Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 73(2): 27-37, 2020 Firenze University Press www.fupress.com/caryologiaCaryologia International Journal of Cytology, Cytosystematics and Cytogenetics ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.13128/caryologia-730 Citation: A. Giovino, F. Martinelli, A. Perrone (2020) The technique of Plant DNA Barcoding: potential application in floriculture. Caryologia 73(2): 27-37. doi: 10.13128/caryologia-730 Received: December 12, 2019 Accepted: April 1, 2020 Published: July 31, 2020 Copyright: © 2020 A. Giovino, F. Martinelli, A. Perrone. This is an open access, peer-reviewed article pub- lished by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distri- bution, and reproduction in any medi- um, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. The technique of Plant DNA Barcoding: potential application in floriculture Antonio Giovino1,*, Federico Martinelli2,*, Anna Perrone3 1 Council for Agricultural Research and Economics (CREA), Research Centre for Plant Protection and Certification (CREA-DC), Bagheria, Italy 2 Department of Biology, University of Florence, Sesto Fiorentino, Florence, 50019, Italy 3 Department of Biological, Chemical and Pharmaceutical Sciences and Technologies Uni- versity of Palermo, Viale delle Scienze, Palermo, 90128, Italy *Correspondonding authors. E-mail: antonio.giovino@crea.gov.it; federico.martinelli@ unifi.it Abstract. The objective of this work was to assess the ability of the DNA barcoding approach to identify different taxonomic groups from two flowering plant collec- tions: 1) the most relevant commercial taxa (nursery production) and 2) Mediterra- nean plants with ornamental attitude (new emerging species). “Core markers”, rbcL and matK, were adoptedthe identification step of 100 taxa belonging to 20 families. A third marker, the intergenic spacer trnH-psbA, was also tested, on 74 taxa, when the core markers were not able to discriminate well the analysed germplasm.DNA barcode fragments were recovered for all the total taxa investigated (100%). The rbcL showed the best performances: the greatest amplification success, the best sequencing perfor- mance both in terms of the number of sequences obtained and in terms of quality of the sequences obtained. Despite having recorded greater amplification difficulties, according to numerous other studies, matK has shown a good success in sequencing and quality of the obtained sequences (de Vere et al. 2012), unlike what is indicated in some protocols that suggests for this region the need for further primers to be adopted for the sequencing phase (Hollingsworth et. al 2011). Results showed that sixty-one taxa overall (61%) were totally resolved at specific or subspecific level, by at least one of the three markers. The matK and rbcL locus respectively resolved 44% and 35% of the taxa. The core markers in multilocus approach led to the discrimination of a total of 49% taxa. The trnH-psbA was able to discriminate 52% of taxa analysed and resulting determinant in the discrimination of 14 taxa. Four families, including the major num- ber of taxa (Arecaeae, Fabaceae, Euphorbiaceae, Asteraceae), were evaluated in terms of genetic distance (K2P% value). This work highlighted the potential of the barcoding approach for a rapid identification of plant species in order to solve taxonomic disputes and support commercial traceability of floreal products. Keywords: DNA barcoding, DNA fingerprinting, floriculture,genetic identification. 1 INTRODUCTION Genetic certification of plant material is, today more than ever, a funda- mental requirement to increase the competitiveness of plant nurseries, even 28 Antonio Giovino, Federico Martinelli, Anna Perrone in the ornamental sector. This represents a unique and effective tool for unambiguous determination of nature of plant species. These improvements will enhancethe floriculture sector through the successful obtainment of the following to objectives: 1) genetic identification (especially for native plants) and particularly to iden- tify the link between genetic resources of ornamental interest and the relative territory of origin, thus pro- moting the products in harmony with the territory and with sustainability criteria, 2) traceability (native plants and imported plants) through the characterization of autochthonous products, plant material of supply chain and non-native incoming material. Therefore, the genet- ic certification of plant material is an extremely impor- tant aspect for the resolution of related problems:1) taxonomic controversies (synonymy/homonymy) and species of difficult identification, 2) newly introduced programs, genetic improvement, 3) early identification of species with very long phenological cycles, 4)corre- spondence checks of vegetable species entering the mar- kets, 5) protection of biodiversity, of native or endan- gered species. Recently, DNA barcoding has emergedas a new molecular tool for taxonomists (Hebert, Ratnas- ingham & deWaard, 2003). A DNA barcodeis a univer- sally accepted short DNA sequence normally employed for the identification of species (Savolainen et al., 2005), promoted for a variety of biological applications (Holl- ingsworth, Graham & Little, 2011), including the identi- fication of cryptic species, species discovery (Bickford et al., 2007) and taxonomic revisions (Simeone et al 2013). The genotype is nothing but the set of all the genes that make up the DNA of an organism. Thus DNA- based taxonomy has proved to be a valuable support to the classical taxonomy allowing to face the growing need for accurate and accessible taxonomic information (Tautz et al., 2003). In particular, the advent of molecu- lar markers has marked a remarkable turning point in the world of plant genetics allowing the construction of association genetic maps and the identification of genes responsible for agronomic characters (Giovino et al. 2015a). In taxonomic studies, markers are important for botanical classifications and the analysis of phyloge- netic relationships (Varshney et al., 2005). Among the molecular techniques, a new approach to the study of biodiversity has become widespread, with all the prob- lems related to this study: the DNA barcoding, literally “DNA barcode”. The name of this approach refers to the identification method by which a scanner distinguishes various commercial products using linear bar codes or “UPC” (Universal Product Code).This molecular inves- tigation approach was first proposed to the scientific community in 2003 by the population geneticist Paul Hebert of the University of Guelph (Canada) (Hebert et al 2003). In this work it was used for the identifica- tion of species, a gene sequence located in the region of the mitochondrial gene COI, coding for the subu- nit I of the cytochrome-c oxidase (also known as War- burg’s respiratory fragment), therefore the variability of a molecular marker for the identification of biological identities is exploited.Over the years, COI has been suc- cessfully used in various animal taxa, including birds (Hebert et al., 2004b), arthropods (Barrett and Hebert, 2005), fish (Ward et al., 2005) and Lepidoptera (Hebert et al., 2004a). In vegetables, COI has not proved to be an excellent marker for phylogenetic studies, due to the low evolutionary rate of the mitochondrial genome. In order to overcome this problem, other markers for DNA barcoding of plants have been identified in recent years. These are DNA sequences present in some sections of the chloroplast genome, such as the trnH-psbA inter- genic region, the matK gene or the rbcL gene, which have characteristics similar tocoxI useful for species identification. There are several requirements for a marker to be considered appropriate for DNA barcod- ing. First of all it is advisable that the marker has a wide taxonomic coverage (also called universality), which would allow the applicability of the gene chosen as bar- code markern to the largest possible number of taxa and have a high success rate of PCR and sequencing. A high resolution capacity of the gene is also important, i.e the ability of a given barcode to differentiate species. This is typically based on the amount of interspecific differences between DNA sequences (Polymorphism). Another fundamental assumption is that the molecular marker chosen as a barcode should show a higher inter- specific variability than intraspecific variability. Inter- and intra-specific variability are separated by a certain distance (discontinuity between intra and interspecific variability) called “barcoding gap” (Meyer and Paulay, 2005).The ideal marker therefore consists of a highly variable region, which provides for species discrimina- tion, flanked by highly conserved regions for which ade- quate primers can be designed (Saunders and Kucera, 2010). Therefore, for the plants, the Barcoding proto- cols refer to the indications of the Plant working Group, which suggests the use of a multi-locus approach (Hol- lingsworth et al., 2011; Domina et al. 2017). The gen- eral objective of the research was to use the technique of DNA barcoding to help nursery production thanks to the easy identification of new products, ornamental plants and ornamental-food valueto respond to new and growing market needs. 29The technique of Plant DNA Barcoding: potential application in floriculture 2 MATERIALS AND METHODS 2.1 Plant collection Native Sicilian plant species of high ornamental val- ue or dual aptitude for new introduction were selected, collected and morphologically analyzed. Selection was also extended to autochthonous or exotic species already produced at Faro srl (Catania, Italy) in order to gain more insights into: 1) taxonomic controversies (synony- my / homonymy); 2) early identification of species with very long phenological cycles; 3) correct identification of species with significant commercial impact. Samples collection for DNA analysis includes 100 plant species. (Tab. 1). We have included 52 species commercialized by Faro srl in addition to 36 native species that were pre- sent in the collection at the CREA-DC (Bagheria, Italy). For all the selected species, a bank of freeze-dried plant material and the respective DNA bank was set up at the CREA-DC of Bagheria for long-term conservation stock. Before proceeding with the application of the molecular characterization protocols, it was necessary to carry out a preliminary characterization at a morphological level, The plant material under study is represented by 3 replicates for each species (or three distinct plants for each species), specifically from each of them tissue sam- ples were taken, represented by young leaves, which con- stitute the plant material from which to proceed with DNA extraction . Every single sample was cataloged with an identification code (ID) in order to set up a real germplasm collection, as well as for the establishment of a bank of germplasm DNA (freeze-dried). For all the selected species, a bank of freeze-dried plant material and the respective DNA bank was made at CREA in Bagheria, as an important stock for the con- servation of the plant material in question. 2.2 Molecular analysis For the molecular identification of the plants, young leaves, previously subjected to lyophilization, were used as starting material for DNA extraction.DNA was extracted from three biological replicates (lyophilized) for each taxonomic entity using CTAB-related method (Doyle & Doyle, 1987). Amplification and sequencing protocols of three regions of DNA usingrbcL, matK and trnH-psbA were performed,as defined by the Consorti- um for the Barcode of Life (CBOL). Firstly, these plastid portions, named “core markers”, were used for genetic characterization. For those species in which the core markers were unsuccessful, a third marker was tested based on the trnH-psbA intergenic region. This portion is in fact known to support a greater degree of discrimi- nation between related species. A pipeline of the genetic characterization analysis is shown in Figure 1. Sequences of the rbcL, matK and trnH-psbA primers used in the PCR amplification were the following: • rbcL-F: ATGTCACCACAAACAGAGACTAAAGC • rbcL-R: GTAAAATCAAGTCCACCRCG • matK-3F KIM: CGTACAGTACTTTTGTGTTTAC- GAG • 4) matK-1R KIM: ACCCAGTCCATCTG- GAAATCTTGGTTC • 5) trnHf_05: CGCGCATGGTGGATTCACAATCC • 6) psbA3_f: GTTATGCATGAACGTAATGCTC In relation to the PCR conditions, the protocol suggested by the CBOL Plant Working Group (Hol- lingsworth et al., 2009) was followed, and the amplifi- cations were conducted with a Gene®Amp PCR System 9700 thermocycler (Applied Biosystems).The amplicons were run on 2% agarose gel, whose purpose is to ensure the successful amplification of the segments of DNA involved, using the barcode primers used. The gels were analysed using the image acquisition “Gel Doc” of BIO- RAD, which allows to use a special “Quantity One” soft- ware, to identify amplified DNA bands. 2.3 Data analysis The PCR products were purified and sequenced fol- lowing the DYEnamic™ ET termination kit sequencing kit (Amersham Biosciences) using an automatic sequenc- er AB3730XL DNA Analyzer (Applied Biosystems). The fragments were sequenced both forward and in reverse, using the same primers adopted for PCR.Through Sequencer software 4.10 (Gene Codes Corporation, USA) the electropherograms were carefully checked and eventually cleaned manually,and assembled in contigs. The obtained sequences were blasted and aligned using MUSCLE software, implemented within Mega 6 pro- gram (Tamura et al. 2013) used for phylogenetic analysis. Several parameters have been evaluated to be able to efficiently determine the real discriminating power of the Barcoding markers used. Two categories of param- eters were taken into account: 1) thoserelated to techni- cal performances and those useful for assessing the dis- criminated power. The number of PCR positive samples for each marker was calculated, both for the total num- ber of biological replicates and number of taxa analyzed. Dealing with sequencing success, the number of samples positive for the sequencing procedure was calculated, which concerned only the PCR-positive samples for each marker, both in relation to the total number of biologi- cal replicates and to the number of taxa. Quality of the 30 Antonio Giovino, Federico Martinelli, Anna Perrone Table 1. Species selected for molecular investigations. Famiglia Specie Acanthaceae Acanthus mollis L. Arecacea Acoelorraphe wrightii H. Wendl. ex Becc. Arengaengleri Becc. Caryota urens L. Chamaerops humilis var. humilis/ Chamaerops humilis L. Chamaerops humilis var. argentea André Chamaeropshumilis L. “Vulcano” Chamaeropshumilis L. “Etna star” Howeaforsteriana (F. Muell.) Becc. Livistonachinensis (Jacq.) R.Br. ex Mart. Phoenix canariensis Chabaud Phoenix dactylifera L. Phoenix reclinata Jacq. Phoenix roebelenii O’Brien Sabal minor (Jacq.) Pers. Sabal palmetto (Walter) Lodd. ex Schult. & Schult.f. Trachycarpus fortune (Hook. ) H. Wendl. Washingtonia robusta H. Wendl. Washingtonia filifera (Linden ex André) H. Wendl. ex de Bary Butia capitata (Mart.) Beccari Bismarckia nobilis Hildebr. & H. Wendl. Brahea armata S. Watson Brahea edulis H.Wendl. ex S.Watson Trithrinax campestris (Burmeist.) Drude&Griseb. Arecastrum romanzoffianum (Cham.) Becc. Syagrus romanzoffiana (Cham.) Xanthorrhoeaceae Aloe arborescens Mill. Aloe vera (L.) Burm.f. Aloe plicatilis (L.) Mill.. Aloe × spinosissima Jahand. Fabaceae Spartium junceum L. Ceratonia siliqua L Genista madoniensis Raimondo Genista demarcoi Brullo, Scelsi & Siracusa Genista tyrrhenaVals. Genista cupanii Guss. Genista aetnensis (Biv.) DC. Genista aristata C.Presl Cistaceae Cistus albidus L Cistus salvifolius L. Cistus x pulverulentus Pourr. Cistus × skanbergii Lojac. Cycadaceae Cycascircinalis L. Cycas revolutaThunb. Myrtaceae Myrtus luma Molina Metrosideros excelsa Sol. ex Gaertn. Myrtus communis L. Famiglia Specie Lamiaceae Rosmarinus officinalis L. Salvia leucantha Cav. Lavandula angustifolia Mill. Lavandula stoechas L. Sideritis italica (Mill.) Greuter&Burdet Salvia officinalis L. Ericaceae Arbutus unedo L. Erica siculaGuss. Erica peduncularis C.Presl Erica multiflora L. Asteraceae Helichrysum italicum (Roth) G. Don Helichrysum hyblaeum Brullo Helichrysum nebrodense Heldr. Helichrysum scandens Guss. Anthemis cupaniana Tod. ex Nyman Centaurea sphaerocephala L. Jacobaea gibbosa (Guss.) B.Nord. &Greuter Pallenis maritime (L.) Greuter Ptilostemon greuteri Raimondo & Domina Senecio candidus (Presl.) DC. /Jacobaea candida (C.Presl) B.Nord. & Greuter Jacobaea ambigua(Biv.) Pelser&Veldkamp Anthemis maritima L. Hieracium cophanense Lojac. Iridaceae Iris pseudopumila Tineo Iris germanica L. Strelitziaceae Strelitzia augusta Thunb Strelitzia Nicolai Regel&K.Koch Strelitzia reginae Banks Tamaricaceae Tamarix gallica L. Convolvulaceae Calystegia soldanella (L.) R. Br. Amaranthaceae Diotis maritima (L.) Desf. ex Cass./Achillea maritima (L.) Ehrend. &YPGuo Liliaceae Tulipa radii Reboul Brassicaceae Brassica insularis Moris Brassica villosa subsp. tinei (Lojac.) Raimondo & Mazzola Brassica rupestris subsp. hispida Raimondo & Mazzola Rosaceae Rosa sicula Tratt. Rosa sempervirens L. Rosa canina L. Rosa corymbifera Borkh. Caryophyllaceae Dianthus busambrae Soldano & F. Conti Dianthus rupicola subsp. aeolicus (Lojac.) Brullo&Miniss. Dianthus rupicola Biv. subsp. rupicola Dianthus rupicola subsp. lopadusanum Brullo & Miniss. Dianthus siculus C. Presl 31The technique of Plant DNA Barcoding: potential application in floriculture sequence was given by the quality of the peaks present on the electropherograms to indicate the precision and reliability of the sequences obtained. Sequences with quality over 70% were considered suitable. The reported value indicates the average of biological replicates. Frag- ment length was determined and referred to the aver- age length of the fragments obtained for each marker, in relation to the total of biological replicates, follow- ing the analysis and cleaning of the electropherograms. The value of thepower of discrimination parameter was given by the number of taxa that have been univocally discriminated on the level of species (or subspecies).The discriminating power was assessed both for single locus and in multi-locus approach. The discrimination power of each locus was evaluated by phylogenetic analysis with Mega6, conducted by comparing all the sequences generated in this study and using a subset of referring sequences related to each taxa found by BOLD Database / GenBank. The level of genetic divergence was deter- mined and indicated the degree of variability between a group of sequences, obtained from the distance matrices calculated according to the parameter K2P% (Kimura, 1980). It was calculated within some families considered most representative by number of species. Number of variable sites was determined. It indicated the number of bases subject to variations within the gel phylogenetic group considered on the total length of the fragments obtained for each locus. Like the previous one, it was calculated within some families considered most repre- sentative of the entire collection of analyzedplant spe- cies. 3 RESULTS AND DISCUSSION Results of discrimination outputs for each of the three markers are reported in Tab. 2. Using a total of 300 samples (including biological replicates), rbcLob- tained 93% PCR success, 95% sequencing success, with 90% sequence quality and an average fragment length of 569 bp. MatK showed a success of PCR and sequencing, respectively of 70% and 93% and a quality of sequences of 80% with an average length of fragments of 766 bp. The use of trnH-psbA marker showed PCR and sequenc- ing success respectively of 80% and 91% and a sequence quality of 85% with an average fragment length of 518 bp. Consideringa total number of 100 taxa tested, rbcL showed higher values than the other two markers, with PCR success of 97% and a success of sequencing of 99%, for matK the recorded values were of 81% for suc- cessful apmification and 96% for sequencing success, while trnH-psbA marker showed respectively PCR and sequencing successof 89% and 94%. In relation to the above results, rbcL showed the best performances: the greatest amplification success, the best sequencing yield both in terms of the number of sequences obtained and in terms of the quality of the sequences obtained. The matK, despite having experienced greater amplification difficulties agreeing with numerous other studies (de Vere et al. 2012), it showed a good success of sequencing and good quality of obatined sequences. This does not agree withprevious works that suggest the need to use matK with additional primers for sequencing purpos- es (Hollingsworth et. to 2011). Taxa identification was firstly carried out using “core markers” (rbcL and matK). The use of the third marker, the IGS trnH-psbA was reserved for those situations in which both core mark- Famiglia Specie Dianthus rupicola subsp. hermaensis (Coss.) O. Bolòs& Vigo Euphorbiaceae Euphorbia ceratocarpa Ten. Euphorbia characias L. Euphorbia dendroides L. Euphorbia meuselii Geltman Euphorbia myrsinites L. Euphorbia helioscopia L. Euphorbia bivonae Steud. Euphorbia pithyusa subsp. cupanii (Guss. ex Bertol.) Radcl.-Sm. Euphorbia amygdaloides L. Table 2. Technical performancesof markers used in DNA barcod- ing techniques referred to the total of biological replicates (a) and tested taxa (b). (a)   rbcL matK trnH-psbA Number of tested samples* 300 300 222 Successful amplification (93%) 279/300 (70%) 210/300 (80%) 177/222 Successful sequencing (contigs) (95%) 265/279 (93%) 195/210 (91%) 161/177 High quality sequence (contigs) 90% 80% 85% Fragment length (average in bp) 569 766 518 (b)   rbcL matK trnH-psbA Number of tested samples* 100 100 74 Successful amplification (97%) 97/100 (81%) 81/100 (89%) 66/74 Number of taxa successfully sequenced (99%) 96/97 (96%) 78/81 (94%) 62/66 32 Antonio Giovino, Federico Martinelli, Anna Perrone ers presented difficulties, due to lack of amplification, failure of sequencing reactions or insufficient discrimi- nating power. The overall identification results at species level for each tested taxawere reported in Tab. S1. Out of a total of 100 taxa tested, 61% of taxa were success- fully identified at the species level with at least one of the three locus, while 37% remained at the genus level. Only the remaining 2% of the taxa remained undetermined due to the failure of all three markers employed.Con- sidering the individual markers, rbcL allowed a unique identification at the species level of 34 taxa (35%), matK of 34 taxa (44%) and trnH-psbA of 32 taxa (52%) (Tab. 3). MatK showed greater percentage values of resolv- ing power in terms of discrimination of taxa than rbcL, confirming the trends indicated by other studies (Chen et al. 2010). When rbcL and matKwere not able to dis- criminate species (belonging to 14 taxa), trnH-psbA was decisive in the identification of them, allowing to increase the total number of discriminated taxa from 47 to 61 taxa. The core markers, used in multi-locus, rbcL + matK, allowed the unambiguous identification at the species level of 38 taxa. Further combinations of the two markers rbcL + trnH-psbA and matK + trnH- psbA allowed the discrimination of 32 taxa and 25 taxa respectively.The use of the multi-locus approach based on core markers appeared to be the most efficient, with a good compromise between the high technical perfor- mance of the rbcL and the best resolving power support- ed by the matK.The following families showed the high- est success rate of species discrimination: Asteraceae (9 uniquely discriminated taxa out of 13, Caryophillaceae with 4 taxa of 6, Fabacecae with 8 taxa out of 8, Euphor- biaceae with 9 taxa out of 9, Brassicaceae with 3 taxa out of 3, Ericaceae with 4 taxa out of 4. Minor successes in terms of unambiguous resolution at the species level, have been found for Arecaceae, (7 taxa discriminated at the species level on a total of 24), and for the Cistaceae (none). Levels of genetic divergence for larger families were reported in Tab. 4. The rbcL marker showed the lowest values of genetic divergence for Arecaceae, with 0.7%, and the highest values for Asteraceae, with 2.1%, while matK showed the lowest values for the Arecace- ae with 1.5% and the highest for Fabaceae with 6.4%. TrnH-psbA showed the highest values for Euphorbi- aceae with 9.1% and the lowest for Arecaceae with 2.9%. TrnH-psbA has confirmed high variability values and its ability to discriminate within very similar taxonom- ic groups (Chase et al. 2007).In the Arecaceae family, which in our study included 24 species from 15 differ- ent genera, the trnH-psbA marker recorded the highest genetic divergence value with a percentage of 2.9%. The lowest values occurred with rbcL with a percentage of 0.7%, while matK showed intermediate values compared with the first two with a value of 1.5% (Tab. 4). The rbcL was able to identify two species of Arecaceae (Acoelor- raphe wrightii and Caryota urens L.). When rbcL failed, matK was decisive for identification of 4 taxa (Arenga engleri Becc., Phoenix roebelenii O’Brien, Sabal minor (Jacq.) Pers., Bismarckia nobilis Hildebrandt & H.Wendl., 1881). Other authors indicated rbcL and matK as highly decisive phylogenetic analysis of this family (Asmussen et al. 2006).Only in the case of Washingtonia robusta H. Wendl., the discrimination was possible through the use of both core markers. Relating to Fabaceae (8 species investigated from 3 different genera), the lowest values of genetic divergence were recorded with rbcL with 1.5% and the highest with trnH-psbA with values of 7.4%. Using matK a genetic divergence of 6.4% was obtained, discriminating 4 species out of 8. The matK was deter- minant for 1 taxa (Genista aristata C.Presl), while the trnH-psbA was determinant for 2 taxa (Genista tyrrhena Vals., Genista demarcoi Brullo, Scelsi & Siracusa). Con- sidering that Genista was the most represented genus (with 6 species), rbcL showed a better result than matK within this group, discriminating 5 species (Spartium junceum L., Ceratonia siliqua L., Genista madonien- sis Raimondo, Genista cupanii Guss., Genista aetnensis Raf. ex Biv.). This result appears to be in contrast with the potential expressed by matK within the Fabaceae in other studies (Gao et al 2011; Gao and Chen 2009). Here, the Genista group showed excellent levels of discrimina- tion with this marker. Relating to Asteraceae (13 inves- tigated species belonging to 8 different genera),matK showed values of genetic divergence of 4.4% and rbcL 2.1%. As for the trnH-psbA, given the excessive vari- ability shown by the analyzed sequences, a subdivision into genera. The lowest genetic divergence values were recorded for Anthemis with 1% and higher for Jacobaea with 3.3%. (Tab. 4). Relating to Asteraceae, rbcL has allowed us to iden- tify at the species level 4 taxa (Centaurea sphaerocephala L., Helichrysum nebrodense Heldr., Ptilostemon greu- teri Raimondo & Domina, Pallenis maritima (L.) Greu- Table 3. Discriminating power of Barcoding markers. 33The technique of Plant DNA Barcoding: potential application in floriculture ter), while the matK has discriminated 5 taxa resulting in particular in the discrimination of 2 species (Heli- chrysum italicum (Roth) G. Don, Hieracium cophanense Lojac.). The trnH-psbA was determinant in the resolu- tion of a further 3 taxa (Jacobaea gibbosa (Guss.) Peru- zzi, Jacobaea ambigua (Biv.) Pelser & Veldk., Senecio candidus (C. Presl) DC. Jacobaea gibbosa (Guss.) Peruzzi showed a wide variability compared to the other species of the genus Jacobaea, departing from these in all three markers used. This highlighted the presence of differ- ent clusters within the species. For Asteraceae, the dis- crimination was rather high in agreement with other studies that indicated high levels of discrimination suc- cess (Gao et al 2010).Within family Euphorbiaceae (9 species investigated of a single genus) the lowest values of genetic divergence occurred with rbcL with 1.2%, the highest with trnH-psbA with 9.1% and intermediate val- ues with matK(4%). (Tab. 4). Figures S1-S2 showed the phylogenetic relationships using the three markers for Euphorbiaceae. The rbcL identified 6 taxa (Euphorbia bivonae Steud., Euphorbia ceratocarpa Ten., Euphorbia dendroides L., Euphorbia helioscopia L., Euphorbia myrs- inites L., Euphorbia pithyusa subsp. Cupanii Guss.). MatK correctly identified 3 taxa and was decisive for 1 taxa (Euphorbia amygdaloides L.), while the trnH-psbA was determinant for 2 taxa (Euphorbia characias L., Euphor- bia meuselii Raimondo & Mazzola). For the genera Bras- sica, Erica, Cistus, Chamaerops, Dianthus, Euphorbia and Genista, the work of molecular identification was performed with the use of referring species found spe- cifically for this study. This was due to the absence in the international databases of species similar to those select- ed in this study (Aubriot et al. 2013; Domina et al. 2017; Giovino et al. 2015b). Therefore, these species and their respective sequences are new will be added into interna- tional databases. For taxa discriminated on a species level with the DNA Barcoding methodology (green colour in Figs 4 and 5), our data open the possibility of a real “iden- tity certification” card for these plant species in order to trace their commercial products at marketing stage, in order to guarantee their unique identification and traceability, to protect both biodiversity and economic aspects of nursery productions as well as end-users.The certification and traceability system may follow a very precise path (Fig. 2; Fig. 3).This traceability can begin with the use of DNA Barcoding protocols for the iden- tification of the species. Consequently, the realization of a label where, in addition to the generic species, it will be possible to include molecular results, translated into a barcode swhich, by scanning with special barcode scan- ners will immediately make it possible to have all certain species’ indications. A big issue emerged from this study was the lack of reference sequences available for species and taxa com- parison. This issue has determined the impossibility of discriminating some groups such as: Livistona chinensis Jacq, Trachycarpus fortunei Hook., Phoenix dactylifera L.; Phoenix reclinata Jacq., Trithrinax campestris Bur- meist., Anthemis cupaniana Tod. ex Nyman, Butia capi- tata (Mart.) Becc., Senecio candidus (C. Presl) DC, Aloe arborescens Mill., Aloe plicatilis L., Iris pseudopumila Tineo, Iris germanica L., Salvia officinalis L., Cistus salvi- fosius L., Cistus x pulverulentus Delilei, Cistus albidus L., Cistus skanbergii, Dianthus rupicola subsp. aeolicus Lojac., Dianthus busambrae Soldano & F. Conti. This Figure 1. Flowchart summarizing steps for the genetic identifica- tion of samples using DNA Barcoding and selected markers. Figure 2. Workflow used for the molecular characterization of the plant species usable by companies using international CBOL stand- ards. Figure 3. Proposed type of genetic labels for traceability of plant species at commercial level. Table 4. Levels of genetic divergence for larger families. Genetic divergences calculated with the parameter K2P% (Kimura 1980). Family rbcL matK   trnH-psbA N. seq Variable sites GD% N. seq Variable sites GD% N. seq Variable sites Arecaceae 107 24/533 0,7 115 101/770 1,5   36 85/676 Fabaceae 25 32/543 1,5 21 181/815 6,4   9 67/329 Euphorbiaceae 27 39/540 1,2 14 88/769 4   18 164/736 Asteraceae 67 54/563 2,1 83 157/797 4,4 Jacobaea 14 22/416 Helichrysum 14 44/533 Anthemis 20 8/348 34 Antonio Giovino, Federico Martinelli, Anna Perrone evidence demonstrated the great importance of creating molecular databases that incorporate the widest pos- sible biodiversity with universal markers. In addition, it highlighted the importance of creating a dedicated database of the main floricultural species of ornamental interest, which can support the practical application of the molecular protocol for the purposes of traceability and monitoring by control bodies (Giovino et al. 2014). Although DNA Barcoding can reach 80-90% of resolu- tion levels, it can lack sufficient discrimination power in some families, including Ericaceae, Lamiaaceae, Orchi- daceae. This is due to the modest evolutionary distance between closely related species evolved from recent divergence, as suggested before (Hollingsworth et al., 2009). Although in some cases, the multi-locus approach can have a great success, the evaluation of additional barcoding regions in relation to the success of discrimi- nation, requires the use of individual taxonomic groups with difficult discrimination (Hollingsworth et al., 2011). In conclusions, this work confirmed the high per- formances of rbcL and matK markers usin a total of 100 plant taxa, belonging to 20 different families. The taxa successfully sequenced for at least one of the considered markers were 98 and 61% of the total evaluated ones at level of species or subspecies. Considering that the fail- ure of taxa is linked to particular genus, or species, with very low evolutionary divergence, this result confirms the potential of the barcoding approach for the rapid analysis of unknown samples. Cryptic groups found in this study highlighted the already well-known techni- cal problems due to the low level of matK amplification and sequencing success. Anyway, this marker greater power of discrimination compared to rbcL.Therefore, we can conclude that although the adoption of core mark- ers appeared to be a good compromise, in some cases the multi-locus approach and the addition of the third trnH-psbA marker can promote greater success, as dem- onstrated here. The evaluation of additional barcoding regions can be useful for increasing the success of discrimination, but thisdepends on the individual taxonomic groups showing problems of PCR amplification and sequencing with core markers. However, it is worthy to notice that a large sample of references related to eachtaxa is neces- sary to validate the accuracy of the method.This study highlighted the great importance of creating molecular databases incorporating the widest possible biodiversity with universal markers, developing a dedicated database, especiallyfor floricultural species with ornamental inter- est to enhance their traceability and monitoring of com- mercial exchanges by control national authorities. DISCLOSURE STATEMENT No fincial interests or benefits has been arisen from the application of our research. DATA AVAILABILITY STATEMENT We declare that all data presented here have been included in the present work and related supplemental material. DATA DEPOSITION Most of the analysed species were submitted in the Bold database within the project: FMED: Manager Gio- vino Antonio (Tab. 5). REFERENCES AsmussenCB, Dransfield J, DeichmannV, BarfodAS, Pin- taudJC, Baker WJ. 2006. A new subfamily classifica- tion of the palm family (Arecacee): Evidence from plastid DNA phylogeny. Bot J Linn Soc. 151(1):15-38. Aubriot X, Lowry PP 2nd, Cruaud C, Couloux A, Haev- ermans T. 2013. DNA barcoding in a biodiversity hot spot: potential value for the identification of Mala- gasy Euphorbia L. listed in CITES Appendices I and II. Mol EcolResour. 13(1):57-65. doi: 10.1111/1755- 0998.12028. Barrett R, Hebert PDN. 2005. Identifying spiders through DNA barcodes. Can J Zool. 83:481–491. Bickford D, Lohman DJ, Sodhi NS, Ng PKL, Meier R,Winker K, Ingram KK, Das I 2007. Crypticspecie- sas awindow on diversity and conservation. Trends in Ecologyand Evolution 22: 148–155. Chase MW, CowanRS, Hollingsworth PM, van den Berg C, Madriñán S, Petersen G, Seberg O,Jørgsensen T, Cameron KM, Carine M, Pedersen N, Hedderson TAJ, Conrad F, Salazar GA, Richardson JE, Hollings- worth ML, Barraclough TG, Kelly L, Wilkinson M. 2007. A proposal for a standard protocol to barcode all land plants. Taxon. 56(2):295–299. Chen SL, Yao H, Han JP, Liu C, Song JY, Shi LC, Zhu YJ, Ma XY, Gao T, Pang XH, Luo K, Li Y, Li XW, Jia XC, Lin YL, Leon C. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE. 5:e8613. doi:10.1371/jour- nal.pone.0008613. De Vere N, Rich TC, Ford CR, et al. DNA barcoding the native flowering plants and conifers of Wales.  PLoS One. 2012;7(6):e37945. doi:10.1371/journal. pone.0037945 35The technique of Plant DNA Barcoding: potential application in floriculture Table 5. Species included in the Barcode of Life Data Systems (BOLD - www.barcodinglife.org). FMED010-12 – Dianthus busambrae [rbcLa:587] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D2-1[sampleid], PAL96708[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED011-12 - Dianthus rupicola subsp rupicola [matK:810,rbcLa:586,trnH-psbA:192] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D3.C[sampleid], PAL96722[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED012-12 - Dianthus rupicola subsp lopadusanum [matK:801,rbcLa:562,trnH-psbA:246] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D4.C[sampleid], PAL96723[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Isole Pelagie FMED013-12 - Genista madoniensis [rbcLa:582] Taxonomy: Magnoliophyta, Magnoliopsida, Fabales, Fabaceae, Genista Identifiers: G2u[sampleid], PAL96710[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED014-12 - Genista demarcoi [matK:805,rbcLa:577] Taxonomy: Magnoliophyta, Magnoliopsida, Fabales, Fabaceae, Genista Identifiers: G4u[sampleid], PAL96713[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED015-12 – Hieracium cophanense [matK:817,rbcLa:590] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Hieracium Identifiers: H2.C[sampleid], PAL96873[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED016-12 – Helichrysum hyblaeum [matK:809,rbcLa:596] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Helichrysum Identifiers: H6.C[sampleid], PAL96719[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Siracusa FMED023-12 – Ptilostemon greuteri [matK:793,rbcLa:577] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Ptilostemon Identifiers: P1.C[sampleid], PAL96705[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Trapani FMED027-13 - Centaurea [matK:805,rbcLa:581] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Centaurea Identifiers: C3.C[sampleid], PAL96729[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED028-13 - Brassica villosa subsp. bivoniana [rbcLa:568] Taxonomy: Magnoliophyta, Magnoliopsida, Brassicales, Brassicaceae, Brassica Identifiers: B3.C[sampleid], PAL96874[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED029-13 - Centaurea [matK:836,rbcLa:588] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Centaurea Identifiers: C1-3[sampleid], PAL86908[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Messina FMED031-14 - Brassica villosa [matK:798,rbcLa:557,trnH- psbA:350] Taxonomy: Magnoliophyta, Magnoliopsida, Brassicales, Brassicaceae, Brassica Identifiers: B4u[sampleid], PAL96698[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED039-16 - Dianthus rupicola subsp rupicola [matK:810,trnH-psbA:192] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D3b[sampleid], FI18813[fieldid], FI18813[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Campania FMED040-16 - Dianthus rupicola subsp rupicola [matK:810,trnH-psbA:192] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D3c[sampleid], PAL72352[fieldid], PAL72352[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Trapani FMED041-16 - Dianthus rupicola [matK:790,trnH-psbA:188] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D6p[sampleid], PAL108619[fieldid], PAL108619[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Tunisia, Zembraisland 36 Antonio Giovino, Federico Martinelli, Anna Perrone Domina G, Scibetta S, Scafidi F, Giovino A. 2017. Con- tribution to the identification of Dianthus rupicola (Caryophyllaceae) subspecies using morphological and molecular approaches. Phytotaxa. 291(1): 017– 032. doi.org/10.11646/phytotaxa.291.1.2. Gao T, Chen SL. 2009. Authentication of the medicinal plants in Fabaceae by DNA barcoding technique. Planta Med.; 75 - P-13DOI: 10.1055/s-2009-1216451 Gao T, Sun Z, Yao H, Song J, Zhu Y, Ma X, Chen S. 2011. Identification of Fabaceae plants using the DNA bar- code matK. Planta Med. 77(1): 92-94. Giovino A, Marino P, Domina G, Scialabba A, Schic- chi R, Diliberto G, Rizza C, Scibetta S. Evaluation of the DNA barcoding approach to develop a reference data-set for the threatened flora of Sicily. 2014. Plant Biosyst. 150(4):631-640. DOI:10.1080/11263504.2014 .989285. Giovino A, Bertolini E, Fileccia V, Al hassan M, Labra M, Martinelli F. 2015a. Transcriptome Analysis of Phoe- nix canariensisChabaud in Response to Rhynchopho- rusferrugineus Olivier Attacks. Frontiers Plant Sci. 6:817. doi:10.3389/fpls.2015.00817. Giovino A, Marino P, Domina G, Rapisarda P, Rizza G, Saia S. 2015b. Fatty acid composition of the seed lipids of Chamaerops humilis L. natural populations and its relation with the environment.Plant Biosys- tems. 149(4):767-776. Hebert PDN, Cywinska A, Ball SL, deWaard JR. 2003. Biological identifications through DNA barcodes. Proc Biol Sci. 270(1512):313-2. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W. 2004.Ten species in one: DNA barcod- ing reveals cryptic species in the neotropical skipper butterfly Astraptesfulgerator. Proc Natl Acad Sci U S A. 101(41):14812-7. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM. 2004. Identification of birds through DNA barcodes. PLoS Biol. 2(10):e312. Hollingsworth PM, Graham SW, Little DP. 2011. Choos- ing and Using a Plant DNA Barcode. PLoS ONE. 6(5): e19254. Hollingsworth P.M. et al. CBOL Plant Working Group. 2009. A DNA barcode for land plants. Proc Nat Acad Sci United States Amer. 106:12794–12797. Kimura M. 1980. A simple method for estimating evo- lutionary rates of base substitution through com- parative studies of nucleotide sequences. J Mol Evol. 16(2):111-120 Meyer CP, Paulay G. 2005. DNA Barcoding: Error Rates Based on Comprehensive Sampling. PLoS Biol. 3(12): 422. Saunders GW, Kucera H. 2010. An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae. Cryptogamie Algol. 31(4):487-528. Savolainen Vincent, Cowan Robyn S, Vogler Alfried P, Roderick George K and Lane Richard Towards writ- ing the encyclopaedia of life: an introduction to DNA barcoding360Phil. Trans. R. Soc. Bhttp://doi. org/10.1098/rstb.2005.1730. Simeone MC, Piredda R, Papini A, Vessella F, Schirone B (2013) Application of plastid and nuclear mark- ers to DNA barcoding of Euro – Mediterranean oaks FMED042-16 - Dianthus rupicola [matK:780,trnH-psbA:247] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D9p[sampleid], PAL108620[fieldid], PAL108620[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Spain, BalearicIslands, Majorca FMED001-12 - Rosa sempervirens [matK:824,rbcLa:590] Taxonomy: Magnoliophyta, Magnoliopsida, Rosales, Rosaceae, Rosa Identifiers: R3-1[sampleid], SV Term[fieldid] Depository: Research Unit for Mediterranean Flower Species Collected in: Italy, Sicily, Palermo FMED003-12 - Asteraceae [rbcLa:577] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae Identifiers: A4u[sampleid], PAL[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED004-12 - Anthemis [matK:806,rbcLa:580] Taxonomy: Magnoliophyta, Magnoliopsida, Asterales, Asteraceae, Anthemis Identifiers: A7.C[sampleid], PAL[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED005-12 - Brassica insularis [rbcLa:594] Taxonomy: Magnoliophyta, Magnoliopsida, Brassicales, Brassicaceae, Brassica Identifiers: B2.23[sampleid], PAL[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Isola di Pantelleria FMED006-12 - Brassica [matK:779,rbcLa:582] Taxonomy: Magnoliophyta, Magnoliopsida, Brassicales, Brassicaceae, Brassica Identifiers: B5.C[sampleid], PAL[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Palermo FMED009-12 - Dianthus rupicola subsp aeolicus [matK:623,rbcLa:578,trnH-psbA:256] Taxonomy: Magnoliophyta, Magnoliopsida, Caryophyllales, Caryophyllaceae, Dianthus Identifiers: D1-2[sampleid], PAL96703[museumid] Depository: Palermo Botanical Garden, HerbariumMediterraneum Collected in: Italy, Sicily, Messina 37The technique of Plant DNA Barcoding: potential application in floriculture (Quercus, Fagaceae): problems, prospects and phy- logenetic implications. Botanical Journal of the Lin- nean Society, 172(4): 478-499. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 30(12): 2725- 2729. Tautz D, Arctander P, Minelli A, Thomas RH, Vogler AP. 2003. A plea for DNA taxonomy. Trends Ecol. Evol. 18(2): 70–74. Varshney RK, Graner A, Sorrells ME. 2005. Genic micro- satellite markers in plants: features and applications. Trends Biotechnol. 23(1):48-55. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. 2005. DNA barcoding Australia’s fish species. Philos Trans R Soc Lond B Biol Sci. 360(1462): 1847–1857. SUPPLEMENTARY FIGURES Fig. 5. Phylogenetic tree of Euphorbiaceae family with Neighbor Joining for matK. Fig. 4. Phylogenetic tree of Euphorbiaceae family with Neighbor Joining for rbcL marker. Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 73, Issue 2 - 2020 Firenze University Press The first molecular identification of Egyptian Miocene petrified dicot woods (Egyptians’ dream becomes a reality) Shaimaa S. Sobieh*, Mona H. Darwish Gene flow patterns reinforce the ecological plasticity of Tropidurus hispidus (Squamata: Tropiduridae) Fernanda Ito, Danielle J. Gama-Maia, Diego M. A. Brito, Rodrigo A. Torres* The technique of Plant DNA Barcoding: potential application in floriculture Antonio Giovino1,*, Federico Martinelli2,*, Anna Perrone3 Cytogenetic of Brachyura (Decapoda): testing technical aspects for obtaining metaphase chromosomes in six mangrove crab species Alessio Iannucci1, Stefano Cannicci1,2,*, Zhongyang Lin3, Karen WY Yuen3, Claudio Ciofi1, Roscoe Stanyon1, Sara Fratini1 Comparison of the Evolution of Orchids with that of Bats Antonio Lima-de-Faria Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection Mehdi Zahravi1,*, Panthea Vosough-Mohebbi2, Mehdi Changizi3, Shahab Khaghani1, Zahra-Sadat Shobbar4 Populations genetic study of the medicinal species Plantago afra L. (Plantaginaceae) Saeed Mohsenzadeh*, Masoud Sheidai, Fahimeh Koohdar A comparative karyo-morphometric analysis of Indian landraces of Sesamum indicum using EMA-giemsa and fluorochrome banding Timir Baran Jha1,*, Partha Sarathi Saha2, Sumita Jha2 Chromosome count, male meiotic behaviour and pollen fertility analysis in Agropyron thomsonii Hook.f. and Elymus nutans Griseb. (Triticeae: Poaceae) from Western Himalaya, India Harminder Singh2, Jaswant Singh1,*, Puneet Kumar2, Vijay Kumar Singhal1, Bhupendra Singh Kholia2, Lalit Mohan Tewari3 Population genetic and phylogeographic analyses of Ziziphora clinopodioides Lam., (Lamiaceae), “kakuti-e kuhi”: An attempt to delimit its subspecies Raheleh Tabaripour1,*, Masoud Sheidai1, Seyed Mehdi Talebi2, Zahra Noormohammadi3 Induced cytomictic crosstalk behaviour among micro-meiocytes of Cyamopsis tetragonoloba (L.) Taub. (cluster bean): Reasons and repercussions Girjesh Kumar, Shefali Singh* Karyotype diversity of stingless bees of the genus Frieseomelitta (Hymenoptera, Apidae, Meliponini) Renan Monteiro do Nascimento1, Antonio Freire Carvalho1, Weyder Cristiano Santana2, Adriane Barth3, Marco Antonio Costa1,* Karyotype studies on the genus Origanum L. (Lamiaceae) species and some hybrids defining homoploidy Esra Martin1, Tuncay Dirmenci2,*, Turan Arabaci3, Türker Yazici2, Taner Özcan2 Determination of phenolic compounds and evaluation of cytotoxicity in Plectranthus barbatus using the Allium cepa test Kássia Cauana Trapp1, Carmine Aparecida Lenz Hister1, H. Dail Laughinghouse IV2,*, Aline Augusti Boligon1, Solange Bosio Tedesco1