Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 78(1): 27-40, 2025 Firenze University Press https://riviste.fupress.net/index.php/caryologiaCaryologia International Journal of Cytology, Cytosystematics and Cytogenetics ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.36253/caryologia-3196 Citation: Verma, R., Kushwaha, B., Afaq, U., Baisvar, V. S., Maurya, S., Kumar, M. S., Dasmandal, T., Mishra, A. K., Kumar, R. & Sarkar, U. K. (2025). Bioinformatic analysis and charac- terization of BAC clones of Clarias magur (Hamilton,1822) using FISH and BAC end sequencing. Caryologia 78(1): 27-40. doi: 10.36253/caryologia-3196 Received: January 26, 2025 Accepted: June 21, 2025 Published: October 1, 2025 © 2025 Author(s). This is an open access, peer-reviewed article pub- lished by Firenze University Press (https://www.fupress.com) and distrib- uted, except where otherwise noted, under the terms of the CC BY 4.0 License for content and CC0 1.0 Uni- versal for metadata. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Bioinformatic analysis and characterization of BAC clones of Clarias magur (Hamilton,1822) using FISH and BAC end sequencing Rashmi Verma1,2, Basdeo Kushwaha1,*, Uzma Afaq2,*, Vishwamitra Singh Baisvar1, Satyamvada Maurya1, Murali S Kumar1, Tanwy Dasmandal1, Akhilesh Kumar Mishra1 Ravindra Kumar1, Uttam Kumar Sarkar1 1 Genomics and Computational Resources Division, ICAR-National Bureau of Fish Genetic Resources, Canal Ring Road, P.O. Dilkusha, Lucknow-226 002, India 2 Department of Biosciences, Integral University, Kursi Road, Lucknow-226 026, India *Corresponding authors. Email: basdeo.kushwaha@icar.gov.in; uzmaafaq89@gmail. com; uzmaafaq@iul.ac.in Abstract. The clones of BAC library combined with FISH are an excellent tool for mapping and identifying full-length genes. The present study was to sequence, mine and characterize the BAC clones of Clarias magur (magur) genome. The end sequenc- es of the BAC clones were bioinformatically mapped onto the genome scaffolds of magur to identify and locate the genes in each clone and FISH was utilized to locate clones on specific chromosomes of magur. A total of 13 BAC clones could be mapped using BAC end sequences on 12 genome scaffolds of magur. From the 13 clones, 34 genes were mined, annotated and characterized. Physical mapping using BAC-FISH signal was used to localize two clones, 012H23 and 012H7 on 11th and 14th chromo- some pairs of magur. The gene enrichment analysis revealed involvement of several genes in growth and regulatory processes, such as protein neddylation and metal ion transport. PPI Network analysis revealed two types of interactions among 11 nodes and between 10 edges; and 4 genes (ash2l, cnot2, lin7c, uba3) were identified to be important. The study reveals the presence of important genes on the 13 undertaken clones, making this a useful genomic resource. The FISH probe could not only be helpful in generation of basic information of gene location for identification of genes on the chromosomes as a chromosome marker, but also in detection of chromosom- al defects arisen due to genetic mutation occurred if any on a particular location of reported genes in C. magur. Keywords: BAC clones, Clarias magur, end sequencing, FISH, PPI, SDG, synteny. INTRODUCTION Catfish is commercially and economically an important group in aquat- ics and fisheries. The species Clarias magur (magur), which belongs to the Clariidae family, is popular because of its flavor and therapeutic qualities and is found throughout India, Nepal, Bhutan, and Bangladesh (Ng and Kotte- https://riviste.fupress.net/index.php/caryologia https://doi.org/10.36253/caryologia-3196 https://doi.org/10.36253/caryologia-3196 https://www.fupress.com https://creativecommons.org/licenses/by/4.0/legalcode https://creativecommons.org/publicdomain/zero/1.0/legalcode mailto:basdeo.kushwaha@icar.gov.in mailto:uzmaafaq89@gmail.com mailto:uzmaafaq89@gmail.com mailto:uzmaafaq@iul.ac.in 28 Rashmi Verma et al. lat, 2008; Devassy et al., 2009). The species is facing risks from overexploitation, wetland conversion, wide- spread illegal introduction of invasive C. gariepinus spe- cies and pesticide use in agricultural areas. According to the IUCN Red List (2010), magur is currently listed as endangered species because of several identified and uni- dentified reasons and most importantly the disappear- ing breeding habitats and its population in India. A lack of appropriate management strategies may lead to fur- ther critical decline for the species in the years to come (Mishra et al.,2019). The United Nation is also con- cerned towards the people, planet and prosperity and set sustainable development goals (SDGs) as its action agen- da. Conservation of fish genetic resources through prop- er planning, replenishing of fisheries and sustainable utilization of fish as food could be a better way to save our planet earth from over exploitation of water bodies and help in achieving the SDG no. 2 & 14. Owing to the species’ commercial significance, the efforts are being made to conserve it through restoration, and enhance its genetic makeup for future expansion. Genetic characterization is an important step towards the genetic conservation of a species. There are several methodologies for genetic characterization of a fish species and, construction of bacterial artificial chro- mosome (BAC) library of a fish species is an important genomic resource. Fertility factor (F-) based plasmid vectors are known as bacterial artificial chromosomes (BACs) reproduce steadily at low copy numbers (Woo et al., 1994). According to Shizuya et al. (1992), the BAC clones’ large insert capacity allows them to carry whole genes with flanking distant regulatory DNA that provide signals for proper spatiotemporal gene expression. For whole genome sequencing, large insert DNA fragments of an organism between 100 and 300 kb into BAC clones were used in case of human genome project and some of plant species. BAC clones insert DNA are also been used for physical gene mapping in the past in several studies. For fluorescent in situ hybridization (FISH), BAC clones are useful probes because they can suppress repetitive DNA sequences, making single-copy sequences detectable (Hanson et al., 1995; Jiang et al., 1995). Chro- mosome mapping, genome sequencing, high-throughput BAC end (BE) sequencing, and other genomic stud- ies can all be performed using BAC extracted DNA (Osoegawa et al., 2001, Osoegawa et al., 2004). Using clone as a probe in FISH is a dependable cytological method for chromosome identification. Genome map- ping is vital for identifying and characterizing the genetic basis of phenotypic features in organisms and detecting specific genes of interest. To create a physi- cal connection with unknown targeted sequences, BAC clones provide a practical and trustworthy landmark. BAC-FISH tool will help us assess how well a linkage map may create and covers a saturated genetic map on a broad scale. Some BAC based studies have been reported for C. magur but still there is need of expansion more such works to build detailed information on physical localization of genes using BAC library of C. magur. The present study aimed to analyze magur BAC clones using their end sequences and whole genome information for gene and SSR mining and pathway analysis which could aid in genomic selection programs or genetic diversity studies and complement aquaculture production. MATERIAL AND METHODS BAC library construction Using genomic high molecular weight DNA from magur blood, the BAC library was built as part of an earlier research initiative supported by the Indian gov- ernment’s Department of Biotechnology in New Delhi. In brief, the HindIII restriction enzyme was used to digest genomic DNA, size selection was performed and selected size insert DNA fragments were attached to the pCC1BAC vector (Epicentre Biotechnologies, Madi- son, WI, USA). Subsequently, approximately 115kb DNA pieces were converted and propagated in Escherichia coli Phage Restraint DH10~ competent cells (Invitro- gen, Burlington, ON, Canada). Using a Genetix Qpix 2 Automated Arraying Bacterial Colony Picker (Molecular Devices, Sunnyvale, CA, USA), the modified BAC clones were robotically lifted, put on plates, and kept in Luria Broth (LB) culture. BAC clone culture, DNA isolation and BAC end sequenc- ing From the BAC library, consisting of 55,141 clones stored in 144 plates each of 384-well format, a plate (ID: 012A) was chosen at random for BAC end sequencing and BAC-FISH. After thawing the plate, 15 μl of each clone was transferred to 15 ml centrifuge tubes for reviv- al, culture and insert DNA isolation using previously reported methodology (Kumar et al., 2020). T7 forward (5’TAATACGACTCACTATAGGG3’) and pbRP1 reverse (5’CTCGTATGTT GTGTGGAATTGTGAGC3’) primers were used to sequence both ends of the clones on an ABI 3500 Genetic Analyzer (Thermo Fisher Scientific, USA). The BAC end sequences (BESs) that were produced were then mapped onto the magur genome scaffolds and examined using a custom Perl script and the Blast tool. 29Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing For insert DNA isolation and BAC-FISH, the clones that were bioinformatically positioned on the same scaffolds were merged into a single culture. Chromosome preparation, probe labelling and BAC-FISH With the help of a fisherman, live and healthy magur specimens were collected from a nearby pond in Lucknow, Uttar Pradesh, India, and brought to the lab in a live form. Using a conventional procedure, the metaphase chromosomal spreads were prepared in vivo from the anterior kidney cells. To make the DNA probe for BAC-FISH, one µg of isolated BAC insert DNA was taken from every clone. Using the direct labeling “nick translation” method, the DNA was tagged with the red f luorophore tetramethyl-rhodamine-5-dUTP (Roche, Basel, Switzerland) and green fluorescein-12-dUTP (Fer- mentas, Vilnius, Lithuania). Metaphase chromosomal spreads that were two to three days old were subjected to FISH for 60 minutes at 95 °C (Kumar et al., 2017). VectaShield mounting media (Vector Labs, Burlingame, CA, USA) containing DAPI and antifade was used to counterstain the chromosomes for 60 minutes after hybridization. Two band filters were then used to view the slides under a Leica fluorescence microscope (Wet- zlar, Germany): DAPI (excitation at 340–380 nm, emis- sion at 461 nm) for chromosome visualization, I3 (excita- tion at 450–490 nm) for fluorescein-labeled probe visual- ization, and N2.1 (excitation at 515–560 nm, emission at 595–605 nm) for rhodamine-labeled probe visualization. For probe signal screening, about 50 metaphase spreads per clone were analyzed. A consensus karyotype was cre- ated after establishing karyotypes from good spread for every hybridized clone. BAC mapped genes and functional description Four hybridized clones with an e-value of 10-5 on the magur genome assembly (NCBI’s Genome Acc. No. QNUK00000000) had their BESs aligned using the BLASTN method. For further examination, the BESs that were aligned on the same scaffold were removed. Simple sequence repeats (SSRs) found in the genes iden- tified from the clones were mined using the MISA bioin- formatic program. Comparative genomics and phylogenetics analysis Ensembl and NCBI databases were searched for zebrafish (Danio rerio) and channel catfish (Ictalurus punctatus) genomes as queries and gene locations as well as chromosome information were retrieved to perform synteny analysis of annotated clone genes. Circos plot (Krzywinski et al., 2009) was used to visualize synteny among 3 fishes (magur, channel catfish and zebrafish) focusing on genes having same magur scaffolds but dis- tinct positions on chromosomes. Phylogenetic study was performed using gene sequences from the channel catfish, zebrafish and magur scaffolds using MEGA tool (Kumar et al., 2016) and also using interactive tree of life (iTOL) v5.5 tool (Letunic et al., 2019) was used to visual- ize the evolutionary lineages and DNA sequences phylo- genetics structure. Network analysis of proteins to proteins The STRING 12.0 (Szklarczyk et al., 2023) database was used to analyze the protein-protein interaction (PPI) networks of the annotated genes, and the Cytoscape v3.6.0 program was used to show the results (Shannon et al., 2003). In order to guarantee interactions with a high degree of confidence and to be included in the interac- tion network, the network was constructed using a strict confidence score threshold of 0.04. Functional annotation and enrichment analysis The identified genes were functionally annotated using Gene Ontology (GO) using BLAST and the Uni- ProtKB/Swiss-Prot databases (http://www.uniprot.org/). The BLOSUM62 substitution matrix with an E-value of less than 1e-4 and a similarity of greater than 80% were the predetermined criteria used to pick BLAST hits. The GO framework was employed to annotate gene sets and KEGG pathway database (Kanehisa & Sato ,2020) was used to obtain information on molecular interactions and network reactions. The PANTHER gene ontology tool was used to perform functional enrichment analysis of the cluster network’s nodes in order to uncover func- tionally enriched gene networks inside the GO Biologi- cal Process and to learn more about the biological sig- nificance of the genes. RESULTS BAC end mapping and gene mining Sequence quality check resulted in a good qual- ity sequence for 32 clones, out of which only 13 BAC clones could be sequenced with both forward and reverse http://www.uniprot.org/ 30 Rashmi Verma et al. end sequences, rest 19 had either forward OR reverse sequence. BESs of these 13 BAC clones were only used for further downstream bioinformatic analysis. Good sequence size was indicated by the 13 clones’ forward and reverse end sequence lengths, which varied from 429 bp (forward end sequence of clone ID: 012G22) to 951 bp (reverse end sequence of clone ID: 012A12) (Table 1). The magur genome’s BES mapping showed that they were dis- persed throughout 12 scaffolds. The size of the scaffolds varied from 4,200,247 bp (ID: 012H23 on Scaffold21) to 340,296 bp (ID: 012H1 on Scaffold657). The lengths of the clones were predicted bioinformatically by aligning both end sequences of the clones on the scaffolds of the magur genome, and the clones size ranged from 45.98 kb (ID: 012J12 on Scaffold22) to 143.307 kb (ID: 012A12 on Scaffold111). A total of 34 genes were identified, anno- tated and characterized after mapping BESs on magur genome scaffolds (Table 2, Supplementary Table 1). One BAC clone (012H23) contained 5 genes, 2 clones (012H7, 012H21) contained 4 genes, 3 clones (012H8, 012J12, 012G22) contained 3 genes, 5 clones (012H15, 012H1, 012A12, 012B15, 012A15) contained 2 genes, while 2 clones (012A22, 012G24) were found to possess only one gene each. The mean size of all clones was around 113.196 kb. A total of 1275 SSRs could identified from the sequences of all 13 BAC clones using MISA tool (Table 1). BAC clone ID: 012H1 contained maximum SSRs (149), while clone ID: 012J12 contained least SSRs (33). Chromosomal complements and BAC-FISH Metaphase chromosomal complements were gener- ated manually with a diploid chromosome (2n) count of 50. According to the morphology and chromosome count, the karyotype was determined to be 14m + 20sm + 8st + 8t with a fundamental arm number (FN) of 90. Clone ID: 012H23, contained maximum 5 genes (Table 1) and labelled with green colour fluorescein-12-dUTP, was mapped on the 11th pair of sub-metacentric chro- mosomes (Fig. 1), while clone 012H7, contained 4 genes (Table 1) and labelled with red colour rhodamine- 5-dUTP, was located on the fourteenth sub-metacen- tric chromosomal pair. (Fig. 2). The chromosomes’ genes were clearly identified, and were compared with zebrafish and channel catfish for the synteny (Fig. 3) which represents the conserveness of the genes across these species. Functional enrichment and gene ontology analysis The ‘cellular anatomical (GO:0110165)’ had the max- imum number (13) of GO terms (Fig. 4). There are genes encoding proteins localized to specific molecular func- tion such as the nucleus (e.g. MIER3A, UNC50), cyto- plasmic vesicle membrane (e.g. SLC39A13) and lysosomal membrane (e.g. SPNS1). Enhancement of cellular constit- uents such as ‘cellular anatomical entity’, ‘protein-con- taining complex’ point towards cellular structures and protein interactions. Higher-order processes, like ‘mul- ticellular organismal process’ and ‘response to stimulus’, hint at responses to environmental cues and organismal functions. Notably, enrichment in ‘binding’ and ‘cata- lytic activity’ suggests significant involvement in these functions within the studied context. Additionally, ‘tran- scription regulator activity’ and ‘ATP-dependent activity’ underscore their regulatory and energy-related roles. In Table 1. Details of BAC clones end sequences mapped on Clarias magur genome. S. No. Clone ID Scaffold mapped on C. magur genome Scaffold length Sequence length BAC ends position mapped on C. magur scaffold Estimated BAC size (kb) Number of SSR on the BAC present %GC content No of Genes 1. 012H23 Scaffold 21 4200247 927 900 1536131 1653231 117.101 71 37.72 5 2. 012H7 Scaffold 27 3918154 907 618 1869141 1982924 113.784 81 38.41 4 3. 012H8 Scaffold65 2520177 698 518 1622436 1728132 105.697 120 40.78 3 4. 012H15 Scaffold72 2332806 802 892 603066 716705 113.64 82 38.3 2 5. 012H21 Scaffold222 1147004 573 582 694436 828095 133.66 130 38.65 4 6. 012J12 Scaffold22 4179625 799 898 2020754 2066733 45.98 33 39.11 3 7. 012G22 Scaffold68 2435928 429 310 243382 341745 98.364 62 38.6 3 8. 012H1 Scaffold657 340296 769 897 89407 211638 122.232 149 41.12 2 9. 012A12 Scaffold111 1875956 875 951 1206038 1325900 143.307 123 39.65 2 10. 012B15 Scaffold22 4179625 778 272 1788839 1911851 123.013 138 39.55 2 11. 012A15 Scaffold349 749303 859 338 359629 481144 121.516 68 39.57 2 12. 012A22 Scaffold368 723143 477 774 350497 444907 94.411 128 39.38 1 13. 012G24 Scaffold49 3144600 643 900 1454430 1593272 138.843 90 38.02 1 31Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing Table 2. Annotation of genes from Mapped scaffold at C. magur genome. S. No. From Protein names Gene Ontology (biological process) Gene Ontology (cellular component) Gene Ontology (molecular function) 1. tmem17 Transmembrane protein 17 NA ciliary membrane [GO:0060170] symporter activity [GO:0015293] 2. agbl2 Cytosolic carboxypeptidase 2 isoform X1 NA NA carboxypeptidase activity [GO:0004180] 3. agbl2 Cytosolic carboxypeptidase 2 (ATP/GTP-binding protein-like 2) (Protein deglutamylase CCP2) proteolysis [GO:0006508] cell projection [GO:0042995]; centriole [GO:0005814]; cytosol [GO:0005829] metallocarboxypeptidase activity [GO:0004181]; zinc ion binding [GO:0008270] 4. Cnot2 CCR4-NOT transcription complex subunit 2 isoform X1 NA NA NA 5. washc4 WASH complex subunit 7 NA WASH complex [GO:0071203] NA 6. pdxp Pyridoxal phosphate phosphatase NA NA NA 7. mier3a Mesoderm induction early response protein 3-like NA nucleus [GO:0005634] NA 8. DAT39_003426 G protein-coupled receptor kinase (EC 2.7.11.-) phosphorylation [GO:0016310]; signal transduction [GO:0007165] NA ATP binding [GO:0005524]; G protein-coupled receptor kinase activity [GO:0004703] 9. ash2l Set1/Ash2 histone methyltransferae complex subunit ASH2 isoform X2 methylation [GO:0032259] Set1C/COMPASS complex [GO:0048188] methyltransferase activity [GO:0008168] 10. DAT39_006333 Serine/threonine-protein kinase SBK1-like phosphorylation [GO:0016310] NA ATP binding [GO:0005524]; protein kinase activity [GO:0004672] 11. nlrc3 NLR family CARD domain- containing protein 3 NA cytoplasm [GO:0005737]; membrane [GO:0016020] NA 12 wdr90 WD repeat-containing protein 90 NA NA NA 13. CHIA Acidic mammalian chitinase- like carbohydrate metabolic process [GO:0005975] NA chitin binding [GO:0008061]; hydrolase activity, hydrolyzing O-glycosyl compounds [GO:0004553] 14. CHIA Acidic mammalian chitinase- like carbohydrate metabolic process [GO:0005975] NA NA 15. CHIA Acidic mammalian chitinase- like carbohydrate metabolic process [GO:0005975] NA chitin binding [GO:0008061]; hydrolase activity, hydrolyzing O-glycosyl compounds [GO:0004553] 16. CHIA Acidic mammalian chitinase- like carbohydrate metabolic process [GO:0005975] NA NA 17. uba3 NEDD8-activating enzyme E1 catalytic subunit (EC 6.2.1.64) protein neddylation [GO:0045116] NA ubiquitin-like modifier activating enzyme activity [GO:0008641] 18. mltF Membrane-bound lytic murein transglucosylase F NA NA NA 19. lin7c Protein lin-7 homolog C exocytosis [GO:0006887]; protein transport [GO:0015031] anchoring junction [GO:0070161]; plasma membrane [GO:0005886] NA (Continued) 32 Rashmi Verma et al. S. No. From Protein names Gene Ontology (biological process) Gene Ontology (cellular component) Gene Ontology (molecular function) 20. mybpc3 Myosin-binding protein C, cardiac-type (C-protein, cardiac muscle isoform) NA NA NA 21. slc39a13 Zinc transporter ZIP13 (Solute carrier family 39 member 13) (Zrt- and Irt- like protein 13) NA cytoplasmic vesicle membrane [GO:0030659] metal ion transmembrane transporter activity [GO:0046873] 22. pcm Argininosuccinate lyase NA membrane [GO:0016020] lyase activity [GO:0016829] 23. DAT39_002900 Uncharacterized protein NA NA NA 24 DAT39_002797 Suppressor of cytokine signaling 5-like intracellular signal transduction [GO:0035556]; negative regulation of signal transduction [GO:0009968]; protein ubiquitination [GO:0016567] NA NA 25. spns1 Protein spinster homolog 1 (Spns1) NA lysosomal membrane [GO:0005765] transmembrane transporter activity [GO:0022857] 26. DAT39_006477 Ataxin-2-like protein isoform X1 NA NA RNA binding [GO:0003723] 27. pitpnbl Phosphatidylinositol transfer protein beta isoform-like NA endoplasmic reticulum membrane [GO:0005789]; Golgi membrane [GO:0000139] phospholipid transporter activity [GO:0005548] 28. unc50 Protein unc-50 NA nuclear inner membrane [GO:0005637] NA 29. slc25a12 Calcium-binding mitochondrial carrier protein Aralar1-like malate-aspartate shuttle [GO:0043490] mitochondrial inner membrane [GO:0005743] calcium ion binding [GO:0005509] 30. slc25a12 Calcium-binding mitochondrial carrier protein Aralar1-like malate-aspartate shuttle [GO:0043490] mitochondrial inner membrane [GO:0005743] calcium ion binding [GO:0005509] 31. stk38a Serine/threonine-protein kinase 38 phosphorylation [GO:0016310] NA ATP binding [GO:0005524]; protein serine/ threonine kinase activity [GO:0004674] 32. prex1 Phosphatidylinositol 3,4,5-trisphosphate- dependent Rac exchanger 1 protein anatomical structure development [GO:0048856]; intracellular signal transduction [GO:0035556] NA guanyl-nucleotide exchange factor activity [GO:0005085] 33. DAT39_002823 Neurexin-1a isoform X10 anatomical structure development [GO:0048856] membrane [GO:0016020] NA 34. DAT39_002905 Uncharacterized protein NA NA NA 35. Otogl Otogelin-like protein NA NA NA 36. Otogl Otogelin-like NA membrane [GO:0016020] transmembrane transporter activity [GO:0022857] 37. Otogl Otogelin-like protein L-arabinose metabolic process [GO:0046373] NA alpha-L-arabinofuranosidase activity [GO:0046556] 38. Otogl Otogelin-like L-arabinose metabolic process [GO:0046373] NA alpha-L-arabinofuranosidase activity [GO:0046556] 39. ypel1 Protein yippee-like 1 NA NA NA 40. bmp5-1 Bone morphogenetic protein 5 NA extracellular region [GO:0005576] growth factor activity [GO:0008083] Table 2. (Continued). 33Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing biological processes, the enrichment in ‘cellular process’, ‘biological regulation’ and ‘metabolic process’ empha- sizes their importance in various cellular activities and regulatory pathways. Overall, these genes represent a wide spectrum of biological functions, from molecular regulation to cellular structural integrity, highlighting the complexity and diversity of cellular processes. TMEM17 gene encodes a transmembrane protein, primarily situated within the ciliary membrane and facilitating symporter activity. AGBL2 gene is involved in proteolysis and is predominantly found in the cen- triole and cytosol, with notable metallo-carboxypepti- dase activity and zinc ion binding. WASHC4 interact with VCP in zebrafish and impacts muscle function as Figure 1. Karyotype of magur showing presence of FISH signals (green) of BAC clone 012H23 on 11th pair submetacentric chromosomes. Figure 2. Karyotype of magur showing presence of FISH signals (red) of BAC clone 012H7 on 14th pair submetacentric chromosomes. 34 Rashmi Verma et al. well as autophagy with distinct roles in protein degra- dation and ER stress. Pitpnb is crucial for double cone cell maintenance in the zebrafish retina, while Pitpna supports early development. Additionally, proteins, like PDXP, PCM and MLPF, contribute to pyridoxal phos- phate phosphatase activity, lyase activity in the mem- brane, and membrane-bound lytic murein transgluco- sylase activity, respectively. Other proteins are essential for many biological functions, including signal trans- mission. (DAT39_003426, DAT39_002797), intracellu- lar transport (LIN7C, PITPNBL) and metabolic path- ways (CHIA, SLC25A12). Notably, some proteins, like UBA3 and SLC39A13, are engaged in crucial regulatory functions such metal ion transport and protein ned- dylation, respectively. Moreover, several genes encode proteins with undefined functions (e.g. DAT39_002905, Figure 3. Synteny visualization of 34 genes present on 12 scaffolds of magur genome with channel catfish and zebrafish. SF represents scaf- fold of magur, IP represents channel catfish and ZF is zebrafish on which the gene are present. 35Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing YPEL1). Overall, this classification illustrates the com- plexity of biological systems by offering insights into the variety of gene functions across many cellular con- texts and pathways. Four pathways, which provided insights into poten- tial cellular mechanisms, could be predicted using PAN- THER, viz. Nicotinic acetylcholine receptor signalling pathway (P00044), PI3 kinase pathway (P00048), p53 pathway (P00059) and Ubiquitin proteasome pathway (P00060) (Fig. 5). Study of protein-protein interactions The protein-protein interaction (PPI) network analy- sis identified 11 genes (mybpc3, prex1, stk38a, tmem17, ash2l, cnot2, lin7c, uba3, agbl2, slc39a13, wdr90) inter- connected by 10 edges, representing their interactions. Cluster analysis revealed three distinct clusters repre- sented by red, blue, and green colours. The red cluster includes mybpc3, prex1, stk38a, and tmem17, indicating close interactions likely involved in a shared functional pathway. The green cluster includes uba3, lin7c, cnot2, and ash2l, with uba3 acting as a central hub. The blue cluster includes agbl2, slc39a13, and wdr90, showing localized interactions. These clusters may represent dis- tinct functional modules or pathways, providing insights into the biological roles and relationships among these genes and warranting further analysis to explore their functional and regulatory significance. (Fig. 6). Comparative genomics and phylogenetics analysis Based on the p-distances, four neighbor-joining (NJ) circular unrooted phylogenetic trees were built to clearly visualize 24 related genes found on the chromosomes of the zebrafish, channel catfish, and magur genome scaf- folds. Wash4 gene of zebrafish did not cluster either with channel catfish or magur. Similarly, Aash2I gene of chan- nel catfish did not cluster either with magur or zebrafish. Figure 4. Panther database analysis showing GO terms associated with molecular function, biological process and cellular components. Figure 5. Panther database analysis. 36 Rashmi Verma et al. The NJ-phylogeny of genes representing in scaffolds (SF), SF_21, SF_21, SF_21, SF_21 and SF_27 combining magur with channel catfish and zebrafish produced two clusters. (Fig. 7a), as similar SF_27, SF_27, SF_65, SF_65, SF_72, SF_72 (Fig. 7b). Likewise, SF_22, SF_68, SF_68, SF_222, SF_222, SF_222, SF_222 and SF_222 generated 4 clusters (Fig. 7c) and SF_111, SF_111, SF_349, SF_368, SF_657 & SF_657 generated 2 clusters (Fig. 7d). 34 genes located on 13 BAC clones of magur genome were annotated with gene id; protein id; amino acid (AA) and gene size in bp. Mybpc3 gene present on clone ID: 012H1 contained maximum AAs (1250), while the gene (DAT39_002900) present on clone ID: 012J12 possessed smallest (59 AAs) and rest gene were unannotated (Sup- plementary Table 1). A total of 14 genes of magur (out of 34 genes) were synchronized with zebrafish and chan- nel catfish chromosomes by aligning end sequences of 13 clones (Fig. 3; Supplementary Table 1). Remaining 20 genes present on clones were found in chromosomes of either channel catfish or zebrafish, therefore, not consid- ered for synteny visualization. Figure 6. Protein-protein interaction network of 11 genes present on BAC clones. Cluster analysis of 11 genes grouped in three distinct clusters, as represented by red, green and blue colours. 37Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing DISCUSSION Several studies have been reported where BAC end sequences were utilized for genomic studies in differ- ent biological contexts (Meyers et al., 2004; Baisvar et al., 2022), indicating BACs are an important resource of live genetic material. There are several databases of BAC end sequences developed for numerous model species, including human, rice, mouse, and sea urchin (Poulsen et al., 2004). Baisvar et al. (2022) have reported a BAC- based partial physical map of magur genome employ- ing whole genome and BAC clones. BAC libraries and their characterization using end sequencing of clones can provide insights into the magur genome. In the pre- sent study, isolated plasmid DNA of 13 clones of magur genome. Of these, 14 genes were common to zebrafish and channel catfish. Metaphase chromosomal complements prepared were of good quality. Similar karyotype results have been obtained by other researchers in magur (Baisvar Figure 7. Phylogenetic trees constructed by neighbour-joining method based on p-distance of common genes present on chromosomes of channel catfish and zebrafish with gene present in magur scaffolds: (a) SF_21, SF_27 (b). SF_27, SF_65, SF_72 (c). SF_22, SF_68, SF_222 (d). SF_111, SF_349, SF_368, SF_657, SF_657. CM represents magur, IP represents channel catfish and ZF represents zebrafish. 38 Rashmi Verma et al. et al., 2022; Kumar et al., 2021). Baisvar et al. (2022) employed BAC-FISH as a cytological marker for iden- tifying individual chromosomes. BAC-FISH includes selecting an appropriate clone and obtaining high- quality chromosomal spread for FISH signal detection as well as to distinguish chromosome-based morphol- ogy. In the present study, two clones, viz. 012H23 (con- taining 5 genes) and 012H7 (containing 4 genes), were mapped on 11th and 14th sub-metacentric chromosomes pair, respectively. A network-based method for identifying and rank- ing potential genes and their functional links is pro- tein-protein interaction analysis. PPI analysis network revealed two interactions among 11 nodes and between 10 edges. These interactions were assessed based on various parameters, including their source in the data- base, experimental evidence, co-expression patterns and text mining, with a confidence score of 0.004 and PPI enrichment value (p-value of 0.000734). Clustering anal- ysis of these 11 genes resulted in three distinct clusters. The red and green clusters contained 4 genes (mybpc3, prex1, stk38a, tmem17) and (ash2l, cnot2, lin7c, uba3) each, respectively, while the blue colour cluster consisted of 3 genes (agbl2, slc39a13, wdr90). Gene enrichment analysis sheds light on a wide range of molecular and biological processes associated with the gene set under study. Deeper comprehension of the roles of the examined gene set in cellular activi- ties and interactions is made possible by these analyses, which provide thorough insights into the biological pro- cesses, molecular functions, and possible pathways con- nected to the gene set. The GO categorizes genes into molecular functions, biological processes, and cellular components. Among cellular function binding was the most frequent, followed by transcription regulator activ- ity and ATP-dependent activity. For biological processes, metabolic process and biological regulation each were the most prevalent (4), followed by response to stimulus and cellular process. Cellular anatomical entity was the most frequent (7 times), followed by protein-contain- ing complex (twice). The genes in the list cover a wide range of cellular locations and biological roles. Four pathways, viz. nicotinic acetylcholine receptor signalling pathway (P00044), PI3 kinase pathway (P00048), p53 pathway (P00059), and ubiquitin proteasome pathway (P00060), could be identified from PANTHER analy- sis offering glimpses into synaptic transmission, cellular signalling, stress response and protein turnover, respec- tively. The list also includes the ‘Inflammation medi- ated by chemokine and cytokine signalling pathway (P00031)’, highlighting the genes involved in inflamma- tion via chemokine and cytokine signalling. Addition- ally, there are entries labelled as No PANTHER catego- ry (UNCLASSIFIED), occurring ten times for cellular components and biological process, and nine times for molecular function. The presence of unclassified entries suggests potential novel functions requiring further investigation. CONCLUSION BAC based genomic library is very useful resource for mapping of genes on the chromosomes using FISH. A total of 9 genes found to be present in two BAC clones of C. magur were mapped in this study. The BAC end sequencing of 13 clones and mapping on magur genome scaffolds generated information of a total of 34 genes. This is the first report of physical mapping of these genes in C. magur. The PPI network among 11 genes revealed their interaction in three different clusters. This information is valuable for the point of further utiliza- tion of BAC resources of C. magur . ACKNOWLEDGMENTS The present reported work was carried out by the first author at ICAR-NBFGR, Lucknow, for her Ph.D. program. The director of the ICAR-National Bureau of Fish Genetic Resources in Lucknow provided labora- tory space and other assistance that the authors needed to complete the Ph.D. research, for which they are grate- ful. For mapping BAC resources and providing financial assistance for the study, the authors further acknowledge the DBT, New Delhi, and the CABin Scheme of ICAR, which is run by the Division of Agricultural Bioinfor- matics, ICAR-IASRI, New Delhi. The BAC resource uti- lized here is the outcome of DBT funded project entitled ‘Whole genome sequencing and development of allied genomics resources in two commercially important fish- Labeo rohita and Clarias batrachus (Sanction Order BT/ PR3688/AAQ/3/571/2011 dated 10.09.2013)’ and the con- sumables and other laboratory resources were utilized from the ICAR CABin Scheme sub-project entitled ‘Con- struction of physical map of Clarias magur genome’ exe- cuted at ICAR-NBFGR, Lucknow, under the ‘Network project on Agricultural Bioinformatics and Computa- tional Biology’ implemented through Division ,ICAR- IASRI, New Delhi. The authors are also grateful to Inte- gral University for providing necessary guidance and help to the first author. This manuscript is also acknowl- edged under Integral University Manuscript number- IU/R&D/2024-MCN0002767. 39Bioinformatic analysis and characterization of BAC clones of Clarias magur using FISH and BAC end sequencing DECLARATION OF INTEREST STATEMENT The authors state that none of the work described in this study could have been influenced by any known competing financial or non-financial, professional, or personal conflicts. FUNDING INFORMATION The authors are thankful to the DBT, New Delhi, and CABin Scheme of ICAR, implemented through Division of Agricultural Bioinformatics, ICAR-IASRI, New Delhi, for providing BAC resource and financial support to the study. The BAC resource utilized here is the outcome of DBT funded project entitled ‘Whole genome sequencing and development of allied genom- ics resources in two commercially important fish- Labeo rohita and Clarias batrachus (Sanction Order BT/ PR3688/AAQ/3/571/2011 dated 10.09.2013)’ and the con- sumables and other laboratory resources were utilized from the ICAR CABin Scheme sub-project entitled ‘Con- struction of physical map of Clarias magur genome’ exe- cuted at ICAR-NBFGR, Lucknow, under the ‘Network project on Agricultural Bioinformatics and Computa- tional Biology’ implemented through Division of Agri- cultural Bioinformatics, ICAR-IASRI, New Delhi. AUTHOR CONTRIBUTION STATEMANT RV: Experimentation, draft writing and editing; BK: Conceptualization, Project Administration, Data Cura- tion, Investigation, Methodology, Writing -original draft; UA: Project Administration: VSB: Formal Analysis, draft writing, editing; SM: Formal Analysis; MSK: Methodolo- gy, Formal Analysis, Writing, reviewing, and editing; TD: Formal Analysis, editing; RK: Project Administration, Resources, Supervision, Writing - review and editing. REFERENCES 1. Ng HH, Kottelat M. 2008. The identity of Clarias batrachus (Linnaeus,1758), with the designation of a neotype (Teleostei: Clariidae). Zoo. J. Lin. Soc. 153(4): 725–732. 2. Baisvar VS, Kushwaha B, Kumar R, Kumar MS, Singh M, Rai A, Sarkar UK. 2022. BAC-FISH Based Physical Map of Endangered Catfish Clarias magur for Chromosome Cataloguing and Gene Isolation through Positional Cloning. Int. J. Mol. Sci. 24:15958. https://doi.org/10.3390/ijms232415958. 3. Mishra BM, Khalid MA, Labh, SN. 2019. Assessment of the effect of water temperature on length gain, feed conversion ratio (FCR) and protein profile in brain of Labeo rohita (Hamilton 1822) fed Nigella sativa incorporated diets. Intl J Fish Aquatic Studies. 3: 6-13. 4. Osoegawa K, Mammoser AG, Wu C, Frengen E, Zeng C, Catanese JJ, de Jong PJ. 2001. A bacterial artificial chromosome library for sequencing the complete human genome. Geno. Res. 113: 483-96. 5. Osoegawa B, Zhu CL, Shu T, Ren Q, Cao G M, Vessere MM. 2004. BAC resources for the rat genome project. Genome Res. 14(4): 780–785. 6. Kanehisa M, Sato Y. 2020. KEGG Mapper for infer- ring cellular functions from protein sequences. Prot. Sci. 29(1): 28–35. 7. Meyers B C, Scalabrin S, Morgante M. 2004. Map- ping and sequencing complex genomes: Let us get physical. Nat Rev Genet. 5(8): 578–89. 8. Devassy A, Kumar R, Shajitha PP, John R, Padma- kumar KG, Basheer V S, Gopalakrishnan A,Mathew L.2016. Genetic identification and Phylogenetic rela- tionships of Indian clariids based on mitochondrial COI sequences. Mitoch. DNA 27(5): 3777–3780. 9. Shizuya Hiroaki, Bruce Birren, Ung-Jin Kim, Vale- ria Mancino, Tatiana Slepak, Yoshiaki Tachiiri, & Melvin Simon. 1992. Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc Natl Acad Sci U S A. 89(18): 8794-8797. 10. Kumar R, Baisvar VS, Kushwaha B, Waikhom G, Nagpur NS. 2017. Cytogenetic investigation of Cyprinus carpio (Linnaeus, 1758) using giemsa, sil- ver nitrate, CMA3 staining and fluorescence in situ hybridization. Nuc. 60: 1–8. 11. Kumar R, Baisvar VS, Kushwaha B, Murali S, Singh VK. 2020. Improved protocols for BAC insert DNA isolation, BAC end sequencing and FISH for con- struction of BAC based physical map of genes on the chromosomes. Mol. Bio. Rep. 47(3): 2405–2413. 12. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Bio. Evol. 33(7): 1870–1874. 13. Derelle E, Ferraz C, Rombauts S, Rouzé P, Worden AZ, Robbens S, Partensky F, Degroeve S, Echey- nié S, Cooke R, Saeys Y, Wuyts J, Jabbari K, Bowl- er C, Panaud O, Piégu B, Ball SG, Ral JP, Bouget FY, Piganeau GDe, Baets B, Picard A, Delseny M, Demaille J, Peer YV, Moreau H.2006. Genome analy- sis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique features. Proc Natl Acad Sci U S A. 103(31): 11647-52. https://doi.org/10.3390/ijms232415958 40 Rashmi Verma et al. 14. Hanson RE, Zwick MS, Choi S, Islam-Faridi MN, McKnight TD, Wing RA, Price HJ , Stelly DM .1995. Fluorescent in situ hybridization of a bacterial artifi- cial chromosome. Genome. 38(4): 646-651. 15. Jiang J, Gill BS, Wang G, Ronald PC, Ward DC. 1995. Metaphase and interphase fluorescence in situ hybridization mapping of the rice genome with bac- terial artificial chromosomes. Proc Natl Acad Sci USA. 92(10): 4487-4491. 16. Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones SJ, Marra MA. 2009. Circos: An information aesthetic for comparative genomics. Gen.Res. 19(9): 1639–1645. 17. Letunic I, Bork P. 2019. Interactive Tree of Life (iTOL) v4: Recent updates and new developments. Nucl. Aci.Res. 47(W1): W256–W259. 18. Shannon P, Markiel A, Ozier, O, Baliga NS ,Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T.2003. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Gen. Res. ,13(11): 2498-504. 19. Szklarczyk D, Kirsch R, Koutrouli M, Nastou K, Mehryary F, Hachilif R, Gable AL, Fang T, Doncheva NT, Pyysalo S, Bork P, Jensen LJ, Mering CV. 2023. The STRING database in 2023: protein-protein asso- ciation networks and functional enrichment analy- ses for any sequenced genome of interest. Nuc. Ac. Res.51(D1): D638-D646. 20. Woo SS, Jiang J, Gill BS, Paterson AH, Wing RA. 1994. Construction and characterization of a bacte- rial artificial chromosome library of Sorghum bicolor. Nc. Ac. Res.22(23):4922-31. 21. Vishwanath W. 2010.Clarias magur. The IUCN Red List of Threatened Species. 2010: e.T168255A6470089. https://doi.org/10.2305/IUCN.UK.2010-4. RLTS. T1682 55A64 70089. 22. Poulsen TS, Johnsen HE, Zhao S, Stodolsky M.2004. BAC End Sequencing. In Methods in Molecular Biology. Bacterial Artificial Chromosomes, Library Construction, Physical Mapping and Sequencing Humana Press Inc. Totowa. 255: 157–161. Supplentary Table 1. Stands Scaffold Genomic Accession Protein id Amino acid + Scaffold21 QNUK01000021.1 KAF5907527.1 442aa - Scaffold21 QNUK01000021.1 KAF5907528.1 208aa - Scaffold21 QNUK01000021.1 KAF5907529.1 772aa + Scaffold21 QNUK01000021.1 KAF5907531.1 330aa - Scaffold21 QNUK01000021.1 KAF5907532.1 1150aa - Scaffold27 QNUK01000027.1 KAF5906889.1 200aa - Scaffold27 QNUK01000027.1 KAF5906891.1 364 aa + Scaffold27 QNUK01000027.1 KAF5906892.1 495aa - Scaffold27 QNUK01000027.1 KAF5906893.1 521aa - Scaffold65 QNUK01000065.1 KAF5903982.1 149aa + Scaffold65 QNUK01000027.1 KAF5906893.1 521aa + Scaffold65 QNUK01000065.1 KAF5903985.1 295aa - Scaffold72 QNUK01000072.1 KAF5903458.1 292aa + Scaffold72 QNUK01000072.1 KAF5903460.1 336aa - Scaffold222 QNUK01000222.1 KAF5897751.1 83aa + Scaffold222 QNUK01000222.1 KAF5897752.1 200aa - Scaffold222 QNUK01000222.1 KAF5897753.1 1250aa + Scaffold222 QNUK01000222.1 KAF5897754.1 376aa - Scaffold22 QNUK01000022.1 KAF5907406.1 64aa + Scaffold22 QNUK01000022.1 KAF5907407.1 59aa - Scaffold22 QNUK01000022.1 KAF5907408.1 552aa + Scaffold68 QNUK01000068.1 KAF5903764.1 926aa - Scaffold68 QNUK01000068.1 KAF5903765.1 883aa + Scaffold68 QNUK01000068.1 KAF5903766.1 256aa + Scaffold657 QNUK01000657.1 KAF5890715.1 250aa + Scaffold657 QNUK01000657.1 KAF5890716.1 608aa + Scaffold111 QNUK01000111.1 KAF5901503.1 369aa + Scaffold111 QNUK01000111.1 KAF5901504.1 1125aa + Scaffold22 QNUK01000022.1 KAF5907397.1 711aa - Scaffold22 QNUK01000022.1 KAF5907398.1 135aa + Scaffold349 QNUK01000349.1 KAF5894936.1 912aa + Scaffold349 QNUK01000349.1 KAF5894937.1 327aa + Scaffold368 QNUK01000368.1 KAF5894553.1 178aa + Scaffold49 QNUK01000049.1 KAF5905006.1 269aa https://doi.org/10.2305/IUCN.UK.2010-4