Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 74(3): 151-168, 2021 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1089 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Somayeh Saboori, Masoud Sheidai, Zahra Noormohammadi, Seyed Samih Marashi, Fahimeh Kooh- dar (2021) Genetic (SSRs) versus morpho- logical differentiation of date palm cul- tivars: Fst versus Pst estimates. Car- yologia 74(3): 151-168. doi: 10.36253/ caryologia-1089 Received: September 20, 2020 Accepted: September 09, 2021 Published: December 21, 2021 Copyright: © 2021 Somayeh Saboori, Masoud Sheidai, Zahra Noormoham- madi, Seyed Samih Marashi, Fahimeh Koohdar. This is an open access, peer-reviewed article published by Firenze University Press (http://www. fupress.com/caryologia) and distributed under the terms of the Creative Com- mons Attribution License, which per- mits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. ORCID ZN: 0000-0003-3890-9001 Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates Somayeh Saboori1, Masoud Sheidai2, Zahra Noormohammadi1,*, Seyed Samih Marashi3, Fahimeh Koohdar2 1Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran 2 Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran 3Date Palm & Tropical Fruits Research Center, Horticultural Sciences Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Ahwaz, Iran *Corresponding authors. E-mail; marjannm@yahoo.com, z-nouri@srbiau.ac.ir Abstract. Date Palm (Phoenix dactylifera L.) is one of the oldest domesticated fruit trees. For future breeding program, knowledge on genetic structure of cultivars is nec- essary. Therefore, the present study was performed with the following aims: 1- To pro- vide data on genetic diversity and genetic structure of 36 date palm cultivars, 2- To provide data on the association between fruit characteristics and the genetic features of the cultivars. We used nine SSRs and EST-SSR loci for our genetic investigation. The most of SSR loci obtained have a high Gst value (0.70), and therefore have a good discrimination power for date palm cultivar differentiation task. K-Means cluster- ing grouped date palm cultivars either in two broad clusters, or in 16 smaller genet- ic groups. This was supported by delta K = 2 of the STRUCTURE analysis. AMOVA produced significant genetic difference among date palm cultivars (PhiPT = 0.70, P = 0.001). New genetic differentiation parameters estimated also produced significant dif- ference among date palm cultivars (G’st (Nei) = 0.673, P = 0.001; G’st (Hed) = 0.738, P = 0.001). Test of assignment revealed that some of the cultivars have 33-66% misas- signment, probably due to genetic admixture. Heatmaps of genetic versus morphologi- cal and agronomical characters in date palm cultivars differed from each other show- ing the cultivars morphological changes is not merely related to their genetic content. It points toward the potential role played either by environmental conditions or local selection practice. The new findings can be utilized in future conservation and breed- ing of date palms in the country. Keywords: date palm, genetic variability, genetic structure, PST index, population assignment. INTRODUCTION Plant species of the family Palmae/ or Arecaceae are distributed mainly in tropical and subtropical areas, but a few species grow at higher latitudes in 152 Somayeh Saboori et al. the southern hemisphere. The main diversification cent- ers of these taxa are the equatorial coast of Africa, Oce- ania, the Brazilian coast, the Amazon, Indonesia and the Antilles (Moore & Uhl, 1982). The palm trees greatly contribute to the economy of the people around the world. Different sort of fruits, seeds, the ‘palmito’, honeys, ‘sagu’ (material with starch extracted from the centre of the trunks), different drinks from the sap or the fruits, and crystallized sugar from the sap, are only some of the palm tree products con- sumed by mankind (Rivas et al. 2012). Among date palm tree species, African oil palm (Elaeis guineensis), the coconut tree (Cocos nucifera), the date palm (Phoenix dactylifera) and the betel nut palm (Areca catechu), are considered as the main cultivated plant species. They are cultivated in about 14.585.811, 11.208.072, 1.264.611 and 834,878 hectares respectively (FAO, 2010). The Date Palm (Phoenix dactylifera L.) is one of old- est domesticated fruit trees, which its wild plants records date back to 5000-6000 BC in Iran, Egypt and Paki- stan (El Hadrami & El Hadrami, 2009). This important food plant produced about 7.048.089 tons of date only in Algeria, Saudi Arabia, Egypt, the Arab Emirates, Iraq, Iran, Morocco, Oman, Pakistan and Tunis (FAO, 2010). Successful future development of date palm industry and cultivation depends on proper evaluating, utilizing, and conserving date palm genetic resources, as well as efficient assessment of the present and potential future cultivars (Jaradat, 2014). One of the main tasks in plant genetic resources investigation is evaluation of available genetic diversity. Genetic diversity of date palm would be studied at dif- ferent levels, including between cultivars, populations or individual clones, as well as between different geographi- cal regions. Genetic variability may be measured at the morphological, physiological, biochemical or molecular levels (Jaradat, 2014). The degree and distribution amount of genetic diversity may vary among different oases and popula- tions, due to historical, geographical, ecological and anthropogenic factors (Jaradat, 2014). Mankind can also influence the genetic diversity of date palms by his activ- ities like cultivation practice, social behavior, artificial selection as well as spatiotemporal exchange and move- ment of germplasm (Jaradat, 2014). Date palm cultivars are reported to have a common genetic back-ground and therefore, proper differentiation of the cultivars and individual plant assignments in each cultivar is a difficult task and mistakes are inevitable in that. This may also be due to genetic admixture of the date palms (Sharifi et. al. 2018, Saboori et al. 2019, 2021 a,b, Gros-Balthazard et al. 2020). “In general, the question of individual assignment to population samples resulted in the development of dif- ferent statistical methods distinguishing between resi- dent individuals that are ‘’mis-assigned’’ (have a geno- type that is most likely to occur in a population other than the one in which the individual was sampled) by error from real immigrant individuals (i.e., type I error, Piry et al. 2004). “In assignment investigation, Monte Carlo resampling methods have been proposed to iden- tify a statistical threshold beyond which individuals are likely to be excluded from a given reference population sample. The principle behind these resampling methods is to approximate the distribution of genotype likeli- hoods in a reference population sample and then com- pare the likelihood computed for the to-be-assigned individual to that distribution (Piry et al. 2004)”. A combination of stable morphological characters and molecular markers may be used in date palm genet- ic diversity studies and discrimination among closely related date palm cultivars and clones (Johnson et al. 2015). Different molecular markers (neutral, multilocus and DNA-sequence based markers) have been utilized in date palm genetic diversity investigations as well as cultivar phylogeny analyses (see for example, Sharifi et al. 2018, Saboori et al. 2019, Saboori et al. 2020). Among these molecular markers, the nuclear microsatellite markers (simple sequence repeat, SSRs) are known to be precise and accurate in genetic finger printing of date palm cultivars (Ahmed et al., 2013, Johnson et al. 2015, Zehdi-Azouzi. et al. 2015). Moreover, Zhao et al. (2013) developed several EST-SSR (Expressed sequence tag- SSR) gene based markers to investigate date palm (Phoe- nix dactylifera L.) genetic finger printing. These genetic markers may provide a valuable genetic and genomic tool for further genetic research and varietal develop- ment in date palm, such as diversity study, QTL map- ping, and molecular breeding. Date palm comprises one of the most important horticultural crops of Iran which is cultivates in several parts of the country but it is mainly in southern parts of Iran (Fig. 1). They have about 400 date palm cultivars, currently under cultivation. Although domestic date palm identification started by 1960s in Iran, it was basi- cally relied on morphological features. However, recent genetic investigations utilize molecular approaches (Hajia et al. 2015). The genetic investigations on Iran date palms, are mainly focused on cultivar identification and evaluation, genetic diversity analyses and cultivars relationships, as well as male and female cultivars discrimination (see for example, Hajian, 2007, Marsafari and Mehrabi, 2013, Has- sanzadeh Khankahdani and Bagheri, 2019. Saboori et al. 153Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates 2020). However, with regard to 400 date palm cultivars and different geographical areas of their cultivation, we need a lot more detailed genetic studies in these cultivars. Along with genetic diversity, significant difference in morphological and agronomic characters of date palm cultivars is important for breeding purpose. QST, is a quantitative genetic analog of Wright’s FST (Spitze 1993, Prout and Barker 1993). The FST gives provides a stand- ardized measure of the genetic differentiation among presumed populations, while the QST provides the amount of genetic variance among populations relative to the total genetic variance. In fact, the average QST of a neutral additive quantitative trait is expected to be equal to the mean value of  FST  for neutral genetic loci.  The FST  can be readily measured on commonly available genetic markers, and  QST  can be measured by an appropriate breeding design in a common gar- den setting. Therefore, QST  is an index of the effect of selection on the quantitative trait. If QST is higher than FST, it is taken as evidence of spatially divergent selec- tion on the studied quantitative trait. If  QST  is much smaller than FST then this has been taken as evidence of spatially uniform stabilizing selection, which makes the trait diverge less than expected by chance. According to Leinonen et al. (2006) and Brom- mer (2011) “when QST estimates are not available, PST can be justified as a substitute.” According to Brommer (2011) “divergence across populations of species that are less amenable for proper QST estimation may still be of considerable evolutionary or conservation interest’’ and it can be assessed by using PST. This in turn estimates the quantitative genetic differentiation (i.e., additive genetic variance) using quantitative trait measurements within populations (Brommer, 2011). The PST index assesses the local adaptation through natural selection of wild populations and is an approximation of the quan- titative genetic differentiation index (QST), obtained in common garden experiments (Gentili et al. 2018). The relationship between the values of PST and FST can be used to estimate the relative importance of genet- ic processes and selection: (a) PST= FST indicates that divergence is compatible with a scenario of genetic drift; (b) PST > FST indicates directional selection (i.e., when one extreme phenotype (Gentili et al. 2018). The quantification of population differentiation based on neutral genetic markers and quantitative traits can highlight the relative role of evolutionary processes such as natural selection, genetic drift and gene flow for patterns of local adaptation (Brommer, 2011; Leinonen et al., 2013). Fixation index (FST) is widely used to estimate genetic differentiation with neutral loci (SSR, ISSR, AFLP) by analyzing the variance in allele frequency (Wright, 1965). In contrast, phenotypic differentiation index (PST) is an estimate of quantitative genetic differ- entiation (i.e., additive genetic variance) using quantita- tive trait measurements within populations (e.g., plant size, growth rate, etc.; Brommer, 2011). MATERIAL AND METHODS Plant materials and morphological features We used 36 cultivars including 122 trees were col- lected from Ahwaz germplasm collection (Omol-tomair station of Date Palm & Tropical Fruits Research Center, Ahwaz, Iran) and different date palm orchards located in Hormozgan and kerman provinces, Iran (Saboori et al. 2019, Saboori et al. 2020). The fruit characters were used based on Saboori et al. 2020. They were including weight of fruit and seed, length and width of fruit, length, and width of the seed. EST-SSR and SSR markers Genomic DNA of fresh leaves were extracted from date palm cultivars collected by modified CTAB pro- tocol (Saboori et al. 2020). For genetic investigation we used three EST-SSR and six SSR loci. Two primers EST-PDG3119-rubisco and EST-DPG0633-Laccase were selected (Zhao et al., 2013), while EST-GTE primer was designed by Primer3 and Gene Runner software. They were then checked for accuracy by BLAST algorithm. Figure 1. The provinces that are under date palm cultivations in Iran. Numbers 1- 13 are: Hormozgan, Kerma, Fars, Sistan & Bal- uchestan, Bushehr, Khuzestan, South Khorasan, Isfahan, Yazd, Ker- manshah, Eilam, Kohgiluie and Boier-Ahmad, and Seman, respec- tively (Hajian 2007, Hajian et al. 2015). 154 Somayeh Saboori et al. Six primers MPdCIR078, MPdCIR085, PdCUC3- ssr2, MPdCIR090, MPdCIR048 and MPdCIR025 were selected for SSR marker (Bodian et al, 2014). The sequences of primers of EST-SSR and SSR markers are listed in Table S1. PCR reaction for EST-SSR and SSR loci were per- formed as following; a 25 µL volume containing 20 ng genomic DNA and 5 U of Taq DNA polymerase (Bioron, Germany), 2X PCR buffer (50 mM KCl; 10 mM Tris-HCl, pH;8), 1.5mM MgCl2; 0.2 mM of each dNTP (Bioron, Germany); 0.2 µM of each primer. The PCR program for EST-SSR and SSR markers were followed: The reactions for EST-SSR were amplified in T100 thermal cycler (BioRad, USA) using the following proce- dure, 5 min at 94 ºC, 35 cycles of 30 sec at 95 ºC, 30 sec at 50-60 ºC (EST-PDG3119-rubisco 50 ºC, EST-GTE 52 ºC, EST-DPG0633- Laccase 60 ºC) and 1 min and 30 sec at 72 ºC followed by 5 min at 72 ºC as final extension. The PCR program for SSR markers were performed as touch-up PCR; 94°C for 5 min, initial 10 cycles at 95°C for 30 sec, annealing step (MPdCIR078 51°C, MPd- CIR085 47.5 °C, PdCUC3-ssr2 62 °C , MPdCIR090 47.5 °C , MPdCIR048 46.9 °C , MPdCIR025 45 °C)for 1 min, 72°C for 1 min and 30 sec, followed by 40 cycles at 95°C for 30 sec, annealing step (MPdCIR078 52°C, MPd- CIR085 49.9 °C, PdCUC3-ssr2 65 °C , MPdCIR090 49.9 °C , MPdCIR048 48.8 °C , MPdCIR025 48 °C) for 1 min, 72°C for 1 min and 30 sec, a final cycle of 72 °C for 15 min. The PCR amplifications were separated on a 12% PAGE (poly acrylamide gel electrophoresis) with a 100- kb gene ruler (Parstous, Iran). Data analyses Genetic diversity analyses The SSR and EST-SSR bands obtained were treated as binary characters (Podani 2000) and used for fur- ther analyses. DCA (Dentrented correspondance analy- sis) was used to evaluate suitability of SSR and EST- SSR bands obtained. Discriminant power of the bands obtained was determined by POPGENE program. Genetic diversity parameters in the date palm cultivars were estimated by GeneAlex 4.2. A heat map was pro- duced on these parameters by R package. Genetic grouping of the cultivars In order to find the proper number of genetic groups within date palm studied, we followed two different sta- tistical approaches. 1- We used K-Means clustering as performed in Genodive program, which is based on likeli- hood method. 2- Delta K was obtained from STRUTURE analysis which is a Bayesian-based method. Details of these methods are according to Sharifi et al. (2018). GenoDive provides two different statistics that can determine the number of clusters. These are pseudo- F-statistic; (the optimal clustering is the one with the highest value for the pseudo-f statistic), and the Bayes- ian Information Criterion (BIC, calculated using sum of squares and the optimal clustering is the one with the lowest value) (Meirmans2020). Both these criteria work well for clustering populations and individuals, espe- cially when there is random mating within populations but BIC has the benefit that it can be used to determine whether there actually is any population structure at all (Meirmans 2020). Based on the number of Ks obtained we performed Ward clustering as performed in PAST and STRUC- TURE analysis as implemented in STRUCTURE pro- gram. The genetic differentiation of the studied cultivars was determined by AMOVA as performed in GeneAlex, as well asby Gst- Nei and Gst-Hederick as performed in Genodive. Correlation between morphological characters stud- ied was determined by Pearson coefficient of correlation. In order to compare groups of the cultivars based on both molecular and morphological characters, heat maps were constructed by related commands in R package. Population assignment was performed by two dif- ferent methods: 1- By discriminant analysis (DA) as performed in SPSS program. In this analysis a sum- mary table was produced which indicates relatedness of each case to its presumed population, and finally pro- vide a percentage value for each population member- ship based on likelihood method. 2- By using Assign- ment test in GeneAlex, which is also based on likeli- hood method and provides a total membership per- centage for all data in question and also provide pair- wise populations graph. Phenotypic versus genetic differentiation PST index was used to estimate the role of local adaptation through natural selection in date palm popu- lations, compared to that of genetic differentiation. For each population pair, pairwise PST values were calcu- lated for each trait (and for an average PST), using the following formula: 155Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates In this formula, ð2 B and ð2 W are between-popula- tion and within population variance components for a trait, respectively; h2 expresses the heritability (the pro- portion of phenotypic variance that. is due to additive genetic effects); the scalar c expresses the proportion of the total variance that is presumed to be due to addi- tive genetic variance across populations (Broker,2011; Leinonen et al., 2013). In the wild, the estimation of the additive genetic variance components is challenging as breeding design is impossible. Therefore, QST is often approximated by PST (Leinonen et al., 2006), which is directly calculated from the total phenotypic variance components with no distinction between the relative contribution of genetic and environmental variations. Therefore, the phenotypic divergence between populations was estimated by the parameter PST as follows: In this formula, ð2 B and ð2 W are the respective phe- notypic variances between and within populations, c is an estimate of the proportion of the total variance due to additive genetic effects across populations, and h2 is heritability, the proportion of phenotypic variance due to additive genetic effects (Brommer, 2011). In present study Pst was estimated by Pstat of R package (Da Silva and Da Silva, 2018). RESULTS SSR and EST-SSR analyses We obtained in total 40 SSR bands in 122 date palm trees studied. The lowest number of bands (13) occurred in cultivar “Wardi” (male, No. 32), while the highest number of bands was observed in cultivars Halili (No. 4), Male (No. 11), Khezrawi (No. 17), and Barhi (No. 20). The cultivars investigated did not have private band. The suitability of SSR and EST-SSR bands for date palm population genetic studies was determined by DCA plot (Fig. 2). The plot shows a well-scattered dis- tribution of SSR loci, which indicated that these loci are from different regions of the genome and are not clus- tered to each other. Such loci are useful in genetic diver- sity analyses of the populations. Discriminating power of SSR and EST-SSR bands versus migration (Nm) is provided in Table S2. The result shows that most of SSR loci obtained have a high Gst value (0.70), and therefore have a good discrimina- tion power for date palm cultivar differentiation task. This is also evidenced with the high mean Gst value = 0.81 obtained. Figure 2. DCA plot of SSR and EST-SSR bands/loci in date palm cultivars showing well-scattered distribution of loci obtained. 156 Somayeh Saboori et al. Genetic diversity of Date palm cultivars Data with regard to genetic diversity parameters determined in 122 individual trees of 36 date palm culti- vars are presented in Table S3. The range of polymorphism percentage varied from 2.5 in cultivar Kharook (No. 13), to 25 in. cultivar Khadhrawi (No. 17). The mean value for polymorphism was 13.07%. Usually, date palm cultivars show similar genetic contents, and therefore, about 13% genetic poly- morphism is yet appreciable for further breeding stud- ies if accompanied by some degree of morphological and agronomical desirable traits variation. Heat-map constructed based on genetic diversity parameters (Fig. 3), reveals that based on percentage of genetic polymorphism (P), Nei’ gene diversity (He) and Figure 3. Heatmap of date palm cultivars based on genetic diversity parameters. Abbreviations: Na = No. of different alleles, Ne = No. of Effective alleles, I = Shanon Information. index, He = Expected Heterozygosity, uHe = Unbiassed Expected Heterozygosity, and P% = Poly- morphism percentage. 157Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates Shanon Information Index (I), date palms may be classi- fied in 5 or 6 genetic groups. This classification is sharp- er by considering only genetic polymorphism parameter. Grouping of the cultivars The Nei genetic distance determined in the culti- vars studied varied from 0.067 between cultivars 1 and 2, to 0.46 between cultivars Estameran (No. 19) and Mashtoom (No. 28). These low values of genetic dis- tance, indicates a high degree of genetic alikeness in date palm cultivars cultivated in the country. For grouping of the cultivars based on SSR markers, we first performed K-Means clustering by Genodive pro- gram (Table S4). The results indicated that these culti- vars can be grouped either in two broad clusters accord- ing to Calinski & Harabasz’ pseudo-F: k = 2, or in 16 smaller genetic groups according to Bayesian Informa- tion Criterion: k = 16. Ward clustering of the date palm cultivars based on SSR and EST-SSR data (Fig. 4), also grouped the geno- types in two major clusters and about 16 sub-clusters which is in agreement with K-Means clustering. WARD dengrogram produced two main clusters or genetic groups in accord with K-Means clustering result. The cultivars 1-13 comprise the first genetic group and form the first main cluster, while the other cultivars form the second major cluster or genetic group. In the first main cluster, the cultivars are distributed in three sub-clusters A-C. Replicates of the cultivars 1-4 show a higher level of genetic similarity and are placed in a single sub-cluster, (A). Replicates of the cultivars 9-13 comprise the second sub-cluster B, while replicates of the cultivar 5-9 form the sub-cluster C. Replicates of the cultivar 4, were admixed in two sub-clusters A and C. Few date palm plants of these cultivars also show some degree of admixture. Since clustering is based on distance parameter only, we also tried STRUCTURE analysis for genotype group- ing, which is a Bayesian-based method. For this, we first obtained K value by Evanno method, which produced delta K = 2. This is in agreement with major growing obtained by K-Means clustering. However, to obtain a better and more detailed picture on the cultivars genetic grouping, we carried out STRUCTURE analysis based on K values 2-5 (Fig. 5). The best genetic grouping obtained seems to be K =5. Based on K =5, the cultivars 1-4 show genetic affin- ity and comprise the first genetic group. This is followed by the cultivars 5-13, then 14-2, 23-30, and finally the cultivars 31-36, form the fifth genetic group. All these five genetic groups show a low degree of genetic admix- ture with the other groups. Figure 4. Ward dendrogram of date palm cultivars based on SSR and EST-SSR data. 158 Somayeh Saboori et al. Genetic difference of the cultivars AMOVA produced significant genetic difference among date palm cultivars (PhiPT = 0.70, P = 0.001). It also revealed that 70% of total genetic variability occurs due to among cultivar difference, while 31% occurs due to within population genetic variability. Moreover, pair- wise AMOVA (Table S5) produced significant genetic dif- ference between the cultivars of the two main clusters as well as the cultivars of different sub-clusters in UPGMA dendrogram. New genetic differentiation parameters esti- mated produced significant difference among date palm cultivars (G’st(Nei) = 0.673, P =0.001; G’st(Hed) = 0.738, P = 0.001). These results indicate the presence of genetic Figure 5. STRUCTURE plot of date palms studied based on K = 2-5. 159Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates variability within date palm cultivar germplasm, which can be used in future breeding program. Assignment of date palms Assignment of individual date palm plants by dis- criminant analysis revealed that the cultivars 2, 9, 10, 13, 20, 21, 25, 29, 31 and. 32, have 33% mis-assignment, while cultivar 4 has 66% mis-assignment. GeneAlex also revealed 67% self population assignment and 33% of other population assignment. In Table S6, some parts of assignment result for 122 date palms have been given (only those samples inferred to be from other population are given). Assignment is based on positive likelihood, and therefore the lower the value shows the correct assignment (inferred population). Fst versus Pst estimates Details of morphological characters studied are giv- en in Fig. 6. ANOVA produced significant difference (P <0.01), for these characters among the studied cultivars. Most of these characters show significant correlation (P. <0.01) (see for example, Fig. 7). Heat-maps of the 45 date palm trees based on mor- phological versus genetic (SSRs), data are presented in Fig. 8. Comparison of the groupings obtained reveals difference in the clustering results. Figure 6. ANOVA of morphological characters studied in date palm cultivars. 160 Somayeh Saboori et al. Moreover, the Mantel test performed between the two clustering results did not produced a significant association between the two markers (r = 0.057, P = 0.16), supporting the heat maps. Therefore, grouping and cultivar relationship illustrated by morphological char- acters studied do not accord with genetic relationship of the same date palm cultivars. Fst versus Pst analyses, revealed that in most of the studied morphological characters, the Pst value greatly exceeds that of genetic Fst value. For example, some of the pair-wise comparison between cultivar No. 3 and the others are provided in Table S7. Therefore, PST > FST indicates directional selection in quantitative fruit and seed characteristics has been occurred in the studied date palm cultivars. Different factors may be responsible for these directional changes, like ecological and environmental conditions in which the cultivars grow, selection practiced by the breeders Figure 7. Representative Pearson coefficient of correlation among morphological characters studied in date palm cultivars. 161Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates or locals, etc. In general, morphological difference along with genetic diversity present in the studied cultivars may contribute in future breeding of date palm. DISCUSSION Genetic diversity Present study revealed the presence of a low to mod- erate genetic diversity within date palm cultivars stud- ied. This is in accord with the studies performed in Iraq and Tunesian date palms by Jubrael et al. (2005) and Zehdi et al. (2015), who suggested a common genetic basis among date palm genotypes despite the differenc- es in fruit characters and tree morphology. Low genetic diversity within date palm germplasm was revealed but both neutral molecular markers like, ISSRs and SSRs (see for example, Sharifi et al. 2018, Saboori et al. 2020), and sequence-based marker, like chloroplast DNA (Shar- ifi et al. 2018). Cultivars genetic grouping The cultivars studied were placed in two major genetic groups by both K-Means and Bayesian-based delta K estimation more detailed analysis, revealed that they can be classified in 5 different genetic groups. Such data may be used in future breeding program. Culti- var grouping based on STRUCTURE analysis were also utilized by the other researchers in date palms (see for example, Sharifi et al. 2018). It is important in plants with almost common genetic background like date palms to classify them in different genetic classes. Population assignment Population assignment seems to be a prerequisite step in selecting plant individuals and breeding date palm, as these plants have a common genetic back- ground and show overlapping genetic structure. This may also happen due to genetic admixture of the date palms (Sharifi et. al. 2018, Saboori et al. 2020). We obtained about 33% of incorrectly assigned date palms in respect to their presumed populations. This may be either due to improper plant sampling or identification within the germplasm, or due to gene flow and admix- ture among these cultivars. In any case, such cases should be considered in future breeding program. In a similar study concerned with genetic structure of Tunesian date palms, Zehdi et al. (2015) reported the presence of admixed cultivars too. They considered that the gene flows between eastern and western origins mostly from east to west following a human-mediated Figure 8. Heat maps of 45 date palm cultivars based on morphological and genetic (SSRs) data, showing different groupings of these culti- vars. (Abbreviations in morphological heat map are: SW = Seed weight, SWI = Seed width, FW = Fruit weigh, SL = Seed. length, and. FL = Fruit length). 162 Somayeh Saboori et al. diffusion of the species, is the reason for the formation of mixed genotypes. Saboori et al. (2020), investigated the genetic struc- ture of 13 date palm cultivars by SCoT molecular mark- ers and reported some degree of genetic admixture among the cultivars. Though, they did not study spe- cifically assignment of the plants to their populations, by looking at the clustering result of their samples, it becomes evident that some of the plants a presumed cul- tivar has been placed intermixed with plants of anoth- er cultivar. However, Sharifi et al (2018) investigated the gene flow and assignment in 16 date palm cultivars by using ISSR molecular markers and observed some degree of population admixture and few cases of incor- rectly assigned date palms. In an elaborate and precisely studied report by Gros- Balthazard et al. (2020), they used a joint ethnographic study and genetic analysis of date palms to test whether named date palm types are true-to-type cultivars versus incorrectly assigned samples in desert nearby Siwa (also known as “feral” in Battesti in Egypt). They recognized three categories of genotypes within their extensive col- lection namely, true-to-type cultivar samples, ethno- varieties and samples of local categories. Therefore, there is a huge mistake in assigning date palms to their respective population or named cultivar. Genetic versus phenotypic differential Aljuhani (2016), studied the degree of dissimilarity and the impact of location on the genetic relationship between local cultivars in Saudi Arabia by using and twenty-four nuclear microsatellite loci. He reported a high level of genetic polymorphism in some of the loci, and could differentiate the studied cultivars by these markers. Some of these cultivars were grouped accord- ing to their geographical area in which they were cul- tivated. We obtained a higher value for Pst versus Fst, almost in all date palm cultivars studied and for most of the fruit and seed characters. The Pst is taken as index for morphological local adaptation through natu- ral selection, but influenced by environment (Brommer, 2011). If Pst = FST, it indicates that divergence is due to genetic drift; and if Pst > Fst, it indicates the role of directional selection (i.e., when one extreme phenotype is favored over other ones) among populations; and finally, if Pst< Fst, it indicates that the same phenotypes are favored in different populations due to stabilizing selection. We may therefore, suggest that, due to some local environmental face or local practice of cultivation or selection, some adaptive changes have occurred in date palm cultivars in the country. QST–FST compari- son has shown that trait divergence due to natural selec- tion, as opposed to genetic drift have occurred in many taxa (Leinonen et al. 2013). In present study, the Mantel test did not produce significant association between the cultivar grouping and morphological grouping, in other words we did not see co-variation between genetic and morphologi- cal traits. However, in Qst-Fst investigation carried out by Sˇurinová et al. (2018), in 11 populations of Festuca rubra, they reported the existence of adaptive differen- tiation in phenotypic traits and their plasticity across the climatic gradient and observed statistically significant co-variation between markers and phenotypic traits, which is likely caused by isolation by adaptation. In a similar study, Caré et al. (2018) investigated the high morphological differentiation in crown architecture in contrasts with low population genetic structure of German Norway Spruce Stands by using Pst-Fst method and 11 nuclear SSR molecular markers. Norway spruce trees have narrow crown pheno- types, whereas lowland trees have broader crowns. Nar- row crown phenotypes are likely the result of adaptation to heavy snow loads combined with high wind speeds. They observed a high differentiation of morphologi- cal traits (Pst = 0.952–0.989) between the neighboring autochthonous and allochthonous stands of similar age contrasts with the very low neutral genetic differen- tiation (Fst = 0.002–0.007; G”st = 0.002–0.030), suggest- ing that directional selection at adaptive gene loci was involved in phenotypic differentiation. It has been suggested that “the QST–FST method is still underused in ‘omics’ contexts, in which it may be useful for identifying evolutionary significance in large data sets in the absence of evolutionary models (Leinon- en et al. 2013)”. In conclusion we may sat that considering different molecular studies in date palm genotypes both around the world and in our country, and irrespective of molec- ular marker used (neutral versus sequence based mark- ers), a low to moderate genetic diversity is present in limited number of cultivars investigated till now. We need to carry one further detailed population genetics analysis in much more number of accessions and culti- vars to possibly broaden the genetic variability of date palm for future breeding. AUTHORS’ CONTRIBUTIONS Z.N. and M.Sh: conceptualization of the project; M.Sh.: analyses of data; S.S and F.K data collection and lab work; S.M.: providing samples 163Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates ACKNOWLEDGEMENTS We acknowledge Science and Research Branch, Islamic Azad University for providing laboratory. We thank the Iran National Science Foundation (INSF), for partial financial support of this project (No.97010700). REFERENCES Ahmed J, Al-Jasass FM, Siddiq M (2014) Date Fruit Composition and Nutrition. In: Siddiq M, Aleid S, Kader A (Eds) Dates: Postharvest Science, Process- ing Technology and Health Benefit. Wiley Blackwell, Chichester, UK, pp 261-283 Aljuhani W S (2016) Genetic Diversity and the Impact of Geographical Location on the Relationships Between Phoenix dactylifera L. Germplasms Grown in Sau- di Arabia. Hereditary Genet 5(3):1-11. https://doi. org/10.4172/2161-1041.1000172 Bodian A, Nachtigall M, Frese L, Elhoumaizi M A, Has- naoui A, Ndir KN, Sané D (2014) Genetic diversity analysis of date palm (Phoenix dactylifera L.) culti- vars from Morocco using SSR markers. J Biodivers Biopros Dev 1(3): 2376-0214 Brommer JE (2011) Whither PST? The approximation of QST by PST in evolutionary and conservation biolo- gy. J Evol Biol 24:1160-1168. https://doi.org/10.1111/ j.1420-9101.2011.02268.x Caré O, Müller, M, Vornam, B, Höltken, A, Kahlert K, Krutovsky K V, Gailing, O, Leinemann, L (2018) High Morphological Differentiation in Crown Archi- tecture Contrasts with Low Population Genetic Structure of German Norway Spruce Stands. Forests 9: 752. https://doi.org/10.3390/f9120752 Da Silva B, Anne Da Silva A (2018) Pstat: An R Package to Assess Population Differentiation in Phenotypic Traits by Stéphane. The R Journal 10(1): 447-454 El hadrami I, El hadrami A (2009) Breeding date palm. In: Jain SM, Priyadarshan PM (eds) Breeding plantation tree crops: tropical species, Berlin, Springer pp191-216 FAO (2010) Statistics Division. . Online. Accessed: Dez. 01, 2010. Gros-Balthazard M, Battesti V, Ivorra S, Paradis L, Aber- lenc F, Zango O, Zehdi S, Moussouni S, Abbas Naqvi S, Newton C, Terral JF (2020) Integration of ethno botany and population genetics uncovers the agro- biodiversity of date palms of Siwa Oasis (Egypt) and their importance to the evolutionary history of the species. Evol Appl. https://doi.org/10.1111/eva.12930 Gentili R, Solari A, Diekmann M, Duprè C, Monti GS, Armiraglio S, Assini S, Sandra Citterio S (2018) Genetic differentiation, local adaptation and pheno- typic plasticity in fragmented populations of a rare forest herb. Peer J 6:e4929 https://doi.org/10.7717/ peerj.4929. Hajia S, Hamidi-Esfahani Z (2015) Date Palm Status and Perspective in Iran. In: Al-Khayri J, Jain S, Johnson D. (eds) Date Palm Genetic Resources and Utiliza- tion, Springer, Dordrecht Hajian S (2007) Quantity and Quality Compari- son of Offshoot and Tissue Cultured Barhee Date Palm Trees. Acta Hortic 736:293-297. https://doi. org/10.17660/ActaHortic.2007.736.27 Hassanzadeh Khankahdani H, Bagheri A (2019) Iden- tification of Genetic Variation of Male and Female Date Palm (Phoenix dactylifera L.) Cultivars Using Morphological and Molecular Markers. Int J Hor- tic Sci 6(1): 63-76. https://doi.org/10.22059/ ijhst.2019.276013.278 Jaradat A A (2014) Synthesis and assessment of date palm genetic diversity studies. Emir J Food Agric 26 (11): 934-952. https://doi.org/10.9755/ejfa.v26i11.18977 Jubrael JMS, Udupa S, Baum M (2005) Assessment of AFLP based genetic relationships among date palm (Phoenix dactylifera. L.) varieties of Iraq. J Amer Soc Hort Sci 130:442–447. Johnson, DV, Al-Khayri JM, Mohan Jain S (2015) Intro- duction: Date Production Status and Prospects in Africa and the Americas. In: Al-Khayri JM,  Jain S M, Johnson D V. (Eds.) Date Palm Genetic Resources and Utilization, 3 rd. Africa and the Americas, pp: 3-18 Leinonen T, McCairns RJS, O’Hara RB, Merilä J (2013) QSTFST comparisons: evolutionary and ecological insights from genomic heterogeneity. Nature Reviews Genetics 14:179190. https://doi.org/ 10.1038/nrg3395 Leinonen T, Cano J M, Makinen H, Merilä J (2006) Con- trasting patterns of body shape and neutral genetic divergence in marine and lake populations of three spine sticklebacks. J Evol Biol 19:1803–1812. https:// doi.org/10.1111/j.1420 9101.2006.01182.x. Meirmans PG (2020) GENODIVE version 3.0: Easy-to- use software for the analysis of genetic data of dip- loids and polyploids. Mol Ecol Resour https://doi. org/10.1111/1755-0998.13145 MOORE H, UHL N (2011) Major trends of evolution in Palm. Botanical Review. http://www.springerlink. com/content/t637574148l46075/. Accessed 04 May 2011 Marsafari M, Mehrabi AA (2013) Molecular identification and genetic diversity of Iranian date palm (Phoenix dactylifera L.) cultivars using ISSR and RAPD mark- ers. AJCS 7(8):1160-1166 164 Somayeh Saboori et al. Prout T, Barker J S F (1993)  F  statistics in  Drosophila buzzatii: selection, population size and inbreed- ing. Genetics 134: 369–375 Piry S, Alapetite A, Cornuet JM, Paetkau D, Baudouin L, Estoup A (2004) GENECLASS2: A Software for Genetic Assignment and First-Generation Migrant Detection. J HERED 95(6):536–539. https://doi. org/10.1093/jhered/esh074. Podani J (2000) Introduction to the Exploration of Mul- tivariate Data [English translation], Leide, Nether- lands: Backhuyes. Rivas M, Barbieri R L, da Maia C (2012) Plant breeding and in situ utilization of palm trees. Ciência Rural, Santa Maria 42: 261-269. Saboori S, Noormohammadi Z, Sheidai M, Marashi S (2019) SCoT molecular markers and genetic finger- printing of date palm (Phoenix dactylifera L.) culti- vars. Genet Resour Crop Evol 67(1): 73-82. https:// doi.org/10.1007/s10722-019-00854-x Saboori S, Noormohammadi Z, Sheidai M, Marashi SS (2021 a) Date Palm (Phoenix dactylifera L.) Cultivar Relationships Based on Chloroplast Genotyping. Ira- nian J Sci Technol Transact A: Sci 45: 833–840. Saboori S, Noormohammadi Z, Sheidai M, Marashi SS (2021 b) Insight into date palm diversity: Genetic and morphological investigations Plant Mol Biol Rep 39: 137–145 Sharifi M, Sheidai M, Koohdar F (2018) Genetic finger- printing of date palm (Pheonix dactylifera L.) by using ISSR and cpDNA sequences. Indian J Genet 78: 507-514. https://doi.org/10.31742/IJGPB.78.4.13 Stojanova B, Šurinová M, Klápště J, Koláříková V, Had- incová V, Münzbergová Z (2018) Adaptive differ- entiation of  Festuca rubra  along a climate gradi- ent revealed by molecular markers and quantita- tive traits. PLoS ONE 13(4): e0194670. https://doi. org/10.1371/journal.pone.0194670 Spitze K (1993) Population structure in Daphnia obtusa: quantitative genetic and allozymic variation.  Genet- ics 135: 367–374. Zehdi-Azouzi S, Cherif E, Moussouni S, Gros-Balthazard M, Naqvi S A, Ludeña B, Castillo K, Chabrillange N, Bouguedoura N, Bennaceur M et al. (2015) Genetic structure of the date palm (Phoenix dactylifera) in the Old World reveals a strong differentiation between eastern and western populations. Ann Bot 116: 101– 112. https://doi.org/10.1093/aob/mcv068 Wright S (1965) The Interpretation of Population Struc- ture by F-Statistics with Special Regard to Systems of Mating. Evol 19: 395-420. Zhao Y, Williams R, Prakash CS, He G (2012) Identifica- tion and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.). BMC Plant Biol 12(1): 237. https://doi.org/10.1186/1471-2229-12-237 Table S1. EST-SSR and SSR primer name, sequences and references. Locus name EST- SSR primer sequence Ref EST-PDG3119-rubisco-F CATACTGATTATTGGCACACC (Zhao et al. 2012) EST-PDG3119-rubisco-R GTACCATACCGTACCAGTTCA EST-DPG0633- Laccase -F AGACTGGTTAAGTTGGTGGAG (Zhao et al. 2012) EST-DPG0633-Laccase-R CTACAAAACTGATGTGGTGGT EST-GTE-F GCTTGGCCATCTATGAAAC -- EST-GTE-R ACTCTGAGCATCCATATCG -- SSR primer sequence MPdCIR025(GA)22-F GCACGAGAAGGCTTATAGT (Bodian et al. 2014) MPdCIR025(GA)22-R CCCCTCATTAGGATTCTAC MPdCIR048(GA)32-F CGAGACCTACCTTCAACAAA (Bodian et al. 2014) MPdCIR048(GA)32-R CCACCAACCAAATCAAACAC MPdCIR078(GA)13-F TGGATTTCCATTGTGAG (Bodian et al. 2014) MPdCIR078(GA)13-R CCCGAAGAGACGCTATT mPdCIR085(GA)29-F GAGAGAGGGTGGTGTTATT (Bodian et al. 2014) mPdCIR085(GA)29-R TTCATCCAGAACCACAGTA MPdCIR090(GA)26-F GCAGTCAGTCCCTCATA (Bodian et al. 2014) MPdCIR090(GA)26-R TGCTTGTAGCCCTTCAG PdCUC3-ssr2(GA)22-F ACATTGCTCTTTTGCCATGGGCT (Bodian et al. 2014) PdCUC3-ssr2(GA)22-R CGAGCAGGTGGGGTTCGGGT 165Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates Table S2. Discrimination power (Gst value), of SSR loci obtained. Locus Sample Size Ht Hs Gst Nm Locus1 122 0.0526 0.0385 0.2676 1.3687 Locus2 122 0.3742 0.0354 0.9053 0.0523 Locus3 122 0.4580 0.1177 0.7430 0.1730 Locus4 122 0.2066 0.0438 0.7882 0.1343 Locus5 122 0.3214 0.0792 0.7536 0.1635 Locus6 122 0.2845 0.0083 0.9707 0.0151 Locus7 122 0.1859 0.0333 0.8209 0.1091 Locus8 122 0.1721 0.0136 0.9212 0.0428 Locus9 122 0.2731 0.0625 0.7710 0.1485 Locus10 122 0.0429 0.0302 0.2961 1.1888 Locus11 122 0.4963 0.0490 0.9013 0.0548 Locus12 122 0.1975 0.0000 1.0000 0.0000 Locus13 122 0.0759 0.0136 0.8214 0.1227 Locus14 122 0.1600 0.0469 0.7072 0.2071 Locus15 122 0.2133 0.0906 0.5751 0.3694 Locus16 122 0.4945 0.0678 0.8629 0.0794 Locus17 122 0.3883 0.1199 0.6913 0.2233 Locus18 122 0.4910 0.0604 0.8770 0.0702 Locus19 122 0.2330 0.0271 0.8836 0.0659 Locus20 122 0.0316 0.0136 0.5705 0.3765 Locus21 122 0.4727 0.1042 0.7796 0.1413 Locus22 122 0.2527 0.0552 0.7816 0.1397 Locus23 122 0.0636 0.0083 0.8691 0.0753 Locus24 122 0.4800 0.0521 0.8915 0.0609 Locus25 122 0.2209 0.0250 0.8869 0.0637 Locus26 122 0.4694 0.1230 0.7380 0.1775 Locus27 122 0.2788 0.0354 0.8729 0.0728 Locus28 122 0.0331 0.0219 0.3391 0.9744 Locus29 122 0.3906 0.0604 0.8453 0.0915 Locus30 122 0.4979 0.0469 0.9059 0.0519 Locus31 122 0.4457 0.1334 0.7006 0.2136 Locus32 122 0.1456 0.0271 0.8138 0.1144 Locus33 122 0.0651 0.0438 0.3276 1.0262 Locus34 122 0.4045 0.1593 0.6060 0.3250 Locus35 122 0.0621 0.0271 0.5633 0.3876 Locus36 122 0.3333 0.0219 0.9343 0.0351 Locus37 122 0.2922 0.0521 0.8217 0.1225 Locus38 122 0.3959 0.0438 0.8895 0.0621 Locus39 122 0.4788 0.0761 0.8411 0.0945 Locus40 122 0.4900 0.1020 0.7930 0.1340 Mean 122 0.2804 0.0530 0.8109 0.1166 * Nm = estimate of gene flow from Gst or Gcs. E.g., Nm = 0.5(1 - Gst)/Gst. Abbreviations: Hs = inbreeding due to sub-population, Ht = Hnbreeding in total population, Gst = Discrimination power, and Nm = Num- ber of migration. 166 Somayeh Saboori et al. Table S3. Genetic diversity parameters in date palm cultivars. No Cultuvar name Na Ne I He uHe P 1 Mazafati 0.625 1.127 0.104 0.071 0.086 17.50 2 Kalooteh 0.625 1.138 0.116 0.079 0.095 20.00 3 Khalezohrei 0.650 1.138 0.116 0.079 0.095 20.00 4 Holeileh 0.700 1.112 0.106 0.069 0.083 20.00 5 Mordarsang 0.500 1.069 0.058 0.039 0.047 10.00 6 Khazab 0.500 1.056 0.053 0.035 0.042 10.00 7 Holoo 0.600 1.077 0.077 0.050 0.060 15.00 8 Khenizi 0.600 1.117 0.092 0.064 0.077 15.00 9 Negar 0.625 1.127 0.104 0.071 0.086 17.50 10 Shahani 0.475 1.058 0.046 0.032 0.038 7.50 11 Male isolate 0.675 1.101 0.094 0.062 0.074 17.50 12 Alimehtari 0.525 1.069 0.058 0.039 0.047 10.00 13 Kharook 0.450 1.024 0.017 0.012 0.015 2.50 14 Gantar 0.550 1.082 0.063 0.044 0.053 10.00 15 Zahidi 0.600 1.104 0.087 0.059 0.071 15.00 16 Jowzi 0.575 1.104 0.087 0.059 0.071 15.00 17 Khadhrawi 0.750 1.186 0.150 0.103 0.124 25.00 18 Shekkar 0.475 1.032 0.036 0.022 0.027 7.50 19 Istamaraan 0.525 1.045 0.041 0.027 0.033 7.50 20 Barhi 0.650 1.104 0.087 0.059 0.071 15.00 21 Hallawi 0.600 1.104 0.087 0.059 0.071 15.00 22 Braim 0.500 1.069 0.058 0.039 0.047 10.00 23 Dayri 0.525 1.080 0.070 0.047 0.056 12.50 24 Beliani 0.650 1.101 0.094 0.062 0.074 17.50 25 Owaidi 0.525 1.080 0.070 0.047 0.056 12.50 26 Sowaidani 0.450 1.071 0.051 0.037 0.044 7.50 27 Owaimri 0.525 1.056 0.053 0.035 0.042 10.00 28 Mashtoom 0.600 1.104 0.087 0.059 0.071 15.00 29 Fersee 0.600 1.114 0.099 0.067 0.080 17.50 30 SabzParak 0.475 1.080 0.070 0.047 0.056 12.50 31 GhannamiSabz 0.500 1.053 0.060 0.037 0.045 12.50 32 Wardi 0.400 1.071 0.051 0.037 0.044 7.50 33 GhannamiSorkh 1 0.525 1.095 0.068 0.049 0.059 10.00 34 GhannamiSorkh2 0.500 1.045 0.041 0.027 0.033 7.50 35 Foreign male 1 0.525 1.106 0.080 0.056 0.068 12.50 36 Foreign male 2 0.525 1.106 0.080 0.056 0.068 12.50 Abbreviations: Na = No. of different alleles, Ne = No. of Effective alleles, I = Shanon Information. index, He = Expected Heterozygosity, uHe = Unbiassed Expected Heterozygosity, and P% = Polymorphism percentage. 167Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates Table S4. K-Means clustering of date palm cultivars based on SSR and EST-SSR data. SSD(T) SSD(AC) SSD(WC) r-squared pseudo-F BIC 1376.672 202.482 1174.191 0.147 20.693 871.945 1376.672 319.18 1057.492 0.232 17.959 863.978 1376.672 411.173 965.499 0.299 16.751 857.679 1376.672 498.76 877.912 0.362 16.618 850.881 1376.672 566.45 810.222 0.411 16.22 845.896 1376.672 620.841 755.831 0.451 15.744 842.222 1376.672 660.327 716.346 0.48 15.012 840.48 1376.672 695.563 681.109 0.505 14.425 839.13 1376.672 724.476 652.196 0.526 13.824 838.642 1376.672 753.245 623.427 0.547 13.411 837.943 1376.672 780.048 596.625 0.567 13.074 837.385 1376.672 807.604 569.068 0.587 12.891 836.42 1376.672 832.456 544.217 0.605 12.708 835.777 1376.672 853.797 522.876 0.62 12.48 835.7 1376.672 874.463 502.209 0.635 12.305 835.584 1376.672 891.686 484.986 0.648 12.066 836.131 1376.672 909.553 467.12 0.661 11.912 836.356 1376.672 925.794 450.878 0.672 11.75 836.842 1376.672 940.632 436.04 0.683 11.581 837.564 * Best clustering according to Calinski & Harabasz’ pseudo-F: k = 2 & Best clustering according to Bayesian Information Criterion: k = 16 Abbreviations: SSD(T) = Total sum of squares, SSD(AC) = Among clusters sum of squares, and SSD(WC) = Within clusters sum of squares. Table S5. Pair-wise AMOVA showing significant genetic differ- ence between the studied date palm cultivars (cultivar numbers are according to Table S3). Cultivar1 Cultivar2 Pvalue 3 21 0.001 4 8 0.001 4 16 0.001 5 10 0.001 5 35 0.001 6 7 0.001 6 11 0.001 6 27 0.001 6 29 0.001 6 1 0.001 7 12 0.001 8 22 0.001 8 30 0.001 11 23 0.001 14 15 0.001 15 36 0.001 21 23 0.001 18 24 0.001 20 24 0.001 20 36 0.092 21 36 0.001 24 26 0.001 25 34 0.001 27 31 0.001 Table S6. Assignment result of date palms (only samples inferred to be from other populations are given) based on positive likelihood. (cul- tivar numbers are according to Table S3). Home cultivar Infered cultivar1 cultivar 1 2 3 4 5 6 7 1 3 4.432 4.15 3.516 6.055 10.076 12.431 14.59 12.748 1 2 6.034 4.099 4.789 5.549 10.356 13.829 15.386 14.793 2 3 4.592 4.533 3.789 4.453 8.18 10.812 12.845 13.6 2 1 3.373 4.724 3.947 5.708 13.331 12.732 10.891 9.901 2 3 3.704 3.413 3.227 4.453 10.414 14.352 14.289 14.969 3 2 3.579 2.798 3.617 4.152 8.812 12.13 12.067 12.873 3 2 3.771 2.798 3.77 4.328 11.59 14.051 11.988 13.094 4 2 5.057 4.439 5.537 5.554 8.796 10.431 10.368 9.997 8 7 8.698 9.4 9.588 6.106 7.683 7.414 4.429 5.641 9 5 8.379 9.044 9.093 10.565 7.239 7.271 11.271 9.776 9 10 8.328 7.597 8.093 7.935 10.96 12.829 12.908 11.316 10 11 10.93 9.09 10.19 8.759 11.106 11.13 14.085 13.316 11 10 9.93 8.898 9.792 9.537 12.437 12.829 14.607 12.89 11 12 11.555 11.032 10.588 10.236 11.692 11.829 10.243 8.043 11 10 12.708 12.713 13.588 10.333 10.68 11.607 15.306 13.316 15 16 11.437 14.442 14.257 13.379 16.294 17.574 15.431 15.288 15 16 9.592 10.965 11.081 9.981 13.118 14.352 15.908 13.714 168 Somayeh Saboori et al. Table S7. Fst versus Pst values in cultivar No.3 with others. Character Pst Fst Pst Fst Pst Fst Pst Fst Fruit weight 0.053 0.16 0.43 0.16 0.36 0.16 0.053 0.16 Fruit width 0.001 0.16 0.09 0.16 0.09 0.16 0.001 0.16 Fruit length 0.99 0.16 0.46 0.16 0.01 0.16 0.99 0.16 Seed weight 0.99 0.16 0.44 0.16 0.98 0.16 0.98 0.16 Seed width 0.98 0.16 0.44 0.16 0.99 0.16 0.99 0.16 Seed length 0.99 0.16 0.44 0.16 0.98 0.16 0.99 0.16 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 74, Issue 3 - 2021 Firenze University Press Chromomycin A3 banding and chromosomal mapping of 45S and 5S ribosomal RNA genes in bottle gourd Ahmet L. Tek*, Hümeyra Yıldız, Kamran Khan, Bilge Ş. Yıldırım Development of a protocol for genetic transformation of Malus spp Federico Martinelli1,*, Anna Perrone2, Abhaya M. Dandekar3 Cytogenetic and cytological analysis of Colombian cape gooseberry genetic material for breeding purposes Viviana Franco-Florez, Sara Alejandra Liberato Guío, Erika Sánchez-Betancourt, Francy Liliana García-Arias, Víctor Manuel Núñez Zarantes* Palynological analysis of genus Geranium (Geraniaceae) and its systematic implications using scanning electron microscopy Jun Wang1,2,*, Qiang Ye1, Chu Wang2, Tong Zhang2, Xusheng Shi2, Majid Khayatnezhad3, Abdul Shakoor4,5 Influence of chronic alcoholic intoxication and lighting regime on karyometric and ploidometric parameters of hepatocytes of rats Yuri A. Kirillov1, Maria A. Kozlova1, Lyudmila A. Makartseva1, Igor A. Chernov2, Evgeniya V. Shtemplevskaya1, David A. Areshidze1,* The morphological, karyological and phylogenetic analyses of three Artemisia L. (Asteraceae) species that around the Van Lake in Turkey Pelin Yilmaz Sancar1,*, Semsettin Civelek1, Murat Kursat2 Molecular identification and genetic relationships among Alcea (Malvaceae) species by ISSR Markers: A high value medicinal plant Jinxin Cheng1,*, Dingyu Hu1, Yaran Liu2, Zetian Zhang1, Majid Khayatnezhad3 Genetic variations and interspesific relationships in Salvia (Lamiaceae) using SCoT molecular markers Songpo Liu1, Yuxuan Wang1, Yuwei Song1,*, Majid Khayatnezhad2, Amir Abbas Minaeifar3 Development of Female Gametophyte in Gladiolus italicus Miller (Iridaceae) Ciler Kartal1, Nuran Ekici2,*, Almina Kargacıoğlu1, Hazal Nurcan Ağırman1 Colchicine induced manifestation of abnormal male meiosis and 2n pollen in Trachyspermum ammi (L.) Sprague (Apiaceae) Harshita Dwivedi*, Girjesh Kumar Statistical evaluation of chromosomes of some Lathyrus L. taxa from Turkey Hasan Genç1, Bekir Yildirim2,*, Mikail Açar3, Tolga Çetin4 Use of chemical, fish micronuclei, and onion chromosome damage analysis, to assess the quality of urban wastewater treatment and water of the Kamniška Bistrica river (Slovenia) Peter Firbas1, Tomaž Amon2 The interacting effects of genetic variation in Geranium subg. Geranium (Geraniaceae) using scot molecular markers Bo Shi1,*, Majid Khayatnezhad2, Abdul Shakoor3,4 Genetic (SSRs) versus morphological differentiation of date palm cultivars: Fst versus Pst estimates Somayeh Saboori1, Masoud Sheidai2, Zahra Noormohammadi1,*, Seyed Samih Marashi3, Fahimeh Koohdar2 Further insights into chromosomal evolution of the genus Enyalius with karyotype description of Enyalius boulengeri Etheridge, 1969 (Squamata, Leiosauridae) Cynthia Aparecida Valiati Barreto1,*, Marco Antônio Peixoto1,2, Késsia Leite de Souza1, Natália Martins Travenzoli1, Renato Neves Feio3, Jorge Abdala Dergam1