Microsoft Word - cet-01.docx CHEMICAL ENGINEERING TRANSACTIONS VOL. 46, 2015 A publication of The Italian Association of Chemical Engineering Online at www.aidic.it/cet Guest Editors: Peiyu Ren, Yancang Li, Huiping Song Copyright © 2015, AIDIC Servizi S.r.l., ISBN 978-88-95608-37-2; ISSN 2283-9216 Repaid and Accurate Detection of Khuskia oryzae by Loop- mediated isothermal Amplification Combined with a Lateral Flow Dipstick Xiong Yun*a, Yang Haoa, Zhu Pengb, Huang Hailongb, He Qianqianc, Zhou Jiana a Dept. of Oil Application & Management Engineering, LEU, Chongqing 401311, China b Key Laboratory of Applied Marine Biotechnology, Ningbo University, Ningbo 315211, China c Academic section ,Logistics Academy，Beijing,100000,China xyun241@126.com Khuskia oryzae being as a contaminating fungus of jet fuel results in many damage. We have developed and valuated a repaid and accurate method for detection of Khuskia oryzae by loop- mediated isothermal amplification (LAMP) combined with a lateral flow dipstick (LFD).The result could be visualized by LFD within 10 min and did not rely on expensive experiment instrumentation. The detection limit of DNA of Khuskia oryzae by LAMP-LFD was 230fg/ul which was 10-fold more sensitive than LAMP and PCR methods.Khuskia oryzae could be specifically detected by LAMP-LFD, and no positive result could be observed when another 5 control genomic DNA were used. The whole process of detection by LAMP-LFD was 80 min which saved 90min compared to PCR method. The LAMP-LFD assay developed by this study was used for field detection and successfully detected Khuskia oryzae from the jet fuel samples. The LAMP combined with LFD makes the detection of Khuskia oryzae to be more simple, repaid and accurate, therefore, it will be a new tool for field detection. 1. Introduction Microbial contamination of jet fuel may cause great damage to the storage equipment and fuel system (Rauch et al 2006, Gaylarde 1991). Fungal contamination were the dominate reason for the biofilm existed in je t fuel which was the biggest threat to fly safe, for example ,the B-52 crash in 1958 (Rauch et al 2006)were directly caused by the plugging of an in-line fuel filter which attributed by the biofilm. In addition, the microbial contamination of jet fuel will not only result in huge economic losses, but also greatly increase the maintenance costs. Therefore, the microbial contamination of jet fuel has aroused widespread concern since 1960ˈs.The main methods for detection of contaminating microorganism were traditional methods based on cultivation (Ferrari et al 1998) and methods based on PCR (Raikos et al 2011). The tradition methods need the living microorganisms and time-consuming. Meanwhile, Sharkey F.H (2004) has indicated that only one percent of microbial in the environment including jet fuel has the identified. The methods based on PCR has been widely used for detection contaminating microorganism in jet fuel (Raikos et al 2011, Brown et al 2010). However, PCR methods requires a high technical skill and expensive equipments. Khuskia oryzae has been identified by the next-generation DNA sequencing (NGS) techniques which was used to analyze the microbiology diversity of the jet fuel.Khuskia oryzae accounts for 10.1% of contaminating fungi according to the result of NGS.Khuskia oryzae is an endophyte which could produce bioactive secondary metabolites and could be widely found in plant (Randa and Kamel 2013). The detection of Khuskia oryzae are also focused on tradition methods (Sempere and Santamarina 2006) and PCR methods (Silva et al 2008). The limitation of these methods for detection of Khuskia oryzae are the same as above. Loop- mediated isothermal amplification (LAMP) is a new method for the am plification of DNA which has been widely used for detection of fungi, bacteria and virus (Mori et al 2013). The LAMP did not rely on special and professional instruments, even a thermostat water bath could cover the requirement. The product of LAMP reaction are commonly analyzed by agarose gel electrophoresis. However, this method also needs special DOI: 10.3303/CET1546147 Please cite this article as: Xiong Y., Yang H., Zhu P., Huang H.L., He Q.Q., Zhou J., 2015, Repaid and accurate detection of khuskia oryzae by loop- mediated isothermal amplification combined with a lateral flow dipstick, Chemical Engineering Transactions, 46, 877-882 DOI:10.3303/CET1546147 877 instruments for agarose gel electrophoresis. In contrast, lateral flow dipstick (LFD) did not need any professional instruments and the process of detection just required 5-10 min compared to 45–60 min for gel electrophoresis (Wang 2013) .Therefor, the aim of this study is to develop a repaid and accurate methods for detection of Khuskia oryzae by the loop- mediated isothermal amplification (LAMP) combined a lateral flow dipstick (LFD). 2. Materials and Methods 2.1 Samples and DNA extraction Total 6 fungi strains Khuskia oryzae, Cladosporium resinae,Trichoderma viride, Aureobasidium pullulans, Penicllium restrictum and Aspergillus penicillioides were used in this study .All fungi were provided by China General Microbiological Culture Collection Center (CGMCC) and cultivated at 25℃ in Potato Dextrose Agar medium for 4d.The DNA of fungi were abstracted by the the General Genomic DNA extraction kit (Takara Biotechnology Co., Ltd) according to the manufacturer's instructions. The extracted DNA were stored at -20℃ until used. 2.2 Primer design Two sets of primers targeting the ITS (GenBank: FN435719.1) of Khuskia oryzae were designed using the PrimerExplorer V4 software (Table 1). The forward inner primer (FIP) of each primer sets was labeled with biotin at 5 ' end and the same position of loop primer (LF) was labeled with FITC. Table 1: Primers for detection of Khuskia oryzae used LAMP assay Primer Primer designation Sequence(5ˈ-3ˈ) K1-F3 Forward-outer primer GGTTCTGGCATCGATGAAGA K1-B3 Backward-outer prime AGAGGACTACTGCCACTCC K1-FIP Forward-inner primer (F1c +TTTT +F2) TGGGCGCAATGTGCGTTCAAACGCAGCGAAATGCGATA K1-BIP Backward-inner primer (B1c +TTTT +B2) CTAGTGGGCATGCCTGTTCGATACGGAGGCCGTAGAGTC K1-LF Loop-forward primer GATTCGATGATTCACTGAATTCTGC K1-LB Loop-backward primer TCAACCCCTAAGCACAGCTTAC K2-F3 Forward-outer primer GGTTCTGGCATCGATGAAGA K2-B3 Backward-outer prime AGAGGACTACTGCCACTCC K2-FIP Forward-inner primer (F1c +TTTT +F2) ATGGGCGCAATGTGCGTTCAACGCAGCGAAATGCGATA K2-BIP Backward-inner primer (B1c +TTTT +B2) TTCGAGCGTCATTTCAACCCCTCATTAGGGAACTACGGAGGC K2-LF Loop-forward primer GATTCGATGATTCACTGAATTCTGC K2-LB Loop-backward primer AGCACAGCTTACTGTTGGGAC 2.3 LAMP reaction The LAMP reaction was optimized comparing to Notomi(2000) that the reaction volume was 25μL, including 0.2 μM of each F3 and B3, 1.6 μM of each FIP and BIP, 0.8 μM of each LF and LB,0.8 M betaine, 10mM KCl,20mM Tris-HCl (PH 8.8) , 0.1% Tween 20,10 mM (NH4)2 SO4,8mM MgSO4,1.4mM dNTPs, 8U Bst DNA 878 and 2μL of template DNA. The negative control did not contain the template DNA which was replaced by ultrapure water.In order to determine the best reaction condition, the LAMP reaction was carried out at different temperature of 61,63 and 65℃ for 60min.The total LAMP reaction were monitored by Realtime Turbidimeter (Loopamp LA-320,Japan). 2.4 Sensitivity of LAMP assay Ten-fold serial dilutions (100–10−8) of DNA extracted from Khuskia oryzae were used as the template for LAMP reaction with the optimized condition described above. The LAMP reaction product was respectively detected and visualized by Realtime Turbidimeter (Loopamp LA-320, Japan) and LFD .In addition, the PCR method was also used as a control for LAMP-LFD. The PCR reaction were conducted in 50μl reaction mixture containing 2.5μl 10×buffer ,20μM of each K1-F3 and K1-B3,5U Ex Taq DNA polymerase(TaKaRa),2.5mM dNTPs and 3μl template of DNA. And the PCR reaction condition was as follows: 2 min at 94℃ ;1 min at 94°C ,1 min at 52°C , 2.5 minat 72°C, 35 cycles; 7.5 min at 72°C .The PCR reaction product was detected by electrophoresis on a 1 % agarose gel. 2.5 Specificity of LAMP assay The specificity of LAMP-LFD compared to PCR was evaluated using the template DNA abstracted from the 6 fungi strains at the condition described above. The LAMP reaction product was respectively detected and visualized by Realtime Turbidimeter (Loopamp LA-320, Japan) and LFD, while, the PCR reaction product was analyzed by 1% agarose gel electrophoresis. 2.6 Application of LAMP-LFD for field detection 12 jet fuel samples were collected from one army oil depot, and numbered 1 to 12. The DNA of samples were abstracted as above, then taken as template for the LAMP -LFD assay. 3. Results 3.1 Optimize the LAMP reaction condition and primers set The two sets of primers were applied for the LAMP reaction with the DNA of Khuskia oryzae at the condition of 61 (Fig.1 A), 63 (Fig,1 B) and 65℃ (Fig.1 C) for 60 min. The reaction were monitored by Realtime Turbidimeter. The LAMP reaction with primers set of K1 at 63℃ has the highest amplification efficiency and minimum threshold time (tm) compared to other reactions .Therefor, the best reaction c ondition of LAMP is 63℃ for 60min, and the optimum primers set is K1. Figure 1: LAMP reaction with the two primers sets at different temperatures. 879 3.2 LAMP reaction condition and primers set PCR, LAMP and LAMP-LFD reaction were carried out using the ten-fold serial dilutions of genomic DNA extracted from Khuskia oryzae as template. The LAMP assay could detected the template at 230fg/μl and 2.3pg/ μl respectively by LFD and Realtime Turbidimeter. The detection limit of PCR was 2.3pg/ μl .These results indicated that sensitivity of LAMP -LFD for detection of Khuskia oryzae was 10 time higher than LAMP and PCR. Figure 2: Sensitivity of LAMP-LFD (C) compared to LAMP (A) and PCR(B) for the detection of Khuskia oryzae genomic DNA.0-8: the serial dilutions of Khuskia oryzae genomic DNA from 100 to 10-8(23ng/μl to 0.23fg/μl) 3.3 Comparison of specificity between PCR, LAMP and LAMP-LFD The specificity of LAMP-LFD(Fig.3 C)for detection Khuskia oryzae was evaluated by comparing to LAMP (Fig.3 A) and PCR(Fig.3 B) using 5 fungi for control. The positive result of LAMP and LAMP -LFD were observed only when the template of Khuskia oryzae used, and the reactions with other template gave the negative results. 880 Figure 4: Specificity of LAMP-LFD (C)compared to LAMP (A)and PCR(B) for the detection of Khuskia oryzae genomic DNA .1-6: Khuskia oryzae, Cladosporium resinae, Trichoderma viride , Aureobasidium pullulans, Penicllium restrictum ,Aspergillus penicillioides. 3.4 Khuskia oryzae detection in jet fuel samples 12 jet fuel samples were used to test the application of LAMP-LFD assay for detection of Khuskia oryzae with field condition .The samples of 1, 2, 3, 6, 8, 10 and 11 were result in positive reaction, while, other of 12 samples and negative control have no amplification. Figure 5: Detecion of Khuskia oryzae in jet fuel samples with the LAMP-LFD. 4. Conclusions Microbial contamination, especially fungal contamination, of jet fuel has become a huge threat to storage and fly safe, and it will be more worse with the increase of storage time(Passman 2013).Khuskia oryzae has been identified from the jet fuel and being as one of the dominate contaminating fungi .The grow of Khuskia oryzae will attribute the formation of biofilm which has been verified to be a huge damage to airplane().The traditional methods for detection contaminating fungi (including Khuskia oryzae) were based on cultivation which required professional staff and aseptic laboratory. PCR methods compared to traditional methods has the advantage of repaid and no cultivation-based. However, PCR methods has its own limitation for requiring special and expensive instruments(Raikos et al 2011 and Silva et al 2008). The oil tank and fuel system could perfectly meet the requirements of microbial growth and reproduction with water, suitable temperature and nutrients, therefor, the detection of dominate contaminating fungi were important for storage and fly safe. Here we developed a LAMP-LFD for detection of ITS sequence of Khuskia 881 oryzae has shown its superiority in sensitivity, specificity and convenient .The reaction condition of LAMP was at 63℃ for 60min. The sensitivity of LAMP-LFD for detection DNA of Khuskia oryzae was 230fg/μl which 10 time higher than LAMP and PCR. Compared to 5 other fungi control, only Khuskia oryzae could be accurate detected by LAMP and LAMP-LFD.In contrast, only two primers applied in the PCR reaction result in the poor specificity. he whole detection process of LAMP-LFD was 1.5h compared to PCR for 2.5h. In addition, AMP- LFD did not rely on the expensive instruments, therefor, t could reduce testing costs. In conclusion, this LAMP-LFD assay developed in this study shown to be a rapid, accurate, and easy-to- perform method for detection of Khuskia oryzae in jet fuel. ur ultimate goal is like to conduct LAMP -LFD assay to be a new standard method for detection of dominate contaminating fungi of jet fuel .And the LAMP -LFD assay successfully applied in detection of Khuskia oryzae makes big step forward to this goal. Acknowledgments We are grateful to thank the Third Military Medical University of China for their cooperation and technical guidance during the study period. We are also grateful thankful to Miss. Wang for her help during the writing period. References Ferrari M.D., Neirotti E., Albornoz C., 1998, Occurrence of heterotrophic bacteria and fungi in an aviation fuel handling system and its relationship with fuel fouling.Revista Argentina De Microbiología, 30(3), 105 -114. Gaylarde C.C., Bento F.M., Kelley J., 1999, Microbial contamination of stored hydrocarbon fuels and its control. Revista De Microbiologia, 30(1), 01-10. Mori Y., Kanda H., Notomi T., 2013, Loop-mediated isothermal amplification (LAMP): recent progress in research and development.Journal of Infection and Chemotherapy, 19(3), 404-411. Notomi T., Okayama H., Masubuchi H., Yonekawa T., W atanabe K., Amino N., Hase T., 2000, Loop -mediated isothermal amplification of DNA.Nucleic Acids Research, 28(12), E63-E63. Passman F.J., 2013, Microbial contamination and its control in fuels and fuel systems since 1980 – a review. International Biodeterioration & Biodegradation, 81(5), 88-104. Raikos V., Vamvakas S.S., Kapolos J., Koliadima A., Karaiskakis G., 2011, Identification and characterization of microbial contaminants isolated from stored aviation fuels by DNA sequencing and restriction fragment length analysis of a PCR-amplified region of the 16s rRNA gene.Fuel, 90(2), 695–700. Randa A., Kamel S., 2013, Bioactive metabolites of the endophyte Khuskia oryzae isolated from the medicinal plant bidens bipinnata. Asian Journal of Pharmacy and Life Science, 3(3)137-145. Rauch M.E., Graef H.W., Rozenzhak S.M., Jones S.E., Bleckmann C.A., Kruger R.L., Naik R.R., Stone M.O., 2006, Characterization of microbial contamination in United States air force aviation fuel tanks. Journal of Industrial Microbiology & Biotechnology, 33(1), 29-36. Sempere F., Santamarina M.P., 2006, Microscopic and macroscopic study of the interaction between alternaria alternata (fr.) keissler andnigrospora oryzae (berk. & broome) petch. Annals of Microbiology, 56(2), 101-107. Sharkey F.H., Banat I.M., Marchant R., 2004, Detection and Quantification and Gene Expression in Environmental Bacteriology. App. and Environ. Microb. 70:3795-3806. Silva M.D., Passarini M.R.Z., Bonugli R.C., Sette L.D., 2008, Cnidarian-derived filamentous fungi from Brazil: isolation, characterization and rbbr decolourisation screening. Environmental Technology, 29(12), 1331- 1339. Wang X., Teng D., Guan Q., Tian F., W ang J., 2013, Detection of roundup ready soybean by loop-mediated isothermal amplification combined with a lateral-flow dipstick. Food Control, 29(1), 213-220. 882 file:///C:/Users/yhwhm/AppData/Local/Yodao/DeskDict/frame/20150804131808/javascript:void(0);