Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 76(2): 3-13, 2023 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1857 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Fatima Omari Alzahrani, Sami Asir Al-Robai (2023). Molecular clas- sification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes. Caryologia 76(2): 3-13. doi: 10.36253/caryologia-1857 Received: October 3, 2022 Accepted: July 3, 2023 Published: December 31, 2023 Copyright: © 2023 Fatima Omari Alzah- rani, Sami Asir Al-Robai. This is an open access, peer-reviewed article published by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes Fatima Omari Alzahrani, Sami Asir Al-Robai Department of Biology, Faculty of Science, Al-Baha University, Al-Baha, Saudi Arabia E-mail: drfatimaomari@gmail.com, dr.alrobai@gmail.com; ,fsalomari@bu.edu.sa, sal- robai@bu.edu.sa Abstract. Despite many efforts to determine the phylogenetic relationship between Barbeyaceae and other families of Rosales, the sister relationship of this family has remained unclear. Barbeya oleoides, which is currently the only species in the family Barbeyaceae, and native to Somalia, Ethiopia, and the Arabian Peninsula were collect- ed from Wadi Turbah Zahran northwestern of Al-Baha City, southwestern Saudi Ara- bia (20°14’N, 41°15’E). To study the sister relationship of Barbeyaceae and the other families of Rosales, the complete chloroplast sequences were used for phylogenetic analysis. In addition, four standard DNA barcodes (the internal transcribed spacer 2 (ITS2), ribulose 1,5-biphosphate carboxylase (rbcL), maturase K (matk), the intergenic spacer region (trnH-psbA)) were used to test for their quality in identifying phyloge- netic relationship of the studied families. Sequence analysis of the complete chloroplast sequences showed that Rosales clade has two subclades and clearly discriminated all families within this order. This is the first report of a partial ITS2 locus sequence in B. oleoides. The partial ITS2, rbcL, matk, and gene sequences discriminate B. oleoides of the Barbeyaceae family from the closely related plant families: Cannabaceae, Rosaceae, Rhamnaceae, Urticaceae, Moraceae, Elaeagnaceae, Dirachmaceae, and Ulmaceae. In contrast, the partial trnH-psbA sequence of B. oleoides did not show any homology to the available DNA sequence of plant families in GenBank, suggesting that it is more suitable as DNA barcode for variations within one species. Keywords: DNA barcoding, phylogenetic analysis, ITS2, rbcL, matK, trnH-psbA. Abbreviations: B. oleoides: Barbeya oleoides Schweinf. ITS2: the internal transcribed spacer 2 rbcL: ribulose 1,5-biphosphate carboxylase matk: maturase K trnH-psbA: the intergenic spacer region w/v: wight/volume IUCN: The International Union for Conservation of Nature 4 Fatima Omari Alzahrani, Sami Asir Al-Robai 1. INTRODUCTION Barbeya oleoides Schweinf. (B. oleoides) is the only species in the family Barbeyaceae and considered one of the smallest families in the plant kingdom (Dicki- son and Sweitzer, 1970, Chaudhary, 1999). Barbeyaceae belongs to the order Rosales, which comprises eight families besides Barbeyaceae: Cannabaceae, Dirach- maceae, Elaeagnaceae, Moraceae, Rhamnaceae, Rosace- ae, Ulmaceae, and Urticaceae (Angiosperm Phylogeny Group (APG), 1998, 2003, 2009). B. oleoides is a small olea-like tree, reaching a height of up to 5 m, and can be found as a bushy shrub. The plant is characterized by dense hairs that cover the lower surfaces of the leaves. It is widely distributed in southwestern Saudi Ara- bia, including the Al-Baha region and locally known as kathah in Arabic (Dickison and Sweitzer, 1970). In Al- Baha region, the plant was reported only in seven loca- tions between 1454 and 1768 masl on drainage lines fac- ing the southwest and northeast (Namazi et al., 2021). B. oleoides is considered a medicinal plant in Saudi Arabia and used as a folkloric remedy for the treatment of diseases such as infection, edema, or related inflammatory diseases (Baka, 2010). Few local studies have evaluated the medicinal effects of different plant parts, including leaves and stems (Ahmed et al., 2002; Khojah et al., 2021). The International Union for Conservation of Nature (IUCN) categorized B. oleoides as the least concerned taxon. However, it represents a monotypic taxon, implying the importance of taxonomic and phylogenetic studies on this plant (Rana and Ranade, 2009; Sarwar and Araki, 2010). DNA barcoding is widely used as an effective tool to identify species and to make the obtained data publicly available to help understand, conserve, and utilize bio- diversity. DNA barcodes in plants are usually located in the chloroplast genome, either within coding sequences (such as maturase K (matK) and ribulose bisphosphate carboxylase (rbcL)) or in intergenic regions (such as the chloroplast trnH-psbA spacer region), or located at nuclear loci (such as the internal transcribed spacer of ribosomal DNA2 (ITS2)) (CBOL Plant Working Group, 2009; China Plant BOL Group, 2011: Li et al., 2015). The combination of these markers is important to achieve the highest discriminatory power and molecular identi- fication of species. The aim of this study was to investigate the phylo- genetic relationship and molecular identification of B. oleoides using the whole chloroplast genome and four different barcodes of plant DNA. The sequences of rbcL, matk, and trnH-psbA loci were compared to those avail- able for B. oleoides in the NCBI GenBank database; how- ever, the current study is considered the first report on the amplification and sequencing of the ITS2 region of the B. oleoides genome. 2. MATERIALS AND METHODS 2.1 Plant materials and DNA extraction The plant samples were collected from Wadi Tur- bah Zahran, northwestern Al-Baha City, southwestern Saudi Arabia (20°14’N, 41°15’E). Total genomic DNA was extracted from 50 mg of fresh leaves using the CTAB extraction method described by Aboul-Maaty and Ora- by (2019). The 3× CTAB extraction buffer contained 3% CTAB (w/v), NaCl, 0.8 M Tris-HCl pH 8.0), and EDTA (0.5 M EDTA pH 8.0). Compound 2 was preheated to 65 °C and 3% 2-β-mercaptoethanol was added to 3× CTAB extraction buffer immediately before use. Then, 800 μL of this buffer was added to the plant samples, which were ground into a powder using liquid nitrogen. The mix- ture was incubated in a water bath at 60–65 °C for 1 h and mixed gently every 20 min by inverting each tube 20 times. After cooling the mixture to room temperature, an equal volume of chloroform was added. The mixture was centrifuged at 13,000 rpm for 15 min at room tem- perature. The upper aqueous phase was then transferred to a new 1.5-mL Eppendorf tube. NaCl (6 M) with a vol- ume equal to half the volume of the upper aqueous phase and 3 M potassium acetate (1/10 the volume of the upper aqueous phase) were added and simultaneously mixed with ice-cold 100% isopropyl alcohol (approximately two- thirds of the volume of the aqueous phase). The extracted DNA was quantified using a UV spec- trophotometer (NanoDrop 2000 Spectrophotometer; Thermo Scientific, UK). 2.2 PCR amplification and sequencing The sequences of the primers used for amplification of the investigated regions are shown in Table 1. Amplifi- cations were performed in 50-μL reactions. DNA amplifi- cation was carried out using PCR TECHNE (GMI, USA) and the conditions were as follows: pre-denaturation at 94 °C for 3 min followed by 34 cycles of denaturation at 94 °C for 30 s, annealing for 40 s, extension at 72 °C for 50 s, and one cycle of final extension at 72 °C for 5 min. The annealing temperatures for each primer are listed in Table 1. The PCR products were separated by 1.0% aga- rose gel electrophoresis. For DNA purification, Expin PCR purification kit (Gene ALL, Korea) was used. Amplicons were sequenced by Macrogen (Seoul, South Korea). 5Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes 2.3 Sequence analysis For the phylogenetic analysis of B. oleoides, the resultant sequences were compared with reference sequences in the NCBI GenBank database (http://www. ncbi.nlm.nih.gov). To query for highly similar sequenc- es, Basic Local Alignment Search Tool (BLAST) (http:// blast.ncbi.nlm.nih.gov/Blast.cgi) was used. The retrieved sequences were aligned, trimmed, and analyzed using the MEGA11 program (Tamura et al., 2021). A phylogenetic tree was constructed after finding the best DNA models using MEGA11, and models with the lowest Bayesian Information Criterion (BIC) scores were considered the best model to describe the substitution pattern. The maximum likelihood method (based on the best model obtained) was used to construct the phylogenetic tree with default parameters, except that the test of phy- logeny was modified to the bootstrap method (Felsen- stein, 1985). Therefore, the confidence levels for the individual branches of the resulting tree were assessed by the bootstrap test in which 1,000 replicate trees were generated from resampled data, and statistical support for each constructed tree was also provided by pairwise distance estimated using the best-fit model. To infer phylogenetic relationships within Rosales, the seven plastid genomes were compared to Barbeya oleoides. All plastid genome sequences were aligned using MAFFT v7.402 (Katoh and Standley 2013) . Maxi- mum likelihood analyses were conducted using raxm- lGUI (Silvestro and Michalak 2012) with GTR+G, and 1000 bootstrap replicates. 3. RESULTS The amplification and sequence success rates of ITS2, rbcL, matk, and trnH-psbA from specimens of B. oleoides were 100%. The lengths of the ITS2, rbcL, matk, and trnH-psbA sequences used for the analysis were 356, 555, 783, and 498, respectively. Sequences of the ITS2, rbcL, matk, and trnH-psbA loci were submitted to the NCBI GenBank database under the following acces- sion numbers: OP023315, OP094675, OP094676, and OP094677, respectively. The obtained sequences were used as query sequences in BLAST at NCBI to find simi- lar sequences in the order Rosales. For the ITS2 loci the species included in the analysis are shown in Fig. 1. The nucleotide sequences of all selected species were analyzed using MEGA11 which revealed that the Tamu- ra 3-parameter model had the lowest BIC scores (Tamu- ra, 1992). As a result, evolutionary history was inferred using the maximum likelihood method and Tamura 3-parameter model (Fig. 1). In addition, by blasting the sequence of rbcL loci, the most highly similar identity sequences obtained from GenBank were the Rosaceae family, For the rbcL loci the species included in the analysis are shown in Fig 2. The nucleotide sequences of all selected species were analyzed by MEGA11, which revealed that the Jukes- Cantor model is the best model to describe the substitu- tion pattern (Jukes and Cantor, 1969). Therefore, evolu- tionary history was inferred using the maximum likeli- hood method and the Jukes-Cantor model (Fig. 2). The matK loci sequence showed that the most highly similar identity sequences obtained from GenBank were from the Rhamnaceae family. For the matK loci the spe- cies included in the analysis are shown in Fig 3. The nucleotide sequences of all selected species were ana- lyzed using MEGA11 which revealed that the Tamura 3-parameter model had the lowest BIC scores (Tamura, 1992). As a result, evolutionary history was inferred using the maximum likelihood method and Tamura 3-parameter model (Fig. 3). In contrast, the trnH-psbA loci of the investigated B. oleoides did not show any similarity to any other plant family in the BLAST search at NCBI, and the present identity to the available data of B. oleoides (only two accessions: NC_040984 and MG880221) was 89.39% Table 1. List of primers used for the investigated DNA barcoding loci. DNA locus Primer name Primer sequence Annealing temperature rbcL rbcLaF ATGTCACCACAAACAGAGACTAAAGC 60.6 °C rbcLarev GTAAAATCAAGTCCACCRCG 57.5 °C matk matK-KIM1 ACCCAGTCCATCTGGAAATCTTGGTTC 66.1 °C matK-KIM3 CGTACAGTACTTTTGTGTTTACGAG 56.8 °C trnH-psbA psbAF CGCGCATGGTGGATTCACAATCC 65.7 °C t-rnH2 GTTATGCATGAACGTAATGCTC 54.8 °C ITS2 ITS-S2F ATGCGATACTTGGTGTGAAT 55 °C ITS4rev TCCTCCGCTTATTGATATGC 55.8 °C 6 Fatima Omari Alzahrani, Sami Asir Al-Robai Figure 1 Phylogram based on ITS2 locus for B. oleoides and the retrieved species from NCBI using the maximum likelihood tree method. The evolutionary history and phylogenetic relationship were inferred using the maximum likelihood method and the Tamura 3-param- eter model (Tamura, 1992). The tree with the highest log-likelihood is shown. The analysis involved 16 nucleotide sequences. The codon positions included were 1st+2nd+3rd+ noncoding. There were 364 positions in the final dataset. Evolutionary analyses were conducted in MEGA11 (Tamura et al., 2021). 7Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes Figure 2 Phylogram based on rbcL locus for B. oleoides and the retrieved species from NCBI using the maximum likelihood tree method. The evolutionary history and phylogenetic relationship were inferred using the maximum likelihood method and the Tamura 3-param- eter model (Tamura, 1992). The tree with the highest log-likelihood is shown. The analysis involved 16 nucleotide sequences. The codon positions included were 1st+2nd+3rd+ noncoding. There were 364 positions in the final dataset. Evolutionary analyses were conducted in MEGA11 (Tamura et al., 2021). 8 Fatima Omari Alzahrani, Sami Asir Al-Robai Figure 3 Phylogram based on matK locus for B. oleoides and the retrieved species from NCBI using the maximum likelihood tree method. The evolutionary history and phylogenetic relationship were inferred using the maximum likelihood method and the Tamura 3-param- eter model (Tamura, 1992). The tree with the highest log-likelihood is shown. The analysis involved 16 nucleotide sequences. The codon positions included were 1st+2nd+3rd+ noncoding. There were 364 positions in the final dataset. Evolutionary analyses were conducted in MEGA11 (Tamura et al., 2021). 9Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes with a very low E value (E-value =1e-127). The length of the aligned sequence was 374 bp and the percentage of variable sites within this sequence was 10% (Fig. 4). The completed sequences of chloroplast of the families within Rosales (except Dirachmaceae not yet sequenced and instead available plastid sequences were used) were included for phylogenetic analysis using raxmlGUI (Silvestro and Michalak 2012). The result showed that the Rosales clade contains two subclades Fig. 5. The first subclade includes Rhamnaceae, Barbey- aceae, Elaeagnaceae, and Rosaceae. The Second subclade includes Ulmaceae, Cannabaceae, Moraceae, and Urti- caceae. However, due to the absence of the completed chloroplast sequence of Dirachmaceae species, the fam- ily appeared as an outgroup taxon. 4. DISCUSSION DNA barcoding is an important tool for species and family identification. Combining nuclear and chloroplast DNA barcodes is a good approach for DNA barcoding in plants (Kress et al., 2010). Not all DNA barcodes exhibit the same performance and efficiency across all plant spe- cies (Liu et al., 2011). In 2009, matK and rbcL barcodes were suggested to be the core sequences of plant DNA barcodes, while ITS and trnH-psbA are complemen- tary plant DNA barcodes (CBOL Plant Working Group, 2009). The karyotype characteristic that is commonly utilized in cytotaxonomic analyses is the count of chro- mosomes. However, the complete sequencing of Barbeya oleoides has not been accomplished, thus preventing the utilization of chromosome number as a means of facili- tating its classification. Chen et al. (2010) attempted to develop a practical and standardized tool for authenti- cating medicinal plants using DNA barcodes. In their study, the phylogeny of 4,800 species from 193 families across seven phyla (angiosperms, gymnosperms, ferns, mosses, liverworts, algae, and fungi) was analyzed, including different DNA barcodes. Their results pro- posed the use of ITS2 as a core DNA barcode to iden- tify medicinal plants at different taxonomic levels. The results of the ITS2 sequence BLAST and phylogenetic relationship inferred by using the maximum likelihood method discriminate Barbeyacea from the Cannabaceae family, which is represented by two highly similar gen- era: Aphananthe and Celtis. Thus, the power of ITS2 for species identification was confirmed in the current study, and it was also documented to be a useful DNA marker for phylogenetic reconstructions at both the genus and species levels by several studies (Schultz and Wolf, 2009; Schultz et al., 2005). The applicability of dif- ferent DNA barcode regions for species identification within Rosaceae has been tested, and the results indi- cate that ITS2 is the best of all loci tested for barcoding Rosaceae (Pang et al., 2011). The matK barcode alone was not suggested to be a suitable universal barcode. This is due to the low success rate of species identification (Fazekas et al., 2008) and the different discrimination rates in different taxonomic groups; for example, the matK discrimination rate was more than 90% for species in the family Orchidaceae (Kress and Erickson, 2007) but less than 49% in the nut- meg family (Newmaster et al., 2008). In contrast to these previous studies, our study presents a strong case for the matK region as a good DNA barcode for authenticating B. oleoides and discriminating the Barbeyaceae family from other closely related families, such as the Rham- naceae family, which is represented in the analysis by the genera Ventilago and Berchemia. Although the rbcL region is not recommended for use as a candidate plant barcode based on several limi- tations, such as its modest discriminatory power at the species level (CBOL Plant Working Group, 2009; Chen et al., 2010; Fazekas et al., 2008; Lahaye et al., 2008) and the length of the gene, this study evaluated the rbcL barcode, and the results indicate accurate identification of B. oleoides. In addition, consistent with the current study, both rbcL and matK barcodes have the ability to discriminate among Cannabaceae, Rosaceae, and Rham- Figure 4 Variable sites between aligned sequence of trnH-psbA locus for B. oleoides and the retrieved sequence of B. oleoides from NCBI 10 Fatima Omari Alzahrani, Sami Asir Al-Robai Fig. 5 Phylogenetic relationships of Barbeyaceae family with related families within Rosales based on the whole chloroplast genomes by maximum likelihood (ML) with bootstrap values above the branches. 11Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes naceae families within the order Rosales (Muhammad and Siddiqui, 2022). Although the ITS2, matk, rbcL, and trnH-psbA loci of B. oleoides were efficient in the identification of this plant species, only ITS2, rbcL, and matk could discrimi- nate the Barbeyaceae family from other closely related families. A phylogenetic evolutionary tree was construct- ed for B. oleoides species for each rbcL, matK, and ITS2, which was supported by the values of nodes on most branches being higher than 90%, indicating that the evolutionary relationships between B. oleoides and oth- er closely related families are highly reliable. This result was supported by the ability of the trees constructed to differentiate clearly between the Barbeyaceae family and other closely related families, such as Cannabaceae, Rosaceae, and Rhamnaceae (fig. 1,2,3). The weak discriminatory power of trnH-psbA com- pared to ITS2 at low taxonomic levels has been widely studied and has been suggested as a complementary bar- code for the identification of medicinal plant species (Chen et al., 2010; Kress et al., 2005; Kress and Erickson, 2007). Our results indicated that the trnH-psbA locus was efficient in the identification of B. oleoides, but failed to distinguish between closely related families. This may be attributed to the high substitution rate within the chlo- roplast trnH-psbA spacer region (Whitlock et al. 2010). Therefore, as the trnH-psbA region accumulates more variation, it may offer more resolution at lower levels of taxa such as species and cultivars (Kress et al., 2010; Kress et al., 2005; Kress and Erickson, 2007, Chen et al., 2010). The complete chloroplast sequence analysis consid- ers a strong and informative tool for phylogenetic rela- tionship analysis (Moore et al. 2007; Do et al. 2013). The analysis showed thar the Rosales clade includes two sub- clades, which agreed with previous studies (Zhang et al. 2011). In addition, it showed that Barbeyaceae is sister to Elaeagnaceae. Other previous studies placed Elaeagnaceae in the same clade with Barbeyaceae, Dirachmaceae and Rhamnaceae (Soltis et al. 2007; Savolainen et al. 2000; Richardson et al. 2000a), hence, confirming the result of completed chloroplast phylogenetic analysis. Additionally, morphological studies confirmed the close relationship of Barbeyaceae, Dirachmaceae, Elaeagnaceae and Rhamna- cea (Richardson et al. 2000b; Wang et al. 2009). 5. CONCLUSIONS This study is the first to assess molecular marker- based identification and classification of B. oleoides. This study produced DNA sequences from ITS2, matK, rbcL, and trnH-psbA barcoding loci in B. oleoides collected from Al-Baha, Saudi Arabia. It is concluded that the three barcode markers, ITS2, matK, and rbcL, worked reasonably well in the differentiation of Barbeyaceae from closely related families of order Rosales. In addi- tion, the study reported a low resolution of the trnH- psbA marker for the identification of families within the order Rosales. Thus, it is suggested to be used to differ- entiate among variations within B. oleoides plants, or variations within one species. Finally, the present study provides data to aid in the correct identification and conservation of this medicinally important plant species. DATA AVAILABILITY Sequences of the ITS2, rbcL, matk, and trnH-psbA loci were submitted to the NCBI GenBank database under the following accession numbers: OP023315, OP094675, OP094676, and OP094677, respectively REFERENCES Aboul-Maaty, N.A.F., Oraby, H.A.S., 2019. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl Res. Cent. 43, 1–10. Ahmed, B., Al-Rehaily, A.J., Mossa, J.S., 2002. Barbeyol: A NewPhenolic indane Type Component from Barbeya oleoides. Z. Naturforsch. C J. Biosci. 57, 17–20. Angiosperm Phylogeny Group (APG), 1998. An ordi- nal classification for the families of flowering plants. Ann. Mo. Bot. Gard. 85, 531–553. Angiosperm Phylogeny Group (APG), 2003. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG II. Botan. J. Linn. Soc. 141, 399–436. Angiosperm Phylogeny Group (APG), 2009. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Bot. J. Linn. Soc. 161, 105–121. Baka, Z.A.M., 2010. Antifungal activity of six Saudi medicinal plant extracts against five phyopathogenic fungi. Arch. Phytopathol. Plant Prot. 43, 736–743. CBOL Plant Working Group, 2009. A DNA barcode for land plants. Proc. Natl Acad. Sci. U. S. A. 106, 12794– 12797. Chaudhary, S.A., Al Jowaid, A.A., 1999. Vegetation of the Kingdom of Saudi Arabia. Ministry of Agriculture and Water Kingdom of Saudi Arabia 1, 222–223. Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X., Luo, K., Li, Y., Li, X., 12 Fatima Omari Alzahrani, Sami Asir Al-Robai Jia, X., Lin, Y., Leon, C., 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLOS ONE. 5, e8613. China Plant, B.O.L., 2011. Group, Li DZ, Gao LM, Li HT, Wang H, Ge XJ, et al. Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc Natl Acad Sci USA, 108, pp.19641-19646. Dickison, W.C., Sweitzer, E.M., 1970. Morphology and relationships of Barbeya oleoides. Am. J. Bot. 57, 468–476. Do HDK, Kim JS, Kim J. 2013. Comparative genomics of four Liliales families inferred from the complete chloroplast genome sequence of Veratrum patulum O. Loes.(Melanthiaceae). Gene 530(2):229-235. Fazekas, A.J., Burgess, K.S., Kesanakurti, P.R., Graham, S.W., Newmaster, S.G., Husband, B.C., Percy, D.M., Hajibabaei, M., Barrett, S.C.H., 2008. Multiple mul- tilocus DNA barcodes from the plastid genome dis- criminate plant species equally well. PLOS ONE. 3, e2802. Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 39, 783– 791. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein mol- ecules, in: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in per- formance and usability. Molecular biology and evolu- tion 30(4):772-780. Khojah, A.A., Padilla-González, G.F., Bader, A., Sim- monds, M.J.S., Munday, M., Heinrich, M., 2021. Bar- beya oleoides leaves extracts: In vitro carbohydrate digestive enzymes inhibition and phytochemical characterization. Molecules. 26, 6229. Kress, W.J., Erickson, D.L., 2007. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS One. 2, e508. Kress, W.J., Erickson, D.L., Swenson, N.G., Thompson, J., Uriarte, M., Zimmerman, J.K., 2010. Advances in the use of DNA barcodes to build a community phyloge- ny for tropical trees in a Puerto Rican Forest Dynam- ics Plot. PLOS ONE. 5, e15409. Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H., 2005. Use of DNA barcodes to identify flowering plants. Proc. Natl Acad. Sci. U. S. A. 102, 8369–8374. Lahaye, R., Van Der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barra- clough, T.G., Savolainen, V., 2008. DNA barcoding the floras of biodiversity hotspots. Proc. Natl Acad. Sci. U. S. A. 105, 2923–2928. Li, X.W., Yang, Y., Henry, R.J., Rossetto, M., Wang, Y., Chen, S., 2015. Plant DNA barcoding: From gene to genome. Biol. Rev. Camb. Philos. Soc. 90, 157–166. Liu, J., Möller, M., Gao, L.M., Zhang, D.Q., Li, D.Z., 2011. DNA barcoding for the discrimination of Eurasian yews (Taxus L., Taxaceae) and the discovery of cryp- tic species. Mol. Ecol. Resour. 11, 89–100. Moore MJ, Bell CD, Soltis PS, Soltis DE. 2007. Using plastid genome-scale data to resolve enigmatic rela- tionships among basal angiosperms. Proceedings of the National Academy of Sciences 104(49):19363- 19368. Muhammad, S., Siddiqui, M.F., 2022. Taxonomic reaf- firmation of some members of family Cannabaceae, Moraceae, Rhamnaceae, Rosaceae and Urticaceae of order Rosales using DNA bar-coding markers. Pak. J. Bot. 54, 231–241. Namazi, A.A., Al-Khulaidi, A.W.A., Algarni, S., Al- Sagheer, N.A., 2021. Natural plant species inventory of hotspot areas in Arabian Peninsula: Southwest Al-Baha region, Saudi Arabia. Saudi J. Biol. Sci. 28, 3309–3324. Newmaster, S.G., Fazekas, A.J., Steeves, R.A.D., Janovec, J., 2008. Testing candidate plant barcode regions in the Myristicaceae. Mol. Ecol. Resour. 8, 480–490. Pang, X., Song, J., Zhu, Y., Xu, H., Huang, L., Chen, S., 2011. Applying plant DNA barcodes for Rosaceae species identification. Cladistics. 27, 165–170. PLoS ONE 2: e508 Rana, T.S., Ranade, S.A., 2009. The enigma of monotypic taxa and their taxonomic implications. Curr. Sci. 96. Richardson JE, Fay MF, Cronk QC, Bowman D, Chase MW. 2000a. A phylogenetic analysis of Rhamnace- ae using rbcL and trnL‐F plastid DNA sequences. American Journal of Botany 87(9):1309-1324. Richardson JE, Fay MF, Cronk QC, Bowman D, Chase MW. 2000b. A phylogenetic analysis of Rhamnace- ae using rbcL and trnL‐F plastid DNA sequences. American Journal of Botany 87(9):1309-1324. Sarwar, A.K.M.G., Araki, H., 2010. Monotypic taxa, their taxonomic implications and conservation needs in Bangladesh. Proc. of International Conference on Environmental Aspects of Bangladesh. Japan, Sept. 2010, (p. ICEAB10). Savolainen V, Fay MF, Albach DC, Backlund A, van der Bank M, Cameron KM, Johnson SA, Lledo MD, Pin- taud J, Powell M. 2000. Phylogeny of the eudicots: a nearly complete familial analysis based on rbcL gene sequences. Kew Bulletin:257-309. 13Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes Schultz, J., Maisel, S., Gerlach, D., Müller, T., Wolf, M., 2005. A common core of secondary structure of the internal transcribed spacer 2 (ITS2) throughout the Eukaryota. RNA. 11, 361–364. Schultz, J., Wolf, M., 2009. ITS2 sequence-structure anal- ysis in phylogenetics: A how-to manual for molecular systematics. Mol. Phylogenet. Evol. 52, 520–523. Silvestro D, Michalak I. 2012. raxmlGUI: a graphical front-end for RAxML. Organisms Diversity & Evolu- tion 12:335-337. Soltis DE, Gitzendanner MA, Soltis PS. 2007. A 567-tax- on data set for angiosperms: the challenges posed by Bayesian analyses of large data sets. International journal of plant sciences 168(2):137-157. Tamura, K., 1992. Estimation of the number of nucleotide substitutions when there are strong transition-trans- version and G + C-content biases. Mol. Biol. Evol. 9, 678–687. Tamura, K., Stecher, G., Kumar, S., 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol., version 11. 38, 3022–3027. htt- ps://doi.org/10.1093/molbev/msab120. Wang H, Moore MJ, Soltis PS, Bell CD, Brockington SF, Alexandre R, Davis CC, Latvis M, Manchester SR, Soltis DE. 2009. Rosid radiation and the rapid rise of angiosperm-dominated forests. Proceedings of the National Academy of Sciences 106(10):3853-3858. Whitlock, B.A., Hale, A.M., Groff, P.A., 2010. Intraspe- cific inversions pose a challenge for the trnH-psbA plant DNA barcode. PLOS ONE. 5, e11533. Zhang S, Soltis DE, Yang Y, Li D, Yi T. 2011. Multi- gene analysis provides a well-supported phylogeny of Rosales. Molecular phylogenetics and evolution 60(1):21-28. Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 76, Issue 2 - 2023 Firenze University Press Molecular classification of Barbeyaceae (Barbeya oleoides Schweinf.) using four different DNA barcodes Fatima Omari Alzahrani, Sami Asir Al-Robai Mitotic metaphase karyotype of the mosquito Anopheles arabiensis Patton (Diptera: Culicidae) from Kassala State, eastern Sudan Asma Mahmoud Hamza1,*, Sumaya Hussein Elboshra2 Karyotypic analysis of Crucian carp, Carassius carassius (Linnaeus, 1758) from cold waters of Kashmir Himalayas Gousia Jan1, Asim Iqbal Bazaz2, Azra Shah1, Saima Andleeb1, Irfan Ahmad1,*, Durdana Qazi1, Oyas Asimi3, Bilal A. Bhat5, Anayitullah Chesti4 Unfolding chromosomal uniqueness of the Scilloid ornamental Albuca virens by application of EMA based Giemsa- DAPI staining Biplab Kumar Bhowmick*, Sayani Nag Cytogenetic analysis of sympatric Trachelyopterus Valenciennes 1840 (Siluriformes, Auchenipteridae) species reveals highly conserved karyotypes despite the geographic distance Denise Felicetti1, Chrystian Aparecido Grillo Haerter2, Lucas Baumgärtner1, Leonardo Marcel Paiz1, Daniel Rodrigues Blanco3, Eliana Feldberg2, Vladimir Pavan Margarido1, Maelin da Silva4, Roberto Laridondo Lui1,* Cytogenetics of Diphysa americana (Mill.) M.Sousa (Leguminosae-Papilionoideae-dalbergioid clade), a rare species from the coast of Oaxaca, Mexico Fernando Tapia-Pastrana Cytogenetical studies of some Convolvulaceae members from the Western Ghats, India reveal uniformity in karyotypes R.N. Chougule, P.V. Deshmukh, P.E. Shelke, V.J. Patil, M.M. Lekhak* In vitro cytotoxic activity of phytosynthesized silver nanoparticles using Clematis vitalba L. (Ranunculaceae) aqueous decoction Nicoleta Anca Şuţan1, Diana Ionela Popescu (Stegarus)2, Oana Alexandra Drăghiceanu1, Carmen Topală3, Claudiu Şuţan3,*, Aurelian Denis Negrea4, Denisa Ştefania Vîlcoci4, Georgiana Cîrstea4, Sorin Georgian Moga4, Liliana Cristina Soare1