10	context	context	NOUN
chd-99	226	11	of	of	ADP
chd-99	226	12	androgen	androgen	NOUN
chd-99	226	13	receptor	receptor	NOUN
chd-99	226	14	positive	positive	ADJ
chd-99	226	15	(	(	PUNCT
chd-99	226	16	ar+	ar+	NOUN
chd-99	226	17	)	)	PUNCT
chd-99	226	18	prostate	prostate	NOUN
chd-99	226	19	adenocarcinoma	adenocarcinoma	NOUN
chd-99	226	20	,	,	PUNCT
chd-99	226	21	mir-204	mir-204	NOUN
chd-99	226	22	functions	function	NOUN
chd-99	226	23	as	as	ADP
chd-99	226	24	a	a	DET
chd-99	226	25	tumor	tumor	NOUN
chd-99	226	26	suppressor	suppressor	NOUN
chd-99	226	27	.	.	PUNCT
chd-99	227	1	however	however	ADV
chd-99	227	2	,	,	PUNCT
chd-99	227	3	in	in	ADP
chd-99	227	4	the	the	DET
chd-99	227	5	context	context	NOUN
chd-99	227	6	of	of	ADP
chd-99	227	7	androgen	androgen	NOUN
chd-99	227	8	receptor	receptor	NOUN
chd-99	227	9	negative	negative	ADJ
chd-99	227	10	(	(	PUNCT
chd-99	227	11	ar-	ar-	NOUN
chd-99	227	12	)	)	PUNCT
chd-99	227	13	neuroendocrine	neuroendocrine	NOUN
chd-99	227	14	prostate	prostate	NOUN
chd-99	227	15	cancer	cancer	NOUN
chd-99	227	16	,	,	PUNCT
chd-99	227	17	mir-204	mir-204	NOUN
chd-99	227	18	functions	function	NOUN
chd-99	227	19	as	as	ADP
chd-99	227	20	an	an	DET
chd-99	227	21	oncogene	oncogene	NOUN
chd-99	227	22	.	.	PUNCT
chd-99	228	1	the	the	DET
chd-99	228	2	dual	dual	ADJ
chd-99	228	3	regulatory	regulatory	ADJ
chd-99	228	4	role	role	NOUN
chd-99	228	5	of	of	ADP
chd-99	228	6	mir-204	mir-204	NOUN
chd-99	228	7	in	in	ADP
chd-99	228	8	cancer	cancer	NOUN
chd-99	228	9	was	be	AUX
chd-99	228	10	recently	recently	ADV
chd-99	228	11	reviewed	review	VERB
chd-99	228	12	and	and	CCONJ
chd-99	228	13	highlighted	highlight	VERB
chd-99	228	14	the	the	DET
chd-99	228	15	fact	fact	NOUN
chd-99	228	16	that	that	SCONJ
chd-99	228	17	the	the	DET
chd-99	228	18	cell	cell	NOUN
chd-99	228	19	type	type	NOUN
chd-99	228	20	in	in	ADP
chd-99	228	21	which	which	PRON
chd-99	228	22	mir-204	mir-204	NOUN
chd-99	228	23	is	be	AUX
chd-99	228	24	being	be	AUX
chd-99	228	25	expressed	express	VERB
chd-99	228	26	,	,	PUNCT
chd-99	228	27	as	as	ADV
chd-99	228	28	well	well	ADV
chd-99	228	29	as	as	ADP
chd-99	228	30	the	the	DET
chd-99	228	31	makeup	makeup	NOUN
chd-99	228	32	of	of	ADP
chd-99	228	33	that	that	DET
chd-99	228	34	cell	cell	NOUN
chd-99	228	35	,	,	PUNCT
chd-99	228	36	are	be	AUX
chd-99	228	37	critical	critical	ADJ
chd-99	228	38	to	to	ADP
chd-99	228	39	the	the	DET
chd-99	228	40	function	function	NOUN
chd-99	228	41	of	of	ADP
chd-99	228	42	mir204	mir204	NOUN
chd-99	228	43	within	within	ADP
chd-99	228	44	that	that	DET
chd-99	228	45	cell	cell	NOUN
chd-99	228	46	(	(	PUNCT
chd-99	228	47	li	li	PROPN
chd-99	228	48	et	et	PROPN
chd-99	228	49	al	al	PROPN
chd-99	228	50	.	.	PROPN
chd-99	228	51	,	,	PUNCT
chd-99	228	52	2016	2016	NUM
chd-99	228	53	)	)	PUNCT
chd-99	228	54	.	.	PUNCT
chd-99	229	1	more	more	ADJ
chd-99	229	2	studies	study	NOUN
chd-99	229	3	are	be	AUX
chd-99	229	4	required	require	VERB
chd-99	229	5	to	to	PART
chd-99	229	6	determine	determine	VERB
chd-99	229	7	whether	whether	SCONJ
chd-99	229	8	the	the	DET
chd-99	229	9	role	role	NOUN
chd-99	229	10	of	of	ADP
chd-99	229	11	mir-204	mir-204	NOUN
chd-99	229	12	in	in	ADP
chd-99	229	13	breast	breast	NOUN
chd-99	229	14	cancer	cancer	NOUN
chd-99	229	15	is	be	AUX
chd-99	229	16	also	also	ADV
chd-99	229	17	dependent	dependent	ADJ
chd-99	229	18	upon	upon	SCONJ
chd-99	229	19	ar	ar	NOUN
chd-99	229	20	expression	expression	NOUN
chd-99	229	21	,	,	PUNCT
chd-99	229	22	an	an	DET
chd-99	229	23	understudied	understudied	ADJ
chd-99	229	24	receptor	receptor	NOUN
chd-99	229	25	in	in	ADP
chd-99	229	26	the	the	DET
chd-99	229	27	breast	breast	NOUN
chd-99	229	28	cancer	cancer	NOUN
chd-99	229	29	field	field	NOUN
chd-99	229	30	.	.	PUNCT
chd-99	230	1	of	of	ADP
chd-99	230	2	interest	interest	NOUN
chd-99	230	3	,	,	PUNCT
chd-99	230	4	a	a	DET
chd-99	230	5	study	study	NOUN
chd-99	230	6	was	be	AUX
chd-99	230	7	recently	recently	ADV
chd-99	230	8	published	publish	VERB
chd-99	230	9	showing	show	VERB
chd-99	230	10	a	a	DET
chd-99	230	11	positive	positive	ADJ
chd-99	230	12	correlation	correlation	NOUN
chd-99	230	13	between	between	ADP
chd-99	230	14	ar	ar	NOUN
chd-99	230	15	expression	expression	NOUN
chd-99	230	16	and	and	CCONJ
chd-99	230	17	pdef	pdef	NOUN
chd-99	230	18	in	in	ADP
chd-99	230	19	breast	breast	NOUN
chd-99	230	20	cancer	cancer	NOUN
chd-99	230	21	(	(	PUNCT
chd-99	230	22	cao	cao	PROPN
chd-99	230	23	et	et	PROPN
chd-99	230	24	al	al	PROPN
chd-99	230	25	.	.	PROPN
chd-99	230	26	,	,	PUNCT
chd-99	230	27	2018	2018	NUM
chd-99	230	28	)	)	PUNCT
chd-99	230	29	.	.	PUNCT
chd-99	231	1	this	this	PRON
chd-99	231	2	is	be	AUX
chd-99	231	3	important	important	ADJ
chd-99	231	4	in	in	ADP
chd-99	231	5	the	the	DET
chd-99	231	6	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	NUM
chd-99	231	7	e14	e14	NOUN
chd-99	231	8	cancer	cancer	NOUN
chd-99	231	9	health	health	NOUN
chd-99	231	10	disparities	disparity	NOUN
chd-99	231	11	research	research	NOUN
chd-99	231	12	discussion	discussion	NOUN
chd-99	231	13	of	of	ADP
chd-99	231	14	mir-204	mir-204	NOUN
chd-99	231	15	as	as	ADP
chd-99	231	16	(	(	PUNCT
chd-99	231	17	i	i	NOUN
chd-99	231	18	)	)	PUNCT
chd-99	231	19	pdef	pdef	NOUN
chd-99	231	20	was	be	AUX
chd-99	231	21	one	one	NUM
chd-99	231	22	of	of	ADP
chd-99	231	23	the	the	DET
chd-99	231	24	first	first	ADJ
chd-99	231	25	identified	identify	VERB
chd-99	231	26	targets	target	NOUN
chd-99	231	27	for	for	ADP
chd-99	231	28	mir-204	mir-204	NOUN
chd-99	231	29	in	in	ADP
chd-99	231	30	breast	breast	NOUN
chd-99	231	31	cancer	cancer	NOUN
chd-99	231	32	(	(	PUNCT
chd-99	231	33	findlay	findlay	PROPN
chd-99	231	34	et	et	PROPN
chd-99	231	35	al	al	PROPN
chd-99	231	36	.	.	PROPN
chd-99	231	37	,	,	PUNCT
chd-99	231	38	2008	2008	NUM
chd-99	231	39	)	)	PUNCT
chd-99	231	40	;	;	PUNCT
chd-99	231	41	and	and	CCONJ
chd-99	231	42	(	(	PUNCT
chd-99	231	43	ii	ii	NOUN
chd-99	231	44	)	)	PUNCT
chd-99	231	45	we	we	PRON
chd-99	231	46	observed	observe	VERB
chd-99	231	47	a	a	DET
chd-99	231	48	neuroendocrine	neuroendocrine	ADJ
chd-99	231	49	pathology	pathology	NOUN
chd-99	231	50	in	in	ADP
chd-99	231	51	mammary	mammary	ADJ
chd-99	231	52	tumors	tumor	NOUN
chd-99	231	53	derived	derive	VERB
chd-99	231	54	from	from	ADP
chd-99	231	55	our	our	PRON
chd-99	231	56	204	204	NUM
chd-99	231	57	tg	tg	PROPN
chd-99	231	58	animals	animal	NOUN
chd-99	231	59	and	and	CCONJ
chd-99	231	60	neuroendocrine	neuroendocrine	NOUN
chd-99	231	61	prostate	prostate	NOUN
chd-99	231	62	tumors	tumor	NOUN
chd-99	231	63	are	be	AUX
chd-99	231	64	known	know	VERB
chd-99	231	65	to	to	PART
chd-99	231	66	be	be	AUX
chd-99	231	67	ar	ar	ADP
chd-99	231	68	negative	negative	ADJ
chd-99	231	69	(	(	PUNCT
chd-99	231	70	tsai	tsai	PROPN
chd-99	231	71	et	et	PROPN
chd-99	231	72	al	al	PROPN
chd-99	231	73	.	.	PROPN
chd-99	231	74	,	,	PUNCT
chd-99	231	75	2017	2017	NUM
chd-99	231	76	)	)	PUNCT
chd-99	231	77	.	.	PUNCT
chd-99	232	1	our	our	PRON
chd-99	232	2	studies	study	NOUN
chd-99	232	3	support	support	VERB
chd-99	232	4	the	the	DET
chd-99	232	5	working	work	VERB
chd-99	232	6	hypothesis	hypothesis	NOUN
chd-99	232	7	that	that	PRON
chd-99	232	8	mir-204	mir-204	NOUN
chd-99	232	9	mediated	mediate	VERB
chd-99	232	10	inhibition	inhibition	NOUN
chd-99	232	11	of	of	ADP
chd-99	232	12	igf2r	igf2r	PROPN
chd-99	232	13	frees	free	VERB
chd-99	232	14	igf2	igf2	PROPN
chd-99	232	15	to	to	PART
chd-99	232	16	bind	bind	VERB
chd-99	232	17	the	the	DET
chd-99	232	18	igf1r	igf1r	PROPN
chd-99	232	19	leading	leading	NOUN
chd-99	232	20	to	to	ADP
chd-99	232	21	hyperactivation	hyperactivation	NOUN
chd-99	232	22	of	of	ADP
chd-99	232	23	this	this	DET
chd-99	232	24	pathway	pathway	NOUN
chd-99	232	25	,	,	PUNCT
chd-99	232	26	resulting	result	VERB
chd-99	232	27	in	in	ADP
chd-99	232	28	increased	increase	VERB
chd-99	232	29	proliferation	proliferation	NOUN
chd-99	232	30	,	,	PUNCT
chd-99	232	31	migration	migration	NOUN
chd-99	232	32	and	and	CCONJ
chd-99	232	33	invasion	invasion	NOUN
chd-99	232	34	,	,	PUNCT
chd-99	232	35	processes	process	NOUN
chd-99	232	36	required	require	VERB
chd-99	232	37	for	for	ADP
chd-99	232	38	tumor	tumor	NOUN
chd-99	232	39	progression	progression	NOUN
chd-99	232	40	(	(	PUNCT
chd-99	232	41	figure	figure	NOUN
chd-99	232	42	6	6	NUM
chd-99	232	43	)	)	PUNCT
chd-99	232	44	.	.	PUNCT
chd-99	233	1	the	the	DET
chd-99	233	2	generation	generation	NOUN
chd-99	233	3	and	and	CCONJ
chd-99	233	4	utility	utility	NOUN
chd-99	233	5	of	of	ADP
chd-99	233	6	an	an	DET
chd-99	233	7	in	in	ADP
chd-99	233	8	vivo	vivo	NOUN
chd-99	233	9	model	model	NOUN
chd-99	233	10	for	for	ADP
chd-99	233	11	mir-204	mir-204	NOUN
chd-99	233	12	is	be	AUX
chd-99	233	13	a	a	DET
chd-99	233	14	more	more	ADV
chd-99	233	15	physiologically	physiologically	ADV
chd-99	233	16	representative	representative	ADJ
chd-99	233	17	model	model	NOUN
chd-99	233	18	than	than	ADP
chd-99	233	19	cells	cell	NOUN
chd-99	233	20	grown	grow	VERB
chd-99	233	21	in	in	ADP
chd-99	233	22	culture	culture	NOUN
chd-99	233	23	.	.	PUNCT
chd-99	234	1	our	our	PRON
chd-99	234	2	development	development	NOUN
chd-99	234	3	of	of	ADP
chd-99	234	4	a	a	DET
chd-99	234	5	unique	unique	ADJ
chd-99	234	6	inducible	inducible	ADJ
chd-99	234	7	transgenic	transgenic	NOUN
chd-99	234	8	mouse	mouse	NOUN
chd-99	234	9	model	model	NOUN
chd-99	234	10	has	have	AUX
chd-99	234	11	allowed	allow	VERB
chd-99	234	12	us	we	PRON
chd-99	234	13	to	to	PART
chd-99	234	14	investigate	investigate	VERB
chd-99	234	15	the	the	DET
chd-99	234	16	oncogenic	oncogenic	ADJ
chd-99	234	17	potential	potential	NOUN
chd-99	234	18	of	of	ADP
chd-99	234	19	mir-204	mir-204	NOUN
chd-99	234	20	and	and	CCONJ
chd-99	234	21	furthermore	furthermore	ADV
chd-99	234	22	,	,	PUNCT
chd-99	234	23	has	have	AUX
chd-99	234	24	provided	provide	VERB
chd-99	234	25	compelling	compelling	ADJ
chd-99	234	26	data	datum	NOUN
chd-99	234	27	to	to	PART
chd-99	234	28	help	help	VERB
chd-99	234	29	resolve	resolve	VERB
chd-99	234	30	the	the	DET
chd-99	234	31	controversy	controversy	NOUN
chd-99	234	32	surrounding	surround	VERB
chd-99	234	33	the	the	DET
chd-99	234	34	role	role	NOUN
chd-99	234	35	of	of	ADP
chd-99	234	36	mir-204	mir-204	NOUN
chd-99	234	37	in	in	ADP
chd-99	234	38	a	a	DET
chd-99	234	39	cellular	cellular	ADJ
chd-99	234	40	context	context	NOUN
chd-99	234	41	.	.	PUNCT
chd-99	235	1	histologically	histologically	ADV
chd-99	235	2	,	,	PUNCT
chd-99	235	3	the	the	DET
chd-99	235	4	tumors	tumor	NOUN
chd-99	235	5	that	that	PRON
chd-99	235	6	developed	develop	VERB
chd-99	235	7	in	in	ADP
chd-99	235	8	the	the	DET
chd-99	235	9	mir-204	mir-204	NOUN
chd-99	235	10	transgenic	transgenic	NOUN
chd-99	235	11	mice	mouse	NOUN
chd-99	235	12	were	be	AUX
chd-99	235	13	distinct	distinct	ADJ
chd-99	235	14	from	from	ADP
chd-99	235	15	the	the	DET
chd-99	235	16	control	control	NOUN
chd-99	235	17	non	non	ADJ
chd-99	235	18	-	-	ADJ
chd-99	235	19	transgenic	transgenic	ADJ
chd-99	235	20	mice	mouse	NOUN
chd-99	235	21	.	.	PUNCT
chd-99	236	1	we	we	PRON
chd-99	236	2	observed	observe	VERB
chd-99	236	3	increased	increase	VERB
chd-99	236	4	vasculature	vasculature	NOUN
chd-99	236	5	and	and	CCONJ
chd-99	236	6	a	a	DET
chd-99	236	7	more	more	ADV
chd-99	236	8	spindle	spindle	NOUN
chd-99	236	9	-	-	PUNCT
chd-99	236	10	like	like	ADJ
chd-99	236	11	appearance	appearance	NOUN
chd-99	236	12	,	,	PUNCT
chd-99	236	13	indicative	indicative	ADJ
chd-99	236	14	of	of	ADP
chd-99	236	15	neuroendocrine	neuroendocrine	ADJ
chd-99	236	16	differentiation	differentiation	NOUN
chd-99	236	17	.	.	PUNCT
chd-99	237	1	this	this	PRON
chd-99	237	2	has	have	VERB
chd-99	237	3	potential	potential	ADJ
chd-99	237	4	interest	interest	NOUN
chd-99	237	5	based	base	VERB
chd-99	237	6	on	on	ADP
chd-99	237	7	the	the	DET
chd-99	237	8	observation	observation	NOUN
chd-99	237	9	mentioned	mention	VERB
chd-99	237	10	above	above	ADV
chd-99	237	11	that	that	PRON
chd-99	237	12	mir-204	mir-204	NOUN
chd-99	237	13	is	be	AUX
chd-99	237	14	specifically	specifically	ADV
chd-99	237	15	expressed	express	VERB
chd-99	237	16	and	and	CCONJ
chd-99	237	17	functions	function	NOUN
chd-99	237	18	as	as	ADP
chd-99	237	19	on	on	ADP
chd-99	237	20	oncomir	oncomir	PROPN
chd-99	237	21	in	in	ADP
chd-99	237	22	neuroendocrine	neuroendocrine	ADJ
chd-99	237	23	prostate	prostate	NOUN
chd-99	237	24	cancer	cancer	NOUN
chd-99	237	25	.	.	PUNCT
chd-99	238	1	future	future	ADJ
chd-99	238	2	studies	study	NOUN
chd-99	238	3	aimed	aim	VERB
chd-99	238	4	at	at	ADP
chd-99	238	5	investigating	investigate	VERB
chd-99	238	6	the	the	DET
chd-99	238	7	potential	potential	ADJ
chd-99	238	8	role	role	NOUN
chd-99	238	9	of	of	ADP
chd-99	238	10	mir-204	mir-204	NOUN
chd-99	238	11	in	in	ADP
chd-99	238	12	driving	drive	VERB
chd-99	238	13	neuroendocrine	neuroendocrine	ADJ
chd-99	238	14	differentiation	differentiation	NOUN
chd-99	238	15	in	in	ADP
chd-99	238	16	tumors	tumor	NOUN
chd-99	238	17	may	may	AUX
chd-99	238	18	have	have	VERB
chd-99	238	19	implications	implication	NOUN
chd-99	238	20	for	for	ADP
chd-99	238	21	both	both	CCONJ
chd-99	238	22	prostate	prostate	NOUN
chd-99	238	23	and	and	CCONJ
chd-99	238	24	breast	breast	NOUN
chd-99	238	25	cancers	cancer	NOUN
chd-99	238	26	.	.	PUNCT
chd-99	239	1	figure	figure	VERB
chd-99	239	2	6	6	NUM
chd-99	239	3	:	:	PUNCT
chd-99	239	4	schematic	schematic	ADJ
chd-99	239	5	model	model	NOUN
chd-99	239	6	of	of	ADP
chd-99	239	7	our	our	PRON
chd-99	239	8	proposed	propose	VERB
chd-99	239	9	mechanism	mechanism	NOUN
chd-99	239	10	for	for	ADP
chd-99	239	11	mir-204	mir-204	NOUN
chd-99	239	12	mediated	mediate	VERB
chd-99	239	13	tumor	tumor	NOUN
chd-99	239	14	progression	progression	NOUN
chd-99	239	15	.	.	PUNCT
chd-99	240	1	in	in	ADP
chd-99	240	2	normal	normal	ADJ
chd-99	240	3	(	(	PUNCT
chd-99	240	4	low	low	ADJ
chd-99	240	5	mir-204	mir-204	NOUN
chd-99	240	6	)	)	PUNCT
chd-99	240	7	cells	cell	NOUN
chd-99	240	8	,	,	PUNCT
chd-99	240	9	igf2	igf2	PROPN
chd-99	240	10	preferentially	preferentially	ADV
chd-99	240	11	binds	bind	VERB
chd-99	240	12	to	to	ADP
chd-99	240	13	the	the	DET
chd-99	240	14	igf2r	igf2r	PROPN
chd-99	240	15	where	where	SCONJ
chd-99	240	16	it	it	PRON
chd-99	240	17	gets	get	AUX
chd-99	240	18	internalized	internalize	VERB
chd-99	240	19	and	and	CCONJ
chd-99	240	20	degraded	degrade	VERB
chd-99	240	21	by	by	ADP
chd-99	240	22	the	the	DET
chd-99	240	23	lysosomes	lysosome	NOUN
chd-99	240	24	.	.	PUNCT
chd-99	241	1	therefore	therefore	ADV
chd-99	241	2	,	,	PUNCT
chd-99	241	3	igf1r	igf1r	X
chd-99	241	4	signaling	signaling	NOUN
chd-99	241	5	is	be	AUX
chd-99	241	6	kept	keep	VERB
chd-99	241	7	to	to	ADP
chd-99	241	8	a	a	DET
chd-99	241	9	minimum	minimum	NOUN
chd-99	241	10	.	.	PUNCT
chd-99	242	1	however	however	ADV
chd-99	242	2	,	,	PUNCT
chd-99	242	3	in	in	ADP
chd-99	242	4	cancer	cancer	NOUN
chd-99	242	5	(	(	PUNCT
chd-99	242	6	high	high	ADJ
chd-99	242	7	mir-204	mir-204	NOUN
chd-99	242	8	)	)	PUNCT
chd-99	242	9	cells	cell	NOUN
chd-99	242	10	,	,	PUNCT
chd-99	242	11	we	we	PRON
chd-99	242	12	propose	propose	VERB
chd-99	242	13	that	that	SCONJ
chd-99	242	14	mir-204	mir-204	NOUN
chd-99	242	15	mediated	mediate	VERB
chd-99	242	16	inhibition	inhibition	NOUN
chd-99	242	17	of	of	ADP
chd-99	242	18	igf2r	igf2r	PROPN
chd-99	242	19	frees	free	VERB
chd-99	242	20	igf2	igf2	PROPN
chd-99	242	21	to	to	PART
chd-99	242	22	bind	bind	VERB
chd-99	242	23	the	the	DET
chd-99	242	24	igf1r	igf1r	PROPN
chd-99	242	25	leading	leading	NOUN
chd-99	242	26	to	to	ADP
chd-99	242	27	hyperactivation	hyperactivation	NOUN
chd-99	242	28	of	of	ADP
chd-99	242	29	this	this	DET
chd-99	242	30	pathway	pathway	NOUN
chd-99	242	31	resulting	result	VERB
chd-99	242	32	in	in	ADP
chd-99	242	33	increased	increase	VERB
chd-99	242	34	proliferation	proliferation	NOUN
chd-99	242	35	,	,	PUNCT
chd-99	242	36	migration	migration	NOUN
chd-99	242	37	and	and	CCONJ
chd-99	242	38	invasion	invasion	NOUN
chd-99	242	39	,	,	PUNCT
chd-99	242	40	processes	process	NOUN
chd-99	242	41	required	require	VERB
chd-99	242	42	for	for	ADP
chd-99	242	43	tumor	tumor	NOUN
chd-99	242	44	progression	progression	NOUN
chd-99	242	45	.	.	PUNCT
chd-99	243	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	243	2	e15	e15	PROPN
chd-99	243	3	cancer	cancer	NOUN
chd-99	243	4	health	health	NOUN
chd-99	243	5	disparities	disparity	NOUN
chd-99	243	6	research	research	NOUN
chd-99	243	7	reduced	reduce	VERB
chd-99	243	8	igf2r	igf2r	PART
chd-99	243	9	expression	expression	NOUN
chd-99	243	10	correlates	correlate	VERB
chd-99	243	11	with	with	ADP
chd-99	243	12	poor	poor	ADJ
chd-99	243	13	patient	patient	ADJ
chd-99	243	14	prognosis	prognosis	NOUN
chd-99	243	15	in	in	ADP
chd-99	243	16	bc	bc	PROPN
chd-99	243	17	patients	patient	NOUN
chd-99	243	18	(	(	PUNCT
chd-99	243	19	chappell	chappell	NOUN
chd-99	243	20	et	et	PROPN
chd-99	243	21	al	al	PROPN
chd-99	243	22	.	.	PROPN
chd-99	243	23	,	,	PUNCT
chd-99	243	24	1997	1997	NUM
chd-99	243	25	;	;	PUNCT
chd-99	243	26	hankins	hankins	PROPN
chd-99	243	27	et	et	PROPN
chd-99	243	28	al	al	PROPN
chd-99	243	29	.	.	PROPN
chd-99	243	30	,	,	PUNCT
chd-99	243	31	1996	1996	NUM
chd-99	243	32	)	)	PUNCT
chd-99	243	33	,	,	PUNCT
chd-99	243	34	and	and	CCONJ
chd-99	243	35	a	a	DET
chd-99	243	36	recent	recent	ADJ
chd-99	243	37	study	study	NOUN
chd-99	243	38	showed	show	VERB
chd-99	243	39	significantly	significantly	ADV
chd-99	243	40	higher	high	ADJ
chd-99	243	41	levels	level	NOUN
chd-99	243	42	of	of	ADP
chd-99	243	43	igf2r	igf2r	PROPN
chd-99	243	44	in	in	ADP
chd-99	243	45	caucasian	caucasian	ADJ
chd-99	243	46	americans	americans	PROPN
chd-99	243	47	(	(	PUNCT
chd-99	243	48	ca	ca	NOUN
chd-99	243	49	)	)	PUNCT
chd-99	243	50	compared	compare	VERB
chd-99	243	51	to	to	ADP
chd-99	243	52	african	african	ADJ
chd-99	243	53	american	american	PROPN
chd-99	243	54	(	(	PUNCT
chd-99	243	55	aa	aa	PROPN
chd-99	243	56	)	)	PUNCT
chd-99	243	57	tumor	tumor	NOUN
chd-99	243	58	samples	sample	NOUN
chd-99	243	59	,	,	PUNCT
chd-99	243	60	suggesting	suggest	VERB
chd-99	243	61	that	that	PRON
chd-99	243	62	decreased	decrease	VERB
chd-99	243	63	igf2r	igf2r	PROPN
chd-99	243	64	expression	expression	NOUN
chd-99	243	65	may	may	AUX
chd-99	243	66	contribute	contribute	VERB
chd-99	243	67	to	to	ADP
chd-99	243	68	bc	bc	PROPN
chd-99	243	69	disparity	disparity	NOUN
chd-99	243	70	(	(	PUNCT
chd-99	243	71	kalla	kalla	PROPN
chd-99	243	72	singh	singh	PROPN
chd-99	243	73	et	et	PROPN
chd-99	243	74	al	al	PROPN
chd-99	243	75	.	.	PROPN
chd-99	243	76	,	,	PUNCT
chd-99	243	77	2010	2010	NUM
chd-99	243	78	)	)	PUNCT
chd-99	243	79	.	.	PUNCT
chd-99	244	1	we	we	PRON
chd-99	244	2	observed	observe	VERB
chd-99	244	3	elevated	elevated	ADJ
chd-99	244	4	mir-204	mir-204	NOUN
chd-99	244	5	levels	level	NOUN
chd-99	244	6	in	in	ADP
chd-99	244	7	aa	aa	NOUN
chd-99	244	8	compared	compare	VERB
chd-99	244	9	to	to	ADP
chd-99	244	10	ca	ca	NOUN
chd-99	244	11	women	woman	NOUN
chd-99	244	12	;	;	PUNCT
chd-99	244	13	specifically	specifically	ADV
chd-99	244	14	in	in	ADP
chd-99	244	15	the	the	DET
chd-99	244	16	low	low	ADJ
chd-99	244	17	-	-	PUNCT
chd-99	244	18	grade	grade	NOUN
chd-99	244	19	samples	sample	NOUN
chd-99	244	20	.	.	PUNCT
chd-99	245	1	interestingly	interestingly	ADV
chd-99	245	2	,	,	PUNCT
chd-99	245	3	loss	loss	NOUN
chd-99	245	4	of	of	ADP
chd-99	245	5	igf2r	igf2r	PROPN
chd-99	245	6	is	be	AUX
chd-99	245	7	an	an	DET
chd-99	245	8	early	early	ADJ
chd-99	245	9	transformational	transformational	ADJ
chd-99	245	10	event	event	NOUN
chd-99	245	11	in	in	ADP
chd-99	245	12	breast	breast	NOUN
chd-99	245	13	cancer	cancer	NOUN
chd-99	245	14	,	,	PUNCT
chd-99	245	15	occurring	occur	VERB
chd-99	245	16	in	in	ADP
chd-99	245	17	the	the	DET
chd-99	245	18	initiation	initiation	NOUN
chd-99	245	19	rather	rather	ADV
chd-99	245	20	than	than	ADP
chd-99	245	21	the	the	DET
chd-99	245	22	progression	progression	NOUN
chd-99	245	23	stage	stage	NOUN
chd-99	245	24	of	of	ADP
chd-99	245	25	carcinogenesis	carcinogenesis	NOUN
chd-99	245	26	.	.	PUNCT
chd-99	246	1	therefore	therefore	ADV
chd-99	246	2	,	,	PUNCT
chd-99	246	3	we	we	PRON
chd-99	246	4	postulate	postulate	VERB
chd-99	246	5	that	that	PRON
chd-99	246	6	overexpression	overexpression	NOUN
chd-99	246	7	of	of	ADP
chd-99	246	8	mir-204	mir-204	NOUN
chd-99	246	9	may	may	AUX
chd-99	246	10	be	be	AUX
chd-99	246	11	an	an	DET
chd-99	246	12	early	early	ADJ
chd-99	246	13	initiating	initiate	VERB
chd-99	246	14	event	event	NOUN
chd-99	246	15	in	in	ADP
chd-99	246	16	aa	aa	PROPN
chd-99	246	17	women	woman	NOUN
chd-99	246	18	,	,	PUNCT
chd-99	246	19	leading	lead	VERB
chd-99	246	20	to	to	ADP
chd-99	246	21	the	the	DET
chd-99	246	22	loss	loss	NOUN
chd-99	246	23	of	of	ADP
chd-99	246	24	igf2r	igf2r	PROPN
chd-99	246	25	and	and	CCONJ
chd-99	246	26	more	more	ADV
chd-99	246	27	aggressive	aggressive	ADJ
chd-99	246	28	disease	disease	NOUN
chd-99	246	29	(	(	PUNCT
chd-99	246	30	figure	figure	NOUN
chd-99	246	31	6	6	NUM
chd-99	246	32	)	)	PUNCT
chd-99	246	33	.	.	PUNCT
chd-99	247	1	acknowledgements	acknowledgement	NOUN
chd-99	247	2	we	we	PRON
chd-99	247	3	thank	thank	VERB
chd-99	247	4	dr	dr	PROPN
chd-99	247	5	.	.	PROPN
chd-99	247	6	tracy	tracy	PROPN
chd-99	247	7	vargo	vargo	PROPN
chd-99	247	8	-	-	PUNCT
chd-99	247	9	gogola	gogola	PROPN
chd-99	247	10	(	(	PUNCT
chd-99	247	11	indiana	indiana	PROPN
chd-99	247	12	university	university	PROPN
chd-99	247	13	school	school	NOUN
chd-99	247	14	of	of	ADP
chd-99	247	15	medicine	medicine	NOUN
chd-99	247	16	)	)	PUNCT
chd-99	247	17	for	for	ADP
chd-99	247	18	the	the	DET
chd-99	247	19	ptetosplice	ptetosplice	NOUN
chd-99	247	20	vector	vector	NOUN
chd-99	247	21	and	and	CCONJ
chd-99	247	22	the	the	DET
chd-99	247	23	mcf7	mcf7	NOUN
chd-99	247	24	tet	tet	NOUN
chd-99	247	25	on	on	ADP
chd-99	247	26	cell	cell	NOUN
chd-99	247	27	line	line	NOUN
chd-99	247	28	,	,	PUNCT
chd-99	247	29	dr	dr	PROPN
chd-99	247	30	.	.	PROPN
chd-99	247	31	lukas	lukas	PROPN
chd-99	247	32	mach	mach	PROPN
chd-99	247	33	(	(	PUNCT
chd-99	247	34	university	university	NOUN
chd-99	247	35	of	of	ADP
chd-99	247	36	natural	natural	ADJ
chd-99	247	37	resources	resource	NOUN
chd-99	247	38	and	and	CCONJ
chd-99	247	39	life	life	NOUN
chd-99	247	40	sciences	sciences	PROPN
chd-99	247	41	,	,	PUNCT
chd-99	247	42	vienna	vienna	NOUN
chd-99	247	43	(	(	PUNCT
chd-99	247	44	boku	boku	NOUN
chd-99	247	45	)	)	PUNCT
chd-99	247	46	)	)	PUNCT
chd-99	247	47	for	for	ADP
chd-99	247	48	the	the	DET
chd-99	247	49	igf2r	igf2r	PROPN
chd-99	247	50	construct	construct	NOUN
chd-99	247	51	,	,	PUNCT
chd-99	247	52	dr	dr	PROPN
chd-99	247	53	.	.	PROPN
chd-99	247	54	adrian	adrian	PROPN
chd-99	247	55	lee	lee	PROPN
chd-99	247	56	(	(	PUNCT
chd-99	247	57	university	university	PROPN
chd-99	247	58	of	of	ADP
chd-99	247	59	pittsburgh	pittsburgh	PROPN
chd-99	247	60	)	)	PUNCT
chd-99	247	61	for	for	ADP
chd-99	247	62	the	the	DET
chd-99	247	63	mcf10a	mcf10a	PROPN
chd-99	247	64	/	/	SYM
chd-99	247	65	igf1r	igf1r	PROPN
chd-99	247	66	cell	cell	NOUN
chd-99	247	67	lines	line	NOUN
chd-99	247	68	,	,	PUNCT
chd-99	247	69	dr	dr	PROPN
chd-99	247	70	.	.	PROPN
chd-99	247	71	lewis	lewis	PROPN
chd-99	247	72	chodosh	chodosh	PROPN
chd-99	247	73	(	(	PUNCT
chd-99	247	74	university	university	NOUN
chd-99	247	75	of	of	ADP
chd-99	247	76	pennsylvania	pennsylvania	PROPN
chd-99	247	77	)	)	PUNCT
chd-99	247	78	for	for	ADP
chd-99	247	79	the	the	DET
chd-99	247	80	mtb	mtb	NOUN
chd-99	247	81	mice	mouse	NOUN
chd-99	247	82	and	and	CCONJ
chd-99	247	83	drs	dr	NOUN
chd-99	247	84	.	.	PUNCT
chd-99	248	1	jeffrey	jeffrey	PROPN
chd-99	248	2	rosen	rosen	PROPN
chd-99	248	3	,	,	PUNCT
chd-99	248	4	suzanne	suzanne	PROPN
chd-99	248	5	fuqua	fuqua	PROPN
chd-99	248	6	,	,	PUNCT
chd-99	248	7	kent	kent	PROPN
chd-99	248	8	osbourne	osbourne	PROPN
chd-99	248	9	(	(	PUNCT
chd-99	248	10	baylor	baylor	PROPN
chd-99	248	11	college	college	PROPN
chd-99	248	12	of	of	ADP
chd-99	248	13	medicine	medicine	NOUN
chd-99	248	14	)	)	PUNCT
chd-99	248	15	and	and	CCONJ
chd-99	248	16	dr	dr	PROPN
chd-99	248	17	.	.	PROPN
chd-99	248	18	steve	steve	PROPN
chd-99	248	19	rosenzweig	rosenzweig	PROPN
chd-99	248	20	(	(	PUNCT
chd-99	248	21	musc	musc	PROPN
chd-99	248	22	)	)	PUNCT
chd-99	248	23	for	for	ADP
chd-99	248	24	their	their	PRON
chd-99	248	25	scientific	scientific	ADJ
chd-99	248	26	expertise	expertise	NOUN
chd-99	248	27	and	and	CCONJ
chd-99	248	28	guidance	guidance	NOUN
chd-99	248	29	throughout	throughout	ADP
chd-99	248	30	the	the	DET
chd-99	248	31	study	study	NOUN
chd-99	248	32	.	.	PUNCT
chd-99	249	1	conflict	conflict	NOUN
chd-99	249	2	of	of	ADP
chd-99	249	3	interest	interest	NOUN
chd-99	249	4	the	the	DET
chd-99	249	5	authors	author	NOUN
chd-99	249	6	declare	declare	VERB
chd-99	249	7	that	that	SCONJ
chd-99	249	8	no	no	DET
chd-99	249	9	competing	compete	VERB
chd-99	249	10	or	or	CCONJ
chd-99	249	11	conflict	conflict	NOUN
chd-99	249	12	of	of	ADP
chd-99	249	13	interests	interest	NOUN
chd-99	249	14	exist	exist	VERB
chd-99	249	15	.	.	PUNCT
chd-99	250	1	the	the	DET
chd-99	250	2	funders	funder	NOUN
chd-99	250	3	had	have	VERB
chd-99	250	4	no	no	DET
chd-99	250	5	role	role	NOUN
chd-99	250	6	in	in	ADP
chd-99	250	7	study	study	NOUN
chd-99	250	8	design	design	NOUN
chd-99	250	9	,	,	PUNCT
chd-99	250	10	writing	writing	NOUN
chd-99	250	11	of	of	ADP
chd-99	250	12	the	the	DET
chd-99	250	13	manuscript	manuscript	NOUN
chd-99	250	14	,	,	PUNCT
chd-99	250	15	or	or	CCONJ
chd-99	250	16	decision	decision	NOUN
chd-99	250	17	to	to	PART
chd-99	250	18	publish	publish	VERB
chd-99	250	19	.	.	PUNCT
chd-99	251	1	authors	author	NOUN
chd-99	251	2	’	’	PART
chd-99	251	3	contributions	contribution	NOUN
chd-99	251	4	lmn	lmn	PROPN
chd-99	251	5	and	and	CCONJ
chd-99	251	6	jdf	jdf	PROPN
chd-99	251	7	performed	perform	VERB
chd-99	251	8	the	the	DET
chd-99	251	9	luciferase	luciferase	ADJ
chd-99	251	10	and	and	CCONJ
chd-99	251	11	western	western	ADJ
chd-99	251	12	blot	blot	NOUN
chd-99	251	13	assays	assay	NOUN
chd-99	251	14	.	.	PUNCT
chd-99	252	1	lmn	lmn	NOUN
chd-99	252	2	and	and	CCONJ
chd-99	252	3	lb	lb	NOUN
chd-99	252	4	performed	perform	VERB
chd-99	252	5	the	the	DET
chd-99	252	6	qpcr	qpcr	ADJ
chd-99	252	7	assays	assay	NOUN
chd-99	252	8	.	.	PUNCT
chd-99	253	1	lmn	lmn	PROPN
chd-99	253	2	and	and	CCONJ
chd-99	253	3	dpt	dpt	PROPN
chd-99	253	4	performed	perform	VERB
chd-99	253	5	the	the	DET
chd-99	253	6	functional	functional	ADJ
chd-99	253	7	and	and	CCONJ
chd-99	253	8	rescue	rescue	NOUN
chd-99	253	9	experiments	experiment	NOUN
chd-99	253	10	.	.	PUNCT
chd-99	254	1	lmn	lmn	PROPN
chd-99	254	2	and	and	CCONJ
chd-99	254	3	ceb	ceb	PROPN
chd-99	254	4	performed	perform	VERB
chd-99	254	5	the	the	PRON
chd-99	254	6	in	in	ADP
chd-99	254	7	vivo	vivo	ADJ
chd-99	254	8	experiments	experiment	NOUN
chd-99	254	9	.	.	PUNCT
chd-99	255	1	klh	klh	PROPN
chd-99	255	2	performed	perform	VERB
chd-99	255	3	the	the	DET
chd-99	255	4	histological	histological	ADJ
chd-99	255	5	analysis	analysis	NOUN
chd-99	255	6	of	of	ADP
chd-99	255	7	the	the	DET
chd-99	255	8	tumors	tumor	NOUN
chd-99	255	9	.	.	PUNCT
chd-99	256	1	egm	egm	PROPN
chd-99	256	2	analyzed	analyze	VERB
chd-99	256	3	and	and	CCONJ
chd-99	256	4	performed	perform	VERB
chd-99	256	5	statistical	statistical	ADJ
chd-99	256	6	analysis	analysis	NOUN
chd-99	256	7	on	on	ADP
chd-99	256	8	the	the	DET
chd-99	256	9	in	in	ADP
chd-99	256	10	vivo	vivo	ADJ
chd-99	256	11	data	datum	NOUN
chd-99	256	12	.	.	PUNCT
chd-99	257	1	vjf	vjf	PROPN
chd-99	257	2	conceived	conceive	VERB
chd-99	257	3	of	of	ADP
chd-99	257	4	the	the	DET
chd-99	257	5	study	study	NOUN
chd-99	257	6	and	and	CCONJ
chd-99	257	7	participated	participate	VERB
chd-99	257	8	in	in	ADP
chd-99	257	9	its	its	PRON
chd-99	257	10	design	design	NOUN
chd-99	257	11	and	and	CCONJ
chd-99	257	12	coordination	coordination	NOUN
chd-99	257	13	,	,	PUNCT
chd-99	257	14	and	and	CCONJ
chd-99	257	15	with	with	ADP
chd-99	257	16	dpt	dpt	PROPN
chd-99	257	17	and	and	CCONJ
chd-99	257	18	dkw	dkw	PROPN
chd-99	257	19	drafted	draft	VERB
chd-99	257	20	the	the	DET
chd-99	257	21	manuscript	manuscript	NOUN
chd-99	257	22	.	.	PUNCT
chd-99	258	1	all	all	DET
chd-99	258	2	authors	author	NOUN
chd-99	258	3	read	read	VERB
chd-99	258	4	and	and	CCONJ
chd-99	258	5	approved	approve	VERB
chd-99	258	6	the	the	DET
chd-99	258	7	final	final	ADJ
chd-99	258	8	manuscript	manuscript	NOUN
chd-99	258	9	.	.	PUNCT
chd-99	259	1	funding	funding	NOUN
chd-99	259	2	this	this	DET
chd-99	259	3	work	work	NOUN
chd-99	259	4	was	be	AUX
chd-99	259	5	supported	support	VERB
chd-99	259	6	in	in	ADP
chd-99	259	7	part	part	NOUN
chd-99	259	8	by	by	ADP
chd-99	259	9	the	the	DET
chd-99	259	10	transgenic	transgenic	NOUN
chd-99	259	11	mouse	mouse	NOUN
chd-99	259	12	core	core	NOUN
chd-99	259	13	facility	facility	NOUN
chd-99	259	14	,	,	PUNCT
chd-99	259	15	the	the	DET
chd-99	259	16	genomics	genomics	NOUN
chd-99	259	17	/	/	SYM
chd-99	259	18	shrna	shrna	ADJ
chd-99	259	19	shared	share	VERB
chd-99	259	20	resource	resource	NOUN
chd-99	259	21	,	,	PUNCT
chd-99	259	22	hollings	holling	NOUN
chd-99	259	23	cancer	cancer	NOUN
chd-99	259	24	center	center	NOUN
chd-99	259	25	,	,	PUNCT
chd-99	259	26	medical	medical	ADJ
chd-99	259	27	university	university	PROPN
chd-99	259	28	of	of	ADP
chd-99	259	29	south	south	PROPN
chd-99	259	30	carolina	carolina	PROPN
chd-99	259	31	(	(	PUNCT
chd-99	259	32	p30	p30	PROPN
chd-99	259	33	ca138313	ca138313	PROPN
chd-99	259	34	)	)	PUNCT
chd-99	259	35	and	and	CCONJ
chd-99	259	36	by	by	ADP
chd-99	259	37	the	the	DET
chd-99	259	38	department	department	PROPN
chd-99	259	39	of	of	ADP
chd-99	259	40	defense	defense	PROPN
chd-99	259	41	inter	inter	ADJ
chd-99	259	42	-	-	ADJ
chd-99	259	43	institutional	institutional	ADJ
chd-99	259	44	training	training	NOUN
chd-99	259	45	award	award	NOUN
chd-99	259	46	w81xwh-10	w81xwh-10	PROPN
chd-99	259	47	-	-	PUNCT
chd-99	259	48	bcrp	bcrp	ADJ
chd-99	259	49	-	-	PUNCT
chd-99	259	50	iita	iita	NOUN
chd-99	259	51	.	.	PUNCT
chd-99	260	1	references	reference	NOUN
chd-99	260	2	albain	albain	VERB
chd-99	260	3	,	,	PUNCT
chd-99	260	4	k.s	k.s	PROPN
chd-99	260	5	.	.	PROPN
chd-99	260	6	,	,	PUNCT
chd-99	260	7	unger	unger	PROPN
chd-99	260	8	,	,	PUNCT
chd-99	260	9	j.m	j.m	PROPN
chd-99	260	10	.	.	PROPN
chd-99	260	11	,	,	PUNCT
chd-99	260	12	crowley	crowley	PROPN
chd-99	260	13	,	,	PUNCT
chd-99	260	14	j.j	j.j	PROPN
chd-99	260	15	.	.	PROPN
chd-99	260	16	,	,	PUNCT
chd-99	260	17	coltman	coltman	PROPN
chd-99	260	18	,	,	PUNCT
chd-99	260	19	c.a	c.a	PROPN
chd-99	260	20	.	.	PROPN
chd-99	260	21	,	,	PUNCT
chd-99	260	22	jr	jr	PROPN
chd-99	260	23	.	.	PROPN
chd-99	260	24	,	,	PUNCT
chd-99	260	25	and	and	CCONJ
chd-99	260	26	hershman	hershman	NOUN
chd-99	260	27	,	,	PUNCT
chd-99	260	28	d.l	d.l	PROPN
chd-99	260	29	.	.	PROPN
chd-99	260	30	(	(	PUNCT
chd-99	260	31	2009	2009	NUM
chd-99	260	32	)	)	PUNCT
chd-99	260	33	.	.	PUNCT
chd-99	261	1	racial	racial	ADJ
chd-99	261	2	disparities	disparity	NOUN
chd-99	261	3	in	in	ADP
chd-99	261	4	cancer	cancer	NOUN
chd-99	261	5	survival	survival	NOUN
chd-99	261	6	among	among	ADP
chd-99	261	7	randomized	randomized	ADJ
chd-99	261	8	clinical	clinical	ADJ
chd-99	261	9	trials	trial	NOUN
chd-99	261	10	patients	patient	NOUN
chd-99	261	11	of	of	ADP
chd-99	261	12	the	the	DET
chd-99	261	13	southwest	southwest	ADJ
chd-99	261	14	oncology	oncology	NOUN
chd-99	261	15	group	group	NOUN
chd-99	261	16	.	.	PUNCT
chd-99	262	1	j	j	PROPN
chd-99	262	2	natl	natl	PROPN
chd-99	262	3	cancer	cancer	PROPN
chd-99	262	4	inst	inst	PROPN
chd-99	262	5	101	101	NUM
chd-99	262	6	,	,	PUNCT
chd-99	262	7	984992	984992	NUM
chd-99	262	8	.	.	PUNCT
chd-99	263	1	bean	bean	PROPN
chd-99	263	2	,	,	PUNCT
chd-99	263	3	g.r	g.r	PROPN
chd-99	263	4	.	.	PROPN
chd-99	263	5	,	,	PUNCT
chd-99	263	6	ganesan	ganesan	PROPN
chd-99	263	7	,	,	PUNCT
chd-99	263	8	y.t	y.t	PROPN
chd-99	263	9	.	.	PROPN
chd-99	263	10	,	,	PUNCT
chd-99	263	11	dong	dong	PROPN
chd-99	263	12	,	,	PUNCT
chd-99	263	13	y.	y.	PROPN
chd-99	263	14	,	,	PUNCT
chd-99	263	15	takeda	takeda	PROPN
chd-99	263	16	,	,	PUNCT
chd-99	263	17	s.	s.	PROPN
chd-99	263	18	,	,	PUNCT
chd-99	263	19	liu	liu	PROPN
chd-99	263	20	,	,	PUNCT
chd-99	263	21	h.	h.	PROPN
chd-99	263	22	,	,	PUNCT
chd-99	263	23	chan	chan	PROPN
chd-99	263	24	,	,	PUNCT
chd-99	263	25	p.m.	p.m.	PROPN
chd-99	263	26	,	,	PUNCT
chd-99	263	27	huang	huang	PROPN
chd-99	263	28	,	,	PUNCT
chd-99	263	29	y.	y.	PROPN
chd-99	263	30	,	,	PUNCT
chd-99	263	31	chodosh	chodosh	PROPN
chd-99	263	32	,	,	PUNCT
chd-99	263	33	l.a	l.a	PROPN
chd-99	263	34	.	.	PROPN
chd-99	263	35	,	,	PUNCT
chd-99	263	36	zambetti	zambetti	PROPN
chd-99	263	37	,	,	PUNCT
chd-99	263	38	g.p	g.p	PROPN
chd-99	263	39	.	.	PROPN
chd-99	263	40	,	,	PUNCT
chd-99	263	41	hsieh	hsieh	PROPN
chd-99	263	42	,	,	PUNCT
chd-99	263	43	j.j	j.j	PROPN
chd-99	263	44	.	.	PROPN
chd-99	263	45	,	,	PUNCT
chd-99	263	46	et	et	PROPN
chd-99	263	47	al	al	PROPN
chd-99	263	48	.	.	PROPN
chd-99	264	1	(	(	PUNCT
chd-99	264	2	2013	2013	NUM
chd-99	264	3	)	)	PUNCT
chd-99	264	4	.	.	PUNCT
chd-99	265	1	puma	puma	PROPN
chd-99	265	2	and	and	CCONJ
chd-99	265	3	bim	bim	NOUN
chd-99	265	4	are	be	AUX
chd-99	265	5	required	require	VERB
chd-99	265	6	for	for	ADP
chd-99	265	7	oncogene	oncogene	NOUN
chd-99	265	8	inactivation	inactivation	NOUN
chd-99	265	9	-	-	PUNCT
chd-99	265	10	induced	induce	VERB
chd-99	265	11	apoptosis	apoptosis	NOUN
chd-99	265	12	.	.	PUNCT
chd-99	266	1	sci	sci	PROPN
chd-99	266	2	signal	signal	VERB
chd-99	266	3	6	6	NUM
chd-99	266	4	,	,	PUNCT
chd-99	266	5	ra20	ra20	PROPN
chd-99	266	6	.	.	PUNCT
chd-99	267	1	bussemakers	bussemaker	NOUN
chd-99	267	2	,	,	PUNCT
chd-99	267	3	m.j	m.j	PROPN
chd-99	267	4	.	.	PROPN
chd-99	267	5	,	,	PUNCT
chd-99	267	6	van	van	PROPN
chd-99	267	7	bokhoven	bokhoven	NOUN
chd-99	267	8	,	,	PUNCT
chd-99	267	9	a.	a.	NOUN
chd-99	267	10	,	,	PUNCT
chd-99	267	11	verhaegh	verhaegh	PROPN
chd-99	267	12	,	,	PUNCT
chd-99	267	13	g.w	g.w	PROPN
chd-99	267	14	.	.	PROPN
chd-99	267	15	,	,	PUNCT
chd-99	267	16	smit	smit	PROPN
chd-99	267	17	,	,	PUNCT
chd-99	267	18	f.p	f.p	PROPN
chd-99	267	19	.	.	PROPN
chd-99	267	20	,	,	PUNCT
chd-99	267	21	karthaus	karthaus	PROPN
chd-99	267	22	,	,	PUNCT
chd-99	267	23	h.f	h.f	PROPN
chd-99	267	24	.	.	PROPN
chd-99	267	25	,	,	PUNCT
chd-99	267	26	schalken	schalken	VERB
chd-99	267	27	,	,	PUNCT
chd-99	267	28	j.a	j.a	PROPN
chd-99	267	29	.	.	PROPN
chd-99	267	30	,	,	PUNCT
chd-99	267	31	debruyne	debruyne	PROPN
chd-99	267	32	,	,	PUNCT
chd-99	267	33	f.m	f.m	PROPN
chd-99	267	34	.	.	PROPN
chd-99	267	35	,	,	PUNCT
chd-99	267	36	ru	ru	PROPN
chd-99	267	37	,	,	PUNCT
chd-99	267	38	n.	n.	NOUN
chd-99	267	39	,	,	PUNCT
chd-99	267	40	and	and	CCONJ
chd-99	267	41	isaacs	isaacs	PROPN
chd-99	267	42	,	,	PUNCT
chd-99	267	43	w.b	w.b	PROPN
chd-99	267	44	.	.	PROPN
chd-99	267	45	(	(	PUNCT
chd-99	267	46	1999	1999	NUM
chd-99	267	47	)	)	PUNCT
chd-99	267	48	.	.	PUNCT
chd-99	268	1	dd3	dd3	ADP
chd-99	268	2	:	:	PUNCT
chd-99	268	3	a	a	DET
chd-99	268	4	new	new	ADJ
chd-99	268	5	prostate	prostate	NOUN
chd-99	268	6	-	-	PUNCT
chd-99	268	7	specific	specific	ADJ
chd-99	268	8	gene	gene	NOUN
chd-99	268	9	,	,	PUNCT
chd-99	268	10	highly	highly	ADV
chd-99	268	11	overexpressed	overexpresse	VERB
chd-99	268	12	in	in	ADP
chd-99	268	13	prostate	prostate	NOUN
chd-99	268	14	cancer	cancer	NOUN
chd-99	268	15	.	.	PUNCT
chd-99	269	1	cancer	cancer	NOUN
chd-99	269	2	res	re	VERB
chd-99	269	3	59	59	NUM
chd-99	269	4	,	,	PUNCT
chd-99	269	5	5975	5975	NUM
chd-99	269	6	-	-	SYM
chd-99	269	7	5979	5979	NUM
chd-99	269	8	.	.	PUNCT
chd-99	270	1	cao	cao	PROPN
chd-99	270	2	,	,	PUNCT
chd-99	270	3	l.	l.	PROPN
chd-99	270	4	,	,	PUNCT
chd-99	270	5	li	li	PROPN
chd-99	270	6	,	,	PUNCT
chd-99	270	7	c.	c.	PROPN
chd-99	270	8	,	,	PUNCT
chd-99	270	9	xu	xu	PROPN
chd-99	270	10	,	,	PUNCT
chd-99	270	11	c.	c.	PROPN
chd-99	270	12	,	,	PUNCT
chd-99	270	13	xiang	xiang	PROPN
chd-99	270	14	,	,	PUNCT
chd-99	270	15	g.	g.	PROPN
chd-99	270	16	,	,	PUNCT
chd-99	270	17	liu	liu	PROPN
chd-99	270	18	,	,	PUNCT
chd-99	270	19	f.	f.	PROPN
chd-99	270	20	,	,	PUNCT
chd-99	270	21	liu	liu	PROPN
chd-99	270	22	,	,	PUNCT
chd-99	270	23	x.	x.	PROPN
chd-99	270	24	,	,	PUNCT
chd-99	270	25	jiao	jiao	PROPN
chd-99	270	26	,	,	PUNCT
chd-99	270	27	j.	j.	PROPN
chd-99	270	28	,	,	PUNCT
chd-99	270	29	lv	lv	PROPN
chd-99	270	30	,	,	PUNCT
chd-99	270	31	s.	s.	PROPN
chd-99	270	32	,	,	PUNCT
chd-99	270	33	and	and	CCONJ
chd-99	270	34	niu	niu	PROPN
chd-99	270	35	,	,	PUNCT
chd-99	270	36	y.	y.	PROPN
chd-99	270	37	(	(	PUNCT
chd-99	270	38	2018	2018	NUM
chd-99	270	39	)	)	PUNCT
chd-99	270	40	.	.	PUNCT
chd-99	271	1	clinical	clinical	ADJ
chd-99	271	2	significance	significance	NOUN
chd-99	271	3	of	of	ADP
chd-99	271	4	pdef	pdef	ADJ
chd-99	271	5	factor	factor	NOUN
chd-99	271	6	expression	expression	NOUN
chd-99	271	7	and	and	CCONJ
chd-99	271	8	its	its	PRON
chd-99	271	9	relation	relation	NOUN
chd-99	271	10	to	to	ADP
chd-99	271	11	androgen	androgen	NOUN
chd-99	271	12	receptor	receptor	NOUN
chd-99	271	13	in	in	ADP
chd-99	271	14	er(-	er(-	NOUN
chd-99	271	15	)	)	PUNCT
chd-99	271	16	breast	breast	NOUN
chd-99	271	17	cancer	cancer	NOUN
chd-99	271	18	.	.	PUNCT
chd-99	272	1	histopathology	histopathology	NOUN
chd-99	272	2	.	.	PUNCT
chd-99	273	1	chappell	chappell	PROPN
chd-99	273	2	,	,	PUNCT
chd-99	273	3	s.a	s.a	PROPN
chd-99	273	4	.	.	PROPN
chd-99	273	5	,	,	PUNCT
chd-99	273	6	walsh	walsh	PROPN
chd-99	273	7	,	,	PUNCT
chd-99	273	8	t.	t.	PROPN
chd-99	273	9	,	,	PUNCT
chd-99	273	10	walker	walker	PROPN
chd-99	273	11	,	,	PUNCT
chd-99	273	12	r.a	r.a	PROPN
chd-99	273	13	.	.	PROPN
chd-99	273	14	,	,	PUNCT
chd-99	273	15	and	and	CCONJ
chd-99	273	16	shaw	shaw	PROPN
chd-99	273	17	,	,	PUNCT
chd-99	273	18	j.a	j.a	PROPN
chd-99	273	19	.	.	PROPN
chd-99	273	20	(	(	PUNCT
chd-99	273	21	1997	1997	NUM
chd-99	273	22	)	)	PUNCT
chd-99	273	23	.	.	PUNCT
chd-99	274	1	loss	loss	NOUN
chd-99	274	2	of	of	ADP
chd-99	274	3	heterozygosity	heterozygosity	NOUN
chd-99	274	4	at	at	ADP
chd-99	274	5	the	the	DET
chd-99	274	6	mannose	mannose	NOUN
chd-99	274	7	6	6	NUM
chd-99	274	8	-	-	PUNCT
chd-99	274	9	phosphate	phosphate	NOUN
chd-99	274	10	insulin	insulin	NOUN
chd-99	274	11	-	-	PUNCT
chd-99	274	12	like	like	ADJ
chd-99	274	13	growth	growth	NOUN
chd-99	274	14	factor	factor	NOUN
chd-99	274	15	2	2	NUM
chd-99	274	16	receptor	receptor	NOUN
chd-99	274	17	gene	gene	NOUN
chd-99	274	18	correlates	correlate	VERB
chd-99	274	19	with	with	ADP
chd-99	274	20	poor	poor	ADJ
chd-99	274	21	differentiation	differentiation	NOUN
chd-99	274	22	in	in	ADP
chd-99	274	23	early	early	ADJ
chd-99	274	24	breast	breast	NOUN
chd-99	274	25	carcinomas	carcinoma	NOUN
chd-99	274	26	.	.	PUNCT
chd-99	275	1	br	br	X
chd-99	275	2	j	j	PROPN
chd-99	275	3	cancer	cancer	NOUN
chd-99	275	4	76	76	NUM
chd-99	275	5	,	,	PUNCT
chd-99	275	6	1558	1558	NUM
chd-99	275	7	-	-	SYM
chd-99	275	8	1561	1561	NUM
chd-99	275	9	.	.	PUNCT
chd-99	276	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	276	2	e16	e16	PROPN
chd-99	276	3	cancer	cancer	NOUN
chd-99	276	4	health	health	NOUN
chd-99	276	5	disparities	disparity	NOUN
chd-99	276	6	research	research	PROPN
chd-99	276	7	chen	chen	PROPN
chd-99	276	8	,	,	PUNCT
chd-99	276	9	z.	z.	PROPN
chd-99	276	10	,	,	PUNCT
chd-99	276	11	ge	ge	PROPN
chd-99	276	12	,	,	PUNCT
chd-99	276	13	y.	y.	PROPN
chd-99	276	14	,	,	PUNCT
chd-99	276	15	landman	landman	NOUN
chd-99	276	16	,	,	PUNCT
chd-99	276	17	n.	n.	NOUN
chd-99	276	18	,	,	PUNCT
chd-99	276	19	and	and	CCONJ
chd-99	276	20	kang	kang	PROPN
chd-99	276	21	,	,	PUNCT
chd-99	276	22	j.x	j.x	PROPN
chd-99	276	23	.	.	PROPN
chd-99	276	24	(	(	PUNCT
chd-99	276	25	2002	2002	NUM
chd-99	276	26	)	)	PUNCT
chd-99	276	27	.	.	PUNCT
chd-99	277	1	decreased	decrease	VERB
chd-99	277	2	expression	expression	NOUN
chd-99	277	3	of	of	ADP
chd-99	277	4	the	the	DET
chd-99	277	5	mannose	mannose	NOUN
chd-99	277	6	6phosphate	6phosphate	PROPN
chd-99	277	7	/	/	SYM
chd-99	277	8	insulin	insulin	NOUN
chd-99	277	9	-	-	PUNCT
chd-99	277	10	like	like	ADJ
chd-99	277	11	growth	growth	NOUN
chd-99	277	12	factor	factor	NOUN
chd-99	277	13	-	-	PUNCT
chd-99	277	14	ii	ii	NOUN
chd-99	277	15	receptor	receptor	NOUN
chd-99	277	16	promotes	promote	VERB
chd-99	277	17	growth	growth	NOUN
chd-99	277	18	of	of	ADP
chd-99	277	19	human	human	ADJ
chd-99	277	20	breast	breast	NOUN
chd-99	277	21	cancer	cancer	NOUN
chd-99	277	22	cells	cell	NOUN
chd-99	277	23	.	.	PUNCT
chd-99	278	1	bmc	bmc	ADJ
chd-99	278	2	cancer	cancer	NOUN
chd-99	278	3	2	2	NUM
chd-99	278	4	,	,	PUNCT
chd-99	278	5	18	18	NUM
chd-99	278	6	.	.	PUNCT
chd-99	279	1	chung	chung	PROPN
chd-99	279	2	,	,	PUNCT
chd-99	279	3	t.k	t.k	PROPN
chd-99	279	4	.	.	PROPN
chd-99	279	5	,	,	PUNCT
chd-99	279	6	lau	lau	PROPN
chd-99	279	7	,	,	PUNCT
chd-99	279	8	t.s	t.s	PROPN
chd-99	279	9	.	.	PROPN
chd-99	279	10	,	,	PUNCT
chd-99	279	11	cheung	cheung	PROPN
chd-99	279	12	,	,	PUNCT
chd-99	279	13	t.h	t.h	PROPN
chd-99	279	14	.	.	PROPN
chd-99	279	15	,	,	PUNCT
chd-99	279	16	yim	yim	PROPN
chd-99	279	17	,	,	PUNCT
chd-99	279	18	s.f	s.f	PROPN
chd-99	279	19	.	.	PROPN
chd-99	279	20	,	,	PUNCT
chd-99	279	21	lo	lo	PROPN
chd-99	279	22	,	,	PUNCT
chd-99	279	23	k.w	k.w	PROPN
chd-99	279	24	.	.	PROPN
chd-99	279	25	,	,	PUNCT
chd-99	279	26	siu	siu	PROPN
chd-99	279	27	,	,	PUNCT
chd-99	279	28	n.s	n.s	PROPN
chd-99	279	29	.	.	PROPN
chd-99	279	30	,	,	PUNCT
chd-99	279	31	chan	chan	PROPN
chd-99	279	32	,	,	PUNCT
chd-99	279	33	l.k	l.k	PROPN
chd-99	279	34	.	.	PROPN
chd-99	279	35	,	,	PUNCT
chd-99	279	36	yu	yu	PROPN
chd-99	279	37	,	,	PUNCT
chd-99	279	38	m.y	m.y	PROPN
chd-99	279	39	.	.	PROPN
chd-99	279	40	,	,	PUNCT
chd-99	279	41	kwong	kwong	PROPN
chd-99	279	42	,	,	PUNCT
chd-99	279	43	j.	j.	PROPN
chd-99	279	44	,	,	PUNCT
chd-99	279	45	doran	doran	PROPN
chd-99	279	46	,	,	PUNCT
chd-99	279	47	g.	g.	PROPN
chd-99	279	48	,	,	PUNCT
chd-99	279	49	et	et	PROPN
chd-99	279	50	al	al	PROPN
chd-99	279	51	.	.	PUNCT
chd-99	279	52	(	(	PUNCT
chd-99	279	53	2012	2012	NUM
chd-99	279	54	)	)	PUNCT
chd-99	279	55	.	.	PUNCT
chd-99	280	1	dysregulation	dysregulation	NOUN
chd-99	280	2	of	of	ADP
chd-99	280	3	microrna-204	microrna-204	ADJ
chd-99	280	4	mediates	mediate	NOUN
chd-99	280	5	migration	migration	NOUN
chd-99	280	6	and	and	CCONJ
chd-99	280	7	invasion	invasion	NOUN
chd-99	280	8	of	of	ADP
chd-99	280	9	endometrial	endometrial	ADJ
chd-99	280	10	cancer	cancer	NOUN
chd-99	280	11	by	by	ADP
chd-99	280	12	regulating	regulate	VERB
chd-99	280	13	foxc1	foxc1	PROPN
chd-99	280	14	.	.	PUNCT
chd-99	281	1	int	int	PROPN
chd-99	281	2	j	j	PROPN
chd-99	281	3	cancer	cancer	NOUN
chd-99	281	4	130	130	NUM
chd-99	281	5	,	,	PUNCT
chd-99	281	6	1036	1036	NUM
chd-99	281	7	-	-	SYM
chd-99	281	8	1045	1045	NUM
chd-99	281	9	.	.	PUNCT
chd-99	282	1	courboulin	courboulin	PROPN
chd-99	282	2	,	,	PUNCT
chd-99	282	3	a.	a.	PROPN
chd-99	282	4	,	,	PUNCT
chd-99	282	5	paulin	paulin	PROPN
chd-99	282	6	,	,	PUNCT
chd-99	282	7	r.	r.	PROPN
chd-99	282	8	,	,	PUNCT
chd-99	282	9	giguere	giguere	PROPN
chd-99	282	10	,	,	PUNCT
chd-99	282	11	n.j	n.j	PROPN
chd-99	282	12	.	.	PROPN
chd-99	282	13	,	,	PUNCT
chd-99	282	14	saksouk	saksouk	PROPN
chd-99	282	15	,	,	PUNCT
chd-99	282	16	n.	n.	NOUN
chd-99	282	17	,	,	PUNCT
chd-99	282	18	perreault	perreault	NOUN
chd-99	282	19	,	,	PUNCT
chd-99	282	20	t.	t.	PROPN
chd-99	282	21	,	,	PUNCT
chd-99	282	22	meloche	meloche	PROPN
chd-99	282	23	,	,	PUNCT
chd-99	282	24	j.	j.	PROPN
chd-99	282	25	,	,	PUNCT
chd-99	282	26	paquet	paquet	PROPN
chd-99	282	27	,	,	PUNCT
chd-99	282	28	e.r	e.r	PROPN
chd-99	282	29	.	.	PROPN
chd-99	282	30	,	,	PUNCT
chd-99	282	31	biardel	biardel	PROPN
chd-99	282	32	,	,	PUNCT
chd-99	282	33	s.	s.	PROPN
chd-99	282	34	,	,	PUNCT
chd-99	282	35	provencher	provencher	PROPN
chd-99	282	36	,	,	PUNCT
chd-99	282	37	s.	s.	PROPN
chd-99	282	38	,	,	PUNCT
chd-99	282	39	cote	cote	PROPN
chd-99	282	40	,	,	PUNCT
chd-99	282	41	j.	j.	PROPN
chd-99	282	42	,	,	PUNCT
chd-99	282	43	et	et	PROPN
chd-99	282	44	al	al	PROPN
chd-99	282	45	.	.	PUNCT
chd-99	282	46	(	(	PUNCT
chd-99	282	47	2011	2011	NUM
chd-99	282	48	)	)	PUNCT
chd-99	282	49	.	.	PUNCT
chd-99	283	1	role	role	NOUN
chd-99	283	2	for	for	ADP
chd-99	283	3	mir-204	mir-204	NOUN
chd-99	283	4	in	in	ADP
chd-99	283	5	human	human	ADJ
chd-99	283	6	pulmonary	pulmonary	ADJ
chd-99	283	7	arterial	arterial	NOUN
chd-99	283	8	hypertension	hypertension	NOUN
chd-99	283	9	.	.	PUNCT
chd-99	284	1	j	j	PROPN
chd-99	284	2	exp	exp	NOUN
chd-99	284	3	med	me	VERB
chd-99	284	4	208	208	NUM
chd-99	284	5	,	,	PUNCT
chd-99	284	6	535548	535548	NUM
chd-99	284	7	.	.	PUNCT
chd-99	285	1	dearth	dearth	NOUN
chd-99	285	2	,	,	PUNCT
chd-99	285	3	r.k	r.k	PROPN
chd-99	285	4	.	.	PROPN
chd-99	285	5	,	,	PUNCT
chd-99	285	6	cui	cui	PROPN
chd-99	285	7	,	,	PUNCT
chd-99	285	8	x.	x.	PROPN
chd-99	285	9	,	,	PUNCT
chd-99	285	10	kim	kim	PROPN
chd-99	285	11	,	,	PUNCT
chd-99	285	12	h.j	h.j	PROPN
chd-99	285	13	.	.	PROPN
chd-99	285	14	,	,	PUNCT
chd-99	285	15	hadsell	hadsell	PROPN
chd-99	285	16	,	,	PUNCT
chd-99	285	17	d.l	d.l	PROPN
chd-99	285	18	.	.	PROPN
chd-99	285	19	,	,	PUNCT
chd-99	285	20	and	and	CCONJ
chd-99	285	21	lee	lee	PROPN
chd-99	285	22	,	,	PUNCT
chd-99	285	23	a.v	a.v	PROPN
chd-99	285	24	.	.	PROPN
chd-99	285	25	(	(	PUNCT
chd-99	285	26	2007	2007	NUM
chd-99	285	27	)	)	PUNCT
chd-99	285	28	.	.	PUNCT
chd-99	286	1	oncogenic	oncogenic	ADJ
chd-99	286	2	transformation	transformation	NOUN
chd-99	286	3	by	by	ADP
chd-99	286	4	the	the	DET
chd-99	286	5	signaling	signal	VERB
chd-99	286	6	adaptor	adaptor	NOUN
chd-99	286	7	proteins	protein	NOUN
chd-99	286	8	insulin	insulin	NOUN
chd-99	286	9	receptor	receptor	NOUN
chd-99	286	10	substrate	substrate	NOUN
chd-99	286	11	(	(	PUNCT
chd-99	286	12	irs)-1	irs)-1	NOUN
chd-99	286	13	and	and	CCONJ
chd-99	286	14	irs-2	irs-2	NOUN
chd-99	286	15	.	.	PUNCT
chd-99	287	1	cell	cell	NOUN
chd-99	287	2	cycle	cycle	NOUN
chd-99	287	3	6	6	NUM
chd-99	287	4	,	,	PUNCT
chd-99	287	5	705	705	NUM
chd-99	287	6	-	-	SYM
chd-99	287	7	713	713	NUM
chd-99	287	8	.	.	PUNCT
chd-99	288	1	dennis	dennis	PROPN
chd-99	288	2	,	,	PUNCT
chd-99	288	3	p.a	p.a	PROPN
chd-99	288	4	.	.	PROPN
chd-99	288	5	,	,	PUNCT
chd-99	288	6	and	and	CCONJ
chd-99	288	7	rifkin	rifkin	PROPN
chd-99	288	8	,	,	PUNCT
chd-99	288	9	d.b	d.b	PROPN
chd-99	288	10	.	.	PROPN
chd-99	288	11	(	(	PUNCT
chd-99	288	12	1991	1991	NUM
chd-99	288	13	)	)	PUNCT
chd-99	288	14	.	.	PUNCT
chd-99	289	1	cellular	cellular	ADJ
chd-99	289	2	activation	activation	NOUN
chd-99	289	3	of	of	ADP
chd-99	289	4	latent	latent	NOUN
chd-99	289	5	transforming	transform	VERB
chd-99	289	6	growth	growth	NOUN
chd-99	289	7	factor	factor	NOUN
chd-99	289	8	beta	beta	NOUN
chd-99	289	9	requires	require	VERB
chd-99	289	10	binding	bind	VERB
chd-99	289	11	to	to	ADP
chd-99	289	12	the	the	DET
chd-99	289	13	cation	cation	NOUN
chd-99	289	14	-	-	PUNCT
chd-99	289	15	independent	independent	ADJ
chd-99	289	16	mannose	mannose	NOUN
chd-99	289	17	6	6	NUM
chd-99	289	18	-	-	PUNCT
chd-99	289	19	phosphate	phosphate	NOUN
chd-99	289	20	/	/	SYM
chd-99	289	21	insulin	insulin	NOUN
chd-99	289	22	-	-	PUNCT
chd-99	289	23	like	like	ADJ
chd-99	289	24	growth	growth	NOUN
chd-99	289	25	factor	factor	NOUN
chd-99	289	26	type	type	NOUN
chd-99	289	27	ii	ii	NOUN
chd-99	289	28	receptor	receptor	NOUN
chd-99	289	29	.	.	PUNCT
chd-99	290	1	proc	proc	PROPN
chd-99	290	2	natl	natl	PROPN
chd-99	290	3	acad	acad	PROPN
chd-99	290	4	sci	sci	PROPN
chd-99	290	5	u	u	PROPN
chd-99	290	6	s	s	PROPN
chd-99	290	7	a	a	DET
chd-99	290	8	88	88	NUM
chd-99	290	9	,	,	PUNCT
chd-99	290	10	580	580	NUM
chd-99	290	11	-	-	SYM
chd-99	290	12	584	584	NUM
chd-99	290	13	.	.	PUNCT
chd-99	291	1	ding	ding	NOUN
chd-99	291	2	,	,	PUNCT
chd-99	291	3	m.	m.	NOUN
chd-99	291	4	,	,	PUNCT
chd-99	291	5	lin	lin	PROPN
chd-99	291	6	,	,	PUNCT
chd-99	291	7	b.	b.	PROPN
chd-99	291	8	,	,	PUNCT
chd-99	291	9	li	li	PROPN
chd-99	291	10	,	,	PUNCT
chd-99	291	11	t.	t.	PROPN
chd-99	291	12	,	,	PUNCT
chd-99	291	13	liu	liu	PROPN
chd-99	291	14	,	,	PUNCT
chd-99	291	15	y.	y.	PROPN
chd-99	291	16	,	,	PUNCT
chd-99	291	17	li	li	PROPN
chd-99	291	18	,	,	PUNCT
chd-99	291	19	y.	y.	PROPN
chd-99	291	20	,	,	PUNCT
chd-99	291	21	zhou	zhou	PROPN
chd-99	291	22	,	,	PUNCT
chd-99	291	23	x.	x.	NOUN
chd-99	291	24	,	,	PUNCT
chd-99	291	25	miao	miao	NOUN
chd-99	291	26	,	,	PUNCT
chd-99	291	27	m.	m.	NOUN
chd-99	291	28	,	,	PUNCT
chd-99	291	29	gu	gu	PROPN
chd-99	291	30	,	,	PUNCT
chd-99	291	31	j.	j.	PROPN
chd-99	291	32	,	,	PUNCT
chd-99	291	33	pan	pan	PROPN
chd-99	291	34	,	,	PUNCT
chd-99	291	35	h.	h.	PROPN
chd-99	291	36	,	,	PUNCT
chd-99	291	37	yang	yang	PROPN
chd-99	291	38	,	,	PUNCT
chd-99	291	39	f.	f.	PROPN
chd-99	291	40	,	,	PUNCT
chd-99	291	41	et	et	PROPN
chd-99	291	42	al	al	PROPN
chd-99	291	43	.	.	PUNCT
chd-99	291	44	(	(	PUNCT
chd-99	291	45	2015	2015	NUM
chd-99	291	46	)	)	PUNCT
chd-99	291	47	.	.	PUNCT
chd-99	292	1	a	a	DET
chd-99	292	2	dual	dual	ADJ
chd-99	292	3	yet	yet	ADV
chd-99	292	4	opposite	opposite	ADJ
chd-99	292	5	growth	growth	NOUN
chd-99	292	6	-	-	PUNCT
chd-99	292	7	regulating	regulate	VERB
chd-99	292	8	function	function	NOUN
chd-99	292	9	of	of	ADP
chd-99	292	10	mir-204	mir-204	NOUN
chd-99	292	11	and	and	CCONJ
chd-99	292	12	its	its	PRON
chd-99	292	13	target	target	NOUN
chd-99	292	14	xrn1	xrn1	NOUN
chd-99	292	15	in	in	ADP
chd-99	292	16	prostate	prostate	NOUN
chd-99	292	17	adenocarcinoma	adenocarcinoma	NOUN
chd-99	292	18	cells	cell	NOUN
chd-99	292	19	and	and	CCONJ
chd-99	292	20	neuroendocrine	neuroendocrine	NOUN
chd-99	292	21	-	-	PUNCT
chd-99	292	22	like	like	ADJ
chd-99	292	23	prostate	prostate	NOUN
chd-99	292	24	cancer	cancer	NOUN
chd-99	292	25	cells	cell	NOUN
chd-99	292	26	.	.	PUNCT
chd-99	293	1	oncotarget	oncotarget	VERB
chd-99	293	2	6	6	NUM
chd-99	293	3	,	,	PUNCT
chd-99	293	4	7686	7686	NUM
chd-99	293	5	-	-	SYM
chd-99	293	6	7700	7700	NUM
chd-99	293	7	.	.	PUNCT
chd-99	294	1	findlay	findlay	PROPN
chd-99	294	2	,	,	PUNCT
chd-99	294	3	v.j	v.j	PROPN
chd-99	294	4	.	.	PROPN
chd-99	294	5	,	,	PUNCT
chd-99	294	6	turner	turner	PROPN
chd-99	294	7	,	,	PUNCT
chd-99	294	8	d.p	d.p	PROPN
chd-99	294	9	.	.	PROPN
chd-99	294	10	,	,	PUNCT
chd-99	294	11	moussa	moussa	PROPN
chd-99	294	12	,	,	PUNCT
chd-99	294	13	o.	o.	PROPN
chd-99	294	14	,	,	PUNCT
chd-99	294	15	and	and	CCONJ
chd-99	294	16	watson	watson	PROPN
chd-99	294	17	,	,	PUNCT
chd-99	294	18	d.k	d.k	PROPN
chd-99	294	19	.	.	PROPN
chd-99	294	20	(	(	PUNCT
chd-99	294	21	2008	2008	NUM
chd-99	294	22	)	)	PUNCT
chd-99	294	23	.	.	PUNCT
chd-99	295	1	microrna	microrna	PROPN
chd-99	295	2	-	-	PUNCT
chd-99	295	3	mediated	mediate	VERB
chd-99	295	4	inhibition	inhibition	NOUN
chd-99	295	5	of	of	ADP
chd-99	295	6	prostatederived	prostatederived	ADJ
chd-99	295	7	ets	et	NOUN
chd-99	295	8	factor	factor	NOUN
chd-99	295	9	messenger	messenger	NOUN
chd-99	295	10	rna	rna	NOUN
chd-99	295	11	translation	translation	NOUN
chd-99	295	12	affects	affect	VERB
chd-99	295	13	prostate	prostate	NOUN
chd-99	295	14	-	-	PUNCT
chd-99	295	15	derived	derive	VERB
chd-99	295	16	ets	et	NOUN
chd-99	295	17	factor	factor	NOUN
chd-99	295	18	regulatory	regulatory	ADJ
chd-99	295	19	networks	network	NOUN
chd-99	295	20	in	in	ADP
chd-99	295	21	human	human	ADJ
chd-99	295	22	breast	breast	NOUN
chd-99	295	23	cancer	cancer	NOUN
chd-99	295	24	.	.	PUNCT
chd-99	296	1	cancer	cancer	NOUN
chd-99	296	2	res	re	NOUN
chd-99	296	3	68	68	NUM
chd-99	296	4	,	,	PUNCT
chd-99	296	5	8499	8499	NUM
chd-99	296	6	-	-	SYM
chd-99	296	7	8506	8506	NUM
chd-99	296	8	.	.	PUNCT
chd-99	297	1	flanigan	flanigan	PROPN
chd-99	297	2	,	,	PUNCT
chd-99	297	3	s.a	s.a	PROPN
chd-99	297	4	.	.	PROPN
chd-99	297	5	,	,	PUNCT
chd-99	297	6	pitts	pitts	PROPN
chd-99	297	7	,	,	PUNCT
chd-99	297	8	t.m	t.m	PROPN
chd-99	297	9	.	.	PROPN
chd-99	297	10	,	,	PUNCT
chd-99	297	11	newton	newton	PROPN
chd-99	297	12	,	,	PUNCT
chd-99	297	13	t.p	t.p	PROPN
chd-99	297	14	.	.	PROPN
chd-99	297	15	,	,	PUNCT
chd-99	297	16	kulikowski	kulikowski	PROPN
chd-99	297	17	,	,	PUNCT
chd-99	297	18	g.n	g.n	PROPN
chd-99	297	19	.	.	PROPN
chd-99	297	20	,	,	PUNCT
chd-99	297	21	tan	tan	PROPN
chd-99	297	22	,	,	PUNCT
chd-99	297	23	a.c	a.c	PROPN
chd-99	297	24	.	.	PROPN
chd-99	297	25	,	,	PUNCT
chd-99	297	26	mcmanus	mcmanus	PROPN
chd-99	297	27	,	,	PUNCT
chd-99	297	28	m.c	m.c	PROPN
chd-99	297	29	.	.	PROPN
chd-99	297	30	,	,	PUNCT
chd-99	297	31	spreafico	spreafico	NOUN
chd-99	297	32	,	,	PUNCT
chd-99	297	33	a.	a.	NOUN
chd-99	297	34	,	,	PUNCT
chd-99	297	35	kachaeva	kachaeva	PROPN
chd-99	297	36	,	,	PUNCT
chd-99	297	37	m.i	m.i	PROPN
chd-99	297	38	.	.	PROPN
chd-99	297	39	,	,	PUNCT
chd-99	297	40	selby	selby	PROPN
chd-99	297	41	,	,	PUNCT
chd-99	297	42	h.m	h.m	PROPN
chd-99	297	43	.	.	PROPN
chd-99	297	44	,	,	PUNCT
chd-99	297	45	tentler	tentler	PROPN
chd-99	297	46	,	,	PUNCT
chd-99	297	47	j.j	j.j	PROPN
chd-99	297	48	.	.	PROPN
chd-99	297	49	,	,	PUNCT
chd-99	297	50	et	et	PROPN
chd-99	297	51	al	al	PROPN
chd-99	297	52	.	.	PROPN
chd-99	297	53	(	(	PUNCT
chd-99	297	54	2013	2013	NUM
chd-99	297	55	)	)	PUNCT
chd-99	297	56	.	.	PUNCT
chd-99	298	1	overcoming	overcome	VERB
chd-99	298	2	igf1r	igf1r	PROPN
chd-99	298	3	/	/	SYM
chd-99	298	4	ir	ir	PROPN
chd-99	298	5	resistance	resistance	NOUN
chd-99	298	6	through	through	ADP
chd-99	298	7	inhibition	inhibition	NOUN
chd-99	298	8	of	of	ADP
chd-99	298	9	mek	mek	PROPN
chd-99	298	10	signaling	signal	VERB
chd-99	298	11	in	in	ADP
chd-99	298	12	colorectal	colorectal	ADJ
chd-99	298	13	cancer	cancer	NOUN
chd-99	298	14	models	model	NOUN
chd-99	298	15	.	.	PUNCT
chd-99	299	1	clin	clin	PROPN
chd-99	299	2	cancer	cancer	NOUN
chd-99	299	3	res	re	VERB
chd-99	299	4	19	19	NUM
chd-99	299	5	,	,	PUNCT
chd-99	299	6	6219	6219	NUM
chd-99	299	7	-	-	SYM
chd-99	299	8	6229	6229	NUM
chd-99	299	9	.	.	PUNCT
chd-99	300	1	frasca	frasca	PROPN
chd-99	300	2	,	,	PUNCT
chd-99	300	3	f.	f.	PROPN
chd-99	300	4	,	,	PUNCT
chd-99	300	5	pandini	pandini	PROPN
chd-99	300	6	,	,	PUNCT
chd-99	300	7	g.	g.	PROPN
chd-99	300	8	,	,	PUNCT
chd-99	300	9	scalia	scalia	PROPN
chd-99	300	10	,	,	PUNCT
chd-99	300	11	p.	p.	PROPN
chd-99	300	12	,	,	PUNCT
chd-99	300	13	sciacca	sciacca	ADJ
chd-99	300	14	,	,	PUNCT
chd-99	300	15	l.	l.	PROPN
chd-99	300	16	,	,	PUNCT
chd-99	300	17	mineo	mineo	PROPN
chd-99	300	18	,	,	PUNCT
chd-99	300	19	r.	r.	PROPN
chd-99	300	20	,	,	PUNCT
chd-99	300	21	costantino	costantino	PROPN
chd-99	300	22	,	,	PUNCT
chd-99	300	23	a.	a.	PROPN
chd-99	300	24	,	,	PUNCT
chd-99	300	25	goldfine	goldfine	NOUN
chd-99	300	26	,	,	PUNCT
chd-99	300	27	i.d	i.d	PROPN
chd-99	300	28	.	.	PROPN
chd-99	300	29	,	,	PUNCT
chd-99	300	30	belfiore	belfiore	NOUN
chd-99	300	31	,	,	PUNCT
chd-99	300	32	a.	a.	NOUN
chd-99	300	33	,	,	PUNCT
chd-99	300	34	and	and	CCONJ
chd-99	300	35	vigneri	vigneri	PROPN
chd-99	300	36	,	,	PUNCT
chd-99	300	37	r.	r.	PROPN
chd-99	300	38	(	(	PUNCT
chd-99	300	39	1999	1999	NUM
chd-99	300	40	)	)	PUNCT
chd-99	300	41	.	.	PUNCT
chd-99	301	1	insulin	insulin	NOUN
chd-99	301	2	receptor	receptor	NOUN
chd-99	301	3	isoform	isoform	NOUN
chd-99	301	4	a	a	DET
chd-99	301	5	,	,	PUNCT
chd-99	301	6	a	a	DET
chd-99	301	7	newly	newly	ADV
chd-99	301	8	recognized	recognize	VERB
chd-99	301	9	,	,	PUNCT
chd-99	301	10	high	high	ADJ
chd-99	301	11	-	-	PUNCT
chd-99	301	12	affinity	affinity	NOUN
chd-99	301	13	insulin	insulin	NOUN
chd-99	301	14	-	-	PUNCT
chd-99	301	15	like	like	ADJ
chd-99	301	16	growth	growth	NOUN
chd-99	301	17	factor	factor	NOUN
chd-99	301	18	ii	ii	NOUN
chd-99	301	19	receptor	receptor	NOUN
chd-99	301	20	in	in	ADP
chd-99	301	21	fetal	fetal	ADJ
chd-99	301	22	and	and	CCONJ
chd-99	301	23	cancer	cancer	NOUN
chd-99	301	24	cells	cell	NOUN
chd-99	301	25	.	.	PUNCT
chd-99	302	1	mol	mol	ADP
chd-99	302	2	cell	cell	NOUN
chd-99	302	3	biol	biol	NOUN
chd-99	302	4	19	19	NUM
chd-99	302	5	,	,	PUNCT
chd-99	302	6	3278	3278	NUM
chd-99	302	7	-	-	SYM
chd-99	302	8	3288	3288	NUM
chd-99	302	9	.	.	PUNCT
chd-99	303	1	gunther	gunther	PROPN
chd-99	303	2	,	,	PUNCT
chd-99	303	3	e.j	e.j	PROPN
chd-99	303	4	.	.	PROPN
chd-99	303	5	,	,	PUNCT
chd-99	303	6	belka	belka	NOUN
chd-99	303	7	,	,	PUNCT
chd-99	303	8	g.k	g.k	PROPN
chd-99	303	9	.	.	PROPN
chd-99	303	10	,	,	PUNCT
chd-99	303	11	wertheim	wertheim	PROPN
chd-99	303	12	,	,	PUNCT
chd-99	303	13	g.b	g.b	PROPN
chd-99	303	14	.	.	PROPN
chd-99	303	15	,	,	PUNCT
chd-99	303	16	wang	wang	PROPN
chd-99	303	17	,	,	PUNCT
chd-99	303	18	j.	j.	PROPN
chd-99	303	19	,	,	PUNCT
chd-99	303	20	hartman	hartman	PROPN
chd-99	303	21	,	,	PUNCT
chd-99	303	22	j.l	j.l	PROPN
chd-99	303	23	.	.	PROPN
chd-99	303	24	,	,	PUNCT
chd-99	303	25	boxer	boxer	PROPN
chd-99	303	26	,	,	PUNCT
chd-99	303	27	r.b	r.b	PROPN
chd-99	303	28	.	.	PROPN
chd-99	303	29	,	,	PUNCT
chd-99	303	30	and	and	CCONJ
chd-99	303	31	chodosh	chodosh	PROPN
chd-99	303	32	,	,	PUNCT
chd-99	303	33	l.a	l.a	PROPN
chd-99	303	34	.	.	PROPN
chd-99	303	35	(	(	PUNCT
chd-99	303	36	2002	2002	NUM
chd-99	303	37	)	)	PUNCT
chd-99	303	38	.	.	PUNCT
chd-99	304	1	a	a	DET
chd-99	304	2	novel	novel	ADJ
chd-99	304	3	doxycycline	doxycycline	NOUN
chd-99	304	4	-	-	PUNCT
chd-99	304	5	inducible	inducible	ADJ
chd-99	304	6	system	system	NOUN
chd-99	304	7	for	for	ADP
chd-99	304	8	the	the	DET
chd-99	304	9	transgenic	transgenic	NOUN
chd-99	304	10	analysis	analysis	NOUN
chd-99	304	11	of	of	ADP
chd-99	304	12	mammary	mammary	ADJ
chd-99	304	13	gland	gland	NOUN
chd-99	304	14	biology	biology	NOUN
chd-99	304	15	.	.	PUNCT
chd-99	305	1	faseb	faseb	PROPN
chd-99	305	2	j	j	PROPN
chd-99	305	3	16	16	NUM
chd-99	305	4	,	,	PUNCT
chd-99	305	5	283	283	NUM
chd-99	305	6	-	-	SYM
chd-99	305	7	292	292	NUM
chd-99	305	8	.	.	PUNCT
chd-99	306	1	guo	guo	PROPN
chd-99	306	2	,	,	PUNCT
chd-99	306	3	q.j	q.j	PROPN
chd-99	306	4	.	.	PROPN
chd-99	306	5	,	,	PUNCT
chd-99	306	6	mills	mill	NOUN
chd-99	306	7	,	,	PUNCT
chd-99	306	8	j.n	j.n	PROPN
chd-99	306	9	.	.	PROPN
chd-99	306	10	,	,	PUNCT
chd-99	306	11	bandurraga	bandurraga	PROPN
chd-99	306	12	,	,	PUNCT
chd-99	306	13	s.g	s.g	PROPN
chd-99	306	14	.	.	PROPN
chd-99	306	15	,	,	PUNCT
chd-99	306	16	nogueira	nogueira	PROPN
chd-99	306	17	,	,	PUNCT
chd-99	306	18	l.m	l.m	PROPN
chd-99	306	19	.	.	PROPN
chd-99	306	20	,	,	PUNCT
chd-99	306	21	mason	mason	PROPN
chd-99	306	22	,	,	PUNCT
chd-99	306	23	n.j	n.j	PROPN
chd-99	306	24	.	.	PROPN
chd-99	306	25	,	,	PUNCT
chd-99	306	26	camp	camp	NOUN
chd-99	306	27	,	,	PUNCT
chd-99	306	28	e.r	e.r	PROPN
chd-99	306	29	.	.	PROPN
chd-99	306	30	,	,	PUNCT
chd-99	306	31	larue	larue	PROPN
chd-99	306	32	,	,	PUNCT
chd-99	306	33	a.c	a.c	PROPN
chd-99	306	34	.	.	PROPN
chd-99	306	35	,	,	PUNCT
chd-99	306	36	turner	turner	PROPN
chd-99	306	37	,	,	PUNCT
chd-99	306	38	d.p	d.p	PROPN
chd-99	306	39	.	.	PROPN
chd-99	306	40	,	,	PUNCT
chd-99	306	41	and	and	CCONJ
chd-99	306	42	findlay	findlay	PROPN
chd-99	306	43	,	,	PUNCT
chd-99	306	44	v.j	v.j	PROPN
chd-99	306	45	.	.	PROPN
chd-99	306	46	(	(	PUNCT
chd-99	306	47	2013	2013	NUM
chd-99	306	48	)	)	PUNCT
chd-99	306	49	.	.	PUNCT
chd-99	307	1	microrna-510	microrna-510	PROPN
chd-99	307	2	promotes	promote	VERB
chd-99	307	3	cell	cell	NOUN
chd-99	307	4	and	and	CCONJ
chd-99	307	5	tumor	tumor	NOUN
chd-99	307	6	growth	growth	NOUN
chd-99	307	7	by	by	ADP
chd-99	307	8	targeting	target	VERB
chd-99	307	9	peroxiredoxin1	peroxiredoxin1	NOUN
chd-99	307	10	in	in	ADP
chd-99	307	11	breast	breast	NOUN
chd-99	307	12	cancer	cancer	NOUN
chd-99	307	13	.	.	PUNCT
chd-99	308	1	breast	breast	NOUN
chd-99	308	2	cancer	cancer	NOUN
chd-99	308	3	res	re	NOUN
chd-99	308	4	15	15	NUM
chd-99	308	5	,	,	PUNCT
chd-99	308	6	r70	r70	NOUN
chd-99	308	7	.	.	PUNCT
chd-99	309	1	hankins	hankins	PROPN
chd-99	309	2	,	,	PUNCT
chd-99	309	3	g.r	g.r	PROPN
chd-99	309	4	.	.	PROPN
chd-99	309	5	,	,	PUNCT
chd-99	309	6	de	de	PROPN
chd-99	309	7	souza	souza	PROPN
chd-99	309	8	,	,	PUNCT
chd-99	309	9	a.t	a.t	PROPN
chd-99	309	10	.	.	PROPN
chd-99	309	11	,	,	PUNCT
chd-99	309	12	bentley	bentley	PROPN
chd-99	309	13	,	,	PUNCT
chd-99	309	14	r.c	r.c	PROPN
chd-99	309	15	.	.	PROPN
chd-99	309	16	,	,	PUNCT
chd-99	309	17	patel	patel	PROPN
chd-99	309	18	,	,	PUNCT
chd-99	309	19	m.r	m.r	PROPN
chd-99	309	20	.	.	PROPN
chd-99	309	21	,	,	PUNCT
chd-99	309	22	marks	marks	PROPN
chd-99	309	23	,	,	PUNCT
chd-99	309	24	j.r	j.r	PROPN
chd-99	309	25	.	.	PROPN
chd-99	309	26	,	,	PUNCT
chd-99	309	27	iglehart	iglehart	PROPN
chd-99	309	28	,	,	PUNCT
chd-99	309	29	j.d	j.d	PROPN
chd-99	309	30	.	.	PROPN
chd-99	309	31	,	,	PUNCT
chd-99	309	32	and	and	CCONJ
chd-99	309	33	jirtle	jirtle	PROPN
chd-99	309	34	,	,	PUNCT
chd-99	309	35	r.l	r.l	PROPN
chd-99	309	36	.	.	PROPN
chd-99	309	37	(	(	PUNCT
chd-99	309	38	1996	1996	NUM
chd-99	309	39	)	)	PUNCT
chd-99	309	40	.	.	PUNCT
chd-99	310	1	m6p	m6p	NOUN
chd-99	310	2	/	/	SYM
chd-99	310	3	igf2	igf2	NOUN
chd-99	310	4	receptor	receptor	NOUN
chd-99	310	5	:	:	PUNCT
chd-99	310	6	a	a	DET
chd-99	310	7	candidate	candidate	NOUN
chd-99	310	8	breast	breast	NOUN
chd-99	310	9	tumor	tumor	NOUN
chd-99	310	10	suppressor	suppressor	NOUN
chd-99	310	11	gene	gene	NOUN
chd-99	310	12	.	.	PUNCT
chd-99	311	1	oncogene	oncogene	NOUN
chd-99	311	2	12	12	NUM
chd-99	311	3	,	,	PUNCT
chd-99	311	4	2003	2003	NUM
chd-99	311	5	-	-	SYM
chd-99	311	6	2009	2009	NUM
chd-99	311	7	.	.	PUNCT
chd-99	312	1	hu	hu	PROPN
chd-99	312	2	,	,	PUNCT
chd-99	312	3	c.k	c.k	PROPN
chd-99	312	4	.	.	PROPN
chd-99	312	5	,	,	PUNCT
chd-99	312	6	mccall	mccall	PROPN
chd-99	312	7	,	,	PUNCT
chd-99	312	8	s.	s.	PROPN
chd-99	312	9	,	,	PUNCT
chd-99	312	10	madden	madden	PROPN
chd-99	312	11	,	,	PUNCT
chd-99	312	12	j.	j.	PROPN
chd-99	312	13	,	,	PUNCT
chd-99	312	14	huang	huang	PROPN
chd-99	312	15	,	,	PUNCT
chd-99	312	16	h.	h.	PROPN
chd-99	312	17	,	,	PUNCT
chd-99	312	18	clough	clough	PROPN
chd-99	312	19	,	,	PUNCT
chd-99	312	20	r.	r.	PROPN
chd-99	312	21	,	,	PUNCT
chd-99	312	22	jirtle	jirtle	PROPN
chd-99	312	23	,	,	PUNCT
chd-99	312	24	r.l	r.l	PROPN
chd-99	312	25	.	.	PROPN
chd-99	312	26	,	,	PUNCT
chd-99	312	27	and	and	CCONJ
chd-99	312	28	anscher	anscher	ADJ
chd-99	312	29	,	,	PUNCT
chd-99	312	30	m.s	m.s	PROPN
chd-99	312	31	.	.	PROPN
chd-99	312	32	(	(	PUNCT
chd-99	312	33	2006	2006	NUM
chd-99	312	34	)	)	PUNCT
chd-99	312	35	.	.	PUNCT
chd-99	313	1	loss	loss	NOUN
chd-99	313	2	of	of	ADP
chd-99	313	3	heterozygosity	heterozygosity	NOUN
chd-99	313	4	of	of	ADP
chd-99	313	5	m6p	m6p	NOUN
chd-99	313	6	/	/	SYM
chd-99	313	7	igf2r	igf2r	PROPN
chd-99	313	8	gene	gene	NOUN
chd-99	313	9	is	be	AUX
chd-99	313	10	an	an	DET
chd-99	313	11	early	early	ADJ
chd-99	313	12	event	event	NOUN
chd-99	313	13	in	in	ADP
chd-99	313	14	the	the	DET
chd-99	313	15	development	development	NOUN
chd-99	313	16	of	of	ADP
chd-99	313	17	prostate	prostate	NOUN
chd-99	313	18	cancer	cancer	NOUN
chd-99	313	19	.	.	PUNCT
chd-99	314	1	prostate	prostate	NOUN
chd-99	314	2	cancer	cancer	NOUN
chd-99	314	3	prostatic	prostatic	ADJ
chd-99	314	4	dis	dis	PROPN
chd-99	314	5	9	9	NUM
chd-99	314	6	,	,	PUNCT
chd-99	314	7	62	62	NUM
chd-99	314	8	-	-	SYM
chd-99	314	9	67	67	NUM
chd-99	314	10	.	.	PUNCT
chd-99	315	1	imam	imam	PROPN
chd-99	315	2	,	,	PUNCT
chd-99	315	3	j.s	j.s	PROPN
chd-99	315	4	.	.	PROPN
chd-99	315	5	,	,	PUNCT
chd-99	315	6	plyler	plyler	PROPN
chd-99	315	7	,	,	PUNCT
chd-99	315	8	j.r	j.r	PROPN
chd-99	315	9	.	.	PROPN
chd-99	315	10	,	,	PUNCT
chd-99	315	11	bansal	bansal	PROPN
chd-99	315	12	,	,	PUNCT
chd-99	315	13	h.	h.	PROPN
chd-99	315	14	,	,	PUNCT
chd-99	315	15	prajapati	prajapati	PROPN
chd-99	315	16	,	,	PUNCT
chd-99	315	17	s.	s.	PROPN
chd-99	315	18	,	,	PUNCT
chd-99	315	19	bansal	bansal	NOUN
chd-99	315	20	,	,	PUNCT
chd-99	315	21	s.	s.	PROPN
chd-99	315	22	,	,	PUNCT
chd-99	315	23	rebeles	rebele	NOUN
chd-99	315	24	,	,	PUNCT
chd-99	315	25	j.	j.	PROPN
chd-99	315	26	,	,	PUNCT
chd-99	315	27	chen	chen	PROPN
chd-99	315	28	,	,	PUNCT
chd-99	315	29	h.i	h.i	PROPN
chd-99	315	30	.	.	PROPN
chd-99	315	31	,	,	PUNCT
chd-99	315	32	chang	chang	PROPN
chd-99	315	33	,	,	PUNCT
chd-99	315	34	y.f	y.f	PROPN
chd-99	315	35	.	.	PROPN
chd-99	315	36	,	,	PUNCT
chd-99	315	37	panneerdoss	panneerdoss	PROPN
chd-99	315	38	,	,	PUNCT
chd-99	315	39	s.	s.	PROPN
chd-99	315	40	,	,	PUNCT
chd-99	315	41	zoghi	zoghi	PROPN
chd-99	315	42	,	,	PUNCT
chd-99	315	43	b.	b.	PROPN
chd-99	315	44	,	,	PUNCT
chd-99	315	45	et	et	PROPN
chd-99	315	46	al	al	PROPN
chd-99	315	47	.	.	PUNCT
chd-99	316	1	(	(	PUNCT
chd-99	316	2	2012	2012	NUM
chd-99	316	3	)	)	PUNCT
chd-99	316	4	.	.	PUNCT
chd-99	317	1	genomic	genomic	ADJ
chd-99	317	2	loss	loss	NOUN
chd-99	317	3	of	of	ADP
chd-99	317	4	tumor	tumor	NOUN
chd-99	317	5	suppressor	suppressor	NOUN
chd-99	317	6	mirna-204	mirna-204	NOUN
chd-99	317	7	promotes	promote	VERB
chd-99	317	8	cancer	cancer	NOUN
chd-99	317	9	cell	cell	NOUN
chd-99	317	10	migration	migration	NOUN
chd-99	317	11	and	and	CCONJ
chd-99	317	12	invasion	invasion	NOUN
chd-99	317	13	by	by	ADP
chd-99	317	14	activating	activate	VERB
chd-99	317	15	akt	akt	PROPN
chd-99	317	16	/	/	SYM
chd-99	317	17	mtor	mtor	PROPN
chd-99	317	18	/	/	SYM
chd-99	317	19	rac1	rac1	PROPN
chd-99	317	20	signaling	signaling	NOUN
chd-99	317	21	and	and	CCONJ
chd-99	317	22	actin	actin	NOUN
chd-99	317	23	reorganization	reorganization	NOUN
chd-99	317	24	.	.	PUNCT
chd-99	318	1	plos	plos	PROPN
chd-99	318	2	one	one	NUM
chd-99	318	3	7	7	NUM
chd-99	318	4	,	,	PUNCT
chd-99	318	5	e52397	e52397	PROPN
chd-99	318	6	.	.	PUNCT
chd-99	318	7	iwamoto	iwamoto	ADJ
chd-99	318	8	,	,	PUNCT
chd-99	318	9	k.s	k.s	PROPN
chd-99	318	10	.	.	PROPN
chd-99	318	11	,	,	PUNCT
chd-99	318	12	yano	yano	PROPN
chd-99	318	13	,	,	PUNCT
chd-99	318	14	s.	s.	PROPN
chd-99	318	15	,	,	PUNCT
chd-99	318	16	barber	barber	PROPN
chd-99	318	17	,	,	PUNCT
chd-99	318	18	c.l	c.l	PROPN
chd-99	318	19	.	.	PROPN
chd-99	318	20	,	,	PUNCT
chd-99	318	21	macphee	macphee	PROPN
chd-99	318	22	,	,	PUNCT
chd-99	318	23	d.g	d.g	PROPN
chd-99	318	24	.	.	PROPN
chd-99	318	25	,	,	PUNCT
chd-99	318	26	and	and	CCONJ
chd-99	318	27	tokuoka	tokuoka	PROPN
chd-99	318	28	,	,	PUNCT
chd-99	318	29	s.	s.	PROPN
chd-99	318	30	(	(	PUNCT
chd-99	318	31	2006	2006	NUM
chd-99	318	32	)	)	PUNCT
chd-99	318	33	.	.	PUNCT
chd-99	319	1	a	a	DET
chd-99	319	2	dose	dose	NOUN
chd-99	319	3	-	-	PUNCT
chd-99	319	4	dependent	dependent	ADJ
chd-99	319	5	decrease	decrease	NOUN
chd-99	319	6	in	in	ADP
chd-99	319	7	the	the	DET
chd-99	319	8	fraction	fraction	NOUN
chd-99	319	9	of	of	ADP
chd-99	319	10	cases	case	NOUN
chd-99	319	11	harboring	harbor	VERB
chd-99	319	12	m6p	m6p	NOUN
chd-99	319	13	/	/	SYM
chd-99	319	14	igf2r	igf2r	PROPN
chd-99	319	15	mutations	mutation	NOUN
chd-99	319	16	in	in	ADP
chd-99	319	17	hepatocellular	hepatocellular	ADJ
chd-99	319	18	carcinomas	carcinoma	NOUN
chd-99	319	19	from	from	ADP
chd-99	319	20	the	the	DET
chd-99	319	21	atomic	atomic	ADJ
chd-99	319	22	bomb	bomb	NOUN
chd-99	319	23	survivors	survivor	NOUN
chd-99	319	24	.	.	PUNCT
chd-99	320	1	radiat	radiat	PROPN
chd-99	320	2	res	re	NOUN
chd-99	320	3	166	166	NUM
chd-99	320	4	,	,	PUNCT
chd-99	320	5	870	870	NUM
chd-99	320	6	-	-	SYM
chd-99	320	7	876	876	NUM
chd-99	320	8	.	.	PUNCT
chd-99	321	1	kalla	kalla	PROPN
chd-99	321	2	singh	singh	PROPN
chd-99	321	3	,	,	PUNCT
chd-99	321	4	s.	s.	PROPN
chd-99	321	5	,	,	PUNCT
chd-99	321	6	tan	tan	PROPN
chd-99	321	7	,	,	PUNCT
chd-99	321	8	q.w	q.w	PROPN
chd-99	321	9	.	.	PROPN
chd-99	321	10	,	,	PUNCT
chd-99	321	11	brito	brito	PROPN
chd-99	321	12	,	,	PUNCT
chd-99	321	13	c.	c.	PROPN
chd-99	321	14	,	,	PUNCT
chd-99	321	15	de	de	PROPN
chd-99	321	16	leon	leon	PROPN
chd-99	321	17	,	,	PUNCT
chd-99	321	18	m.	m.	NOUN
chd-99	321	19	,	,	PUNCT
chd-99	321	20	and	and	CCONJ
chd-99	321	21	de	de	X
chd-99	321	22	leon	leon	PROPN
chd-99	321	23	,	,	PUNCT
chd-99	321	24	d.	d.	PROPN
chd-99	321	25	(	(	PUNCT
chd-99	321	26	2010	2010	NUM
chd-99	321	27	)	)	PUNCT
chd-99	321	28	.	.	PUNCT
chd-99	322	1	insulin	insulin	NOUN
chd-99	322	2	-	-	PUNCT
chd-99	322	3	like	like	ADJ
chd-99	322	4	growth	growth	NOUN
chd-99	322	5	factors	factor	NOUN
chd-99	322	6	i	i	PRON
chd-99	322	7	and	and	CCONJ
chd-99	322	8	ii	ii	NOUN
chd-99	322	9	receptors	receptor	NOUN
chd-99	322	10	in	in	ADP
chd-99	322	11	the	the	DET
chd-99	322	12	breast	breast	NOUN
chd-99	322	13	cancer	cancer	NOUN
chd-99	322	14	survival	survival	NOUN
chd-99	322	15	disparity	disparity	NOUN
chd-99	322	16	among	among	ADP
chd-99	322	17	africanamerican	africanamerican	ADJ
chd-99	322	18	women	woman	NOUN
chd-99	322	19	.	.	PUNCT
chd-99	323	1	growth	growth	NOUN
chd-99	323	2	horm	horm	PROPN
chd-99	323	3	igf	igf	PROPN
chd-99	323	4	res	res	PROPN
chd-99	323	5	20	20	NUM
chd-99	323	6	,	,	PUNCT
chd-99	323	7	245	245	NUM
chd-99	323	8	-	-	SYM
chd-99	323	9	254	254	NUM
chd-99	323	10	.	.	PUNCT
chd-99	324	1	kang	kang	PROPN
chd-99	324	2	,	,	PUNCT
chd-99	324	3	j.x	j.x	PROPN
chd-99	324	4	.	.	PROPN
chd-99	324	5	,	,	PUNCT
chd-99	324	6	li	li	PROPN
chd-99	324	7	,	,	PUNCT
chd-99	324	8	y.	y.	NOUN
chd-99	324	9	,	,	PUNCT
chd-99	324	10	and	and	CCONJ
chd-99	324	11	leaf	leaf	NOUN
chd-99	324	12	,	,	PUNCT
chd-99	324	13	a.	a.	NOUN
chd-99	324	14	(	(	PUNCT
chd-99	324	15	1997	1997	NUM
chd-99	324	16	)	)	PUNCT
chd-99	324	17	.	.	PUNCT
chd-99	325	1	mannose-6phosphate	mannose-6phosphate	VERB
chd-99	325	2	/	/	SYM
chd-99	325	3	insulin	insulin	NOUN
chd-99	325	4	-	-	PUNCT
chd-99	325	5	like	like	ADJ
chd-99	325	6	growth	growth	NOUN
chd-99	325	7	factor	factor	NOUN
chd-99	325	8	-	-	PUNCT
chd-99	325	9	ii	ii	NOUN
chd-99	325	10	receptor	receptor	NOUN
chd-99	325	11	is	be	AUX
chd-99	325	12	a	a	DET
chd-99	325	13	receptor	receptor	NOUN
chd-99	325	14	for	for	ADP
chd-99	325	15	retinoic	retinoic	ADJ
chd-99	325	16	acid	acid	NOUN
chd-99	325	17	.	.	PUNCT
chd-99	326	1	proc	proc	PROPN
chd-99	326	2	natl	natl	PROPN
chd-99	326	3	acad	acad	PROPN
chd-99	326	4	sci	sci	PROPN
chd-99	326	5	u	u	PROPN
chd-99	326	6	s	s	PROPN
chd-99	326	7	a	a	DET
chd-99	326	8	94	94	NUM
chd-99	326	9	,	,	PUNCT
chd-99	326	10	13671	13671	NUM
chd-99	326	11	-	-	SYM
chd-99	326	12	13676	13676	NUM
chd-99	326	13	.	.	PUNCT
chd-99	327	1	kim	kim	PROPN
chd-99	327	2	,	,	PUNCT
chd-99	327	3	h.j	h.j	PROPN
chd-99	327	4	.	.	PROPN
chd-99	327	5	,	,	PUNCT
chd-99	327	6	litzenburger	litzenburger	PROPN
chd-99	327	7	,	,	PUNCT
chd-99	327	8	b.c	b.c	PROPN
chd-99	327	9	.	.	PROPN
chd-99	327	10	,	,	PUNCT
chd-99	327	11	cui	cui	PROPN
chd-99	327	12	,	,	PUNCT
chd-99	327	13	x.	x.	PROPN
chd-99	327	14	,	,	PUNCT
chd-99	327	15	delgado	delgado	PROPN
chd-99	327	16	,	,	PUNCT
chd-99	327	17	d.a	d.a	PROPN
chd-99	327	18	.	.	PROPN
chd-99	327	19	,	,	PUNCT
chd-99	327	20	grabiner	grabiner	PROPN
chd-99	327	21	,	,	PUNCT
chd-99	327	22	b.c	b.c	PROPN
chd-99	327	23	.	.	PROPN
chd-99	327	24	,	,	PUNCT
chd-99	327	25	lin	lin	PROPN
chd-99	327	26	,	,	PUNCT
chd-99	327	27	x.	x.	PROPN
chd-99	327	28	,	,	PUNCT
chd-99	327	29	lewis	lewis	PROPN
chd-99	327	30	,	,	PUNCT
chd-99	327	31	m.t	m.t	PROPN
chd-99	327	32	.	.	PROPN
chd-99	327	33	,	,	PUNCT
chd-99	327	34	gottardis	gottardis	PROPN
chd-99	327	35	,	,	PUNCT
chd-99	327	36	m.m	m.m	PROPN
chd-99	327	37	.	.	PROPN
chd-99	327	38	,	,	PUNCT
chd-99	327	39	wong	wong	PROPN
chd-99	327	40	,	,	PUNCT
chd-99	327	41	t.w	t.w	PROPN
chd-99	327	42	.	.	PROPN
chd-99	327	43	,	,	PUNCT
chd-99	327	44	attar	attar	PROPN
chd-99	327	45	,	,	PUNCT
chd-99	327	46	r.m	r.m	PROPN
chd-99	327	47	.	.	PROPN
chd-99	327	48	,	,	PUNCT
chd-99	327	49	et	et	PROPN
chd-99	327	50	al	al	PROPN
chd-99	327	51	.	.	PUNCT
chd-99	327	52	(	(	PUNCT
chd-99	327	53	2007	2007	NUM
chd-99	327	54	)	)	PUNCT
chd-99	327	55	.	.	PUNCT
chd-99	328	1	constitutively	constitutively	ADV
chd-99	328	2	active	active	ADJ
chd-99	328	3	type	type	NOUN
chd-99	328	4	i	i	PRON
chd-99	328	5	insulin	insulin	NOUN
chd-99	328	6	-	-	PUNCT
chd-99	328	7	like	like	ADJ
chd-99	328	8	growth	growth	NOUN
chd-99	328	9	factor	factor	NOUN
chd-99	328	10	receptor	receptor	NOUN
chd-99	328	11	causes	cause	VERB
chd-99	328	12	transformation	transformation	NOUN
chd-99	328	13	and	and	CCONJ
chd-99	328	14	xenograft	xenograft	NOUN
chd-99	328	15	growth	growth	NOUN
chd-99	328	16	of	of	ADP
chd-99	328	17	immortalized	immortalized	ADJ
chd-99	328	18	mammary	mammary	ADJ
chd-99	328	19	epithelial	epithelial	ADJ
chd-99	328	20	cells	cell	NOUN
chd-99	328	21	and	and	CCONJ
chd-99	328	22	is	be	AUX
chd-99	328	23	accompanied	accompany	VERB
chd-99	328	24	by	by	ADP
chd-99	328	25	an	an	DET
chd-99	328	26	epithelial	epithelial	ADJ
chd-99	328	27	-	-	PUNCT
chd-99	328	28	tomesenchymal	tomesenchymal	NOUN
chd-99	328	29	transition	transition	NOUN
chd-99	328	30	mediated	mediate	VERB
chd-99	328	31	by	by	ADP
chd-99	328	32	nf	nf	NOUN
chd-99	328	33	-	-	PUNCT
chd-99	328	34	kappab	kappab	NOUN
chd-99	328	35	and	and	CCONJ
chd-99	328	36	snail	snail	NOUN
chd-99	328	37	.	.	PUNCT
chd-99	329	1	mol	mol	ADP
chd-99	329	2	cell	cell	NOUN
chd-99	329	3	biol	biol	NOUN
chd-99	329	4	27	27	NUM
chd-99	329	5	,	,	PUNCT
chd-99	329	6	3165	3165	NUM
chd-99	329	7	-	-	SYM
chd-99	329	8	3175	3175	NUM
chd-99	329	9	.	.	PUNCT
chd-99	330	1	lam	lam	PROPN
chd-99	330	2	,	,	PUNCT
chd-99	330	3	e.k	e.k	PROPN
chd-99	330	4	.	.	PROPN
chd-99	330	5	,	,	PUNCT
chd-99	330	6	wang	wang	PROPN
chd-99	330	7	,	,	PUNCT
chd-99	330	8	x.	x.	PROPN
chd-99	330	9	,	,	PUNCT
chd-99	330	10	shin	shin	PROPN
chd-99	330	11	,	,	PUNCT
chd-99	330	12	v.y	v.y	PROPN
chd-99	330	13	.	.	PROPN
chd-99	330	14	,	,	PUNCT
chd-99	330	15	zhang	zhang	PROPN
chd-99	330	16	,	,	PUNCT
chd-99	330	17	s.	s.	PROPN
chd-99	330	18	,	,	PUNCT
chd-99	330	19	morrison	morrison	PROPN
chd-99	330	20	,	,	PUNCT
chd-99	330	21	h.	h.	PROPN
chd-99	330	22	,	,	PUNCT
chd-99	330	23	sun	sun	PROPN
chd-99	330	24	,	,	PUNCT
chd-99	330	25	j.	j.	PROPN
chd-99	330	26	,	,	PUNCT
chd-99	330	27	ng	ng	PROPN
chd-99	330	28	,	,	PUNCT
chd-99	330	29	e.k	e.k	PROPN
chd-99	330	30	.	.	PROPN
chd-99	330	31	,	,	PUNCT
chd-99	330	32	yu	yu	PROPN
chd-99	330	33	,	,	PUNCT
chd-99	330	34	j.	j.	PROPN
chd-99	330	35	,	,	PUNCT
chd-99	330	36	and	and	CCONJ
chd-99	330	37	jin	jin	NOUN
chd-99	330	38	,	,	PUNCT
chd-99	330	39	h.	h.	PROPN
chd-99	330	40	(	(	PUNCT
chd-99	330	41	2011	2011	NUM
chd-99	330	42	)	)	PUNCT
chd-99	330	43	.	.	PUNCT
chd-99	331	1	a	a	DET
chd-99	331	2	microrna	microrna	PROPN
chd-99	331	3	contribution	contribution	NOUN
chd-99	331	4	to	to	ADP
chd-99	331	5	aberrant	aberrant	ADJ
chd-99	331	6	ras	ras	NOUN
chd-99	331	7	activation	activation	NOUN
chd-99	331	8	in	in	ADP
chd-99	331	9	gastric	gastric	ADJ
chd-99	331	10	cancer	cancer	NOUN
chd-99	331	11	.	.	PUNCT
chd-99	332	1	am	be	AUX
chd-99	332	2	j	j	PROPN
chd-99	332	3	transl	transl	PROPN
chd-99	332	4	res	re	VERB
chd-99	332	5	3	3	NUM
chd-99	332	6	,	,	PUNCT
chd-99	332	7	209	209	NUM
chd-99	332	8	-	-	SYM
chd-99	332	9	218	218	NUM
chd-99	332	10	.	.	PUNCT
chd-99	333	1	lee	lee	PROPN
chd-99	333	2	,	,	PUNCT
chd-99	333	3	h.	h.	PROPN
chd-99	333	4	,	,	PUNCT
chd-99	333	5	lee	lee	PROPN
chd-99	333	6	,	,	PUNCT
chd-99	333	7	s.	s.	PROPN
chd-99	333	8	,	,	PUNCT
chd-99	333	9	bae	bae	PROPN
chd-99	333	10	,	,	PUNCT
chd-99	333	11	h.	h.	PROPN
chd-99	333	12	,	,	PUNCT
chd-99	333	13	kang	kang	PROPN
chd-99	333	14	,	,	PUNCT
chd-99	333	15	h.s	h.s	PROPN
chd-99	333	16	.	.	PROPN
chd-99	333	17	,	,	PUNCT
chd-99	333	18	and	and	CCONJ
chd-99	333	19	kim	kim	PROPN
chd-99	333	20	,	,	PUNCT
chd-99	333	21	s.j	s.j	PROPN
chd-99	333	22	.	.	PROPN
chd-99	333	23	(	(	PUNCT
chd-99	333	24	2016	2016	NUM
chd-99	333	25	)	)	PUNCT
chd-99	333	26	.	.	PUNCT
chd-99	334	1	genome	genome	NOUN
chd-99	334	2	-	-	PUNCT
chd-99	334	3	wide	wide	ADJ
chd-99	334	4	identification	identification	NOUN
chd-99	334	5	of	of	ADP
chd-99	334	6	target	target	NOUN
chd-99	334	7	genes	gene	NOUN
chd-99	334	8	for	for	ADP
chd-99	334	9	mir-204	mir-204	NOUN
chd-99	334	10	and	and	CCONJ
chd-99	334	11	mir-211	mir-211	NOUN
chd-99	334	12	identifies	identify	VERB
chd-99	334	13	their	their	PRON
chd-99	334	14	proliferation	proliferation	NOUN
chd-99	334	15	stimulatory	stimulatory	ADJ
chd-99	334	16	role	role	NOUN
chd-99	334	17	in	in	ADP
chd-99	334	18	breast	breast	NOUN
chd-99	334	19	cancer	cancer	NOUN
chd-99	334	20	cells	cell	NOUN
chd-99	334	21	.	.	PUNCT
chd-99	335	1	sci	sci	PROPN
chd-99	335	2	rep	rep	PROPN
chd-99	335	3	6	6	NUM
chd-99	335	4	,	,	PUNCT
chd-99	335	5	25287	25287	NUM
chd-99	335	6	.	.	PUNCT
chd-99	336	1	leroith	leroith	PROPN
chd-99	336	2	,	,	PUNCT
chd-99	336	3	d.	d.	PROPN
chd-99	336	4	,	,	PUNCT
chd-99	336	5	and	and	CCONJ
chd-99	336	6	roberts	roberts	PROPN
chd-99	336	7	,	,	PUNCT
chd-99	336	8	c.t	c.t	PROPN
chd-99	336	9	.	.	PROPN
chd-99	336	10	,	,	PUNCT
chd-99	336	11	jr	jr	PROPN
chd-99	336	12	.	.	PROPN
chd-99	336	13	(	(	PUNCT
chd-99	336	14	2003	2003	NUM
chd-99	336	15	)	)	PUNCT
chd-99	336	16	.	.	PUNCT
chd-99	337	1	the	the	DET
chd-99	337	2	insulin	insulin	NOUN
chd-99	337	3	-	-	PUNCT
chd-99	337	4	like	like	ADJ
chd-99	337	5	growth	growth	NOUN
chd-99	337	6	factor	factor	NOUN
chd-99	337	7	system	system	NOUN
chd-99	337	8	and	and	CCONJ
chd-99	337	9	cancer	cancer	NOUN
chd-99	337	10	.	.	PUNCT
chd-99	338	1	cancer	cancer	NOUN
chd-99	338	2	lett	lett	PROPN
chd-99	338	3	195	195	NUM
chd-99	338	4	,	,	PUNCT
chd-99	338	5	127137	127137	NUM
chd-99	338	6	.	.	PUNCT
chd-99	339	1	li	li	PROPN
chd-99	339	2	,	,	PUNCT
chd-99	339	3	g.	g.	PROPN
chd-99	339	4	,	,	PUNCT
chd-99	339	5	luna	luna	PROPN
chd-99	339	6	,	,	PUNCT
chd-99	339	7	c.	c.	PROPN
chd-99	339	8	,	,	PUNCT
chd-99	339	9	qiu	qiu	PROPN
chd-99	339	10	,	,	PUNCT
chd-99	339	11	j.	j.	PROPN
chd-99	339	12	,	,	PUNCT
chd-99	339	13	epstein	epstein	PROPN
chd-99	339	14	,	,	PUNCT
chd-99	339	15	d.l	d.l	PROPN
chd-99	339	16	.	.	PROPN
chd-99	339	17	,	,	PUNCT
chd-99	339	18	and	and	CCONJ
chd-99	339	19	gonzalez	gonzalez	PROPN
chd-99	339	20	,	,	PUNCT
chd-99	339	21	p.	p.	NOUN
chd-99	339	22	(	(	PUNCT
chd-99	339	23	2011	2011	NUM
chd-99	339	24	)	)	PUNCT
chd-99	339	25	.	.	PUNCT
chd-99	340	1	role	role	NOUN
chd-99	340	2	of	of	ADP
chd-99	340	3	mir-204	mir-204	NOUN
chd-99	340	4	in	in	ADP
chd-99	340	5	the	the	DET
chd-99	340	6	regulation	regulation	NOUN
chd-99	340	7	of	of	ADP
chd-99	340	8	apoptosis	apoptosis	NOUN
chd-99	340	9	,	,	PUNCT
chd-99	340	10	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	VERB
chd-99	340	11	e17	e17	NOUN
chd-99	340	12	cancer	cancer	NOUN
chd-99	340	13	health	health	NOUN
chd-99	340	14	disparities	disparity	NOUN
chd-99	340	15	research	research	VERB
chd-99	340	16	endoplasmic	endoplasmic	ADJ
chd-99	340	17	reticulum	reticulum	NOUN
chd-99	340	18	stress	stress	NOUN
chd-99	340	19	response	response	NOUN
chd-99	340	20	,	,	PUNCT
chd-99	340	21	and	and	CCONJ
chd-99	340	22	inflammation	inflammation	NOUN
chd-99	340	23	in	in	ADP
chd-99	340	24	human	human	ADJ
chd-99	340	25	trabecular	trabecular	ADJ
chd-99	340	26	meshwork	meshwork	ADJ
chd-99	340	27	cells	cell	NOUN
chd-99	340	28	.	.	PUNCT
chd-99	341	1	invest	invest	VERB
chd-99	341	2	ophthalmol	ophthalmol	PROPN
chd-99	341	3	vis	vis	X
chd-99	341	4	sci	sci	PROPN
chd-99	341	5	52	52	NUM
chd-99	341	6	,	,	PUNCT
chd-99	341	7	2999	2999	NUM
chd-99	341	8	-	-	SYM
chd-99	341	9	3007	3007	NUM
chd-99	341	10	.	.	PUNCT
chd-99	342	1	li	li	PROPN
chd-99	342	2	,	,	PUNCT
chd-99	342	3	t.	t.	PROPN
chd-99	342	4	,	,	PUNCT
chd-99	342	5	pan	pan	PROPN
chd-99	342	6	,	,	PUNCT
chd-99	342	7	h.	h.	PROPN
chd-99	342	8	,	,	PUNCT
chd-99	342	9	and	and	CCONJ
chd-99	342	10	li	li	PROPN
chd-99	342	11	,	,	PUNCT
chd-99	342	12	r.	r.	PROPN
chd-99	342	13	(	(	PUNCT
chd-99	342	14	2016	2016	NUM
chd-99	342	15	)	)	PUNCT
chd-99	342	16	.	.	PUNCT
chd-99	343	1	the	the	DET
chd-99	343	2	dual	dual	ADJ
chd-99	343	3	regulatory	regulatory	ADJ
chd-99	343	4	role	role	NOUN
chd-99	343	5	of	of	ADP
chd-99	343	6	mir-204	mir-204	NOUN
chd-99	343	7	in	in	ADP
chd-99	343	8	cancer	cancer	NOUN
chd-99	343	9	.	.	PUNCT
chd-99	344	1	tumour	tumour	ADJ
chd-99	344	2	biol	biol	PROPN
chd-99	344	3	37	37	NUM
chd-99	344	4	,	,	PUNCT
chd-99	344	5	11667	11667	NUM
chd-99	344	6	-	-	SYM
chd-99	344	7	11677	11677	NUM
chd-99	344	8	.	.	PUNCT
chd-99	345	1	li	li	PROPN
chd-99	345	2	,	,	PUNCT
chd-99	345	3	w.	w.	PROPN
chd-99	345	4	,	,	PUNCT
chd-99	345	5	jin	jin	PROPN
chd-99	345	6	,	,	PUNCT
chd-99	345	7	x.	x.	PROPN
chd-99	345	8	,	,	PUNCT
chd-99	345	9	zhang	zhang	PROPN
chd-99	345	10	,	,	PUNCT
chd-99	345	11	q.	q.	PROPN
chd-99	345	12	,	,	PUNCT
chd-99	345	13	zhang	zhang	PROPN
chd-99	345	14	,	,	PUNCT
chd-99	345	15	g.	g.	PROPN
chd-99	345	16	,	,	PUNCT
chd-99	345	17	deng	deng	PROPN
chd-99	345	18	,	,	PUNCT
chd-99	345	19	x.	x.	PROPN
chd-99	345	20	,	,	PUNCT
chd-99	345	21	and	and	CCONJ
chd-99	345	22	ma	ma	PROPN
chd-99	345	23	,	,	PUNCT
chd-99	345	24	l.	l.	PROPN
chd-99	345	25	(	(	PUNCT
chd-99	345	26	2014	2014	NUM
chd-99	345	27	)	)	PUNCT
chd-99	345	28	.	.	PUNCT
chd-99	346	1	decreased	decrease	VERB
chd-99	346	2	expression	expression	NOUN
chd-99	346	3	of	of	ADP
chd-99	346	4	mir-204	mir-204	NOUN
chd-99	346	5	is	be	AUX
chd-99	346	6	associated	associate	VERB
chd-99	346	7	with	with	ADP
chd-99	346	8	poor	poor	ADJ
chd-99	346	9	prognosis	prognosis	NOUN
chd-99	346	10	in	in	ADP
chd-99	346	11	patients	patient	NOUN
chd-99	346	12	with	with	ADP
chd-99	346	13	breast	breast	NOUN
chd-99	346	14	cancer	cancer	NOUN
chd-99	346	15	.	.	PUNCT
chd-99	347	1	int	int	PROPN
chd-99	348	1	j	j	PROPN
chd-99	348	2	clin	clin	PROPN
chd-99	348	3	exp	exp	NOUN
chd-99	348	4	pathol	pathol	NOUN
chd-99	348	5	7	7	NUM
chd-99	348	6	,	,	PUNCT
chd-99	348	7	3287	3287	NUM
chd-99	348	8	-	-	SYM
chd-99	348	9	3292	3292	NUM
chd-99	348	10	.	.	PUNCT
chd-99	349	1	mattie	mattie	PROPN
chd-99	349	2	,	,	PUNCT
chd-99	349	3	m.d	m.d	PROPN
chd-99	349	4	.	.	PROPN
chd-99	349	5	,	,	PUNCT
chd-99	349	6	benz	benz	PROPN
chd-99	349	7	,	,	PUNCT
chd-99	349	8	c.c	c.c	PROPN
chd-99	349	9	.	.	PROPN
chd-99	349	10	,	,	PUNCT
chd-99	349	11	bowers	bowers	PROPN
chd-99	349	12	,	,	PUNCT
chd-99	349	13	j.	j.	PROPN
chd-99	349	14	,	,	PUNCT
chd-99	349	15	sensinger	sensinger	NOUN
chd-99	349	16	,	,	PUNCT
chd-99	349	17	k.	k.	PROPN
chd-99	349	18	,	,	PUNCT
chd-99	349	19	wong	wong	PROPN
chd-99	349	20	,	,	PUNCT
chd-99	349	21	l.	l.	PROPN
chd-99	349	22	,	,	PUNCT
chd-99	349	23	scott	scott	PROPN
chd-99	349	24	,	,	PUNCT
chd-99	349	25	g.k	g.k	PROPN
chd-99	349	26	.	.	PROPN
chd-99	349	27	,	,	PUNCT
chd-99	349	28	fedele	fedele	PROPN
chd-99	349	29	,	,	PUNCT
chd-99	349	30	v.	v.	ADV
chd-99	349	31	,	,	PUNCT
chd-99	349	32	ginzinger	ginzinger	NOUN
chd-99	349	33	,	,	PUNCT
chd-99	349	34	d.	d.	PROPN
chd-99	349	35	,	,	PUNCT
chd-99	349	36	getts	getts	PROPN
chd-99	349	37	,	,	PUNCT
chd-99	349	38	r.	r.	NOUN
chd-99	349	39	,	,	PUNCT
chd-99	349	40	and	and	CCONJ
chd-99	349	41	haqq	haqq	NOUN
chd-99	349	42	,	,	PUNCT
chd-99	349	43	c.	c.	PROPN
chd-99	349	44	(	(	PUNCT
chd-99	349	45	2006	2006	NUM
chd-99	349	46	)	)	PUNCT
chd-99	349	47	.	.	PUNCT
chd-99	350	1	optimized	optimize	VERB
chd-99	350	2	high	high	ADJ
chd-99	350	3	-	-	PUNCT
chd-99	350	4	throughput	throughput	NOUN
chd-99	350	5	microrna	microrna	PROPN
chd-99	350	6	expression	expression	NOUN
chd-99	350	7	profiling	profiling	NOUN
chd-99	350	8	provides	provide	VERB
chd-99	350	9	novel	novel	ADJ
chd-99	350	10	biomarker	biomarker	NOUN
chd-99	350	11	assessment	assessment	NOUN
chd-99	350	12	of	of	ADP
chd-99	350	13	clinical	clinical	ADJ
chd-99	350	14	prostate	prostate	NOUN
chd-99	350	15	and	and	CCONJ
chd-99	350	16	breast	breast	NOUN
chd-99	350	17	cancer	cancer	NOUN
chd-99	350	18	biopsies	biopsy	NOUN
chd-99	350	19	.	.	PUNCT
chd-99	351	1	mol	mol	ADP
chd-99	351	2	cancer	cancer	NOUN
chd-99	351	3	5	5	NUM
chd-99	351	4	,	,	PUNCT
chd-99	351	5	24	24	NUM
chd-99	351	6	.	.	PUNCT
chd-99	352	1	oates	oates	PROPN
chd-99	352	2	,	,	PUNCT
chd-99	352	3	a.j	a.j	PROPN
chd-99	352	4	.	.	PROPN
chd-99	352	5	,	,	PUNCT
chd-99	352	6	schumaker	schumaker	PROPN
chd-99	352	7	,	,	PUNCT
chd-99	352	8	l.m	l.m	PROPN
chd-99	352	9	.	.	PROPN
chd-99	352	10	,	,	PUNCT
chd-99	352	11	jenkins	jenkins	PROPN
chd-99	352	12	,	,	PUNCT
chd-99	352	13	s.b	s.b	PROPN
chd-99	352	14	.	.	PROPN
chd-99	352	15	,	,	PUNCT
chd-99	352	16	pearce	pearce	PROPN
chd-99	352	17	,	,	PUNCT
chd-99	352	18	a.a	a.a	PROPN
chd-99	352	19	.	.	PROPN
chd-99	352	20	,	,	PUNCT
chd-99	352	21	dacosta	dacosta	PROPN
chd-99	352	22	,	,	PUNCT
chd-99	352	23	s.a	s.a	PROPN
chd-99	352	24	.	.	PROPN
chd-99	352	25	,	,	PUNCT
chd-99	352	26	arun	arun	PROPN
chd-99	352	27	,	,	PUNCT
chd-99	352	28	b.	b.	PROPN
chd-99	352	29	,	,	PUNCT
chd-99	352	30	and	and	CCONJ
chd-99	352	31	ellis	ellis	PROPN
chd-99	352	32	,	,	PUNCT
chd-99	352	33	m.j	m.j	PROPN
chd-99	352	34	.	.	PROPN
chd-99	352	35	(	(	PUNCT
chd-99	352	36	1998	1998	NUM
chd-99	352	37	)	)	PUNCT
chd-99	352	38	.	.	PUNCT
chd-99	353	1	the	the	DET
chd-99	353	2	mannose	mannose	NOUN
chd-99	353	3	6	6	NUM
chd-99	353	4	-	-	PUNCT
chd-99	353	5	phosphate	phosphate	NOUN
chd-99	353	6	/	/	SYM
chd-99	353	7	insulin	insulin	NOUN
chd-99	353	8	-	-	PUNCT
chd-99	353	9	like	like	ADJ
chd-99	353	10	growth	growth	NOUN
chd-99	353	11	factor	factor	NOUN
chd-99	353	12	2	2	NUM
chd-99	353	13	receptor	receptor	NOUN
chd-99	353	14	(	(	PUNCT
chd-99	353	15	m6p	m6p	NOUN
chd-99	353	16	/	/	SYM
chd-99	353	17	igf2r	igf2r	NUM
chd-99	353	18	)	)	PUNCT
chd-99	353	19	,	,	PUNCT
chd-99	353	20	a	a	DET
chd-99	353	21	putative	putative	ADJ
chd-99	353	22	breast	breast	NOUN
chd-99	353	23	tumor	tumor	NOUN
chd-99	353	24	suppressor	suppressor	NOUN
chd-99	353	25	gene	gene	NOUN
chd-99	353	26	.	.	PUNCT
chd-99	354	1	breast	breast	NOUN
chd-99	354	2	cancer	cancer	NOUN
chd-99	354	3	res	re	NOUN
chd-99	354	4	treat	treat	VERB
chd-99	354	5	47	47	NUM
chd-99	354	6	,	,	PUNCT
chd-99	354	7	269	269	NUM
chd-99	354	8	-	-	SYM
chd-99	354	9	281	281	NUM
chd-99	354	10	.	.	PUNCT
chd-99	355	1	oka	oka	NOUN
chd-99	355	2	,	,	PUNCT
chd-99	355	3	y.	y.	NOUN
chd-99	355	4	,	,	PUNCT
chd-99	355	5	rozek	rozek	NOUN
chd-99	355	6	,	,	PUNCT
chd-99	355	7	l.m	l.m	PROPN
chd-99	355	8	.	.	PROPN
chd-99	355	9	,	,	PUNCT
chd-99	355	10	and	and	CCONJ
chd-99	355	11	czech	czech	PROPN
chd-99	355	12	,	,	PUNCT
chd-99	355	13	m.p	m.p	PROPN
chd-99	355	14	.	.	PROPN
chd-99	355	15	(	(	PUNCT
chd-99	355	16	1985	1985	NUM
chd-99	355	17	)	)	PUNCT
chd-99	355	18	.	.	PUNCT
chd-99	356	1	direct	direct	ADJ
chd-99	356	2	demonstration	demonstration	NOUN
chd-99	356	3	of	of	ADP
chd-99	356	4	rapid	rapid	ADJ
chd-99	356	5	insulin	insulin	NOUN
chd-99	356	6	-	-	PUNCT
chd-99	356	7	like	like	ADJ
chd-99	356	8	growth	growth	NOUN
chd-99	356	9	factor	factor	NOUN
chd-99	356	10	ii	ii	NOUN
chd-99	356	11	receptor	receptor	NOUN
chd-99	356	12	internalization	internalization	NOUN
chd-99	356	13	and	and	CCONJ
chd-99	356	14	recycling	recycling	NOUN
chd-99	356	15	in	in	ADP
chd-99	356	16	rat	rat	NOUN
chd-99	356	17	adipocytes	adipocyte	NOUN
chd-99	356	18	.	.	PUNCT
chd-99	357	1	insulin	insulin	NOUN
chd-99	357	2	stimulates	stimulate	NOUN
chd-99	357	3	125i	125i	NOUN
chd-99	357	4	-	-	PUNCT
chd-99	357	5	insulin	insulin	NOUN
chd-99	357	6	-	-	PUNCT
chd-99	357	7	like	like	ADJ
chd-99	357	8	growth	growth	NOUN
chd-99	357	9	factor	factor	NOUN
chd-99	357	10	ii	ii	NOUN
chd-99	357	11	degradation	degradation	NOUN
chd-99	357	12	by	by	ADP
chd-99	357	13	modulating	modulate	VERB
chd-99	357	14	the	the	DET
chd-99	357	15	igf	igf	PROPN
chd-99	357	16	-	-	PUNCT
chd-99	357	17	ii	ii	NOUN
chd-99	357	18	receptor	receptor	NOUN
chd-99	357	19	recycling	recycling	NOUN
chd-99	357	20	process	process	NOUN
chd-99	357	21	.	.	PUNCT
chd-99	358	1	j	j	PROPN
chd-99	358	2	biol	biol	PROPN
chd-99	358	3	chem	chem	NOUN
chd-99	358	4	260	260	NUM
chd-99	358	5	,	,	PUNCT
chd-99	358	6	9435	9435	NUM
chd-99	358	7	-	-	SYM
chd-99	358	8	9442	9442	NUM
chd-99	358	9	.	.	PUNCT
chd-99	359	1	rhodes	rhode	NOUN
chd-99	359	2	,	,	PUNCT
chd-99	359	3	d.r	d.r	PROPN
chd-99	359	4	.	.	PROPN
chd-99	359	5	,	,	PUNCT
chd-99	359	6	yu	yu	PROPN
chd-99	359	7	,	,	PUNCT
chd-99	359	8	j.	j.	PROPN
chd-99	359	9	,	,	PUNCT
chd-99	359	10	shanker	shanker	PROPN
chd-99	359	11	,	,	PUNCT
chd-99	359	12	k.	k.	PROPN
chd-99	359	13	,	,	PUNCT
chd-99	359	14	deshpande	deshpande	PROPN
chd-99	359	15	,	,	PUNCT
chd-99	359	16	n.	n.	NOUN
chd-99	359	17	,	,	PUNCT
chd-99	359	18	varambally	varambally	ADV
chd-99	359	19	,	,	PUNCT
chd-99	359	20	r.	r.	PROPN
chd-99	359	21	,	,	PUNCT
chd-99	359	22	ghosh	ghosh	PROPN
chd-99	359	23	,	,	PUNCT
chd-99	359	24	d.	d.	PROPN
chd-99	359	25	,	,	PUNCT
chd-99	359	26	barrette	barrette	PROPN
chd-99	359	27	,	,	PUNCT
chd-99	359	28	t.	t.	PROPN
chd-99	359	29	,	,	PUNCT
chd-99	359	30	pandey	pandey	PROPN
chd-99	359	31	,	,	PUNCT
chd-99	359	32	a.	a.	PROPN
chd-99	359	33	,	,	PUNCT
chd-99	359	34	and	and	CCONJ
chd-99	359	35	chinnaiyan	chinnaiyan	NOUN
chd-99	359	36	,	,	PUNCT
chd-99	359	37	a.m.	a.m.	PROPN
chd-99	359	38	(	(	PUNCT
chd-99	359	39	2004	2004	NUM
chd-99	359	40	)	)	PUNCT
chd-99	359	41	.	.	PUNCT
chd-99	360	1	oncomine	oncomine	NOUN
chd-99	360	2	:	:	PUNCT
chd-99	360	3	a	a	DET
chd-99	360	4	cancer	cancer	NOUN
chd-99	360	5	microarray	microarray	NOUN
chd-99	360	6	database	database	NOUN
chd-99	360	7	and	and	CCONJ
chd-99	360	8	integrated	integrate	VERB
chd-99	360	9	data	data	NOUN
chd-99	360	10	-	-	PUNCT
chd-99	360	11	mining	mining	NOUN
chd-99	360	12	platform	platform	NOUN
chd-99	360	13	.	.	PUNCT
chd-99	361	1	neoplasia	neoplasia	NOUN
chd-99	361	2	6	6	NUM
chd-99	361	3	,	,	PUNCT
chd-99	361	4	1	1	NUM
chd-99	361	5	-	-	SYM
chd-99	361	6	6	6	NUM
chd-99	361	7	.	.	PUNCT
chd-99	362	1	schultz	schultz	PROPN
chd-99	362	2	,	,	PUNCT
chd-99	362	3	j.	j.	PROPN
chd-99	362	4	,	,	PUNCT
chd-99	362	5	lorenz	lorenz	PROPN
chd-99	362	6	,	,	PUNCT
chd-99	362	7	p.	p.	NOUN
chd-99	362	8	,	,	PUNCT
chd-99	362	9	gross	gross	PROPN
chd-99	362	10	,	,	PUNCT
chd-99	362	11	g.	g.	PROPN
chd-99	362	12	,	,	PUNCT
chd-99	362	13	ibrahim	ibrahim	PROPN
chd-99	362	14	,	,	PUNCT
chd-99	362	15	s.	s.	PROPN
chd-99	362	16	,	,	PUNCT
chd-99	362	17	and	and	CCONJ
chd-99	362	18	kunz	kunz	PROPN
chd-99	362	19	,	,	PUNCT
chd-99	362	20	m.	m.	NOUN
chd-99	362	21	(	(	PUNCT
chd-99	362	22	2008	2008	NUM
chd-99	362	23	)	)	PUNCT
chd-99	362	24	.	.	PUNCT
chd-99	363	1	microrna	microrna	PROPN
chd-99	363	2	let-7b	let-7b	PROPN
chd-99	363	3	targets	target	VERB
chd-99	363	4	important	important	ADJ
chd-99	363	5	cell	cell	NOUN
chd-99	363	6	cycle	cycle	NOUN
chd-99	363	7	molecules	molecule	NOUN
chd-99	363	8	in	in	ADP
chd-99	363	9	malignant	malignant	ADJ
chd-99	363	10	melanoma	melanoma	NOUN
chd-99	363	11	cells	cell	NOUN
chd-99	363	12	and	and	CCONJ
chd-99	363	13	interferes	interfere	VERB
chd-99	363	14	with	with	ADP
chd-99	363	15	anchorage	anchorage	NOUN
chd-99	363	16	-	-	PUNCT
chd-99	363	17	independent	independent	ADJ
chd-99	363	18	growth	growth	NOUN
chd-99	363	19	.	.	PUNCT
chd-99	364	1	cell	cell	NOUN
chd-99	364	2	res	re	NOUN
chd-99	364	3	18	18	NUM
chd-99	364	4	,	,	PUNCT
chd-99	364	5	549557	549557	NUM
chd-99	364	6	.	.	PUNCT
chd-99	365	1	todorova	todorova	PROPN
chd-99	365	2	,	,	PUNCT
chd-99	365	3	k.	k.	PROPN
chd-99	365	4	,	,	PUNCT
chd-99	365	5	metodiev	metodiev	PROPN
chd-99	365	6	,	,	PUNCT
chd-99	365	7	m.v	m.v	PROPN
chd-99	365	8	.	.	PROPN
chd-99	365	9	,	,	PUNCT
chd-99	365	10	metodieva	metodieva	PROPN
chd-99	365	11	,	,	PUNCT
chd-99	365	12	g.	g.	PROPN
chd-99	365	13	,	,	PUNCT
chd-99	365	14	zasheva	zasheva	PROPN
chd-99	365	15	,	,	PUNCT
chd-99	365	16	d.	d.	PROPN
chd-99	365	17	,	,	PUNCT
chd-99	365	18	mincheff	mincheff	PROPN
chd-99	365	19	,	,	PUNCT
chd-99	365	20	m.	m.	NOUN
chd-99	365	21	,	,	PUNCT
chd-99	365	22	and	and	CCONJ
chd-99	365	23	hayrabedyan	hayrabedyan	NOUN
chd-99	365	24	,	,	PUNCT
chd-99	365	25	s.	s.	PROPN
chd-99	365	26	(	(	PUNCT
chd-99	365	27	2016	2016	NUM
chd-99	365	28	)	)	PUNCT
chd-99	365	29	.	.	PUNCT
chd-99	366	1	mir-204	mir-204	PROPN
chd-99	366	2	is	be	AUX
chd-99	366	3	dysregulated	dysregulate	VERB
chd-99	366	4	in	in	ADP
chd-99	366	5	metastatic	metastatic	ADJ
chd-99	366	6	prostate	prostate	NOUN
chd-99	366	7	cancer	cancer	NOUN
chd-99	366	8	in	in	ADP
chd-99	366	9	vitro	vitro	X
chd-99	366	10	.	.	PUNCT
chd-99	367	1	mol	mol	ADP
chd-99	367	2	carcinog	carcinog	PROPN
chd-99	367	3	55	55	NUM
chd-99	367	4	,	,	PUNCT
chd-99	367	5	131	131	NUM
chd-99	367	6	-	-	SYM
chd-99	367	7	147	147	NUM
chd-99	367	8	.	.	PUNCT
chd-99	368	1	tsai	tsai	PROPN
chd-99	368	2	,	,	PUNCT
chd-99	368	3	h.k	h.k	PROPN
chd-99	368	4	.	.	PROPN
chd-99	368	5	,	,	PUNCT
chd-99	368	6	lehrer	lehrer	PROPN
chd-99	368	7	,	,	PUNCT
chd-99	368	8	j.	j.	PROPN
chd-99	368	9	,	,	PUNCT
chd-99	368	10	alshalalfa	alshalalfa	PROPN
chd-99	368	11	,	,	PUNCT
chd-99	368	12	m.	m.	NOUN
chd-99	368	13	,	,	PUNCT
chd-99	368	14	erho	erho	ADJ
chd-99	368	15	,	,	PUNCT
chd-99	368	16	n.	n.	NOUN
chd-99	368	17	,	,	PUNCT
chd-99	368	18	davicioni	davicioni	PROPN
chd-99	368	19	,	,	PUNCT
chd-99	368	20	e.	e.	PROPN
chd-99	368	21	,	,	PUNCT
chd-99	368	22	and	and	CCONJ
chd-99	368	23	lotan	lotan	ADJ
chd-99	368	24	,	,	PUNCT
chd-99	368	25	t.l	t.l	PROPN
chd-99	368	26	.	.	PUNCT
chd-99	368	27	(	(	PUNCT
chd-99	368	28	2017	2017	NUM
chd-99	368	29	)	)	PUNCT
chd-99	368	30	.	.	PUNCT
chd-99	369	1	gene	gene	NOUN
chd-99	369	2	expression	expression	NOUN
chd-99	369	3	signatures	signature	NOUN
chd-99	369	4	of	of	ADP
chd-99	369	5	neuroendocrine	neuroendocrine	ADJ
chd-99	369	6	prostate	prostate	NOUN
chd-99	369	7	cancer	cancer	NOUN
chd-99	369	8	and	and	CCONJ
chd-99	369	9	primary	primary	ADJ
chd-99	369	10	small	small	ADJ
chd-99	369	11	cell	cell	NOUN
chd-99	369	12	prostatic	prostatic	ADJ
chd-99	369	13	carcinoma	carcinoma	NOUN
chd-99	369	14	.	.	PUNCT
chd-99	370	1	bmc	bmc	ADJ
chd-99	370	2	cancer	cancer	NOUN
chd-99	370	3	17	17	NUM
chd-99	370	4	,	,	PUNCT
chd-99	370	5	759	759	NUM
chd-99	370	6	.	.	PUNCT
chd-99	371	1	tsujiuchi	tsujiuchi	PROPN
chd-99	371	2	,	,	PUNCT
chd-99	371	3	t.	t.	PROPN
chd-99	371	4	,	,	PUNCT
chd-99	371	5	sasaki	sasaki	PROPN
chd-99	371	6	,	,	PUNCT
chd-99	371	7	y.	y.	PROPN
chd-99	371	8	,	,	PUNCT
chd-99	371	9	oka	oka	PROPN
chd-99	371	10	,	,	PUNCT
chd-99	371	11	y.	y.	PROPN
chd-99	371	12	,	,	PUNCT
chd-99	371	13	kuniyasu	kuniyasu	PROPN
chd-99	371	14	,	,	PUNCT
chd-99	371	15	h.	h.	PROPN
chd-99	371	16	,	,	PUNCT
chd-99	371	17	konishi	konishi	PROPN
chd-99	371	18	,	,	PUNCT
chd-99	371	19	y.	y.	PROPN
chd-99	371	20	,	,	PUNCT
chd-99	371	21	and	and	CCONJ
chd-99	371	22	tsutsumi	tsutsumi	PROPN
chd-99	371	23	,	,	PUNCT
chd-99	371	24	m.	m.	NOUN
chd-99	371	25	(	(	PUNCT
chd-99	371	26	2004	2004	NUM
chd-99	371	27	)	)	PUNCT
chd-99	371	28	.	.	PUNCT
chd-99	372	1	alterations	alteration	NOUN
chd-99	372	2	of	of	ADP
chd-99	372	3	the	the	DET
chd-99	372	4	m6p	m6p	NOUN
chd-99	372	5	/	/	SYM
chd-99	372	6	igf2	igf2	PROPN
chd-99	372	7	receptor	receptor	NOUN
chd-99	372	8	gene	gene	NOUN
chd-99	372	9	in	in	ADP
chd-99	372	10	hepatocellular	hepatocellular	ADJ
chd-99	372	11	carcinomas	carcinoma	NOUN
chd-99	372	12	induced	induce	VERB
chd-99	372	13	by	by	ADP
chd-99	372	14	nnitrosodiethylamine	nnitrosodiethylamine	NOUN
chd-99	372	15	and	and	CCONJ
chd-99	372	16	a	a	DET
chd-99	372	17	choline	choline	NOUN
chd-99	372	18	-	-	PUNCT
chd-99	372	19	deficient	deficient	ADJ
chd-99	372	20	l	l	ADJ
chd-99	372	21	-	-	ADJ
chd-99	372	22	amino	amino	ADJ
chd-99	372	23	acid	acid	NOUN
chd-99	372	24	-	-	PUNCT
chd-99	372	25	defined	define	VERB
chd-99	372	26	diet	diet	NOUN
chd-99	372	27	in	in	ADP
chd-99	372	28	rats	rat	NOUN
chd-99	372	29	.	.	PUNCT
chd-99	373	1	mol	mol	ADP
chd-99	373	2	carcinog	carcinog	NOUN
chd-99	373	3	39	39	NUM
chd-99	373	4	,	,	PUNCT
chd-99	373	5	199	199	NUM
chd-99	373	6	-	-	SYM
chd-99	373	7	205	205	NUM
chd-99	373	8	.	.	PUNCT
chd-99	374	1	ulanet	ulanet	PROPN
chd-99	374	2	,	,	PUNCT
chd-99	374	3	d.b	d.b	PROPN
chd-99	374	4	.	.	PROPN
chd-99	374	5	,	,	PUNCT
chd-99	374	6	ludwig	ludwig	PROPN
chd-99	374	7	,	,	PUNCT
chd-99	374	8	d.l	d.l	PROPN
chd-99	374	9	.	.	PROPN
chd-99	374	10	,	,	PUNCT
chd-99	374	11	kahn	kahn	PROPN
chd-99	374	12	,	,	PUNCT
chd-99	374	13	c.r	c.r	PROPN
chd-99	374	14	.	.	PROPN
chd-99	374	15	,	,	PUNCT
chd-99	374	16	and	and	CCONJ
chd-99	374	17	hanahan	hanahan	PROPN
chd-99	374	18	,	,	PUNCT
chd-99	374	19	d.	d.	PROPN
chd-99	374	20	(	(	PUNCT
chd-99	374	21	2010	2010	NUM
chd-99	374	22	)	)	PUNCT
chd-99	374	23	.	.	PUNCT
chd-99	375	1	insulin	insulin	NOUN
chd-99	375	2	receptor	receptor	NOUN
chd-99	375	3	functionally	functionally	ADV
chd-99	375	4	enhances	enhance	VERB
chd-99	375	5	multistage	multistage	NOUN
chd-99	375	6	tumor	tumor	NOUN
chd-99	375	7	progression	progression	NOUN
chd-99	375	8	and	and	CCONJ
chd-99	375	9	conveys	convey	VERB
chd-99	375	10	intrinsic	intrinsic	ADJ
chd-99	375	11	resistance	resistance	NOUN
chd-99	375	12	to	to	ADP
chd-99	375	13	igf-1r	igf-1r	ADJ
chd-99	375	14	targeted	target	VERB
chd-99	375	15	therapy	therapy	NOUN
chd-99	375	16	.	.	PUNCT
chd-99	376	1	proc	proc	PROPN
chd-99	376	2	natl	natl	PROPN
chd-99	376	3	acad	acad	PROPN
chd-99	376	4	sci	sci	PROPN
chd-99	376	5	u	u	PROPN
chd-99	376	6	s	s	PROPN
chd-99	376	7	a	a	DET
chd-99	376	8	107	107	NUM
chd-99	376	9	,	,	PUNCT
chd-99	376	10	1079110798	1079110798	NUM
chd-99	376	11	.	.	PUNCT
chd-99	377	1	vargo	vargo	PROPN
chd-99	377	2	-	-	PUNCT
chd-99	377	3	gogola	gogola	PROPN
chd-99	377	4	,	,	PUNCT
chd-99	377	5	t.	t.	PROPN
chd-99	377	6	,	,	PUNCT
chd-99	377	7	heckman	heckman	PROPN
chd-99	377	8	,	,	PUNCT
chd-99	377	9	b.m	b.m	PROPN
chd-99	377	10	.	.	PROPN
chd-99	377	11	,	,	PUNCT
chd-99	377	12	gunther	gunther	PROPN
chd-99	377	13	,	,	PUNCT
chd-99	377	14	e.j	e.j	PROPN
chd-99	377	15	.	.	PROPN
chd-99	377	16	,	,	PUNCT
chd-99	377	17	chodosh	chodosh	PROPN
chd-99	377	18	,	,	PUNCT
chd-99	377	19	l.a	l.a	PROPN
chd-99	377	20	.	.	PROPN
chd-99	377	21	,	,	PUNCT
chd-99	377	22	and	and	CCONJ
chd-99	377	23	rosen	rosen	PROPN
chd-99	377	24	,	,	PUNCT
chd-99	377	25	j.m	j.m	PROPN
chd-99	377	26	.	.	PROPN
chd-99	377	27	(	(	PUNCT
chd-99	377	28	2006	2006	NUM
chd-99	377	29	)	)	PUNCT
chd-99	377	30	.	.	PUNCT
chd-99	378	1	p190	p190	NUM
chd-99	378	2	-	-	PUNCT
chd-99	378	3	b	b	NOUN
chd-99	378	4	rho	rho	ADJ
chd-99	378	5	gtpaseactivating	gtpaseactivate	VERB
chd-99	378	6	protein	protein	NOUN
chd-99	378	7	overexpression	overexpression	NOUN
chd-99	378	8	disrupts	disrupt	VERB
chd-99	378	9	ductal	ductal	ADJ
chd-99	378	10	morphogenesis	morphogenesis	NOUN
chd-99	378	11	and	and	CCONJ
chd-99	378	12	induces	induce	VERB
chd-99	378	13	hyperplastic	hyperplastic	ADJ
chd-99	378	14	lesions	lesion	NOUN
chd-99	378	15	in	in	ADP
chd-99	378	16	the	the	DET
chd-99	378	17	developing	develop	VERB
chd-99	378	18	mammary	mammary	ADJ
chd-99	378	19	gland	gland	NOUN
chd-99	378	20	.	.	PUNCT
chd-99	379	1	mol	mol	ADP
chd-99	379	2	endocrinol	endocrinol	NOUN
chd-99	379	3	20	20	NUM
chd-99	379	4	,	,	PUNCT
chd-99	379	5	13911405	13911405	NUM
chd-99	379	6	.	.	PUNCT
chd-99	380	1	vimalraj	vimalraj	PROPN
chd-99	380	2	,	,	PUNCT
chd-99	380	3	s.	s.	PROPN
chd-99	380	4	,	,	PUNCT
chd-99	380	5	miranda	miranda	PROPN
chd-99	380	6	,	,	PUNCT
chd-99	380	7	p.j	p.j	PROPN
chd-99	380	8	.	.	PROPN
chd-99	380	9	,	,	PUNCT
chd-99	380	10	ramyakrishna	ramyakrishna	VERB
chd-99	380	11	,	,	PUNCT
chd-99	380	12	b.	b.	PROPN
chd-99	380	13	,	,	PUNCT
chd-99	380	14	and	and	CCONJ
chd-99	380	15	selvamurugan	selvamurugan	NOUN
chd-99	380	16	,	,	PUNCT
chd-99	380	17	n.	n.	PROPN
chd-99	380	18	(	(	PUNCT
chd-99	380	19	2013	2013	NUM
chd-99	380	20	)	)	PUNCT
chd-99	380	21	.	.	PUNCT
chd-99	381	1	regulation	regulation	NOUN
chd-99	381	2	of	of	ADP
chd-99	381	3	breast	breast	NOUN
chd-99	381	4	cancer	cancer	NOUN
chd-99	381	5	and	and	CCONJ
chd-99	381	6	bone	bone	NOUN
chd-99	381	7	metastasis	metastasis	NOUN
chd-99	381	8	by	by	ADP
chd-99	381	9	micrornas	microrna	NOUN
chd-99	381	10	.	.	PUNCT
chd-99	382	1	dis	dis	PROPN
chd-99	382	2	markers	marker	VERB
chd-99	382	3	35	35	NUM
chd-99	382	4	,	,	PUNCT
chd-99	382	5	369	369	NUM
chd-99	382	6	-	-	SYM
chd-99	382	7	387	387	NUM
chd-99	382	8	.	.	PUNCT
chd-99	383	1	xia	xia	PROPN
chd-99	383	2	,	,	PUNCT
chd-99	383	3	y.	y.	PROPN
chd-99	383	4	,	,	PUNCT
chd-99	383	5	zhu	zhu	PROPN
chd-99	383	6	,	,	PUNCT
chd-99	383	7	y.	y.	PROPN
chd-99	383	8	,	,	PUNCT
chd-99	383	9	ma	ma	PROPN
chd-99	383	10	,	,	PUNCT
chd-99	383	11	t.	t.	PROPN
chd-99	383	12	,	,	PUNCT
chd-99	383	13	pan	pan	PROPN
chd-99	383	14	,	,	PUNCT
chd-99	383	15	c.	c.	PROPN
chd-99	383	16	,	,	PUNCT
chd-99	383	17	wang	wang	PROPN
chd-99	383	18	,	,	PUNCT
chd-99	383	19	j.	j.	PROPN
chd-99	383	20	,	,	PUNCT
chd-99	383	21	he	he	PRON
chd-99	383	22	,	,	PUNCT
chd-99	383	23	z.	z.	PROPN
chd-99	383	24	,	,	PUNCT
chd-99	383	25	li	li	PROPN
chd-99	383	26	,	,	PUNCT
chd-99	383	27	z.	z.	PROPN
chd-99	383	28	,	,	PUNCT
chd-99	383	29	qi	qi	PROPN
chd-99	383	30	,	,	PUNCT
chd-99	383	31	x.	x.	NOUN
chd-99	383	32	,	,	PUNCT
chd-99	383	33	and	and	CCONJ
chd-99	383	34	chen	chen	PROPN
chd-99	383	35	,	,	PUNCT
chd-99	383	36	y.	y.	PROPN
chd-99	383	37	(	(	PUNCT
chd-99	383	38	2014	2014	NUM
chd-99	383	39	)	)	PUNCT
chd-99	383	40	.	.	PUNCT
chd-99	384	1	mir-204	mir-204	NOUN
chd-99	384	2	functions	function	NOUN
chd-99	384	3	as	as	ADP
chd-99	384	4	a	a	DET
chd-99	384	5	tumor	tumor	NOUN
chd-99	384	6	suppressor	suppressor	NOUN
chd-99	384	7	by	by	ADP
chd-99	384	8	regulating	regulate	VERB
chd-99	384	9	six1	six1	NOUN
chd-99	384	10	in	in	ADP
chd-99	384	11	nsclc	nsclc	NOUN
chd-99	384	12	.	.	PUNCT
chd-99	385	1	febs	febs	PROPN
chd-99	385	2	lett	lett	PROPN
chd-99	385	3	588	588	NUM
chd-99	385	4	,	,	PUNCT
chd-99	385	5	3703	3703	NUM
chd-99	385	6	-	-	SYM
chd-99	385	7	3712	3712	NUM
chd-99	385	8	.	.	PUNCT
chd-99	386	1	ying	ying	PROPN
chd-99	386	2	,	,	PUNCT
chd-99	386	3	z.	z.	PROPN
chd-99	386	4	,	,	PUNCT
chd-99	386	5	li	li	PROPN
chd-99	386	6	,	,	PUNCT
chd-99	386	7	y.	y.	PROPN
chd-99	386	8	,	,	PUNCT
chd-99	386	9	wu	wu	PROPN
chd-99	386	10	,	,	PUNCT
chd-99	386	11	j.	j.	PROPN
chd-99	386	12	,	,	PUNCT
chd-99	386	13	zhu	zhu	PROPN
chd-99	386	14	,	,	PUNCT
chd-99	386	15	x.	x.	PROPN
chd-99	386	16	,	,	PUNCT
chd-99	386	17	yang	yang	PROPN
chd-99	386	18	,	,	PUNCT
chd-99	386	19	y.	y.	PROPN
chd-99	386	20	,	,	PUNCT
chd-99	386	21	tian	tian	PROPN
chd-99	386	22	,	,	PUNCT
chd-99	386	23	h.	h.	PROPN
chd-99	386	24	,	,	PUNCT
chd-99	386	25	li	li	PROPN
chd-99	386	26	,	,	PUNCT
chd-99	386	27	w.	w.	PROPN
chd-99	386	28	,	,	PUNCT
chd-99	386	29	hu	hu	PROPN
chd-99	386	30	,	,	PUNCT
chd-99	386	31	b.	b.	PROPN
chd-99	386	32	,	,	PUNCT
chd-99	386	33	cheng	cheng	PROPN
chd-99	386	34	,	,	PUNCT
chd-99	386	35	s.y	s.y	PROPN
chd-99	386	36	.	.	PROPN
chd-99	386	37	,	,	PUNCT
chd-99	386	38	and	and	CCONJ
chd-99	386	39	li	li	PROPN
chd-99	386	40	,	,	PUNCT
chd-99	386	41	m.	m.	NOUN
chd-99	386	42	(	(	PUNCT
chd-99	386	43	2013	2013	NUM
chd-99	386	44	)	)	PUNCT
chd-99	386	45	.	.	PUNCT
chd-99	387	1	loss	loss	NOUN
chd-99	387	2	of	of	ADP
chd-99	387	3	mir-204	mir-204	NOUN
chd-99	387	4	expression	expression	NOUN
chd-99	387	5	enhances	enhance	VERB
chd-99	387	6	glioma	glioma	NOUN
chd-99	387	7	migration	migration	NOUN
chd-99	387	8	and	and	CCONJ
chd-99	387	9	stem	stem	NOUN
chd-99	387	10	cell	cell	NOUN
chd-99	387	11	-	-	PUNCT
chd-99	387	12	like	like	ADJ
chd-99	387	13	phenotype	phenotype	NOUN
chd-99	387	14	.	.	PUNCT
chd-99	388	1	cancer	cancer	NOUN
chd-99	388	2	res	re	NOUN
chd-99	388	3	73	73	NUM
chd-99	388	4	,	,	PUNCT
chd-99	388	5	990	990	NUM
chd-99	388	6	-	-	SYM
chd-99	388	7	999	999	NUM
chd-99	388	8	.	.	PUNCT
chd-99	389	1	you	you	PRON
chd-99	389	2	,	,	PUNCT
chd-99	389	3	h.	h.	PROPN
chd-99	389	4	,	,	PUNCT
chd-99	389	5	pellegrini	pellegrini	PROPN
chd-99	389	6	,	,	PUNCT
chd-99	389	7	m.	m.	NOUN
chd-99	389	8	,	,	PUNCT
chd-99	389	9	tsuchihara	tsuchihara	PROPN
chd-99	389	10	,	,	PUNCT
chd-99	389	11	k.	k.	PROPN
chd-99	389	12	,	,	PUNCT
chd-99	389	13	yamamoto	yamamoto	PROPN
chd-99	389	14	,	,	PUNCT
chd-99	389	15	k.	k.	PROPN
chd-99	389	16	,	,	PUNCT
chd-99	389	17	hacker	hacker	NOUN
chd-99	389	18	,	,	PUNCT
chd-99	389	19	g.	g.	PROPN
chd-99	389	20	,	,	PUNCT
chd-99	389	21	erlacher	erlacher	PROPN
chd-99	389	22	,	,	PUNCT
chd-99	389	23	m.	m.	NOUN
chd-99	389	24	,	,	PUNCT
chd-99	389	25	villunger	villunger	NOUN
chd-99	389	26	,	,	PUNCT
chd-99	389	27	a.	a.	NOUN
chd-99	389	28	,	,	PUNCT
chd-99	389	29	and	and	CCONJ
chd-99	389	30	mak	mak	PROPN
chd-99	389	31	,	,	PUNCT
chd-99	389	32	t.w	t.w	PROPN
chd-99	389	33	.	.	PROPN
chd-99	389	34	(	(	PUNCT
chd-99	389	35	2006	2006	NUM
chd-99	389	36	)	)	PUNCT
chd-99	389	37	.	.	PUNCT
chd-99	390	1	foxo3a	foxo3a	NOUN
chd-99	390	2	-	-	PUNCT
chd-99	390	3	dependent	dependent	ADJ
chd-99	390	4	regulation	regulation	NOUN
chd-99	390	5	of	of	ADP
chd-99	390	6	puma	puma	NOUN
chd-99	390	7	in	in	ADP
chd-99	390	8	response	response	NOUN
chd-99	390	9	to	to	PART
chd-99	390	10	cytokine	cytokine	VERB
chd-99	390	11	/	/	SYM
chd-99	390	12	growth	growth	NOUN
chd-99	390	13	factor	factor	NOUN
chd-99	390	14	withdrawal	withdrawal	NOUN
chd-99	390	15	.	.	PUNCT
chd-99	391	1	j	j	PROPN
chd-99	391	2	exp	exp	NOUN
chd-99	391	3	med	me	VERB
chd-99	391	4	203	203	NUM
chd-99	391	5	,	,	PUNCT
chd-99	391	6	16571663	16571663	NUM
chd-99	391	7	.	.	PUNCT
chd-99	392	1	yu	yu	PROPN
chd-99	392	2	,	,	PUNCT
chd-99	392	3	h.	h.	PROPN
chd-99	392	4	,	,	PUNCT
chd-99	392	5	levesque	levesque	PROPN
chd-99	392	6	,	,	PUNCT
chd-99	392	7	m.a	m.a	PROPN
chd-99	392	8	.	.	PROPN
chd-99	392	9	,	,	PUNCT
chd-99	392	10	khosravi	khosravi	NOUN
chd-99	392	11	,	,	PUNCT
chd-99	392	12	m.j	m.j	PROPN
chd-99	392	13	.	.	PROPN
chd-99	392	14	,	,	PUNCT
chd-99	392	15	papanastasioudiamandi	papanastasioudiamandi	PROPN
chd-99	392	16	,	,	PUNCT
chd-99	392	17	a.	a.	NOUN
chd-99	392	18	,	,	PUNCT
chd-99	392	19	clark	clark	PROPN
chd-99	392	20	,	,	PUNCT
chd-99	392	21	g.m	g.m	PROPN
chd-99	392	22	.	.	PROPN
chd-99	392	23	,	,	PUNCT
chd-99	392	24	and	and	CCONJ
chd-99	392	25	diamandis	diamandis	PROPN
chd-99	392	26	,	,	PUNCT
chd-99	392	27	e.p	e.p	PROPN
chd-99	392	28	.	.	PROPN
chd-99	392	29	(	(	PUNCT
chd-99	392	30	1996	1996	NUM
chd-99	392	31	)	)	PUNCT
chd-99	392	32	.	.	PUNCT
chd-99	393	1	associations	association	NOUN
chd-99	393	2	between	between	ADP
chd-99	393	3	insulin	insulin	NOUN
chd-99	393	4	-	-	PUNCT
chd-99	393	5	like	like	ADJ
chd-99	393	6	growth	growth	NOUN
chd-99	393	7	factors	factor	NOUN
chd-99	393	8	and	and	CCONJ
chd-99	393	9	their	their	PRON
chd-99	393	10	binding	bind	VERB
chd-99	393	11	proteins	protein	NOUN
chd-99	393	12	and	and	CCONJ
chd-99	393	13	other	other	ADJ
chd-99	393	14	prognostic	prognostic	ADJ
chd-99	393	15	indicators	indicator	NOUN
chd-99	393	16	in	in	ADP
chd-99	393	17	breast	breast	NOUN
chd-99	393	18	cancer	cancer	NOUN
chd-99	393	19	.	.	PUNCT
chd-99	394	1	br	br	X
chd-99	394	2	j	j	PROPN
chd-99	394	3	cancer	cancer	NOUN
chd-99	394	4	74	74	NUM
chd-99	394	5	,	,	PUNCT
chd-99	394	6	1242	1242	NUM
chd-99	394	7	-	-	SYM
chd-99	394	8	1247	1247	NUM
chd-99	394	9	.	.	PUNCT
chd-99	395	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	395	2	e18	e18	PROPN
chd-99	395	3	cancer	cancer	NOUN
chd-99	395	4	health	health	NOUN
chd-99	395	5	disparities	disparity	NOUN
chd-99	395	6	research	research	VERB
chd-99	395	7	supplementary	supplementary	ADJ
chd-99	395	8	data	datum	NOUN
chd-99	395	9	:	:	PUNCT
chd-99	395	10	supplemental	supplemental	ADJ
chd-99	395	11	figure	figure	NOUN
chd-99	395	12	1	1	NUM
chd-99	395	13	:	:	PUNCT
chd-99	395	14	western	western	ADJ
chd-99	395	15	blot	blot	NOUN
chd-99	395	16	of	of	ADP
chd-99	395	17	igf2r	igf2r	PROPN
chd-99	395	18	(	(	PUNCT
chd-99	395	19	a	a	NOUN
chd-99	395	20	)	)	PUNCT
chd-99	395	21	and	and	CCONJ
chd-99	395	22	qpcr	qpcr	ADJ
chd-99	395	23	analysis	analysis	NOUN
chd-99	395	24	of	of	ADP
chd-99	395	25	mir-204	mir-204	NOUN
chd-99	395	26	expression	expression	NOUN
chd-99	395	27	levels	level	NOUN
chd-99	395	28	in	in	ADP
chd-99	395	29	various	various	ADJ
chd-99	395	30	human	human	ADJ
chd-99	395	31	breast	breast	NOUN
chd-99	395	32	cell	cell	NOUN
chd-99	395	33	lines	line	NOUN
chd-99	395	34	(	(	PUNCT
chd-99	395	35	b	b	NOUN
chd-99	395	36	)	)	PUNCT
chd-99	395	37	and	and	CCONJ
chd-99	395	38	normal	normal	ADJ
chd-99	395	39	and	and	CCONJ
chd-99	395	40	breast	breast	NOUN
chd-99	395	41	cancer	cancer	NOUN
chd-99	395	42	mouse	mouse	NOUN
chd-99	395	43	tissue	tissue	NOUN
chd-99	395	44	(	(	PUNCT
chd-99	395	45	c	c	NOUN
chd-99	395	46	)	)	PUNCT
chd-99	395	47	.	.	PUNCT
chd-99	396	1	qpcr	qpcr	ADV
chd-99	396	2	analysis	analysis	NOUN
chd-99	396	3	of	of	ADP
chd-99	396	4	mir-204	mir-204	NOUN
chd-99	396	5	expression	expression	NOUN
chd-99	396	6	levels	level	NOUN
chd-99	396	7	in	in	ADP
chd-99	396	8	cell	cell	NOUN
chd-99	396	9	lines	line	NOUN
chd-99	396	10	after	after	ADP
chd-99	396	11	either	either	CCONJ
chd-99	396	12	mir-204	mir-204	NOUN
chd-99	396	13	overexpression	overexpression	NOUN
chd-99	396	14	in	in	ADP
chd-99	396	15	mcf10a(d	mcf10a(d	PROPN
chd-99	396	16	)	)	PUNCT
chd-99	396	17	and	and	CCONJ
chd-99	396	18	mcf12a(e	mcf12a(e	PROPN
chd-99	396	19	)	)	PUNCT
chd-99	396	20	cells	cell	NOUN
chd-99	396	21	or	or	CCONJ
chd-99	396	22	mir-204	mir-204	NOUN
chd-99	396	23	inhibition	inhibition	NOUN
chd-99	396	24	in	in	ADP
chd-99	396	25	mda	mda	PROPN
chd-99	396	26	-	-	PUNCT
chd-99	396	27	mb-231	mb-231	PROPN
chd-99	396	28	(	(	PUNCT
chd-99	396	29	f	f	X
chd-99	396	30	)	)	PUNCT
chd-99	396	31	and	and	CCONJ
chd-99	396	32	bt549(g	bt549(g	NOUN
chd-99	396	33	)	)	PUNCT
chd-99	396	34	cells	cell	NOUN
chd-99	396	35	.	.	PUNCT
chd-99	397	1	*	*	PUNCT
chd-99	397	2	p	p	X
chd-99	397	3	<	<	X
chd-99	397	4	0.05	0.05	NUM
chd-99	397	5	supplemental	supplemental	ADJ
chd-99	397	6	figure	figure	NOUN
chd-99	397	7	2	2	NUM
chd-99	397	8	:	:	PUNCT
chd-99	397	9	time	time	NOUN
chd-99	397	10	to	to	PART
chd-99	397	11	tumor	tumor	NOUN
chd-99	397	12	onset	onset	NOUN
chd-99	397	13	(	(	PUNCT
chd-99	397	14	a	a	NOUN
chd-99	397	15	)	)	PUNCT
chd-99	397	16	and	and	CCONJ
chd-99	397	17	tumor	tumor	NOUN
chd-99	397	18	multiplicity	multiplicity	NOUN
chd-99	397	19	(	(	PUNCT
chd-99	397	20	b	b	NOUN
chd-99	397	21	)	)	PUNCT
chd-99	397	22	in	in	ADP
chd-99	397	23	non	non	ADJ
chd-99	397	24	tg	tg	PROPN
chd-99	397	25	(	(	PUNCT
chd-99	397	26	black	black	ADJ
chd-99	397	27	lines	line	NOUN
chd-99	397	28	)	)	PUNCT
chd-99	397	29	and	and	CCONJ
chd-99	397	30	mir204	mir204	PROPN
chd-99	397	31	tg	tg	PROPN
chd-99	397	32	(	(	PUNCT
chd-99	397	33	red	red	ADJ
chd-99	397	34	lines	line	NOUN
chd-99	397	35	)	)	PUNCT
chd-99	397	36	mice	mouse	NOUN
chd-99	397	37	.	.	PUNCT
chd-99	398	1	www.companyofscientists.com/index.php/chd	www.companyofscientists.com/index.php/chd	AUX
chd-99	398	2	e19	e19	VERB
chd-99	398	3	cancer	cancer	NOUN
chd-99	398	4	health	health	NOUN
chd-99	398	5	disparities	disparity	NOUN
chd-99	398	6	research	research	VERB
chd-99	398	7	supplemental	supplemental	ADJ
chd-99	398	8	figure	figure	NOUN
chd-99	398	9	3	3	NUM
chd-99	398	10	:	:	PUNCT
chd-99	398	11	qpcr	qpcr	ADV
chd-99	398	12	analysis	analysis	NOUN
chd-99	398	13	of	of	ADP
chd-99	398	14	(	(	PUNCT
chd-99	398	15	a	a	NOUN
chd-99	398	16	)	)	PUNCT
chd-99	398	17	igf2r	igf2r	PROPN
chd-99	399	1	and	and	CCONJ
chd-99	399	2	(	(	PUNCT
chd-99	399	3	b	b	NOUN
chd-99	399	4	)	)	PUNCT
chd-99	399	5	mir-204	mir-204	NOUN
chd-99	399	6	expression	expression	NOUN
chd-99	399	7	levels	level	NOUN
chd-99	399	8	in	in	ADP
chd-99	399	9	mcf10a	mcf10a	PROPN
chd-99	399	10	cells	cell	NOUN
chd-99	399	11	transiently	transiently	ADV
chd-99	399	12	transfected	transfecte	VERB
chd-99	399	13	with	with	ADP
chd-99	399	14	igf2r	igf2r	PROPN
chd-99	399	15	or	or	CCONJ
chd-99	399	16	empty	empty	ADJ
chd-99	399	17	vector	vector	NOUN
chd-99	399	18	(	(	PUNCT
chd-99	399	19	ev	ev	NOUN
chd-99	399	20	)	)	PUNCT
chd-99	399	21	control	control	NOUN
chd-99	399	22	.	.	PUNCT
chd-99	400	1	supplemental	supplemental	ADJ
chd-99	400	2	figure	figure	NOUN
chd-99	400	3	4	4	NUM
chd-99	400	4	:	:	PUNCT
chd-99	400	5	qpcr	qpcr	ADV
chd-99	400	6	analysis	analysis	NOUN
chd-99	400	7	of	of	ADP
chd-99	400	8	(	(	PUNCT
chd-99	400	9	a	a	PRON
chd-99	400	10	)	)	PUNCT
chd-99	400	11	mir-204	mir-204	NOUN
chd-99	400	12	,	,	PUNCT
chd-99	400	13	(	(	PUNCT
chd-99	400	14	b	b	X
chd-99	400	15	)	)	PUNCT
chd-99	400	16	igf2r	igf2r	PROPN
chd-99	400	17	and	and	CCONJ
chd-99	400	18	(	(	PUNCT
chd-99	400	19	c	c	X
chd-99	400	20	)	)	PUNCT
chd-99	400	21	igf1r	igf1r	PRON
chd-99	400	22	expression	expression	NOUN
chd-99	400	23	levels	level	NOUN
chd-99	400	24	in	in	ADP
chd-99	400	25	mcf12a	mcf12a	ADP
chd-99	400	26	cells	cell	NOUN
chd-99	400	27	stably	stably	ADV
chd-99	400	28	transfected	transfecte	VERB
chd-99	400	29	with	with	ADP
chd-99	400	30	mir-204	mir-204	NOUN
chd-99	400	31	and	and	CCONJ
chd-99	400	32	either	either	CCONJ
chd-99	400	33	untreated	untreated	ADJ
chd-99	400	34	or	or	CCONJ
chd-99	400	35	treated	treat	VERB
chd-99	400	36	with	with	ADP
chd-99	400	37	50	50	NUM
chd-99	400	38	nm	nm	ADJ
chd-99	400	39	igf2	igf2	PROPN
chd-99	400	40	for	for	ADP
chd-99	400	41	5	5	NUM
chd-99	400	42	minutes	minute	NOUN
chd-99	400	43	.	.	PUNCT
chd-99	401	1	qpcr	qpcr	ADV
chd-99	401	2	analysis	analysis	NOUN
chd-99	401	3	of	of	ADP
chd-99	401	4	(	(	PUNCT
chd-99	401	5	d	d	NOUN
chd-99	401	6	)	)	PUNCT
chd-99	401	7	igf1r	igf1r	PROPN
chd-99	402	1	and	and	CCONJ
chd-99	402	2	(	(	PUNCT
chd-99	402	3	e	e	NOUN
chd-99	402	4	)	)	PUNCT
chd-99	402	5	mir-204	mir-204	NOUN
chd-99	402	6	expression	expression	NOUN
chd-99	402	7	levels	level	NOUN
chd-99	402	8	in	in	ADP
chd-99	402	9	mcf10a	mcf10a	PROPN
chd-99	402	10	cells	cell	NOUN
chd-99	402	11	stably	stably	ADV
chd-99	402	12	expressing	express	VERB
chd-99	402	13	igf1r	igf1r	ADJ
chd-99	402	14	or	or	CCONJ
chd-99	402	15	control	control	NOUN
chd-99	402	16	cells	cell	NOUN
chd-99	402	17	and	and	CCONJ
chd-99	402	18	then	then	ADV
chd-99	402	19	transiently	transiently	ADV
chd-99	402	20	transfected	transfecte	VERB
chd-99	402	21	with	with	ADP
chd-99	402	22	mir-204	mir-204	NOUN
chd-99	402	23	or	or	CCONJ
chd-99	402	24	scr	scr	NOUN
chd-99	402	25	control	control	NOUN
chd-99	402	26	.	.	PUNCT