Caryologia. International Journal of Cytology, Cytosystematics and Cytogenetics 72(3): 41-51, 2019 Firenze University Press www.fupress.com/caryologiaCaryologia International Journal of Cytology, Cytosystematics and Cytogenetics ISSN 0008-7114 (print) | ISSN 2165-5391 (online) | DOI: 10.13128/caryologia-760 Citation: S. Wang, Y. Luo, T. Yang, Y. Zhang, Z. Li, W. Jin, Y. Fang (2019) Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Moun- tain. Caryologia 72(3): 41-51. doi: 10.13128/caryologia-760 Published: December 13, 2019 Copyright: © 2019 S. Wang, Y. Luo, T. Yang, Y. Zhang, Z. Li, W. Jin, Y. Fang. This is an open access, peer-reviewed article published by Firenze University Press (http://www.fupress.com/caryo- logia) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All rel- evant data are within the paper and its Supporting Information files. Competing Interests: The Author(s) declare(s) no conflict of interest. Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain (central China) Shuzhen Wang, Yanyan Luo, Tao Yang, Yujia Zhang, Zhiliang Li, Wei- bin Jin, Yuanping Fang* Hubei Key Laboratory of Economic Forest Germplasm Improvement and Resources Com- prehensive Utilization; Hubei Collaborative Innovation Center for the Characteristic Resources Exploitation of Dabie Mountains; College of Life Science, Huanggang Normal University, Huanggang, 438000, Hubei Province, P.R. China *Correspondence author 3559541179@qq.com or wangshuzhen710@whu.edu.cn Abstract. Altitude could greatly influence species distribution and even their genet- ic diversity. However, it is unclear how altitude has affected the genetic diversity and population structure of Rhododendron simsii Planch., an dominant forestry species in north temperate forest. In this research, 22 polymorphic EST-SSR markers were utilized to assess the genetic diversity of R. simsii population distributed at different altitudes of Wujiashan Mountain, a major peak of Dabie Mountains (central Chi- na). Totally, 203 alleles were obtained, and each locus gave out 5 to 19 alleles. High genetic diversity existed, as Nei’s gene diversity (h) and Shannon’s Information index (I) ranged from 0.728 to 0.920 and 1.430 to 2.690, with the mean value of 0.821 and 1.916, respectively. In particular, 11.1% of genetic differentiation was maintained between populations, while 88.9% occurred within populations. Moreover, moder- ate gene flow (2.001) among populations was observed, which could effectively resist genetic drift. The genetic diversity of all these five R. simsii populations varied signifi- cantly with elevation, basically showing high-low-high pattern with elevation increase. Without human intervention, genetic diversity of R. simsii populations might increase with the altitude. At the significance level (p < 0.05), negative correlation was found between genetic diversity and attenuation rate of light intensity (r=-0.873). Soil of Wujiashan Mountain was acid (the pH value ranged from 4.33 to 4.70), which was rich in organic matter, available phosphorus, available potassium, and alkali hydrolys- able nitrogen, as these soil factors interacted with each other to affect the growth of R. simsii population. This research would contribute a lot to the knowledge of evolution- ary history of R. simsii species and benefit subsequent management and conservation actions. Key words. Rhododendron simsii Planch.; EST-SSR; genetic diversity; altitude; germ- plasm protection. 42 Shuzhen Wang et al. INTRODUCTION Genetic studies are important for understanding the genetic structure of populations and their ability to respond to natural selection (Lee 2002; Allendorf and Lundquist 2003). Genetic diversity reflects the ability of plant species to adapt environment changes during evolution. Moreover, understanding of genetic diversity in plants, including origin, maintenance and distribu- tion, could give great insight into the modes of specia- tion, adaptation, as well as population dynamics (Bussell 1999). Genetic composition of a certain species is often influenced by various factors, including the history of introduction, founder effects, life-history characteris- tics, reproductive method, and even the effect of gene drift (Liu et al. 1998; Ye et al. 2003; Dewalt and Ham- rick 2004; Liang et al. 2008). In particular, life-history characteristics, including reproductive method, could affect genetic diversity within- and among- populations (Dewalt and Hamrick 2004). Founder effects and genetic drift could reduce the heterozygosity and increase inter- population differentiation (Liang et al. 2008). Moreover, spatial distribution of genetic structure, reflecting adap- tation evolution, environmental changes and natural selection effect, is often closely related to breeding mech- anisms of the species (Ishihama et al. 2005). Genetic and geographical structure in natural pop- ulations along elevational gradients are often influenced by life history, ecological traits, and biogeographic his- tory (Quiroga and Premoli 2007; Truong et al. 2007). Elevation, or altitudinal gradient, is an assemblage of environmental variables, which could markedly influ- ence the distribution of population genetic variation (Hahn et al. 2012). Therefore, understanding of current distribution pattern of population genetic diversity and differentiation along altitudinal gradients is vital for conservation and reasonable utilization (Mcmahon et al. 2007). The Rhododendron genus, belonging to Ericaceae family, is widely distributed around the northern hemi- sphere and presents as different ecological types (Pope- scu and Kopp 2013). Besides high horticultural and medicinal properties, Rhododendron plants play impor- tant roles in the stability of ecological system. In par- ticular, R. simsii is the dominant species in the com- munity of “Dabie Mountains woods” (central China), (Wang et al. 2017). However, Rhododendron-based tour- ism, habitat fragmentation caused by human activities, as well as changes in ecological environment, all have exerted great influence towards natural Rhododendron population (Wang et al. 2017). Therefore, research on genetic diversity and ecological conservation of wild R. simsii is essential. However, analysis of genetic diversity and population structure of wild R. simsii population is limited, especially the populations located on Dabie Mountains. Microsatellite, or simple sequence repeats (SSR), is abundant, co-dominant, widely distributed in genom- es, highly polymorphic, and easily detectable, which has been widely used in genotype mapping, population structure and genetic diversity analysis (Ambreen et al. 2018; Ukoskit et al. 2018). In particular, SSR mark- er developed from expressed sequence tags (EST), the EST-SSR, showed more convenience in genetic studies, which has a high transferability to related species (Xu et al. 2018; Zhang et al. 2018). In this research, EST-SSR markers were used to investigate the genetic diversity of R. simsii populations at different altitudes in Wujiashan Mountain. MATERIALS AND METHODS Description of Wujiashan Mountain and Materials Wujiashan Mountain (115°46’31.37”-115°50’39.20”E, 31°04’43.20”- 31°07’31.60”N, 3.02×104 hm2), is one of the beautiful spot in Dabie Mountains. According to our field investigation, the constructive species making up the brush and forest were mainly species belonging to the families of Lauraceae, Cornaceae, Leguminos- ae, Anacardiaceae, Fagaceae, and Caprifoliaceae. Fresh leaves of R. simsii were collected at different altitudes on Wujiashan Mountain in August 2017 (Table 1). Particu- larly, the minimum interval between individuals was set as 100m. Development of EST-SSR markers Transcriptome data (SRP099282) of R. simsii flower tissue was used for the development of EST-SSR markers Table 1 The location of R. simsii populations studied sampled from Wujiashan Mountain. Population code Sampling altitudes Number of individuals Longitude (E) Latitude (N) Percentage of polymorphic loci 1 972m 15 115°47’18’’31°06’53’’ 100% 2 1,071m 15 115°47’06’’31°06’04’’ 100% 3 1,167m 15 115°47’01’’31°06’07’’ 100% 4 1,270m 15 115°46’49’’31°06’08’’ 100% 5 1,370m 15 115°46’40’’31°06’08’’ 100% 43Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain with MicroSAtellite (MISA, http://pgrc.ipk- gatersleben. de/misa). These SSR-containing unigenes (di-nucleotide units) with sufficient flanking regions (more than 100bp) were chosen for prime pair design with online software Primer 3 (Wang et al. 2010). DNA Extraction and Genetic diversity analysis based on EST-SSR markers The modified CTAB (cetyltrimethyl ammonium bromide) method was adopted to extract genomic DNA, which was further diluted to 50ng/μL (Wang et al. 2017). The 10μL PCR amplification system was set, includ- ing 5μL 2×Taq Plus PCR MasterMix (TianGen, Beijing, China), 0.2 μM for each primer, as well as 50 ng genomic DNA. The PCR amplification conditions included initial denaturation at 95°C for 10 min, followed by 35 ampli- fication cycles (94°C for 30 s, annealing at optimal tem- perature for 40 s, and 72°C for 50 s), as well as a 7 min elongation step at 72°C. Then, the PCR amplification products were separated on 6% (w/v) denaturing poly- acrylamide gels, which were further visualized by silver staining. Analysis of soil nutrients and attenuation rate of light intensity in sample plots Five randomized soil cores (3cm in diameter) were taken up from each sampling spot (0-15cm depth), which were dried off in air and sieved through the 1mm sieve according to WiśniowskaKielian and Klima (2010). Available phosphorus and potassium forms were extracted from the soil with lactate reagent according to the Egner-Riehm’s method (Sienkiewicz et al. 2011). In particular, the content of available phosphorus (mg/kg of the soil dry matter) were determined through spec- trophotometric method using Beckman DU 640 appara- tus, while content of available potassium were obtained with atomic absorption spectrometry (AAS) using PU 9100X Philips. Furthermore, contents of alkali hydrolys- able nitrogen were determined with alkaline persulfate digestion (Ding et al. 2013). Contents of the soil organic matter (SOM) were calculated with potassium  dichro- mate  oxidation  method. Soil pH values were measured in 0.01mol/L CaCl2 slurry (1:2.5 soil/solution) using a reference glass electrode (Ding et al. 2013). The light intensity upon the upper leaf surface and below the bottom leaf of each R. simsii plant was meas- ured with luminometer (AS 810), and 50 plant were ran- domly selected in each sampling pot. The attenuation rate of light intensity was equal to the upper light inten- sity divided by lower light intensity. STATISTICA (ver- sion 6.1, StatSoft) was employed to determine the statis- tical parameters and correlation coefficients. Data Analysis DNA bands were scored for each sample. Popula- tion genetic parameters were calculated with POPGENE version 1.31 software, including number of alleles (NA) per locus, effective number of alleles (NE) per locus, expected heterozygosity (HE), observed heterozygosity (HO), tests for linkage disequilibrium (LD), Nei’s (1973) gene diversity (h), Shannon’s information index (I), total- population inbreeding coefficient (FIT), intra-population inbreeding coefficient (FIS), inter-population genetic dif- ferentiation coefficient (FST), gene flow, genetic identify (GI), and genetic distance (D) between populations (Wu et al. 2011). Moreover, genetic distance matrix among pairs of populations resulting from POPGENE analysis was utilized to create a dendrogram by MEGA software version 4.0. In addition, the correlations between genetic diversity and altitudinal distances, as well as soil factors were tested using DMRT with the software SPSS 17.0. The statistical significance between populations was esti- mated by two-tailed Student’s t test (P < 0.05). RESULTS Genetic diversity of Rhododendron populations Among 57 EST-SSR markers, 22 were polymorphic (Table 2), which gave out 203 bands. R. simsii had high genetic diversity at species level, and the polymorphic percentage in five populations were all 100%. NA and NE ranged from 5 to 19 and 3.674 to 12.437, with the mean value of 9.227 and 6.083, respectively (Table 3). The length of amplified bands ranged from 161 to 268 bp. The average Shannon’s information index (I) and Nei’s gene diversity (h) were 1.916 and 0.821, respectively (Table 3). In particular, the highest I and h was observed at EST-SSR117 locus, while the lowest existed at SSR019 locus (Table 3). Moreover, HO and HE ranged from 0.208 to 1.000 and 0.744 to 0.926, with the mean value of 0.862 and 0.828, respectively (Table 3). The genetic diversity of population was lower than that of the species. At population level, the aver- age NA and NE were 5.56 and 4.23, and the mean I and H were 1.498 and 0.734, respectively (Table 4). The lev- el of genetic variation of these five populations from the highest to lowest revealed by I was pop 5> pop 1> pop 3> pop 2> pop 4. In particular, pop 5 gave out 44 Shuzhen Wang et al. the most alleles (128), while pop 4 produced the least alleles (119), which were all polymorphic (Table 4). The I ranged from 1.423 (pop 4) to 1.565 (pop 5), while h ranged from 0.705 (pop 4) to 0.762 (pop 1). The mean HO and HE ranged from 0.836 (pop 2) to 0.885 (pop 5) and 0.730 (pop 4) to 0.807 (pop 1), respectively. Basi- cally, the genetic diversity of five populations showed a high-low-high variation pattern, as genetic diversity of R. simsii populations sampled at high and low altitude was higher than populations collected at middle altitude. Using an unpaired  two-tailed  Student  t-test, the differ- ence between populations was not statistically significant (p<0.05) Genetic differentiation among populations at different alti- tudes Significant genetic differentiation presented among these five R. simsii populaitons (P<0.001). An AMOVA of the distance matrix for all individuals partitioned over- all variation into two levels, including ‘among species’ and ‘among populations’. The FIS and FIT values ranged from -0.508 to 0.447 and -0.215 to 0.715, with the mean value of -0.178 and -0.047, respectively (Table 3). The FIS value was negative for all five populations, ranging from -0.223 (pop 4) to -0.136 (pop 3), inferring that relatively high level of outcross occurred within populations (Table 4). FST value was calculated to be 0.111, suggesting that only 11.1 percent of overall genetic variation occurred between populations, while 88.9 percent took place within populations (Table 3). Furthermore, genetic vari- ation mainly occurred at the SSR019 locus, followed by SSR105, SSR117, and SSR123 loci. In particular, gene flow was 2.001, which occurred frequently at SSR114, SSR097, SSR129, SSR082, and SSR090 loci (Table 3). However, the gene flow was a low-frequency event at SSR019 locus with the Nm value of 0.265, inferring that this locus might undergo genetic drift during population evolution (Whit- lock and McCauley 1999). Cluster analysis of different R. simsii populations Genetic distance between pop 1 and pop 3 was the biggest (D = 0.8169), while their genetic identify was the lowest (GI = 0.4418). However, genetic distance between pop 3 and pop 4 was the smallest (D = 0.3979), while their genetic identify was the highest (GI = 0.6717) (Table 5). Based on the matrix of genetic distance, UPG- Table 2 Characteristics of SSR primers used in this research. Shown for each primer pair are forward and reverse primer sequences, repeat motif, annealing temperature (Ta), and the size range of alleles fragment (bp). Locus Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) Repeat motif Ta (°C) Size range (bp) SSR019 ATCCCATCCCATCTCTCTC CACAGATGAGAGAAGAGAGC (CT)25 55 202-212 SSR025 TCGTGTTGGGTTTCTATTGT TCCATCAAACTACCAACACC (CT)25 55 236-256 SSR031 GCAATCTTTCCTCCCATCTT CTTCTGAATGGGTGCTACTT (AG)26 56 233-245 SSR032 GAAACGTGTCTGTTTTCTCC CTACCCCAATTTCCACTACC (CT)28 56 207-231 SSR070 TCTTCCGATTCCATCATTCC TGGGCGTGATTTGGTTATAA (CT)22 54 179-203 SSR078 TTCCAGTTCCAATTCATCGG CCCAACAACAATTCCATCAC (CT)22 56 161-179 SSR081 GCCCTATCCCTCAACTTTAC GAGGAGCGTGGTTAGTAATT (TC)21 55 230-252 SSR082 GTATGGGACCTGTGATTTCC CTCCAACTAGCTACTCCAAC (AG)24 57 229-243 SSR090 TTGAAGAACACTCAAGTTGC ACGTAGAACATTGCTTTCCT (GA)21 56 187-201 SSR093 GGTATCCGGTTTTCATCACT ATACCCACTAGCAACAGAGA (GA)23 55 234-248 SSR097 AGAAAACTGGGAGATGTGTC AGGTGATCATCTTTGCATGT (CT)21 55 247-267 SSR105 CCCCTCTTTCTCTCTAGGAT GAGAGAGAAGCCGATTACAG (TC)22 56 186-200 SSR110 TAACCTGCCAGTGGAATTAC TCTACGTACGCCATTGAAAT (CT)22 55 224-234 SSR111 CTGCAGACATGACATGAAAC TTTGCTTACCACTCCCATTT (AG)21 55 244-260 SSR113 TATTGTACAGCTCCCCTTTG CCTCAATGTTCTATCGACGT (CT)23 56 186-200 SSR114 TATTGTACAGCTCCCCTTTG GAACATGTTAAAGCGCTTGA (TC)21 54 171-183 SSR116 ATTGCTTCTGATACCATCCG TATCAGCTTTCGAGTTGTCC (TC)21 55 211-223 SSR117 GCTATTCACTCGTCAAATGC ATTGTGGGAATGAAGGTCTC (GA)22 55 229-268 SSR123 CCCTTCCTCTTCTCAAATCC CGTCATTTTCACACACAGAG (CT)23 54 174-189 SSR125 CTCTCCCAAAATTAGCCGAT GAATTGGCTGTTGGATGATG (CT)21 55 234-246 SSR129 TGAAGCTGTTTTAGACTCCC CATGATGGGAAAGCAAAGTG (TC)22 55 161-175 SSR130 CCATGACGAACCCTATTGAT TCCTGATATTCCTTTGCACA (AG)21 56 235-245 45Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain MA cluster analysis assigned these five populations into two groups (Figure 1). Group I possessed pop 3, pop 4, and pop 5, while pop 1 and pop 2 were clustered into group II. Group I could be further divided into two sub- groups, Ia and Ib. Particularly, Ib consisted of pop 3 and pop 4. Population 3 appeared to be more closer with population 4 than other populations. The dendrogram indicated that R. simsii population clustering had obvi- ous region specificity, as the first group included popu- lations sampled at higher altitudes, while the second possessed populations collected at the lower altitudes of Wujiashan Mountain (Figure 1). Soil nutrients and attenuation rate of light intensity in five sample plots Contents of available phosphorus and available potassium ranged from 13.696 mg/kg (pop 2) to 20.850 Table 3 Genetic diversity of R. simsii populations based on SSR markers, including Number of alleles (NA), effective number of alleles (NE), Shannon’s information index (I), Nei’s gene diversity (h), observed heterozygosity (HO), expected heterozygosity (HE), intra-population inbreeding coefficient (FIS), total-population inbreeding coefficient (FIT), inter-population genetic differentiation coefficient (FST), and gene flow (Nm). Locus NA NE I h HO HE FIS FIT Fst Nm SSR019 5 3.674 1.430 0.728 0.208 0.744 0.447 0.715 0.486 0.265 SSR025 11 6.751 2.090 0.852 0.964 0.860 -0.286 -0.154 0.103 2.184 SSR031 7 4.018 1.598 0.751 0.900 0.757 -0.278 -0.182 0.075 3.105 SSR032 13 7.904 2.245 0.874 1.000 0.880 -0.243 -0.146 0.078 2.937 SSR070 13 9.047 2.361 0.890 1.000 0.896 -0.225 -0.130 0.078 2.960 SSR078 10 6.468 2.036 0.845 1.000 0.852 -0.338 -0.169 0.126 1.738 SSR081 12 5.787 2.005 0.827 1.000 0.833 -0.356 -0.189 0.123 1.785 SSR082 9 5.842 1.923 0.829 1.000 0.835 -0.269 -0.204 0.052 4.606 SSR090 8 6.630 1.961 0.849 1.000 0.857 -0.247 -0.175 0.058 4.048 SSR093 8 6.512 1.944 0.846 1.000 0.853 -0.276 -0.172 0.082 2.817 SSR097 11 6.054 2.015 0.835 1.000 0.841 -0.254 -0.193 0.049 4.874 SSR105 8 5.678 1.870 0.824 1.000 0.831 -0.508 -0.215 0.195 1.036 SSR110 6 3.947 1.527 0.747 0.561 0.752 0.201 0.251 0.062 3.754 SSR111 11 5.161 1.915 0.806 1.000 0.813 -0.363 -0.205 0.116 1.904 SSR113 8 6.383 1.949 0.843 0.754 0.850 0.019 -0.078 0.060 3.889 SSR114 7 5.070 1.758 0.803 0.732 0.810 0.053 0.097 0.047 5.116 SSR116 7 4.398 1.660 0.773 0.797 0.778 -0.117 -0.045 0.063 3.716 SSR117 19 12.437 2.690 0.920 0.843 0.926 -0.114 0.097 0.189 1.071 SSR123 9 7.861 2.126 0.873 0.968 0.880 -0.332 -0.109 0.168 1.241 SSR125 7 4.350 1.624 0.770 0.712 0.776 -0.016 0.059 0.074 3.133 SSR129 8 5.630 1.886 0.822 0.908 0.829 -0.161 -0.102 0.05 4.708 SSR130 6 4.221 1.538 0.763 0.623 0.769 0.080 0.208 0.139 1.547 Mean 9.227 6.083 1.916 0.821 0.862 0.828 -0.178 -0.047 0.111 2.001 St. Dev 3.146 1.990 0.295 0.050 0.201 0.050 Table 4 Genetic diversity of R. simsii populations at different altitudes. Population codes NA Mean NA Mean NE I h HO HE FIS Pop 1 120 5.46±1.57 4.52±1.30 1.551±0.271 0.762±0.065 0.884±0.222 0.807±0.069 -0.153±0.262 Pop 2 121 5.50±1.50 3.97±1.27 1.457±0.321 0.717±0.110 0.836±0.239 0.750±0.114 -0.151±0.293 Pop 3 124 5.64±1.68 4.27±1.35 1.495±0.396 0.727±0.148 0.849±0.249 0.757±0.154 -0.136±0.358 Pop 4 119 5.41±1.71 3.92±1.21 1.423±0.387 0.705±0.154 0.866±0.257 0.730±0.159 -0.223±0.294 Pop 5 128 5.82±1.62 4.50±1.30 1.565±0.291 0.757±0.077 0.885±0.200 0.784±0.079 -0.167±0.260 Mean 122.4 5.56±0.17 4.23±0.28 1.498±0.060 0.734±0.025 - - - 46 Shuzhen Wang et al. mg/kg (pop 5) and 144.378 mg/kg (pop 1) to 306.197 mg/kg (pop 5), with the mean values of 17.329 mg/ kg and 204.198 mg/kg, respectively (Figure 2A, 2B and Supplementary file 1). The content of available phospho- rus differed slightly between various populations, with a decreasing order of pop 5, pop 3, pop 4, pop 1, and pop 2 (Figure 2A). Moreover, content of soil organic matter in Wujiashan Mountain was 720.953 mg/kg (Figure 2C and Supplementary file 1). Basically, the content of soil organic matter increased with altitude rising, which was highest in pop 5 (838.565mg/kg). Along the eleva- tion, contents of alkali hydrolysable nitrogen were also increased: the lowest value existed in pop 1, while the highest value was observed in pop 5 (Figure 2D). Over- all, soil of Wujiashan Mountain was estimated to be rich in nutrients necessary for the growth of R. simsii. The pH value of soil ranged from 4.33 (pop 4) to 4.70 (pop 3), and the mean value was calculated to be 4.494 (Figure 2E). Moreover, the attenuation rate of light intensity in R. simsii populations differed significantly, varying from 0.438 to 0.594 (Figure 2F). In particular, pop 5 had the lowest attenuation rate of light intensity (0.438), followed by pop 1 (0.455). However, the highest attenuation rate of light intensity was observed in pop 4 (0.594), followed by pop 3 (0.529). Correlation between population genetic differentiation and environmental factors The correlation analysis showed that genetic diver- sity between populations was not significantly related to altitude (r(I, altitude)=-0.014, p>0.05; r (h, altitude) = -0.136, p>0.05). Moreover, NA, HO, HE, and FIS also showed no relationship with altitude: r(NA, altitude)=0.599, p>0.05; r(HO, altitude)=0.599, p>0.05; r(HE, altitude)=-0.343, p>0.05; r(Fis, alti- tude)=-0.474, p>0.05. At the significance level (p < 0.05), negative correlation was observed between genetic diver- sity and attenuation rate of light intensity with r value of -0.873 (Figure 3A). However, no significant correla- tion were observed between genetic diversity and avail- able phosphorus, available potassium, alkali hydrolys- able nitrogen, soil organic matter, as well as pH value of soil at the significance level (p < 0.05) by Mantel’s test, with the r value ranging from 0.236 to 0.526. In par- ticular, contents of available phosphorus were positively correlated with content of alkali hydrolysable nitrogen (r=0.953, p=0.012) and the content of soil organic mat- ter (r=0.879, p=0.05) (Figure 3B and C). Furthermore, similar correlation also existed between alkali hydrolys- able nitrogen content and soil organic matter content (r = 0.935, p = 0.020) (Figure 3D). Table 5 Nei’s genetic identity (above diagonal) and genetic distance (below diagonal) between different populations. Pop ID Pop 1 Pop 2 Pop 3 Pop 4 Pop 5 Pop 1 - 0.5720 0.4418 0.4718 0.4865 Pop 2 0.5587 - 0.6309 0.5660 0.5332 Pop 3 0.8169 0.4605 - 0.6717 0.6194 Pop 4 0.7512 0.5692 0.3979 - 0.6712 Pop 5 0.7206 0.6288 0.4790 0.3987 - Table 6 Contents of available phosphorus, available potassium, alkali hydrolysable nitrogen, soil organic matter, and the pH values of five sampling spots. Populations Available phosphorus (mg/ kg) Available potassium (mg/kg) Soil organic matter (g/kg) Alkali hydrolysable nitrogen (mg/kg) pH value Attenuation rate of light intensity (%) pop 1 14.578±6.429 144.378±21.666 670.808±39.513 192.356±38.317 4.67 0.455±0.165 pop 2 13.696±3.975 186.313±43.959 658.812±31.972 221.104±43.587 4.43 0.489±0.246 pop 3 20.302±8.97 167.584±10.924 734.673±40.214 327.148±38.510 4.70 0.529±0.229 pop 4 17.220±5.475 216.518±62.862 701.905±37.975 258.014±37.964 4.33 0.594±0.242 pop 5 20.850±2.125 306.197±32.939 838.565±35.178 375.484±42.802 4.34 0.438±0.294 Mean 17.329 204.198 720.953 274.821 4.494 0.501 Standard deviation 3.241 62.838 72.041 75.564 0.179 0.063 Fig. 1. Dendrogram of five R. simsii populations generated with MEAG4 cluster analysis. 47Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain Fig. 2. Contents of aAvailable phosphorus content (A), available potassium content (B), soil organic matter content (C), alkali hydrolys- able nitrogen content (D), soil acidity (E), and attenuation rate of light intensity (F) of five R. simsii populations. Values were represented as mean value ± standard deviation. Fig. 3. Correlation between genetic diversity and attenuation rate of light intensity (A), content of alkali hydrolysable nitrogen and available phosphorus (B), soil organic matter and available phosphorus content (C), as well as soil organic matter and alkali hydrolysable nitrogen content (D). 48 Shuzhen Wang et al. DISCUSSION Genetic diversity is the result of long-term evolution of a species, which represents the evolutionary potential (Cheng et al. 2017). Moreover, population evolution and the ability to adapt to environment may largely depend on genetic diversity. According to Bussell (1999), deep research on origin, maintenance, as well as distribu- tion of genetic diversity in a species could enhance the understanding of modes of speciation, adaptation, and even population dynamics in the future. R. simsii, one of the most valuable woody plants, is dominant shrub with narrow distribution in Dabie Mountains (Li et al. 2015). Global environmental change and travel increase have threatened native biodiversity of wild R. simsii, espe- cially the populations located on Dabie Mountain, whose current status need for significant attention. In this study, high level of genetic diversity was observed in R. simsii populations, with I and HE rang- ing from 1.423 to 1.565 and 0.730 to 0.807, respectively, as HE ranging from 0.3 to 0.8 means that the tested pop- ulation possessed high genetic diversity (Frankham et al. 2002; Edwards et al. 2014). The genetic diversity was significantly higher than Corylus heterophylla popula- tions in Xingtangsi forest park (I=0.4790), Acer ginnala sampled at different altitudes in Qiliyu (I=0.5070), Fir- miana danxiaensis located in Danxia landform of China (HE: 0.364±0.019), R. decorum in southwest China (HE: 0.758±0.048), Erigeron arisolius (HE: 0.748±0.069), and R. jinggangshanicum population (HE: 0.642±0.200) sampled from Mount Jinggangshan of China (Yan et al. 2010; Di et al. 2014; Chen et al. 2014; Wang et al. 2013a; Edwards et al. 2014; Li et al. 2015). In our opinion, the ancestor of R. simsii located on Wujiashan Mountaian might have a rich genetic basis, which is well preserved during evolu- tion. R. simsii, as perennial shrub with overlapping gen- erations, is both wind-pollinated and insect-pollinated plant. Sexual reproduction could increase genetic vari- ation within population, which correspondingly allow natural selection to proceed effectively (Ayres and Ryan 1999; Burt 2000). Therefore, the high genetic diversity existed in R. simsii natural populations might be related to the biological characteristics and living conditions. Furthermore, sexual reproduction might be another crit- ical reason for high genetic diversity. Heterozygote excess was found in this wide R. sim- sii populations (FIS = -0.178), inferring that outcross might occurred, especially in pop 4 (FIS = -0.223) (Nagy- laki 1998). Relatively low levels of inbreeding coefficient and outcross also existed in R. jinggangshanicum (FIS = 0.023), R. championiae (FIS = 0.012), and R. moulmain- ense populations (FIS = 0.045) (Ng and Corlett 2000; Li et al. 2015).Furthermore, 88.9 percent of genetic varia- tion occurred within populations, while only 11.1 per- cent was maintained between populations (FST = 0.111, P < 0.001). In particular, genetic variation of R. simsii pop- ulationswas slightly lower than R. jinggangshanicum dis- tributed on Jinggangshan Mountain (93.13%, P < 0.001), but higher than R. decorum sampled from Southwest China (85.11%, P < 0.001) and R. concinnum collected in Qinling Mountains (85.3%, P < 0.001) (Zhao et al. 2012; Wang et al. 2013b; Li et al. 2015). Gene flow was2.001, higher than R. arboreum population (Nm = 1.13). There- fore, these R. simsii populations might effectively coun- teract the effect of genetic drift and resist the popula- tion differentiation (Kuttapetty et al. 2014). Dendrogram showed typical region specificity, so gene flow might eas- ily occur between neighboring populations. Genetic diversity of these five R. simsii populations varied significantly with elevation (pop 5> pop1>pop 3>pop 2>pop 4), and basically showed high-low-high pattern. In relation to pop 5 with the highest genetic diversity, the contents of available phosphorus, potas- sium, soil organic matter, and the alkali hydrolysable nitrogen were all the most, while the attenuation rate of light intensity was lowest. During field observation, we found that R. simsii population increased basically with altitudes, which reached the maximum at 1,280 meters. According to Leimu et al. (2006), genetic diversity and population size was positively correlated, as well as fit- ness and population size. Therefore, high genetic diver- sity at high altitude might be due to the large population size, as effective population size is sufficient to prevent the genetic drift caused by loss of genetic diversity dur- ing long-term evolution. Moreover, populations located at 1,280 meters might also possess high level of ecologi- cal adapt-ability. Furthermore, the community struc- ture in Wujiashan Mountain had almost no artificial destruction, especially at the high altitude. Local famers plant R. simsii as ornamental plant, therefore different genotypes might have been brought to the population at low altitudes. Gene mutation and recombination further enhance the genetic diversity of R. simsii populations at low altitudes (Liang et al. 2008). Soil of Wujiashan Mountain was acid with the pH value ranging from 4.33 to 4.70, and was rich in organic matter, available phosphorus, available potassium, and alkali hydrolysable nitrogen. The typical acid soil is very suitable for the growth of R. simsii. Substrate avail- ability could influence microbial metabolic pathways to regulate carbon and even nutrient demand (Mondini et al. 2006). The soil conditions might also exert influ- ence towards the metabolic pathways of microbes associ- ated with R. simsii, which further affect the growth of R. 49Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain simsii population. However, no obvious correlation was observed between these soil factors with genetic diver- sity of R. simsii populations, except the attenuation rate of light intensity. Relatively high genetic diversity maintained within R. simsii populations located on Wujiashan Mountain was observed. No obvious correlation was observed between genetic diversity and altitude. However, genetic diversity was in negative correlation with attenuation rate of light intensity. In particular, the available phosphorus, potas- sium, soil organic matter, and the alkali hydrolysable nitrogen in soil might interact with each other to affect the growth of R. simsii population. This research will be ben- eficial for the understanding of evolutionary history and population dynamics of R. simsii population located on Wujiashan Mountain. In addition, the study is also impor- tant for preserving R. simsii genetic resources, as well as broadening genetic basis of Rhododendron cultivars. ACKNOWLEDGMENTS This work was supported by research grants from National Natural Science Foundation of China (NSFC 31500995), Open fund of Hubei Key Laboratory of Eco- nomic Forest Germplasm Improvement and Resources Comprehensive Utilization (2017BX06), and Fund of College students’  innovative  and entrepreneurial  activi- ties of Huanggang Normal University. REFERENCES Ambreen H, Kumar S, Kumar A, Agarwal M, Jagannath A, Goel S. 2018. Association mapping for important agronomic traits in safflower (Carthamus tincto- rius L.) core collection using microsatellite markers. Front. Plant Sci. 9: 402. Allendorf FW, Lundquist LL. 2003. Introduction: popula- tion biology, evolution, and control of invasive spe- cies. Conserv. Biol. 17: 24-30. Ayres DR, Ryan FJ. 1999. Genetic diversity and structure of the narrow endemic Wyethia Reticulata and its congener W. Bolanderi (Asteraceae) using RAPD and allozyme techniques. Am. J. Bot. 86: 344353. Burt A. 2000. Perspective: sex, recombination, and the efficacy of selection was Weismann right ? Evolution 54: 337351. Bussell JD. 1999. The distribution of random amplified polymorphic DNA (RAPD) diversity amongst popu- lations of Isotoma petraea (Lobeliaceae). Mol. Ecol. 8: 775-789. Chen SF, Li M, Hou RF, Liao WB, Zhou RC, Fan Q. 2014. Low genetic diversity and weak population differenti- ation in Firmiana danxiaensis, a tree species endemic to Danxia landform in northern Guangdong, China. Biochem. Syst. Ecol. 55: 66-72. Cheng X, Jiang Y, Tang T, Fan G, Huang X. 2017. Genetic diversity of Picea likiangensis natural population at different altitudes revealed by EST-SSR markers. Sil- vae Genet. 63(5): 191-198. Dewalt SJ, Hamrick JL. 2004. Genetic variation of intro- duced Hawaiian and native Costa Rican populations of an invasive tropical shrub Clidemia Hirta (Melas- tomataceae). Am. J. Bot. 91: 1155-1162. Di XY, Liu KW, Hou SQ, Ji PL, Wang YL. 2014. Genetic variation of hazel (Corylus heterophylla) populations at different altitudes in Xingtangsi forest park in huoshan, Shanxi, China. Plant Omics, 7(4): 213-220. Ding X, Han X, Zhang X, Qiao Y. 2013. Effects of con- trasting agricultural management on microbial resi- dues in a mollisol in china.  Soil Till. Res.  130(6): 13-17. Edwards CE, Lindsay DL, Bailey P, Lance RF. 2014. Pat- terns of genetic diversity in the rare Erigeron lemmo- ni and comparison with its more widespread conge- ner, Erigeron arisolius (Asteraceae). Conserv. Genet. 15: 419-428. Frankham R, Ballou JD, Briscoe DA. 2002. Introduction to Conservation Genetics, second edition. New York, Cambridge University Press. Hahn T, Kettle CJ, Ghazoul J, Frei ER, Matter P, Pluess AR. 2012. Patterns of genetic variation across altitude in three plant species of semi-dry grasslands. PLoS One. 7(8): e41608. Ishihama F, Ueno S, Tsumura Y, Washitani I. 2005. Gene flow and inbreeding depression inferred from fine- scale genetic structure in an endangered heterosty- lous perennial, Primula sieboldii.  Mol. Ecol. 14(4): 983-990. Kuttapetty M, Pillai PP, Varghese RJ, Seeni S. 2014. Genetic diversity analysis in disjunct populations of Rhododendron arboreum from the temperate and tropical forests of Indian subcontinent corrobo- rate Satpura hypothesis of species migration.  Bio- logia 69(3): 311-322. Lee CE. 2002. Evolutionary genetics of invasive species. Trends. Ecol. Evol. 17: 386-391. Leimu R, Mutikainen P, Koricheva J, Fischer M. 2006. How general are positive relationships between plant population size, fitness and genetic variation? J. Ecol. 94: 942952. Li M, Chen S, Shi S, Zhang Z, Liao W, Wu W, Zhou R, Fan Q. 2015. High genetic diversity and weak popu- 50 Shuzhen Wang et al. lation structure of Rhododendron jinggangshanicum, a threatened endemic species in Mount Jinggangshan of China. Biochem. Syst. Ecol. 58: 178-186. Liang Y, Liu J, Zhang SP, Wang SJ, Guo WH, Wang RQ. 2008. Genetic diversity of the invasive plant coreopsis grandiflora at different altitudes in laoshan mountain, china. Can. J. Plant Sci. 88(4): 831-837. Liu F, Zhang L, Charleswoth D. 1998. Genetic diversity in leavenworthia populations with different inbreeding levels. Proc. R. Soc. B. 265: 293-301. Mcmahon SM, Harrison SP, Armbruster WS, Bartlein PJ, Beale CM, Meloni ME, Perini MD, Binelli G. 2007. The distribution of genetic variation in Norway spruce (Picea abies Karst.) populations in western Alps. J. Biogeogr. 34: 929-938. Mondini C, Cayuela ML, Sanchez-Monedero MA, Roig A, Brookes PC. 2006. Soil microbial biomass acti- vation by trace amounts of readily available sub- strate. Biol. Fert. Soils. 42(6): 542-549. Nagylaki T. 1998. Fixation indices in subdivided popula- tions. Genetics 148: 1325-1332. Ng SC, Corlett RT. 2000. Genetic variation and structure in six Rhododendron species (Ericaceae) with con- trasting local distribution patterns in Hong Kong, China. Mol. Ecol. 9: 959-969. Popescu R, Kopp B. 2013. The genus Rhododendron: An ethnopharmacological and toxicological review. J. Ethnopharmacol. 147: 42-62. Quiroga MP, Premoli AC. 2007. Genetic patterns in Podocarpus parlatorei reveal the long-term persis- tence of cold-tolerant elements in the southern Yun- gas. J. Biogeogr. 34: 447-455. Sienkiewicz S, ŻArczyńSki P, Krzebietke S. 2011. Effect of land use of fields excluded from cultivation on soil content of available nutrients.  J. Elementol.  16(1): 75-84. Truong C, Palme AE., Felber F. 2007. Recent invasion of the mountain birch Betula pubescens ssp. tortuosa above the treeline due to climate change: genetic and ecological study in northern Sweden. J. Evol. Biol. 20: 369-380. Ukoskit K, Posudsavang G, Pongsiripat N, Chatwachi- rawong P, Klomsa-Ard P, Poomipant P, Tragoonrung S. 2018. Detection and validation of EST-SSR mark- ers associated with sugar-related traits in sugarcane using linkage and association mapping.  Genomics. Doi.org/10.1016/j.ygeno.2018.03.019 Wang SZ, Pan L, Hu K, Chen CY, Ding, Y. 2010. Devel- opment and characterization of polymorphic micro- satellite markers in Momordica charantia (Cucurbita- ceae). Am. J. Bot. 97(8): e75–e78. Wang XQ, Huang Y, Long CL. 2013(a) Assessing the genetic consequences of flower-harvesting in Rhodo- dendron decorum Franchet (Ericaceae) using micros- atellite markers. Biochem. Syst. Ecol. 50: 296-303. Wang L, Liao WB, Chen CQ, Fan Q. 2013(b) The seed plant flora of the Mount Jinggangshan region, South- eastern China. PLoS One 8: e75834. Wang S, Li Z, Jin W, Xiang F, Xiang J, Fang Y. 2017. Development and characterization of polymorphic microsatellite markers in Rhododendron simsii (Eri- caceae). Plant Spec. Biol. 32: 100-103. Whitlock MC, McCauley DE. 1999. Indirect measures of gene flow and migration: Fst≠1/(4Nm+1). Heredity 82: 117-125. Wiśniowska-Kielian B, Klima K. 2010. Estimate of avail- able phosphorus and potassium forms content in the winter wheat soils from organic and conventional farms on the background their selected properties.  J. Dent. Res. 39(12): 1056-1061. Wu ZH, Wang SZ, Hu JH, Li F, Ke WD, Ding Y. 2011. Development and characterization of microsatellite markers for Sagittaria trifolia var. sinensis (Alismata- ceae). Am. J. Bot. 98(2): e36-e38. Xu X, Zhou C, Zhang Y, Zhang W, Gan X, Zhang H, Guo Y, Gan S. 2018. A novel set of 223 EST-SSR markers in Casuarina L. ex Adans.: polymorphisms, cross- species transferability, and utility for commercial clone genotyping. Tree Genet. Genome. 14(2): 30. Yan N, Wang D, Gao YH, Hao XJ, Wang YL. 2010. Genetic diversity of Acer ginnala populations at dif- ferent levation in Qiliyu based on ISSR markers. Sci. Silv. Sin. 46(10): 50-56. Ye WH, Li J, Cao HL, Ge XJ. 2003. Genetic uniformity of Alternanthera philoxeroides in South China. Weed Res. 43: 297-302. Zhang Z, Xie W, Zhang J, Zhao X, Zhao Y, Wang Y. 2018. Phenotype- and SSR-based estimates of genetic vari- ation between and within two important Elymus species in Western and Northern china. Genes. 9(3): 147. Zhao B, Yin ZF, Xu M, Wang QC. 2012. AFLP analysis of genetic variation in wild populations of five Rhodo- dendron species in Qinling Mountain in China. Bio- chem. Syst. Ecol. 45: 198-205. 51Genetic diversity of Rhododendron simsii Planch. natural populations at different altitudes in Wujiashan Mountain Supplementary file 1 The correlation coefficient (below) and significant level (above) among genetic diversity, contents of available phos- phorus, available potassium, alkali hydrolysable nitrogen, soil organic matter, soil pH value, and the attenuation rate of light intensity. Item Genetic diversity Available phosphorus Available potassium Alkali hydrolysable nitrogen Soil organic matter pH value Attenuation rate of light intensity Genetic diversity —— 0.619 0.703 0.611 0.363 0.614 0.050 Available phosphorus 0.304 —— 0.298 0.012 0.05 0.91 0.965 Available potassium 0.236 0.587 —— 0.154 0.069 0.127 0.735 Alkali hydrolysable nitrogen 0.311 0.953 0.739 —— 0.02 0.696 0.867 Soil organic matter 0.526 0.879 0.849 0.935 —— 0.588 0.604 pH value 0.308 -0.071 -0.77 -0.0241 -0.33 —— 0.796 Attenuation rate of light intensity -0.873 0.027 -0.021 -0.105 -0.317 -0.161 —— Substantia An International Journal of the History of Chemistry Vol. 2, n. 1 - March 2018 Firenze University Press