Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 76(3): 39-49, 2023 Firenze University Press www.fupress.com/caryologia ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-2279 Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Citation: Giovino, A., Marchese, A., Bonanno, F., Sala, G., Marra, F.P., & Domina, G. (2023). Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) acces- sions. Caryologia 76(3): 39-49. doi: 10.36253/caryologia-2279 Received: August 7, 2023 Accepted: December 14, 2023 Published: February 29, 2024 Copyright: © 2023 Giovino, A., Marchese, A., Bonanno, F., Sala, G., Marra, F.P., & Domina, G. This is an open access, peer-reviewed article published by Firenze University Press (http://www. fupress.com/caryologia) and distrib- uted under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, pro- vided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions Antonio Giovino1, Annalisa Marchese2,*, Floriana Bonanno1, Giovan- na Sala2, Francesco Paolo Marra3, Gianniantonio Domina2 1 Council for Agricultural Research and Economics (CREA), Research Centre for Plant Protection and Certification (CREA-DC), 90128 Palermo, Italy 2 Department of Agricultural, Food and Forest Sciences, University of Palermo, Viale delle Scienze– Ed. 4, 90128 Palermo, Italy 3 Department of Architecture (DARCH), University of Palermo, Viale delle Scienze—Ed. 8, 90128 Palermo, Italy *Corresponding author. E-mail: annalisa.marchese@unipa.it Abstract. The evergreen carob tree (Ceratonia siliqua) is considered one of the oldest trees in the world, cultivated since ancient times in the Mediterranean Basin, for its edible and high nutritional fruits, adapted to human and animal consumption. Spain is the main producer, followed by Italy, Portugal, Greece, Morocco, and Turkey. In Italy, the cultivation of carob is concentrated in a few provinces and insists on an area of more than 5,500 hectares. In this work 19 accessions, showing interesting fruit traits were analysed morphologically and genetically. Overall, 13 quantitative characters were considered regarding leaf (5 characters), pod (5) and seed (3). To investigate the genetic diversity 8 fluorescently labelled SSR primers were used, indicated as polymor- phic in the literature. A UPGMA dendrogram was constructed to depict identity cas- es and relationships among the accessions. Clustering showed discrimination among accessions from Eastern and Western Sicily. The morphological characterisation does not clearly discriminate any of the cultivars recognized by the growers, similarly, the molecular analysis showed a reduced level of diversity. Since most of these local acces- sions are of unknown origin and that they are representative of the local germplasm they still warrant protection for their economic and environmental value. Keywords: carob tree, morphological analysis, microsatellites or SSR markers, genetic diversity, conservation. INTRODUCTION The evergreen and rustic carob tree, Ceratonia siliqua L., a diploid spe- cies (2n = 48) belonging to the Fabaceae family, is grown since ancient times in most countries of the Mediterranean basin for economic and environmen- tal value. This tree characterizes the Mediterranean vegetation and landscape. In the Mediterranean area, pastures with carob trees were traditional agro-sil- http://www.fupress.com/caryologia https://doi.org/10.36253/caryologia-2279 https://doi.org/10.36253/caryologia-2279 http://www.fupress.com/caryologia http://www.fupress.com/caryologia mailto:annalisa.marchese@unipa.it 40 Antonio Giovino et al. vo-pastoral systems, representing multifunctional sys- tems that can contribute to the preservation of agrobio- diversity and traditional knowledge (Venturi et al. 2022). Carob trees planted with other trees such as olive, fig, grapevines, or almonds and with annual perennial crops between the rows represents an agroforestry practice aiming at integrating woody perennials and an agricul- tural crop growing as part of the understory. The carob tree can thrive in calcareous and dry soils (Batlle 1997; Tous et al. 2013), making the species suitable for the valorization of marginal areas for agri- culture. Its fruits (pods) are legumes and can have elon- gated, compressed, or curved shapes (Batlle 1997), they are rich in nutritional values and bioactive molecules properties, showing a wide range of biological properties with important health-promoting effects (prevention of cancers, lowering of LDL cholesterol, antidiabetic effects) (Avallone et al. 1997; Zunft et al. 2003; Goulas et al. 2016; Theophilou et al. 2017). Carob seeds can be used to produce carob bean gum, a food-thickening agent (Bou- zouita et al. 2007; Kyratzis et al. 2019). The carob is considered native to the Eastern Medi- terranean and it was mainly spread in cultivation in the Western Mediterranean countries by Greeks, and Romans who selected and propagated genotypes by sci- on grafting (Baumel et al. 2022). Anyway, multiple ori- gins of domestication were identified both in the Eastern and Western Mediterranean Basin (Baumel et al. 2022). The differences between cultivated varieties and wild progenitors are relative to the size and position of fruits (La Malfa et al. 2007). The cultivation in specialized orchards has taken place only recently, because in the past carob cultivation essentially comprised wild root- stocks distributed naturally and randomly grafted with phenotypes of selected scions (La Malfa et al. 2014). Spain is the main producer of Carob followed by Ita- ly, Portugal, Greece, Morocco, and Turkey (Batlle 1997; Bulca 2016). Nowadays in Italy, carob cultivation is prevalent in South-eastern Sicily, in the provinces of Syracuse and Ragusa, where it has represented an important economic resource for centuries. In the Monti Iblei (South-eastern Sicily) the enclosed fields with carob trees are included in the “National Catalogue of Historical Rural Land- scapes” where a dense network of low walls marks out plots where carob trees provide food and shade to live- stock left grazing there after the wheat harvest (Agno- letti, 2011; 2013). Carob pods in Sicily are directly marketed or trans- formed into derivatives for animal or human feed (Caru- so et al. 2008; La Malfa et al. 2012). In the last twenty years, on the island, the demand for carob has under- gone a transformation moving from products exclusive- ly for animal feed and widespread culinary traditions towards a sought-after product (chocolate, liqueurs, and cough sweets) thanks to local companies that improved the processing of carob. According to the latest pub- lished statistical data, carob cultivation in Sicily con- cerns about 5,415 ha (ISTAT 2022). In Sicily, the carob genotypes were introduced at different times by Phoenicians, before the Greek and Roman dominations and later during the Arab domina- tion (Ramón-Laca and Mabberley 2004; Baumel et al. 2022). The Sicilian carob germplasm includes peculiar cultivars multiplicated by seeds or grafted. In the field farmers in general grow few phenotypes. Different studies have been performed on carob genetic diversity by using different molecular markers (Barracosa et al. 2008; Caruso et al. 2008; La Malfa et al. 2014; Viruel et al. 2018; Di Guardo et al. 2019; Kyratzis et al. 2019; Baumel et al. 2022). Similarly, many studies have been conducted to check the nutritional composi- tion of carob products (Avallone et al. 1997; Zunft et al. 2003; Bouzouita et al. 2007; Bulca, 2016; Goulas et al. 2016; Theophilou et al. 2017). Although among the molecular markers, micros- atellite or SSR (Simple Sequence Repeats) represent the marker of choice for fingerprinting study and a pow- erful instrument for germplasm management, allow- ing diversity assessment among standardized databases (e.g. peach – Marchese et al. 2005; palm – Giovino et al. 2021, 2023; fig – Costa et al. 2017; apple – Venison et al. 2022; sweet cherry – Ordidge et al. 2021; Trifonova et al. 2021; almond – Dangl et al. 2009; Cimò et al. 2017; hazelnut – Fiore et al. 2022; olive – Atrouz et al. 2021; Marchese et al. 2023), in the carob species La Malfa et al. (2014) found low genetic diversity by using a set of EST- SSR. Viruel et al. (2018) tried to improve the detection of diversity by using next-generation sequencing of SSR loci, screening populations throughout the Mediterrane- an Basin – from Spain, Greece, Lebanon, and Morocco. They found hidden SNP mutations in the SSR amplicons which can be considered an additional source of genetic variation, however, the differences among populations were not so large. The purpose of the current study was to characterize carob accessions from Sicilian farms using morphologi- cal and SSR markers to detect the level of diversity and for conservation purposes. 41Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions MATERIALS AND METHODS Plant material The specimens used for morphological statisti- cal analysis and molecular analysis were collected in the private farms and the regional collection field and voucher specimens were deposited in herbarium SAAF- University of Palermo. A total of 19 accessions were geo- referenced and collected from local farms (Table 1, Fig- ure 1). Morphological characterization Overall, 14 accessions were used for morphological analysis (Table 1). For each accession, 10 measurements were taken for each quantitative character on 3 different samples. Overall, 15 descriptors were considered regard- ing leaf (6 characters), pod (5), and seed (4) based on carob descriptors developed by Batlle and Tous (1997) (Table 2). A principal component analysis (PCA) and a discri- minant analysis (DA) were performed, following Boyd (2002), Giovino et al. (2015), and Domina et al. (2017; 2022). The PCA was based on logarithmic values of con- tinuous quantitative characters, using PAST version 4.11 (Hammer et al. 2001; Hammer et al. 2022). The DA, with the individuals a priori assigned to the postulated culti- vars, was performed on continuous and discrete numeri- cal characters. Each of the 13 continuous characters was also subjected to univariate analysis. Table 1. Carob trees accessions analyzed in this study. Code Accession Country Geographic coordinates Morphological analysis Molecular analysis Voucher 1 Cicero Italy 36° 51’ 09” N 14° 55’ 05” E X X SAF100086 2 Fratantonio_E Italy 36° 53’ 10” N 14° 54’ 25” E X X SAF100087 3 Fratantonio_G Italy 36° 48’ 24” N 14° 54’ 20” E X X SAF100088 4 Fratantonio_S Italy 36° 53’ 33” N 14° 54’ 14” E X X SAF100089 5 Iacono Italy 36° 50’ 42” N 14° 34’ 07” E X X SAF100090 6 Licitra Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100091 7 Maltese Italy 36° 46’ 49” N 14° 42’ 54” E X X SAF100092 8 Racemosa Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100093 9 Scrofani Italy 36° 51’ 10” N 14° 41’ 40” E X X SAF100094 10 Tantillo Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100095 11 Tenuta Chiaramonte Italy 36° 50’ 00” N 14° 38’ 27” E X X SAF100096 12 Latinissima Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100097 13 Pasta Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100098 14 Saccarata Italy 36° 52’ 49” N 14° 54’ 17” E (collection field) X X SAF100099 15 Torretta Italy 36°86’56.17”N 14°83’70.71”E X SAF100100 16 Terrasini Italy 36°86’55.48”N 14°83’75.43”E X SAF100101 17 Cinisi Italy 36°86’55.48”N 14°83’75.43”E X SAF100102 18 NA CAR Israel X SAF100103 19 Israel CAR Israel X SAF100104 42 Antonio Giovino et al. Genomic DNA Extraction and SSR genotyping Overall, 19 accessions were used for molecular analy- sis (Table 1). Genomic DNA extraction was performed from young leaves by using the Doyle and Doyle protocol (1987). DNA quantifications were carried out with Nan- oDrop 1000 Spectrophotometer and dilution were made to the final concentration of 150 ng/μl. Eight Single Sequence Repeats (SSRs) loci were chosen: Cesi_98_gct6; Cesi_187_ at15; Cesi_673_ct9; Cesi_722_ag9; Cesi_976_ta5tg6 and Cesi_1187_at9 reported by La Malfa et al. (2014), and two C09 and C24 developed by Viruel et al. (2018) following number and range of expected alleles, reported heterozy- gosity in the literature, to set multiplexes PCR reactions. For multiplexing, the SSR loci were used for the amplifi- cation of eight genotypes and once detected their expected allele size range in comparison with the literature. Fluores- cent dyes (FAM, HEX, NED, and PET; Life Technologies, Thermo Fisher, Foster City, CA, USA) were used for each locus, and multiplexes PCR were developed, and the mark- ers used are shown in Table 3. Figure 1. Location sites of carob trees where accessions were sampled (yellow pointer) and of regional collection field (red star). Table 2. Morphological traits among studied Ceratonia siliqua accessions. Descriptor Type Leaf No. leaflets discrete leaflet length mm, continuous leaflet width mm, continuous leaf axis length mm, continuous Distance of the first pair of leaflets from the base mm, continuous leaflets petiole length mm, continuous Pod length mm, continuous width mm, continuous edge thickness mm, continuous groove thickness mm, continuous pod weight gr, continuous Seed length mm, continuous width mm, continuous thickness mm, continuous No. seeds per Pod discrete 43Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions The PCR reactions were performed in 8 μl reactions containing 1.5 ng template genomic DNA, 1 x Multiplex PCR master mix (Qiagen) and 0.2 μM of each primer on a Geneamp Pcr System 9700 Thermocycler (Thermo Fisher) using the following touch-down protocol: initial denaturation at 95°C for 5 minutes followed by 10 cycles of 95°C for 45 s, 65°C for 30 s with a reduction in tem- peratures of 1°C per cycle and 72°C for 45 s, then 25 cycles of 95°C for 45 s, 55°C for 30 s, 72°C for 45 s. The final extension was performed at 72°C for 30 minutes. The SSR analysis was performed with an ABI 3135xl Genetic Analyzer (Applied Biosystems, Thermo Fisher, Foster City, CA, USA), using ABI GeneScan and Geno- typer software for allele sizing and scoring. SSR diversity analysis By analyzing SSR in a plant’s genome, research- ers can create a unique fingerprint for that species and use it to identify and differentiate it from other closely related species. SSRs have been successfully used for the identification of genetic diversity between cultivars of the same species (Glynn et al. 2009; Marra et al. 2013; Fiore et al. 2022). The SSR data were analyzed using the software package Cervus 3.0 (Kalinowski et al. 2007). The total number of alleles (Na), the number of effective alleles (Ne), Polymorphic Information Content (PIC), He and Ho, and null alleles were computed. A UPGMA dendrogram was constructed by using the software Darwin6 (Perrier and Jacquemoud-Collet 2006). RESULTS Morphological analysis Leaf width and length ranged from 27.4 mm (Scro- fani) to 46.3 mm (Latinissima) and from 41.5 mm (Scro- fani) to 67.6 mm (Tantillo), respectively. The number of leaflets/leaves was found between 7.6 and 9.9. The aver- age pod dimensions (width, length, and thickness) were found between 20 and 26.1 mm, 130.3 and 232 mm and 6-11 mm for the accessions. The pod weight was variable and ranged from 14.7 g (Tantillo) to 50.1 g (Saccarata) among genotypes (Table 4). Figure 2 shows the quality of representation of the variables by cos2. The results of PCA indicated that the first two principal components explained 68% of the data variability, the plot shows the loading of each stud- ied variable (arrows), and the arrow lengths approximate their variance, whereas the angles between them repre- sent their correlations. The seed characters are positively correlated, they are grouped together, and on the oppo- site side there are the leaves descriptors. The seed length was positively correlated with pod thickness and nega- tively correlated with the number of leaflets. Further- more, pod weight is negatively correlated with the leaflet Table 3. Specific biomarkers for the determination of intraspecific variability Marker Sequence 5’-3’ Cesi_976F TCCTGAAGGCTGAAGATGATG Cesi_976R CAAACCAATGAAGGGCTCTA Cesi_98F GCCACCACTTTGAAGGAAGA Cesi_98R GCTAGAAGCAGGAGCAGGAG Cesi_1187F TTCTCGTCGCCCAAACTG Cesi_1187R CTCCCTCATCTCCTTCGTTG Cesi_187F ATAACTGGGCGTTCTTTGCTT Cesi_187R ATTATCTCTTGCTTTGTGGTCCT Cesi_509_F GCCACCTCTCCCTCTTCTC Cesi_509_R TTTTGTTCTAATTTTGCTTGCA Cesi_673F GAATAGGGCAGAGAGAACAGG Cesi_673R TCAAAGGAAGATGAGAAAGAAATCC Cesi_722F AGGCTCACACGAAACCCTAA Cesi_722R CTGCCACAAGATGATAGATTTG VirC-09_F AAGACTCGGCAGCATCTCCAGGCTTTGTAGCTGCCCATTG VirC-09_R GCGATCGTCACTGTTCTCCAGAAGGTTGGATAGCGTCCTG VirC-24_F AAGACTCGGCAGCATCTCCAAGCTGCAATTTGAGGAATAAAGC VirC-24_R GCGATCGTCACTGTTCTCCAACATCCAAAACCCTAGAGCAAG 44 Antonio Giovino et al. length and width. The trait correlations are also indicat- ed using absolute Pearson correlation coefficients, with red shades indicating high absolute correlation and blue shades indicating low absolute correlation (Figure 3). We found a negative correlation between seed length and the number of seeds in the pod and a positive correlation between leaflets length and leaf axis length. No continuous numerical morphological charac- ter discriminates the single cultivars since all the values overlap. Both the PCA and the DA are of little signifi- cance because they represent a small portion of the vari-Ta bl e 4. L ea f, po d an d se ed d es cr ip to rs o f c ar ob a cc es sio ns .   Le afl et s Po d Se ed N . L ea fle ts le ng th (m m ) w id th (m m ) le af a xi s le ng th (m m ) di st an ce fi rs t pa ir le afl et s fr om th e ba se pe tio le le ng th (m m ) po d w ei gh t (m m ) le ng th (m m ) w id th (m m ) gr oo ve th ic kn es s 1 (m m ) gr oo ve th ic kn es s 2 (m m ) N . s ee ds pe r p od (m m ) le ng th (m m ) w id th (m m ) th ic kn es s (m m ) C ic er o 8. 4 49 .4 36 .3 95 .8 23 .4 2. 6 25 .8 13 9. 0 24 .4 9. 4 4. 7 13 .3 8. 8 6. 2 2. 3 Fr at an to ni o_ E 8. 3 52 .5 39 .8 11 2. 4 26 .3 2. 7 32 .2 14 1. 5 26 .1 11 .4 5. 0 12 .0 9. 3 6. 8 2. 5 Fr at an to ni o_ G 8. 0 55 .2 38 .2 98 .5 24 .7 2. 5 19 .2 13 2. 2 23 .3 9. 9 5. 5 12 .0 8. 3 6. 0 2. 5 Fr at an to ni o_ S 8. 9 43 .0 29 .4 88 .6 19 .5 2. 5 38 .0 15 6. 7 24 .7 8. 3 5. 7 13 .0 9. 7 7. 0 3. 0 Ia co no 7. 6 42 .7 34 .1 68 .3 23 .5 2. 5 36 .1 14 2. 2 23 .7 10 .2 6. 0 13 .0 10 .0 7. 3 2. 8 Li ci tr a 7. 6 42 .7 34 .1 68 .3 23 .5 2. 5 36 .1 14 2. 2 23 .7 10 .2 6. 0 13 .0 10 .0 7. 3 2. 8 M al te se 8. 8 46 .1 35 .7 10 3. 0 21 .8 2. 3 24 .9 13 1. 1 25 .2 10 .1 5. 3 12 .0 9. 8 6. 7 2. 7 Ra ce m os a 8. 8 54 .9 42 .6 11 2. 8 23 .4 2. 5 29 .1 15 0. 0 20 .0 6. 0 4. 5 13 .0 7. 0 4. 5 2. 0 Sc ro fa ni 8. 7 41 .5 27 .4 90 .8 19 .3 2. 3 17 .2 13 3. 5 21 .8 7. 6 5. 5 13 .5 8. 3 5. 8 3. 3 Ta nt ill o 8. 6 67 .6 45 .7 13 5. 1 30 .9 2. 5 14 .7 14 5. 0 20 .0 8. 5 5. 0 15 .0 9. 5 7. 0 3. 0 Te nu ta C hi ar am on te 7. 8 48 .1 33 .6 97 .6 24 .0 2. 5 27 .2 13 0. 3 23 .9 9. 9 6. 2 12 .7 9. 3 7. 0 2. 8 La tin iss im a 9. 4 58 .9 46 .3 14 0. 5 26 .5 3. 1 36 .6 15 2. 5 23 .0 8. 3 4. 8 12 .0 10 .5 8. 0 3. 3 Pa st a 9. 9 47 .7 30 .5 13 1. 6 26 .7 2. 7 38 .1 23 2. 0 25 .7 9. 4 5. 0 15 .0 8. 8 7. 8 3. 3 Sa cc ar at a 9. 2 53 .4 42 .5 13 8. 7 30 .0 3. 2 50 .1 15 5. 0 25 .0 10 .0 6. 0 11 .0 10 .0 7. 5 3. 0 Figure 2. Biplot illustration of PCA analysis, squared cosine (cos2) shows how accurate the representation of our variables or individu- als on the PC plane. Figure 3. Correlation matrix of different descriptor in different accession of carob tree. 45Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions ability. The PCA done on the complete dataset (Figure 4) shows an almost complete overlapping of all examined accessions. The DA on the complete dataset discriminates only the accessions “Iacono” and “Pasta” (Figure 5). SSR marker diversity The 8 SSR markers used in this analysis showed a low level of polymorphism; the mean number of alleles per locus resulted 3.875; the mean proportion of loci typed was 0.8750; the mean expected heterozygosity was 0.5029 and the mean polymorphic information content (PIC) was 0.4129. The most polymorphic primer pair was Cesi_187 which amplified 6 alleles, while Cesi_722 and Cesi_1187 only three alleles. The Primer Cesi_673 resulted monomorphic thus it was eliminated from the cluster analysis. Figure 4. Principal Component Analysis based on the 13 continuous morphological characters, with groups corresponding to the 18 stud- ied accessions. PC1: Eigenvalue 0.0367, % variance 32.969; PC2: Eigenvalue 0.0293, % variance 26.284. Figure 5. Discriminant analysis (DA), based on the 15 considered morphological characters with groups corresponding to the nine studied taxa. Axis 1: Eigenvalue 31.498, % variance 22.37; Axis 2 Eigenvalue 21.532, % variance 28.97. 46 Antonio Giovino et al. Cluster analysis As depicted in the UPGMA dendrogram, based on 7 SSRs, as Cesi_673 was monomorphic, constructed with the Dice dissimilarity index by using DARwin 6 soft- ware (CIRAD), only 9 accessions studied were discrimi- nated, while most were undiscriminated (Figure 6). DISCUSSION The carob species represents a genetic resource of adaptation to the environmental and dry climatic condi- tions of Sicily, which is the leading Italian region for carob production, producing 98% of the Italian carobs, account- ing for 35,0838 tons (ISTAT 2022). Carob pods are mainly produced in Ragusa areas in the south-eastern part of Sic- ily, where the most common varieties are “Latinissima” (or known synonyms “Giubiliana”, “Cipriana”, “Cipriota”, “Masculina”), Racemosa (or “Moresca”, “Spada”, “Sciabu- lara”), Saccarata (or “Latina”, “Fimminedda”, “Milara”) (Caruso et al. 2006, Blangiforti et al., 2022). Most carob present in specialized orchards are now- adays grafted trees; the grafted carob trees improve phe- notypic traits: fleshiness, size and sweetness of the pod and productivity (Batlle and Tous 1997; Tous et al. 2013). Female cultivars are the most important trees in com- mercial orchards in Mediterranean countries (Albanell et al. 1996) appreciated for their pods and seeds employed as raw materials in the food, pharmaceutical and cosmetic industries (Vourdoubas et al. 2002). Carob pods have been investigated as a material for bioethanol production (Biner et al. 2007). The carob characterization can be performed at both the morphological and genetic levels. In our study, all the accessions were female, and it was evident the low phenotypical diversity among them that was almost overlapping. The DA analysis enabled the discrimina- tion of only the accessions Iacono and Pasta. Barbagallo et al. (1997) recorded that pod size and numbers of nor- mal and aborted seeds were the characters with a certain degree of polymorphism in analyzing a survey of sixteen Sicilian carob cultivars. They recognized cultivar groups according to a geographic criterion. Our accessions, in general, showed many leaflets between 7.6 and 9.9 with higher values than the num- ber reported by Korkmaz et al., (2020) analyzing Turkish genotypes where it ranged from 5.9 to 7.1. Regarding the morphological character of pod carob cultivars in Sic- ily, La Malfa et al. (2012) reported average pod weight, pod width, pod length, and pod thickness as 13.7–33.4 g, 19.3–26.8 mm, 14.9–22.9 cm and 6.8–14.0 mm, respec- tively, which is in accordance with our study. Similarly, our dendrogram (Figure 6) showed a lim- ited SSR variability. The most diverse accessions were Terrasini_1, Maltese_2, Cinisi_3, NA_RAC_AG, and Figure 6. Dendrogram of 19 carob accessions based on simple matching coefficients. 47Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions Pasta_1, mostly from Western Sicily. Three groups of identity were found: Saccarata/ Cicero_2; a group of Latinissima_1 accessions and a group of Latinissima_2/ Racemosa/Maltese accessions closely related to a plant derived from a seed originated in Israel and Frantanto- nio_G2. Clustering showed discrimination among acces- sions from Eastern Sicily and Western Sicily. As observed for the whole Mediterranean area (Baumel et al. 2022), the morphological and genetic diversity recorded in the Sicilian carob accessions turned out to be very low. Sicilian farmers can distinguish vegetatively or sex- ually propagated accessions to which local names are given but the analysis of this germplasm has shown that the morphological and genetic variations are minimal. The low level of diversity within a given geographic area can be explained by the asexual propagation of selected clones (La Malfa et al. 2014). However, considering that most of the local accessions are of unknown origin and that they are representative of a typical germplasm they still deserve attention and protection. Baumel et al. (2022) also observed higher genetic variability in the eastern and western Mediterranean basin and lower in the central Mediterranean. Further molecular analysis including SNP sequencing may better shed light on the carob genetic diversity and origin. Nonetheless, given the multiple origins of domes- tication and the presence of haplotypes peculiar to the central Mediterranean (Baumel et al. 2022), the knowl- edge and conservation of the Sicilian germplasm is found to be extremely important for the conservation of carob biodiversity to protect both the agro-forest ecosys- tem and landscape of Mediterranean region. The cultiva- tion of this multi-functional tree is ideal for agricultural diversification in semi-arid areas therefore in the next coming year it is expected to increase due to climate change, considering its resistance to drought, high rus- ticity, low requirements for orchard management, and low environmental footprint (Zemouri et al. 2020; Tza- tzani et al. 2023). ACKNOWLEDGMENTS This work was supported by ‘PSR SICILIA 2014- 2020 – Programma di Sviluppo Rurale – Misura 16 – Cooperazione – Sottomisura 16.1 – “Sostegno per la costituzione e la gestione dei gruppi operativi del PEI in materia di produttività e sostenibilità dell’agricoltura” – Gruppo Operativo: ATS GO CARRUBO – Project Title: “SISTEMI INNOVATIVI PER LO SVILUPPO DELLA FILIERA DEL “CARRUBO” for the technical support. We gratefully thank Daniela Trippa for her help in the laboratory activity. REFERENCES Atrouz K, Bousba R, Marra FP, Marchese A, Conforti FL, Perrone B, Harkat H, Salimonti A, Zelasco S. 2021. Algerian olive germplasm and its relationships with the Central-Western Mediterranean varieties contrib- utes to clarify cultivated olive diversification. Plants 10(4):678. https://doi.org/10.3390/plants10040678 Avallone R, Plessi M, Baraldi M, Monzani A. 1997. Determination of chemical composition of carob (Ceratonia siliqua): protein, fat, carbohydrates, and tannins. J food Compos Anal. 10(2):166–172. https:// doi.org/10.1006/jfca.1997.0528 Agnoletti M. (Editor) 2011. Paesaggi rurali storici: per un catalogo nazionale. Roma; Laterza. Agnoletti M. (Editor) 2013. Italian historical rural land- scape. Cultural Values for the Environment and Rural Development; Springer Dordrecht, The Netherlands. https://doi.org/10.1007/978-94-007-5354-9 Albanell E, Caja G, Plaixats J. 1996. Characterization of carob fruits (Ceratonia siliqua L.), cultivated in Spain for Agroindustrial use. Int. Tree Crops J. 9:1-9. htt- ps://doi.org/10.1080/01435698.1996.9752955 Barbagallo MG, Di Lorenzo R, Meli R, Crescimanno FG. 1997. Characterization of carob germplasm (Cerato- nia siliqua L.) in Sicily. J Hortic Sci. 72(4):537–543. https://doi.org/10.1080/14620316.1997.11515541 Barracosa P, Lima MB, Cravador A. 2008. Analysis of genetic diversity in Portuguese Ceratonia siliqua L. cultivars using RAPD and AFLP markers. Sci Hortic (Amsterdam). 118(3):189–199. https://doi. org/10.1016/j.scienta.2008.06.020 Batlle I and Tous J. 1997. Carob tree: Ceratonia siliqua L.-Promoting the conservation and use of underu- tilized and neglected crops. 17. Institute of Plant Genetics and Crop Plant Research, Gatersleben/ International Plant Genetic Resources Institute, Rome, Italy. Baumel A, Nieto Feliner G, Médail F, La Malfa S, Di Guardo M, Bou Dagher Kharrat M, Lakhal‐Mir- leau F, Frelon V, Ouahmane L, Diadema K. 2022. Genome‐wide footprints in the carob tree (Ceratonia siliqua) unveil a new domestication pattern of a fruit tree in the Mediterranean. Mol Ecol. 31(15):4095– 4111. https://doi.org/10.1111/mec.16563 Biner B, Gubbuk H, Karhan M, Aksu M, Pekmezci M. 2007. Sugar profiles of the pods of cultivated and wild types of carob bean (Ceratonia siliqua L.) in https://doi.org/10.3390/plants10040678 https://doi.org/10.1006/jfca.1997.0528 https://doi.org/10.1006/jfca.1997.0528 https://doi.org/10.1007/978-94-007-5354-9 https://doi.org/10.1080/01435698.1996.9752955 https://doi.org/10.1080/01435698.1996.9752955 https://doi.org/10.1080/14620316.1997.11515541 https://doi.org/10.1016/j.scienta.2008.06.020 https://doi.org/10.1016/j.scienta.2008.06.020 https://doi.org/10.1111/mec.16563 48 Antonio Giovino et al. Turkey. Food Chemistry. 100(4):453-1455. https:// doi.org/10.1016/j.foodchem.2005.11.037. Blangiforti C, D’Amato A, La Malfa S. 2022. Il carrubo è l’uomo. Memoria, storia e storie attorno a un albero emblematico. Abulafia ISBN: 8894623750 Bouzouita N, Khaldi A, Zgoulli S, Chebil L, Chekki R, Chaabouni MM, Thonart P. 2007. The analysis of crude and purified locust bean gum: A comparison of samples from different carob tree populations in Tunisia. Food Chem. 101(4):1508–1515. https://doi. org/10.1016/j.foodchem.2006.03.056 Boyd A. 2002. Morphological analysis of Sky Island populations of Macromeria viridif lora (Bor- aginaceae). Syst Bot. 27(1):116–126. https://doi. org/10.1043/0363-6445-27.1.116 Bulca S. 2016. Some properties of carob pod and its use in different areas including food technology. Sci Bull Ser F Biotechnol. 20:142–147. Caruso M, La Malfa S, La Rosa G, Gentile A, Tribulato E, Frutos Tomás D. 2006. Molecular characterization and evaluation of carob germplasm. In I Internation- al Symposium on Pomegranate and Minor Mediter- ranean Fruits 818: 95–102. https://doi.org/10.17660/ ActaHortic.2009.818.12 Caruso M, La Malfa S, Pavlíček T, Frutos Tomñs D, Gen- tile A, Tribulato E. 2008. Characterisation and assess- ment of genetic diversity in cultivated and wild carob (Ceratonia siliqua L.) genotypes using AFLP markers. J Hortic Sci Biotechnol. 83(2):177–182. https://doi. org/10.1080/14620316.2008.11512367 Cimò G, Marchese A, Germanà M.A. 2017. Microspore embryogenesis induced through in vitro anther cul- ture of almond (Prunus dulcis Mill.). Plant Cell, Tis- sue and Organ Culture (PCTOC). 128:85–95. https:// doi.org/10.1007/s11240-016-1086-2 Costa F, Marchese A, Mafrica R, Di Vaio C, Ferrara G, Fretto S, Quartararo A, Marra FP, Mennone C, Vitale F, Reale S, Caruso T. 2017. Genetic diversity of fig (Ficus carica L.) genotypes grown in Southern Italy revealed by the use of SSR markers. Acta Hor- tic. 1173:75-80. https://doi.org/10.17660/ActaHor- tic.2017.1173.13 Di Guardo M, Scollo F, Ninot A, Rovira M, Hermoso JF, Distefano G, La Malfa S, Batlle I. 2019. Genetic structure analysis and selection of a core collection for carob tree germplasm conservation and manage- ment. Tree Genet Genomes. 15:1–14. https://doi. org/10.1007/s11295-019-1345-6 Domina G, Di Gristina E, Barone G. 2022. A new spe- cies within the Centaurea busambarensis complex (Asteraceae, Cardueae) from Sicily. Biodivers Data J. 10:e91505. https://doi.org/10.3897/BDJ.10.e91505 Domina G, Greuter W, Raimondo FM. 2017. A taxo- nomic reassessment of the Centaurea busambarensis complex (Compositae, Cardueae), with description of a new species from the Egadi Islands (W Sicily). Isr J Plant Sci. 64(1–2):48–56. https://doi.org/10.1080/079 29978.2016.1257146 Doyle JJ, Doyle JL. 1987. A rapid DNA isolation proce- dure for small quantities of fresh leaf tissue. Phyto- chemical Bulletin. 19(1):11-15. Fiore MC, Marchese A, Mauceri A, Digangi I, Scial- abba A. 2022. Diversity assessment and DNA-based fingerprinting of Sicilian hazelnut (Corylus avel- lana L.) germplasm. Plants. 11(5):631. https://doi. org/10.3390/plants11050631 Giovino A, Domina G, Bazan G, Campisi P, Scibetta S. 2015. Taxonomy and conservation of Pancratium maritimum (Amaryllidaceae) and relatives in the Central Mediterranean. Acta Bot Gall. 162(4):289– 299. https://doi.org/10.1080/12538078.2015.1089416 Giovino A, Guarino C, Marchese A, Sciarillo R, Domina G, Tolone M, Mateu-Andrés I, Khadari B, Schillaci C, Guara-Requena M, Saia S. 2023. Genetic variabil- ity of Chamaerops humilis (Arecaceae) throughout its native range highlights 2 species movement pathways from its area of origin. Botanical Journal of the Lin- nean Society. 201:3: 361–376. https://doi.org/10.1093/ botlinnean/boac053 Giovino A, Marchese A, Domina G. 2021. Morphological and genetic variation of Chamaerops humilis (Are- caceae) in relation to the altitude. Caryologia. Inter- national Journal of Cytology, Cytosystematics and Cytogenetics. 73(4):85–98. https://doi.org/10.13128/ caryologia-1011 Goulas V, Stylos E, Chatziathanasiadou M V, Mavro- moustakos T, Tzakos AG. 2016. Functional compo- nents of carob fruit: Linking the chemical and bio- logical space. Int J Mol Sci. 17(11):1875. https://doi. org/10.3390/ijms17111875 Hammer Ø, Harper DA, Ryan PD. 2022. Past Software. Nat Hist Museum. Hammer Ø, Harper DAT, Ryan PD. 2001. PAST: Paleon- tological statistics software package for education and data analysis. Palaeontol Electron. 4(1):9. ISTAT Italian National Institute of Statistics Cultiva- tions 2022. Available at: http://dati.istat.it/Index. aspx?DataSetC ode=D CSP_COLTIVAZIONI# (accessed June, 2023). Kalinowski ST, Taper ML, Marshall TC. 2007. Revis- ing how the computer program CERVUS accom- modates genotyping error increases success in paternity assignment. Mol Ecol. 16(5):1099–1106. 10.1111/j.1365-294X.2007.03089.x https://doi.org/10.1016/j.foodchem.2005.11.037 https://doi.org/10.1016/j.foodchem.2005.11.037 https://doi.org/10.1016/j.foodchem.2006.03.056 https://doi.org/10.1016/j.foodchem.2006.03.056 https://doi.org/10.1043/0363-6445-27.1.116 https://doi.org/10.1043/0363-6445-27.1.116 https://doi.org/10.17660/ActaHortic.2009.818.12 https://doi.org/10.17660/ActaHortic.2009.818.12 https://doi.org/10.1080/14620316.2008.11512367 https://doi.org/10.1080/14620316.2008.11512367 https://doi.org/10.1007/s11240-016-1086-2 https://doi.org/10.1007/s11240-016-1086-2 https://doi.org/10.17660/ActaHortic.2017.1173.13 https://doi.org/10.17660/ActaHortic.2017.1173.13 https://doi.org/10.1007/s11295-019-1345-6 https://doi.org/10.1007/s11295-019-1345-6 https://doi.org/10.3897/BDJ.10.e91505 https://doi.org/10.1080/07929978.2016.1257146 https://doi.org/10.1080/07929978.2016.1257146 https://doi.org/10.3390/plants11050631 https://doi.org/10.3390/plants11050631 https://doi.org/10.1080/12538078.2015.1089416 https://doi.org/10.1093/botlinnean/boac053 https://doi.org/10.1093/botlinnean/boac053 https://doi.org/10.13128/caryologia-1011 https://doi.org/10.13128/caryologia-1011 https://doi.org/10.3390/ijms17111875 https://doi.org/10.3390/ijms17111875 http://dati.istat.it/Index.aspx?DataSetCode=DCSP_COLTIVAZIONI# http://dati.istat.it/Index.aspx?DataSetCode=DCSP_COLTIVAZIONI# 49Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions Korkmaz N, Akin M, Koc A, Eyduran S, İlhan G, Sağbaş H, Ercişli S. 2020. Morphological and biochemical diversity among wild-grown carob trees (Ceratonia siliqua L.). Folia Horticulturae. 32(1). https://doi. org/0.2478/fhort-2020-0007 Kyratzis AC, Nikoloudakis N, Katsiotis A. 2019. Genet- ic variability in landraces populations and the risk to lose genetic variation. The example of landrace ‘Kyperounda’and its implications for ex situ con- servation. PLoS One. 14(10):e0224255. https://doi. org/10.1371/journal.pone.0224255 La Malfa S, Avola C, Brugaletta M, La Rosa G, Muratore G. 2012. Morphological and technological charac- terization of different carob cultivars in Sicily. Acta Horticulturae, In: XXVIII Int Hortic Congr Sci Hortic People Int Symp. 940: 207–212. https://doi. org/10.17660/ActaHortic.2012.940.27 La Malfa S, Brugaletta M, Caruso M, Gentile A. 2007. La biodiversità del carrubo: aspetti bioagronomici e molecolari. Riv di Fruttic e di Ortofloric. 69(6):44–48. La Malfa S, Currò S, Douglas AB, Brugaletta M, Caru- so M, Gentile A. 2014. Genetic diversity revealed by EST-SSR markers in carob tree (Ceratonia sili- qua L.). Biochem Syst Ecol. 55:205–211. https://doi. org/10.1016/j.bse.2014.03.022 Marchese A, Tobutt KR, Caruso T. 2005. Molecular char- acterisation of Sicilian Prunus persica cultivars using microsatellites. J. Hortic. Sci. Biotechnol. 80(1):121– 129. https://doi.org/10.1080/14620316.2005.11511902 Marchese A, Bonanno F, Marra FP, Trippa DA, Zelasco S, Rizzo S, Giovino A, Imperiale V, Ioppolo A, Sala G, Granata I, Caruso, T. 2023. Recovery and genotyp- ing ancient Sicilian monumental olive trees. Frontiers in Conservation Science. 4: p.1206832. https://doi. org/10.3389/fcosc.2023.1206832 Marra FP, Caruso T, Costa F, Di Vaio C, Mafrica R, Mar- chese A. 2013. Genetic relationships, structure and parentage simulation among the olive tree (Olea euro- paea L. subsp. europaea) cultivated in Southern Italy revealed by SSR markers. Tree Genet genomes. 9:961– 973. https://doi.org/10.1007/s11295-013-0609-9 Ordidge M, Litthauer S, Venison E, Blouin-Delmas M, Fernandez-Fernandez F, Höfer M, Kägi C, Kellerhals, M, Marchese A, Mariette S, Nybom H. 2021. Towards a Joint International Database: Alignment of SSR marker data for European collections of cherry germ- plasm. Plants, 10(6): 1243. https://doi.org/10.3390/ plants10061243 Perrier X, Jacquemoud-Collet JP. 2006. DARwin software, https://darwin.cirad.fr/ Ramón-Laca L, Mabberley DJ. 2004. The ecological status of the carob-tree (Ceratonia siliqua, Leguminosae) in the Mediterranean. Bot J Linn Soc. 144(4):431–436. https://doi.org/10.1111/j.1095-8339.2003.00254.x Theophilou IC, Neophytou CM, Constantinou AI. 2017. Carob and its Components in the Management of Gas- trointestinal Disorders. J Hepatol Gastroenterol. 1(5). Tous J, Romero A, Batlle I. 2013. The Carob tree: Botany, horticulture, and genetic resources. Hortic Rev 41:385– 456. https://doi.org/10.1002/9781118707418.ch08 Tzatzani TT, Ouzounidou G. 2023. Carob as an Agrifood Chain Product of Cultural, Agricultural and Econom- ic Importance in the Mediterranean Region. Journal of Innovation Economics Management, I140-21. Venison EP, Litthauer S, Laws P, Denancé C, Fernández- Fernández F, Durel CE, Ordidge M. 2022. Micros- atellite markers as a tool for active germplasm man- agement and bridging the gap between national and local collections of apple. Genet. Resour. Crop Evol. 69(5):1817–1832. https://doi.org/10.1007/s10722-022- 01342-5 Venturi M, Piras F, Corrieri F. et al. 2022. The multifunc- tional role of linear features in traditional silvopasto- ral systems: the sabana de morro in Dolores (El Sal- vador) and the pastures with carob trees in Ragusa (Italy). Biodivers Conserv 31, 2315–2327. https://doi. org/10.1007/s10531-021-02220-9 Viruel J, Haguenauer A, Juin M, Mirleau F, Bouteiller D, Boudagher‐Kharrat M, Ouahmane L, La Malfa S, Médail F, Sanguin H. 2018. Advances in genotyping microsatellite markers through sequencing and con- sequences of scoring methods for Ceratonia siliqua (Leguminosae). Appl Plant Sci. 6(12):e01201. https:// doi.org/10.1002/aps3.1201 Vourdoubas J, Makris P, Kefalas J, Kaliakatsos G 2002. In Proceedings of the 12th National Conference and Technology Exhibition on Biomass for Energy, Indus- try and Climate Protection, Amsterdam:489-493 Zemouri Z, Djabeur A, Frimehdi N, Khelil O, Kaid- Harche M, 2020. The seed diversity of Carob (Cera- tonia siliqua L.) and the relationship between seeds color and coat dormancy. Scientia Horticultu- rae. 274:p.109679. https://doi.org/10.1016/j.scien- ta.2020.10967 Zunft HJF, Lüder W, Harde A, Haber B, Graubaum HJ, Koebnick C, Grünwald J. 2003. Carob pulp prepara- tion rich in insoluble fibre lowers total and LDL cho- lesterol in hypercholesterolemic patients. Eur J Nutr. 42:235–242. https://doi.org/10.1007/s00394-003-0438-y https://doi.org/0.2478/fhort-2020-0007 https://doi.org/0.2478/fhort-2020-0007 https://doi.org/10.1371/journal.pone.0224255 https://doi.org/10.1371/journal.pone.0224255 https://doi.org/10.17660/ActaHortic.2012.940.27 https://doi.org/10.17660/ActaHortic.2012.940.27 https://doi.org/10.1016/j.bse.2014.03.022 https://doi.org/10.1016/j.bse.2014.03.022 https://doi.org/10.1080/14620316.2005.11511902 https://doi.org/10.3389/fcosc.2023.1206832 https://doi.org/10.3389/fcosc.2023.1206832 https://doi.org/10.1007/s11295-013-0609-9 https://doi.org/10.3390/plants10061243 https://doi.org/10.3390/plants10061243 https://darwin.cirad.fr/ https://doi.org/10.1111/j.1095-8339.2003.00254.x https://doi.org/10.1002/9781118707418.ch08 https://doi.org/10.1007/s10722-022-01342-5 https://doi.org/10.1007/s10722-022-01342-5 https://doi.org/10.1007/s10531-021-02220-9 https://doi.org/10.1007/s10531-021-02220-9 https://doi.org/10.1002/aps3.1201 https://doi.org/10.1002/aps3.1201 https://doi.org/10.1016/j.scienta.2020.10967 https://doi.org/10.1016/j.scienta.2020.10967 https://doi.org/10.1007/s00394-003-0438-y The chromosome resembles more a crystal than other cell organelles Antonio Lima-De-Faria Karyotype asymmetry in some Scilloideae (Hyacinthaceae) members from Algeria Meryem Nassar1,4,*, Nora Sakhraoui2,4, Gianniantonio Domina3 Chromosome counts and karyotype features of different ecotypes of Allium L. species (Amaryllidaceae – Subg. Melanocrommyum) in Iran Shahla Hosseini*, Hiva Yaghoobi Meiotic behavior and its implications on the reproductive success of Arnebia euchroma (Royle ex Benth.) I.M.Johnst. (Boraginaceae), an important medicinal plant of Trans-Himalaya Irfan Iqbal Sofi1,*, Shivali Verma2, Aijaz H. Ganie1, Namrata Sharma2, Manzoor A. Shah1 Morphological and molecular characterization of Sicilian carob (Ceratonia siliqua L.) accessions Antonio Giovino1, Annalisa Marchese2,*, Fxxxxx Bonanno1, Giovanna Sala2, Francesco Paolo Marra3, Gianniantonio Domina2 Microtubule response to salt stress Emre Köseoğlu, Özlem Aytürk* Chromosomal characterization mediated by karyomorphological analysis and differential banding pattern in fenugreek (Trigonella foenum-graecum L.): a neglected legume Indranil Santra, Diptesh Biswas, Biswajit Ghosh*