Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 75(4): 87-92, 2022 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-1939 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Simona Ceraulo, Francesca Dumas (2022). Mapping CAP-A satellite DNAs by FISH in Sapajus cay para- guay and S. macrocephalus (Platyr- rhini, Primates). Caryologia 75(4): 87-92. doi: 10.36253/caryologia-1939 Received: September 15, 2022 Accepted: December 24, 2022 Published: April 28, 2023 Copyright: © 2022 Simona Ceraulo, Francesca Dumas. This is an open access, peer-reviewed article pub- lished by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Mapping CAP-A satellite DNAs by FISH in Sapajus cay paraguay and S. macrocephalus (Platyrrhini, Primates) Simona Ceraulo, Francesca Dumas* Department of Biological, Chemical and Pharmaceutical Sciences and Technologies (STEBICEF), University of Palermo, 90100, Palermo, Italy *Corresponding author. E-mail: francesca.dumas@unipa.it Abstract. Satellite DNAs such as Cap-A sequences are potentially informative taxo- nomic and phylogenetic markers useful for characterizing primate genomes. They have also been used as cytogenetic markers facilitating species identification in many taxa. The aim of this work is to map Cap-A sequences by FISH (fluorescent in situ hybrid- ization) on two Platyrrhini (Primates) species genomes, Sapajus cay paraguay and S. macrocephalus, in order to study their distribution pattern on chromosomes. The Cap- A probes showed bright signals with almost the same interstitial pattern of distribu- tion in correspondence with C and CMA3 rich regions on six pairs of chromosomes in both Sapajus species. An additional pair was detected on S. macrocephalus. The analysis of the results, compared with previous literature data on other phylogenetically close New World species, shows that Cap-A satellite sequences have a genus-specific pattern, but with slight species-specific patterns that are useful as phylogenetic and tax- onomic markers. Keywords: heterochromatin, karyotype, genome, New World monkeys. INTRODUCTION Apart from coding regions (about 2%), the human genome includes highly repetitive sequences (about 98%) which are usually underestimated in genome analyses due to their complexity; these sequences are known as the dark matter of the genome (Ahmad et al. 2020) and consist of satellite DNA (satDNA), defined as tandemly arranged repeats that represent a considerable proportion of the heterochromatic portion of chromosomes in the eukaryotic genome. satDNA, at first seen as serving no useful purpose, is now known to be associated with genome function, chromosome evolution, speciation, and diversity, comprising different kind of elements such as satellite DNAs, SINEs (Short Interspersed Nuclear Elements), LINE retrotransposons (Long Interspersed Nuclear Elements), and rDNA repeats (Ahmad et al. 2020, Ceraulo et al. 2021 a, Dumas et al. 2022). Thus, satDNAs are potentially informative cytogenetic markers which can be used to study karyotype evolution and address taxonomic issues. They 88 Simona Ceraulo, Francesca Dumas display high evolutionary rates and consist of tandem repeats organized in the type of large arrays (up to Mb size) typically associated with chromosome landmarks such as centromeres, telomeres, and heterochromatic regions (Ahmed 2020). They evolve by mechanisms of gene conversion, and unequal crossing-over which are involved in what is known as concerted evolution (Sand- er Lower et al. 2018). satDNAs have high intraspecific sequence homogeneity and interspecific differences, mak- ing satDNAs potential taxonomic markers and, in some cases, allowing their use for phylogenetic inference. Fur- thermore, satDNAs have been used as cytogenetic mark- ers facilitating species identification in many taxa (Prak- hongcheep et al. 2013 a,b, Cacheux, et al. 2018). Among repetitive sequences, Cap-A is a satDNA that has been analyzed in many mammals through molecular comparative sequence analysis (Valeri et al. 2018), and their history has been reconstructed in mam- mals. This analysis led researchers to show that a Cap- A like sequence is present as a single monomer in most eutherians such as Chiroptera, some Eulipotyphla, and some Rodentia, and also in Homo sapiens. Indeed, in H. sapiens, it is only a sequence within the intron of the NOS1AP (nitric oxide synthase 1 adaptor protein) gene. No Cap-A like sequence was found among Mar- supialia or Monotremata, the sister clades to Eutheria, presumably due to the occurrence of low copy numbers or because the sequence has diverged (Valeri et al. 2018, Valeri et al. 2020). On the other hand, Cap-A duplica- tion and expansion have been shown in New World monkeys (NWMs); this amplification may be explained by a mechanism in which the Cap-A intronic segment was transferred to heterochromatic regions in the ances- tral Platyrrhini genome followed by a hyper-expansion through unequal crossing (Valeri et al. 2020). Comparative cytogenetics using different kinds of repetitive sequence probes mapped by fluorescence in situ hybridization (FISH) on chromosomes led us to study sequence pattern distribution among species allowing genomic comparison (Ceraulo et al. 2021 b, c). Cap-A sequence probes have been mapped by FISH in many taxa, including Primates (Valeri et al. 2018, Valeri et al. 2020), in order to study their distribution pattern. This work permits researchers to show that Cap-A is an abundant satDNA in Platyrrhini with a high accumu- lation in blocks in some genomes. In particular, Cap-A has been found in representatives of the three Platyr- rhini families (Cebidae, with the exception of Calli- trichines, Atelidae and Pitheciidae, with the exception of the Callicebus genus), with genome abundance ranging from less than 1% up to 5%, and chromosome localiza- tion which is always associated with non-centromeric constitutive heterochromatin (Valeri et al. 2018, 2020). Furthermore, intragenus research analyzing Cap-A distribution on four Saimiri species has also been per- formed (Valeri et al. 2020) showing slight pattern differ- ences between species. The fact that Cap-A is present across Platyrrhini led researchers to show its utility as a marker for chromo- some and genome evolution studies in NWMs (Valeri et al. 2018). This is especially important because of the extinction to an alarmingly large number of NWM spe- cies due to rapid habitat loss. The Cap-A sequence was first described in the tufted capuchin monkey Sapajus apella (previously classified as Cebus apella); Cap-A was identified after digestion of genomic DNA with restriction enzymes and with DNA– DNA hybridization (Malfoy et al. 1986, Fanning et al. 1993). Thus, in order to extend previous studies using Cap- A as a marker in Platyrrhines, two additional Sapajus species, S. cay paraguay and S. macrocephalus (Cebidae), were analyzed, mapping the Cap-A probe by FISH. This study will help clarify Sapajus chromosome evolution and add potentially useful data for taxonomic, systemat- ics, and conservation issues. Indeed, the cytogenetic information about Sapajus is poor, whereas more species from the phylogenetical- ly close Cebus have been analyzed (Garcia et al. 2002). The number of specimens karyotypically analyzed is low, and most samples have not been studied, especially from the recently recognized Sapajus genus. Karyotypes among the two taxa are very similar, and these species have been hypothesized to be distinguishable for the non-centromeric heterochromatin block of some chro- mosomes, with a differential chromosomal position in each of them (Mudry, 1990, Garcia et al. 2002). MATERIAL AND METHODS Peripheral blood from male samples of S. cay par- aguay and S. macrocephalus (Cebidae) was collected from primates at the ISTC-CNR of Rome, in accord- ance with international and institutional ethics rules. Metaphases were obtained from lymphoblast cell cul- tures in RPMI culture medium, following standard- ized protocols. Cell harvesting was performed after 3 h incubation with colcemid 10 μL (10 μg/mL Gibco), followed by hypotonic treatments of 0.075 M KCl for 20 min at 37 °C, following standard protocols (Dumas et al. 2022). Metaphases of the analyzed species were stained pre- and post-FISH using chromomycin A3 (CMA3) and 4’,6-diamidino-2-phenylindole (DAPI) 89Mapping CAP-A satellite DNAs by FISH in Sapajus cay paraguay and S. macrocephalus (Platyrrhini, Primates) staining, according to a recent protocol (Lemskaya et al. 2018), with some adjustments. CMA3 staining of GC-rich regions and DAPI staining of AT-rich regions were useful for identifying chromosomes and preferen- tial insertion sites of Cap-A sequences. DAPI images were inverted with a photo editing program (Adobe Photoshop C 2022 V23.3.2); inverted gray bands generally correspond to dark G-bands or light R bands; the DAPI inverted karyotypes for the S. cay paraguay and S. macrocephalus species were com- pared with previously published banded karyotypes of the phylogenetically close species S. apella and Cebus capucinus (Garcia et al. 2002, Milioto et al. 2022). Human DNA extraction from lymphoblast cell lines was performed using the Pure Link DNA kit (Invitro- gen), according to the basic DNA extraction protocol. Cap-A was amplified by Polymerase Chain Reaction (PCR) from human DNA; the following universal set of primers, developed for the PCR of CAP-1 repeats in Pri- mates, were used: (Cap-A F: ACTTCCTCACTGACCT- GTCTT; Cap-A R:GGGCTGATGCTTAATGTAGCA). Genomic DNA was amplified in 50 μL PCR-reac- tions: five units of Taq GOLD DNA Polymerase (Invit- rogen), the template DNA, 500 nM of each primer, 200 μM each of dATP, dCTP, dTTP, and dGTP in 10 mM TRIS-HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl. PCR reactions were performed using an Applied Biosystems SimplyAmp (Thermo Fisher Scientific) with the follow- ing cycling parameters: 30 cycles each of 94 °C, 60 s; 55 °C, 60 s; 72 °C, 60 s, following a 3 min denaturation at 94 and with a final elongation step of 72 °C, 10 min. A bright band of about 1500 pb was visualized on 1% aga- rose gel. The PCR products were directly labeled through Nick Translation using 11-dUTP-Fluorescein (green) (Invitrogen). FISH was performed following previously described protocols (Dumas and Sineo 2014, Dumas et al. 2015) using Cap-A probes obtained by PCR as previous described (Valeri et al. 2018, 2020). The hybridization mix consisted of 2.5 ng/L of probe, 50% formamide, 10% dextran sulfate, and 2xSSC, with an incubation time of 18 h at 37 C. Detection was performed at medium strin- gency, with washing at low temperatures (45 °C) and at high saline buffer concentration of SSC 0.1 Tween, 15 min, PBS 1min. C banding was done sequentially post-FISH through a protocol which included denaturation with formamide (Fernàndez et al. 2002). After FISH, the metaphases were analyzed under a Zeiss Axio2 epifluorescence microscope. Images were captured using a coupled Zeiss digital camera. At least ten metaphase spreads were analyzed for each sample. RESULTS Sequential staining, banding, and FISH mapping were performed for the two Sapajus species. The invert- ed DAPI karyotypes of S. cay paraguay and S. macro- cephalus were almost the same as those of the other con- generic species previously published (Garcia et al. 2002, Milioto et al. 2022), with both species having the diploid number 2n = 54; for the karyotype reconstruction, we followed a previous publication (Garcia et al. 2002), with ten pairs of meta/submetacentric chromosomes in S. cay paraguay (pairs 1–10), eight pairs in S. macrocepha- lus (1–7, 9), and fourteen and sixteen acrocentric chro- mosomes, respectively, thus differing over chromosome pairs 8 and 10, which are subtelocentric in the former and acrocentric in the latter. DAPI/CMA3 staining was helpful for identifying chromosomes and preferential sites of Cap- A insertion (Fig. 1, 2). Figure 1. Metaphases of S. cay paraguay in DAPI (a), in DAPI inverted (b), Cap-A probe mapping (c), CMA3/DAPI stains (d), the reconstructed karyotype of S. cay paraguay from the metaphase in a) after sequential CMA3/ DAPI, DAPI inverted, FISH with Cap-A probes (e). 90 Simona Ceraulo, Francesca Dumas Cap-A probe mapping revealed bright signals on the metaphases of the two species analyzed, with a similar accumulation pattern and slight differences (Fig. 1, 2): twelve signals were on six chromosome pairs: 5 acrocen- tric and a subtelocentric chromosome pairs, respectively pairs 11, 17-20 and 8. Additional signals were found on acrocentric chromosome pairs 23 in S. macrocephalus, for a total of fourteen (Fig. 2). The post-FISH C banding pattern obtained was compared with previously published C banding of phy- logenetically close species such as S. apella (Dumas et al. 2022). Chromosomes pairs with evident C bands were: 8, 11, 18-20; other C bands were at the centromeres of acro- centric chromosomes (Fig. 3), as in the previously ana- lyzed Sapajus species. DISCUSSION Cap-A satDNA have been mapped in many Mam- mals, including in Primates; previous works have shown that Cap-A is highly amplified in NWMs, localized at non-centromeric positions, with different patterns in the different Platyrrhini species (Valeri et al. 2018, 2020). To extend Cap-A distribution analysis to more primate samples, we used FISH to map Cap-A probes in two spe- cies of the genus Sapajus. In the two species, chromo- some pairs having these signals were identified as 8, 11, 17-20, (Fig. 1, 2); an additional signal was detected on chromosome pair 23 in S. macrocephalus (Fig 2); the probe signals fall on CMA3 rich regions in correspond- ence to the big interstitial C bands (Fig. 3). Our results for S. cay paraguay and S. macrocepha- lus were compared with previous Cap-A mapping data on other platyrrhine species (Sapajus xanthosternos, Saimiri boliviensis, Aotus infulatus, Alouatta guariba, Lagotrix Lagotricha, brachyteles hypoxanthus, Callice- bus nigrifrons, Chiropotes satanas, Pithecia irrorata, S. boliviensis, S. sciureus, S. vanzolinii and S. ustus) (Valeri et al. 2018, 2020). The analysis of the results compared with the one from the previous species of the same genus S. xanthos- ternos permitted us to hypothesize that the same chro- mosome pairs would have these signals. Indeed, in S. xanthosternos, six pairs showed signals plus an addtional Figure 2. Metaphases of S. macrocephalus in DAPI (a), in DAPI inverted (b), Cap-A probe mapping (c), CMA3/DAPI stains (d), the reconstructed karyotype of S. macrocephalus from the metaphase in a) after sequential CMA3/ DAPI, DAPI inverted, FISH with Cap-A probes (e). Figure 3. Metaphases of S. cay paraguay with C bands. Example of representative chromosome pairs with evident bands are indicated with numbers. 91Mapping CAP-A satellite DNAs by FISH in Sapajus cay paraguay and S. macrocephalus (Platyrrhini, Primates) on a single chromosome, for a total of thirteen signals. Whereas twelve signals were detected on chromosome pairs in S. cay paraguay: on acrocentric chromosome pairs 11, 17-20, and on the subtelocentric chromosome pair 8; moreover, additional signals were found on the acrocentric chromosome pair 23 in S. macrocephalus, with a total of fourteen Cap-A signals. However, one pair seems to have a different Cap-A pattern; indeed, in the previously analyzed S. xanthos- ternos species, the Cap-A probe signal covers both arms, almost all the q and the p arm, while in S. cay paraguay and S. macrocephalus all the Cap-A probe signals cover just part of the q arm. This difference could presum- ably be due to an intrachromosomal rearrangement such as an inversion that has amplified and dislocated the sequences differently (presumably on the subtelocentric/ acro chromosome pair 8). Analyzing our results in relation to all the previ- ous available data from different taxa (Valeri et al. 2018, 2020), it is possible to underline that Cap-A localiza- tion has high interspecific repeat homogeneity within a genus; indeed, the Saimiri species have almost the same chromosomes harboring the Cap-A sequences, with slight differences (Valeri et al. 2020), as it also occurs in the species from the Sapajus genus as shown above. Cap-A probe signals are abundant, around fourteen or fifteen, among Saimiri species and are, in the distal regions of the short arms, and in the interstitial hetero- chromatin of five to seven chromosome pairs. Among Saimiri species, signals are on the same chromosome pairs, while others are additional or absent in same specimens. This slightly different location of the Cap-A probe found between the Samiri species is particularly evident, especially on chromosomes involved in rear- rangements, such as chromosomes 5 and 15. These dif- ferences in the Cap-A hybridization pattern in squirrel monkeys has been reported in captivity and in nature; for this reason, it has been hypothesized that Cap-A mapping patterns may be useful in revealing the ori- gin of chromosome sets in hybrids more precisely than chromosome morphology or banding patterns (Valeri et al. 2020). The link between Cap-A distribution and rear- rangements in Saimiri is in agreement with the differ- ent Cap-A position shown on subtelocentric chromo- some between the Sapajus species analyzed here and the previously analyzed S. xanthosternos (Valeri et al. 2018). Furthermore, Saimiri species also show addition- al chromosomes with Cap-A signals, just as it occurs on S. microcephalus in our study. Thus, it can be con- firmed the hypothesis that new acquisition of Cap-A occurs; it is presumably due to unequal crossing-over and concerted evolution as previous suggested (Sander Lower et al. 2018). We observed a slight, variable chromosomal locali- zation of Cap-A signals among the species of the Sapajus genus, thus we hypothesized that these differences can be used as taxonomic markers for species identification, in agreement with what was previously shown among Saimiri species. This evidence is in agreement with the hypothesis that satDNA sequences, in general, can be used as cytogenetic markers facilitating species iden- tification in many taxa (Prakhongcheep et al. 2013 a,b, Cacheux, et al. 2018). Furthermore, through the classic cytogenetic approach, detecting heterochromatin with differential chromosomal position has already been hypothesized as distinguishing species (Mudry, 1990, Garcia et al. 2002). The correspondence of the Cap-A signal with hetero- chromatin block extends the hypothesis regarding the possibility of distinguishing species not only by C bands but also through the Cap-A pattern. In conclusion, this work demonstrates the presence of Cap-A satellite sequences on chromosomes of Sapa- jus genomes, with a genus specific pattern interstitially in correspondence with C and CMA3 rich regions, but with slight species-specific patterns that can be useful as phylogenetic and taxonomic markers. ACKNOWLEDGEMENTS We are grateful to Elsa Addessi, Serena Gastaldi, and Arianna Manciocco for providing the Sapajus blood samples from primates of the ISTC-CNR of Rome, Italy. LITERATURE CITED Ahmad SF, Singchat W, Jehangir M, Suntronpong A, Pan- thum T, Malaivijitnond S, Srikulnath K. 2020. Dark Matter of Primate Genomes: Satellite DNA Repeats and Their Evolutionary Dynamics. Cells, 9, 2714. doi. org/10.3390/cells9122714. Cacheux L, Ponger L, Gerbault-Seureau M, Loll F, Gey D, Richard FA, Escudé C. 2018. The targeted sequencing of alpha satellite DNA in Cercopithecus pogonias pro- vides new insight into the diversity and dynamics of centromeric repeats in old world monkeys. Genome Biol. Evol.,10, 1837–1851. Ceraulo S, Milioto V, Dumas F. 2021. Centromeric enrichment of LINE-1 retrotransposon in two spe- cies of South American monkeys Alouatta belzebul and Ateles nancymaae (Platyrrhini, Primates). Caryo- 92 Simona Ceraulo, Francesca Dumas logia, 74, 111–119. https://doi.org/10.36253/caryolo- gia-1296. Ceraulo S, Perelman LP, Mazzoleni S, Rovatsos M, Dumas F. 2021. Repetitive Sequence Distribution on Saguinus, Leontocebus and Leontopithecus Tama- rins (Platyrrhine, Primates) by Mapping Telomeric (TTAGGG) Motifs and rDNA Loci. Biology, 10, 844. https://doi.org/10.3390/biology10090844 Ceraulo S, Perelman PL, Dumas F. 2021. Massive LINE-1 retrotransposon enrichment in tamarins of the Cebi- dae family (Platyrrhini, Primates) and its significance for genome evolution. J. Zool. Syst. Evol. Res., 59, 2553–2561 https://doi.org/10.1111/jzs.12536 Dumas F, Perelman PL, Biltueva L, Roelke ME. 2022. Retrotransposon mapping in spider monkey genomes of the family Atelidae (Platyrrhini, Primates) shows a high level of LINE-1 amplification. J Biol Res doi: 10.4081/jbr.2022.10725 Dumas F, Sineo L, Ishida T. 2015.Taxonomic identifica- tion of Aotus (Platyrrhinae) through cytogenetics| Identificazione tassonomica di Aotus (Platyrrhinae) mediante la citogenetica. J. Biol. Res 88: 65-66. Dumas F, Sineo L. 2014. The evolution of human synteny 4 by mapping sub-chromosomal specific probes in Primates. Caryologia. 67, 281–291. https://doi.org/10 .1080/0144235X.2014.974357. 30. Fanning TG, Seuanez HN, Forman L. 1993. Satellite DNA sequences in the new World primate Cebus apella (Platyrrhini, Primates). Chromosoma 102,306– 311. (doi:10.1007/BF00661273) Fernàndez R, Barragàn M, Bullejos M, Marchal J, Diaz de la Guardia R, Sanchez A. 2002. New C-band pro- tocol by heat denaturation in the presence of forma- mide. Hereditas 137, 145–148. https://doi.org/10.1034 /j.1601-5223.2002.01672 Garcia F, Ruiz-Herrera A, Egozcue J, Ponsa M, Garcia M. 2002. Chromosomal homologies between Cebus and Ateles (Primates) based on ZOO-FISH and G-banding comparisons. Am. J. Primatol. Off. J. Am. Soc. Prima- tol. 57, 177–188. https://doi.org/10.1002/ajp.10047. Lemskaya NA, Kulemzina AI, Beklemisheva VR, Biltueva LS, Proskuryakova AA, Hallenbeck JM, Graphodat- sky AS. 2018. A combined banding method that allows the reliable identification of chromosomes as well as differentiation of AT-and GC-rich heterochro- matin. Chromosome Res., 26, 307–315. https://doi. org/10.1007/s10577-018-9589-9. Malfoy B, Rousseau N, Vogt N, Viegas-Pequignot E. 1986 Nucleotide sequence of a heterochromatic segment recognized by the antibodies to Z-DNA in fixed met- aphase chromosomes. Nucleic Acids Res. 14, 3197– 3214. doi:10.1093/nar/14.8.3197 Milioto V, Perelman P L, Paglia LL, Biltueva L, Roelke M, Dumas, F. 2022. Mapping Retrotransposon LINE- 1 Sequences into Two Cebidae Species and Homo sapiens Genomes and a Short Review on Primates. Genes, 13(10), 1742. Prakhongcheep O, Chaiprasertsri N, Terada S, Hirai Y, Srikulnath K, Hirai H, Koga A. 2013. Heterochroma- tin blocks constituting the entire short arms of acro- centric chromosomes of Azara’s owl monkey: Forma- tion processes inferred from chromosomal locations. DNA Res., 20, 461–470. Prakhongcheep O, Hirai Y, Hara T, Srikulnath K, Hirai H, Koga A. 2013. Two types of alpha satellite DNA in distinct chromosomal locations in Azara’s owl mon- key. DNA Res., 20, 235–240. Prakhongcheep O, Thapana W, Suntronpong A, Sing- chat W, Pattanatanang K, Phatcharakullawarawat R, Muangmai N, Peyachoknagul S, Matsubara K, Ezaz T et al. 2017. Lack of satellite DNA species-specific homogenization and relationship to chromosomal rearrangements in monitor lizards (Varanidae, Squa- mata). BMC Evol. Biol., 17, 193. Sander Lower S, McGurk MP, Clark AG, Barbash DA. 2018. Satellite DNA evolution: old ideas, new approaches, Current Opinion in Genet- ics & Development,Volume 49,, Pages 70-78,ISSN 0959-437X,https://doi.org/10.1016/j.gde.2018.03.003. Valeri M, Dias GB, Moreira CN, Yonenaga-Yassuda Y, Stanyon R, Svartman M. 2020. characterization of Satellite DNAs in Squirrel Monkeys genus Saimiri (cebidae, platyrrhini). Scientific reports, 10 (1), 1-11. Valeri MP, Dias GB, Pereira VDS, Campos Silva Kuhn G, Svartman, M. 2018. A eutherian intronic sequence gave rise to a major satellite DNA in Platyrrhi- ni.  Biology letters,  14(1), 20170686. http://dx.doi. org/10.1098/rsbl.2017.0686 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 75, Issue 3 - 2022 Firenze University Press