DOI: 10.3303/CET2293048 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Paper Received: 19 January 2022; Revised: 13 March 2022; Accepted: 16 April 2022 
Please cite this article as: Ropero-Vega J.L., Albiares-Sánchez L.J., León-Sánchez W.R., Valdivieso-Quintero W., Flórez-Castillo J.M., 2022, 
Detection of Pathogenic E. Coli by Electrochemical Biosensors Based on Aptamers Designed by Bioinformatic Tools, Chemical Engineering 
Transactions, 93, 283-288  DOI:10.3303/CET2293048 
  

 CHEMICAL ENGINEERING TRANSACTIONS  
 

VOL. 93, 2022 

A publication of 

 

The Italian Association 

of Chemical Engineering 

Online at www.cetjournal.it 

Guest Editors: Marco Bravi, Alberto Brucato, Antonio Marzocchella 

Copyright © 2022, AIDIC Servizi S.r.l. 

ISBN 978-88-95608-91-4; ISSN 2283-9216 

Detection of Pathogenic E. Coli by Electrochemical 

Biosensors Based on Aptamers Designed by Bioinformatic 

Tools 

Jose L. Ropero-Vega*, Leidy J. Albiares-Sánchez, Wendy R. León-Sanchez, 

Wilfredo Valdivieso-Quintero, Johanna M. Flórez-Castillo 

Universidad de Santander. Facultad de Ciencias Naturales. Ciencias Básicas y Aplicadas para la Sostenibilidad. 

Bucaramanga, Colombia. 

jose.ropero@udes.edu.co 

In this work, we present the in-silico design of a new aptamer (named Apt917) capable of interacting with 

E. coli and its evaluation as a recognition element in electrochemical biosensors. A search and bioinformatic 

analysis of various aptamers reported in the literature was carried out. Parameters such as low dissociation 

constant and short sequences were considered to design and model new hybrid sequences. The designed 

Apt917 has a minimum free energy and high percent to frequency, making it promising compared to the initial 

ones. Apt917 was synthesized and immobilized on gold nanoparticles-modified screen-printed electrodes. The 

evaluation of the obtained biosensor shows a promising detection of E. coli O157:H7 with limits of detection 

and quantification of 8 and 27 CFU/mL, respectively. 

1. Introduction 

Escherichia coli (E. coli) is one of the most widespread pathogenic bacteria in nature and it has been 

recognized that some special serotypes of this pathogen can produce enterotoxins, which cause abdominal 

pain, diarrhea, inflammation, ulcers, and even severe cases such as hemorrhagic enteritis (Zhao et al., 2018). 

Therefore, the quantitative detection of E. coli has always been an essential task in the environment, 

medicine, pharmaceutical industry, and food safety. Currently, there are several detection methods for E. coli, 

such as culture counts, immunological detection, and those based on molecular biology (Palomino-Camargo & 

González-Muñoz, 2014). However, these methods have drawbacks ranging from long times for the 

confirmation and identification of the type of microorganism, high costs or complexity in the tests (Zhao et al., 

2018). Considering the above, there is a demand for fast, cost-effective, and sensitive methods to detect and 

identify bacteria or their components. In this sense, electrochemical biosensors have recently been considered 

attractive options to existing methods to detect pathogens (Albanese et al., 2019). These biosensors show 

excellent characteristics, including simplicity, specificity, low detection limit, simple operation, cheap, provide 

real-time measurement, portability, miniaturization, and rapid detection (Razmi et al., 2020). Electrochemical 

biosensors are defined as analytical devices that use biological/biochemical phenomena for the detection of 

target analytes, based on interaction with a bioelement attached to a transducer. This transducer converts the 

biochemical interaction into a quantifiable electrical signal (Justino et al., 2015). 

In recent years, electrochemical biosensors with different types of transducers have been widely applied for 

the detection of pathogenic bacteria. Gold nanoparticles and carbon nanostructures are widely used in 

electrochemical transducers systems due to their excellent stability and electron transport properties (Shoaie 

et al., 2018). On the other hand, it is crucial to select recognition elements with a high affinity for bacterial 

components or whole cells to ensure that detectable signals are generated, even at very low concentrations of 

the microorganism (Hoyos-Nogués et al., 2018). The development of new bioreceptors including aptamers 

offers higher specificity, which is a key advantage for detecting bacteria in complex matrices (Hianik, 2018). 

Aptamers are single short nucleic acids (NAs) sequences capable of binding specific molecules with high 

283

mailto:jose.ropero@udes.edu.co


affinity by folding into specific tertiary structures (Kinghorn et al., 2017). These molecules are commonly 

isolated by systematic evolution of ligands by exponential enrichment (SELEX), an evolutionary process in 

which successive rounds of selection and amplification are used to enrich a library of aptamers and create 

high-affinity aptamers (Wang et al., 2019). However, the selection of aptamers by this methodology is time-

consuming, complex, and expensive. Hence, bioinformatics tools are being used to improve the affinity quality 

of these elements (Kurup et al., 2021). 

A particular application to improve the efficiency of aptamer selections by computationally (in silico) methods 

is solving the three-dimensional structures of these NAs and their targets, and simulating the physical forces 

involved in the coupling to a target. Computational prediction of NAs secondary and tertiary structures and 

targets reveals the steric and energetic properties of each structure. These predictions allow modifying their 

selection groups to have a broader range of three-dimensional structures with more favorable free energy and 

provide essential information for molecular docking simulations. These simulations allow studying 

aptamer-target non-covalent interactions, including ionic interactions, hydrogen bonds, van der Waals forces, 

hydrophobic interactions, base stacking interactions, and shape complementarity. 

In silico technologies allow to obtain aptamers in a short time and reduce the costs involved in the 

development through SELEX. For this reason, in this work we report the design and evaluation of a new 

aptamer for the detection of E. coli in an electrochemical biosensor. Various NAs sequences reported in the 

literature were used, and their three-dimensional structures were modeled. The new designed aptamer 

(named Apt917) was synthesized and immobilized on gold nanoparticles-modified screen-printed electrodes 

and their sensitivity and specificity towards E. coli O157:H7 were evaluated. 

2. Experimental section 

2.1 Bioinformatic design of aptamers 

It was performed a search of scientific articles whose main objective was the detection of Escherichia coli by 

means of aptamer-based biosensors or the development of aptamers for the detection of E. coli. This 

bibliographic review was carried out in two databases: Scopus and Scielo (Scientific Electronic Library 

Online). The keywords used for the search were: aptamers, SELEX, biomarker, detection of Escherichia coli. 

The limit of detection (LOD), the dissociation constant (Kd), the strain of E. coli, the type of extracellular or 

intracellular target and type of measure used were considered. All the information was organized in a table to 

compare the results obtained from each of the articles reviewed. Aptamer sequences were used to obtain an 

alignment using the Clustal W algorithm and then distance trees were constructed to show common 

characteristics in the aptamer sequences. On the other hand, the sequences were analyzed using the free 

access program RNAfold Web server (v. 2.4.17) to identify the stability of the aptamers through the calculation 

of the free energy of each of the structures in two dimensions (2D) self-complementarity structure. The 

approach to the three-dimensional structure was developed using the free access program RNA composer 

(v. 1.0) (Antczak et al., 2017). Based on the sequences with the lowest dissociation constant and greater 

stability, a hybrid aptamer was designed considering the loops regions and performing base correction to 

increase stability. 

2.2 Preparation and characterization of the biosensors 

The biosensors were prepared on carbon-based screen-printed electrodes (SPEs, Italsens). The working 

electrodes of the SPEs were first modified by electrodeposition of gold nanoparticles (AuNPs) using 

chronoamperometry. For this, 100 µL of an aqueous solution of 1.0 mM of HAuCl4ˣH2O (≥99%, Sigma-Aldrich) 

in 0.5 M of H2SO4 were placed on the SPEs. Chronoamperometry was performed at -0.05 V vs. Ag/AgCl for 

100 s. The AuNPs-modified SPEs were rinsed with Type-I water (Jose Luis Ropero-Vega et al., 2021). The 

aptamer designed in the present work was synthesized with a thiol group at the 5' end (Macrogen, South 

Korea). Immobilization of the aptamer on the SPEs was performed by self-assembly on the AuNPs surface via 

Au-S bond formation. Briefly, 20 µL of a 20-100 nM aqueous solution of the aptamer were placed on SPEs 

and incubated overnight (16 h). The biosensors obtained were rinsed with Type-I water. The effect of the 

concentration of the aptamer in the solution to be immobilized toward E. coli detection was evaluated. 

Changes in the electrochemical response of SPEs during their modification were evaluated by electrochemical 

impedance spectroscopy (EIS) at a scan frequency between 50,000 to 1 Hz, the amplitude of 10 mV RMS and 

0 V vs. OCP (DC) by using an electrolytic solution of Fe[(CN)6]3-/4- couple (5 mM) and KCl (0.1 M). Surface 

characteristics of AuNPs-modified SPEs were studied by scanning electron microscopy (SEM) using a Quanta 

Field Emission Gun (Model 650) microscope operated at 15.0 kV. The images were obtained in secondary 

electron mode. 

284



2.3 Evaluation of the biosensors on the detection of Escherichia coli O157:H7 

E. coli O157:H7 (EC, ATCC 43895) was kept under cryopreservation at −80 °C in Luria Bertani broth (LBB, 

Merck) with 15% of glycerol. For the reactivation of the microorganism, 50 µL of cryopreserved material was 

added in 5 mL of LBB and incubated at 35±2 ºC from 18 to 24 h before each assay, adjusting the 

concentration at 1×108 CFU/mL in 0.9 % w/v of NaCl. Then, 7 mL of NaCl (0.9 % w/v) with known 

concentrations of EC (0 to 1000 CFU/mL) were placed in an appropriate beaker, and the biosensor was 

immersed. The system was incubated at 25 °C for 30 min and with constant stirring of 150 rpm. After that, the 

biosensor was rinsed with Type-I water prior to electrochemical measurements. The detection blank was 0.9 

% w/v of NaCl solution without bacteria (0 CFU/mL). EIS measurements were performed using the same 

conditions used for the characterization of the biosensor. Staphylococcus aureus (ATCC 25923) and 

Pseudomonas aeruginosa (ATCC 27853) were used as model microorganisms to evaluate the selectivity of 

the biosensor. Electrochemical measurements and evaluation of the biosensor were performed on a 

potentiostat/galvanostat VersaSTAT 3 (Princeton Applied Research) controlled by Versastudio (v. 2.60.6.) 

software. The interaction of EC with the surface of WE limits the electron-charge transfer between the redox 

probe and the transductor. This is reflected in an increase in the impedance of the electrode. In the case of a 

Nyquist diagram, it will be reflected in an increase in the diameter of the semicircle, as long as the 

electrochemical system behaves in accordance with the Randles circuit. In fact, from this circuit it is possible 

to calculate the resistance to charge transfer (Rct) on the electrode surface, whose values change 

proportionally with changes in the concentration of the microorganism. Thus, a normalized resistance change 

is calculated using equation 1 and whose numerical values are expected to be directly proportional to the 

concentration of the bacteria. 

∆𝑅𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑  =  
𝑅𝐴𝑝𝑡917+𝐸𝐶 − 𝑅𝐴𝑝𝑡

𝑅𝐴𝑝𝑡917
 (1) 

Where RApt917 is the Rct of the biosensor while RApt917+EC is the Rct of the biosensor in the presence of E. coli at 

a given concentration. 

3. Results and discussions 

3.1 Bioinformatic design of aptamers 

Data from 19 articles were organized to consider the dissociation constant (Kd), limit of detection (LOD), type 

of biosensor, and signal measured. These results are published in Mendeley Data repository (J.L. Ropero-

Vega et al., 2022). Aptamer sequences were between 32 and 88 nucleotides, one of them was reported as 

RNA sequence (Ec3), and seven recognized whole cell of E. coli O157:H7 strain. Alignment using whole 

aptamers sequences did not show a distribution pattern associated with E. coli strain, Kd, LOD, or molecular 

target. Despite the above, the S1 aptamer family (Table 1) was selected as a model for creating hybrid 

aptamer derivatives because they recognize the whole E. coli O157:H7 cells, have low Kd, a short length, and 

a high frequency of the structure with MFE. 

Table 1: Main parameters of some aptamer that recognize E. coli O157:H7 cells and hybrid aptamer. 

Aptamer 
Sequence 5’ – 3’ 

Dot-Bracket representation 
nt 

ΔGº 

[Kcal/mol] 

F** 

(%) 

Kd 

nM 

S1 
TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC* 

................(((.(((.....))).))).......... 
45 -3.51 22.75 10.33 

S2 
GCGGGAATAGGATGCGGCTGGAAGGAGAGGTGTTGGTGGGTGGTG 

((........(((((..((......))..)))))........)). 
45 -5.28 23.85 NR 

S3 
GTGCGGTGACGTGAGGGGGAGAGGCGTTGGTGTAGGCTGTTGGTG 

.((((.((((((...........)))))).))))........... 
45 -8.86 55.93 NR 

Apt517*** 
TTTTTACGTGGGTGGTGCGGCTGGAAGGAGAGGTTGA 

...((((....))))..(((((.........))))). 
37 -3.98 17.35 --- 

Apt917*** 
TTTTTACGTGAGGGGGAGAGGCGTGCGGCTGGAAGGAGAGGTTGA 

....(((((...........)))))(((((.........))))). 
45 -5.40 61.95 --- 

*Bold letters indicate external loop nucleotides. 

**Frequency of minimal free energy structure. 

***This work. 

 

Previous studies (Jayasena, 1999) have reported that larger aptamers are less selective and specific at the 

moment of detecting a target molecule. For this reason, hybrid aptamers were created without exceeding the 

number of nucleotides from S1. On the other hand, since the publication of SELEX technique (Tuerk & Gold, 

1990) the structure of loop conformations has been gained attention due to its relation with the potential sites 

285



to interact with a specific target. The selection of specific loops has been described to be helpful to detect 

whole cell of E. coli (Dua et al., 2016), and the presence of two external loops in the same aptamer could help 

to the target recognition as I-1 aptamer to E. coli O157:H7 (Lee et al., 2012). 

Different combinations of two sequences from the external loop from S1 family were used to build hybrid 

aptamers. Also, five thymines were added at the 5' end, which provides flexibility to the aptamers and could 

improve the density of them on the surface of the electrode (Balamurugan et al., 2008). Finally, a thymine-

guanine-adenine triplet was added at the 3' end to ensure base pairing and to improve the frequency of the 

MFE. With these considerations, two representative sequences were obtained and named Apt517 and Apt917 

(Table 1). Spatial 2D conformation of Apt517 and Apt917 were elucidated using an RNA approximation. Unlike 

S1 family, the new hybrids have two external loops. However, the minor loop conformation of Apt517 does not 

have the same free nucleotides as S1 model. This change was observed too when the external loop from the 

S2 aptamer was used in Apt917. Only the external loop from S3 aptamer remains in its structure in the new 

hybrid aptamer (Figure 1). Finally, Aptamer Apt917 was chosen to attach to working electrode of the biosensor 

due to its minimum free energy (MFE) and high percent to the frequency of MFE. 

 

Figure 1: RNA 2D representation of family aptamer S1 and hybrid aptamer designed in this work (Apt517 and 

Apt917). Blue nucleotides represent external loops, green complementary and orange nucleotides with 

random disposition. 

3.2 Electrochemical and structural characterization of the biosensors 

The surface of the working electrode of SPEs was modified by electrodeposition of gold nanoparticles 

(AuNPs) by chronoamperometry, and the results are shown in Figure 2a. This method leads to obtaining 

well-distributed nanoparticles on the surface with sizes around 60-90 nm (Figure 2a, insert). Figures 2b-d 

show the effect that each of the modifications made has on the impedance of the electrode represented in the 

Nyquist diagrams. As expected, it is clearly observed that the electrode impedance decreases considerably 

when the AuNPs are deposited (red curves) compared to the signal from the new electrode (black curves). 

This is evidenced by the decrease in the diameter of the semicircle. 

 

Figure 2: Current vs time response (a) in the chronoamperometric electrodeposition of AuNPs. Insert: SEM 

image of the AuNPs-modified surface of SPEs (scale bar 1 µm). EIS response of the biosensor by using 20 

nM (b), 50 nM (c) and 100 nM (d) of aqueous solutions of Apt917. Curves black, red and blue correspond to 

SPE, SPE/AuNPs and SPE/AuNPs/Apt917, respectively. 

For its part, the use of a concentration of aptamer of 20 nM does not clearly modify the impedance of the 

electrode (blue curve in Figure 2b). This can be attributed to the fact that this concentration is not sufficient to 

immobilize a considerable amount of the aptamer. On the other hand, the impedance of the electrode is 

increased when the concentrations of 50 and 100 nM are used (blue curves in Figure 2c-d), being notably 

higher at 100 nM. This effect is attributed to the immobilization of the aptamer on the gold nanoparticles. 

3.3 Evaluation of the biosensors on the detection of Escherichia coli O157:H7 

The prepared biosensors were evaluated in the detection of E. coli O157:H7 at concentrations between 0 and 

1000 CFU/mL, and the results are shown in Figure 3. The biosensor prepared with a 20 nM solution of the 

aptamer does not show changes in the electrochemical impedance signal when exposed to different 

concentrations of the microorganism (Figure 3a). This is attributed to the possible low or null amount of the 

286



aptamer on the surface of the electrode, which translates into a null sensitive response of the biosensor 

towards E. coli. Finally, this is evidenced by the fact that there is no correlation between the concentration of 

the microorganism and the quantified electrochemical signal (Figure 3b). 

 

Figure 3: Results of the evaluation of the Apt917-based biosensor. The effect of the concentration of aptamer 

was evaluated. The linearization of response of each biosensor is presented on bottom. 

The biosensor prepared with 50 nM of aptamer presented an adequate response since the electrochemical 

impedance signal increases as the concentration of E. coli increases (Figure 3c). It is important to mention 

that at low concentrations of E. coli, the biosensor presents an apparent linear response, as shown in the 

Figure 3d. Finally, the immobilization of aptamer is ensured when concentrations of 100 nM are used, but this 

results in a saturation of the surface of the electrode when interacting with the bacteria. This is reflected by the 

formation of two semicircles at concentrations above 100 CFU/mL (Figure 3d). Finally, this results that the 

electrode does not present a linear response between the measured signal and the concentration of E. coli in 

the matrix (Figure 3e). 

The estimated values of the limits of detection and quantification calculated for the biosensor prepared with 

50 nM of Apt917 are 8 and 27 CFU/mL, respectively. However, it is necessary to evaluate lower 

concentrations of the microorganism to carry out an adequate validation of the system. 

Preliminary tests were carried out to evaluate the specificity of the biosensor prepared with 50 nM of Apt917 

towards E. coli in the presence of other model microorganisms that may be present in water, such as 

Staphylococcus aureus and Pseudomonas aeruginosa. Concentrations of 50 and 100 CFU/mL of each 

microorganism were evaluated, and the results are presented in Figure 4. 

 

Figure 4: Results of the evaluation of the selectivity of biosensor towards E. coli. 

The difference in the electrochemical response of the biosensor (RNormalized) between the blank and S. aureus 

is not significant at a concentration of microorganisms of 50 CFU/mL. Considering that this microorganism is 

gram-positive, this indicates that the biosensor could differentiate this type of bacteria at low concentrations. In 

the case of P. aeruginosa, there is a significant difference with the E. coli response, but the biosensor is still 

capable of detecting the former, possibly related to this group of gram-negative bacteria. This is possible also 

considering that the aptamer has been designed to detect the whole E. coli, and not towards specific targets 

on the cell membrane. 

287



4. Conclusions 

An aptamer (named Apt917) was designed by bioinformatic tools based on sequences reported in the 

literature. Apt917 has two loops in its structure and can recognize whole cells of E. coli O157:H7. Apt917 was 

immobilized on gold nanoparticles-modified screen-printed electrodes. The electrochemical evaluation of the 

obtained biosensor shows that the device can be able to recognize E. coli at low concentrations. Also, the 

biosensor shows good specificity towards E. coli compared to a gram-positive bacterium such as S. aureus. 

However, at high concentrations of P. aeruginosa it is difficult to differentiate one or another microorganism. In 

any case, this two-loop aptamer-based system becomes an important basis for the subsequent design of new 

recognition molecules with increased specificity towards E. coli at low concentrations. 

Acknowledgments 

This research was supported by MINCIENCIAS under grant number CT 596-2018. 

References 

Albanese, D., Garofalo, F., Pilloton, R., Capo, S., & Malvano, F. (2019). Development of an antimicrobial peptide-

based biosensor for the monitoring of bacterial contaminations. Chemical Engineering Transactions, 75(July 

2018), 61–66. 

Antczak, M., Popenda, M., Zok, T., Sarzynska, J., Ratajczak, T., Tomczyk, K., Adamiak, R. W., & Szachniuk, M. 

(2017). New functionality of RNAComposer: application to shape the axis of miR160 precursor structure. Acta 

Biochimica Polonica, 63(4). 

Balamurugan, S., Obubuafo, A., McCarley, R. L., Soper, S. A., & Spivak, D. A. (2008). Effect of Linker Structure on 

Surface Density of Aptamer Monolayers and Their Corresponding Protein Binding Efficiency. Analytical 

Chemistry, 80(24), 9630–9634. 

Dua, P., Ren, S., Lee, S. W., Kim, J.-K., Shin, H., Jeong, O.-C., Kim, S., & Lee, D.-K. (2016). Cell-SELEX Based 

Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats. Molecules and 

Cells, 39(11), 807–813. 

Hianik, T. (2018). Aptamer-Based Biosensors. In Encyclopedia of Interfacial Chemistry (Issue January 2017, pp. 11–

19). Elsevier. 

Hoyos-Nogués, M., Gil, F. J., & Mas-Moruno, C. (2018). Antimicrobial Peptides: Powerful Biorecognition Elements to 

Detect Bacteria in Biosensing Technologies. Molecules, 23(7), 1683. 

Jayasena, S. D. (1999). Aptamers: An Emerging Class of Molecules That Rival Antibodies in Diagnostics. Clinical 

Chemistry, 45(9), 1628–1650. 

Justino, C. I. L., Freitas, A. C., Pereira, R., Duarte, A. C., & Rocha Santos, T. A. P. (2015). Recent developments in 

recognition elements for chemical sensors and biosensors. TrAC Trends in Analytical Chemistry, 68, 2–17. 

Kinghorn, A., Fraser, L., Liang, S., Shiu, S., & Tanner, J. (2017). Aptamer Bioinformatics. International Journal of 

Molecular Sciences, 18(12), 2516. 

Kurup, C. P., Tlili, C., Zakaria, S. N. A., & Ahmed, M. U. (2021). Recent Trends in Design and Development of 

Nanomaterial-based Aptasensors. Biointerface Research in Applied Chemistry, 11(6), 14057–14077. 

Lee, Y. J., Han, S. R., Maeng, J.-S., Cho, Y.-J., & Lee, S.-W. (2012). In vitro selection of Escherichia coli O157:H7-specific 

RNA aptamer. Biochemical and Biophysical Research Communications, 417(1), 414–420. 

Palomino-Camargo, C., & González-Muñoz, Y. (2014). Técnicas moleculares para la detección e identificación de 

patógenos en alimentos: ventajas y limitaciones. Revista Peruana de Medicina Experimental y Salud Pública, 

31(3), 535–546. 

Razmi, N., Hasanzadeh, M., Willander, M., & Nur, O. (2020). Recent Progress on the Electrochemical Biosensing of 

Escherichia coli O157:H7: Material and Methods Overview. Biosensors, 10(5), 54. 

Ropero-Vega, Jose Luis, Redondo-Ortega, J. F., Galvis-Curubo, Y. J., Rondón-Villarreal, P., & Flórez-Castillo, J. M. 

(2021). A Bioinspired Peptide in TIR Protein as Recognition Molecule on Electrochemical Biosensors for the 

Detection of E. coli O157:H7 in an Aqueous Matrix. Molecules, 26(9), 2559. 

Ropero-Vega, J.L., Albiares, L., Leon, W., Valdivieso-Quintero, W., & Flórez-Castillo, J. . (2022). Selected articles for 

the design of an aptamer “in silico” for the detection of E. coli. Mendeley Data, 1. 

doi.org/10.17632/XD3TXM9WWB.1 

Shoaie, N., Forouzandeh, M., & Omidfar, K. (2018). Highly Sensitive Electrochemical Biosensor Based on 

Polyaniline and Gold Nanoparticles for DNA Detection. IEEE Sensors Journal, 18(5), 1835–1843. 

Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to 

bacteriophage T4 DNA polymerase. Science (New York, N.Y.), 249(4968), 505–510. 

Wang, H., Zhao, Y., Bie, S., Suo, T., Jia, G., Liu, B., Ye, R., & Li, Z. (2019). Development of an Electrochemical 

Biosensor for Rapid and Effective Detection of Pathogenic Escherichia coli in Licorice Extract. Applied Sciences, 

9(2), 295. 

Zhao, Y.-W., Wang, H.-X., Jia, G.-C., & Li, Z. (2018). Application of Aptamer-Based Biosensor for Rapid Detection of 

Pathogenic Escherichia coli. Sensors, 18(8), 2518. 

288


	102roperovega.pdf
	Detection of Pathogenic E. Coli by Electrochemical Biosensors Based on Aptamers Designed by Bioinformatic Tools