Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 75(1): 165-171, 2022 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1411 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Kristen D. Felt, Makayla B. Lagerman, Samantha Maurer, Lu Qian, Oluwasefunmi Oluwafemi, Noe- mi Pedraza-Aguado, Emily L. Stowe, Leocadia V. Paliulis (2022) Segregation of the univalent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824). Caryologia 75(1): 165-171. doi: 10.36253/caryologia-1411 Received: September 22, 2021 Accepted: March 23, 2022 Published: July 6, 2022 Copyright: © 2022 Kristen D. Felt, Makay- la B. Lagerman, Samantha Maurer, Lu Qian, Oluwasefunmi Oluwafemi, Noe- mi Pedraza-Aguado, Emily L. Stowe, Leocadia V. Paliulis. This is an open access, peer-reviewed article pub- lished by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distri- bution, and reproduction in any medi- um, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. ORCID LVP: 0000-0002-8244-7548 Segregation of the univalent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824) Kristen D. Felt, Makayla B. Lagerman, Samantha Maurer, Lu Qian, Oluwasefunmi Oluwafemi, Noemi Pedraza-Aguado, Emily L. Stowe, Leocadia V. Paliulis* Biology Department, Bucknell University, Lewisburg, Pennsylvania, USA *Corresponding author. E-mail: le.paliulis@bucknell.edu Abstract. In metaphase I, autosomal bivalents align on the metaphase plate, while nat- urally-occurring univalent sex chromosomes can display a number of different behav- iours depending on cellular conditions. Here we describe the behaviour of the univa- lent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824). We confirm the chromosome number and sex determination method for this species, and that males possess a univalent X chromosome. We show that the univalent X chromo- some forms a bipolar attachment to the spindle in metaphase I, and then segregates intact toward one spindle pole in late anaphase I (long after autosomes have initiated poleward movement). Movement of the univalent toward one pole is associated with loss of microtubule connections toward the opposite spindle pole. Keywords: chromosomes, bivalent, univalent, X chromosome, meiosis, Auchenor- rhynca, Enchenopa latipes. INTRODUCTION The aim of meiosis is to divide the chromosome number of the cell by two, creating haploid gametes. Reduction of chromosome number requires the formation of bivalents. To form a bivalent, the DNA in each chromo- some is replicated. The replicated chromosomes pair, and are held together through sister-chromatid cohesion. After DNA replication, the homologues or partner sex chromosomes connect and undergo recombination, complet- ing construction of the bivalent (Moore and Orr-Weaver 1998). Sister kine- tochores are fused together in meiosis I and act as a single attachment site, allowing one half-bivalent to attach to microtubules coming from one spin- dle pole (a syntelic attachment), while the homologous half-bivalent associ- ates with the opposite pole (Moore and Orr-Weaver 1998). Fusion of sister kinetochores ensures that sister chromatids will not separate prematurely in anaphase I. In “typical” meiosis I, homologues are guaranteed to sepa- rate from one another because they are initially connected, and because sis- 166 Kristen D. Felt et al. ter kinetochores are fused together. Cells then undergo a second meiotic division, with the sister kinetochores now facing in opposite directions and associating with opposite spindle poles (an amphitelic attachment) in metaphase II, and separating sister chromatids in ana- phase II (Moore and Orr-Weaver 1998). Initial formation of a bivalent is, in general, required for successful crea- tion of four gametes, each with half of the chromosomes of the original parent. Correct chromosome distribution depends on hom- ologues linking with one another, but what if homo- logues fail to link? Or, what if there is no partner at all? A number of organisms have sex chromosomes that do not have a pairing partner for meiosis I, and thus remain univalent in the first meiotic division. While errors that create univalent autosomes lead to erratic chromosome behaviours for the univalent, such as frequent and rapid oscillations between spindle poles and a failure to align at the metaphase plate, naturally-occurring univalent sex chromosomes appear to have a set of characteristic, stable behaviours depending upon conditions in the cell (Fabig, et al. 2016; Rebollo et al. 1998; Nokkala 1986; Bressa et al. 2001; Rebollo and Arana 1995; Rebollo and Arana 1997; Ault 1984; Bauer et al. 1961; Dietz 1954; Dietz 1969; John 1990). In some cases, the univalent’s sister kinetochores are fused together in meiosis I just like those of the autosomal bivalents nearby (Fabig et al. 2016; Ault 1984). In such systems, the univalent can form an attachment to a single spindle pole early in mei- osis I and remain adjacent to that spindle pole through telophase I (Fabig et al. 2016). In other cases, the univa- lent has sister kinetochores facing in opposite directions. It aligns on the metaphase plate with the bivalents. In anaphase I, when the autosomal half bivalents separate from one another, the univalent remains at the center of the spindle, and following separation of the autosomes, the univalent moves intact to one spindle pole (Fabig et al. 2016). Still other behaviors have been observed in univalentsand are well described in Fabig et al. (2016). Univalent X chromosomes are frequently seen in insects of the order Hemiptera, suborder Auchenorrhyn- cha. In fact, these insects are some of the first species in which an X chromosome was observed and realized to exhibit different behaviours than the other chromo- somes in the cell. Very early work on one species in the suborder Auchenorrhyncha, the spittle bug Philaenus spumarius, described the X chromosome to be an “odd” chromosome that “lags behind the others but goes undi- vided to one pole” (Boring 1913). Here we report on our study of the behaviour of the univalent X chromosome in another member of the suborder Auchenorrhyncha, the treehopper, Enchenopa latipes (Say 1824). Halkka and Heinonen (1964) previ- ously reported the karyotype and sex determination mechanism for the species to be 2N=19 in males with X0 (male)-XX (female) sex determination, but did not make any statement on the behaviour of the univalent X chro- mosome during meiosis. We confirm the previously-pub- lished report on chromosome number and sex determi- nation mechanism, and use live-cell imaging and immu- nofluorescence staining to reveal that the X chromosome of E. latipes aligns with the autosomes in metaphase, forming an amphitelic attachment to the spindle. We also show that the X chromosome of E. latipes moves intact to one spindle pole after the autosomes have segregated, losing its connection to one spindle pole while retaining microtubule connections to the pole toward which it is moving. We also make conclusions about the conditions that lead to these characteristic behaviours. MATERIALS AND METHODS Collection and Identification Adult Enchenopa latipes males were collected from a field site at the Bucknell University Farm (Lewisburg, PA). Treehoppers were identified and sexed according to Dietrich et al. (2001) and Kopp and Yonke (1973). DNA Barcoding DNA barcoding was done as described in the Caro- lina Biological Supply Company Using DNA Barcodes to Identify and Classify Living Things kit (Carolina 211385). Cytochrome c oxidase subunit 1 was ampli- fied using the primers and PCR beads supplied by Carolina Biological Supply Company and sequenced at Genewiz using the M13forward and M13reverse prim- ers. Sequence was analyzed using Sequencher v5.4.6 and trimmed to approximately 640 bp. Alignments were pro- duced using ClustalOmega (https://www.ebi.ac.uk/Tools/ msa/clustalo/). Orcein Staining of Spread Chromosomes Orcein stained chromosome spreads were prepared as described in Felt et al. (2017). Living Cell Preparations Testes were removed from the abdomens of E. latipes males and transferred to a culture chamber (Lin 167Segregation of the univalent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824) et al. 2018) under a layer of Kel-F Oil #10 (Ohio Valley Specialty Company, Marietta, Ohio). Testes contents were spread thinly on a coverslip under oil, as described in Lin et al. (2018). Living meiosis I spermatocytes were imaged using a Zeiss inverted microscope equipped with a 100X 1.25 NA phase-contrast, oil-immersion objective and an Infinity 1 camera with Infinity Analyze software or a Nikon Eclipse TS100 microscope equipped with a 100X, 1.25 NA phase-contrast, oil-immersion objective and a Spot RT monochrome camera (Diagnostic Instru- ments Inc.) with Spot Basic 3.5.7 software. Immunofluorescence Fixation, immunostaining, and imaging of stained specimens were carried out as described in Felt et al. (2017). RESULTS DNA Barcoding To confirm the identification of the insect speci- mens, we performed DNA barcoding analysis on one KF919639.1 ATTTTATTTTTGGTATATGATCTGGAATATTAGGGATAATAATAAGAATTATTATTCGAA 60 HM416189.1 ATTTTATTTTTGGTATATGATCTGGAATATTAGGAATAATAATAAGAATTATTATTCGAA 60 MZ723494 ATTTTATTTTTGGTATATGATCTGGAATATTAGGGATAATAATAAGAATTATTATTCGAA 60 ********************************** ************************* KF919639.1 TTGAACTGAGTCAGCCGGGCCCTTTAATTCAAAATGACCAAATCTATAATACTGTAGTGA 120 HM416189.1 TTGAATTAAGTCAGCCGGGTCCTTTTATTCAAAATGACCAAATTTATAATACTGTAGTGA 120 MZ723494 TTGAATTAAGTCAACCGGGTCCTTTTATTCAAAATGACCAAATTTATAATACTGTAGTGA 120 ***** * ***** ***** ***** ***************** **************** KF919639.1 CTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGGGGATTTG 180 HM416189.1 CTTCACATGCATTTATCATAATTTTTTTTATAGTTATACCCATTATAATTGGGGGATTTG 180 MZ723494 CTTCACATGCATTTATCATAATTTTTTTTATAGTTATACCCATTATAATTGGGGGATTTG 180 **************** ******************************************* KF919639.1 GAAATTGATTAGTACCATTAATAGTTGGAGCACCAGATATAGCTTTTCCTCGTCTTAATA 240 HM416189.1 GAAATTGACTAGTACCATTAATAATTGGAGCCCCAGATATAGCTTTTCCTCGTCTTAATA 240 MZ723494 GAAATTGATTAGTACCATTAATAATTGGAGCCCCAGATATAGCTTTTCCTCGTCTTAATA 240 ******** ************** ******* **************************** KF919639.1 ATATAAGATTTTGATTATTACCTCCATCAATCTTATTACTTCTATCTAGATCAGTGGTAG 300 HM416189.1 ATATAAGATTTTGATTATTACCTCCATCAATCTTATTACTTTTATCTAGATCAATGGTAG 300 MZ723494 ATATAAGATTTTGATTATTACCTCCATCAATCTTATTACTTTTATCTAGATCAATGGTAG 300 ***************************************** *********** ****** KF919639.1 AATCAGGTGCAGGAACTGGATGAACAGTATACCCTCCTCTTTCTAGTAACATTGCTCATT 360 HM416189.1 AATCAGGTGCAGGTACTGGATGGACAGTATACCCCCCTCTTTCTAGTAATATTGCTCATT 360 MZ723494 AATCAGGTGCAGGTACTGGATGGACAGTATACCCCCCTCTTTCTAGTAATATTGCTCATT 360 ************* ******** *********** ************** ********** KF919639.1 CTGGGGCTAGAGTAGATTTAGCTATTTTTTCTCTGCATTTAGCTGGTATTTCATCAATTT 420 HM416189.1 CTGGGGCTAGAGTAGATTTAGCTATTTTTTCTCTGCATTTAGCTGGTATTTCATCAATTT 420 MZ723494 CTGGGGCTAGAGTAGATTTAGCTATTTTTTCTCTACATTTAGCTGGTATTTCATCAATTT 420 ********************************** ************************* KF919639.1 TAGGTGCAATTAATTTTATTACAACTATTATAAATATACGTTGTGATGAATTAAATATAG 480 HM416189.1 TAGGTGCAATTAATTTTATTACAACTATTATAAATATACGTTGTGATGAATTAAATATAG 480 MZ723494 TAGGTGCAATTAATTTTATCACAACTATTATAAATATACGTTGTAATGAATTAAATATAG 480 ******************* ************************ *************** KF919639.1 ATCGTCTTCCTTTATTTGTTTGGTCAGTAATAATCACAGCGGTTTTACTTTTATTGTCCC 540 HM416189.1 ATCGTCTTCCTTTATTTGTTTGGTCAGTAATAATCACAGCGGTTTTACTTTTATTATCCC 540 MZ723494 ATCGTCTTCCTTTATTTGTTTGGTCAGTAATAATCACAGCGGTTTTACTTTTATTATCCC 540 ******************************************************* **** KF919639.1 TTCCCGTTTTAGCTGGTGCTATCACTATATTATTAACCGATCGTAATATAAATACTTCTT 600 HM416189.1 TTCCCGTATTAGCTGGTGCTATTACTATATTATTAACCGATCGTAATATAAATACTTCTT 600 MZ723494 TTCCCGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACTTCTT 600 ******* ************** ************** ********************** KF919639.1 TCTTTGATCCTTCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTC 650 HM416189.1 TCTTTGATCCTTCTGGGGGAGGAGATCCCATTTTATACCAACATTTATTT 650 MZ723494 TCTTTGATCCTTCTGGGGGGGGAGACCCCATTTTATATCAACATTTATTT 650 **************** ** ***** ** ******** *********** Figure 1. ClustalOmega alignment of cytochrome oxidase 1 gene from Enchenopa latipes specimens. The top two sequences represent speci- mens with the closest identity to our specimen from two independent barcoding studies of E. latipes based on blastn analysis. Our specimen MZ723494 is 98.46% identical to sequence HM4161189.1 and 95.84% to sequence KF919639.1. 168 Kristen D. Felt et al. individual and submitted the sequence to Genbank. The sequence has accession number MZ723494. The par- tial Cox1 gene sequences were analysed using blastn and identified two sequences, one associated with KF919639, and a second associated with HM416189. The full sequence of MZ723494 was used in Clustal Omega (Madiera et al. 2019) to create the alignment (Figure 1). The MZ723494 isolate was 95.8% identical to the KF 919639 specimen and 98.5% identical to the HM416189 specimen (Figure 1). Karyotype Analysis Chromosome spreads from E. latipes were prepared and analysed to confirm chromosome number and sex determination mechanism. Spreads of testes contents from ten individuals were used to determine the chro- mosome number. E. latipes has a chromosome number of 2n=19 in males, with nine bivalents and one univalent X chromosome (Figure 2). Sex Determination and Sex Chromosome Behaviour Chromosome behaviour was observed in living metaphase I and anaphase I spermatocytes (Figure 3). In metaphase I, the univalent X chromosome aligned on the metaphase plate along with all of the autosomal bivalents (Figure 3; 0 min.). At anaphase I onset, the univalent X chromosome remained at the center of the spindle while the autosomes separated toward the spindle poles (Figure 3; 5, 15, 25 min.). By late anaphase I, the X chromosome moved to one side of the spindle, approaching the bulk of autosomal half bivalents (Figure 3; 45, 50 min.). Immunofluorescence staining revealed microtubules associated with the X chromosome from both spindle poles in metaphase I spermatocytes (Figure 4A). Micro- tubule connections were also observed on both sides of the univalent X chromosome in early anaphase I (Figure 4B). In late anaphase I spermatocytes, the X chromo- some had microtubules associated with one side of the univalent, but the other side had no apparent microtu- bule connections on the other side (Figure 4C and 4D). The X chromosome was located near the spindle pole with the microtubule connection in late anaphase I sper- matocytes (Figure 4C and 4D), and was positioned on one side of the cleavage furrow (Figure 4D). DISCUSSION Our results confirm the results of Halkka and Heinonen (1964), with a chromosome number of 2n=19 in males and an XX (female)-X0 (male) sex determina- tion mechanism. Our work also corroborates previous studies that reveal chromosome numbers between 2n = 18 and 2n = 22 for other species within the Membraci- dae family (of which E. latipes is a member), most of which have X0 (male)/XX (female) sex determination (Boring 1907; Halkka 1959; Halkka 1962; Tian and Yuan 1997; Bhattacharya and Manna 1973). As was previ- ously observed, all males in this study have a univalent X chromosome that does not have a pairing partner in meiosis I. The autosomes and the sex chromosomes of E. latipes all align on the metaphase plate in metaphase I (Figure 3; 0 min., Figure 4; metaphase). This demon- strates that the univalent X chromosome has a bipolar attachment to the spindle (reviewed in Fabig et al. 2016), that is confirmed through our immunofluorescence data (Figure 4A, 4B). Our observations of anaphase in living cells (Figure 3) and in fixed, stained specimens (Figure 4) revealed that segregation of the univalent X chromosome is delayed relative to the autosomes, and that movement of the X chromosome is associated with loss of microtubule connections to one spindle pole and retention of connections to the pole toward which the chromosome moves. Delayed or lagging segregation is frequently observed in cells that have bipolarly-attached univalent X chromosomes, including primary sper- matocytes of other hemipteran insects, and the primary Figure 2. Orcein-stained chromosome spread generated from mei- osis I spermatocyte of E. latipes. The spread shows 9 bivalents. X chromosome is indicated with arrow. Bar=5μm. 169Segregation of the univalent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824) spermatocytes in the male Caenorhabditis elegans (Fabig et al. 2020; Felt et al. 2017; Fabig et al. 2016; John and Claridge 1974; Rao 1956; Rebollo et al. 1998; Rebollo and Arana 1998). We have confirmed the previously-published chro- mosome number and sex-determination mechanism of the treehopper Enchenopa latipes (Halkka and Heinonen 1964). We have also shown that the univalent X chromo- some aligns at the spindle equator in metaphase I along- side the bivalent autosomes, and forms a bipolar attach- ment to the spindle. We finally show that the univalent X chromosome moves intact to one of the spindle poles in late anaphase, after all of the autosomes have initi- ated segregation, by losing microtubule connections to one spindle pole and retaining connections to the pole toward which is moving. Figure 3. Delayed segregation of the intact univalent X chromosome. The X chromosome aligns with the autosomes on the metaphase plate (0 min) and remains at the centre of the spindle after the autosomal half bivalents have initiated segregation to their associated spindle poles (5, 15, 25 min). In late anaphase, the X chromosome moves intact toward the upper spindle pole. Bar=5μm. 170 Kristen D. Felt et al. Hemipteran insects like E. latipes have holocentric chromosomes in mitosis (Halkka 1959; Melters et al. 2012; Kuznetsova and Aguin-Pombo 2015). Hemipterans of the suborder Auchenorryncha (like E. latipes) appear to restrict kinetic activity of each bivalent so that bivalents behave as if they have localized kinetochores (Halkka 1959; Kuznetsova and Aguin-Pombo 2015). This allows one set of sister chromatids to move to one spindle pole while the homologous set moves to the opposite spindle pole in a traditional (non-inverted) meiosis (Melters et al. 2012). In our previous examination of the behaviour of univalent X chromosomes, we have found that systems that have holocentric chromosomes in mitosis, a non- inverted meiosis, and a univalent X chromosome show the same pattern of X-chromosome segregation in male meiosis I as we have observed in E. latipes (Fabig et al. 2016; Felt et al. 2017). This univalent-segregating behav- iour is observed in different phyla of animals (Fabig et al. 2016; Felt et al. 2017; Fabig et al 2020), suggesting that the characteristics of the meiotic system, rather than phylog- eny, dictate univalent behaviour in meiosis. The question for the future will be to find the mechanistic underpin- nings for these characteristic chromosome behaviours. ACKNOWLEDGEMENTS We thank Art Forer for discussions essential to the completion of this work. FUNDING DETAILS KDF was funded by a Bucknell University Graduate Research Fellowship and a Robert P. Vidinghoff Memorial Summer Internship through the Bucknell University Biol- ogy Department. MBL and LQ were funded by the Nation- al Science Foundation (grant number NSF DUE-1317446). NP-A was funded by the Biology Department, Bucknell University. OO was funded through a STEM Scholars Grant, Bucknell University. ELS was funded by the Biol- ogy Department, Bucknell University. LVP was funded by research funds awarded through Bucknell University. REFERENCES Ault JG. 1984. Unipolar orientation stability of the sex univalent in the grasshopper (Melanoplus sanguin- ipes). Chromosoma. 89:201-205. Bauer H, Dietz R, and Röbbelen C. 1961. Die spermato- cytenteilungen der tipuliden. III. das bewegungsverh- alten der chromsomen in translokationheterozygoten von Tipula oleracea. Chromosoma. 12:116-189. Bhattacharya AK, Manna GK. 1973. Morphology, behav- iour, and metrical studies of the germinal chromo- somes of ten species of Membracidae (Homoptera). Cytologia. 38:657-665. Boring AM. 1907. A study of the spermatogenesis in twenty-two species of the Membracidae, Jassidae, Figure 4. Segregation of the X chromosome in anaphase I E. latipes spermatocytes results from reduction and subsequent loss of micro- tubule connections on one side of the univalent. Immunofluorescence staining of microtubules (green) and DAPI staining (purple) of E. latipes spermatocytes in metaphase I (A), early anaphase I (B), and late anaphase/telophase I (C, D). In metaphase I, the X chromosome aligns on the metaphase plate, with microtubules connecting the univalent to both spindle poles. In early anaphase, the half bivalents move toward their associated poles while the X univalent remains at the centre of the spindle. It retains microtubule connections to both poles in early anaphase I (B). In late anaphase/telophase I (C, D), the X univalent only has microtubule connections to the spindle pole to which it is closest. Bar=5 μm. 171Segregation of the univalent X chromosome in the wide-footed treehopper Enchenopa latipes (Say 1824) Cercopidae, and Fulgoridae [dissertation]. Bryn Mawr (PA): Bryn Mawr College. Boring AM. 1913. The chromosomes of the Cercopidae. Biol. Bull. 24:133-146. Bressa MJ, Papeschi AG, Mola L, Larramendy M L. 2001. Autosomal univalents as a common meiotic feature in Jadera haematoloma (Herrich-Schaeffer, 1847) and Jadera sanguinolenta (Fabricius, 1775) (Heter- optera: Rhopalidae: Serinethinae). Eur. Jour. Ent. 98:151-157. Dietrich C H, McKamey S H, Deitz LL. 2001. Mor- phology-based phylogeny of the treehopper family Membracidae (Hemiptera: Cicadomorpha: Membra- coidea). Systematic Entomology 26:213-239. Dietz R. 1954. Multiple geschlechtschromosomen bei dem ostracoden Notodromas monacha. Chromo- soma. 6:397-418. Dietz R. 1969. Bau und funktion des spindelapparats. Naturwissenschaften, 56:237-248. Fabig G, Kiewisz R, Lindow N, Powers JA, Cota V, Quin- tanilla LJ, et al. 2020. Male meiotic spindle features that efficiently segregate paired and lagging chromo- somes. eLife. 10:9:e50988. Felt KD, Lagerman M, Ravida N, Qian L, Powers S, Paliulis LV. 2017. Segregation of the amphitelically- attached univalent X chromosome in the spittlebug Philaenus spumarius. Protoplasma. 254:2263-2271. Fabig G, Müller-Reichert T, Paliulis LV. 2016. Back to the roots: Segregation of univalent sex chromosomes in meiosis. Chromosoma. 125:277-286. Halkka O. 1959. Chromosome studies on the Hemiptera Homoptera Auchenorrhyncha. Ann. Acad. Sci. Fenn. A. IV. 43:1-72. Halkka O. 1962. The chromosomes of the Membracidae. Hereditas. 48:215-219. Halkka O, Heinonen L. 1964. The chromosomes of 17 nearctic homoptera. Hereditas. 52:77-80. John B. 1990. Meiosis. Cambridge (UK): Cambridge Uni- versity Press. John B, Claridge MF. 1974. Chromosome variation in British populations of Oncopsis (Hemiptera: Cicadel- lidae). Chromosoma. 46:77-89. Kopp DD, Yonke TR. 1973. The treehoppers of Missouri: Part 1. Subfamilies Centrotinae, Hoplophorioninae, and Membracinae (Homoptera: Membracidae). Jour- nal of the Kansas Entomological Society. 46:42-64. Kuznetsova V, Aguin-Pombo D. 2015. Comparative cytogenetics of Auchenorrhyncha (Hemiptera, Hom- optera): a review. Zookeys. 19:63-93. Lin K, Nance R, Szybist J, Cheville A, Paliulis LV. 2018. Micromanipulation of insect spermatocytes. Journal of Visualized Experiments. 140:57359. Madeira F, Park YM, Lee J, Buso N, Gur T, Madhu- soodanan N, Basutkar P, Tivey ARN, Potter SC, Finn RD, Lopez R. 2019. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 47:W636-W641. Melters DP, Paliulis LV, Korf IF, Chan SWL. 2012. Holo- centric chromosomes: Convergent evolution, meiotic adaptations, and genomic analysis. Chromosome Res. 20:579-593. Moore DP, Orr-Weaver TL. 1998. Chromosome segrega- tion during meiosis: building an unambivalent biva- lent. Curr Top Dev Biol. 37:263–299. Nokkala S. 1986. The mechanisms behind the regular segregation of autosomal univalents in Calocoris quadripunctatus (vil.) (Miridae, Hemiptera). Heredi- tas. 105:199-204. Rao SRV. 1956. Studies on the spermatogenesis of some Indian Homoptera Part III: A study of chromosomes in two members of the family Membracidae. Caryo- logia, 8:309-315. Rebollo E, Arana P. 1995. A comparative study of orien- tation at behavior of univalent in living grasshopper spermatocytes. Chromosoma. 104:56-67. Rebollo E, Martín S, Manzanero S, Arana P. 1998. Chro- mosomal strategies for adaptation to univalency. Chromosome Res. 6:515-531. Rebollo E, Arana P. 1997. Univalent orientation in living meiocytes. Chromosomes Today. 12:249-269. Rebollo E, Arana P. 1998. Chromosomal factors affect- ing the transmission of univalents. Chromosome Res. 6:67-69. Tian R, Yuan F. 1997. Chromosomes in twenty-five spe- cies of Chinese Membracids (Homoptera: Membraci- dae). Insect Science. 4:150-158.