Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 74(2): 131-139, 2021 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1056 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Xiao Cheng, Xiaoling Hong, Majid Khayatnezhad, Fazal Ullah (2021) Genetic diversity and comparative study of genomic DNA extraction proto- cols in Tamarix L. species. Caryologia 74(2): 131-139. doi: 10.36253/caryolo- gia-1056 Received: August 18, 2020 Accepted: July 22, 2021 Published: October 08, 2021 Copyright: © 2021 Xiao Cheng, Xiaol- ing Hong, Majid Khayatnezhad, Fazal Ullah. This is an open access, peer- reviewed article published by Firenze University Press (http://www.fupress. com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species Xiao Cheng1,*, Xiaoling Hong1, Majid Khayatnezhad2, Fazal Ullah3,4 1 Jiangxi University of Applied Sciences, Nanchang, Jiangxi , 330100, China 2 Department of Environmental Sciences and Engineering, Ardabil Branch, Islamic Azad University, Ardabil, Iran 3 CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization and Ecological Restoration, Biodiversity Conservation Key Laboratory of Sichuan Prov- ince, Chengdu Institute of Biology, Chinese Academy of Science, P.O Box 416, Chengdu, Sichuan 610041, China 4 University of Chinese Academy of Science, Beijing 100049, China *Corresponding author. E-mail: chengxiao20212021@163.com Abstract. The genus Tamarix consists of about 54 species that mainly grow in saline areas of deserts and semi-deserts. This genus is chemically characterized by the pres- ence of tannins, flavonoids, anthocyanins and essential oils which interfere with the extraction of pure genomic DNA. Thus it is necessary to optimize extraction protocols to minimize the influence of these compounds to the lowest level. The present study compares the efficiency of five different approaches to extract total genomic DNA in Tamarix species, showing significant differences in the extracted DNA contents and quality,by using Kit (DNP TM Kit), CTAB DNA extraction method by Murray and Thompson, Sahu et al., Nalini et al. and Bi et al., for the extraction of DNA from Tamarix species. Our results showed significant differences in DNA contents between these five methods. The quantity and quality of extracted genomic DNA were checked by the spectrophotometer, Nano-Drop and and agarose gel electrophoresis analysis. Finally, a PCR-based method was also applied to verify the amplification efficiency for two molecular markers (ITS and ISSR).. In the present study, the genetic diversity of 96 Tamarix individuals species and 8 populations were studied using 10 ISSR mark- erswhile for nrDNA ITS 8 species samples were used. The method of Nalini et al., provided best results (207 ng/μL) in terms of quantity and quality ofDNA. Our results proposed that this method could be effective for plants with the same polysaccha- rides, proteins and polyphenols components. The advantage of this method is simple and fast as it does not involve time consuming steps such as incubation at higher tem- peratures, and also do not requires expensive chemicals such as proteinase K, liquid nitrogen. ,. The success of this method in obtaining high-quality genomic DNA has been demonstrated in the Tamarix species group and the reliability of this method has been discussed. Keywords: DNA yield, extraction protocols, Tamarix, ISSR, secondary metabolites. 132 Xiao Cheng et al. INTRODUCTION Tamaricaceae is relatively a small family of 4 gen- era and 120 species (Trease and Evans, 2002). The genus Tamarix L. (tamarisk, salt cedar) contain about 54 spe- cies that mainly distributed in saline areas of deserts and semi-deserts in Europe, concentrated mainly in the Mediterranean region and Eastern Europe (Gaskin, 2003). They are typically adapted to arid climate with an efficient and deep root system (Baum, 1978). Thirty-five species of Tamarix occur in Iran reported by Schiman-Czeika (1964). These species have been used in plantation to prevent deforestation in Iran. The species of Tamarix are distributed in 21 provinces of Iran. Some species of the genus Tamarix are used as orna- mental plants (Baum 1967; Gaskin and Schaal, 2002). Tamarix species are frequently planted as windbreaks or grown for the stabilization and afforestation of sand dunes (Gaskin and Schaal 2003, Gaskin and Kazmer 2019, Mayonde et al., 2019). Tamarix are also famous for medicinal purposes such as the galls and bark are used as astringent. Some species of the genus Tamarix are uti- lized, as tonic, diuretic, stimulant, and stomachic action. They are also used as diaphoretic, diuretic,hepatotonic and to treat liver disorders, relieve headache, ease pro- longed or difficulty during labor. Some Tamarix species are melliferous and are used as a sugar substitute (Shar- ma and Parmar 1998; Abouzid et al. 2008; Orfali et al 2009; Bakr et al 2013; Orabi et al., 2016). Plastid DNA (cpDNA) and Nuclear DNA (nDNA), can together be used to discourse different ecological queries. Whereas the nuclear DNA covers both unique single copy and repetitive regions (multiple copies), the chloroplast genome contains of coding segments such as ribosomal noncoding tandemly repeated units or RNA genes (Le Roux and Wieczorek, 2008). The ITS regions between the nuclear ribosomal DNA (rDNA) genes are com- monly used for detecting changeability among species (Sun et al., 1994). Additionally, it is also a widely used molecular marker for rebuilding angiosperm phylog- enies at different taxonomic levels as they always pro- vide the correct level of difference at species level for well-resolved phylogenetic reconstruction (Baldwin et al., 1995). The trnS–trnG primers are used to infer phy- logenetic comparisons. Moreover, chloroplast introns and intergenic spacer regions show the highest levels of intraspecific polymorphism since they are a lesser amount of inhibited through selection to preserve gene function (Hamilton, 1999). The extraction and purification of high-quality DNA is a critical step for genomic analysis especially from the plant materials with high accumulation of interfer- ing substances including polysaccharides, proteins, and DNA polymerase inhibitors such as tannins, alkaloids, and polyphenols. The presence of these compounds affects the quality and quantity of isolated DNA, and therefore, renders the sample non-amplifiable (Zamboni et al. 2008). Pure and rapid DNA extraction is a pre- requisite for most advanced techniques such as genetic mapping, fingerprinting, marker-assisted selection, and for evaluating authenticity of exported cereal varieties. General problems in the isolation and purification of high molecular weight DNA from medicinal and aro- matic plant species include: (1) degradation of DNA due to endonucleases, consolation of highly viscous polysac- charides, and (2) inhibitor compounds like polyphenols and other secondary metabolites which directly or indi- rectly interfere with the enzymatic reactions (Weising et al. 1995; Jenderek et al., 1997; Zamboni et al. 2008; Sahu et al. 2012). The presence of polyphenols, as oxidiz- ing agents present in many plant species, can reduce the production of the purified extracted DNA (Loomis 1974; Porebski et al., 1997). Several methods to isolate DNA from plant tissues are available; however, these methods produce either small amounts or DNA of inconsistent quality. Some of the DNA extraction methods are modified versions of cetyltrimethyl ammonium bromide (CTAB) extrac- tion and differ in time and cost (Doyle and Doyle 1990; Reichandt and Rogers, 1994). Doyle and Doyle method (1990) are applied to extract DNA in fruit trees (Jen- derek et al., 1997). The extraction technique of Lodhi et al. (1994) has been utilized for the grape, apple, apricot, peach, cherry and snapdragon. Sarkhosh et al. (2006) used the Bi et al. (1996) method for some Iranian pome- granate (Punica granatum L.) genotypes. Murray and Thompson (1980) method were used for DNA extrac- tion in cabbage, olive, rose (Csaikl et al., 1998) and sweet cherry (Khadivi-Khub et al., 2008). Saghai-Maroof et al. (1984) method was used for DNA extraction in Mangroves and salt marsh species (Sahu et al. 2012). Talebi Baddaf et al. (2003) intro- duced Murray and Thompson (1980) method as the most appropriate method to achieve high-quality DNA extrac- tion from pomegranate leaves. Because plants contain high amounts of many different substances, it is unlikely that just one nucleic acid isolation method suitable for all plants can ever exist (Loomis, 1974). A perfect method is the one that is fast, simple, and reliable DNA extraction method, which does not require long incubations, multiple DNA precipitations, or com- mercial reagents, and could meet the PCR, sequencing, and next-generation library preparation requirements. Therefore, the aim of this study was to compare quality 133Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species and quantity of five different DNA extraction methods to isolate high-quality DNA from leaf tissues of differ- ent Tamarix species. In this study, we showed the results of tests from several DNA extraction protocols that were made to overcome the problems that mainly arise from polysaccharide contamination. ISSR and ITS amplification was also performed to evaluate the suitability of the DNA extraction methods for PCR-based techniques. As far as, we know, this’s the first report on DNA extraction from Tamarix leave at species level from Iran, and we expect that the suggested protocol can be an incentive to perform further studies in order to investigate the genetic diversity among the plants with same chemical components as Tamarix species. MATERIALS AND METHOD Plant samples for DNA isolation In this study leaves of 8 Tamarix species were col- lected from different habitats in Iran (Table 1). One gram of young and mature leaf was collected and then frozen in liquid nitrogen and stored at -70 °C until extraction. For molecular studies, we used different number of plant individuals, as they were required. For example, in ISSR analysis, we used 96 individual samples of 8 species, while for nrDNA ITS 8 individual of 8 spe- cies were used for the extraction of DNA. DNA extraction methods One gram of the frozen leaf samples of Tamarix were grind into fine powder using pre-cooled mortar and pestle, and then homogenized with five different DNA extraction methods based on randomized com- plete block design (RCBD) with five replicates. The five extraction methods were 1) Murry and Thompson (1980); 2) Kit (DNP TM Kit) 3) Sahu et al. (2012),4) Bi et al. (1996) 5) Nalini et al. (2003) methods. After DNA extraction and sedimentation, resulted pellet was rinsed with ethanol 75% and dissolved in 200 μL double dis- tilled sterile water at 4 °C overnight and stored at -70 °C until next treatments. The chemicals used for the isolation of DNA viz. Tris, EDTA were obtained from Sigma and Sodium chloride, urea, SDS, Isopropanol, sodium acetate, chloro- form, Isoamlyalcohol, phenol, dNTPs, Enzyme Taq DNA Polymerase, 10X-assay buffer for Taq DNA Polymerase, Magnesium chloride and agarose. Concentration, purity and quality of extracted DNA The quantity (concentration and extraction effi- ciency) and quality (purity and intactness) of the DNA obtained at the ratio of 1:49 (20 μL of DNA stock solu- tion + 980 μL of double distilled sterile water) were assessed using spectrophotometer at 260 and 280 nm, and the A260/A280 ratio was used to assess contami- nation with proteins through employing the spectro- photometry (Hitachi U-2001 UV/VIS), Nano-DropTM (Thermo Scientific) described by Brodmann (2008) and Wilmington (2008), agarose gel electrophoresis, PCR methods and molecular markers (ITS and ISSR). This spectrophotometric analysis was performed in triplicate on the samples of extracted DNA using spectrophotom- eter. To verify DNA integrity, 5 μL DNA from 7 sample were subjected to gel electrophoresis at 0.8% (w/v) aga- rose gel, stained with ethidium bromide, and a constant voltage of 120 V for 90 min. The DNA bands were visu- alized, and the images were acquired using Gel Doc XR+ Imaging system (Bio-Rad Laboratories Inc., Germany). ISSR amplifications The quality of extracted DNA was examined at 0.8% agarose gel. In total, 10 ISSR primers; (AGC) 5GT, (CA) Table 1. Tamarix species and populations, their localities and voucher numbers. R Taxa Locality Alt (m) Latitude Longitude Voucher No 1 Tamarix arceuthoides Bge. Ardabil, Khalkhal-Asalem Road 1500 37°57’36” 48°61’03” IAUH1011 2 T. ramosissima Ledeb Gilan, Damash 1700 36°75’54” 49°81’07” IAUH1012 3 T. chinensis Lour. Fars, Shahr miyan 2700 30°84’40” 52°06’76” IAUH1013 4 T. szowitsiana Bge. Mazandaran,Chalus, Visar 1400 36°65’011” 51°31’051” IAUH1014 5 T. meyeri Boiss. Gilan, Damash 1700 36°75’54” 49°81’07” IAUH1015 6 T. androssowii Litw. Golestan Forest 700 37°47’50” 47°23’36.2” IAUH1016 7 T. mascatensis Bge. Mazandaran, Noshahr, Kheyrud kenar Forest 400 36°38’05” 51°29’05” IAUH1017 8 T. aucheriana (Decne. ex Walp.) B.R. Baum. Ardabil,Meshkin shahr, hatam Forest 2700 38°18’77.1” 56°41’60” IAUH1018 134 Xiao Cheng et al. 7GT, (AGC) 5GG, UBC 810, (CA) 7AT, (GA) 9C, UBC 807, UBC 823, (GA) 9T and (GT) 7CA commercialized by UBC (the University of British Columbia) were used (see Table 2). The final volume of 12 μL was tested in PCR reaction (2.5 μL PCR reaction buffer 10x, 0.875 μL MgCl2 50 mM, 0.5 μL dNTPs 10 mM, 1.0 μL primer 10 μM, 0.2 μL Taq DNA polymerase 5 Unit/μL, 2.0 μL tem- plate DNA (5 ng/μL). The amplification, reactions were performed in Techne thermocycler (Germany) with the following program: 5min initial denaturation step 94°C, followed by 38 cyclesfor 1 min at 95°C; 1 min at 50-55°C and 1 min at 72°C. The reaction was completed through a final extension step of 5-10 min at 72°C. The amplifica- tion products were observed at 1% agarose gel, followed by the ethidium bromide staining. The fragment size was estimated using a 100 bp molecular size ladder (Fer- mentas, Germany). ITS- sequences The ITS region was amplified using PCR with fol- lowing primer pairs ITS-4 and ITS-5 (White et al. 1990). The final volume of 12 μL was tested in PCR reaction (2.5 μL PCR reaction buffer 10x, 0.875 μL MgCl2 50 mM, 0.5 μL dNTPs 10 mM, 1.0 μL primer 10 μM, 0.2 μL Taq DNA polymerase 5 Unit/μL, 2.0 μL template DNA (5 ng/μL). The amplification, reactions were performed in Techne thermocycler (Germany) with the following pro- gram: 5min initial denaturation step 94°C, followed by 38 cycles of 1 min at 94°C; 40 sec, at 55°C and 1 min at 72°C. The reaction was completed by a final exten- sion step of 5-10 min at 72°C. The amplification prod- ucts were observed at 1% agarose gel, followed by the ethidium bromide staining. The fragment size was esti- mated using a 100 bp molecular size ladder (Fermentas, Germany). The ITS regions were amplified using primers reported as universal primers by White et al. (1990) and Taberlet et al. (1991), respectively, for flowering plants (see Table 2). RESULTS Comparison of different DNA extraction methods on aga- rose gel electrophoresis The quality of 8 extracted DNA sample was veri- fied spectrophotometrically using a NanoDrop instru- ment and agarose gel electrophoresis. DNA purity and yield were compared between these five extracted DNA methods. Plant genomic DNA extraction of Murry and Thompson (1980); Kit (DNP TM Kit), Sahu et al. (2012), Bi et al. (1996) (Fig. 1b: 1-4), did not give best results for Tamarix species due to the presence of polysaccharides and proteins in the pellet and showed brown or yellow DNA precipitate that presents the gDNA gel image. The presence of phenolic compounds caused a brownish pel- let (Fig. 1b). The results confirmed that extracted DNA by Nalini et al. (2003) method from leaves showed better qual- ity in comparison with the other extraction methods (Fig.1a). Due to the elimination of polysaccharides or protein contaminations DNA has been extracted with high quality. We believe that this method will be efficient for molecular studies of many other aro- Table 2. Primer sequences used in this study. Region Primer Sequences (5’-3’) Tm Ref. TABC CGAAATCGGTAGACGCTACG 56 Taberlet et al. (1991). TABF ATTTGAACTGGTGACACGAG 56 Taberlet et al. (1991). ITS4 TCCTCCGCTTATTGATATGC 57 White et al. (1990). ITS5 GGA AGT AAA AGTCGT AAC AAG G 57 White et al. (1990). UBS807 AGAGAGAGAGAGAGAGT 54 UBS set no. 9 UBS810 GAGAGAGAGAGAGAGAT 54 UBS set no. 9 UBC 823 TCTCTCTCTCTCTCTCC 56 UBS set no. 9 (AGC) 5GT AGC AGC AGC AGC AGC GT 56 UBS set no. 9 (CA) 7GT CACACACACACACAGT 56 UBS set no. 9 (AGC) 5GG AGC AGC AGC AGC AGC GG 56 UBS set no. 9 (CA) 7AT CACACACACACACAAT 56 UBS set no. 9 (GA) 9C GAGAGAGAGAGAGAGAGAC 56 UBS set no. 9 (GA) 9T GAGAGAGAGAGAGAGAGAT 55 UBS set no. 9 (GT) 7CA GTGTGTGTGTGTGTCA 55 UBS set no. 9 135Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species matic and herbal plants. In this method high level of β-mercaptoethanol successfully removed the polyphe- nols of the leaf tissue which may be responsible forinhi- bition of the DNA amplification during PCR reactions (Suman et al. 1999). It was evident that high concentra- tion of β-mercaptoethanol resulted in the high-quality of DNA. Using of NaCl concentrations higher than 0.5 M, along with CTAB, was previously recorded to be effi- cient in removing polysaccharides during DNA extrac- tion (Moreira and Oliveira 2011, Paterson et al. 1993). It was also efficient in the present study with 0.5M of NaCl concentration. Polysaccharides and secondary metabo- lites of Tamarix species were bounded by PVP and it is in concordance with previous studies (Couch and Fritz 1990, Chaudhry et al. 1999, Zhang and Stewart 2000). More replications for using chloroform: isoamyl alcohol resulted in better removing of proteins in Tamarix spe- cies. Sahu et al. (2012) used of sodium acetate and iso- propanol only in step (xv), but we used one more time of this material in order to have the better precipitation of DNA and removing most of the secondary metabo- lites and polysaccharides from the DNA. The presence of higher quantities of polyphenols and polysaccharides in mature leaves are proved by Porebski et al. (1997), which makes it very difficult to isolate DNA of good qual- ity. So, we used fresh and young leaves to overcome this problem. Clear banding patterns were observed in the ISSR study by Nalini et al. (2003) method (Fig. 2a). It possess better quality in comparison with the other extraction methods as well as Murry and Thompson (1980); Kit (DNP TM Kit), Sahu et al. (2012), Bi et al. (1996) (Fig.2 b, 1-4). PCR tests findings of ITS are given in (Figs. 3. a, b) which showed that extracted DNA by the method of Nalini et al. (2003) method (Figs. 3a) from leaf samples brings an acceptable quality for PCR, and as the most appropriate method in aspect of quality of DNA extract- Figure 1. Electrophoretic pattern of DNA extracted by the five different methods from Tamarix leaves. Note. The electrophoresis was per- formed in 0.8% (w/v) agarose gel. The extraction methods were: a) Nalini et al. (2003) (1- Tamarix arceuthoides 2- T. ramosissima ,3- T. chinensis, 4- T. szowitsiana, 5- T. meyeri, 6- T. androssowii, 7- T. mascatensis and 8- T. aucheriana); b) 1- Murry and Thompson (1980); 2- Kit (DNP TM Kit), 3- Sahu et al. (2012), 4- Bi et al. (1996); L) 100 bp DNA ladder. Figure 2. Amplification of DNA from Tamarix leaf using five different extraction methods by ISSR amplification. Note. Fig. 2. a) Nalini et al. (2003); Fig. 2. b) 1- Murry and Thompson (1980); 2- Kit (DNP TM Kit), 3- Sahu et al. (2012), 4- Bi et al. (1996); L) 100 bp DNA ladder. 136 Xiao Cheng et al. ed from young leaves of Tamarix. The PCR-amplified DNA fragments of ITS for 8 samples showed a clean single band product, when examined on an agarose gel (Fig. 3a). The PCR products were of about 600 bp. UV spectrophotometer and NanoDrop™ 1000 spectropho- tometer analysis In spectrophotometer procedure, absorption of double-stranded DNA in wavelength of 260 nm was 50 μg/μL. In fact, the ratio of absorption amount result- ed in 260 nm to 280 nm was ranged from 1.7 to 2.12. It shows the most absorption was done by nucleic acids and therefore extracted DNA was well-qualified and its purity was acceptable. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm. The results showed that the DNA yield and DNA purity obtained from one gram of the fresh leaf tissue in different methods using UV spectropho- tometer was statistically significant (P ≤ 0.01). A higher DNA yield was obtained with the method of Nalini et al. (2003) (333±58.1 ng/μL fresh weight), while the low- est was obtained with method of Sahu et al. (2012) (120±64.4 ng/μL fresh weight) (Table 3). Therefore, the results confirmed that extracted DNA by Nalini et al. (2003) method from leaves of Tamarix possess bet- ter qualitative and quantitative results as compared to other methods. DNA sample was measured with a UV spectrophotometer for the ratio of OD260/OD280 using TE buffer. The ratio of OD260/OD280 was determined to assess the purity and concentration of DNA sample. DNA concentration was calculated according to the equation of Wilmington et al. (2008). DNA concentra- tion (ng/μL) = OD260 × a (dilution factor) × 50 Absorbance measurements made on a spectropho- tometer, including any Thermo Scientific NanoDrop Spectrophotometer, will include the absorbance of all molecules in the sample that absorb at the wavelength of interest. The ratio of absorbance at 260 nm and 280 nm was used to assess the purity of DNA and RNA. A ratio of ~1.8 was generally accepted as “pure” for DNA; a ratio of ~2.0 was generally accepted as “pure” for RNA. If the ratio appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm. Some researchers encounter a consistent 260/280 ratio change, when switching from a standard cuvette spectrophotometer to a NanoDrop Spectrophotometer. The three main explanations for this observation were listed below: Small changes in the pH of the solution will cause the 260/280 to vary*. Acidic solutions will under-represent the 260/280 ratio by 0.2-0.3, while a basic solution will over-represent the ratio through 0.2- 0.3. If comparing results obtained using a NanoDrop Spectrophotometer to results obtained using other spec- trophotometers, it is important to ensure that the pH of an undiluted sample measured on our instruments was at the same pH and ionic strength as the diluted sample measured on the conventional spectrophotometer. The NanoDrop absorbance was useful for detection of contaminants such as protein, salts, and polysaccha- rides, which can inhibit and interfere in DNA sequenc- ing. The NanoDrop 1000 sspectrophotometer has the capability to measure highly concentrated samples with- out dilution. The ratio of 260 and 280 nm absorbance Figure 3. Agarose gel (1.5%) showing the PCR amplified ITS of the plant materials used in the present study. Note. Fig. a) Nalini et al. (2003) (1- Tamarix arceuthoides, 2- T. ramosissima, 3- T. chinensis, 4- T. szowitsiana, 5- T. meyeri, 6- T. androssowii, 7- T. mascatensis and 8- T. aucheriana); Fig. b) 1- Murry and Thompson (1980); 2- Kit (DNP TM Kit), 3- Sahu et al. (2012), 4- Bi et al. (1996); L) 100 bp DNA ladder. 137Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species was used to assess the purity of DNA and RNA. This ratio was between 1.7 and 1.9, and this range was gener- ally accepted as “pure” for DNA (Table 3). DISCUSSION The quality and quantity of DNA required depends on the extraction method and plant group. DNA iso- lated from plants often contains certain compounds that inhibit PCR amplification reactions (Reichandt and Rogers, 1994). In this method Sodium chloride and β-mercaptoethanol were added in the extraction buffer to take care of the polysaccharides and the polyphenols in the leaf tissue which were the compounds that con- tribute to the inhibition of the DNA amplification dur- ing PCR reactions. Hence there were no additional steps needed for the removal of these compounds (Khadivi- Khub et al., 2008]. The presence of the enzyme RNAse A in the DNA solution does not hamper the amplification. Hence repurification of the DNA is not needed (Csaikl et al., 1998). Our results showed that the DNA isolation protocol could be successfully applied to a broad range of plant species. Sarkhosh et al. (2006) in a study on genetic diver- sity of pomegranate cultivars of Iran, using Random Amplified Polymorphic DNA (RAPD) using four differ- ent genomic DNA extraction procedures; Murray and Thompson (1980), J. J. Doyle and J. L. Doyle (1990), Zie- genhagen et al. (1993) and Jenderek et al., (1997) intro- duced Murray and Thompson’s method as the most appropriate and successful method in terms of quality of DNA extraction from young leaves of pomegranate. Jen- derek et al. (1997) have found the method of J. J. Doyle and J. L. Doyle as the best quality resulting method for DNA extraction form marshmallow, but its quantity was too low. Saha et al. (2016) in a study on genetic stabil- ity of Morus alba L. variety and Nadha et al. (2011) on genetic diversity of Guadua angustifolia Kunth, using RAPD and ISSR marker introduced Murray and Thomp- son (1980), and J. J. Doyle and J. L. Doyle (1990) meth- ods as appropriate DNA extraction procedures, respec- tively. Bhatia et al. (2011) in a study on the genetic fideli- ty of Gerbera jamesonii Bolus using DNA-based markers were used Murry and Thompson (1980). PCR tests find- ing showed that the extracted DNA by Bi et al. (1996) method from leaf samples brings an acceptable quality forth for PCR, and the candescence of amplified DNA bands, In this study, five DNA extraction methods were compared to isolate high-quality DNA that can be effi- ciently amplified using PCR techniques. Murry and Thompson (1980); Kit (DNP TM Kit), Sahu et al. (2012), Bi et al. (1996) resulted in brown or yellow DNA precipi- tate that could not be reliably amplified through PCR. Therefore, we used the method of Nalini et al. (2003) that produced good quality DNA., The DNA extracted by this method is successful in many land plants includ- ing; mangroves and salt marsh plants containing elevat- ed concentrations of polysaccharide and polyphenolic compounds (Nalini et al. 2003). Nalini et al. (2003) method are helpful to provide a pure DNA with high efficiency in Tamarix species. Advantages of the present method for studying medici- nal plants with secondary metabolites are as follows: 1) omission of liquid nitrogen, 2) decrease of toxic effects, hazardous, expensive of some component as phenol in other methods, 3) lower amount of dried or fresh plant material, without any conservation specific condition. Although this method has many advantages but its time-consuming. The DNA extracted using this proto- col can be used for whole-genome sequencing, advanced sequencing technologies, and bioinformatics tools. ACKNOWLEDGEMENTS This project was supported by Faculty Life Sciences and Biotechnology, Islamic Azad University, Ardebil, Iran. Table 3. Comparison of means for efficiency of three different DNA extraction methods in leaf samples of leaves Tamarix using Duncan’s multiple range test (P ≤ 0.01). Methods Spectrophotometer Nano-Drop DNA yield (ng/μL) DNA purity (ng/μL) DNA yield (ng/μL) DNA purity (ng/μL) Nalini et al. (2003) 333±58.1 2.12±0.15 590.4±86.5 1.94±0.15 Kit (DNP TM Kit) 178±33.8 1.8±0.18 767.5±11.8 1.80±0.09 Murray and Thompson (1980) 292±34.4 1.7±0.19 534±76.4 1.78±0.07 Sahu et al. (2012) 120±64.4 2.01±0.18 575±55.2 1.82±0.09 Bi et al. (1996) 185±44.4 2.04±0.19 655±86.4 1.74±0.09 138 Xiao Cheng et al. REFERENCES Abouzid S, Elshahaat A, Ali S, Choudhary MI. 2008. Antioxidant activity of wild plants collected in Beni- Sueif governorate, Upper Egypt. Drug Discov Ther 2: 286-288. Baum, B. R. 1967. Introduced and naturalized tamarisks in the United States and Canada [Tamaricaceae]. Bai- leya 15: 19–25. Baum BR. 1978. The Genus Tamarix. Jerusalem, Israel: Israel Academy of Sciences and Humanities. Bakr RO, El Raey MA, Ashour RS 2013. Phenolic con- tent, radical scavenging activity and cytotoxicity of Tamarix nilotica (Ehrenb.) bunge growing in Egypt. J Pharmacognosy Phytother 5: 47-52. Baldwin, B.G., Sanderson, M.J., Porter, J.M., Wojciechowski, M.F., Campbell, C.S., Donoghue, M.J., 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Gardens 82, 247–277 Bi I.V., Harvengt L., Chandelier A., Mergeai G. and Jardin P.D. 1996. Improved RAPD amplification of recalci- trant plant DNA by the use of activated charcoal dur- ing DNA extraction. – Plant Breeding. 115: 205-206. doi: 10.1111/j.1439-0523.1996.tb00905.x Brondmann P. 2008. DNA extraction from different matrices. Molecular Biology Methods for Traceability Purposes BfR Berlin, Germany December 18-19. Csaikl U., Bastian H., Brettschneider R., Gauch S., Meir A., Schauerte M. and Ziegenhagen B. 1998. Com- parative analysis of different DNA extraction pro- tocols: a fast, universal maxi-preparation of high quality plant DNA for genetic evaluation and phy- logenetic studies. – Plant. Mol. Biol. Rep. 16: 69-86. doi:10.1023/A:1007428009556 Couch J. A. and Fritz P.J. 1990. “Isolation of DNA from plants high in polyphenolics,” – Plant. Mol. Biol. Rep. 8: 8–12. Chaudhry B., Yasmeen A., Husnain T. and Riazuddin S. 1999. “Mini-scale genomic DNA extraction from cot- ton,” – Plant. Mol. Biol. Rep. 17: 1–7. Doyle J.J. and Doyle J.E. 1990. Isolation of plant DNA from fresh plant tissue. Focus 12: 13–15 Gaskin J. F. 2003. Tamaricaceae. In: Kubitzki, K & Bay- er, C. (eds.). The Families and Genera of Vascular Plants. Springer. pp. 363‒368. Gaskin J. F. & Kazmer D.J. 2009. Introgression between invasive saltcedars (Tamarix chinensis and T. ramo- sissima) in the USA. Biological Invasions 11: 1121– 1130. Gaskin J. F. & Schaal B. A. 2002. Hybrid Tamarix wide- spread in U.S. invasion and undetected in native Asian range. Proceedings of the National Academy of Sciences of the United States of America 99: 11256– 11259 Gaskin J. F. & Schaal B.A. 2003. Molecular Phylogenetic Investigation of U. S. Invasive Tamarix. Systematic Botany 28: 86–95. Hamilton, M., 1999. Four primer pairs for the amplifica- tion of chloroplast intergenic regions with intraspe- cific variation. Molecular Ecology 8, 521–523. Khadivi-Khub A., Zamani Z. and Bouzari N. 2008. Eval- uation of genetic diversity in some Iranian and for- eign sweet cherry cultivars by using RAPD molecular markers and morphological traits. – Hortic Environ Biotechnol. 49: 188-196. Jenderek M., Shierenbeck K. and Olney A. 1997. Develop- ment of random amplified polymorphic DNA markers characteristic of Hibiscus rosa-sinensis and H. syria- cus. Center for Irrigation Technology, California State University, USA. Le Roux, J., Wieczorek, A.M., 2008. Molecular system- atic and population genetics of biological invasions: towards a better understanding of invasive species management. Annals of Applied Biology 157, 1–17. Lodhi M.A., Ye G.N., Weeden N.F. and Reisch B.I. 1994. A simple and efficient method for DNA extraction from grapevine cultivars and vitis spe- cies. – Plant. Mol. Biol. Rept. 12: 6-13. doi:10.1007/ BF02668658 Loomis W.D. 1974. Overcoming problems of phenolics and quinones in the isolation of plant enzymes and organelles. – Meth. Enzymol. 31: 528- 545. Murray M.G. and Thompson W.F. 1980. Rapid isolation of high molecular weight plant DNA. – Nucleic Acids Res. 8: 4321-4325. Moreira P.A. and Oliveira D.A. 2011. “Leaf age affects the quality of DNA extracted from Dimorphandra mollis (Fabaceae), a tropical tree species from the Cerrado region of Brazil,” –Genet. Mol. Res. 10: 353–358. doi: 10.4238/vol10-1gmr1030. Mayonde S, Cron G.V, Glennon K. L & Byrne M. J. 2019. Genetic diversity assessment of Tamarix in South Africa – Biocontrol and conservation implications. South African Journal of Botany 121: 54–62. Orfali RS, Ebada SS, El-Shafae AM, Al-Taweel AM, Lin WH, et al. 2009. 3-O-trans-caffeoylisomyricadiol: A new triterpenoid from Tamarix nilotica growing in Saudi Arabia. Z Naturforsch C 64: 637-643. Orabi MAA, Taniguchi S, Sakagami H, Yoshimura M, Amakura Y, et al. 2016. Hydrolyzable tannins of tam- 139Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species aricaceous plants. 7.1 Structures and cytotoxic prop- erties of oligomeric ellagitannins from leaves of Tam- arix nilotica and cultured tissues of Tamarix tetran- dra. J Nat Prod 79: 984-995. Porebski S., Bailey L.G. and Baum B.R. 1997. Modifica- tion of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol com- ponent. – Plant. Mol. Biol. Rept. 15: 8-25. Paterson, A.H., Brubaker, C.L. and Wendel, J.F. 1993. “A rapid method for extraction of cotton (Gossypium spp.) genomic DNA suitable for RFLP or PCR analy- sis,” – Plant. Mol. Biol. Rep. 11: 122–127. Reichandt, M. and Rogers, S. 1994. Preparation of plant DNA using CTAB. – Curr. Protoc. Mol. Biol. 12: 233- 237. Sarkhosh A., Zamani Z., Fatahi R. and Ebadi A. 2006. RAPD markers reveal polymorphism among some Iranian pomegranate (Punica granatum L.) geno- types. – Sci. Hort. 111: 24-29. doi:10.1016/j.scien- ta.2006.07.033 Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R.A. and Allard, R.W. 1984. “Ribosomal DNA spacer- length polymorphisms in barley: mendelian inherit- ance, chromosomal location, and population dynam- ics,” – Proc Natl Acad Sci U S A 81: 8014–8018. Sharma SK, Parmar VS 1998. Novel constitutes of Tama- rix species. J Sci Ind Res 57: 873-890. Schiman-Czeika, H. 1964. Flora Iranica. Graz: Akademis- che Druck-u. Verlagsanstalt, Vol. 4. Sahu, S.K., Thangaraj, M. and Kathiresan, K. 2012. DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides with- out Using Liquid Nitrogen and Phenol, International Scholarly Research Network, – Mol. Biol. 11:1-6 Suman, P.S.K., Ajit, K.S., Darokar, M.P. and Sushil, K. 1999. “Rapid isolation of DNA from dry and fresh samples of plants producing large amounts of sec- ondary metabolites and essential oils,” – Plant. Mol. Biol. Rep. 17: 1-7. Sun, Y., Skinner, D.J., Hulbert, S.H., 1994. Phylogenetic analysis of sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theo- retical of Applied Genetics 89, 26–32. Taberlet, P., Gielly, L., Pautou, G. and Bouvet, J. 1991. Universal primers for amplification of three non− coding regions of chloroplast DNA. – Plant. Mol. Biol. 17: 1105–1109. Talebi-Baddaf, M., Sharifi-Neia, B. and Bahar, M. 2003. Analysis of genetic diversity in pomegranate cultivars of Iran, using Random Amplified Polymorphic DNA (RAPD) markers. Proceedings of the Third National Congress of Biotechnology, Iran (pp. 343-345). Trease GE, Evans WC 2002. Pharmacognosy, 15th ed., WB Saunders Company Ltd, London. White, T.J., Bruns, T., Les, S. and Taylor, J. 1990. Ampli- fication and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., D. H. Gelfand, J. J. Sninsky & T. J. White (eds.), PCR Pro- tocols: a guide to methods and application, pp. 315– 322. Academic Press, San Diego. Weising, K., Nybom, H., Wolff, K. and Meyer, W. 1995. DNA isolation and purification In: DNA fingerprint- ing in plants and fungi, 44-59. CRC Press, Boca Raton, Florida. Wilmington, D. E. 2008. NanoDrop 1000 Spectrophotom- eter V3.7 User’s Manual (pp. 1-105). Thermo Fisher Scientific Inc. Zamboni, A., Pierantoni, L., De Franceschi, P. 2008. Total RNA extraction from strawberry tree (Arbutus une- do) and several other woody-plants. IForest 1: 122- 125. doi: org/10.3832/ifor0465-0010122 Zhang, J., Stewart, J.M. 2000. “Economical and rapid method for extracting cotton genomic DNA,” – J. Cotton. Sci. 4: 193–201. Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 74, Issue 1 - 2021 Firenze University Press