Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 73(2): 63-72, 2020 Firenze University Press www.fupress.com/caryologiaCaryologia International Journal of Cytology, Cytosystematics and Cytogenetics ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.13128/caryologia-752 Citation: P. Vosough-Mohebbi, M. Zah- ravi, M. Changizi, S. Khaghani, Z.-S. Shobbar (2020) Identification of the dif- ferentially expressed genes of wheat genotypes in response to powdery mil- dew infection. Caryologia 73(2): 63-72. doi: 10.13128/caryologia-752 Received: December 3, 2019 Accepted: April 3, 2020 Published: July 31, 2020 Copyright: © 2020 P. Vosough- Mohebbi, M. Zahravi, M. Changizi, S. Khaghani, Z.-S. Shobbar. This is an open access, peer-reviewed article published by Firenze University Press (http://www.fupress.com/caryologia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distri- bution, and reproduction in any medi- um, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection Panthea Vosough-Mohebbi1, Mehdi Zahravi2,*, Mehdi Changizi3, Sha- hab Khaghani1, Zahra-Sadat Shobbar4 1 Department of Agronomy and Plant Breeding, Arak Branch, Islamic Azad University, Arak, Iran 2 Seed and Plant Improvement Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran 3 Department of Agriculture, Arak Branch, Islamic Azad University, Arak, Iran 4 Department of System Biology, Agricultural Biotechnology Research Institute, Agricul- tural Research, Education and Extension Organization (AREEO), Karaj, Iran Corresponding author: Email: mzahravi@yahoo.com Abstract. Bread wheat (Triticum aestivum L.) is the most widely grown crop world- wide. Powdery mildew caused by fungal pathogen Blumeria graminis is one of the most devastating diseases of wheat. The present study aimed to identify differential- ly expressed genes and investigate their expression in response to B. graminis in sus- ceptible (Bolani) and resistant (KC2306) wheat genotypes, using publicly  available microarray data set and qRT-PCR analysis. A total of 5760 and 5315 probe sets were detected which 5427 and 4630 by adjusted P-value < 0.05 and 168 and 144 genes based on e-value < 1 × 10–5 cut-off were differentially expressed in susceptible and resistant wheat genotypes, respectively. Among exclusively up regulated genes in the resistant genotype 12 hpi compared to its control, fifteen potential genes that may be respon- sible for B. graminis inoculation resistance were detected. The results of real time PCR for the candidate genes showed that the genes were upregulated in the resistant geno- type 12 hpi compared to its control, which validated the results of microarray analysis. The bZIP, ERF, and ARF1 genes may play an important role in B. graminis resistance. The powdery mildew responsive genes identified in the present study will give us a bet- ter understanding on molecular mechanisms involved in B. graminis resistance in dif- ferent wheat genotypes. Keywords: wheat, genotype, powdery mildew, microarray, qRT-PCR. INTRODUCTION Bread wheat (Triticum aestivum L, AABBDD 2n = 42) is the most wide- ly grown crop in the world, belongs to Poaceae family (Chen S et al. 2018). It occupying 17% of all the cultivated land and providing approximately 20% of globally consumed calories (Gill et al. 2004; Vetch et al. 2019). In 64 Panthea Vosough-Mohebbi et al. Iran, more than 39% of all cultivated lands belongs to wheat, as the most important human food (Abdollahi 2008). There are many biotic and abiotic stresses which affecting the quality and quantity of crops in the coun- try (Sheikh Beig Goharrizi et al. 2016; Sheikh-Moham- adi et al. 2018; Sanjari et al., 2019). Powdery mildew caused by fungal pathogen Blumeria graminis is one of the most devastating diseases of wheat, occurring in regions with cool and humid climate that particularly is very conducive for the development of this disease (Chang et al. 2019; Liu N et al. 2019). Iran is one of the most important primary centers of the wheat distribu- tion, thereby it has one of the richest wheat germplasm worldwide. Therefore, the wild wheat relatives in the area could be a source of novel resistance genes to be transferred into wheat cultivars (Pour-Aboughadareh et al. 2018). Also, this rich wheat germplasm can be used as a valuable material for better understanding of the molecular mechanisms involved in the wheat-pathogen interaction (Brunner et al. 2012). Traditional breeding has been used to transmitting resistant genes to sus- ceptible wheat cultivars, by this method some powdery mildew resistant genes were discovered (Xin et al. 2012). Traditional breeding is based on the phenotype, there- fore less information can derived and some traits, such as disease resistance, cannot be observed easily (Chen H et al. 2014). The microarray technology provides us a lot of information about the genes. Recognizing new genes and analyzing their expression in response to powdery mildew will provide a valuable molecular informa- tion for enhancing disease resistance in the plant and microarray analysis could provide a plethora of gene expression profiles (Xin et al. 2011). Microarray has been widely used to detect the pathogen-resistant genes in wheat responding to different plant diseases. Li et al. (2018) identified 36 Lr39/41-resistance related differ- entially expressed genes at 48 h post inoculation (hpi) in leaf rust resistant and susceptible wheat isogenic lines. Foley et al. (2016) investigated the differentially expressed wheat genes in response to the Rhizoctonia solani isolate (AG8) and identified a significant number of genes involved in reactive oxygen species production and redox regulation. Erayman et al. (2015) examined the early response to Fusarium head blight in moder- ately susceptible and susceptible wheat cultivars at 12 hpi using microarray technology. The authors reported that 3668 genes were differentially expressed at least in one time comparison, which the majority of them were associated with disease response and the gene expres- sion mechanism. Putative transcription factor (TF) genes constitute 7% of all plant genes, they are pro- teins which play a major role in gene expression regula- tion (Yazdani et al., 2020). Xin et al. (2012) examined the leaves transcriptomes before and after B. graminis inoculation in a susceptible and its near-isogenic wheat line and compared the result of microarray with qRT- PCR analyses. Since Iran has one of the richest wheat germplasm in the world however, limited studies has performed regarding pathogen resistant genes in the germplasm. Therefore the present study aimed to iden- tify differentially expressed genes and investigate their expression in response to B. graminis in both suscepti- ble and resistant wheat genotypes, using publicly avail- able microarray data set and qRT-PCR analysis. MATERIALS AND METHODS Plant material and growth condition Two susceptible (Bolani) and resistant (KC2306) wheat genotypes to powdery mildew, were obtained from the National Plant Gene-bank, Karaj, Iran. The seeds of these two genotypes were planted in 10 cm diameter pots, at greenhouse condition. At the first fully expanded leaf stage, the plants inoculated with a patho- type (B. graminis) collected from Moghan, Ardabil, Iran (a local pathotype). Inoculation was performed by dust- ing or brushing conidia from neighboring sporulating susceptible seedlings onto the test seedlings. Leaf sam- ples of each genotype were collected at 0 and 12 hpi. The samples were stored in liquid nitrogen for qRT-PCR analysis. In silico powdery mildew gene expression survey In the present study we used a publicly  available microarray data set published by Xin et al. (2011), avail- able at GEO (http://www.ncbi.nlm.nih.gov/gds/) with GSE27320 accession number. The authors used a sus- ceptible wheat cultivar ‘8866’ and it’s near isogenic line with single powdery mildew resistance gene. The differ- entially expressed sequences were homology searched against wheat transcription factor (TF) database (http:// planttfdb.cbi.pku.edu.cn/), and then BLAST analysis with a strict cutoff e-value <1 × 10–5 was performed. Venn diagram was generated to find the differentially expressed genes between the two genotypes and the TFs which up-regulated in the resistant genotype were selected. To confirm the authenticity of the selected TFs, Pfam proteins family database (https://pfam.xfam. org/) was used. Also, the hierarchical cluster algorithm was performed on the differentially expressed genes among the samples. 65Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection RNA extraction and qRT-PCR analysis In order to extract the total RNA of the samples, Trizol reagent (Invitrogen, USA), was used. In addition, total RNA was treated using RNase-free DNase (Gene- all, Korea) and reversely transcribed to double-stranded cDNAs using oligo (dT)18 primers by cDNA synthesis kit (Takara, Japan). Oligo software was used to design gene-specific primers for 15 selected genes (Table 1). The qRT-PCR was performed on a Bio-Rad, MiniOpti- con Real-Time PCR detection system using SYBR Green Supermix (Takara, Japan). The reactions were performed using the following program: 95 °C for 5 min and 40 cycles (95 °C for 30 s, 57 up to 61°C for 30 s and 72 °C for 30 s). Wheat Actin gene was used as the internal control. For each data point, the CT value was the aver- age of CT values derived from three biological and three technical replicates, were normalized based on the Ct of the control products (Ta actin). The relative quantitative analysis preformed using the 2-ΔΔCT method (Schmitt- gen and Livak 2008) then subjected to a complete ran- dom design (CRD) and least significant difference (LSD) test using SAS software package (SAS Institute Inc.). The correlations were visualized as a colored heat map. The heat map and the bi-plots were created by MetaboAna- lyst (Xia and Wishart 2016). Also, the graphs were per- formed using GraphPad Prism software. In addition, the gene expression of powdery mildew-sensitive genotype under normal condition was used as calibrator for calcu- lating the relative gene expression. RESULTS AND DISCUSSION Microarray analysis In order to identify the differentially expressed genes in susceptible and resistant wheat genotypes respond- ing to B. graminis, the publicly available microarray data set published by Xin et al. (2011) was used. The repro- ducibility of the microarray data was confirmed by the authors. Based on the BLAST of the differentially expressed sequences against wheat transcription factor (TF) database, 5760 and 5315 probe sets were detected which 5427 and 4630 were differentially expressed by adjusted P-value <0.05, and 168 and 144 genes were dif- ferentially expressed based on e-value <1 × 10–5 cut-off in susceptible and resistant wheat genotypes, respective- ly (Fig. 1). Among 168 and 144 DEGs, 70 and 56 DEGs were upregulated and 98 and 88 DEGs were downregu- lated, respectively (Fig. 2). In previous study, of the total of 61,127 probe sets, 44.57 and 42.43% were detected as expressed genes in susceptible and resistant wheat genotypes at 12 hpi by B. graminis, respectively (Xin et al. 2011). According to results of present and previ- ous studies, many genes are involved in wheat resist- ance to this disease. In another study, Bruggmann et al. (2005) studied the epidermis-and mesophyll-specific transcript accumulation in powdery mildew-inoculated wheat leaves. The authors reported that out of 17000, 141 transcripts, were found to accumulate after B. graminis f. sp. hordei inoculation using microarray hybridization Table 1. List of primer pairs using for validation of gene expression using qRT-PCR. PID Gene symbol Forward primer (5’-3’) Reverse primer (5’-3’) TaAffx.51406.1.S1_at GATA GAAGTCAAACCCTCCCTCAAG GCAAACAAACATCTCACATTTCC Ta.9390.1.A1_at ARF GAGATCGCCCGTCTTTAGC ACCAACACTACATTCAAACAAAG TaAffx.78909.1.S1_at G2 GGTCTCTCGCTCGGTCTC CTCATCCACTTGTTCTTCATCG TaAffx.85891.1.S1_at bHLH AAGGTGCTGGAGAATCAAGG CTCATTGTTCGCTGGGTTC Ta.25219.1.A1_at ARF ACTACTACAACATTTCCTCGTATC GACAACTGACACTGTATTCTGG Ta.4054.2.S1_at ARR GCTGTTACTGTTTGTCCTTCTG TCTTGTCTCATTCCACCATCC TaAffx.36896.1.A1_at MYB CAATGTCGTCAAGAAGGAAGA CCGTCGTGCTGAGAAACC TaAffx.37068.1.S1_at GRF CGGAACCTACTACGACCATC GATTCAGATTGCCTCAACATAG TaAffx.120915.1.S1_at FAR1 TTTACCAGTGATGTTCTTTTCT CTCCAGGGTGTCCAATGC TaAffx.129201.1.S1_s_at C3H AAATGGGAAATTGGACAGATACC CATAGAAAGAGACCACATAAAGG Ta.7033.1.S1_s_at HB AATGAAGCACATGACGACAAG ACCGACAATCCAACACTCTG Ta.21124.1.S1_x_at ERF TCCGCCAACCAACTGTTAG CAGTCATCGTCGCCAAAGC Ta.6443.2.S1_at bZIP AAACGGCGAACAACACAGG ACCATCAAGGAGAACAACAAC Ta.4828.1.S1_a_at C3H ACTGCTCGTCGTCTCCTAC TGCGTAATGCTACTACTGATTC Ta.2023.1.S1_at bHLH GCCATAACGCACATCACTG ATTACACGAACAAGAACCTCA Reference gene actin GTGTACCCTCAGAGGAATAAGG GTACCACACAATGTCGCTTAGG 66 Panthea Vosough-Mohebbi et al. analysis. Our results were consistent with the previous studies that pathogen infection activates a wide range of genes and pathways in the transcriptional networks in wheat plant (Bolton et al. 2008; Coram et al. 2008; Boz- kurt et al. 2010). Among exclusively up regulated genes in the resistant genotype 12 hpi compared to its control, potential genes that may be responsible for B. graminis infection resistance were detected (Table 2). For exam- ple, G2 (TaAffx.78909.1.S1_at) was the top upregulated gene with a log2 fold change of 3.39, and its expres- sion might has a function in stress and disease resist- ance (Liu F et al. 2016; Zeng et al. 2018). The bHLH1 (TaAffx.85891.1.S1_at) was also in the top fifteen upreg- ulated genes with a log2 fold change of 3.08, the plant bHLH transcription factors family have key function in regulation of developmental processes and environmen- tal stresses (Wang et al. 2015). However,  limited  infor- mation is available on their roles in wheat disease caused by pathogens infection. Another bHLH family member, bHLH2, was also revealed to be upregulated in resistant genotype. Gene expression analysis Fifteen potential genes that may be responsible for B. graminis infection resistance were selected for gene expression analysis by real-time PCR. The genes includ- ing ARF1, HB, C3H2, C3H1, bZIP, MYB, ARR, bHLH1, G2, FAR1, bHLH2, GATA, ERF, ARF2 and GR were selected among exclusively up regulated genes in the resistant genotype 12 hpi. The result of gene expression indicated that all the selected genes were upregulated in the resistant genotype, and HB, C3H2, C3H1, MYB, ARR, and bHLH1 genes were downregulated in the sus- ceptible genotype at 12 hpi compared to their controls (Fig 3). Based on the results of cluster analysis, the top fifteen genes were classified in four main groups (Fig. 4). The bZIP and ERF genes formed the first group, which their expressions were significant at 12 hpi in both geno- types compared to their control conditions (before inoc- R-up R-down S-up S-down 0 50 100 150 N um be r o f g en es 56 88 70 98 Figure 1. Venn diagrams showing the common and unique differ- entially expressed genes in S (red) and R (blue) genotypes detected (P-value < 0.05) and S-evalue (yellow) and R-evalue (green) based on e-value <1 × 10–5 cut-off. Figure 2. Number of up- and down-regulated genes responsive to powdery mildew in susceptible and resistant genotypes. Table 2. Top 15 exclusively upregulated genes in the resistant geno- type 12 hpi. Probe set ID log2 (fold change) Adj. P-Value P-Value TaAffx.51406.1.S1_at 1.4868 0.0354 0.0023 Ta.9390.1.A1_at 1.2165 0.0171 0.0006 TaAffx.78909.1.S1_at 3.3896 0.0329 0.0021 TaAffx.85891.1.S1_at 3.0839 0.0149 0.0004 Ta.25219.1.A1_at 2.2206 0.0198 0.0008 Ta.4054.2.S1_at 1.0219 0.0383 0.0027 TaAffx.36896.1.A1_at 1.0314 0.0462 0.0037 TaAffx.37068.1.S1_at 1.7241 0.0449 0.0036 TaAffx.120915.1.S1_at 1.2725 0.0151 0.0004 TaAffx.129201.1.S1_s_at 1.1133 0.0411 0.0031 Ta.7033.1.S1_s_at 1.1329 0.0184 0.0006 Ta.21124.1.S1_x_at 1.7122 0.0143 0.0004 Ta.6443.2.S1_at 1.5355 0.0107 0.0002 Ta.4828.1.S1_a_at 1.0126 0.0397 0.0029 Ta.2023.1.S1_at 1.3044 0.0158 0.0005 67Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection S-0h S-12 h R-0h R-12 h 0 5 10 15 R el at iv e ge ne e xp re ss io n *** ARF1 S-0h S-12 h R-0h R-12 h 0 2 4 6 R el at iv e ge ne e xp re ss io n * HB S-0h S-12 h R-0h R-12 h 0.0 0.5 1.0 1.5 2.0 R el at iv e ge ne e xp re ss io n ** C3H2 S-0h S-12 h R-0h R-12 h 0 1 2 3 4 R el at iv e ge ne e xp re ss io n * ** C3H1 S-0h S-12 h R-0h R-12 h 0 1 2 3 4 5 R el at iv e ge ne e xp re ss io n * ** bZIP S-0h S-12 h R-0h R-12 h 0.0 0.5 1.0 1.5 R el at iv e ge ne e xp re ss io n ** MYB S-0h S-12 h R-0h R-12 h 0 2 4 6 R el at iv e ge ne e xp re ss io n ARR S-0h S-12 h R-0h R-12 h 0 1 2 3 4 R el at iv e ge ne e xp re ss io n ** bHLH1 S-0h S-12 h R-0h R-12 h 0 2 4 6 R el at iv e ge ne e xp re ss io n G2 * S-0h S-12 h R-0h R-12 h 0.0 0.5 1.0 1.5 2.0 R el at iv e ge ne e xp re ss io n FAR1 S-0h S-12 h R-0h R-12 h 0 1 2 3 R el at iv e ge ne e xp re ss io n bHLH2 S-0h S-12 h R-0h R-12 h 0 1 2 3 R el at iv e ge ne e xp re ss io n GATA S-0h S-12 h R-0h R-12 h 0 10 20 30 40 R el at iv e ge ne e xp re ss io n * **ERF S-0h S-12 h R-0h R-12 h 0.0 0.5 1.0 1.5 2.0 2.5 R el at iv e ge ne e xp re ss io n ARF2 S-0h S-12 h R-0h R-12 h 0 2 4 6 8 R el at iv e ge ne e xp re ss io n GR Figure 3. Expression patterns of the top 15 genes by qRT-PCR. Student’s t-test was performed to analyze the changes in the gene expres- sion 12 h after powdery mildew infection compared to 0 h in respective genotype. * and ** are statistically significant at 0.05 and 0.01 levels, respectively. 68 Panthea Vosough-Mohebbi et al. ulation). There are different pathways including salicylic and jasmonic acids, and ethylene, which involved in the plant resistance against pathogens (Yuan et al. 2019). The ERF and bZIP transcription factors are two main families responding to pathogen attack due to their importance, abundance, and availability of function- ally well-characterized (Amorim et al. 2017). The result of present study showed that the expression of bZIP and ERF genes were upregulated in the genotypes, however this upregulation in resistant genotype was higher than the susceptible genotype. Many studies have shown that up-regulation and activation of bZIP and ERF tran- scription factor families are common as part of plant defense mechanism to response to pathogen attack (Tateda et al. 2008; Amorim et al. 2017; Tezuka et al. 2019). For examples, the bZIP60 gene was significantly up-regulated in Nicotina benthamiana in response to Pseudomonas cichorii inoculation, showing an involve- ment of the bZIP in the plant innate immunity (Tateda et al. 2008). An ERF transcription factor in Oriza sativa (OsERF83) was expressed in leaves in response to blast fungus infection and led to blast resistance by regulat- ing the expression of defense related genes (Tezuka et al. 2019). The result of PCA analysis, based on the first two main components showed that these two genes were far from the other genes (Fig 5), indicating different expres- sion patterns for the genes. This result was consistent with the cluster analysis. The high regulation and differ- ent expression patterns of these genes, indicating their important roles in responding to pathogen attack. Also, the result of correlation analysis showed a low and posi- tive correlation coefficient between these two genes. The second group consisted of three genes includ- ing ARF1, ARF2, and G2 genes. ARF1 gene similar to the genes in the first group was significantly upregu- lated in the susceptible and resistant genotypes 12 hpi compared to their control, however the upregulation in resistant genotype was higher than the susceptible genotype. This result was confirmed by PCA analysis, which had similar expression pattern with bZIP and ERF genes. In the present study the expression level of two auxin response factors were investigated. Recently, the ARFs were introduced as an active actor in plant resistance mechanism against different pathogens attack (Bouzroud et al. 2018). Similar to our results, two ARFs were detected in rice upon Magnaporthe grisea and Striga hermonthica infections (Ghanashyam and Jain 2009). Differential expression of ARF genes were observed in cotton in response to Fusarium oxyspo- rum f. sp vasinfectum infection (Dowd et al. 2004). Our results showed that the expression of both ARF genes were upregulated in the genotypes 12 hpi compared to their controls, indicating the importance of auxin pathway in wheat resistance mechanism against the B. graminis. The result of gene expression revealed that G2 gene was significantly upregulated in the resistant geno- type, while it was not significant for susceptible geno- type 12 hpi compared to their controls. The result of real time PCR confirmed the result of microarray anal- ysis, in both analyses G2 was highly upregulated in the resistant genotype. Previous studies have shown that G2 plays an important role in disease defense mechanism Figure 4. Hierarchical clustering analysis of the top 15 differentially expressed genes among the susceptible and resistant samples. Figure 5. Bi-plot derived from PCA analysis based on the top 15 genes. 69Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection in different plants such as Arabidopsis (Murmu et al. 2014) and rice (Nakamura et al. 2009). Over expression of a G2-like family (AtGLK1) in Arabidopsis resulted in significant up-regulation of some genes involved in the defense mechanism and salicylic acid signaling path- way, which displayed stronger resistance to Fusarium graminearum (Savitch et al. 2007). The third group contained four genes, i.e. C3H1, C3H2, GR, and bHLH1. The results of PCA analysis based on the two first main components confirmed the result of dendrogram, which these genes were close to each other than the other genes (Fig. 5). The expres- sion levels of C3H1, C3H2, and bHLH1 genes were sig- nificantly downregulated in the susceptible genotype, while the four genes were upregulated in the resistant genotype 12 hpi compared to their controls. Also, the result of correlation analysis revealed that there were positive and significant correlation coefficients among these three genes (P < 0.01). OsC3H12 and OsDOS genes (C3H family) positively and quantitatively regulates rice resistance to different diseases, which are likely associ- ated with the jasmonic acid pathway (Kong et al. 2006; Deng et al. 2012). The bHLH transcription factors are important signaling components with dual roles in the regulation of defense responses thorough jasmonic acid pathway (Wild et al. 2012; Hu et al. 2013). The results of gene expression showed that the GR (GRF) gene was upregulated in resistant genotype, however no change was observed in the susceptible genotype compared to their controls. GRF-regulated genes are involved in some hormone biosynthesis pathways such as jasmonic acid, salicylic acid, ethylene, and auxin, which can activate the plant defense mechanisms and coordinate between developmental process and plant defense mechanisms (Liu J et al. 2014). It seems that the genes in the third group caused to wheat resistance to the disease thor- ough jasmonic acid pathway. Our result showed that the expression of C3H1, C3H2, and bHLH1 genes were downregulated in the susceptible genotype 12 hpi, which could be due to the process called stress-induced tran- scriptional attenuation (SITA). In response to pathogens infections, the plant cells interrupt their daily routines to protect themselves from damage, cells start the pro- duction of new proteins to help damaged proteins and at the same time, many normally expressed genes rapidly downregulate in the SITA process (Aprile-Garcia et al. 2019). The fourth group consisted of six genes, namely HB, bHLH2, MYB, ARR, FAR1, and GATA. The expressions of HB and MYB genes were significantly downregulated in the susceptible genotype 12 hpi compared to the con- trol. Also, there was a significantly positive correlation coefficient between them (P < 0.05). It seems that the downregulation of these two genes in the susceptible genotype were due to the SITA process. Cominelli et al. (2005) reported that an Arabidopsis transcription factor Figure 6. Heat map of the correlations among the top 15 genes. Figure 7. Bi-plot derived from PCA analysis based on susceptible and resistant samples. 70 Panthea Vosough-Mohebbi et al. (AtMYB60) involved in stomata movement, which rap- idly downregulated by stress. One of the plants defense mechanism to pathogen attack, is closing their stomata to prevent pathogen entry (Arnaud and Hwang 2015). It seems that the susceptible genotype downregulated the MYB gene to close the stomata and preventing pathogen entry, which can be a part of SITA process. The results demonstrated that all genes in the fourth group were up regulated in the resistant genotype 12 hpi compared to the control, however none of them was statistically sig- nificant. The roles of these transcription factors in plant pathogen resistant were reported in different studies. For example, Zhang et al. (2018) studied the expression pat- tern of TFs in resistant (Vernicia montana) and suscep- tible (V. fordii) tung trees responding to Fusarium wilt disease. The authors reported that the MYB and bHLH families had the largest number of TFs among 59 dif- ferent families in both V. fordii and V. montana spe- cies during the four infection stages. According to the result of correlation analysis all the genes in the fourth group had a significant correlation coefficient with each other (P < 0.05 or P < 0.01), although the highest cor- relation coefficient among the studied genes was between GATA and FAR1 (r=0.94, P < 0.01). According to the PCA analysis based on the genotypes, the two first main components confirmed more than 68% of total variance (Fig. 7). It was obvious from the figure 7, the main vari- ance of PC1 (50.4%) and PC2 (17.8%) were explained by infection treatment (0 and 12 hpi) and genotype fac- tors, respectively. Usually under similar conditions, genetic factors are the main source of variances among the samples (Hassanabadi et al. 2019; Farajpour et al., 2017). Finally, the result of PCA confirmed the results of microarray and real time PCR analyses. CONCLUSIONS In the present study, the publicly available wheat microarray data set and the real time PCR analysis were used to study the transcriptomes and gene expres- sion of susceptible (Bolani) and resistant (KC2306) wheat genotypes in response to powdery mildew. A total of 5760 and 5315 probe sets were detected which 5427 and 4630 were differentially expressed by adjusted P-value < 0.05, in susceptible and resistant wheat gen- otypes, respectively. Among exclusively up regulated genes in the resistant genotype 12 hpi compared to its control, fifteen potential genes that may be responsible for B. graminis inoculation resistance were detected. The results of real time PCR for the candidate genes showed that the genes were upregulated in the resist- ant genotype 12 hpi compared to its control, which validated the results of microarray analysis. Our results illustrated aforementioned genes positively regulated resistance mechanism to powdery mildew infection. Also, they may be good candidate genes for studying and improving resistance to powdery mildew in wheat. The powdery mildew responsive genes identified in the present study will give us a better understanding on molecular mechanisms involved in B. graminis resist- ance in different wheat genotypes. REFERENCES Abdollahi M. 2008. Comparison of some Indian popu- lations of cereal cyst nematode, Heterodera avenae (Wollenweber, 1924) using RAPD. Proc Pakistan Acad Sci. 45:1-10. Amorim A, Lidiane L, da Fonseca dos Santos R, Pacif- ico Bezerra Neto J, Guida-Santos M, Crovella S, Maria Benko-Iseppon A. 2017. Transcription factors involved in plant resistance to pathogens. Curr Pro- tein Pept Sci. 18(4):335-351. Aprile-Garcia F, Tomar P, Hummel B, Khavaran A, Sawarkar R. 2019. Nascent-protein ubiquitination is required for heat shock–induced gene downregula- tion in human cells. Nat Struct Mol Biol. 26(2):137. Arnaud D, Hwang I. 2015. A sophisticated network of signaling pathways regulates stomatal defenses to bacterial pathogens. Mol Plant. 8(4):566-581. Bolton MD, Kolmer JA, Xu WW, Garvin DF. 2008. Lr34- mediated leaf rust resistance in wheat: transcript pro- filing reveals a high energetic demand supported by transient recruitment of multiple metabolic pathways. Mol Plant Microbe In. 21(12):1515-1527. Bouzroud S, Gouiaa S, Hu N, Bernadac A, Mila I, Bendaou N, Smouni A, Bouzayen M, Zouine M. 2018. Auxin response factors (ARFs) are poten- tial mediators of auxin action in tomato response to biotic and abiotic stress (Solanum lycopersicum). PloS one. 13(2):e0193517. Bozkurt TO, McGrann GR, MacCormack R, Boyd LA, Akkaya MS. 2010. Cellular and transcriptional responses of wheat during compatible and incom- patible race‐specific interactions with Puccinia strii- formis f. sp. tritici. Mol Plant Pathol. 11(5):625-640. Bruggmann R, Abderhalden O, Reymond P, Dudler R. 2005. Analysis of epidermis-and mesophyll-specific transcript accumulation in powdery mildew-inocu- lated wheat leaves. Plant Mol Biol. 58(2):247-267. Brunner S, Stirnweis D, Diaz Quijano C, Buesing G, Her- ren G, Parlange F, Barret P, Tassy C, Sautter C, Win- 71Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection zeler M. 2012. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field. Plant Biotechnol J. 10(4):398-409. Chang X, Luo L, Liang Y, Hu Y, Luo P, Gong G, Chen H, Khaskheli M, Liu T, Chen W. 2019. Papilla formation, defense gene expression and HR contribute to the powdery mildew resistance of the novel wheat line L699 carrying Pm40 gene. Physiological and Molecu- lar Plant Pathology. 106:208-216. Chen H, Xie W, He H, Yu H, Chen W, Li J, Yu R, Yao Y, Zhang W, He Y. 2014. A high-density SNP geno- typing array for rice biology and molecular breeding. Mol Plant. 7(3):541-553. Chen S, Wang J, Deng G, Chen L, Cheng X, Xu H, Zhan K. 2018. Interactive effects of multiple vernalization (Vrn-1)-and photoperiod (Ppd-1)-related genes on the growth habit of bread wheat and their association with heading and flowering time. BMC Plant Biol. 18(1):374. Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M, Leonhardt N, Dellaporta SL, Tonelli C. 2005. A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tol- erance. Current biology. 15(13):1196-1200. Coram TE, Settles ML, Chen X. 2008. Transcriptome anal- ysis of high‐temperature adult‐plant resistance condi- tioned by Yr39 during the wheat–Puccinia striiformis f. sp. tritici interaction. Mol Plant Pathol. 9(4):479-493. Deng H, Liu H, Li X, Xiao J, Wang S. 2012. A CCCH- type zinc finger nucleic acid-binding protein quanti- tatively confers resistance against rice bacterial blight disease. Plant Physiol. 158(2):876-889. Dowd C, Wilson IW, McFadden H. 2004. Gene expres- sion profile changes in cotton root and hypoco- tyl tissues in response to infection with Fusarium oxysporum f. sp. vasinfectum. Mol Plant Microbe In. 17(6):654-667. Erayman M, Turktas M, Akdogan G, Gurkok T, Inal B, Ishakoglu E, Ilhan E, Unver T. 2015. Transcriptome analysis of wheat inoculated with Fusarium gramine- arum. Front Plant Sci. 6:867. Farajpour M, Ebrahimi M, Baghizadeh A, Aalifar M. 2017. Phytochemical and yield variation among Iranian Achillea millefolium accessions.  HortSci- ence. 52(6):827-830. Foley RC, Kidd BN, Hane JK, Anderson JP, Singh KB. 2016. Reactive oxygen species play a role in the infec- tion of the necrotrophic fungi, Rhizoctonia solani in wheat. PLoS One. 11(3):e0152548. Ghanashyam C, Jain M. 2009. Role of auxin-responsive genes in biotic stress responses. Plant Signal Behav. 4(9):846-848. Gill BS, Appels R, Botha-Oberholster A-M, Buell CR, Bennetzen JL, Chalhoub B, Chumley F, Dvořák J, Iwanaga M, Keller B. 2004. A workshop report on wheat genome sequencing: International Genome Research on Wheat Consortium. Genetics. 168(2):1087-1096. Hassanabadi M, Ebrahimi M, Farajpour M, Dejahang A. 2019. Variation in essential oil components among Iranian Ferula assa-foetida L. accessions. Industrial Crops and Products. 140:11598. Hu P, Zhou W, Cheng Z, Fan M, Wang L, Xie D. 2013. JAV1 controls jasmonate-regulated plant defense. Mol Cell. 50(4):504-515. Kong Z, Li M, Yang W, Xu W, Xue Y. 2006. A novel nuclear-localized CCCH-type zinc finger protein, OsDOS, is involved in delaying leaf senescence in rice. Plant Physiol. 141(4):1376-1388. Li X, Wang X, Kang Z, Ren Z, Bi W, Yang W, Liu D. 2018. Suppression subtractive hybridization and microarray analysis reveal differentially expressed genes in the Lr39/41-mediated wheat resistance to Puccinia trit- icina. Eur J Plant Pathol. 152(2):479-492. Liu F, Xu Y, Han G, Zhou L, Ali A, Zhu S, Li X. 2016. Molecular evolution and genetic variation of G2-like transcription factor genes in maize. PloS one. 11(8):e0161763. Liu J, Rice JH, Chen N, Baum TJ, Hewezi T. 2014. Syn- chronization of developmental processes and defense signaling by growth regulating transcription factors. PloS one. 9(5):e98477. Liu N, Lei Y, Zhang M, Zheng W, Shi Y, Qi X, Chen H, Zhou Y, Gong G. 2019. Latent Infection of Powdery Mildew on Volunteer Wheat in Sichuan Province, China. Plant Dis.PDIS-06-18-1003-RE. Murmu J, Wilton M, Allard G, Pandeya R, Desveaux D, Singh J, Subramaniam R. 2014. A rabidopsis GOLD- EN2‐LIKE (GLK) transcription factors activate jas- monic acid (JA)‐dependent disease susceptibility to the biotrophic pathogen H yaloperonospora arabi- dopsidis, as well as JA‐independent plant immunity against the necrotrophic pathogen Botrytis cinerea. Mol Plant Pathol. 15(2):174-184. Nakamura H, Muramatsu M, Hakata M, Ueno O, Naga- mura Y, Hirochika H, Takano M, Ichikawa H. 2009. Ectopic overexpression of the transcription factor OsGLK1 induces chloroplast development in non- green rice cells. Plant Cell Physiol. 50(11):1933- 1949. Pour-Aboughadareh A, Ahmadi J, Mehrabi AA, Etmi- nan A, Moghaddam M. 2018. Insight into the genetic variability analysis and relationships among some Aegilops and Triticum species, as genome progenitors 72 Panthea Vosough-Mohebbi et al. of bread wheat, using SCoT markers. Plant Biosyst. 152(4):694-703. Savitch LV, Subramaniam R, Allard GC, Singh J. 2007. The GLK1 ‘regulon’encodes disease defense related proteins and confers resistance to Fusarium gramine- arum in Arabidopsis. Biochem Biophys Res Com- mun. 359(2):234-238. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C T method. Nat Prot. 3(6):1101. Sanjari S, Shirzadian-Khorramabad R, Shobbar ZS, Shah- bazi M. 2019. Systematic analysis of NAC transcrip- tion factors’ gene family and identification of post- flowering drought stress responsive members in sor- ghum. Plant Cell Reports. 38(3):361-376. Sheikh-Mohamadi M-H, Etemadi N, Nikbakht A, Fara- jpour M, Arab M, Majidi MM. 2018. Wheatgrass ger- mination and seedling growth under osmotic stress. Agronomy Journal. 110(2):572-585. Sheikh Beig Goharrizi M, Dejahang A, Tohidfar M, Izadi Darbandi A, Carrillo NJ, Hajirezaei M, Vahdati K. 2016. Agrobacterium mediated transformation of somatic embryos of Persian walnut using fld gene for osmotic stress tolerance. Journal of Agricultural Sci- ence and Technology. 18:423-435. Tateda C, Ozaki R, Onodera Y, Takahashi Y, Yamagu- chi K, Berberich T, Koizumi N, Kusano T. 2008. NtbZIP60, an endoplasmic reticulum-localized tran- scription factor, plays a role in the defense response against bacterial pathogens in Nicotiana tabacum. J Plant Res. 121(6):603-611. Tezuka D, Kawamata A, Kato H, Saburi W, Mori H, Imai R. 2019. The rice ethylene response factor OsERF83 posi- tively regulates disease resistance to Magnaporthe ory- zae. Plant physiology and biochemistry. 135:263-271. Vetch JM, Stougaard RN, Martin JM, Giroux MJ. 2019. Revealing the genetic mechanisms of pre-harvest sprouting in hexaploid wheat (Triticum aestivum L.). Plant Sci. Wang F, Lin R, Feng J, Qiu D, Chen W, Xu S. 2015. Wheat bHLH transcription factor gene, TabHLH060, enhances susceptibility of transgenic Arabidopsis thaliana to Pseudomonas syringae. Physiological and molecular plant pathology. 90:123-130. Wild M, Davière J-M, Cheminant S, Regnault T, Baum- berger N, Heintz D, Baltz R, Genschik P, Achard P. 2012. The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate sign- aling responses. Plant Cell. 24(8):3307-3319. Xia J, Wishart DS. 2016. Using MetaboAnalyst 3.0 for comprehensive metabolomics data analysis. Curr Protoc Bioin. 55(1):14.10. 11-14.10. 91. Xin M, Wang X, Peng H, Yao Y, Xie C, Han Y, Ni Z, Sun Q. 2012. Transcriptome comparison of susceptible and resistant wheat in response to powdery mildew infection. Genom Proteom Bioinf. 10(2):94-106. Xin M, Wang Y, Yao Y, Song N, Hu Z, Qin D, Xie C, Peng H, Ni Z, Sun Q. 2011. Identification and char- acterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequenc- ing. BMC Plant Biol. 11(1):61. Yazdani B, Sanjari S, Asghari-Zakaria R, Ghanegolmo- hammadi F, Pourabed E, Shahbazi M, Shobbar Z. 2020. Revision of the barley WRKY gene family phy- logeny and expression analysis of the candidate genes in response to drought. Biologia Plantarum. 64:9-19. Yuan M, Huang Y, Ge W, Jia Z, Song S, Zhang L, Huang Y. 2019. Involvement of jasmonic acid, ethylene and salicylic acid signaling pathways behind the systemic resistance induced by Trichoderma longibrachiatum H9 in cucumber. BMC Genomics. 20(1):144. Zeng L, Liu X, Zhou Z, Li D, Zhao X, Zhu L, Luo Y, Hu S. 2018. Identification of a G2-like transcription fac- tor, OsPHL3, functions as a negative regulator of flowering in rice by co-expression and reverse genetic analysis. BMC Plant Biol. 18(1):157. Zhang Q, Gao M, Wu L, Wu H, Chen Y, Wang Y. 2018. Expression network of transcription factors in resist- ant and susceptible tung trees responding to Fusar- ium wilt disease. Industrial crops and products. 122:716-725. Caryologia International Journal of Cytology, Cytosystematics and Cytogenetics Volume 73, Issue 2 - 2020 Firenze University Press The first molecular identification of Egyptian Miocene petrified dicot woods (Egyptians’ dream becomes a reality) Shaimaa S. Sobieh*, Mona H. Darwish Gene flow patterns reinforce the ecological plasticity of Tropidurus hispidus (Squamata: Tropiduridae) Fernanda Ito, Danielle J. Gama-Maia, Diego M. A. Brito, Rodrigo A. Torres* The technique of Plant DNA Barcoding: potential application in floriculture Antonio Giovino1,*, Federico Martinelli2,*, Anna Perrone3 Cytogenetic of Brachyura (Decapoda): testing technical aspects for obtaining metaphase chromosomes in six mangrove crab species Alessio Iannucci1, Stefano Cannicci1,2,*, Zhongyang Lin3, Karen WY Yuen3, Claudio Ciofi1, Roscoe Stanyon1, Sara Fratini1 Comparison of the Evolution of Orchids with that of Bats Antonio Lima-de-Faria Identification of the differentially expressed genes of wheat genotypes in response to powdery mildew infection Mehdi Zahravi1,*, Panthea Vosough-Mohebbi2, Mehdi Changizi3, Shahab Khaghani1, Zahra-Sadat Shobbar4 Populations genetic study of the medicinal species Plantago afra L. (Plantaginaceae) Saeed Mohsenzadeh*, Masoud Sheidai, Fahimeh Koohdar A comparative karyo-morphometric analysis of Indian landraces of Sesamum indicum using EMA-giemsa and fluorochrome banding Timir Baran Jha1,*, Partha Sarathi Saha2, Sumita Jha2 Chromosome count, male meiotic behaviour and pollen fertility analysis in Agropyron thomsonii Hook.f. and Elymus nutans Griseb. (Triticeae: Poaceae) from Western Himalaya, India Harminder Singh2, Jaswant Singh1,*, Puneet Kumar2, Vijay Kumar Singhal1, Bhupendra Singh Kholia2, Lalit Mohan Tewari3 Population genetic and phylogeographic analyses of Ziziphora clinopodioides Lam., (Lamiaceae), “kakuti-e kuhi”: An attempt to delimit its subspecies Raheleh Tabaripour1,*, Masoud Sheidai1, Seyed Mehdi Talebi2, Zahra Noormohammadi3 Induced cytomictic crosstalk behaviour among micro-meiocytes of Cyamopsis tetragonoloba (L.) Taub. (cluster bean): Reasons and repercussions Girjesh Kumar, Shefali Singh* Karyotype diversity of stingless bees of the genus Frieseomelitta (Hymenoptera, Apidae, Meliponini) Renan Monteiro do Nascimento1, Antonio Freire Carvalho1, Weyder Cristiano Santana2, Adriane Barth3, Marco Antonio Costa1,* Karyotype studies on the genus Origanum L. (Lamiaceae) species and some hybrids defining homoploidy Esra Martin1, Tuncay Dirmenci2,*, Turan Arabaci3, Türker Yazici2, Taner Özcan2 Determination of phenolic compounds and evaluation of cytotoxicity in Plectranthus barbatus using the Allium cepa test Kássia Cauana Trapp1, Carmine Aparecida Lenz Hister1, H. Dail Laughinghouse IV2,*, Aline Augusti Boligon1, Solange Bosio Tedesco1