Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 73(3): 89-96, 2020 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.13128/caryologia-191 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: E. Karlik (2020) Display of Suk- kula distributions on Barley Roots via in situ hybridization. Caryologia 73(3): 89-96. doi: 10.13128/caryologia-191 Received: March 17, 2019 Accepted: June 19, 2020 Published: December 31, 2020 Copyright: © 2020 E. Karlik. This is an open access, peer-reviewed article published by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distri- bution, and reproduction in any medi- um, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Display of Sukkula distributions on Barley Roots via in situ hybridization Elif Karlik The University of Istinye, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Istanbul/Turkey E-mail: elif.karlik@istinye.edu.tr Abstract. Retrotransposon are an abundant and ancient parts of the plant genomes that especially LTR retrotransposons influence the genome size and evolution. Sukku- la is a non-autonomous and active, relatively high copy-number retroelement. In this study, we performed fluorescence in situ hybridization (FISH) to observe the distribu- tions of Sukkula elements (LTRs and internal-domain) by using labelled-PCR products. The localizations of Sukkula elements (LTRs and internal-domain) were observed under confocal microscope on Hordeum vulgare L. cv. Hasat root preparations. Our results revealed that Sukkula elements is still active and spread through the whole barley chro- mosomes. Additionally, the re-sequencing analysis of Sukkula LTRs demonstrated that LTRs sequences had ~65 bp gain. These analyses represent a valuable resource to reveal genome organization of barley and large sized plants. Keywords: fluorescence in situ hybridization, retrotransposon, Sukkula, Barley, LTRs, internal-domain INTRODUCTION Beginning with the pioneering work of Barbara McClinton, transpos- able elements (TEs) have become to take part a central position in the plant genome studies. TEs consist of DNA fractions capable of chromosomal movement, either via replicative or conservative (cut-and-paste) mechanisms (Doolittle and Sapienza 1980; Orgel and Crick 1980; Finnegan 1989). Eukary- otic TEs contain two main classes; Class I elements and Class II elements. Class I elements are also known as retrotransposons move through using an RNA intermediate, while Class II elements move through the genome using a DNA intermediate (Finnegan 1989). In plants, the vast majority of repetitive DNA in the nuclear genomes is derived from the proliferation of mostly Class I elements called as retrotrans- posons (SanMiguel et al. 1996; Vicient et al. 1999; Hawkins et al. 2006; Neu- mann et al. 2006; Vitte and Bennetzen 2006) which are subdivided as two major subclasses; Long terminal repeat (LTR) retrotransposons and non-LTR retrotransposons. LTR retrotransposons, which typically comprise GAG and POL protein coding ORFs encoding several enzymes (reverse transcriptase 90 Elif Karlik – RT; protease – PR; RNaseH – RH; integrase – INT) responsible for reverse transcription and integration of daughter sequences into new chromosomal locations, constitute the largest fraction of the TEs (Eickbush and Malik 2002; Havecker et al. 2004; Hawkins et al. 2006; Neumann et al. 2006; Vitte and Bennetzen 2006). Moreover, LTR retrotransposons are found in plants are subdivided in two main superfamilies, gypsy-like and copia-like (also known as Metaviridae and Pseudoviri- dae, respectively), which include the same protein cod- ing domains. However, these domains are rearranged in different order in both LTR retrotransposon types (Eick- bush and Malik 2002; Havecker et al. 2004). Sukkula elements were first identified in bar- ley genome at the barley Mlo locus and to an insertion sequence present in the 3’ LTR of one BARE1element (Manninen and Schulman 1993). Shirasu et al. (2000) later determined two ~5 kb sequence similar this insertion in a 66 kb stretch of barley genome that were also found to be flanked by 5 kb direct repeats. Therefore, these sequences were named as Sukkula elements means “shuttle” in Finn- ish. However, Sukkula LTR copies are found to be gypsy- like retrotransposons, but non-autonomous elements belonging to a novel group of retroelements, large retro- transposon derivatives or LARDs (Kemekawa et al. 1999; Kalendar et al. 2004). Moreover, Sukkula elements consist of reverse transcriptase in appx. 3.5 kb central domain which is found to be conserved as in primary sequence and secondary structure, including no open reading frames (ORFs) encodes typical retroelement proteins. According to these features of Sukkula elements, they are TRIMs (Terminal-repeat Retrotranposons in Miniature) in their lack of a protein-coding domain (Kalendar et al. 2004). Active retrotransposons are important for genome diversification in plants, because of their transposition and accumulation potentials in the genome, thus it can change the overall genome structure (Wessler et al. 1995; Vicient et al. 1999; Schulman and Kalendar 2005). Fluorescence in situ hybridization (FISH) using tar- get-specific DNA probes have become important tool in modern biology and cell research (Hausmann and Cre- mer 2003). In plants, introducing FISH probes is more difficult, because of the cell wall and the cytoplasm of the plants that they hinder chromosome spreading and low metaphase indices (Salvo-Garrido et al. 2001). By using FISH technique, the distribution of retrotranspo- son families has been reported in various plants such as Hordeum vulgare, Allium cepa, Aegilops speltoides, Brachypodium distachyon and Glycine max (Vicient et al. 1999; Lin et al. 2005; Kiseleva et al. 2014; Shams and Raskina 2018; Li et al. 2018). BARE1 distributions on barley chromosomes have been demonstrated by using BAC clones a probe via FISH (Vicient et al. 1999). In barley, FISH technique was also used to reveal gene organization and to integrate the genetic linkage map with a physical map (Stephens et al. 2004). The aim of this study was to present the distribu- tions of Sukkula elements (LTRs and internal-domain) in Hordeum vulgare L. cv. Hasat chromosomes using labelled-PCR products via FISH. Sukkula localization patterns were observed under confocal microscope on barley root preparations. We also performed sequenc- ing studies and the sequence analysis of Sukkula ele- ments (LTRs and internal-domain) to elucidate Sukkula sequence alterations in barley. Our results indicate that Sukkula elements (LTRs and internal-domain) are still active and under genome evolution. MATERIALS AND METHODS Plant materials Barley (Hordeum vulgare L.) cv. Hasat was provid- ed from Directorate of Trakya Agricultural Research Institute. The seeds were grown at growth chamber for germination period under controlled conditions (16 h light/8 h dark, 25°C ± 2°C) and relative humid- ity was kept at 60–75%. The plants were harvested after 72 hours, directly treated with liquid nitrogen and then stored at –80°C until DNA extraction. gDNA Isolation gDNA were isolated from 200 mg of the sam- ples by using the cetyltrimethylammonium bromide (CTAB) precipitation method was modified as previous- ly described in Mafra et al. (2008). Specifically, 200 mg homogenized sample was incubated with 1 ml Edward’s buffer (0.5% (w/v) SDS, 250 mM NaCl, 25 mM EDTA, 200 mM Tris pH 8.0) at 95oC for 5 min (Cold Spring Harbor Laboratory 2005). They were then spun down at relative centrifugal force of 16,000 g in a microcentrifuge for 15 min, and the supernatant was isolated twice with chloroform. Then, the aqueous phase was incubated with 2 volumes of CTAB precipitation solution, after which the CTAB protocol was followed as previously described (Mafra et al. 2008). DNA yield and purity were meas- ured by UV spectrophotometry at 230, 260 and 280 nm using a NanoDrop 2000c instrument (Thermo Scientific USA). DNA integrity was evaluated by agarose gel elec- trophoresis, samples were separated on 1% agarose gels containing Ethidium bromide nucleic acid stain in 1X TAE buffer. 91Display of Sukkula distributions on Barley Roots via in situ hybridization Chromosome preparation for FISH analysis Grains were placed randomly in petri dishes con- taining filter paper soaked in only water to germinate in an incubator at 18-25°C in the dark for 3 days. Then, root tips of barley cv. Hasat were harvested, then directly fixed in Carnoy fixative (3:1 ethanol:acetic acid solution) without any chemical pre-treatment, stored roots at 4ºC. Chromosome preparations and FISH analysis were per- formed according to Jenkins and Hasterok (2001, 2007) with modifications. The slides were checked under the light microscope (Olympus U-TVO.5XC-3) and kept in a freezer at -20 ºC. Development of probes and labelling The FISH probes used in this study were generated from two set of data which is the Sukkula (internal- domain) gene and LTR sequences. To investigate the distribution of Sukkula, we amplified internal-domain and LTR sequences of Sukkula using designed specific primer sets Table 1. The probes for internal-domain and LTR sequences designated by using IDT’s Primer- Quest© Tool (2012). GC% and Tm values of probes were around 50 and between 50°C and 55°C, respectively. The sequences of Sukkula LTR and internal-domain were obtained from barley (AY054376 for LTR and intern-domain). Probe synthesis was carried out individually by using Sukkula LTR and internal-domain primers. The reactions were carried out in total volume of 50 μl including 18.25 μl nuclease-free water, 25 μl of Hot- Start PCR Master Mix (Bio-Rad), 1.5 μl of each primer (10 μM/μl), 1.75 μl of tetramethylrhodamine-dUTP (TRITC) (1 mM), and 2 μl template DNA (40 ng/μl). PCR conditions were as follows: 94°C for 5 min followed by 40 cycles of 94°C for 25 s, annealing 50°C for 25 s and 72°C for 30 s. The reaction was completed by a final extension step at 72°C for 5 min. Fluorescence in situ hybridization (FISH) analysis The FISH analysis procedure was performed based on Jenkins and Hasterok protocol (2001, 2007) with modifications. Chromosome spreads were scanned under ×40 objective light microscopes to define the number and quality of well-spread metaphase plates, and they were treated with 100 μg/ml of RNase at 37°C for 1 h. The hybridization mixture consist of 20 μl of deionised formamide (50%), 8 μl of dextran sul- phate (10%), 4 μl of 20X SSC (2X SSC), 2 μl of 10% SDS (0.5%), 10 μl of probe (75-200ng/slide), 1 μl of blocking DNA (sonicated salmon sperm DNA) (25- 100X probe) and added sterile dH2O to bring final volume 40 μl. Final concentrations were indicated in parenthesis. The mixture was denatured at 85°C for 10 min and kept on ice for 10 min. A 38 μl aliquot of the hybridization mixture was applied onto each slide, covered with a coverslip, and sealed with paper bond. Both chromosomal DNA and probe DNA on the slides were denatured together in a thermal cycler at 70°C for 6 min and hybridized with each other at 37°C overnight in a humid dark box. Afterwards, hybridi- zation the chromosome spreads were washed three times in 2X SSC: once 2X SSC to float coverslips off; once in 15% formamide/0.1X SSC, and again once in 15% formamide/0.1X SSC, each for 10 min at 42°C. Then, slides were washed in 2X SSC for 3 min at 42°. This step was repeated twice with fresh 2X SSC at 42°. Ultimately, slides were washed three times in 2X SSC for 3 min at RT. After, slides were dehydrated in alco- hol series (70, 90 and 100%), each for 1 min at RT and waited in the dark for 15-20 min. Vectashield-DAPI mounting-staining medium (7-10 μL) was dropped onto the chromosome spreads, which were then stored at 4°C until used. Image acquisition For imaging the slides, the following wavelengths were utilized for fluorescence detection: 551-575 nm for probes labelled with TRITC and 420-480 nm for DAPI in Leica DM5500 confocal microscope. The different fluorescent images were acquired separately. Afterwards, they were merged into single composite images. The sig- nal images were analysed by Adobe Photoshop CC 2014. Table 1. Primers used in this study. No Primer Name Sequence (5’→3’) 1 Sukkula LTR F CCCTCCTTCCCTCTTCTCTAAT 2 Sukkula LTR R CCATACTCTGAACCTGATCCTAAAC 3 Sukkula LTR sequencing F AACCAGTCAACCAGCATAGG 4 Sukkula LTR sequencing R GGAGAGGGAGAGATAAGAGGAA 5 Sukkula internal- domain F CCTTGCACTTGATGGCTACT 6 Sukkula internal- domain R CGGATGAGACACGGAAGAAA 92 Elif Karlik Sequence analysis For sequence analysis of Sukkula LTRs, we per- formed PCR reaction. The PCR products were re- sequenced. Th e sequence homology search was conduct- ed in barley genome by using BLASTN in the Ensembl website (http://plants.ensembl.org/barley). However, the re-sequencing results of Sukkula LTRs were compared the original Sukkula LTR sequences using Clustalomega (Altschul et al. 1990). RESULTS AND DISCUSSION Total copy number of TEs in plant genomes expands from as little as a few hundred in those with smaller genome sizes, including Arabidopsis, to hundreds of thou- sands in their larger genome counterparts (e.g. maize, Triticum, Hordeum) (Bennett and Leitch 2005). Compari- son studies suggest that the same general TE types are found in all plant species, however the relative propor- tions of diverse classes and subclasses can diff er dramati- Figure 1. Display of Sukkula internal-domain distributions in barley root preparations via FISH. Figure 2. Display of Sukkula LTRs distributions in barley root preparations via FISH. 93Display of Sukkula distributions on Barley Roots via in situ hybridization cally (Kejnovsky et al. 2012). Moreover, LTR retrotranspo- son turnover in monocots have been demonstrated to be extremely rapid with both gains and losses of TEs com- paring with eudicots (Ma et al. 2004; Vitte and Bennetzen 2006). In the present study, distribution of Sukkula LTRs and intern-domain were observed on Hordeum vulgare L. cv. Hasat root tips preparations using FISH analysis (see Figure 1 and 2). Because of the large genome size of bar- ley, single-copy probes are mostly designed from BAC or YAC contigs (Vicient et al. 1999; Acevedo-Garcia et al. 2013; Bustamante et al. 2017). In the current study, we used direct PCR products derived from barley genomik DNA to generate single-stranded probes were short, ~ 421 bp for LTRs and 451 bp for internal-domain which were highly specifi c and stable for hybridization, therefore it leads to very good amplifi cation of the signals. In addition to display of Sukkula elements in barley chromosomes, our group were able to observe the distributions of SIRE1 ENV and GAG by using barley root tips via FISH (Kar- lik and Gozukirmizi unpublished data). Nowadays, it is Figure 3. A) Gel fi guration of sequencing primers results. B) Demonstration of sequencing analysis results. Original Genbank sequence AY054376 compared with the sequences recovered from bottom gel band and upper gel band displayed in Figure 3A. 94 Elif Karlik also possible to use short direct labelled-PCR products to observe lncRNAs on barley chromosomes by using FISH (Karlik et al. 2018). The impact of retrotransposons especially LTR-ret- rotransposon proliferations and loss on genome struc- ture and evolution of plant species have been studied in species with small- or medium sized genomes. However, large sized genomes have been reported in monocotyle- donous species, including maize (2.3 gigabase pairs) and barley (5.1 gigabase pairs) (Schnable et al. 2009; Mascher et al. 2017), thus we studied with barley in the present study. Sukkula element is known as non-autonomous LTR retrotransposons which use other retrotransposons proteins for transposition, thus we observed that Suk- kula elements (LTRs and internal-domain) distributed on whole barley genome (see Figure 1 and 2). However, some studies demonstrated the prevalence or eventual decay of TEs in the different genomic regions depends on the process of selection and “host control” in a very long evolutionary time (Rebollo et al. 2012; Vitte et al. 2014). Kartal-Alacam et al. (2014) has investigated Sukkula polymorphism rates in non-cultured mature embryos, 40- and 80-days old callus materials by using IRAP and iPBS techniques that Sukkula is the second most active retrotransposon in barley genome. Moreo- ver, our study indicated that transposition of Sukkula elements does not depend on the process of selection and “host control”. Kalendar et al. (2004) suggested that Sukkula LTRs are rarer than BARE1 and not distributed in the bar- ley genome. However, their FISH results demonstrated Sukkula LTRs with a high copy number. Their labelled- LTR probes were hybridized with the chromosome arms except the telomeres, nucleolar organizing regions, and centromeres, where the signals are blocking. Interest- ingly, we also observed a high copy number, in addition with our LTR and internal-domain probes labelled the regions in the whole chromosomes, including telom- eres, nucleolar organizing regions, and centromeres (see Figure 1 and 2). However, our FISH results are consist- ent with the chromosome hybridization data were con- firmed by PCR reaction that both Sukkula segments (LTRs and internal-domain) were found to be present on all barley chromosomal segments. The abundance of repetitive DNA is mostly respon- sible for genome size variations in species or interspecies that especially in LTR-retrotransposons, these differenc- es in abundance may be originated from extreme ampli- fication through retro-transposition or from DNA loss by unequal homologous recombination, which produced solo-LTRs (Flavell 1986; Lisch 2013). During the probe synthesis, we noticed the two bands in agarose gel elec- trophoresis analysis (see Figure 3A). Then, we performed sequencing analysis to reveal the difference between two bands. Therefore, re-sequencing analysis of Sukkula LTRs has revealed that Sukkula LTRs had some gains, especially ~ 65 bp during the evolutionary time, indicat- ing that this event may depend on DNA gain by unequal homologous recombination (see Figure 3B). Addition- ally, Sukkula LTRs sequences (AY054376) demonstrated 95.20% sequence identity to bottom gel band and 58.81% identity to upper gel band. In conclusion, we were able to observe the distribu- tions of the Sukkula LTRs and internal-domain elements via FISH by using labelled-PCR products in barley root preparations. Sukkula is a non-autonomous LTR retro- transposon which is still active. However, how these ele- ments function or organize the genome is still a mystery, thus FISH analysis of TEs has important potentials to uncover the organization of large sized plant genomes. ACKNOWLEDGEMENT This study was supported by Istinye University and Istanbul University. REFERENCES Acevedo‐Garcia J, Collins NC, Ahmadinejad N, Ma L, Houben A, Bednarek P, Benjdia M, Freialdenhoven A, Altmüller J, Nürnberg P, et al. 2013. Fine mapping and chromosome walking towards the  Ror1  locus in barley (Hordeum vulgare  L.).  Theor Appl Genet. 126(12):2969–2982. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol. 215:403-410. Bennett MD, Leitch IJ. 2005. Nuclear DNA amounts in angiosperms: progress, problems and prospects. Ann Bot. 95:45–90. Bustamante FO, Aliyeva-Schnorr L, Fuchs J, Beier S, Houben A. 2017. Correlating the genetic and physi- cal map of barley chromosome 3H revealed limita- tions of the FISH-based mapping of nearby single- copy probes caused by the dynamic structure of metaphase chromosomes.  Cytogenet Genome Res. 152:90–96. Doolittle WF, Sapienza C. 1980. Selfish genes, the phe- notype paradigm and genome evolution. Nature. 284:601–603. Eickbush TH, Malik HS. 2002. Origin and evolution of retrotransposons. In: Craig NL, Craigie R, Gellert M, 95Display of Sukkula distributions on Barley Roots via in situ hybridization Lambowitz AM, editors. Mobile DNA. Washington (DC): ASM Press; p. 1111–1146. Finnegan DJ. 1989. Eukaryotic transposable elements and genome evolution. Trends Genet. 5:103–107. Flavell RB. 1986. Repetitive DNA and chromosome evo- lution in plants. Phil Trans R Soc London B: Biol Sci. 312:227–42. Hausmann M, Cremer C. 2003. Standardisation of FISH- procedures: Summary of the first discussion work- shop. Anal Cell Pathol. 25:201–205. Havecker ER, Gao X, Voytas DF. 2004. The diversity of LTR retrotransposons. Genome Biol. 5:225 Hawkins JS, Kim H, Nason JD, Wing RA, Wendel JF. 2006. Differential lineage-specific amplification of transposable elements is responsible for genome size variation in Gossypium. Genome Res. 16:1252–1261. Jenkins G, Hasterok R. 2001. Painting whole chromo- some sets in hybrids using GISH. In: Advanced Molecular Cytogenetics – a practical course manual. Wydawnictwo Uniwersytetu Śląskiego. p. 35-48. Jenkins G, Hasterok R. 2007. BAC ‘landing’ on chromo- somes of Brachypodium distachyon for comparative genome alignment. Nat Protoc. 2:88-98. Kalendar R, Vicient CM, Peleg O, Anamthawat-Jonsson K, Bolshoy A, Schulman AH. 2004. Large Retrotrans- poson Derivatives: Abundant, Conserved but Non- autonomous Retroelements of Barley and Related Genomes. Genetics. 166(3):1437-1450. Karlik E, Marakli S, Gozukirmizi N. 2018. Two lncRNAs expression profiles in salt stressed barley (Hordeum vulgare L.) roots. Cytologia. 83:37–43. Kartal-Alacam G, Yılmaz S, Marakli S, Gozukirmizi N. 2014. Sukkula Retrotransposon Insertion Polymor- phism in Barley. Russ J Plant Physiol. 61(6):8282- 833. Kejnovsky E, Hawkins JS, Feschotte C. 2012. Plant trans- posable elements: biology and evolution. In: Wen- del J, Greilhuber J, Dolezel J, Leitch IJ, editors. Plant Genome Diversity. Vol 1. India: Springer; p. 17-34. Kemekawa N, Ohtsubo H, Horiuchi T, Ohtsubo E. 1999. Identification and characterization of novel retro- transposons of the gypsy type in rice. Mol Gen Gen- et. 260:593–602. Kiseleva AV, Kirov IV, Khrustaleva LI. 2014. Chromo- somal organization of centromeric Ty3/gypsy retro- transposons in Allium cepa L. and Allium fistulosum L. Genetika. 50:670–676. Li Y, Zuo S, Zhang Z, Li Z, Han J, Chu Z, Hasterok R, Wang K. 2018. Centromeric DNA characterization in the model grass Brachypodium distachyon pro- vides insights on the evolution of the genus. Plant J. 93(6):1088-1101. Lin JY, Jacobus BH, SanMiguel P, Walling JG, Yuan Y, Shoemaker RC, Young ND, Jackson SA. 2005. Peri- centromeric regions of soybean (Glycine max L. Merr.) chromosomes consist of retroelements and tandemly repeated DNA and are structurally and evolutionarily labile. Genetics. 170:1221–1230. Lisch D. 2013. How important are transposons for plant evolution?. Nat Rev Genet. 14:49–61. Ma J, Devos KM, Bennetzen JL. 2004. Analyses of LTR retrotransposon structures reveal recent and rapid genomic DNA loss in rice. Genome Res. 14:860–869. Mafra I, Silva SA, Moreira EJMO, Ferreira da Silva CS, Beatriz M, Oliveira PP. 2008. Comparative study of DNA extraction methods for soybean derived food products. Food Control. 19:1183–1190. Manninen I, Schulman AH. 1993. BARE-1, a copia-like retroelemnt in barley (Hordeum vulgare L.). Plant Mol Biol. 22:829–846. Mascher M, Gundlach H, Himmelbach A, Beier S, Twardziok SO, Wicker T, Radchuk V, Dockter C, Hedley PE, Russell J, et al. 2017. A chromosome con- formation capture ordered sequence of the barley genome. Nature. 544(7651):427-433. Neumann P, Koblı´zkova´ A, Navra´tilova´ A, Macas J. 2006. Significant expansion of Vicia pannonica genome size mediated by amplification of a single type of giant retroelement. Genetics. 173:1047–1056. Orgel LE, Crick FHC. 1980. Selfish DNA: the ultimate parasite. Nature. 284:604–607. Rebollo R, Romanish MT, Mager DL. 2012. Transposable elements: an abundant and natural source of regu- latory sequences for host genes. Annu Rev Genet. 46:21–42. Salvo-Garrido HG, Travella S, Schwarzacher T, Harwood WA, Snape JW. 2001.  An efficient method for the physical mapping of transgenes in barley using  in situ hybridization. Genome. 44:104–110. SanMiguel P, Tikhonov A, Jin YK, Motchoulskaia N, Zakharov D, Melake-Berhan A, Springer PS, Edwards KJ, Lee M, Avramova Z, et al. 1996. Nested retro- transposons in the intergenic regions of the maize genome. Science. 274:765–768. Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, Paster- nak S, Liang C, Zhang J, Fulton L, Graves TA, et al. 2009. The B73 maize genome: complexity, diversity, and dynamics. Science. 326:1112–1115. Schulman AH, and Kalendar R. 2005. A movable feast: diverse retrotransposons and their contribution to barley genome Dynamics. Cytogenet Genome Res. 110:598-605. Shams I, Raskina O. 2018. Intraspecific and intraorganis- mal copy number dynamics of retrotransposons and 96 Elif Karlik tandem repeat in Aegilops speltoides Tausch (Poaceae, Triticeae). Protoplasma. 255:1023–1038. Shirasu K, Schulman AH, Lahaye T, Schulze-Lefert P. 2000 A contiguous 66 kb barley DNA sequence pro- vides evidence for reversible genome expansion. Genome Res. 10:908–915. Stephens JL, Brown SE, Lapitan NLV, Knudson DL. 2004.  Physical mapping of barley genes using an ultrasensitive fluorescence in situ hybridization tech- nique. Genome. 47:179–189. Vicient CM, Suoniemi A, Anamthawat-Jo´nsson K, Tan- skanen J, Beharav A, Nevo E, Schulman AH. 1999. Retrotransposon BARE-1 and its role in genome evolution in the genus hordeum. Plant Cell. 11:1769– 1784. Vitte C, Bennetzen JL. 2006 Analysis of retrotransposon structural diversity uncovers properties and propen- sities in angiosperm genome evolution. Proc Natl Acad Sci USA. 103:17638–17643. Wessler SR, Bureau TE, White SE. 1995. LTRretrotrans- posons and MITEs: important players in the evo- lution of plant genomes. Curr Opin Genet Dev. 5(6):814-821.