Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 75(2): 119-127, 2022 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1540 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Qin Zhao, Zitong Guo, Minx- ing Gao, Wenbo Wang, Lingling Dou, Sahar H. Rashid (2022) Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Ret- rotransposon-Based Markers. Caryolo- gia 75(2): 119-127. doi: 10.36253/caryo- logia-1540 Received: January 17, 2022 Accepted: July 06, 2022 Published: September 21, 2022 Copyright: © 2022 Qin Zhao, Zitong Guo, Minxing Gao, Wenbo Wang, Lingling Dou, Sahar H. Rashid. This is an open access, peer-reviewed article published by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distri- bution, and reproduction in any medi- um, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Evaluation of genetic diversity and Gene- Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers Qin Zhao1,*, Zitong Guo1, Minxing Gao1, Wenbo Wang1, Lingling Dou1, Sahar H. Rashid2 1.School of Chemistry and Chemical Engineering, Xianyang Normal University, Xianyang 712000, Shaanxi, China 2.Technical College of Applied Science, Sulaimani Polytechnic University, Iraq *Corresponding author. E-mail: zhaoqin2018@aliyun.com Abstract. Pistachio genetic variety includes a wide range of female variations and male genotypes, and Iran is regarded as one of the critical sites for this diversity in the world. The genus Pistacia consists of eleven species that only have edible nuts and are commercially important. Four important species of pistachios include Pista- cia vera, P. khinjuk Stocks, P. eurycarpa Yalt. (P. atlantica subsp. Kurdica Zoh.), and P. atlantica Dsef are found in Iran. Genetic diversity is one aspect of biological diversity that is extremely important for conservation strategies, especially in rare and narrowly endemic species. In Iran, there is no knowledge concerning the genomic organization of the population, genetic diversity, or phenotypic variations of the species. Pistacia khinjuk has eight distinct regional populations, all of which were studied for genetic variation and demographic organization because of the species’ therapeutic value. For this reason, we employed six inter-retrotransposon amplified polymorphism (IRAP) indicators and 15 mixed IRAP indicators to highlight genomic variation in this plant both within and across populations in this study. It was discovered that 73% of overall genomic variability was related to within-population variety and 27% was attributable to inter-population genomic divergence using the AMOVA test among the examined populations (PhiPT = 0.49, P = 0.010). It was discovered by the Mantel analysis that there was a substantial positive association between genomic isolation and geographic distance among the tested populations. STRUCTURE analyses and population assign- ment tests revealed some degree of gene flow among these populations. There was consistency between the MDS plots of communities and the NJ grouping of molecu- lar information. Based on (IRAP) indicators, these findings demonstrated that regional communities of the plant Pistacia khinjuk are well distinct. Keywords: gene flow, IRAP, Pistacia khinjuk, population differentiation. INTRODUCTION According to current estimates, the Pistacia genus has at least twelve species and has existed for around eighty million years (Karimi et al. 2009). Pistacia vera is the sole commercially viable species throughout this genus 120 Qin Zhao et al. (Fares et al. 2009). According to previous theories, the Pistacia genus originated in Europe and North Africa, but recent research suggests that it probably originated in Central Asia. Pistacia species have been reported to have spread over the world, based on initial research. One theory concentrates on the Mediterranean region of Europe, Northern Africa, and the Middle East. The eastern portion of the Zagros Mountains (Iran) and the Caucasus regions stretching from Crimea to the Caspian Sea are further options (Zohary 1952). Four important species of pistachios include P. vera, P. khinjuk Stocks, P. eurycarpa Yalt. (P. atlantica subsp. Kurdica Zoh.), and P. atlantica Dsef are found in Iran (Karimi et al. 2009). Pistacia vera, P. khinjuk, and P. atlantica are three of the most important wild Pistacia species that thrive in Iran. In Central Asia, which includes Turkmenistan, Afghani- stan, and Northeast Iran, wild P. vera has grown in an area of approximately 75,000 hectares. In the Sarakhs region, P. vera grows in an area of approximately 17,500 hectares (Behboodi 2003). With the biggest area under cultivation, Iran is the world’s leading pistachio export- er, although recent years have seen poor yields relative to other nations, notably the United States and Turkey (Ahmad et al. 2003a). Pistachio plants are long-living with a juvenile peri- od of approximately 5–10 years. In addition, wild Pista- cia species have edible seeds. They are used as rootstock seed sources for cultivated P. vera, and sometimes, fruit consumption, oil extraction, soap production, and as forest trees (Katsiotis et al. 2003). Pistacia genetic diversity has been the subject of several investigations that have been conducted on the basis of examination of morphological, physiologi- cal, and metabolic properties (Tayefeh Aliakbarkhany et al. 2013). A number of these methods have been employed to characterize pistachio cultivars across time, with RAPD (Williams et al., 1990) being the most extensively utilized (Kafkas et al., 2002; Kat- siotis et al., 2003). To examine the evolutionary con- nection between Pistacia species and cultivars, AFLP and SSR approaches have also been utilized on pis- tachio (Katsiotis et al., 2003; Ibrahim Basha et al., 2007; Ahmad et al., 2003; Ahmad et al., 2005; Ahma- di Afzadi et al., 2007). Pistachio pollination difficul- ties may be solved by identifying the genetic variety of male cultivars and genotypes in Iran because there is not enough data surrounding their genetic charac- teristics (Ahmad et al., 2005). Most of the taxonomic and nomenclatural ambiguity in European species has been cleared up thanks to the later research. To examine the genetic diversity and connections among Pistacia khinjuk cultivars and landraces, random- ly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), inter simple sequence repeat (ISSR), simple sequence repeat (SSR), and inter-retrotransposon amplified polymorphism (IRAP) were some molecular marker techniques employed during recent years. There is also the potential that this species might have infra-specific taxonomic variants owing to the wide range of morphological variation throughout the nation. As a result, we conducted the first-ever nation- wide demographic genetic evaluation and morpho- metric examination of eight distinct regional groups. Through amplifying the segments of DNA between two retrotransposons for genomic analysis, we employed the inter-retrotransposon amplified polymorphism (IRAP) approach to detect insertional polymorphisms. It has been employed in various investigations on genomic variation (Smykal et al., 2011). The objectives of this research were to study genetic diversity among Pistacia khinjuk cultivars/populations with a different geographical origin by inter-retrotransposon amplified polymorphism (IRAP) method to determine genetic variation among and within materials using IRAP markers. MATERIALS AND METHODS Plant materials During the months of July and August of 2019-2020, a number of 40 participants from eight natural commu- nities of Pistacia khinjuk were collected in the Iranian provinces of Fars, Kerman, Sistan and Baluchestan, and Hormozgan (Table 1). Fresh leaves of 3-6 individuals from each population were collected and immediately dried in Silica Gel (Table 1). The accurate recognition of species was achieved through the utilization of numer- ous sources (Pistacia khinjuk) (Kafkas et al., 2002; Katsi- otis et al., 2003). Table 1 list the locations where samples were taken. DNA extraction and IRAP examination Three to six plants from each group were randomly selected to collect fresh leaves. The silica gel powder was used to dry them. Genomic DNA was extracted using a CTAB stimulated charcoal technique (Esfandani-Bozch- aloyi et al., 2019). By passing the isolated DNA across a 0.8% agarose gel, the purity of the DNA was determined. The IRAP assessment was conducted using a collection of six outward-facing LTR primers (Smykal et al., 2011; 121Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers Table 2). Outward-facing LTR paired primers were addi- tionally utilized in 15 distinct mixtures. PCR reactions were carried in a 25μl volume containing 10 mM Tris- HCl buffer at pH 8; 50 mM KCl; 1.5 mM MgCl2; 0.2 mM of each dNTP (Bioron, Germany); 0.2 μM of a sin- gle primer; 20 ng genomic DNA and 3 U of Taq DNA polymerase (Bioron, Germany). An initial denaturation during 1 minute at 94°C was continued by 40 rounds divided into three sections, including  35 s at 95°C, the 40s at 47°C, and the 55s at 72°C, which comprised the thermal schedule. The final extension was performed at 72°C for 5 min. In order to see the amplification results, the gels were first to run on a 1 percent agarose solution and then stained with ethidium bromide. A molecular size ladder with a step size of 100 bp was used to deter- mine the fragment size (Fermentas, Germany). Data analyses The IRAP profiles obtained for each samples were scored as binary characters. For grouping of the plant specimens, Ordination methods such as MDS (Multidi- mensional scaling) analysis were also performed (Podani 2000). Multivariate and all the necessary calculations were done in the PAST software, 2.17 (Hammer et al. 2012). Parameter like Nei’s gene diversity (H), Shannon information index (I), number of effective alleles, and percentage of polymorphism were determined (Freeland et al., 2011). Nei’s genetic distance among populations was used for Neighbor Joining (NJ) clustering and Neighbor-Net networking (Freeland et al., 2011). Mantel test checked the correlation between geographical and genetic dis- tance of the studied populations (Podani, 2000). These analyses were done by PAST ver. 2.17 (Hammer et al., 2012), DARwin ver. 5 (2012) and SplitsTree4 V4.13.1 (2013) software. AMOVA (Analysis of molecular variance) test (with 1000 permutations) as implemented in GenAlex 6.4 (Peakall and Smouse, 2006), and Nei,s Gst analysis as implemented in GenoDive ver.2 (2013) were used to show genetic difference of the populations. Moreover, populations, genetic differentiation was studied by G’ST est = standardized measure of genetic differentiation, and D_est = Jost measure of differentiation. The genetic structure of populations was stud- ied by Bayesian based model STRUCTURE analysis (Pritchard et al. 2000), and maximum likelihood- based method of K-Means clustering of GenoDive ver. 2. (2013). For STRUCTURE analysis, data were scored as dominant markers (Falush et al. 2007). The Evanno test was performed on STRUCTURE result to deter- mine proper number of K by using delta K value. In K-Means clustering, two summary statistics, pseudo-F, and Bayesian Information Criterion (BIC), provide the best fit for k. Gene flow was determined by (i) Calculating Nm an estimate of gene flow from Gst by PopGene ver. 1.32 (1997) as: Nm = 0.5(1 - Gst)/Gst. This approach consid- ers equal amount of gene flow among all populations. (ii) Population assignment test based on maximum like- lihood as performed in Genodive ver. in GenoDive ver. 2. (2013). The presence of shared alleles was determined by drawing the reticulogram network based on the least square method by DARwin ver 5. (2012). RESULTS Genetic variation across communities. Table 3 displays the genetic variation characteristics of Pistacia khinjuk collected from eight different geo- graphic locations. Fars, Shiraz (population No. 1) exhib- ited the largest polymorphism  percentage  (53.75 per- cent) and the maximum scores for gene variation (0.39) and Shanon data indicator  (0.40). Hormozgan, Bandar Abbas, and Genow (No.6) populations had the mini- mum polymorphism rate (17.15%) and the minimum values for Shanon, data score (0.15), and He (0.18). Table 1. Populations studied their locality and ecological features. Pop.no Locality 1 Fars, Shiraz 2 Fars, 60 km south of Shiraz at the vicinity to Shiraz-Bushehr 3 Fars, Arjan Lake 4 Hormozgan, Bandar Lengeh 5 Hormozgan, Bandar Abbas 6 Hormozgan, Bandar Abbas, Genow 7 Kerman, Hamun-e Jaz Murian 8 Sistan and Baluchestan, Iranshahr Table 2. IRAP primers based on SMYKAL et al. (2011) study. IRAP Sequence (5´-3´) GU735096 ACCCCTTGAGCTAACTTTTGGGGTAAG GU980589 AGCCTGAAAGTGTTGGGTTGTCG GU929878 GCATCAGCCTGGACCAGTCCTCGTCC GU735096 CACTTCAAATTTTGGCAGCAGCGGATC GU929877 TCGAGGTACACCTCGACTCAGG GU980590 ATTCTCGTCCGCTGCGCCCCTACA 122 Qin Zhao et al. Population genetic differentiation AMOVA (PhiPT = 0.49, P = 0.010), and Gst analysis (0.844, p = 0.001) revealed significant difference among the studied populations (Table 4). Within-population variation accounted for 27% of overall genomic varia- tion, whereas among-population genomic divergence accounted for 73% of variations. There were substan- tial variations in the communities analyzed using pair- wise AMOVA analysis. Moreover, we got high values for Hedrick standardized fixation index after 999 per- mutation (G’st = 0.844, P = 0.001) and Jost, differentia- tion index (D-est = 0.116, P = 0.001). Pistacia khinjuk has been shown to be genetically distinct across its geo- graphical communities, according to these findings. Populations, genetic affinity There were different clusters of plants from each population in the NJ tree. No transitional stages were found throughout the samples that we examined. These results showed that IRAP data could differentiate the populations of Pistacia khinjuk in three different major clusters or groups (Figure 1). The first significant cluster supported with significant bootstrapping values of 94% so that plants of Fars, Shiraz (No.1) comprised the first cluster due to morphological similarity. In contrast, the plants of Hormozgan, Bandar Abbas pop 5 (B=94%), formed the second cluster and finally, the population 2 (Fars, 60 km south of Shiraz at the vicinity to Shiraz- Bushehr) with 97% of support. While plants of Hormoz- gan, Bandar Lengeh (pop 4), Hormozgan, Bandar Abbas, Genow (pop6), Kerman, Hamun-e Jaz Murian (pop7), Sistan and Baluchestan, Iranshahr (Pop 8) showed genet- ic affinity and intermixture. Genetic divergence and separation of populations Fars, 60 km South of Shiraz at the vicinity to Shiraz- Bushehr (No.2) as well as Hormozgan, Bandar Abbas (No.5) and Hormozgan, Bandar Abbas, Genow (No.6) from the other communities is obvious in MDS design of IRAP information following 900 permutations (Fig- ure.2). The other groups were genetically related to each Table 3. Genetic diversity parameters in the studied populations Pistacia khinjuk (N = number of samples, Na= number of different alleles; Ne = number of effective alleles, I= Shannon’s information index, He = gene diversity, UHe = unbiased gene diversity, P%= percentage of polymorphism, populations). Pop N Na Ne I He UHe %P Pop1 5 0.241 1.158 0.40 0.36 0.39 53.75% Pop2 6 0.355 1.077 0.377 0.34 0.32 35.05% Pop3 4 0.449 1.167 0.24 0.23 0.24 19.26% Pop4 4 0.535 1.020 0.22 0.25 0.28 43.13% Pop5 4 0.231 1.088 0.30 0.22 0.25 31.63% Pop6 3 0.355 1.121 0.15 0.18 0.12 17.15% Pop7 6 0.538 1.091 0.207 0.23 0.280 23.93% Pop8 5 0.291 1.333 0.231 0.333 0.167 21.59% Table 4. Analysis of molecular variance (AMOVA) of the studied species. Source df SS MS Est. Var. % ΦPT Among Pops 55 116.596 22.329 17.077 73% 73% Within Pops 14 33.757 29.580 33.590 27% Total 69 150.342 51.773 100% df: degree of freedom; SS: sum of squared observations; MS: mean of squared observations; EV: estimated variance; ΦPT: proportion of the total genetic variance among individuals within an accession, (P < 0.001). Figure 1. NJ tree of populations in Pistacia khinjuk based on IRAP data. Bootstrap value from1000 replicates are indicated above branches (Population numbers are according to Table 1). 123Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers other. A substantial association between genetic isolation and geographic separation was found in these communi- ties after a Mantel analysis with 5000 permutations (r = 0.55, P = 0.001). We possess isolation by distance (IBD) in the Pistacia khinjuk species because communities that are spatially separated exhibit less genetic exchange. Populations genetic structure There are three genetic subgroups present when K = 3. When the Evanno examination was run on the STRUCTURE evaluation, it yielded a comparable out- come, with a large peak appearing at k=3. Both studies found genetic differentiation in Pistacia khinjuk groups. STRUCTURE plot based on k = 3 revealed a genetic difference of populations 1-3 (differently colored), as well as 4-6 (Figure.3). But it showed genetic affinity between populations 7, 8 (similarly colored). The mean Nm = 0.29 was obtained for all IRAP loci, which indicates a low amount of gene flow among the populations and sup- ports genetic stratification as indicated by K-Means and STRUCTURE analyses. It was also found that there was no substantial genetic exchange between these groups when the demographic allocation experiment was per- formed. It was found that populations 1 and 5, as well as populations 3 and 6, also 2 and 5  shared certain alleles, according to a reticulogram created using the least square approach (Figure not shown). Due to the proximity of both communities, our MDS map resulted in the same classification. Genetic differentiation among Pistacia khinjuk communities is clearly evident from the STRUCTURE plot, which shows that the common Figure 2. MDS plot of populations in Pistacia khinjuk based on IRAP data. (Population numbers are according to Table 1). Figure 3. STRUCTURE plot of Pistacia khinjuk populations based on k = 3 of IRAP data. (Population numbers are according to Table 1). 124 Qin Zhao et al. genetic alleles throughout these communities represent only a small percentage of the genomes. It was possible to collect 75 IRAP bands totally; 15 of them were con- sidered exclusive. Two to four unique bands were found in communities 3 and 6, and 8. DISCUSSION Genetic and breeding investigations benefit greatly from population genetics analysis. Data on the degrees of genomic diversity, genetic diversity distribution with- in and across communities, inbreeding and outcrossing, the efficient community size and bottleneck are  pre- sented by these studies (Ellis and Burke, 2007). Demo- graphic genomic research has significantly advanced with the introduction of molecular biomarkers. Among the various Pistacia accessions, such indicators have been utilized to detect possibly unique genotypes (Mar- tin et al.,1997). To examine the genetic diversity and connections among Pistacia khinjuk cultivars and lan- draces, randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), inter simple sequence repeat (ISSR), simple sequence repeat (SSR), and inter-retrotransposon amplified polymor- phism (IRAP) were some molecular marker techniques employed during recent years (Wiesnerova and Wiesner, 2004; ren and khayatnezhad 2021; khayatnezhad and Nasehi 2021, i et al., 2021; jia et al, 2021). The majority of plant genomes are made up of transposable elements, especially retrotransposons. Genomic variety is generated through their replication,  rendering  them an ideal repository of molecular indicators (Smykal et al., 2011; GHOLAMIN and KHAYATNEZHAD, 2020a; 2020b, 2020c). Through replicating the sections of DNA between two retrotransposons, the inter-retrotransposon amplified polymorphism (IRAP) approach reveals inser- tional polymorphisms. Several genomic investigations have relied on this technique (Smykal et al., 2011). Iranian Pistacia khinjuk’s genomic variation was evaluated during this research in order to help in the preservation of its germplasm. In order to formu- late suitable conservation approaches, the data gath- ered on genetic diversity between and within various groups will be used to establish a solid foundation for future research. Iranian Pistacia khinjuk is very diverse, according to the results of the current study, which is likely owing to differences in genetic backgrounds across different geographical areas, breeding pressure, and/ or restricted exchange of genomic information. Our findings demonstrate the distinct character of the Ira- nian Pistacia khinjuk germplasm, hence bolstering the rationale for deploying more intensive characterization, preservation, and reproduction techniques. It was pos- sible to determine the genomic variation of the Iranian population employing  IRAP indicators. The results of this molecular assay in fingerprinting the 8 Pistacia khinjuk population are presented in Table 3. A total of 75 bands were amplified by the six primers, an average of 8 bands per primer, of which 62 (84%) were poly- morphic. The total number of amplified fragments was between 6 to 10, and the number of polymorphic frag- ments ranged from 5 to 9. NJ clustering and MDS plot (Figs 1–2), of the studied populations did not entirely delimit the studied populations and revealed that some plants in these populations are intermixed. In MDS plot, a higher degree of intermixture occurred between popu- lations of 7, 8 and seem to be an area that populations of 1,4 and 7, 8 together with the gene exchange (Fig. 2). These results indicate that the geographical populations of Pistacia khinjuk are not genetically differentiated from each other. Evanno test performed on STRUCTURE analysis produced the best number of k = 3. This genetic grouping is in agreement with NJ clustering result pre- sented before. Throughout the semi-arid and dry farming areas of Iran, pistachio has significant socioeconomic and environmental implications (Kafkas et al., 2006). More than 300 pistachio genotypes have been identified in Iran, which is home to a diverse range of Pistacia spe- cies. Pistachio development and preservation efforts may thus benefit from Iran’s Pistachio germplasm. It is con- sequently vital to evaluate genomic variation and inter- actions among cultivars of Iranian Pistachio employing discriminative and reliable indicators. Genetic diversity is of fundamental importance to the survival of a species (Sun and Khayatnezhad 2021; Tao et al, 2021; Wang et al, 2021; Xu et al., 2021; Yin et al., 2021; Zhang et al, 2021). There were three primers ultimately chosen for fur- ther testing out of the original six employed during ISSR following initial screening (Kafkas et al., 2006; Zheng, et al., 2021; Zhu et al, 2021), in accordance with the stated findings. The three primers replicated a maximum of 28 bands, with each primer amplifying an average of 9.3 bands among 13 types (or 46 percent), which were poly- morphic. Approximately seven to 12 pieces of DNA were replicated, and three to five segments of DNA were poly- morphic. Between 22 Iranian cultivars and wild Pistachio varieties, Mirzaei et al. (2005) found 80% polymor- phism. Because of the changes in genotypes and primers between the present research and the previous study, it is possible that variations  in polymorphism are observed. 125Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers 82.41%% polymorphism was discovered by Katsiotis and colleagues (2003);  there were 18.2 polymorphic bands out of a total number of 22.11. In a study reported by Golan-Goldhirsh et al. (2004) in assessing polymor- phisms among 28 Mediterranean Pistacia accessions, twenty-seven selected primers produced 259 total bands (average 9.59), and 86.1 of them were polymorphic. The genotypes investigated by Khadivi (2018) showed a significant degree of polymorphism. 18 alleles were produced by seven SSR primer pairs, thirteen among them were polymorphic across the genotypes. Averag- ing 2.57, the polymorphic alleles ranged from one for Ptms9, Ptms40, Ptms41, and Ptms42 loci to five for the Ptms7 locus. Allele lengths ranging from 120 to 250 bp were replicated. The coefficients of genomic homology between two individuals ranged from 0.20 to 0.75. To summarize, it can be concluded that one of two signifi- cant hubs of Pistacia variety is Iran. Genomic variation among several Pistacia khinjuk communities employ- ing IRAP indicators was studied during the current research,  offering  useful data in the effort to conserve the species’ germplasm. Because Iranian Pistacia khin- juk possesses limited genetic variety, its preservation and prospective reproduction initiatives are very vital. Preserving, core collecting, and reproducing the Pistacia khinjuk will be made easier thanks to the outcomes of this research. ACKNOWLEDGEMENTS The National Natural Science Foundation of China (31872175);Special scientific Research Project of Educa- tion Department of Shaanxi Province (21JK0965); Key R & D program of Shaanxi Province (2019NY-103). REFERENCES Ahmad R, Ferguson L, Southwick SM (2003a) Identifica- tion of pistachio (Pistacia vera L.) nuts with micros- atellite markers. J Am Soc Hortic Sci 128:898–903 Ahmad R, Struss D, Southwick SM (2003b) Development and characterization of microsatellite markers in cit- rus. J Am SocHorticSci 128:584–590 Ahmad, R., Fergusen, L. and Southwick, S.M (2005). Molecular marker analysis of pistachio rootstocks by simple sequence sepeats and sequence-selated Ampli- fied solymorphisms. Journal of Horticultural Science and Biotechnology, 80, 382-386. Ahmadi Afzadi M, SeyedTabatabaei BE, Mohammadi SA, Tajabadipur A (2007) Comparison of genetic diver- sity in species and cultivars of pistachio (Pistacia vera L.) based on amplified fragment length polymor- phism marker. Iran J Biotechnol 5:147–152 Behboodi B (2003) Ecological distribution study of wild pistachios for selection of rootstock. Options Medi- terr Ser A 63:61–67 Bi, D., C. Dan, M. Khayatnezhad, Z. Sayyah Hashjin, Z. Y. Ma (2021): Molecular Identification And Genetic Diversity In Hypericum L.: A High Value Medicinal Plant Using Rapd Markers Markers. Genetika 53(1): 393-405. Cheng, X., X. Hong, M. Khayatnezhad, F. Ullah (2021): Genetic diversity and comparative study of genomic DNA extraction protocols in Tamarix L. species.” Caryologia 74(2): 131-139. Esfandani Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2017a): Genetic Diversity and Morphological Variability in Geranium Purpureum Vill. (Geraniaceae) of Iran. Genetika, 49: 543-557. Esfandani Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2017b): Species Delimitation In Geranium Sect. Batrachioidea: Morphological and Molecular. Act. Bot. Hung., 59(3–4):319–334. Esfandani Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2017c): Genetic and morphologi- cal diversity in Geranium dissectum (Sec. Dissecta, Geraniaceae) populations. Biologia, 72(10): 1121- 1130. Esfandani Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2017d): Analysis of genetic diver- sity in Geranium robertianum by ISSR markers. Phy- tologia Balcanica, 23(2):157–166. Esfandani-Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2018a): Species Relationship and Population Structure Analysis In Geranium Subg. Robertium (Picard) Rouy With The Use of ISSR Molecular Markers. Act. Bot. Hung., 60(1–2): 47–65. Esfandani-Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2018b): Species Identification and Population Structure Analysis In Geranium Subg. Geranium (Geraniaceae) . Hacquetia, 17/2: 235–246. Esfandani–Bozchaloyi, S., M., Sheidai, M., Keshavarzi, Z., Noormohammadi (2018c): Morphometric and ISSR- analysis of local populations of Geranium molle L. from the southern coast of the Caspian Sea. Cytology and genetics, 52, No. 4: 309–321. Esfandani-Bozchaloyi, S., M., Sheidai (2018d): Molecu- lar diversity and genetic relationships among Gera- nium pusillum and G. pyrenaicum with inter simple sequence repeat (ISSR) regions, Caryologia, vol. 71, No. 4: 1-14. 126 Qin Zhao et al. Esfandani-Bozchaloyi, S., M., Sheidai (2019): Comparison of DNA Extraction Methods from Geranium (Gera- niaceae). Acta Botanica Hungarica, 61(3–4): 251–266. Freeland, Jr., H., Kirk, S.D., Peterson (2011): Molecular Ecology, 2nd Ed. Wiley-Blackwell, Chichester, 464 pp. Fares, K.; Guasmi, F.; Touil, L.; Triki, T.; Ferchichi, A. Genetic Diversity of Pistachio Tree using Inter-Sim- ple Sequence Repeat Markers ISSR Supported by Morphological and Chemical Markers. Biotechnology 2009, 8, 24–34. Gholamin, R. M. Khayatnezhad (2020a): Assessment of the Correlation between Chlorophyll Content and Drought Resistance in Corn Cultivars (Zea Mays). Helix 10(05): 93-97. Gholamin, R. M. Khayatnezhad (2020b): The effect of dry season stretch on Chlorophyll Content and RWC of Wheat Genotypes (Triticum Durum L.). Bioscience Biotechnology Research Communications 13(4): 1833-1829. Gholamin, R. M. Khayatnezhad (2020c): Study of Bread Wheat Genotype Physiological and Biochemical Responses to Drought Stress. Helix 10(05): 87-92. Guo, L.-N., C. She, D.-B. Kong, S.-L. Yan, Y.-P. Xu, M. Khayatnezhad F. Gholinia (2020). Prediction of the effects of climate change on hydroelectric generation, electricity demand, and emissions of greenhouse gases under climatic scenarios and optimized ANN model. Energy Reports 7: 5431-5445. Hou, R., S. Li, M. Wu, G. Ren, W. Gao, M. Khayatnezhad. F. Gholinia (2019: Assessing of impact climate parameters on the gap between hydropower supply and electricity demand by RCPs scenarios and opti- mized ANN by the improved Pathfinder (IPF) algo- rithm. Energy 237: 121621 Hammer, Ø., Dat., Harper, P.D., Ryan (2012): PAST: Pale- ontological Statistics software package for education and data analysis. Palaeontologia Electronica, 4: 1−9. Huang, D., J. Wang, M. Khayatnezhad (2020): Estimation of Actual Evapotranspiration Using Soil Moisture Balance and Remote Sensing” Iranian Journal of Sci- ence and Technology, Transactions of Civil Engineer- ing: 1-8. I, A., X. Mu, X. Zhao, J. Xu, M. Khayatnezhad And R. Lalehzari (2020). Developing the non‐dimensional framework for water distribution formulation to eval- uate sprinkler irrigation. Irrigation and Drainage. Jia, Y., M. Khayatnezhad, S. Mehri (2020). Population dif- ferentiation and gene flow in Rrodium cicutarium: A potential medicinal plant. Genetika 52(3): 1127-1144. Kafkas S, Kafkas E, Perl-Treves R (2002) Morphological diversity and germplasm survey of three wild Pistacia species in Turkey. Genet Resour Crop Evol 49:261–270 Kafkas S, Kaska A, Wassimi AN, Padulosi S (2006) Molecular characterisation of Afghan pistachio acces- sions by amplified fragment length polymorphisms (AFLPs). J Hortic Sci Biotechnol 81(5):864–868 Karimi HR, Zamani Z, Ebadi A, Fatahi MR (2009b) Mor- phological diversity of Pistacia species in Iran. Genet Resour Crop Evol 56:561–571 Katsiotis A, Hagidimitriou M, Drossou A, Pontikis C, Loukas M (2003) Genetic relationships among spe- cies and cultivars of Pistacia using RAPDs and AFLPs. Euphytica 132:279–286 Khadivi-Khub, A.; Esmaeili, A.; Mardani, N. Genetic diversity of cultivated pistachio as revealed by micro- satellite molecular markers. Biotechnol. Biotechnol. Equip. 2018, 32, 602–609. KARASAKAL, A., M. KHAYATNEZHAD, R. GHOLA- MIN (2020a). The Durum Wheat Gene Sequence Response Assessment of Triticum durum for Dehy- dration Situations Utilizing Different Indicators of Water Deficiency.Bioscience Biotechnology Research Communications 13(4): 2050-2057. Karasakal, A., M. Khayatnezhad, R. Gholamin (2020b): The Effect of Saline, Drought, and Presowing Salt Stress on Nitrate Reductase Activity in Varieties of Eleusine coracana (Gaertn). Bioscience Biotechnol- ogy Research Communications 13(4): 2087-2091. Khayatnezhad, M. R. Gholamin (2020): Study of Durum Wheat Genotypes’ Response to Drought Stress Con- ditions. Helix, 10(05): 98-103. Khayatnezhad, M. And R. Gholamin (2021a): The Effect of Drought Stress on the Superoxide Dismutase and Chlorophyll Content in Durum Wheat Genotypes. Advancements in Life Sciences, 8(2): 119-123. Khayatnezhad, M. And R. Gholamin (2021b): Impacts of Drought Stress on Corn Cultivars (Zea mays L.) At the Germination Stage. Bioscience Research 18(1): 409-414. Khayatnezhad, M. F. Nasehi (2021): Industrial Pesti- cides and a Methods Assessment for the Reduction of Associated Risks: A Review.” Advancements in Life Sciences 8(2) Ma, S., M. Khayatnezhad, A. A. Minaeifar (2021): Genetic diversity and relationships among Hypericum L. spe- cies by ISSR Markers: A high value medicinal plant from Northern of Iran. Caryologia, 74(1): 97-107. Podani, J. (2000): Introduction to the Exploration of Mul- tivariate Data. Backhuyes, Leiden, pp.407. Pritchard, J.K., M., Stephens, P., Donnelly (2000): Infer- ence of population structure using multilocus geno- type Data. Genetics, 155: 945−959. Peng, X., M. Khayatnezhad, L. Ghezeljehmeidan (2021): Rapd profiling in detecting genetic variation in stel- 127Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers laria l. (caryophyllaceae). Genetika-Belgrade, 53(1): 349-362. Peakall, R., P.E., Smouse (2006): GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes, 6: 288−295. Ren, J. M. Khayatnezhad (2021): Evaluating the storm- water management model to improve urban water allocation system in drought conditions. Water Sup- ply. S. GARSHASBI et al.: GENETIC EDIVERSITY OF Lonicera Si, X., L., Gao, Y. Song, M, Khayatnezhad, A.A. Minaei- far (2020): Understanding population differentiation using geographical, morphological and genetic char- acterization in Erodium cicunium. Indian J. Genet., 80(4): 459-467. Sun, Q., D. Lin, M., Khayatnezhad, M. Taghavi (2020): Investigation of phosphoric acid fuel cell, linear Fresnel solar reflector and Organic Rankine Cycle polygeneration energy system in different climatic conditions. Process Safety and Environmental Protec- tion, 147: 993-1008. Sun, X. And M. Khayatnezhad (2019): Fuzzy-probabilis- tic modeling the flood characteristics using bivariate frequency analysis and α-cut decomposition. Water Supply. Smykal, P., N., Bacova-Kerteszova, R., Kalendar, J., Corander, A.H., Schulman, M., Pavelek (2011): Genetic diversity of cultivated flax (Linum usitatis- simum L.) germplasm assessed by retrotransposon- based markers. TAG, 122: 1385–1397. TayefehAliakbarkhany S, Talaie AR, Fatahi Moghadam MR (2013) Investigation of genetic diversity among Pistacia Vera In the Khorasan by using molecular. Mod Genet 8:169–176 Tao, Z., Z., Cui, J., Yu, M., Khayatnezhad (2021): Finite Difference Modelings of Groundwater Flow for Con- structing Artificial Recharge Structures. Iranian J. Sci. Techn., Transactions of Civil Engineering. Wang, C., Y. Shang, M. Khayatnezhad (2021): Fuzzy Stress-based Modeling for Probabilistic Irrigation Planning Using Copula-NSPSO. Water Resources Management. Weising, K., H., Nybom, K., Wolff, G., Kahl (2005): DNA Fingerprinting in Plants. Principles, Methods, and Applications. (2nd ed.), Boca Raton, FL., USA: CRC Press, pp. 472. Williams, J.G.K., Kubelik, A.R., Levak, K.J., Rafalski, J.A. and Tingey, S.V. 1990. DNA polymorphism ampli- fication by arbitrary primers are useful as genetic markers. Nucleic Acids Res, 18: 6531-6535. Zohary M (1952) A monographic study of the genus Pistacia. Palest J Bot Jerus Ser 5:187–228 Xu, Y.-P., P. Ouyang, S.-M., Xing, L.-Y., Qi, M., Khayat- nezhad, H., Jafari (2020): Optimal structure design of a PV/FC HRES using amended Water Strider Algo- rithm. Energy Reports, 7: 2057-2067. Yin, J., M. Khayatnezhad, A. Shakoor (2020): Evaluation of genetic diversity in Geranium (Geraniaceae) using rapd marker. Genetika, 53(1): 363-378. Zhang, H., M. Khayatnezhad, A. Davarpanah (2019): Experimental investigation on the application of car- bon dioxide adsorption for a shale reservoir. Energy Science & Engineering n/a(n/a). Zheng, R., S. Zhao, M. Khayatnezhad, S, Afzal Shah (2020): Comparative study and genetic diversity in Salvia (Lamiaceae) using RAPD Molecular Markers. Caryologia, 74(2): 45-56. Zhu, K., L. Liu, S. Li, B., Li, M. Khayatnezhad, A. Sha- koor (2019): Morphological method and molecular marker determine genetic diversity and population structure in Allochrusa. Caryologia, 74(2): 121-130. Zhu, P., H. Saadati, M. Khayatnezhad (2020): Application of probability decision system and particle swarm optimization for improving soil moisture content. Water Supply. Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 75, Issue 2 - 2022 Firenze University Press Cytogenetic Studies of Six Species in Family Araceae from Thailand Piyaporn Saensouk1, Surapon Saensouk2,*, Rattanavalee Senavongse2 Effect of Ag Nanoparticles on Morphological and Physio-biochemical Traits of the Medicinal Plant Stevia Rebaudiana Sherzad R. Abdull, Sahar H. Rashid*, Bakhtiar S. Ghafoor, Barzan S. Khdhir Morphometric analysis and genetic diversity in Hypericum L. using sequence related amplified polymorphism Wei Cao1, Xiao Chen2,*, Zhiwei Cao3 Population Differentiation and Gene Flow of Salicornia persica Akhani (Chenopodiaceae) Xiaoju Zhang1, Li Bai2,*, Somayeh Esfandani-Bozchaloyi3 SCoT molecular markers are efficient in genetic fingerprinting of pomegranate (Punica granatum L.) cultivars Shiva Shahsavari1, Zahra Noormohammadi1,*, Masoud Sheidai2,*, Farah Farahani3, Mohammad Reza Vazifeshenas4 First record of nucleus migration in premeiotic antherial cells of Saccharum spontaneum L. (Poaceae) Chandra Bhanu Singh1, Vijay Kumar Singhal2, Manish Kapoor2,* Genetic Characterization of Salicornia persica Akhani (Chenopodiaceae) Assessed Using Random Amplified Polymorphic DNA Zhu Lin1,*, Hamed Khodayari2 Comparative chromosome mapping of repetitive DNA in four minnow fishes (Cyprinidae, Cypriniformes) Surachest Aiumsumang1, Patcharaporn Chaiyasan2, Kan Khoomsab3, Weerayuth Supiwong4, Alongklod Tanomtong2 Sumalee Phimphan1,* Classical chromosome features and microsatellites repeat in Gekko petricolus (Reptilia, Gekkonidae) from Thailand Weera Thongnetr1, Surachest Aiumsumang2, Alongklod Tanomtong3, Sumalee Phimphan2,* Genotoxic and antigenotoxic potential of encapsulated Enhalus acoroides (L. f.) Royle leaves extract against nickel nitrate Made Pharmawati1,*, Ni Nyoman Wirasiti1, Luh Putu Wrasiati2 Chromosomal description of three Dixonius (Squamata, Gekkonidae) from Thailand Isara Patawang1, Suphat Prasopsin2, Chatmongkon Suwannapoom3, Alongklod Tanomtong4, Puntivar Keawmad5, Weera Thongnetr6,* First Report on Classical and Molecular Cytogenetics of Doi Inthanon Bent-toed Gecko, Cyrtodactylus inthanon Kunya et al., 2015 (Squamata: Gekkonidae) in Thailand Suphat Prasopsin1, Nawarat Muanglen2, Sukhonthip Ditcharoen3, Chatmongkon Suwannapoom4, Alongklod Tanomtong5, Weera Thongnetr6,* Evaluation of genetic diversity and Gene-Pool of Pistacia khinjuk Stocks Based On Retrotransposon-Based Markers Qin Zhao1,*, Zitong Guo1, Minxing Gao1, Wenbo Wang1, Lingling Dou1, Sahar H. Rashid2 A statistical overview to the chromosome characteristics of some Centaurea L. taxa distributed in the Eastern Anatolia (Turkey) Mikail Açar1,*, Neslihan Taşar2 Cytotoxicity of Sunset Yellow and Brilliant Blue food dyes in a plant test system Elena Bonciu1, Mirela Paraschivu1,*, Nicoleta Anca Șuțan2, Aurel Liviu Olaru1