id	sid	tid	token	lemma	pos
cet-12545	1	1	doi	doi	NOUN
cet-12545	1	2	:	:	PUNCT
cet-12545	1	3	10.3303	10.3303	NUM
cet-12545	1	4	/	/	SYM
cet-12545	1	5	cet2293048	cet2293048	NOUN
cet-12545	1	6	paper	paper	NOUN
cet-12545	1	7	received	receive	VERB
cet-12545	1	8	:	:	PUNCT
cet-12545	1	9	19	19	NUM
cet-12545	1	10	january	january	PROPN
cet-12545	1	11	2022	2022	NUM
cet-12545	1	12	;	;	PUNCT
cet-12545	1	13	revised	revise	VERB
cet-12545	1	14	:	:	PUNCT
cet-12545	1	15	13	13	NUM
cet-12545	1	16	march	march	NOUN
cet-12545	1	17	2022	2022	NUM
cet-12545	1	18	;	;	PUNCT
cet-12545	1	19	accepted	accept	VERB
cet-12545	1	20	:	:	PUNCT
cet-12545	1	21	16	16	NUM
cet-12545	1	22	april	april	PROPN
cet-12545	1	23	2022	2022	NUM
cet-12545	1	24	please	please	INTJ
cet-12545	1	25	cite	cite	VERB
cet-12545	1	26	this	this	DET
cet-12545	1	27	article	article	NOUN
cet-12545	1	28	as	as	ADP
cet-12545	1	29	:	:	PUNCT
cet-12545	1	30	ropero	ropero	NOUN
cet-12545	1	31	-	-	PUNCT
cet-12545	1	32	vega	vega	PROPN
cet-12545	1	33	j.l	j.l	PROPN
cet-12545	1	34	.	.	PROPN
cet-12545	1	35	,	,	PUNCT
cet-12545	1	36	albiares	albiare	NOUN
cet-12545	1	37	-	-	PUNCT
cet-12545	1	38	sánchez	sánchez	PROPN
cet-12545	1	39	l.j	l.j	PROPN
cet-12545	1	40	.	.	PROPN
cet-12545	1	41	,	,	PUNCT
cet-12545	1	42	león	león	PROPN
cet-12545	1	43	-	-	PUNCT
cet-12545	1	44	sánchez	sánchez	PROPN
cet-12545	1	45	w.r	w.r	PROPN
cet-12545	1	46	.	.	PROPN
cet-12545	1	47	,	,	PUNCT
cet-12545	1	48	valdivieso	valdivieso	NOUN
cet-12545	1	49	-	-	PUNCT
cet-12545	1	50	quintero	quintero	PROPN
cet-12545	1	51	w.	w.	PROPN
cet-12545	1	52	,	,	PUNCT
cet-12545	1	53	flórez	flórez	PROPN
cet-12545	1	54	-	-	PUNCT
cet-12545	1	55	castillo	castillo	PROPN
cet-12545	1	56	j.m	j.m	PROPN
cet-12545	1	57	.	.	PROPN
cet-12545	1	58	,	,	PUNCT
cet-12545	1	59	2022	2022	NUM
cet-12545	1	60	,	,	PUNCT
cet-12545	1	61	detection	detection	NOUN
cet-12545	1	62	of	of	ADP
cet-12545	1	63	pathogenic	pathogenic	ADJ
cet-12545	1	64	e.	e.	PROPN
cet-12545	1	65	coli	coli	NOUN
cet-12545	1	66	by	by	ADP
cet-12545	1	67	electrochemical	electrochemical	ADJ
cet-12545	1	68	biosensors	biosensor	NOUN
cet-12545	1	69	based	base	VERB
cet-12545	1	70	on	on	ADP
cet-12545	1	71	aptamers	aptamer	NOUN
cet-12545	1	72	designed	design	VERB
cet-12545	1	73	by	by	ADP
cet-12545	1	74	bioinformatic	bioinformatic	ADJ
cet-12545	1	75	tools	tool	NOUN
cet-12545	1	76	,	,	PUNCT
cet-12545	1	77	chemical	chemical	ADJ
cet-12545	1	78	engineering	engineering	NOUN
cet-12545	1	79	transactions	transaction	NOUN
cet-12545	1	80	,	,	PUNCT
cet-12545	1	81	93	93	NUM
cet-12545	1	82	,	,	PUNCT
cet-12545	1	83	283	283	NUM
cet-12545	1	84	-	-	SYM
cet-12545	1	85	288	288	NUM
cet-12545	1	86	doi:10.3303	doi:10.3303	NOUN
cet-12545	1	87	/	/	SYM
cet-12545	1	88	cet2293048	cet2293048	NOUN
cet-12545	1	89	chemical	chemical	PROPN
cet-12545	1	90	engineering	engineering	NOUN
cet-12545	1	91	transactions	transaction	NOUN
cet-12545	1	92	vol	vol	NOUN
cet-12545	1	93	.	.	PUNCT
cet-12545	1	94	93	93	NUM
cet-12545	1	95	,	,	PUNCT
cet-12545	1	96	2022	2022	NUM
cet-12545	1	97	a	a	DET
cet-12545	1	98	publication	publication	NOUN
cet-12545	1	99	of	of	ADP
cet-12545	1	100	the	the	DET
cet-12545	1	101	italian	italian	ADJ
cet-12545	1	102	association	association	NOUN
cet-12545	1	103	of	of	ADP
cet-12545	1	104	chemical	chemical	PROPN
cet-12545	1	105	engineering	engineering	NOUN
cet-12545	1	106	online	online	ADV
cet-12545	1	107	at	at	ADP
cet-12545	1	108	www.cetjournal.it	www.cetjournal.it	PROPN
cet-12545	1	109	guest	guest	NOUN
cet-12545	1	110	editors	editor	NOUN
cet-12545	1	111	:	:	PUNCT
cet-12545	1	112	marco	marco	PROPN
cet-12545	1	113	bravi	bravi	PROPN
cet-12545	1	114	,	,	PUNCT
cet-12545	1	115	alberto	alberto	PROPN
cet-12545	1	116	brucato	brucato	PROPN
cet-12545	1	117	,	,	PUNCT
cet-12545	1	118	antonio	antonio	PROPN
cet-12545	1	119	marzocchella	marzocchella	NOUN
cet-12545	1	120	copyright	copyright	NOUN
cet-12545	1	121	©	©	PROPN
cet-12545	1	122	2022	2022	NUM
cet-12545	1	123	,	,	PUNCT
cet-12545	1	124	aidic	aidic	ADJ
cet-12545	1	125	servizi	servizi	PROPN
cet-12545	1	126	s.r.l	s.r.l	PROPN
cet-12545	1	127	.	.	PUNCT
cet-12545	2	1	isbn	isbn	ADJ
cet-12545	2	2	978	978	NUM
cet-12545	2	3	-	-	SYM
cet-12545	2	4	88	88	NUM
cet-12545	2	5	-	-	PUNCT
cet-12545	2	6	95608	95608	NUM
cet-12545	2	7	-	-	PUNCT
cet-12545	2	8	91	91	NUM
cet-12545	2	9	-	-	PUNCT
cet-12545	2	10	4	4	NUM
cet-12545	2	11	;	;	PUNCT
cet-12545	2	12	issn	issn	PROPN
cet-12545	2	13	2283	2283	NUM
cet-12545	2	14	-	-	SYM
cet-12545	2	15	9216	9216	NUM
cet-12545	2	16	detection	detection	NOUN
cet-12545	2	17	of	of	ADP
cet-12545	2	18	pathogenic	pathogenic	ADJ
cet-12545	2	19	e.	e.	PROPN
cet-12545	2	20	coli	coli	NOUN
cet-12545	2	21	by	by	ADP
cet-12545	2	22	electrochemical	electrochemical	ADJ
cet-12545	2	23	biosensors	biosensor	NOUN
cet-12545	2	24	based	base	VERB
cet-12545	2	25	on	on	ADP
cet-12545	2	26	aptamers	aptamer	NOUN
cet-12545	2	27	designed	design	VERB
cet-12545	2	28	by	by	ADP
cet-12545	2	29	bioinformatic	bioinformatic	ADJ
cet-12545	2	30	tools	tool	NOUN
cet-12545	2	31	jose	jose	PROPN
cet-12545	2	32	l.	l.	PROPN
cet-12545	2	33	ropero	ropero	PROPN
cet-12545	2	34	-	-	PUNCT
cet-12545	2	35	vega	vega	PROPN
cet-12545	2	36	*	*	PUNCT
cet-12545	2	37	,	,	PUNCT
cet-12545	2	38	leidy	leidy	VERB
cet-12545	2	39	j.	j.	PROPN
cet-12545	2	40	albiares	albiares	PROPN
cet-12545	2	41	-	-	PUNCT
cet-12545	2	42	sánchez	sánchez	PROPN
cet-12545	2	43	,	,	PUNCT
cet-12545	2	44	wendy	wendy	PROPN
cet-12545	2	45	r.	r.	PROPN
cet-12545	2	46	león	león	PROPN
cet-12545	2	47	-	-	PUNCT
cet-12545	2	48	sanchez	sanchez	PROPN
cet-12545	2	49	,	,	PUNCT
cet-12545	2	50	wilfredo	wilfredo	PROPN
cet-12545	2	51	valdivieso	valdivieso	PROPN
cet-12545	2	52	-	-	PUNCT
cet-12545	2	53	quintero	quintero	PROPN
cet-12545	2	54	,	,	PUNCT
cet-12545	2	55	johanna	johanna	PROPN
cet-12545	2	56	m.	m.	PROPN
cet-12545	2	57	flórez	flórez	PROPN
cet-12545	2	58	-	-	PUNCT
cet-12545	2	59	castillo	castillo	PROPN
cet-12545	2	60	universidad	universidad	PROPN
cet-12545	2	61	de	de	X
cet-12545	2	62	santander	santander	NOUN
cet-12545	2	63	.	.	PUNCT
cet-12545	3	1	facultad	facultad	PROPN
cet-12545	3	2	de	de	PROPN
cet-12545	3	3	ciencias	ciencias	PROPN
cet-12545	3	4	naturales	naturales	PROPN
cet-12545	3	5	.	.	PUNCT
cet-12545	4	1	ciencias	ciencias	PROPN
cet-12545	4	2	básicas	básicas	PROPN
cet-12545	4	3	y	y	PROPN
cet-12545	4	4	aplicadas	aplicadas	PROPN
cet-12545	4	5	para	para	PROPN
cet-12545	4	6	la	la	PROPN
cet-12545	4	7	sostenibilidad	sostenibilidad	PROPN
cet-12545	4	8	.	.	PUNCT
cet-12545	5	1	bucaramanga	bucaramanga	PROPN
cet-12545	5	2	,	,	PUNCT
cet-12545	5	3	colombia	colombia	PROPN
cet-12545	5	4	.	.	PUNCT
cet-12545	6	1	jose.ropero@udes.edu.co	jose.ropero@udes.edu.co	ADV
cet-12545	6	2	in	in	ADP
cet-12545	6	3	this	this	DET
cet-12545	6	4	work	work	NOUN
cet-12545	6	5	,	,	PUNCT
cet-12545	6	6	we	we	PRON
cet-12545	6	7	present	present	VERB
cet-12545	6	8	the	the	DET
cet-12545	6	9	in	in	ADP
cet-12545	6	10	-	-	PUNCT
cet-12545	6	11	silico	silico	NOUN
cet-12545	6	12	design	design	NOUN
cet-12545	6	13	of	of	ADP
cet-12545	6	14	a	a	DET
cet-12545	6	15	new	new	ADJ
cet-12545	6	16	aptamer	aptamer	NOUN
cet-12545	6	17	(	(	PUNCT
cet-12545	6	18	named	name	VERB
cet-12545	6	19	apt917	apt917	PROPN
cet-12545	6	20	)	)	PUNCT
cet-12545	6	21	capable	capable	ADJ
cet-12545	6	22	of	of	ADP
cet-12545	6	23	interacting	interact	VERB
cet-12545	6	24	with	with	ADP
cet-12545	6	25	e.	e.	PROPN
cet-12545	6	26	coli	coli	PROPN
cet-12545	6	27	and	and	CCONJ
cet-12545	6	28	its	its	PRON
cet-12545	6	29	evaluation	evaluation	NOUN
cet-12545	6	30	as	as	ADP
cet-12545	6	31	a	a	DET
cet-12545	6	32	recognition	recognition	NOUN
cet-12545	6	33	element	element	NOUN
cet-12545	6	34	in	in	ADP
cet-12545	6	35	electrochemical	electrochemical	ADJ
cet-12545	6	36	biosensors	biosensor	NOUN
cet-12545	6	37	.	.	PUNCT
cet-12545	7	1	a	a	DET
cet-12545	7	2	search	search	NOUN
cet-12545	7	3	and	and	CCONJ
cet-12545	7	4	bioinformatic	bioinformatic	ADJ
cet-12545	7	5	analysis	analysis	NOUN
cet-12545	7	6	of	of	ADP
cet-12545	7	7	various	various	ADJ
cet-12545	7	8	aptamers	aptamer	NOUN
cet-12545	7	9	reported	report	VERB
cet-12545	7	10	in	in	ADP
cet-12545	7	11	the	the	DET
cet-12545	7	12	literature	literature	NOUN
cet-12545	7	13	was	be	AUX
cet-12545	7	14	carried	carry	VERB
cet-12545	7	15	out	out	ADP
cet-12545	7	16	.	.	PUNCT
cet-12545	8	1	parameters	parameter	NOUN
cet-12545	8	2	such	such	ADJ
cet-12545	8	3	as	as	ADP
cet-12545	8	4	low	low	ADJ
cet-12545	8	5	dissociation	dissociation	NOUN
cet-12545	8	6	constant	constant	ADJ
cet-12545	8	7	and	and	CCONJ
cet-12545	8	8	short	short	ADJ
cet-12545	8	9	sequences	sequence	NOUN
cet-12545	8	10	were	be	AUX
cet-12545	8	11	considered	consider	VERB
cet-12545	8	12	to	to	PART
cet-12545	8	13	design	design	VERB
cet-12545	8	14	and	and	CCONJ
cet-12545	8	15	model	model	VERB
cet-12545	8	16	new	new	ADJ
cet-12545	8	17	hybrid	hybrid	ADJ
cet-12545	8	18	sequences	sequence	NOUN
cet-12545	8	19	.	.	PUNCT
cet-12545	9	1	the	the	DET
cet-12545	9	2	designed	design	VERB
cet-12545	9	3	apt917	apt917	NOUN
cet-12545	9	4	has	have	VERB
cet-12545	9	5	a	a	DET
cet-12545	9	6	minimum	minimum	ADJ
cet-12545	9	7	free	free	ADJ
cet-12545	9	8	energy	energy	NOUN
cet-12545	9	9	and	and	CCONJ
cet-12545	9	10	high	high	ADJ
cet-12545	9	11	percent	percent	NOUN
cet-12545	9	12	to	to	ADP
cet-12545	9	13	frequency	frequency	NOUN
cet-12545	9	14	,	,	PUNCT
cet-12545	9	15	making	make	VERB
cet-12545	9	16	it	it	PRON
cet-12545	9	17	promising	promise	VERB
cet-12545	9	18	compared	compare	VERB
cet-12545	9	19	to	to	ADP
cet-12545	9	20	the	the	DET
cet-12545	9	21	initial	initial	ADJ
cet-12545	9	22	ones	one	NOUN
cet-12545	9	23	.	.	PUNCT
cet-12545	10	1	apt917	apt917	NOUN
cet-12545	10	2	was	be	AUX
cet-12545	10	3	synthesized	synthesize	VERB
cet-12545	10	4	and	and	CCONJ
cet-12545	10	5	immobilized	immobilize	VERB
cet-12545	10	6	on	on	ADP
cet-12545	10	7	gold	gold	ADJ
cet-12545	10	8	nanoparticles	nanoparticle	NOUN
cet-12545	10	9	-	-	PUNCT
cet-12545	10	10	modified	modify	VERB
cet-12545	10	11	screen	screen	NOUN
cet-12545	10	12	-	-	PUNCT
cet-12545	10	13	printed	print	VERB
cet-12545	10	14	electrodes	electrode	NOUN
cet-12545	10	15	.	.	PUNCT
cet-12545	11	1	the	the	DET
cet-12545	11	2	evaluation	evaluation	NOUN
cet-12545	11	3	of	of	ADP
cet-12545	11	4	the	the	DET
cet-12545	11	5	obtained	obtain	VERB
cet-12545	11	6	biosensor	biosensor	NOUN
cet-12545	11	7	shows	show	VERB
cet-12545	11	8	a	a	DET
cet-12545	11	9	promising	promising	ADJ
cet-12545	11	10	detection	detection	NOUN
cet-12545	11	11	of	of	ADP
cet-12545	11	12	e.	e.	PROPN
cet-12545	11	13	coli	coli	PROPN
cet-12545	11	14	o157	o157	PROPN
cet-12545	11	15	:	:	PUNCT
cet-12545	11	16	h7	h7	NOUN
cet-12545	11	17	with	with	ADP
cet-12545	11	18	limits	limit	NOUN
cet-12545	11	19	of	of	ADP
cet-12545	11	20	detection	detection	NOUN
cet-12545	11	21	and	and	CCONJ
cet-12545	11	22	quantification	quantification	NOUN
cet-12545	11	23	of	of	ADP
cet-12545	11	24	8	8	NUM
cet-12545	11	25	and	and	CCONJ
cet-12545	11	26	27	27	NUM
cet-12545	11	27	cfu	cfu	NOUN
cet-12545	11	28	/	/	SYM
cet-12545	11	29	ml	ml	NOUN
cet-12545	11	30	,	,	PUNCT
cet-12545	11	31	respectively	respectively	ADV
cet-12545	11	32	.	.	PUNCT
cet-12545	12	1	1	1	X
cet-12545	12	2	.	.	X
cet-12545	12	3	introduction	introduction	NOUN
cet-12545	12	4	escherichia	escherichia	NOUN
cet-12545	12	5	coli	coli	NOUN
cet-12545	12	6	(	(	PUNCT
cet-12545	12	7	e.	e.	NOUN
cet-12545	12	8	coli	coli	PROPN
cet-12545	12	9	)	)	PUNCT
cet-12545	12	10	is	be	AUX
cet-12545	12	11	one	one	NUM
cet-12545	12	12	of	of	ADP
cet-12545	12	13	the	the	DET
cet-12545	12	14	most	most	ADV
cet-12545	12	15	widespread	widespread	ADJ
cet-12545	12	16	pathogenic	pathogenic	ADJ
cet-12545	12	17	bacteria	bacteria	NOUN
cet-12545	12	18	in	in	ADP
cet-12545	12	19	nature	nature	NOUN
cet-12545	12	20	and	and	CCONJ
cet-12545	12	21	it	it	PRON
cet-12545	12	22	has	have	AUX
cet-12545	12	23	been	be	AUX
cet-12545	12	24	recognized	recognize	VERB
cet-12545	12	25	that	that	SCONJ
cet-12545	12	26	some	some	DET
cet-12545	12	27	special	special	ADJ
cet-12545	12	28	serotypes	serotype	NOUN
cet-12545	12	29	of	of	ADP
cet-12545	12	30	this	this	DET
cet-12545	12	31	pathogen	pathogen	NOUN
cet-12545	12	32	can	can	AUX
cet-12545	12	33	produce	produce	VERB
cet-12545	12	34	enterotoxins	enterotoxin	NOUN
cet-12545	12	35	,	,	PUNCT
cet-12545	12	36	which	which	PRON
cet-12545	12	37	cause	cause	VERB
cet-12545	12	38	abdominal	abdominal	ADJ
cet-12545	12	39	pain	pain	NOUN
cet-12545	12	40	,	,	PUNCT
cet-12545	12	41	diarrhea	diarrhea	NOUN
cet-12545	12	42	,	,	PUNCT
cet-12545	12	43	inflammation	inflammation	NOUN
cet-12545	12	44	,	,	PUNCT
cet-12545	12	45	ulcers	ulcer	NOUN
cet-12545	12	46	,	,	PUNCT
cet-12545	12	47	and	and	CCONJ
cet-12545	12	48	even	even	ADV
cet-12545	12	49	severe	severe	ADJ
cet-12545	12	50	cases	case	NOUN
cet-12545	12	51	such	such	ADJ
cet-12545	12	52	as	as	ADP
cet-12545	12	53	hemorrhagic	hemorrhagic	NOUN
cet-12545	12	54	enteritis	enteritis	NOUN
cet-12545	12	55	(	(	PUNCT
cet-12545	12	56	zhao	zhao	PROPN
cet-12545	12	57	et	et	PROPN
cet-12545	12	58	al	al	PROPN
cet-12545	12	59	.	.	PROPN
cet-12545	12	60	,	,	PUNCT
cet-12545	12	61	2018	2018	NUM
cet-12545	12	62	)	)	PUNCT
cet-12545	12	63	.	.	PUNCT
cet-12545	13	1	therefore	therefore	ADV
cet-12545	13	2	,	,	PUNCT
cet-12545	13	3	the	the	DET
cet-12545	13	4	quantitative	quantitative	ADJ
cet-12545	13	5	detection	detection	NOUN
cet-12545	13	6	of	of	ADP
cet-12545	13	7	e.	e.	PROPN
cet-12545	13	8	coli	coli	PROPN
cet-12545	13	9	has	have	AUX
cet-12545	13	10	always	always	ADV
cet-12545	13	11	been	be	AUX
cet-12545	13	12	an	an	DET
cet-12545	13	13	essential	essential	ADJ
cet-12545	13	14	task	task	NOUN
cet-12545	13	15	in	in	ADP
cet-12545	13	16	the	the	DET
cet-12545	13	17	environment	environment	NOUN
cet-12545	13	18	,	,	PUNCT
cet-12545	13	19	medicine	medicine	NOUN
cet-12545	13	20	,	,	PUNCT
cet-12545	13	21	pharmaceutical	pharmaceutical	NOUN
cet-12545	13	22	industry	industry	NOUN
cet-12545	13	23	,	,	PUNCT
cet-12545	13	24	and	and	CCONJ
cet-12545	13	25	food	food	NOUN
cet-12545	13	26	safety	safety	NOUN
cet-12545	13	27	.	.	PUNCT
cet-12545	14	1	currently	currently	ADV
cet-12545	14	2	,	,	PUNCT
cet-12545	14	3	there	there	PRON
cet-12545	14	4	are	be	VERB
cet-12545	14	5	several	several	ADJ
cet-12545	14	6	detection	detection	NOUN
cet-12545	14	7	methods	method	NOUN
cet-12545	14	8	for	for	ADP
cet-12545	14	9	e.	e.	PROPN
cet-12545	14	10	coli	coli	PROPN
cet-12545	14	11	,	,	PUNCT
cet-12545	14	12	such	such	ADJ
cet-12545	14	13	as	as	ADP
cet-12545	14	14	culture	culture	NOUN
cet-12545	14	15	counts	count	NOUN
cet-12545	14	16	,	,	PUNCT
cet-12545	14	17	immunological	immunological	ADJ
cet-12545	14	18	detection	detection	NOUN
cet-12545	14	19	,	,	PUNCT
cet-12545	14	20	and	and	CCONJ
cet-12545	14	21	those	those	PRON
cet-12545	14	22	based	base	VERB
cet-12545	14	23	on	on	ADP
cet-12545	14	24	molecular	molecular	ADJ
cet-12545	14	25	biology	biology	NOUN
cet-12545	14	26	(	(	PUNCT
cet-12545	14	27	palomino	palomino	ADJ
cet-12545	14	28	-	-	PUNCT
cet-12545	14	29	camargo	camargo	PROPN
cet-12545	14	30	&	&	CCONJ
cet-12545	14	31	gonzález	gonzález	PROPN
cet-12545	14	32	-	-	PUNCT
cet-12545	14	33	muñoz	muñoz	PROPN
cet-12545	14	34	,	,	PUNCT
cet-12545	14	35	2014	2014	NUM
cet-12545	14	36	)	)	PUNCT
cet-12545	14	37	.	.	PUNCT
cet-12545	15	1	however	however	ADV
cet-12545	15	2	,	,	PUNCT
cet-12545	15	3	these	these	DET
cet-12545	15	4	methods	method	NOUN
cet-12545	15	5	have	have	VERB
cet-12545	15	6	drawbacks	drawback	NOUN
cet-12545	15	7	ranging	range	VERB
cet-12545	15	8	from	from	ADP
cet-12545	15	9	long	long	ADJ
cet-12545	15	10	times	time	NOUN
cet-12545	15	11	for	for	ADP
cet-12545	15	12	the	the	DET
cet-12545	15	13	confirmation	confirmation	NOUN
cet-12545	15	14	and	and	CCONJ
cet-12545	15	15	identification	identification	NOUN
cet-12545	15	16	of	of	ADP
cet-12545	15	17	the	the	DET
cet-12545	15	18	type	type	NOUN
cet-12545	15	19	of	of	ADP
cet-12545	15	20	microorganism	microorganism	NOUN
cet-12545	15	21	,	,	PUNCT
cet-12545	15	22	high	high	ADJ
cet-12545	15	23	costs	cost	NOUN
cet-12545	15	24	or	or	CCONJ
cet-12545	15	25	complexity	complexity	NOUN
cet-12545	15	26	in	in	ADP
cet-12545	15	27	the	the	DET
cet-12545	15	28	tests	test	NOUN
cet-12545	15	29	(	(	PUNCT
cet-12545	15	30	zhao	zhao	X
cet-12545	15	31	et	et	PROPN
cet-12545	15	32	al	al	PROPN
cet-12545	15	33	.	.	PROPN
cet-12545	15	34	,	,	PUNCT
cet-12545	15	35	2018	2018	NUM
cet-12545	15	36	)	)	PUNCT
cet-12545	15	37	.	.	PUNCT
cet-12545	16	1	considering	consider	VERB
cet-12545	16	2	the	the	DET
cet-12545	16	3	above	above	ADJ
cet-12545	16	4	,	,	PUNCT
cet-12545	16	5	there	there	PRON
cet-12545	16	6	is	be	VERB
cet-12545	16	7	a	a	DET
cet-12545	16	8	demand	demand	NOUN
cet-12545	16	9	for	for	ADP
cet-12545	16	10	fast	fast	ADJ
cet-12545	16	11	,	,	PUNCT
cet-12545	16	12	cost	cost	NOUN
cet-12545	16	13	-	-	PUNCT
cet-12545	16	14	effective	effective	ADJ
cet-12545	16	15	,	,	PUNCT
cet-12545	16	16	and	and	CCONJ
cet-12545	16	17	sensitive	sensitive	ADJ
cet-12545	16	18	methods	method	NOUN
cet-12545	16	19	to	to	PART
cet-12545	16	20	detect	detect	VERB
cet-12545	16	21	and	and	CCONJ
cet-12545	16	22	identify	identify	VERB
cet-12545	16	23	bacteria	bacteria	NOUN
cet-12545	16	24	or	or	CCONJ
cet-12545	16	25	their	their	PRON
cet-12545	16	26	components	component	NOUN
cet-12545	16	27	.	.	PUNCT
cet-12545	17	1	in	in	ADP
cet-12545	17	2	this	this	DET
cet-12545	17	3	sense	sense	NOUN
cet-12545	17	4	,	,	PUNCT
cet-12545	17	5	electrochemical	electrochemical	ADJ
cet-12545	17	6	biosensors	biosensor	NOUN
cet-12545	17	7	have	have	AUX
cet-12545	17	8	recently	recently	ADV
cet-12545	17	9	been	be	AUX
cet-12545	17	10	considered	consider	VERB
cet-12545	17	11	attractive	attractive	ADJ
cet-12545	17	12	options	option	NOUN
cet-12545	17	13	to	to	ADP
cet-12545	17	14	existing	exist	VERB
cet-12545	17	15	methods	method	NOUN
cet-12545	17	16	to	to	PART
cet-12545	17	17	detect	detect	VERB
cet-12545	17	18	pathogens	pathogen	NOUN
cet-12545	17	19	(	(	PUNCT
cet-12545	17	20	albanese	albanese	PROPN
cet-12545	17	21	et	et	PROPN
cet-12545	17	22	al	al	PROPN
cet-12545	17	23	.	.	PROPN
cet-12545	17	24	,	,	PUNCT
cet-12545	17	25	2019	2019	NUM
cet-12545	17	26	)	)	PUNCT
cet-12545	17	27	.	.	PUNCT
cet-12545	18	1	these	these	DET
cet-12545	18	2	biosensors	biosensor	NOUN
cet-12545	18	3	show	show	VERB
cet-12545	18	4	excellent	excellent	ADJ
cet-12545	18	5	characteristics	characteristic	NOUN
cet-12545	18	6	,	,	PUNCT
cet-12545	18	7	including	include	VERB
cet-12545	18	8	simplicity	simplicity	NOUN
cet-12545	18	9	,	,	PUNCT
cet-12545	18	10	specificity	specificity	NOUN
cet-12545	18	11	,	,	PUNCT
cet-12545	18	12	low	low	ADJ
cet-12545	18	13	detection	detection	NOUN
cet-12545	18	14	limit	limit	NOUN
cet-12545	18	15	,	,	PUNCT
cet-12545	18	16	simple	simple	ADJ
cet-12545	18	17	operation	operation	NOUN
cet-12545	18	18	,	,	PUNCT
cet-12545	18	19	cheap	cheap	ADJ
cet-12545	18	20	,	,	PUNCT
cet-12545	18	21	provide	provide	VERB
cet-12545	18	22	real	real	ADJ
cet-12545	18	23	-	-	PUNCT
cet-12545	18	24	time	time	NOUN
cet-12545	18	25	measurement	measurement	NOUN
cet-12545	18	26	,	,	PUNCT
cet-12545	18	27	portability	portability	NOUN
cet-12545	18	28	,	,	PUNCT
cet-12545	18	29	miniaturization	miniaturization	NOUN
cet-12545	18	30	,	,	PUNCT
cet-12545	18	31	and	and	CCONJ
cet-12545	18	32	rapid	rapid	ADJ
cet-12545	18	33	detection	detection	NOUN
cet-12545	18	34	(	(	PUNCT
cet-12545	18	35	razmi	razmi	ADV
cet-12545	18	36	et	et	PROPN
cet-12545	18	37	al	al	PROPN
cet-12545	18	38	.	.	PROPN
cet-12545	18	39	,	,	PUNCT
cet-12545	18	40	2020	2020	NUM
cet-12545	18	41	)	)	PUNCT
cet-12545	18	42	.	.	PUNCT
cet-12545	19	1	electrochemical	electrochemical	ADJ
cet-12545	19	2	biosensors	biosensor	NOUN
cet-12545	19	3	are	be	AUX
cet-12545	19	4	defined	define	VERB
cet-12545	19	5	as	as	ADP
cet-12545	19	6	analytical	analytical	ADJ
cet-12545	19	7	devices	device	NOUN
cet-12545	19	8	that	that	PRON
cet-12545	19	9	use	use	VERB
cet-12545	19	10	biological	biological	ADJ
cet-12545	19	11	/	/	SYM
cet-12545	19	12	biochemical	biochemical	ADJ
cet-12545	19	13	phenomena	phenomena	NOUN
cet-12545	19	14	for	for	ADP
cet-12545	19	15	the	the	DET
cet-12545	19	16	detection	detection	NOUN
cet-12545	19	17	of	of	ADP
cet-12545	19	18	target	target	NOUN
cet-12545	19	19	analytes	analyte	NOUN
cet-12545	19	20	,	,	PUNCT
cet-12545	19	21	based	base	VERB
cet-12545	19	22	on	on	ADP
cet-12545	19	23	interaction	interaction	NOUN
cet-12545	19	24	with	with	ADP
cet-12545	19	25	a	a	DET
cet-12545	19	26	bioelement	bioelement	NOUN
cet-12545	19	27	attached	attach	VERB
cet-12545	19	28	to	to	ADP
cet-12545	19	29	a	a	DET
cet-12545	19	30	transducer	transducer	NOUN
cet-12545	19	31	.	.	PUNCT
cet-12545	20	1	this	this	DET
cet-12545	20	2	transducer	transducer	NOUN
cet-12545	20	3	converts	convert	VERB
cet-12545	20	4	the	the	DET
cet-12545	20	5	biochemical	biochemical	ADJ
cet-12545	20	6	interaction	interaction	NOUN
cet-12545	20	7	into	into	ADP
cet-12545	20	8	a	a	DET
cet-12545	20	9	quantifiable	quantifiable	ADJ
cet-12545	20	10	electrical	electrical	ADJ
cet-12545	20	11	signal	signal	NOUN
cet-12545	20	12	(	(	PUNCT
cet-12545	20	13	justino	justino	PROPN
cet-12545	20	14	et	et	PROPN
cet-12545	20	15	al	al	PROPN
cet-12545	20	16	.	.	PROPN
cet-12545	20	17	,	,	PUNCT
cet-12545	20	18	2015	2015	NUM
cet-12545	20	19	)	)	PUNCT
cet-12545	20	20	.	.	PUNCT
cet-12545	21	1	in	in	ADP
cet-12545	21	2	recent	recent	ADJ
cet-12545	21	3	years	year	NOUN
cet-12545	21	4	,	,	PUNCT
cet-12545	21	5	electrochemical	electrochemical	ADJ
cet-12545	21	6	biosensors	biosensor	NOUN
cet-12545	21	7	with	with	ADP
cet-12545	21	8	different	different	ADJ
cet-12545	21	9	types	type	NOUN
cet-12545	21	10	of	of	ADP
cet-12545	21	11	transducers	transducer	NOUN
cet-12545	21	12	have	have	AUX
cet-12545	21	13	been	be	AUX
cet-12545	21	14	widely	widely	ADV
cet-12545	21	15	applied	apply	VERB
cet-12545	21	16	for	for	ADP
cet-12545	21	17	the	the	DET
cet-12545	21	18	detection	detection	NOUN
cet-12545	21	19	of	of	ADP
cet-12545	21	20	pathogenic	pathogenic	ADJ
cet-12545	21	21	bacteria	bacteria	NOUN
cet-12545	21	22	.	.	PUNCT
cet-12545	22	1	gold	gold	ADJ
cet-12545	22	2	nanoparticles	nanoparticle	NOUN
cet-12545	22	3	and	and	CCONJ
cet-12545	22	4	carbon	carbon	NOUN
cet-12545	22	5	nanostructures	nanostructure	NOUN
cet-12545	22	6	are	be	AUX
cet-12545	22	7	widely	widely	ADV
cet-12545	22	8	used	use	VERB
cet-12545	22	9	in	in	ADP
cet-12545	22	10	electrochemical	electrochemical	ADJ
cet-12545	22	11	transducers	transducer	NOUN
cet-12545	22	12	systems	system	NOUN
cet-12545	22	13	due	due	ADP
cet-12545	22	14	to	to	ADP
cet-12545	22	15	their	their	PRON
cet-12545	22	16	excellent	excellent	ADJ
cet-12545	22	17	stability	stability	NOUN
cet-12545	22	18	and	and	CCONJ
cet-12545	22	19	electron	electron	NOUN
cet-12545	22	20	transport	transport	NOUN
cet-12545	22	21	properties	property	NOUN
cet-12545	22	22	(	(	PUNCT
cet-12545	22	23	shoaie	shoaie	NOUN
cet-12545	22	24	et	et	PROPN
cet-12545	22	25	al	al	PROPN
cet-12545	22	26	.	.	PROPN
cet-12545	22	27	,	,	PUNCT
cet-12545	22	28	2018	2018	NUM
cet-12545	22	29	)	)	PUNCT
cet-12545	22	30	.	.	PUNCT
cet-12545	23	1	on	on	ADP
cet-12545	23	2	the	the	DET
cet-12545	23	3	other	other	ADJ
cet-12545	23	4	hand	hand	NOUN
cet-12545	23	5	,	,	PUNCT
cet-12545	23	6	it	it	PRON
cet-12545	23	7	is	be	AUX
cet-12545	23	8	crucial	crucial	ADJ
cet-12545	23	9	to	to	PART
cet-12545	23	10	select	select	VERB
cet-12545	23	11	recognition	recognition	NOUN
cet-12545	23	12	elements	element	NOUN
cet-12545	23	13	with	with	ADP
cet-12545	23	14	a	a	DET
cet-12545	23	15	high	high	ADJ
cet-12545	23	16	affinity	affinity	NOUN
cet-12545	23	17	for	for	ADP
cet-12545	23	18	bacterial	bacterial	ADJ
cet-12545	23	19	components	component	NOUN
cet-12545	23	20	or	or	CCONJ
cet-12545	23	21	whole	whole	ADJ
cet-12545	23	22	cells	cell	NOUN
cet-12545	23	23	to	to	PART
cet-12545	23	24	ensure	ensure	VERB
cet-12545	23	25	that	that	SCONJ
cet-12545	23	26	detectable	detectable	ADJ
cet-12545	23	27	signals	signal	NOUN
cet-12545	23	28	are	be	AUX
cet-12545	23	29	generated	generate	VERB
cet-12545	23	30	,	,	PUNCT
cet-12545	23	31	even	even	ADV
cet-12545	23	32	at	at	ADP
cet-12545	23	33	very	very	ADV
cet-12545	23	34	low	low	ADJ
cet-12545	23	35	concentrations	concentration	NOUN
cet-12545	23	36	of	of	ADP
cet-12545	23	37	the	the	DET
cet-12545	23	38	microorganism	microorganism	NOUN
cet-12545	23	39	(	(	PUNCT
cet-12545	23	40	hoyos	hoyos	PROPN
cet-12545	23	41	-	-	PUNCT
cet-12545	23	42	nogués	nogués	PROPN
cet-12545	23	43	et	et	PROPN
cet-12545	23	44	al	al	PROPN
cet-12545	23	45	.	.	PROPN
cet-12545	23	46	,	,	PUNCT
cet-12545	23	47	2018	2018	NUM
cet-12545	23	48	)	)	PUNCT
cet-12545	23	49	.	.	PUNCT
cet-12545	24	1	the	the	DET
cet-12545	24	2	development	development	NOUN
cet-12545	24	3	of	of	ADP
cet-12545	24	4	new	new	ADJ
cet-12545	24	5	bioreceptors	bioreceptor	NOUN
cet-12545	24	6	including	include	VERB
cet-12545	24	7	aptamers	aptamer	NOUN
cet-12545	24	8	offers	offer	VERB
cet-12545	24	9	higher	high	ADJ
cet-12545	24	10	specificity	specificity	NOUN
cet-12545	24	11	,	,	PUNCT
cet-12545	24	12	which	which	PRON
cet-12545	24	13	is	be	AUX
cet-12545	24	14	a	a	DET
cet-12545	24	15	key	key	ADJ
cet-12545	24	16	advantage	advantage	NOUN
cet-12545	24	17	for	for	ADP
cet-12545	24	18	detecting	detect	VERB
cet-12545	24	19	bacteria	bacteria	NOUN
cet-12545	24	20	in	in	ADP
cet-12545	24	21	complex	complex	ADJ
cet-12545	24	22	matrices	matrix	NOUN
cet-12545	24	23	(	(	PUNCT
cet-12545	24	24	hianik	hianik	NOUN
cet-12545	24	25	,	,	PUNCT
cet-12545	24	26	2018	2018	NUM
cet-12545	24	27	)	)	PUNCT
cet-12545	24	28	.	.	PUNCT
cet-12545	25	1	aptamers	aptamer	NOUN
cet-12545	25	2	are	be	AUX
cet-12545	25	3	single	single	ADJ
cet-12545	25	4	short	short	ADJ
cet-12545	25	5	nucleic	nucleic	ADJ
cet-12545	25	6	acids	acid	NOUN
cet-12545	25	7	(	(	PUNCT
cet-12545	25	8	nas	nas	NOUN
cet-12545	25	9	)	)	PUNCT
cet-12545	25	10	sequences	sequence	NOUN
cet-12545	25	11	capable	capable	ADJ
cet-12545	25	12	of	of	ADP
cet-12545	25	13	binding	bind	VERB
cet-12545	25	14	specific	specific	ADJ
cet-12545	25	15	molecules	molecule	NOUN
cet-12545	25	16	with	with	ADP
cet-12545	25	17	high	high	ADJ
cet-12545	25	18	283	283	NUM
cet-12545	25	19	mailto:jose.ropero@udes.edu.co	mailto:jose.ropero@udes.edu.co	ADJ
cet-12545	25	20	affinity	affinity	NOUN
cet-12545	25	21	by	by	ADP
cet-12545	25	22	folding	fold	VERB
cet-12545	25	23	into	into	ADP
cet-12545	25	24	specific	specific	ADJ
cet-12545	25	25	tertiary	tertiary	ADJ
cet-12545	25	26	structures	structure	NOUN
cet-12545	25	27	(	(	PUNCT
cet-12545	25	28	kinghorn	kinghorn	PROPN
cet-12545	25	29	et	et	PROPN
cet-12545	25	30	al	al	PROPN
cet-12545	25	31	.	.	PROPN
cet-12545	25	32	,	,	PUNCT
cet-12545	25	33	2017	2017	NUM
cet-12545	25	34	)	)	PUNCT
cet-12545	25	35	.	.	PUNCT
cet-12545	26	1	these	these	DET
cet-12545	26	2	molecules	molecule	NOUN
cet-12545	26	3	are	be	AUX
cet-12545	26	4	commonly	commonly	ADV
cet-12545	26	5	isolated	isolate	VERB
cet-12545	26	6	by	by	ADP
cet-12545	26	7	systematic	systematic	ADJ
cet-12545	26	8	evolution	evolution	NOUN
cet-12545	26	9	of	of	ADP
cet-12545	26	10	ligands	ligand	NOUN
cet-12545	26	11	by	by	ADP
cet-12545	26	12	exponential	exponential	ADJ
cet-12545	26	13	enrichment	enrichment	NOUN
cet-12545	26	14	(	(	PUNCT
cet-12545	26	15	selex	selex	NOUN
cet-12545	26	16	)	)	PUNCT
cet-12545	26	17	,	,	PUNCT
cet-12545	26	18	an	an	DET
cet-12545	26	19	evolutionary	evolutionary	ADJ
cet-12545	26	20	process	process	NOUN
cet-12545	26	21	in	in	ADP
cet-12545	26	22	which	which	PRON
cet-12545	26	23	successive	successive	ADJ
cet-12545	26	24	rounds	round	NOUN
cet-12545	26	25	of	of	ADP
cet-12545	26	26	selection	selection	NOUN
cet-12545	26	27	and	and	CCONJ
cet-12545	26	28	amplification	amplification	NOUN
cet-12545	26	29	are	be	AUX
cet-12545	26	30	used	use	VERB
cet-12545	26	31	to	to	PART
cet-12545	26	32	enrich	enrich	VERB
cet-12545	26	33	a	a	DET
cet-12545	26	34	library	library	NOUN
cet-12545	26	35	of	of	ADP
cet-12545	26	36	aptamers	aptamer	NOUN
cet-12545	26	37	and	and	CCONJ
cet-12545	26	38	create	create	VERB
cet-12545	26	39	high	high	ADJ
cet-12545	26	40	-	-	PUNCT
cet-12545	26	41	affinity	affinity	NOUN
cet-12545	26	42	aptamers	aptamer	NOUN
cet-12545	26	43	(	(	PUNCT
cet-12545	26	44	wang	wang	PROPN
cet-12545	26	45	et	et	PROPN
cet-12545	26	46	al	al	PROPN
cet-12545	26	47	.	.	PROPN
cet-12545	26	48	,	,	PUNCT
cet-12545	26	49	2019	2019	NUM
cet-12545	26	50	)	)	PUNCT
cet-12545	26	51	.	.	PUNCT
cet-12545	27	1	however	however	ADV
cet-12545	27	2	,	,	PUNCT
cet-12545	27	3	the	the	DET
cet-12545	27	4	selection	selection	NOUN
cet-12545	27	5	of	of	ADP
cet-12545	27	6	aptamers	aptamer	NOUN
cet-12545	27	7	by	by	ADP
cet-12545	27	8	this	this	DET
cet-12545	27	9	methodology	methodology	NOUN
cet-12545	27	10	is	be	AUX
cet-12545	27	11	timeconsuming	timeconsuming	ADJ
cet-12545	27	12	,	,	PUNCT
cet-12545	27	13	complex	complex	ADJ
cet-12545	27	14	,	,	PUNCT
cet-12545	27	15	and	and	CCONJ
cet-12545	27	16	expensive	expensive	ADJ
cet-12545	27	17	.	.	PUNCT
cet-12545	28	1	hence	hence	ADV
cet-12545	28	2	,	,	PUNCT
cet-12545	28	3	bioinformatics	bioinformatics	NOUN
cet-12545	28	4	tools	tool	NOUN
cet-12545	28	5	are	be	AUX
cet-12545	28	6	being	be	AUX
cet-12545	28	7	used	use	VERB
cet-12545	28	8	to	to	PART
cet-12545	28	9	improve	improve	VERB
cet-12545	28	10	the	the	DET
cet-12545	28	11	affinity	affinity	NOUN
cet-12545	28	12	quality	quality	NOUN
cet-12545	28	13	of	of	ADP
cet-12545	28	14	these	these	DET
cet-12545	28	15	elements	element	NOUN
cet-12545	28	16	(	(	PUNCT
cet-12545	28	17	kurup	kurup	VERB
cet-12545	28	18	et	et	PROPN
cet-12545	28	19	al	al	PROPN
cet-12545	28	20	.	.	PROPN
cet-12545	28	21	,	,	PUNCT
cet-12545	28	22	2021	2021	NUM
cet-12545	28	23	)	)	PUNCT
cet-12545	28	24	.	.	PUNCT
cet-12545	29	1	a	a	DET
cet-12545	29	2	particular	particular	ADJ
cet-12545	29	3	application	application	NOUN
cet-12545	29	4	to	to	PART
cet-12545	29	5	improve	improve	VERB
cet-12545	29	6	the	the	DET
cet-12545	29	7	efficiency	efficiency	NOUN
cet-12545	29	8	of	of	ADP
cet-12545	29	9	aptamer	aptamer	NOUN
cet-12545	29	10	selections	selection	NOUN
cet-12545	29	11	by	by	ADP
cet-12545	29	12	computationally	computationally	ADV
cet-12545	29	13	(	(	PUNCT
cet-12545	29	14	in	in	ADP
cet-12545	29	15	silico	silico	NOUN
cet-12545	29	16	)	)	PUNCT
cet-12545	29	17	methods	method	NOUN
cet-12545	29	18	is	be	AUX
cet-12545	29	19	solving	solve	VERB
cet-12545	29	20	the	the	DET
cet-12545	29	21	three	three	NUM
cet-12545	29	22	-	-	PUNCT
cet-12545	29	23	dimensional	dimensional	ADJ
cet-12545	29	24	structures	structure	NOUN
cet-12545	29	25	of	of	ADP
cet-12545	29	26	these	these	DET
cet-12545	29	27	nas	nas	NOUN
cet-12545	29	28	and	and	CCONJ
cet-12545	29	29	their	their	PRON
cet-12545	29	30	targets	target	NOUN
cet-12545	29	31	,	,	PUNCT
cet-12545	29	32	and	and	CCONJ
cet-12545	29	33	simulating	simulate	VERB
cet-12545	29	34	the	the	DET
cet-12545	29	35	physical	physical	ADJ
cet-12545	29	36	forces	force	NOUN
cet-12545	29	37	involved	involve	VERB
cet-12545	29	38	in	in	ADP
cet-12545	29	39	the	the	DET
cet-12545	29	40	coupling	coupling	NOUN
cet-12545	29	41	to	to	ADP
cet-12545	29	42	a	a	DET
cet-12545	29	43	target	target	NOUN
cet-12545	29	44	.	.	PUNCT
cet-12545	30	1	computational	computational	ADJ
cet-12545	30	2	prediction	prediction	NOUN
cet-12545	30	3	of	of	ADP
cet-12545	30	4	nas	nas	PROPN
cet-12545	30	5	secondary	secondary	ADJ
cet-12545	30	6	and	and	CCONJ
cet-12545	30	7	tertiary	tertiary	ADJ
cet-12545	30	8	structures	structure	NOUN
cet-12545	30	9	and	and	CCONJ
cet-12545	30	10	targets	target	NOUN
cet-12545	30	11	reveals	reveal	VERB
cet-12545	30	12	the	the	DET
cet-12545	30	13	steric	steric	ADJ
cet-12545	30	14	and	and	CCONJ
cet-12545	30	15	energetic	energetic	ADJ
cet-12545	30	16	properties	property	NOUN
cet-12545	30	17	of	of	ADP
cet-12545	30	18	each	each	DET
cet-12545	30	19	structure	structure	NOUN
cet-12545	30	20	.	.	PUNCT
cet-12545	31	1	these	these	DET
cet-12545	31	2	predictions	prediction	NOUN
cet-12545	31	3	allow	allow	VERB
cet-12545	31	4	modifying	modify	VERB
cet-12545	31	5	their	their	PRON
cet-12545	31	6	selection	selection	NOUN
cet-12545	31	7	groups	group	NOUN
cet-12545	31	8	to	to	PART
cet-12545	31	9	have	have	VERB
cet-12545	31	10	a	a	DET
cet-12545	31	11	broader	broad	ADJ
cet-12545	31	12	range	range	NOUN
cet-12545	31	13	of	of	ADP
cet-12545	31	14	three	three	NUM
cet-12545	31	15	-	-	PUNCT
cet-12545	31	16	dimensional	dimensional	ADJ
cet-12545	31	17	structures	structure	NOUN
cet-12545	31	18	with	with	ADP
cet-12545	31	19	more	more	ADV
cet-12545	31	20	favorable	favorable	ADJ
cet-12545	31	21	free	free	ADJ
cet-12545	31	22	energy	energy	NOUN
cet-12545	31	23	and	and	CCONJ
cet-12545	31	24	provide	provide	VERB
cet-12545	31	25	essential	essential	ADJ
cet-12545	31	26	information	information	NOUN
cet-12545	31	27	for	for	ADP
cet-12545	31	28	molecular	molecular	ADJ
cet-12545	31	29	docking	docking	NOUN
cet-12545	31	30	simulations	simulation	NOUN
cet-12545	31	31	.	.	PUNCT
cet-12545	32	1	these	these	DET
cet-12545	32	2	simulations	simulation	NOUN
cet-12545	32	3	allow	allow	VERB
cet-12545	32	4	studying	study	VERB
cet-12545	32	5	aptamer	aptamer	NOUN
cet-12545	32	6	-	-	PUNCT
cet-12545	32	7	target	target	NOUN
cet-12545	32	8	non	non	ADJ
cet-12545	32	9	-	-	ADJ
cet-12545	32	10	covalent	covalent	ADJ
cet-12545	32	11	interactions	interaction	NOUN
cet-12545	32	12	,	,	PUNCT
cet-12545	32	13	including	include	VERB
cet-12545	32	14	ionic	ionic	ADJ
cet-12545	32	15	interactions	interaction	NOUN
cet-12545	32	16	,	,	PUNCT
cet-12545	32	17	hydrogen	hydrogen	NOUN
cet-12545	32	18	bonds	bond	NOUN
cet-12545	32	19	,	,	PUNCT
cet-12545	32	20	van	van	PROPN
cet-12545	32	21	der	der	NOUN
cet-12545	32	22	waals	waal	NOUN
cet-12545	32	23	forces	force	NOUN
cet-12545	32	24	,	,	PUNCT
cet-12545	32	25	hydrophobic	hydrophobic	NOUN
cet-12545	32	26	interactions	interaction	NOUN
cet-12545	32	27	,	,	PUNCT
cet-12545	32	28	base	base	NOUN
cet-12545	32	29	stacking	stacking	NOUN
cet-12545	32	30	interactions	interaction	NOUN
cet-12545	32	31	,	,	PUNCT
cet-12545	32	32	and	and	CCONJ
cet-12545	32	33	shape	shape	VERB
cet-12545	32	34	complementarity	complementarity	NOUN
cet-12545	32	35	.	.	PUNCT
cet-12545	33	1	in	in	ADP
cet-12545	33	2	silico	silico	NOUN
cet-12545	33	3	technologies	technology	NOUN
cet-12545	33	4	allow	allow	VERB
cet-12545	33	5	to	to	PART
cet-12545	33	6	obtain	obtain	VERB
cet-12545	33	7	aptamers	aptamer	NOUN
cet-12545	33	8	in	in	ADP
cet-12545	33	9	a	a	DET
cet-12545	33	10	short	short	ADJ
cet-12545	33	11	time	time	NOUN
cet-12545	33	12	and	and	CCONJ
cet-12545	33	13	reduce	reduce	VERB
cet-12545	33	14	the	the	DET
cet-12545	33	15	costs	cost	NOUN
cet-12545	33	16	involved	involve	VERB
cet-12545	33	17	in	in	ADP
cet-12545	33	18	the	the	DET
cet-12545	33	19	development	development	NOUN
cet-12545	33	20	through	through	ADP
cet-12545	33	21	selex	selex	NOUN
cet-12545	33	22	.	.	PUNCT
cet-12545	34	1	for	for	ADP
cet-12545	34	2	this	this	DET
cet-12545	34	3	reason	reason	NOUN
cet-12545	34	4	,	,	PUNCT
cet-12545	34	5	in	in	ADP
cet-12545	34	6	this	this	DET
cet-12545	34	7	work	work	NOUN
cet-12545	34	8	we	we	PRON
cet-12545	34	9	report	report	VERB
cet-12545	34	10	the	the	DET
cet-12545	34	11	design	design	NOUN
cet-12545	34	12	and	and	CCONJ
cet-12545	34	13	evaluation	evaluation	NOUN
cet-12545	34	14	of	of	ADP
cet-12545	34	15	a	a	DET
cet-12545	34	16	new	new	ADJ
cet-12545	34	17	aptamer	aptamer	NOUN
cet-12545	34	18	for	for	ADP
cet-12545	34	19	the	the	DET
cet-12545	34	20	detection	detection	NOUN
cet-12545	34	21	of	of	ADP
cet-12545	34	22	e.	e.	PROPN
cet-12545	34	23	coli	coli	PROPN
cet-12545	34	24	in	in	ADP
cet-12545	34	25	an	an	DET
cet-12545	34	26	electrochemical	electrochemical	ADJ
cet-12545	34	27	biosensor	biosensor	NOUN
cet-12545	34	28	.	.	PUNCT
cet-12545	35	1	various	various	ADJ
cet-12545	35	2	nas	nas	PROPN
cet-12545	35	3	sequences	sequence	NOUN
cet-12545	35	4	reported	report	VERB
cet-12545	35	5	in	in	ADP
cet-12545	35	6	the	the	DET
cet-12545	35	7	literature	literature	NOUN
cet-12545	35	8	were	be	AUX
cet-12545	35	9	used	use	VERB
cet-12545	35	10	,	,	PUNCT
cet-12545	35	11	and	and	CCONJ
cet-12545	35	12	their	their	PRON
cet-12545	35	13	three	three	NUM
cet-12545	35	14	-	-	PUNCT
cet-12545	35	15	dimensional	dimensional	ADJ
cet-12545	35	16	structures	structure	NOUN
cet-12545	35	17	were	be	AUX
cet-12545	35	18	modeled	model	VERB
cet-12545	35	19	.	.	PUNCT
cet-12545	36	1	the	the	DET
cet-12545	36	2	new	new	ADJ
cet-12545	36	3	designed	design	VERB
cet-12545	36	4	aptamer	aptamer	NOUN
cet-12545	36	5	(	(	PUNCT
cet-12545	36	6	named	name	VERB
cet-12545	36	7	apt917	apt917	NOUN
cet-12545	36	8	)	)	PUNCT
cet-12545	36	9	was	be	AUX
cet-12545	36	10	synthesized	synthesize	VERB
cet-12545	36	11	and	and	CCONJ
cet-12545	36	12	immobilized	immobilize	VERB
cet-12545	36	13	on	on	ADP
cet-12545	36	14	gold	gold	ADJ
cet-12545	36	15	nanoparticles	nanoparticle	NOUN
cet-12545	36	16	-	-	PUNCT
cet-12545	36	17	modified	modify	VERB
cet-12545	36	18	screen	screen	NOUN
cet-12545	36	19	-	-	PUNCT
cet-12545	36	20	printed	print	VERB
cet-12545	36	21	electrodes	electrode	NOUN
cet-12545	36	22	and	and	CCONJ
cet-12545	36	23	their	their	PRON
cet-12545	36	24	sensitivity	sensitivity	NOUN
cet-12545	36	25	and	and	CCONJ
cet-12545	36	26	specificity	specificity	NOUN
cet-12545	36	27	towards	towards	ADP
cet-12545	36	28	e.	e.	PROPN
cet-12545	36	29	coli	coli	PROPN
cet-12545	36	30	o157	o157	PROPN
cet-12545	36	31	:	:	PUNCT
cet-12545	36	32	h7	h7	PROPN
cet-12545	36	33	were	be	AUX
cet-12545	36	34	evaluated	evaluate	VERB
cet-12545	36	35	.	.	PUNCT
cet-12545	37	1	2	2	X
cet-12545	37	2	.	.	X
cet-12545	37	3	experimental	experimental	ADJ
cet-12545	37	4	section	section	NOUN
cet-12545	37	5	2.1	2.1	NUM
cet-12545	37	6	bioinformatic	bioinformatic	ADJ
cet-12545	37	7	design	design	NOUN
cet-12545	37	8	of	of	ADP
cet-12545	37	9	aptamers	aptamer	NOUN
cet-12545	37	10	it	it	PRON
cet-12545	37	11	was	be	AUX
cet-12545	37	12	performed	perform	VERB
cet-12545	37	13	a	a	DET
cet-12545	37	14	search	search	NOUN
cet-12545	37	15	of	of	ADP
cet-12545	37	16	scientific	scientific	ADJ
cet-12545	37	17	articles	article	NOUN
cet-12545	37	18	whose	whose	DET
cet-12545	37	19	main	main	ADJ
cet-12545	37	20	objective	objective	NOUN
cet-12545	37	21	was	be	AUX
cet-12545	37	22	the	the	DET
cet-12545	37	23	detection	detection	NOUN
cet-12545	37	24	of	of	ADP
cet-12545	37	25	escherichia	escherichia	NOUN
cet-12545	37	26	coli	coli	NOUN
cet-12545	37	27	by	by	ADP
cet-12545	37	28	means	mean	NOUN
cet-12545	37	29	of	of	ADP
cet-12545	37	30	aptamer	aptamer	NOUN
cet-12545	37	31	-	-	PUNCT
cet-12545	37	32	based	base	VERB
cet-12545	37	33	biosensors	biosensor	NOUN
cet-12545	37	34	or	or	CCONJ
cet-12545	37	35	the	the	DET
cet-12545	37	36	development	development	NOUN
cet-12545	37	37	of	of	ADP
cet-12545	37	38	aptamers	aptamer	NOUN
cet-12545	37	39	for	for	ADP
cet-12545	37	40	the	the	DET
cet-12545	37	41	detection	detection	NOUN
cet-12545	37	42	of	of	ADP
cet-12545	37	43	e.	e.	PROPN
cet-12545	37	44	coli	coli	PROPN
cet-12545	37	45	.	.	PUNCT
cet-12545	38	1	this	this	DET
cet-12545	38	2	bibliographic	bibliographic	ADJ
cet-12545	38	3	review	review	NOUN
cet-12545	38	4	was	be	AUX
cet-12545	38	5	carried	carry	VERB
cet-12545	38	6	out	out	ADP
cet-12545	38	7	in	in	ADP
cet-12545	38	8	two	two	NUM
cet-12545	38	9	databases	database	NOUN
cet-12545	38	10	:	:	PUNCT
cet-12545	38	11	scopus	scopus	NOUN
cet-12545	38	12	and	and	CCONJ
cet-12545	38	13	scielo	scielo	PROPN
cet-12545	38	14	(	(	PUNCT
cet-12545	38	15	scientific	scientific	ADJ
cet-12545	38	16	electronic	electronic	ADJ
cet-12545	38	17	library	library	NOUN
cet-12545	38	18	online	online	ADV
cet-12545	38	19	)	)	PUNCT
cet-12545	38	20	.	.	PUNCT
cet-12545	39	1	the	the	DET
cet-12545	39	2	keywords	keyword	NOUN
cet-12545	39	3	used	use	VERB
cet-12545	39	4	for	for	ADP
cet-12545	39	5	the	the	DET
cet-12545	39	6	search	search	NOUN
cet-12545	39	7	were	be	AUX
cet-12545	39	8	:	:	PUNCT
cet-12545	39	9	aptamers	aptamer	NOUN
cet-12545	39	10	,	,	PUNCT
cet-12545	39	11	selex	selex	NOUN
cet-12545	39	12	,	,	PUNCT
cet-12545	39	13	biomarker	biomarker	NOUN
cet-12545	39	14	,	,	PUNCT
cet-12545	39	15	detection	detection	NOUN
cet-12545	39	16	of	of	ADP
cet-12545	39	17	escherichia	escherichia	NOUN
cet-12545	39	18	coli	coli	NOUN
cet-12545	39	19	.	.	PUNCT
cet-12545	40	1	the	the	DET
cet-12545	40	2	limit	limit	NOUN
cet-12545	40	3	of	of	ADP
cet-12545	40	4	detection	detection	NOUN
cet-12545	40	5	(	(	PUNCT
cet-12545	40	6	lod	lod	PROPN
cet-12545	40	7	)	)	PUNCT
cet-12545	40	8	,	,	PUNCT
cet-12545	40	9	the	the	DET
cet-12545	40	10	dissociation	dissociation	NOUN
cet-12545	40	11	constant	constant	ADJ
cet-12545	40	12	(	(	PUNCT
cet-12545	40	13	kd	kd	PROPN
cet-12545	40	14	)	)	PUNCT
cet-12545	40	15	,	,	PUNCT
cet-12545	40	16	the	the	DET
cet-12545	40	17	strain	strain	NOUN
cet-12545	40	18	of	of	ADP
cet-12545	40	19	e.	e.	PROPN
cet-12545	40	20	coli	coli	PROPN
cet-12545	40	21	,	,	PUNCT
cet-12545	40	22	the	the	DET
cet-12545	40	23	type	type	NOUN
cet-12545	40	24	of	of	ADP
cet-12545	40	25	extracellular	extracellular	ADJ
cet-12545	40	26	or	or	CCONJ
cet-12545	40	27	intracellular	intracellular	ADJ
cet-12545	40	28	target	target	NOUN
cet-12545	40	29	and	and	CCONJ
cet-12545	40	30	type	type	NOUN
cet-12545	40	31	of	of	ADP
cet-12545	40	32	measure	measure	NOUN
cet-12545	40	33	used	use	VERB
cet-12545	40	34	were	be	AUX
cet-12545	40	35	considered	consider	VERB
cet-12545	40	36	.	.	PUNCT
cet-12545	41	1	all	all	DET
cet-12545	41	2	the	the	DET
cet-12545	41	3	information	information	NOUN
cet-12545	41	4	was	be	AUX
cet-12545	41	5	organized	organize	VERB
cet-12545	41	6	in	in	ADP
cet-12545	41	7	a	a	DET
cet-12545	41	8	table	table	NOUN
cet-12545	41	9	to	to	PART
cet-12545	41	10	compare	compare	VERB
cet-12545	41	11	the	the	DET
cet-12545	41	12	results	result	NOUN
cet-12545	41	13	obtained	obtain	VERB
cet-12545	41	14	from	from	ADP
cet-12545	41	15	each	each	PRON
cet-12545	41	16	of	of	ADP
cet-12545	41	17	the	the	DET
cet-12545	41	18	articles	article	NOUN
cet-12545	41	19	reviewed	review	VERB
cet-12545	41	20	.	.	PUNCT
cet-12545	42	1	aptamer	aptamer	NOUN
cet-12545	42	2	sequences	sequence	NOUN
cet-12545	42	3	were	be	AUX
cet-12545	42	4	used	use	VERB
cet-12545	42	5	to	to	PART
cet-12545	42	6	obtain	obtain	VERB
cet-12545	42	7	an	an	DET
cet-12545	42	8	alignment	alignment	NOUN
cet-12545	42	9	using	use	VERB
cet-12545	42	10	the	the	DET
cet-12545	42	11	clustal	clustal	ADJ
cet-12545	42	12	w	w	NOUN
cet-12545	42	13	algorithm	algorithm	NOUN
cet-12545	42	14	and	and	CCONJ
cet-12545	42	15	then	then	ADV
cet-12545	42	16	distance	distance	NOUN
cet-12545	42	17	trees	tree	NOUN
cet-12545	42	18	were	be	AUX
cet-12545	42	19	constructed	construct	VERB
cet-12545	42	20	to	to	PART
cet-12545	42	21	show	show	VERB
cet-12545	42	22	common	common	ADJ
cet-12545	42	23	characteristics	characteristic	NOUN
cet-12545	42	24	in	in	ADP
cet-12545	42	25	the	the	DET
cet-12545	42	26	aptamer	aptamer	NOUN
cet-12545	42	27	sequences	sequence	NOUN
cet-12545	42	28	.	.	PUNCT
cet-12545	43	1	on	on	ADP
cet-12545	43	2	the	the	DET
cet-12545	43	3	other	other	ADJ
cet-12545	43	4	hand	hand	NOUN
cet-12545	43	5	,	,	PUNCT
cet-12545	43	6	the	the	DET
cet-12545	43	7	sequences	sequence	NOUN
cet-12545	43	8	were	be	AUX
cet-12545	43	9	analyzed	analyze	VERB
cet-12545	43	10	using	use	VERB
cet-12545	43	11	the	the	DET
cet-12545	43	12	free	free	ADJ
cet-12545	43	13	access	access	NOUN
cet-12545	43	14	program	program	NOUN
cet-12545	43	15	rnafold	rnafold	PROPN
cet-12545	43	16	web	web	NOUN
cet-12545	43	17	server	server	NOUN
cet-12545	43	18	(	(	PUNCT
cet-12545	43	19	v.	v.	PROPN
cet-12545	43	20	2.4.17	2.4.17	NUM
cet-12545	43	21	)	)	PUNCT
cet-12545	43	22	to	to	PART
cet-12545	43	23	identify	identify	VERB
cet-12545	43	24	the	the	DET
cet-12545	43	25	stability	stability	NOUN
cet-12545	43	26	of	of	ADP
cet-12545	43	27	the	the	DET
cet-12545	43	28	aptamers	aptamer	NOUN
cet-12545	43	29	through	through	ADP
cet-12545	43	30	the	the	DET
cet-12545	43	31	calculation	calculation	NOUN
cet-12545	43	32	of	of	ADP
cet-12545	43	33	the	the	DET
cet-12545	43	34	free	free	ADJ
cet-12545	43	35	energy	energy	NOUN
cet-12545	43	36	of	of	ADP
cet-12545	43	37	each	each	PRON
cet-12545	43	38	of	of	ADP
cet-12545	43	39	the	the	DET
cet-12545	43	40	structures	structure	NOUN
cet-12545	43	41	in	in	ADP
cet-12545	43	42	two	two	NUM
cet-12545	43	43	dimensions	dimension	NOUN
cet-12545	43	44	(	(	PUNCT
cet-12545	43	45	2d	2d	NOUN
cet-12545	43	46	)	)	PUNCT
cet-12545	43	47	self	self	NOUN
cet-12545	43	48	-	-	PUNCT
cet-12545	43	49	complementarity	complementarity	NOUN
cet-12545	43	50	structure	structure	NOUN
cet-12545	43	51	.	.	PUNCT
cet-12545	44	1	the	the	DET
cet-12545	44	2	approach	approach	NOUN
cet-12545	44	3	to	to	ADP
cet-12545	44	4	the	the	DET
cet-12545	44	5	three	three	NUM
cet-12545	44	6	-	-	PUNCT
cet-12545	44	7	dimensional	dimensional	ADJ
cet-12545	44	8	structure	structure	NOUN
cet-12545	44	9	was	be	AUX
cet-12545	44	10	developed	develop	VERB
cet-12545	44	11	using	use	VERB
cet-12545	44	12	the	the	DET
cet-12545	44	13	free	free	ADJ
cet-12545	44	14	access	access	NOUN
cet-12545	44	15	program	program	NOUN
cet-12545	44	16	rna	rna	NOUN
cet-12545	44	17	composer	composer	NOUN
cet-12545	44	18	(	(	PUNCT
cet-12545	44	19	v.	v.	ADP
cet-12545	44	20	1.0	1.0	NUM
cet-12545	44	21	)	)	PUNCT
cet-12545	44	22	(	(	PUNCT
cet-12545	44	23	antczak	antczak	PROPN
cet-12545	44	24	et	et	PROPN
cet-12545	44	25	al	al	PROPN
cet-12545	44	26	.	.	PROPN
cet-12545	44	27	,	,	PUNCT
cet-12545	44	28	2017	2017	NUM
cet-12545	44	29	)	)	PUNCT
cet-12545	44	30	.	.	PUNCT
cet-12545	45	1	based	base	VERB
cet-12545	45	2	on	on	ADP
cet-12545	45	3	the	the	DET
cet-12545	45	4	sequences	sequence	NOUN
cet-12545	45	5	with	with	ADP
cet-12545	45	6	the	the	DET
cet-12545	45	7	lowest	low	ADJ
cet-12545	45	8	dissociation	dissociation	NOUN
cet-12545	45	9	constant	constant	ADJ
cet-12545	45	10	and	and	CCONJ
cet-12545	45	11	greater	great	ADJ
cet-12545	45	12	stability	stability	NOUN
cet-12545	45	13	,	,	PUNCT
cet-12545	45	14	a	a	DET
cet-12545	45	15	hybrid	hybrid	ADJ
cet-12545	45	16	aptamer	aptamer	NOUN
cet-12545	45	17	was	be	AUX
cet-12545	45	18	designed	design	VERB
cet-12545	45	19	considering	consider	VERB
cet-12545	45	20	the	the	DET
cet-12545	45	21	loops	loop	NOUN
cet-12545	45	22	regions	region	NOUN
cet-12545	45	23	and	and	CCONJ
cet-12545	45	24	performing	perform	VERB
cet-12545	45	25	base	base	NOUN
cet-12545	45	26	correction	correction	NOUN
cet-12545	45	27	to	to	PART
cet-12545	45	28	increase	increase	VERB
cet-12545	45	29	stability	stability	NOUN
cet-12545	45	30	.	.	PUNCT
cet-12545	46	1	2.2	2.2	NUM
cet-12545	46	2	preparation	preparation	NOUN
cet-12545	46	3	and	and	CCONJ
cet-12545	46	4	characterization	characterization	NOUN
cet-12545	46	5	of	of	ADP
cet-12545	46	6	the	the	DET
cet-12545	46	7	biosensors	biosensor	NOUN
cet-12545	46	8	the	the	DET
cet-12545	46	9	biosensors	biosensor	NOUN
cet-12545	46	10	were	be	AUX
cet-12545	46	11	prepared	prepare	VERB
cet-12545	46	12	on	on	ADP
cet-12545	46	13	carbon	carbon	NOUN
cet-12545	46	14	-	-	PUNCT
cet-12545	46	15	based	base	VERB
cet-12545	46	16	screen	screen	NOUN
cet-12545	46	17	-	-	PUNCT
cet-12545	46	18	printed	print	VERB
cet-12545	46	19	electrodes	electrode	NOUN
cet-12545	46	20	(	(	PUNCT
cet-12545	46	21	spes	spe	NOUN
cet-12545	46	22	,	,	PUNCT
cet-12545	46	23	italsens	italsen	NOUN
cet-12545	46	24	)	)	PUNCT
cet-12545	46	25	.	.	PUNCT
cet-12545	47	1	the	the	DET
cet-12545	47	2	working	work	VERB
cet-12545	47	3	electrodes	electrode	NOUN
cet-12545	47	4	of	of	ADP
cet-12545	47	5	the	the	DET
cet-12545	47	6	spes	spe	NOUN
cet-12545	47	7	were	be	AUX
cet-12545	47	8	first	first	ADV
cet-12545	47	9	modified	modify	VERB
cet-12545	47	10	by	by	ADP
cet-12545	47	11	electrodeposition	electrodeposition	NOUN
cet-12545	47	12	of	of	ADP
cet-12545	47	13	gold	gold	ADJ
cet-12545	47	14	nanoparticles	nanoparticle	NOUN
cet-12545	47	15	(	(	PUNCT
cet-12545	47	16	aunps	aunps	ADJ
cet-12545	47	17	)	)	PUNCT
cet-12545	47	18	using	use	VERB
cet-12545	47	19	chronoamperometry	chronoamperometry	NOUN
cet-12545	47	20	.	.	PUNCT
cet-12545	48	1	for	for	ADP
cet-12545	48	2	this	this	PRON
cet-12545	48	3	,	,	PUNCT
cet-12545	48	4	100	100	NUM
cet-12545	48	5	µl	µl	NOUN
cet-12545	48	6	of	of	ADP
cet-12545	48	7	an	an	DET
cet-12545	48	8	aqueous	aqueous	ADJ
cet-12545	48	9	solution	solution	NOUN
cet-12545	48	10	of	of	ADP
cet-12545	48	11	1.0	1.0	NUM
cet-12545	48	12	mm	mm	NOUN
cet-12545	48	13	of	of	ADP
cet-12545	48	14	haucl4ˣh2o	haucl4ˣh2o	NOUN
cet-12545	48	15	(	(	PUNCT
cet-12545	48	16	≥99	≥99	NUM
cet-12545	48	17	%	%	NOUN
cet-12545	48	18	,	,	PUNCT
cet-12545	48	19	sigma	sigma	PROPN
cet-12545	48	20	-	-	PUNCT
cet-12545	48	21	aldrich	aldrich	NOUN
cet-12545	48	22	)	)	PUNCT
cet-12545	48	23	in	in	ADP
cet-12545	48	24	0.5	0.5	NUM
cet-12545	48	25	m	m	NOUN
cet-12545	48	26	of	of	ADP
cet-12545	48	27	h2so4	h2so4	PROPN
cet-12545	48	28	were	be	AUX
cet-12545	48	29	placed	place	VERB
cet-12545	48	30	on	on	ADP
cet-12545	48	31	the	the	DET
cet-12545	48	32	spes	spe	NOUN
cet-12545	48	33	.	.	PUNCT
cet-12545	49	1	chronoamperometry	chronoamperometry	PROPN
cet-12545	49	2	was	be	AUX
cet-12545	49	3	performed	perform	VERB
cet-12545	49	4	at	at	ADP
cet-12545	49	5	-0.05	-0.05	NUM
cet-12545	49	6	v	v	NOUN
cet-12545	49	7	vs.	vs.	ADP
cet-12545	49	8	ag	ag	PROPN
cet-12545	49	9	/	/	SYM
cet-12545	49	10	agcl	agcl	NOUN
cet-12545	49	11	for	for	ADP
cet-12545	49	12	100	100	NUM
cet-12545	49	13	s.	s.	PROPN
cet-12545	49	14	the	the	DET
cet-12545	49	15	aunps	aunps	PROPN
cet-12545	49	16	-	-	PUNCT
cet-12545	49	17	modified	modify	VERB
cet-12545	49	18	spes	spe	NOUN
cet-12545	49	19	were	be	AUX
cet-12545	49	20	rinsed	rinse	VERB
cet-12545	49	21	with	with	ADP
cet-12545	49	22	type	type	NOUN
cet-12545	49	23	-	-	PUNCT
cet-12545	49	24	i	i	PRON
cet-12545	49	25	water	water	NOUN
cet-12545	49	26	(	(	PUNCT
cet-12545	49	27	jose	jose	PROPN
cet-12545	49	28	luis	luis	PROPN
cet-12545	49	29	ropero	ropero	PROPN
cet-12545	49	30	-	-	PUNCT
cet-12545	49	31	vega	vega	PROPN
cet-12545	49	32	et	et	PROPN
cet-12545	49	33	al	al	PROPN
cet-12545	49	34	.	.	PROPN
cet-12545	49	35	,	,	PUNCT
cet-12545	49	36	2021	2021	NUM
cet-12545	49	37	)	)	PUNCT
cet-12545	49	38	.	.	PUNCT
cet-12545	50	1	the	the	DET
cet-12545	50	2	aptamer	aptamer	NOUN
cet-12545	50	3	designed	design	VERB
cet-12545	50	4	in	in	ADP
cet-12545	50	5	the	the	DET
cet-12545	50	6	present	present	ADJ
cet-12545	50	7	work	work	NOUN
cet-12545	50	8	was	be	AUX
cet-12545	50	9	synthesized	synthesize	VERB
cet-12545	50	10	with	with	ADP
cet-12545	50	11	a	a	DET
cet-12545	50	12	thiol	thiol	ADJ
cet-12545	50	13	group	group	NOUN
cet-12545	50	14	at	at	ADP
cet-12545	50	15	the	the	DET
cet-12545	50	16	5	5	NUM
cet-12545	50	17	'	'	PART
cet-12545	50	18	end	end	NOUN
cet-12545	50	19	(	(	PUNCT
cet-12545	50	20	macrogen	macrogen	NOUN
cet-12545	50	21	,	,	PUNCT
cet-12545	50	22	south	south	PROPN
cet-12545	50	23	korea	korea	PROPN
cet-12545	50	24	)	)	PUNCT
cet-12545	50	25	.	.	PUNCT
cet-12545	51	1	immobilization	immobilization	NOUN
cet-12545	51	2	of	of	ADP
cet-12545	51	3	the	the	DET
cet-12545	51	4	aptamer	aptamer	NOUN
cet-12545	51	5	on	on	ADP
cet-12545	51	6	the	the	DET
cet-12545	51	7	spes	spe	NOUN
cet-12545	51	8	was	be	AUX
cet-12545	51	9	performed	perform	VERB
cet-12545	51	10	by	by	ADP
cet-12545	51	11	self	self	NOUN
cet-12545	51	12	-	-	PUNCT
cet-12545	51	13	assembly	assembly	NOUN
cet-12545	51	14	on	on	ADP
cet-12545	51	15	the	the	DET
cet-12545	51	16	aunps	aunps	ADJ
cet-12545	51	17	surface	surface	NOUN
cet-12545	51	18	via	via	ADP
cet-12545	51	19	au	au	PROPN
cet-12545	51	20	-	-	PUNCT
cet-12545	51	21	s	s	NOUN
cet-12545	51	22	bond	bond	NOUN
cet-12545	51	23	formation	formation	NOUN
cet-12545	51	24	.	.	PUNCT
cet-12545	52	1	briefly	briefly	ADV
cet-12545	52	2	,	,	PUNCT
cet-12545	52	3	20	20	NUM
cet-12545	52	4	µl	µl	NOUN
cet-12545	52	5	of	of	ADP
cet-12545	52	6	a	a	DET
cet-12545	52	7	20	20	NUM
cet-12545	52	8	-	-	SYM
cet-12545	52	9	100	100	NUM
cet-12545	52	10	nm	nm	ADJ
cet-12545	52	11	aqueous	aqueous	ADJ
cet-12545	52	12	solution	solution	NOUN
cet-12545	52	13	of	of	ADP
cet-12545	52	14	the	the	DET
cet-12545	52	15	aptamer	aptamer	NOUN
cet-12545	52	16	were	be	AUX
cet-12545	52	17	placed	place	VERB
cet-12545	52	18	on	on	ADP
cet-12545	52	19	spes	spe	NOUN
cet-12545	52	20	and	and	CCONJ
cet-12545	52	21	incubated	incubate	VERB
cet-12545	52	22	overnight	overnight	ADV
cet-12545	52	23	(	(	PUNCT
cet-12545	52	24	16	16	NUM
cet-12545	52	25	h	h	NOUN
cet-12545	52	26	)	)	PUNCT
cet-12545	52	27	.	.	PUNCT
cet-12545	53	1	the	the	DET
cet-12545	53	2	biosensors	biosensor	NOUN
cet-12545	53	3	obtained	obtain	VERB
cet-12545	53	4	were	be	AUX
cet-12545	53	5	rinsed	rinse	VERB
cet-12545	53	6	with	with	ADP
cet-12545	53	7	type	type	NOUN
cet-12545	53	8	-	-	PUNCT
cet-12545	53	9	i	i	PRON
cet-12545	53	10	water	water	NOUN
cet-12545	53	11	.	.	PUNCT
cet-12545	54	1	the	the	DET
cet-12545	54	2	effect	effect	NOUN
cet-12545	54	3	of	of	ADP
cet-12545	54	4	the	the	DET
cet-12545	54	5	concentration	concentration	NOUN
cet-12545	54	6	of	of	ADP
cet-12545	54	7	the	the	DET
cet-12545	54	8	aptamer	aptamer	NOUN
cet-12545	54	9	in	in	ADP
cet-12545	54	10	the	the	DET
cet-12545	54	11	solution	solution	NOUN
cet-12545	54	12	to	to	PART
cet-12545	54	13	be	be	AUX
cet-12545	54	14	immobilized	immobilize	VERB
cet-12545	54	15	toward	toward	ADP
cet-12545	54	16	e.	e.	PROPN
cet-12545	54	17	coli	coli	PROPN
cet-12545	54	18	detection	detection	NOUN
cet-12545	54	19	was	be	AUX
cet-12545	54	20	evaluated	evaluate	VERB
cet-12545	54	21	.	.	PUNCT
cet-12545	55	1	changes	change	NOUN
cet-12545	55	2	in	in	ADP
cet-12545	55	3	the	the	DET
cet-12545	55	4	electrochemical	electrochemical	ADJ
cet-12545	55	5	response	response	NOUN
cet-12545	55	6	of	of	ADP
cet-12545	55	7	spes	spe	NOUN
cet-12545	55	8	during	during	ADP
cet-12545	55	9	their	their	PRON
cet-12545	55	10	modification	modification	NOUN
cet-12545	55	11	were	be	AUX
cet-12545	55	12	evaluated	evaluate	VERB
cet-12545	55	13	by	by	ADP
cet-12545	55	14	electrochemical	electrochemical	ADJ
cet-12545	55	15	impedance	impedance	NOUN
cet-12545	55	16	spectroscopy	spectroscopy	NOUN
cet-12545	55	17	(	(	PUNCT
cet-12545	55	18	eis	eis	PROPN
cet-12545	55	19	)	)	PUNCT
cet-12545	55	20	at	at	ADP
cet-12545	55	21	a	a	DET
cet-12545	55	22	scan	scan	ADJ
cet-12545	55	23	frequency	frequency	NOUN
cet-12545	55	24	between	between	ADP
cet-12545	55	25	50,000	50,000	NUM
cet-12545	55	26	to	to	PART
cet-12545	55	27	1	1	NUM
cet-12545	55	28	hz	hz	VERB
cet-12545	55	29	,	,	PUNCT
cet-12545	55	30	the	the	DET
cet-12545	55	31	amplitude	amplitude	NOUN
cet-12545	55	32	of	of	ADP
cet-12545	55	33	10	10	NUM
cet-12545	55	34	mv	mv	NOUN
cet-12545	55	35	rms	rm	NOUN
cet-12545	55	36	and	and	CCONJ
cet-12545	55	37	0	0	NUM
cet-12545	55	38	v	v	NOUN
cet-12545	55	39	vs.	vs.	X
cet-12545	55	40	ocp	ocp	PROPN
cet-12545	55	41	(	(	PUNCT
cet-12545	55	42	dc	dc	PROPN
cet-12545	55	43	)	)	PUNCT
cet-12545	55	44	by	by	ADP
cet-12545	55	45	using	use	VERB
cet-12545	55	46	an	an	DET
cet-12545	55	47	electrolytic	electrolytic	ADJ
cet-12545	55	48	solution	solution	NOUN
cet-12545	55	49	of	of	ADP
cet-12545	55	50	fe[(cn)6]3-/4couple	fe[(cn)6]3-/4couple	ADP
cet-12545	55	51	(	(	PUNCT
cet-12545	55	52	5	5	NUM
cet-12545	55	53	mm	mm	NOUN
cet-12545	55	54	)	)	PUNCT
cet-12545	55	55	and	and	CCONJ
cet-12545	55	56	kcl	kcl	PROPN
cet-12545	55	57	(	(	PUNCT
cet-12545	55	58	0.1	0.1	NUM
cet-12545	55	59	m	m	NOUN
cet-12545	55	60	)	)	PUNCT
cet-12545	55	61	.	.	PUNCT
cet-12545	56	1	surface	surface	NOUN
cet-12545	56	2	characteristics	characteristic	NOUN
cet-12545	56	3	of	of	ADP
cet-12545	56	4	aunps	aunps	NOUN
cet-12545	56	5	-	-	PUNCT
cet-12545	56	6	modified	modify	VERB
cet-12545	56	7	spes	spe	NOUN
cet-12545	56	8	were	be	AUX
cet-12545	56	9	studied	study	VERB
cet-12545	56	10	by	by	ADP
cet-12545	56	11	scanning	scan	VERB
cet-12545	56	12	electron	electron	NOUN
cet-12545	56	13	microscopy	microscopy	NOUN
cet-12545	56	14	(	(	PUNCT
cet-12545	56	15	sem	sem	NOUN
cet-12545	56	16	)	)	PUNCT
cet-12545	56	17	using	use	VERB
cet-12545	56	18	a	a	DET
cet-12545	56	19	quanta	quanta	PROPN
cet-12545	56	20	field	field	NOUN
cet-12545	56	21	emission	emission	NOUN
cet-12545	56	22	gun	gun	NOUN
cet-12545	56	23	(	(	PUNCT
cet-12545	56	24	model	model	NOUN
cet-12545	56	25	650	650	NUM
cet-12545	56	26	)	)	PUNCT
cet-12545	56	27	microscope	microscope	NOUN
cet-12545	56	28	operated	operate	VERB
cet-12545	56	29	at	at	ADP
cet-12545	56	30	15.0	15.0	NUM
cet-12545	56	31	kv	kv	NOUN
cet-12545	56	32	.	.	PUNCT
cet-12545	57	1	the	the	DET
cet-12545	57	2	images	image	NOUN
cet-12545	57	3	were	be	AUX
cet-12545	57	4	obtained	obtain	VERB
cet-12545	57	5	in	in	ADP
cet-12545	57	6	secondary	secondary	ADJ
cet-12545	57	7	electron	electron	NOUN
cet-12545	57	8	mode	mode	NOUN
cet-12545	57	9	.	.	PUNCT
cet-12545	58	1	284	284	NUM
cet-12545	58	2	2.3	2.3	NUM
cet-12545	58	3	evaluation	evaluation	NOUN
cet-12545	58	4	of	of	ADP
cet-12545	58	5	the	the	DET
cet-12545	58	6	biosensors	biosensor	NOUN
cet-12545	58	7	on	on	ADP
cet-12545	58	8	the	the	DET
cet-12545	58	9	detection	detection	NOUN
cet-12545	58	10	of	of	ADP
cet-12545	58	11	escherichia	escherichia	NOUN
cet-12545	58	12	coli	coli	NOUN
cet-12545	58	13	o157	o157	PROPN
cet-12545	58	14	:	:	PUNCT
cet-12545	58	15	h7	h7	PROPN
cet-12545	58	16	e.	e.	PROPN
cet-12545	58	17	coli	coli	PROPN
cet-12545	58	18	o157	o157	PROPN
cet-12545	58	19	:	:	PUNCT
cet-12545	58	20	h7	h7	PROPN
cet-12545	58	21	(	(	PUNCT
cet-12545	58	22	ec	ec	PROPN
cet-12545	58	23	,	,	PUNCT
cet-12545	58	24	atcc	atcc	NOUN
cet-12545	58	25	43895	43895	NUM
cet-12545	58	26	)	)	PUNCT
cet-12545	58	27	was	be	AUX
cet-12545	58	28	kept	keep	VERB
cet-12545	58	29	under	under	ADP
cet-12545	58	30	cryopreservation	cryopreservation	NOUN
cet-12545	58	31	at	at	ADP
cet-12545	58	32	−80	−80	PROPN
cet-12545	58	33	°	°	PROPN
cet-12545	58	34	c	c	PROPN
cet-12545	58	35	in	in	ADP
cet-12545	58	36	luria	luria	PROPN
cet-12545	58	37	bertani	bertani	PROPN
cet-12545	58	38	broth	broth	NOUN
cet-12545	58	39	(	(	PUNCT
cet-12545	58	40	lbb	lbb	PROPN
cet-12545	58	41	,	,	PUNCT
cet-12545	58	42	merck	merck	PROPN
cet-12545	58	43	)	)	PUNCT
cet-12545	58	44	with	with	ADP
cet-12545	58	45	15	15	NUM
cet-12545	58	46	%	%	NOUN
cet-12545	58	47	of	of	ADP
cet-12545	58	48	glycerol	glycerol	NOUN
cet-12545	58	49	.	.	PUNCT
cet-12545	59	1	for	for	ADP
cet-12545	59	2	the	the	DET
cet-12545	59	3	reactivation	reactivation	NOUN
cet-12545	59	4	of	of	ADP
cet-12545	59	5	the	the	DET
cet-12545	59	6	microorganism	microorganism	NOUN
cet-12545	59	7	,	,	PUNCT
cet-12545	59	8	50	50	NUM
cet-12545	59	9	µl	µl	NOUN
cet-12545	59	10	of	of	ADP
cet-12545	59	11	cryopreserved	cryopreserve	VERB
cet-12545	59	12	material	material	NOUN
cet-12545	59	13	was	be	AUX
cet-12545	59	14	added	add	VERB
cet-12545	59	15	in	in	ADP
cet-12545	59	16	5	5	NUM
cet-12545	59	17	ml	ml	NOUN
cet-12545	59	18	of	of	ADP
cet-12545	59	19	lbb	lbb	PROPN
cet-12545	59	20	and	and	CCONJ
cet-12545	59	21	incubated	incubate	VERB
cet-12545	59	22	at	at	ADP
cet-12545	59	23	35±2	35±2	PROPN
cet-12545	59	24	ºc	ºc	NOUN
cet-12545	59	25	from	from	ADP
cet-12545	59	26	18	18	NUM
cet-12545	59	27	to	to	PART
cet-12545	59	28	24	24	NUM
cet-12545	59	29	h	h	NOUN
cet-12545	59	30	before	before	SCONJ
cet-12545	59	31	each	each	DET
cet-12545	59	32	assay	assay	VERB
cet-12545	59	33	,	,	PUNCT
cet-12545	59	34	adjusting	adjust	VERB
cet-12545	59	35	the	the	DET
cet-12545	59	36	concentration	concentration	NOUN
cet-12545	59	37	at	at	ADP
cet-12545	59	38	1×108	1×108	NUM
cet-12545	59	39	cfu	cfu	NOUN
cet-12545	59	40	/	/	SYM
cet-12545	59	41	ml	ml	NOUN
cet-12545	59	42	in	in	ADP
cet-12545	59	43	0.9	0.9	NUM
cet-12545	59	44	%	%	NOUN
cet-12545	59	45	w	w	PROPN
cet-12545	59	46	/	/	SYM
cet-12545	59	47	v	v	NOUN
cet-12545	59	48	of	of	ADP
cet-12545	59	49	nacl	nacl	NOUN
cet-12545	59	50	.	.	PUNCT
cet-12545	60	1	then	then	ADV
cet-12545	60	2	,	,	PUNCT
cet-12545	60	3	7	7	NUM
cet-12545	60	4	ml	ml	NOUN
cet-12545	60	5	of	of	ADP
cet-12545	60	6	nacl	nacl	NOUN
cet-12545	60	7	(	(	PUNCT
cet-12545	60	8	0.9	0.9	NUM
cet-12545	60	9	%	%	NOUN
cet-12545	60	10	w	w	PROPN
cet-12545	60	11	/	/	SYM
cet-12545	60	12	v	v	NOUN
cet-12545	60	13	)	)	PUNCT
cet-12545	60	14	with	with	ADP
cet-12545	60	15	known	known	ADJ
cet-12545	60	16	concentrations	concentration	NOUN
cet-12545	60	17	of	of	ADP
cet-12545	60	18	ec	ec	PROPN
cet-12545	60	19	(	(	PUNCT
cet-12545	60	20	0	0	NUM
cet-12545	60	21	to	to	ADP
cet-12545	60	22	1000	1000	NUM
cet-12545	60	23	cfu	cfu	NOUN
cet-12545	60	24	/	/	SYM
cet-12545	60	25	ml	ml	NOUN
cet-12545	60	26	)	)	PUNCT
cet-12545	60	27	were	be	AUX
cet-12545	60	28	placed	place	VERB
cet-12545	60	29	in	in	ADP
cet-12545	60	30	an	an	DET
cet-12545	60	31	appropriate	appropriate	ADJ
cet-12545	60	32	beaker	beaker	NOUN
cet-12545	60	33	,	,	PUNCT
cet-12545	60	34	and	and	CCONJ
cet-12545	60	35	the	the	DET
cet-12545	60	36	biosensor	biosensor	NOUN
cet-12545	60	37	was	be	AUX
cet-12545	60	38	immersed	immerse	VERB
cet-12545	60	39	.	.	PUNCT
cet-12545	61	1	the	the	DET
cet-12545	61	2	system	system	NOUN
cet-12545	61	3	was	be	AUX
cet-12545	61	4	incubated	incubate	VERB
cet-12545	61	5	at	at	ADP
cet-12545	61	6	25	25	NUM
cet-12545	61	7	°	°	NOUN
cet-12545	61	8	c	c	NOUN
cet-12545	61	9	for	for	ADP
cet-12545	61	10	30	30	NUM
cet-12545	61	11	min	min	NOUN
cet-12545	61	12	and	and	CCONJ
cet-12545	61	13	with	with	ADP
cet-12545	61	14	constant	constant	ADJ
cet-12545	61	15	stirring	stirring	NOUN
cet-12545	61	16	of	of	ADP
cet-12545	61	17	150	150	NUM
cet-12545	61	18	rpm	rpm	NOUN
cet-12545	61	19	.	.	PUNCT
cet-12545	62	1	after	after	ADP
cet-12545	62	2	that	that	PRON
cet-12545	62	3	,	,	PUNCT
cet-12545	62	4	the	the	DET
cet-12545	62	5	biosensor	biosensor	NOUN
cet-12545	62	6	was	be	AUX
cet-12545	62	7	rinsed	rinse	VERB
cet-12545	62	8	with	with	ADP
cet-12545	62	9	type	type	NOUN
cet-12545	62	10	-	-	PUNCT
cet-12545	62	11	i	i	PRON
cet-12545	62	12	water	water	NOUN
cet-12545	62	13	prior	prior	ADV
cet-12545	62	14	to	to	ADP
cet-12545	62	15	electrochemical	electrochemical	ADJ
cet-12545	62	16	measurements	measurement	NOUN
cet-12545	62	17	.	.	PUNCT
cet-12545	63	1	the	the	DET
cet-12545	63	2	detection	detection	NOUN
cet-12545	63	3	blank	blank	NOUN
cet-12545	63	4	was	be	AUX
cet-12545	63	5	0.9	0.9	NUM
cet-12545	63	6	%	%	NOUN
cet-12545	63	7	w	w	PROPN
cet-12545	63	8	/	/	SYM
cet-12545	63	9	v	v	NOUN
cet-12545	63	10	of	of	ADP
cet-12545	63	11	nacl	nacl	ADJ
cet-12545	63	12	solution	solution	NOUN
cet-12545	63	13	without	without	ADP
cet-12545	63	14	bacteria	bacteria	NOUN
cet-12545	63	15	(	(	PUNCT
cet-12545	63	16	0	0	NUM
cet-12545	63	17	cfu	cfu	NOUN
cet-12545	63	18	/	/	SYM
cet-12545	63	19	ml	ml	NOUN
cet-12545	63	20	)	)	PUNCT
cet-12545	63	21	.	.	PUNCT
cet-12545	64	1	eis	eis	PROPN
cet-12545	64	2	measurements	measurement	NOUN
cet-12545	64	3	were	be	AUX
cet-12545	64	4	performed	perform	VERB
cet-12545	64	5	using	use	VERB
cet-12545	64	6	the	the	DET
cet-12545	64	7	same	same	ADJ
cet-12545	64	8	conditions	condition	NOUN
cet-12545	64	9	used	use	VERB
cet-12545	64	10	for	for	ADP
cet-12545	64	11	the	the	DET
cet-12545	64	12	characterization	characterization	NOUN
cet-12545	64	13	of	of	ADP
cet-12545	64	14	the	the	DET
cet-12545	64	15	biosensor	biosensor	NOUN
cet-12545	64	16	.	.	PUNCT
cet-12545	65	1	staphylococcus	staphylococcus	NOUN
cet-12545	65	2	aureus	aureus	PROPN
cet-12545	65	3	(	(	PUNCT
cet-12545	65	4	atcc	atcc	NOUN
cet-12545	65	5	25923	25923	NUM
cet-12545	65	6	)	)	PUNCT
cet-12545	65	7	and	and	CCONJ
cet-12545	65	8	pseudomonas	pseudomonas	PROPN
cet-12545	65	9	aeruginosa	aeruginosa	NOUN
cet-12545	65	10	(	(	PUNCT
cet-12545	65	11	atcc	atcc	NOUN
cet-12545	65	12	27853	27853	NUM
cet-12545	65	13	)	)	PUNCT
cet-12545	65	14	were	be	AUX
cet-12545	65	15	used	use	VERB
cet-12545	65	16	as	as	ADP
cet-12545	65	17	model	model	NOUN
cet-12545	65	18	microorganisms	microorganism	NOUN
cet-12545	65	19	to	to	PART
cet-12545	65	20	evaluate	evaluate	VERB
cet-12545	65	21	the	the	DET
cet-12545	65	22	selectivity	selectivity	NOUN
cet-12545	65	23	of	of	ADP
cet-12545	65	24	the	the	DET
cet-12545	65	25	biosensor	biosensor	NOUN
cet-12545	65	26	.	.	PUNCT
cet-12545	66	1	electrochemical	electrochemical	ADJ
cet-12545	66	2	measurements	measurement	NOUN
cet-12545	66	3	and	and	CCONJ
cet-12545	66	4	evaluation	evaluation	NOUN
cet-12545	66	5	of	of	ADP
cet-12545	66	6	the	the	DET
cet-12545	66	7	biosensor	biosensor	NOUN
cet-12545	66	8	were	be	AUX
cet-12545	66	9	performed	perform	VERB
cet-12545	66	10	on	on	ADP
cet-12545	66	11	a	a	DET
cet-12545	66	12	potentiostat	potentiostat	ADJ
cet-12545	66	13	/	/	SYM
cet-12545	66	14	galvanostat	galvanostat	NOUN
cet-12545	66	15	versastat	versastat	NOUN
cet-12545	66	16	3	3	NUM
cet-12545	66	17	(	(	PUNCT
cet-12545	66	18	princeton	princeton	PROPN
cet-12545	66	19	applied	apply	VERB
cet-12545	66	20	research	research	NOUN
cet-12545	66	21	)	)	PUNCT
cet-12545	66	22	controlled	control	VERB
cet-12545	66	23	by	by	ADP
cet-12545	66	24	versastudio	versastudio	NOUN
cet-12545	66	25	(	(	PUNCT
cet-12545	66	26	v.	v.	ADP
cet-12545	66	27	2.60.6	2.60.6	NUM
cet-12545	66	28	.	.	PUNCT
cet-12545	66	29	)	)	PUNCT
cet-12545	66	30	software	software	NOUN
cet-12545	66	31	.	.	PUNCT
cet-12545	67	1	the	the	DET
cet-12545	67	2	interaction	interaction	NOUN
cet-12545	67	3	of	of	ADP
cet-12545	67	4	ec	ec	PROPN
cet-12545	67	5	with	with	ADP
cet-12545	67	6	the	the	DET
cet-12545	67	7	surface	surface	NOUN
cet-12545	67	8	of	of	ADP
cet-12545	67	9	we	we	PRON
cet-12545	67	10	limits	limit	VERB
cet-12545	67	11	the	the	DET
cet-12545	67	12	electron	electron	NOUN
cet-12545	67	13	-	-	PUNCT
cet-12545	67	14	charge	charge	NOUN
cet-12545	67	15	transfer	transfer	NOUN
cet-12545	67	16	between	between	ADP
cet-12545	67	17	the	the	DET
cet-12545	67	18	redox	redox	NOUN
cet-12545	67	19	probe	probe	NOUN
cet-12545	67	20	and	and	CCONJ
cet-12545	67	21	the	the	DET
cet-12545	67	22	transductor	transductor	NOUN
cet-12545	67	23	.	.	PUNCT
cet-12545	68	1	this	this	PRON
cet-12545	68	2	is	be	AUX
cet-12545	68	3	reflected	reflect	VERB
cet-12545	68	4	in	in	ADP
cet-12545	68	5	an	an	DET
cet-12545	68	6	increase	increase	NOUN
cet-12545	68	7	in	in	ADP
cet-12545	68	8	the	the	DET
cet-12545	68	9	impedance	impedance	NOUN
cet-12545	68	10	of	of	ADP
cet-12545	68	11	the	the	DET
cet-12545	68	12	electrode	electrode	NOUN
cet-12545	68	13	.	.	PUNCT
cet-12545	69	1	in	in	ADP
cet-12545	69	2	the	the	DET
cet-12545	69	3	case	case	NOUN
cet-12545	69	4	of	of	ADP
cet-12545	69	5	a	a	DET
cet-12545	69	6	nyquist	nyquist	NOUN
cet-12545	69	7	diagram	diagram	NOUN
cet-12545	69	8	,	,	PUNCT
cet-12545	69	9	it	it	PRON
cet-12545	69	10	will	will	AUX
cet-12545	69	11	be	be	AUX
cet-12545	69	12	reflected	reflect	VERB
cet-12545	69	13	in	in	ADP
cet-12545	69	14	an	an	DET
cet-12545	69	15	increase	increase	NOUN
cet-12545	69	16	in	in	ADP
cet-12545	69	17	the	the	DET
cet-12545	69	18	diameter	diameter	NOUN
cet-12545	69	19	of	of	ADP
cet-12545	69	20	the	the	DET
cet-12545	69	21	semicircle	semicircle	NOUN
cet-12545	69	22	,	,	PUNCT
cet-12545	69	23	as	as	ADV
cet-12545	69	24	long	long	ADV
cet-12545	69	25	as	as	SCONJ
cet-12545	69	26	the	the	DET
cet-12545	69	27	electrochemical	electrochemical	ADJ
cet-12545	69	28	system	system	NOUN
cet-12545	69	29	behaves	behave	VERB
cet-12545	69	30	in	in	ADP
cet-12545	69	31	accordance	accordance	NOUN
cet-12545	69	32	with	with	ADP
cet-12545	69	33	the	the	DET
cet-12545	69	34	randles	randle	NOUN
cet-12545	69	35	circuit	circuit	NOUN
cet-12545	69	36	.	.	PUNCT
cet-12545	70	1	in	in	ADP
cet-12545	70	2	fact	fact	NOUN
cet-12545	70	3	,	,	PUNCT
cet-12545	70	4	from	from	ADP
cet-12545	70	5	this	this	DET
cet-12545	70	6	circuit	circuit	NOUN
cet-12545	70	7	it	it	PRON
cet-12545	70	8	is	be	AUX
cet-12545	70	9	possible	possible	ADJ
cet-12545	70	10	to	to	PART
cet-12545	70	11	calculate	calculate	VERB
cet-12545	70	12	the	the	DET
cet-12545	70	13	resistance	resistance	NOUN
cet-12545	70	14	to	to	PART
cet-12545	70	15	charge	charge	NOUN
cet-12545	70	16	transfer	transfer	NOUN
cet-12545	70	17	(	(	PUNCT
cet-12545	70	18	rct	rct	PROPN
cet-12545	70	19	)	)	PUNCT
cet-12545	70	20	on	on	ADP
cet-12545	70	21	the	the	DET
cet-12545	70	22	electrode	electrode	NOUN
cet-12545	70	23	surface	surface	NOUN
cet-12545	70	24	,	,	PUNCT
cet-12545	70	25	whose	whose	DET
cet-12545	70	26	values	value	NOUN
cet-12545	70	27	change	change	VERB
cet-12545	70	28	proportionally	proportionally	ADV
cet-12545	70	29	with	with	ADP
cet-12545	70	30	changes	change	NOUN
cet-12545	70	31	in	in	ADP
cet-12545	70	32	the	the	DET
cet-12545	70	33	concentration	concentration	NOUN
cet-12545	70	34	of	of	ADP
cet-12545	70	35	the	the	DET
cet-12545	70	36	microorganism	microorganism	NOUN
cet-12545	70	37	.	.	PUNCT
cet-12545	71	1	thus	thus	ADV
cet-12545	71	2	,	,	PUNCT
cet-12545	71	3	a	a	DET
cet-12545	71	4	normalized	normalize	VERB
cet-12545	71	5	resistance	resistance	NOUN
cet-12545	71	6	change	change	NOUN
cet-12545	71	7	is	be	AUX
cet-12545	71	8	calculated	calculate	VERB
cet-12545	71	9	using	use	VERB
cet-12545	71	10	equation	equation	NOUN
cet-12545	71	11	1	1	NUM
cet-12545	71	12	and	and	CCONJ
cet-12545	71	13	whose	whose	DET
cet-12545	71	14	numerical	numerical	ADJ
cet-12545	71	15	values	value	NOUN
cet-12545	71	16	are	be	AUX
cet-12545	71	17	expected	expect	VERB
cet-12545	71	18	to	to	PART
cet-12545	71	19	be	be	AUX
cet-12545	71	20	directly	directly	ADV
cet-12545	71	21	proportional	proportional	ADJ
cet-12545	71	22	to	to	ADP
cet-12545	71	23	the	the	DET
cet-12545	71	24	concentration	concentration	NOUN
cet-12545	71	25	of	of	ADP
cet-12545	71	26	the	the	DET
cet-12545	71	27	bacteria	bacteria	NOUN
cet-12545	71	28	.	.	PUNCT
cet-12545	72	1	∆𝑅𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑	∆𝑅𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑	NOUN
cet-12545	72	2	=	=	NOUN
cet-12545	72	3	𝑅𝐴𝑝𝑡917+𝐸𝐶	𝑅𝐴𝑝𝑡917+𝐸𝐶	NOUN
cet-12545	72	4	−	−	PROPN
cet-12545	72	5	𝑅𝐴𝑝𝑡	𝑅𝐴𝑝𝑡	PROPN
cet-12545	72	6	𝑅𝐴𝑝𝑡917	𝑅𝐴𝑝𝑡917	PUNCT
cet-12545	72	7	(	(	PUNCT
cet-12545	72	8	1	1	X
cet-12545	72	9	)	)	PUNCT
cet-12545	72	10	where	where	SCONJ
cet-12545	72	11	rapt917	rapt917	PROPN
cet-12545	72	12	is	be	AUX
cet-12545	72	13	the	the	DET
cet-12545	72	14	rct	rct	PROPN
cet-12545	72	15	of	of	ADP
cet-12545	72	16	the	the	DET
cet-12545	72	17	biosensor	biosensor	NOUN
cet-12545	72	18	while	while	SCONJ
cet-12545	72	19	rapt917+ec	rapt917+ec	ADJ
cet-12545	72	20	is	be	AUX
cet-12545	72	21	the	the	DET
cet-12545	72	22	rct	rct	PROPN
cet-12545	72	23	of	of	ADP
cet-12545	72	24	the	the	DET
cet-12545	72	25	biosensor	biosensor	NOUN
cet-12545	72	26	in	in	ADP
cet-12545	72	27	the	the	DET
cet-12545	72	28	presence	presence	NOUN
cet-12545	72	29	of	of	ADP
cet-12545	72	30	e.	e.	PROPN
cet-12545	72	31	coli	coli	PROPN
cet-12545	72	32	at	at	ADP
cet-12545	72	33	a	a	DET
cet-12545	72	34	given	give	VERB
cet-12545	72	35	concentration	concentration	NOUN
cet-12545	72	36	.	.	PUNCT
cet-12545	73	1	3	3	X
cet-12545	73	2	.	.	NOUN
cet-12545	73	3	results	result	NOUN
cet-12545	73	4	and	and	CCONJ
cet-12545	73	5	discussions	discussion	NOUN
cet-12545	73	6	3.1	3.1	NUM
cet-12545	73	7	bioinformatic	bioinformatic	ADJ
cet-12545	73	8	design	design	NOUN
cet-12545	73	9	of	of	ADP
cet-12545	73	10	aptamers	aptamer	NOUN
cet-12545	73	11	data	datum	NOUN
cet-12545	73	12	from	from	ADP
cet-12545	73	13	19	19	NUM
cet-12545	73	14	articles	article	NOUN
cet-12545	73	15	were	be	AUX
cet-12545	73	16	organized	organize	VERB
cet-12545	73	17	to	to	PART
cet-12545	73	18	consider	consider	VERB
cet-12545	73	19	the	the	DET
cet-12545	73	20	dissociation	dissociation	NOUN
cet-12545	73	21	constant	constant	ADJ
cet-12545	73	22	(	(	PUNCT
cet-12545	73	23	kd	kd	PROPN
cet-12545	73	24	)	)	PUNCT
cet-12545	73	25	,	,	PUNCT
cet-12545	73	26	limit	limit	NOUN
cet-12545	73	27	of	of	ADP
cet-12545	73	28	detection	detection	NOUN
cet-12545	73	29	(	(	PUNCT
cet-12545	73	30	lod	lod	PROPN
cet-12545	73	31	)	)	PUNCT
cet-12545	73	32	,	,	PUNCT
cet-12545	73	33	type	type	NOUN
cet-12545	73	34	of	of	ADP
cet-12545	73	35	biosensor	biosensor	NOUN
cet-12545	73	36	,	,	PUNCT
cet-12545	73	37	and	and	CCONJ
cet-12545	73	38	signal	signal	PROPN
cet-12545	73	39	measured	measure	VERB
cet-12545	73	40	.	.	PUNCT
cet-12545	74	1	these	these	DET
cet-12545	74	2	results	result	NOUN
cet-12545	74	3	are	be	AUX
cet-12545	74	4	published	publish	VERB
cet-12545	74	5	in	in	ADP
cet-12545	74	6	mendeley	mendeley	PROPN
cet-12545	74	7	data	datum	NOUN
cet-12545	74	8	repository	repository	NOUN
cet-12545	74	9	(	(	PUNCT
cet-12545	74	10	j.l	j.l	PROPN
cet-12545	74	11	.	.	PROPN
cet-12545	74	12	roperovega	roperovega	PROPN
cet-12545	74	13	et	et	PROPN
cet-12545	74	14	al	al	PROPN
cet-12545	74	15	.	.	PROPN
cet-12545	74	16	,	,	PUNCT
cet-12545	74	17	2022	2022	NUM
cet-12545	74	18	)	)	PUNCT
cet-12545	74	19	.	.	PUNCT
cet-12545	75	1	aptamer	aptamer	PROPN
cet-12545	75	2	sequences	sequence	NOUN
cet-12545	75	3	were	be	AUX
cet-12545	75	4	between	between	ADP
cet-12545	75	5	32	32	NUM
cet-12545	75	6	and	and	CCONJ
cet-12545	75	7	88	88	NUM
cet-12545	75	8	nucleotides	nucleotide	NOUN
cet-12545	75	9	,	,	PUNCT
cet-12545	75	10	one	one	NUM
cet-12545	75	11	of	of	ADP
cet-12545	75	12	them	they	PRON
cet-12545	75	13	was	be	AUX
cet-12545	75	14	reported	report	VERB
cet-12545	75	15	as	as	ADP
cet-12545	75	16	rna	rna	NOUN
cet-12545	75	17	sequence	sequence	NOUN
cet-12545	75	18	(	(	PUNCT
cet-12545	75	19	ec3	ec3	NOUN
cet-12545	75	20	)	)	PUNCT
cet-12545	75	21	,	,	PUNCT
cet-12545	75	22	and	and	CCONJ
cet-12545	75	23	seven	seven	NUM
cet-12545	75	24	recognized	recognize	VERB
cet-12545	75	25	whole	whole	ADJ
cet-12545	75	26	cell	cell	NOUN
cet-12545	75	27	of	of	ADP
cet-12545	75	28	e.	e.	PROPN
cet-12545	75	29	coli	coli	PROPN
cet-12545	75	30	o157	o157	PROPN
cet-12545	75	31	:	:	PUNCT
cet-12545	75	32	h7	h7	NOUN
cet-12545	75	33	strain	strain	NOUN
cet-12545	75	34	.	.	PUNCT
cet-12545	76	1	alignment	alignment	NOUN
cet-12545	76	2	using	use	VERB
cet-12545	76	3	whole	whole	ADJ
cet-12545	76	4	aptamers	aptamer	NOUN
cet-12545	76	5	sequences	sequence	NOUN
cet-12545	76	6	did	do	AUX
cet-12545	76	7	not	not	PART
cet-12545	76	8	show	show	VERB
cet-12545	76	9	a	a	DET
cet-12545	76	10	distribution	distribution	NOUN
cet-12545	76	11	pattern	pattern	NOUN
cet-12545	76	12	associated	associate	VERB
cet-12545	76	13	with	with	ADP
cet-12545	76	14	e.	e.	PROPN
cet-12545	76	15	coli	coli	PROPN
cet-12545	76	16	strain	strain	NOUN
cet-12545	76	17	,	,	PUNCT
cet-12545	76	18	kd	kd	PROPN
cet-12545	76	19	,	,	PUNCT
cet-12545	76	20	lod	lod	PROPN
cet-12545	76	21	,	,	PUNCT
cet-12545	76	22	or	or	CCONJ
cet-12545	76	23	molecular	molecular	ADJ
cet-12545	76	24	target	target	NOUN
cet-12545	76	25	.	.	PUNCT
cet-12545	77	1	despite	despite	SCONJ
cet-12545	77	2	the	the	DET
cet-12545	77	3	above	above	NOUN
cet-12545	77	4	,	,	PUNCT
cet-12545	77	5	the	the	DET
cet-12545	77	6	s1	s1	PROPN
cet-12545	77	7	aptamer	aptamer	NOUN
cet-12545	77	8	family	family	NOUN
cet-12545	77	9	(	(	PUNCT
cet-12545	77	10	table	table	NOUN
cet-12545	77	11	1	1	NUM
cet-12545	77	12	)	)	PUNCT
cet-12545	77	13	was	be	AUX
cet-12545	77	14	selected	select	VERB
cet-12545	77	15	as	as	ADP
cet-12545	77	16	a	a	DET
cet-12545	77	17	model	model	NOUN
cet-12545	77	18	for	for	ADP
cet-12545	77	19	creating	create	VERB
cet-12545	77	20	hybrid	hybrid	ADJ
cet-12545	77	21	aptamer	aptamer	NOUN
cet-12545	77	22	derivatives	derivative	NOUN
cet-12545	77	23	because	because	SCONJ
cet-12545	77	24	they	they	PRON
cet-12545	77	25	recognize	recognize	VERB
cet-12545	77	26	the	the	DET
cet-12545	77	27	whole	whole	ADJ
cet-12545	77	28	e.	e.	PROPN
cet-12545	77	29	coli	coli	PROPN
cet-12545	78	1	o157	o157	PROPN
cet-12545	78	2	:	:	PUNCT
cet-12545	79	1	h7	h7	ADJ
cet-12545	79	2	cells	cell	NOUN
cet-12545	79	3	,	,	PUNCT
cet-12545	79	4	have	have	VERB
cet-12545	79	5	low	low	ADJ
cet-12545	79	6	kd	kd	PROPN
cet-12545	79	7	,	,	PUNCT
cet-12545	79	8	a	a	DET
cet-12545	79	9	short	short	ADJ
cet-12545	79	10	length	length	NOUN
cet-12545	79	11	,	,	PUNCT
cet-12545	79	12	and	and	CCONJ
cet-12545	79	13	a	a	DET
cet-12545	79	14	high	high	ADJ
cet-12545	79	15	frequency	frequency	NOUN
cet-12545	79	16	of	of	ADP
cet-12545	79	17	the	the	DET
cet-12545	79	18	structure	structure	NOUN
cet-12545	79	19	with	with	ADP
cet-12545	79	20	mfe	mfe	PROPN
cet-12545	79	21	.	.	PROPN
cet-12545	79	22	table	table	NOUN
cet-12545	79	23	1	1	NUM
cet-12545	79	24	:	:	PUNCT
cet-12545	79	25	main	main	ADJ
cet-12545	79	26	parameters	parameter	NOUN
cet-12545	79	27	of	of	ADP
cet-12545	79	28	some	some	DET
cet-12545	79	29	aptamer	aptamer	NOUN
cet-12545	79	30	that	that	PRON
cet-12545	79	31	recognize	recognize	VERB
cet-12545	79	32	e.	e.	PROPN
cet-12545	79	33	coli	coli	PROPN
cet-12545	79	34	o157	o157	PROPN
cet-12545	79	35	:	:	PUNCT
cet-12545	79	36	h7	h7	ADJ
cet-12545	79	37	cells	cell	NOUN
cet-12545	79	38	and	and	CCONJ
cet-12545	79	39	hybrid	hybrid	NOUN
cet-12545	79	40	aptamer	aptamer	NOUN
cet-12545	79	41	.	.	PUNCT
cet-12545	80	1	aptamer	aptamer	NOUN
cet-12545	80	2	sequence	sequence	NOUN
cet-12545	80	3	5	5	NUM
cet-12545	80	4	’	'	PUNCT
cet-12545	80	5	–	–	PUNCT
cet-12545	80	6	3	3	NUM
cet-12545	80	7	’	'	PUNCT
cet-12545	80	8	dot	dot	NOUN
cet-12545	80	9	-	-	PUNCT
cet-12545	80	10	bracket	bracket	NOUN
cet-12545	80	11	representation	representation	NOUN
cet-12545	80	12	nt	not	PART
cet-12545	80	13	δgº	δgº	ADV
cet-12545	80	14	[	[	X
cet-12545	80	15	kcal	kcal	PROPN
cet-12545	80	16	/	/	SYM
cet-12545	80	17	mol	mol	PROPN
cet-12545	80	18	]	]	PUNCT
cet-12545	80	19	f	f	X
cet-12545	80	20	*	*	PUNCT
cet-12545	80	21	*	*	PUNCT
cet-12545	80	22	(	(	PUNCT
cet-12545	80	23	%	%	INTJ
cet-12545	80	24	)	)	PUNCT
cet-12545	80	25	kd	kd	PROPN
cet-12545	80	26	nm	nm	PRON
cet-12545	80	27	s1	s1	PROPN
cet-12545	80	28	tggtcgtggtgaggtgcgtgtatgggtggtggatgagtgtgtggc	tggtcgtggtgaggtgcgtgtatgggtggtggatgagtgtgtggc	PROPN
cet-12545	80	29	*	*	PUNCT
cet-12545	80	30	................	................	PUNCT
cet-12545	80	31	(	(	PUNCT
cet-12545	80	32	(	(	PUNCT
cet-12545	80	33	(	(	PUNCT
cet-12545	80	34	.	.	PUNCT
cet-12545	80	35	(	(	PUNCT
cet-12545	80	36	(	(	PUNCT
cet-12545	80	37	(	(	PUNCT
cet-12545	80	38	.....	.....	PUNCT
cet-12545	80	39	)	)	PUNCT
cet-12545	80	40	)	)	PUNCT
cet-12545	80	41	)	)	PUNCT
cet-12545	80	42	.	.	PUNCT
cet-12545	80	43	)	)	PUNCT
cet-12545	80	44	)	)	PUNCT
cet-12545	80	45	)	)	PUNCT
cet-12545	80	46	..........	..........	PUNCT
cet-12545	81	1	45	45	NUM
cet-12545	81	2	-3.51	-3.51	NUM
cet-12545	81	3	22.75	22.75	NUM
cet-12545	81	4	10.33	10.33	NUM
cet-12545	81	5	s2	s2	NOUN
cet-12545	81	6	gcgggaataggatgcggctggaaggagaggtgttggtgggtggtg	gcgggaataggatgcggctggaaggagaggtgttggtgggtggtg	ADJ
cet-12545	81	7	(	(	PUNCT
cet-12545	81	8	(	(	PUNCT
cet-12545	81	9	........	........	PUNCT
cet-12545	81	10	(	(	PUNCT
cet-12545	81	11	(	(	PUNCT
cet-12545	81	12	(	(	PUNCT
cet-12545	81	13	(	(	PUNCT
cet-12545	81	14	(	(	PUNCT
cet-12545	81	15	..	..	PUNCT
cet-12545	81	16	(	(	PUNCT
cet-12545	81	17	(	(	PUNCT
cet-12545	81	18	......	......	PUNCT
cet-12545	81	19	)	)	PUNCT
cet-12545	81	20	)	)	PUNCT
cet-12545	81	21	..	..	PUNCT
cet-12545	81	22	)	)	PUNCT
cet-12545	81	23	)	)	PUNCT
cet-12545	81	24	)	)	PUNCT
cet-12545	81	25	)	)	PUNCT
cet-12545	81	26	)	)	PUNCT
cet-12545	81	27	........	........	PUNCT
cet-12545	81	28	)	)	PUNCT
cet-12545	81	29	)	)	PUNCT
cet-12545	81	30	.	.	PUNCT
cet-12545	82	1	45	45	NUM
cet-12545	82	2	-5.28	-5.28	NUM
cet-12545	82	3	23.85	23.85	NUM
cet-12545	82	4	nr	nr	NOUN
cet-12545	82	5	s3	s3	PROPN
cet-12545	82	6	gtgcggtgacgtgagggggagaggcgttggtgtaggctgttggtg	gtgcggtgacgtgagggggagaggcgttggtgtaggctgttggtg	NOUN
cet-12545	82	7	.	.	PUNCT
cet-12545	83	1	(	(	PUNCT
cet-12545	83	2	(	(	PUNCT
cet-12545	83	3	(	(	PUNCT
cet-12545	83	4	(	(	PUNCT
cet-12545	83	5	.	.	PUNCT
cet-12545	83	6	(	(	PUNCT
cet-12545	83	7	(	(	PUNCT
cet-12545	83	8	(	(	PUNCT
cet-12545	83	9	(	(	PUNCT
cet-12545	83	10	(	(	PUNCT
cet-12545	83	11	(	(	PUNCT
cet-12545	83	12	...........	...........	PUNCT
cet-12545	83	13	)	)	PUNCT
cet-12545	83	14	)	)	PUNCT
cet-12545	83	15	)	)	PUNCT
cet-12545	83	16	)	)	PUNCT
cet-12545	83	17	)	)	PUNCT
cet-12545	83	18	)	)	PUNCT
cet-12545	84	1	.	.	PUNCT
cet-12545	84	2	)	)	PUNCT
cet-12545	84	3	)	)	PUNCT
cet-12545	84	4	)	)	PUNCT
cet-12545	84	5	)	)	PUNCT
cet-12545	85	1	...........	...........	PUNCT
cet-12545	85	2	45	45	NUM
cet-12545	85	3	-8.86	-8.86	NUM
cet-12545	85	4	55.93	55.93	NUM
cet-12545	85	5	nr	nr	NOUN
cet-12545	85	6	apt517	apt517	PROPN
cet-12545	85	7	*	*	PUNCT
cet-12545	85	8	*	*	PUNCT
cet-12545	85	9	*	*	PUNCT
cet-12545	85	10	tttttacgtgggtggtgcggctggaaggagaggttga	tttttacgtgggtggtgcggctggaaggagaggttga	INTJ
cet-12545	85	11	...	...	PUNCT
cet-12545	85	12	(	(	PUNCT
cet-12545	85	13	(	(	PUNCT
cet-12545	85	14	(	(	PUNCT
cet-12545	85	15	(	(	PUNCT
cet-12545	85	16	....	....	PUNCT
cet-12545	85	17	)	)	PUNCT
cet-12545	85	18	)	)	PUNCT
cet-12545	85	19	)	)	PUNCT
cet-12545	85	20	)	)	PUNCT
cet-12545	85	21	..	..	PUNCT
cet-12545	85	22	(	(	PUNCT
cet-12545	85	23	(	(	PUNCT
cet-12545	85	24	(	(	PUNCT
cet-12545	85	25	(	(	PUNCT
cet-12545	85	26	(	(	PUNCT
cet-12545	85	27	.........	.........	PUNCT
cet-12545	85	28	)	)	PUNCT
cet-12545	85	29	)	)	PUNCT
cet-12545	85	30	)	)	PUNCT
cet-12545	85	31	)	)	PUNCT
cet-12545	85	32	)	)	PUNCT
cet-12545	85	33	.	.	PUNCT
cet-12545	86	1	37	37	NUM
cet-12545	86	2	-3.98	-3.98	NUM
cet-12545	86	3	17.35	17.35	NUM
cet-12545	86	4	--	--	PUNCT
cet-12545	86	5	apt917	apt917	NOUN
cet-12545	86	6	*	*	PROPN
cet-12545	86	7	*	*	PROPN
cet-12545	86	8	*	*	PUNCT
cet-12545	86	9	tttttacgtgagggggagaggcgtgcggctggaaggagaggttga	tttttacgtgagggggagaggcgtgcggctggaaggagaggttga	NOUN
cet-12545	86	10	....	....	PUNCT
cet-12545	86	11	(	(	PUNCT
cet-12545	86	12	(	(	PUNCT
cet-12545	86	13	(	(	PUNCT
cet-12545	86	14	(	(	PUNCT
cet-12545	86	15	(	(	PUNCT
cet-12545	86	16	...........	...........	PUNCT
cet-12545	86	17	)	)	PUNCT
cet-12545	86	18	)	)	PUNCT
cet-12545	86	19	)	)	PUNCT
cet-12545	86	20	)	)	PUNCT
cet-12545	86	21	)	)	PUNCT
cet-12545	86	22	(	(	PUNCT
cet-12545	86	23	(	(	PUNCT
cet-12545	86	24	(	(	PUNCT
cet-12545	86	25	(	(	PUNCT
cet-12545	86	26	(	(	PUNCT
cet-12545	86	27	.........	.........	PUNCT
cet-12545	86	28	)	)	PUNCT
cet-12545	86	29	)	)	PUNCT
cet-12545	86	30	)	)	PUNCT
cet-12545	86	31	)	)	PUNCT
cet-12545	86	32	)	)	PUNCT
cet-12545	86	33	.	.	PUNCT
cet-12545	87	1	45	45	NUM
cet-12545	87	2	-5.40	-5.40	NUM
cet-12545	87	3	61.95	61.95	NUM
cet-12545	87	4	--	--	PUNCT
cet-12545	87	5	*	*	PUNCT
cet-12545	87	6	bold	bold	ADJ
cet-12545	87	7	letters	letter	NOUN
cet-12545	87	8	indicate	indicate	VERB
cet-12545	87	9	external	external	ADJ
cet-12545	87	10	loop	loop	NOUN
cet-12545	87	11	nucleotides	nucleotide	NOUN
cet-12545	87	12	.	.	PUNCT
cet-12545	88	1	*	*	PUNCT
cet-12545	88	2	*	*	PUNCT
cet-12545	88	3	frequency	frequency	NOUN
cet-12545	88	4	of	of	ADP
cet-12545	88	5	minimal	minimal	ADJ
cet-12545	88	6	free	free	ADJ
cet-12545	88	7	energy	energy	NOUN
cet-12545	88	8	structure	structure	NOUN
cet-12545	88	9	.	.	PUNCT
cet-12545	89	1	*	*	PUNCT
cet-12545	90	1	*	*	PUNCT
cet-12545	90	2	*	*	PUNCT
cet-12545	90	3	this	this	DET
cet-12545	90	4	work	work	NOUN
cet-12545	90	5	.	.	PUNCT
cet-12545	91	1	previous	previous	ADJ
cet-12545	91	2	studies	study	NOUN
cet-12545	91	3	(	(	PUNCT
cet-12545	91	4	jayasena	jayasena	PROPN
cet-12545	91	5	,	,	PUNCT
cet-12545	91	6	1999	1999	NUM
cet-12545	91	7	)	)	PUNCT
cet-12545	91	8	have	have	AUX
cet-12545	91	9	reported	report	VERB
cet-12545	91	10	that	that	SCONJ
cet-12545	91	11	larger	large	ADJ
cet-12545	91	12	aptamers	aptamer	NOUN
cet-12545	91	13	are	be	AUX
cet-12545	91	14	less	less	ADV
cet-12545	91	15	selective	selective	ADJ
cet-12545	91	16	and	and	CCONJ
cet-12545	91	17	specific	specific	ADJ
cet-12545	91	18	at	at	ADP
cet-12545	91	19	the	the	DET
cet-12545	91	20	moment	moment	NOUN
cet-12545	91	21	of	of	ADP
cet-12545	91	22	detecting	detect	VERB
cet-12545	91	23	a	a	DET
cet-12545	91	24	target	target	NOUN
cet-12545	91	25	molecule	molecule	NOUN
cet-12545	91	26	.	.	PUNCT
cet-12545	92	1	for	for	ADP
cet-12545	92	2	this	this	DET
cet-12545	92	3	reason	reason	NOUN
cet-12545	92	4	,	,	PUNCT
cet-12545	92	5	hybrid	hybrid	ADJ
cet-12545	92	6	aptamers	aptamer	NOUN
cet-12545	92	7	were	be	AUX
cet-12545	92	8	created	create	VERB
cet-12545	92	9	without	without	ADP
cet-12545	92	10	exceeding	exceed	VERB
cet-12545	92	11	the	the	DET
cet-12545	92	12	number	number	NOUN
cet-12545	92	13	of	of	ADP
cet-12545	92	14	nucleotides	nucleotide	NOUN
cet-12545	92	15	from	from	ADP
cet-12545	92	16	s1	s1	PROPN
cet-12545	92	17	.	.	PUNCT
cet-12545	93	1	on	on	ADP
cet-12545	93	2	the	the	DET
cet-12545	93	3	other	other	ADJ
cet-12545	93	4	hand	hand	NOUN
cet-12545	93	5	,	,	PUNCT
cet-12545	93	6	since	since	SCONJ
cet-12545	93	7	the	the	DET
cet-12545	93	8	publication	publication	NOUN
cet-12545	93	9	of	of	ADP
cet-12545	93	10	selex	selex	PROPN
cet-12545	93	11	technique	technique	NOUN
cet-12545	93	12	(	(	PUNCT
cet-12545	93	13	tuerk	tuerk	NOUN
cet-12545	93	14	&	&	CCONJ
cet-12545	93	15	gold	gold	NOUN
cet-12545	93	16	,	,	PUNCT
cet-12545	93	17	1990	1990	NUM
cet-12545	93	18	)	)	PUNCT
cet-12545	93	19	the	the	DET
cet-12545	93	20	structure	structure	NOUN
cet-12545	93	21	of	of	ADP
cet-12545	93	22	loop	loop	NOUN
cet-12545	93	23	conformations	conformation	NOUN
cet-12545	93	24	has	have	AUX
cet-12545	93	25	been	be	AUX
cet-12545	93	26	gained	gain	VERB
cet-12545	93	27	attention	attention	NOUN
cet-12545	93	28	due	due	ADP
cet-12545	93	29	to	to	ADP
cet-12545	93	30	its	its	PRON
cet-12545	93	31	relation	relation	NOUN
cet-12545	93	32	with	with	ADP
cet-12545	93	33	the	the	DET
cet-12545	93	34	potential	potential	ADJ
cet-12545	93	35	sites	site	NOUN
cet-12545	93	36	285	285	NUM
cet-12545	93	37	to	to	PART
cet-12545	93	38	interact	interact	VERB
cet-12545	93	39	with	with	ADP
cet-12545	93	40	a	a	DET
cet-12545	93	41	specific	specific	ADJ
cet-12545	93	42	target	target	NOUN
cet-12545	93	43	.	.	PUNCT
cet-12545	94	1	the	the	DET
cet-12545	94	2	selection	selection	NOUN
cet-12545	94	3	of	of	ADP
cet-12545	94	4	specific	specific	ADJ
cet-12545	94	5	loops	loop	NOUN
cet-12545	94	6	has	have	AUX
cet-12545	94	7	been	be	AUX
cet-12545	94	8	described	describe	VERB
cet-12545	94	9	to	to	PART
cet-12545	94	10	be	be	AUX
cet-12545	94	11	helpful	helpful	ADJ
cet-12545	94	12	to	to	PART
cet-12545	94	13	detect	detect	VERB
cet-12545	94	14	whole	whole	ADJ
cet-12545	94	15	cell	cell	NOUN
cet-12545	94	16	of	of	ADP
cet-12545	94	17	e.	e.	PROPN
cet-12545	94	18	coli	coli	PROPN
cet-12545	94	19	(	(	PUNCT
cet-12545	94	20	dua	dua	X
cet-12545	94	21	et	et	PROPN
cet-12545	94	22	al	al	PROPN
cet-12545	94	23	.	.	PROPN
cet-12545	94	24	,	,	PUNCT
cet-12545	94	25	2016	2016	NUM
cet-12545	94	26	)	)	PUNCT
cet-12545	94	27	,	,	PUNCT
cet-12545	94	28	and	and	CCONJ
cet-12545	94	29	the	the	DET
cet-12545	94	30	presence	presence	NOUN
cet-12545	94	31	of	of	ADP
cet-12545	94	32	two	two	NUM
cet-12545	94	33	external	external	ADJ
cet-12545	94	34	loops	loop	NOUN
cet-12545	94	35	in	in	ADP
cet-12545	94	36	the	the	DET
cet-12545	94	37	same	same	ADJ
cet-12545	94	38	aptamer	aptamer	NOUN
cet-12545	94	39	could	could	AUX
cet-12545	94	40	help	help	VERB
cet-12545	94	41	to	to	ADP
cet-12545	94	42	the	the	DET
cet-12545	94	43	target	target	NOUN
cet-12545	94	44	recognition	recognition	NOUN
cet-12545	94	45	as	as	ADP
cet-12545	94	46	i-1	i-1	ADJ
cet-12545	94	47	aptamer	aptamer	NOUN
cet-12545	94	48	to	to	ADP
cet-12545	94	49	e.	e.	PROPN
cet-12545	94	50	coli	coli	PROPN
cet-12545	94	51	o157	o157	PROPN
cet-12545	94	52	:	:	PUNCT
cet-12545	94	53	h7	h7	PROPN
cet-12545	94	54	(	(	PUNCT
cet-12545	94	55	lee	lee	PROPN
cet-12545	94	56	et	et	PROPN
cet-12545	94	57	al	al	PROPN
cet-12545	94	58	.	.	PROPN
cet-12545	94	59	,	,	PUNCT
cet-12545	94	60	2012	2012	NUM
cet-12545	94	61	)	)	PUNCT
cet-12545	94	62	.	.	PUNCT
cet-12545	95	1	different	different	ADJ
cet-12545	95	2	combinations	combination	NOUN
cet-12545	95	3	of	of	ADP
cet-12545	95	4	two	two	NUM
cet-12545	95	5	sequences	sequence	NOUN
cet-12545	95	6	from	from	ADP
cet-12545	95	7	the	the	DET
cet-12545	95	8	external	external	ADJ
cet-12545	95	9	loop	loop	NOUN
cet-12545	95	10	from	from	ADP
cet-12545	95	11	s1	s1	PROPN
cet-12545	95	12	family	family	NOUN
cet-12545	95	13	were	be	AUX
cet-12545	95	14	used	use	VERB
cet-12545	95	15	to	to	PART
cet-12545	95	16	build	build	VERB
cet-12545	95	17	hybrid	hybrid	ADJ
cet-12545	95	18	aptamers	aptamer	NOUN
cet-12545	95	19	.	.	PUNCT
cet-12545	96	1	also	also	ADV
cet-12545	96	2	,	,	PUNCT
cet-12545	96	3	five	five	NUM
cet-12545	96	4	thymines	thymine	NOUN
cet-12545	96	5	were	be	AUX
cet-12545	96	6	added	add	VERB
cet-12545	96	7	at	at	ADP
cet-12545	96	8	the	the	DET
cet-12545	96	9	5	5	NUM
cet-12545	96	10	'	'	PART
cet-12545	96	11	end	end	NOUN
cet-12545	96	12	,	,	PUNCT
cet-12545	96	13	which	which	PRON
cet-12545	96	14	provides	provide	VERB
cet-12545	96	15	flexibility	flexibility	NOUN
cet-12545	96	16	to	to	ADP
cet-12545	96	17	the	the	DET
cet-12545	96	18	aptamers	aptamer	NOUN
cet-12545	96	19	and	and	CCONJ
cet-12545	96	20	could	could	AUX
cet-12545	96	21	improve	improve	VERB
cet-12545	96	22	the	the	DET
cet-12545	96	23	density	density	NOUN
cet-12545	96	24	of	of	ADP
cet-12545	96	25	them	they	PRON
cet-12545	96	26	on	on	ADP
cet-12545	96	27	the	the	DET
cet-12545	96	28	surface	surface	NOUN
cet-12545	96	29	of	of	ADP
cet-12545	96	30	the	the	DET
cet-12545	96	31	electrode	electrode	NOUN
cet-12545	96	32	(	(	PUNCT
cet-12545	96	33	balamurugan	balamurugan	VERB
cet-12545	96	34	et	et	PROPN
cet-12545	96	35	al	al	PROPN
cet-12545	96	36	.	.	PROPN
cet-12545	96	37	,	,	PUNCT
cet-12545	96	38	2008	2008	NUM
cet-12545	96	39	)	)	PUNCT
cet-12545	96	40	.	.	PUNCT
cet-12545	97	1	finally	finally	ADV
cet-12545	97	2	,	,	PUNCT
cet-12545	97	3	a	a	DET
cet-12545	97	4	thymineguanine	thymineguanine	ADJ
cet-12545	97	5	-	-	PUNCT
cet-12545	97	6	adenine	adenine	ADJ
cet-12545	97	7	triplet	triplet	NOUN
cet-12545	97	8	was	be	AUX
cet-12545	97	9	added	add	VERB
cet-12545	97	10	at	at	ADP
cet-12545	97	11	the	the	DET
cet-12545	97	12	3	3	NUM
cet-12545	97	13	'	'	PART
cet-12545	97	14	end	end	NOUN
cet-12545	97	15	to	to	PART
cet-12545	97	16	ensure	ensure	VERB
cet-12545	97	17	base	base	NOUN
cet-12545	97	18	pairing	pairing	NOUN
cet-12545	97	19	and	and	CCONJ
cet-12545	97	20	to	to	PART
cet-12545	97	21	improve	improve	VERB
cet-12545	97	22	the	the	DET
cet-12545	97	23	frequency	frequency	NOUN
cet-12545	97	24	of	of	ADP
cet-12545	97	25	the	the	DET
cet-12545	97	26	mfe	mfe	PROPN
cet-12545	97	27	.	.	PROPN
cet-12545	98	1	with	with	ADP
cet-12545	98	2	these	these	DET
cet-12545	98	3	considerations	consideration	NOUN
cet-12545	98	4	,	,	PUNCT
cet-12545	98	5	two	two	NUM
cet-12545	98	6	representative	representative	ADJ
cet-12545	98	7	sequences	sequence	NOUN
cet-12545	98	8	were	be	AUX
cet-12545	98	9	obtained	obtain	VERB
cet-12545	98	10	and	and	CCONJ
cet-12545	98	11	named	name	VERB
cet-12545	98	12	apt517	apt517	PROPN
cet-12545	98	13	and	and	CCONJ
cet-12545	98	14	apt917	apt917	PROPN
cet-12545	98	15	(	(	PUNCT
cet-12545	98	16	table	table	NOUN
cet-12545	98	17	1	1	NUM
cet-12545	98	18	)	)	PUNCT
cet-12545	98	19	.	.	PUNCT
cet-12545	99	1	spatial	spatial	ADJ
cet-12545	99	2	2d	2d	NUM
cet-12545	99	3	conformation	conformation	NOUN
cet-12545	99	4	of	of	ADP
cet-12545	99	5	apt517	apt517	PROPN
cet-12545	99	6	and	and	CCONJ
cet-12545	99	7	apt917	apt917	PROPN
cet-12545	99	8	were	be	AUX
cet-12545	99	9	elucidated	elucidate	VERB
cet-12545	99	10	using	use	VERB
cet-12545	99	11	an	an	DET
cet-12545	99	12	rna	rna	NOUN
cet-12545	99	13	approximation	approximation	NOUN
cet-12545	99	14	.	.	PUNCT
cet-12545	100	1	unlike	unlike	ADP
cet-12545	100	2	s1	s1	PROPN
cet-12545	100	3	family	family	NOUN
cet-12545	100	4	,	,	PUNCT
cet-12545	100	5	the	the	DET
cet-12545	100	6	new	new	ADJ
cet-12545	100	7	hybrids	hybrid	NOUN
cet-12545	100	8	have	have	VERB
cet-12545	100	9	two	two	NUM
cet-12545	100	10	external	external	ADJ
cet-12545	100	11	loops	loop	NOUN
cet-12545	100	12	.	.	PUNCT
cet-12545	101	1	however	however	ADV
cet-12545	101	2	,	,	PUNCT
cet-12545	101	3	the	the	DET
cet-12545	101	4	minor	minor	ADJ
cet-12545	101	5	loop	loop	NOUN
cet-12545	101	6	conformation	conformation	NOUN
cet-12545	101	7	of	of	ADP
cet-12545	101	8	apt517	apt517	PROPN
cet-12545	101	9	does	do	AUX
cet-12545	101	10	not	not	PART
cet-12545	101	11	have	have	VERB
cet-12545	101	12	the	the	DET
cet-12545	101	13	same	same	ADJ
cet-12545	101	14	free	free	ADJ
cet-12545	101	15	nucleotides	nucleotide	NOUN
cet-12545	101	16	as	as	ADP
cet-12545	101	17	s1	s1	PROPN
cet-12545	101	18	model	model	NOUN
cet-12545	101	19	.	.	PUNCT
cet-12545	102	1	this	this	DET
cet-12545	102	2	change	change	NOUN
cet-12545	102	3	was	be	AUX
cet-12545	102	4	observed	observe	VERB
cet-12545	102	5	too	too	ADV
cet-12545	102	6	when	when	SCONJ
cet-12545	102	7	the	the	DET
cet-12545	102	8	external	external	ADJ
cet-12545	102	9	loop	loop	NOUN
cet-12545	102	10	from	from	ADP
cet-12545	102	11	the	the	DET
cet-12545	102	12	s2	s2	NOUN
cet-12545	102	13	aptamer	aptamer	NOUN
cet-12545	102	14	was	be	AUX
cet-12545	102	15	used	use	VERB
cet-12545	102	16	in	in	ADP
cet-12545	102	17	apt917	apt917	PROPN
cet-12545	102	18	.	.	PUNCT
cet-12545	103	1	only	only	ADV
cet-12545	103	2	the	the	DET
cet-12545	103	3	external	external	ADJ
cet-12545	103	4	loop	loop	NOUN
cet-12545	103	5	from	from	ADP
cet-12545	103	6	s3	s3	PROPN
cet-12545	103	7	aptamer	aptamer	NOUN
cet-12545	103	8	remains	remain	VERB
cet-12545	103	9	in	in	ADP
cet-12545	103	10	its	its	PRON
cet-12545	103	11	structure	structure	NOUN
cet-12545	103	12	in	in	ADP
cet-12545	103	13	the	the	DET
cet-12545	103	14	new	new	ADJ
cet-12545	103	15	hybrid	hybrid	ADJ
cet-12545	103	16	aptamer	aptamer	NOUN
cet-12545	103	17	(	(	PUNCT
cet-12545	103	18	figure	figure	NOUN
cet-12545	103	19	1	1	NUM
cet-12545	103	20	)	)	PUNCT
cet-12545	103	21	.	.	PUNCT
cet-12545	104	1	finally	finally	ADV
cet-12545	104	2	,	,	PUNCT
cet-12545	104	3	aptamer	aptamer	PROPN
cet-12545	104	4	apt917	apt917	PROPN
cet-12545	104	5	was	be	AUX
cet-12545	104	6	chosen	choose	VERB
cet-12545	104	7	to	to	PART
cet-12545	104	8	attach	attach	VERB
cet-12545	104	9	to	to	ADP
cet-12545	104	10	working	work	VERB
cet-12545	104	11	electrode	electrode	NOUN
cet-12545	104	12	of	of	ADP
cet-12545	104	13	the	the	DET
cet-12545	104	14	biosensor	biosensor	NOUN
cet-12545	104	15	due	due	ADP
cet-12545	104	16	to	to	ADP
cet-12545	104	17	its	its	PRON
cet-12545	104	18	minimum	minimum	ADJ
cet-12545	104	19	free	free	ADJ
cet-12545	104	20	energy	energy	NOUN
cet-12545	104	21	(	(	PUNCT
cet-12545	104	22	mfe	mfe	NOUN
cet-12545	104	23	)	)	PUNCT
cet-12545	104	24	and	and	CCONJ
cet-12545	104	25	high	high	ADJ
cet-12545	104	26	percent	percent	NOUN
cet-12545	104	27	to	to	ADP
cet-12545	104	28	the	the	DET
cet-12545	104	29	frequency	frequency	NOUN
cet-12545	104	30	of	of	ADP
cet-12545	104	31	mfe	mfe	PROPN
cet-12545	104	32	.	.	PROPN
cet-12545	104	33	figure	figure	NOUN
cet-12545	104	34	1	1	NUM
cet-12545	104	35	:	:	PUNCT
cet-12545	104	36	rna	rna	NOUN
cet-12545	104	37	2d	2d	NOUN
cet-12545	104	38	representation	representation	NOUN
cet-12545	104	39	of	of	ADP
cet-12545	104	40	family	family	NOUN
cet-12545	104	41	aptamer	aptamer	NOUN
cet-12545	104	42	s1	s1	PROPN
cet-12545	104	43	and	and	CCONJ
cet-12545	104	44	hybrid	hybrid	ADJ
cet-12545	104	45	aptamer	aptamer	NOUN
cet-12545	104	46	designed	design	VERB
cet-12545	104	47	in	in	ADP
cet-12545	104	48	this	this	DET
cet-12545	104	49	work	work	NOUN
cet-12545	104	50	(	(	PUNCT
cet-12545	104	51	apt517	apt517	PROPN
cet-12545	104	52	and	and	CCONJ
cet-12545	104	53	apt917	apt917	PROPN
cet-12545	104	54	)	)	PUNCT
cet-12545	104	55	.	.	PUNCT
cet-12545	105	1	blue	blue	ADJ
cet-12545	105	2	nucleotides	nucleotide	NOUN
cet-12545	105	3	represent	represent	VERB
cet-12545	105	4	external	external	ADJ
cet-12545	105	5	loops	loop	NOUN
cet-12545	105	6	,	,	PUNCT
cet-12545	105	7	green	green	ADJ
cet-12545	105	8	complementary	complementary	ADJ
cet-12545	105	9	and	and	CCONJ
cet-12545	105	10	orange	orange	ADJ
cet-12545	105	11	nucleotides	nucleotide	NOUN
cet-12545	105	12	with	with	ADP
cet-12545	105	13	random	random	ADJ
cet-12545	105	14	disposition	disposition	NOUN
cet-12545	105	15	.	.	PUNCT
cet-12545	106	1	3.2	3.2	NUM
cet-12545	106	2	electrochemical	electrochemical	ADJ
cet-12545	106	3	and	and	CCONJ
cet-12545	106	4	structural	structural	ADJ
cet-12545	106	5	characterization	characterization	NOUN
cet-12545	106	6	of	of	ADP
cet-12545	106	7	the	the	DET
cet-12545	106	8	biosensors	biosensor	NOUN
cet-12545	106	9	the	the	DET
cet-12545	106	10	surface	surface	NOUN
cet-12545	106	11	of	of	ADP
cet-12545	106	12	the	the	DET
cet-12545	106	13	working	work	VERB
cet-12545	106	14	electrode	electrode	NOUN
cet-12545	106	15	of	of	ADP
cet-12545	106	16	spes	spe	NOUN
cet-12545	106	17	was	be	AUX
cet-12545	106	18	modified	modify	VERB
cet-12545	106	19	by	by	ADP
cet-12545	106	20	electrodeposition	electrodeposition	NOUN
cet-12545	106	21	of	of	ADP
cet-12545	106	22	gold	gold	ADJ
cet-12545	106	23	nanoparticles	nanoparticle	NOUN
cet-12545	106	24	(	(	PUNCT
cet-12545	106	25	aunps	aunps	ADJ
cet-12545	106	26	)	)	PUNCT
cet-12545	106	27	by	by	ADP
cet-12545	106	28	chronoamperometry	chronoamperometry	PROPN
cet-12545	106	29	,	,	PUNCT
cet-12545	106	30	and	and	CCONJ
cet-12545	106	31	the	the	DET
cet-12545	106	32	results	result	NOUN
cet-12545	106	33	are	be	AUX
cet-12545	106	34	shown	show	VERB
cet-12545	106	35	in	in	ADP
cet-12545	106	36	figure	figure	NOUN
cet-12545	106	37	2a	2a	NUM
cet-12545	106	38	.	.	PUNCT
cet-12545	107	1	this	this	DET
cet-12545	107	2	method	method	NOUN
cet-12545	107	3	leads	lead	VERB
cet-12545	107	4	to	to	ADP
cet-12545	107	5	obtaining	obtain	VERB
cet-12545	107	6	well	well	ADV
cet-12545	107	7	-	-	PUNCT
cet-12545	107	8	distributed	distribute	VERB
cet-12545	107	9	nanoparticles	nanoparticle	NOUN
cet-12545	107	10	on	on	ADP
cet-12545	107	11	the	the	DET
cet-12545	107	12	surface	surface	NOUN
cet-12545	107	13	with	with	ADP
cet-12545	107	14	sizes	size	NOUN
cet-12545	107	15	around	around	ADP
cet-12545	107	16	60	60	NUM
cet-12545	107	17	-	-	SYM
cet-12545	107	18	90	90	NUM
cet-12545	107	19	nm	nm	NOUN
cet-12545	107	20	(	(	PUNCT
cet-12545	107	21	figure	figure	NOUN
cet-12545	107	22	2a	2a	NUM
cet-12545	107	23	,	,	PUNCT
cet-12545	107	24	insert	insert	NOUN
cet-12545	107	25	)	)	PUNCT
cet-12545	107	26	.	.	PUNCT
cet-12545	108	1	figures	figure	NOUN
cet-12545	108	2	2b	2b	NOUN
cet-12545	108	3	-	-	PUNCT
cet-12545	108	4	d	d	NOUN
cet-12545	108	5	show	show	VERB
cet-12545	108	6	the	the	DET
cet-12545	108	7	effect	effect	NOUN
cet-12545	108	8	that	that	SCONJ
cet-12545	108	9	each	each	PRON
cet-12545	108	10	of	of	ADP
cet-12545	108	11	the	the	DET
cet-12545	108	12	modifications	modification	NOUN
cet-12545	108	13	made	make	VERB
cet-12545	108	14	has	have	VERB
cet-12545	108	15	on	on	ADP
cet-12545	108	16	the	the	DET
cet-12545	108	17	impedance	impedance	NOUN
cet-12545	108	18	of	of	ADP
cet-12545	108	19	the	the	DET
cet-12545	108	20	electrode	electrode	NOUN
cet-12545	108	21	represented	represent	VERB
cet-12545	108	22	in	in	ADP
cet-12545	108	23	the	the	DET
cet-12545	108	24	nyquist	nyquist	NOUN
cet-12545	108	25	diagrams	diagram	NOUN
cet-12545	108	26	.	.	PUNCT
cet-12545	109	1	as	as	SCONJ
cet-12545	109	2	expected	expect	VERB
cet-12545	109	3	,	,	PUNCT
cet-12545	109	4	it	it	PRON
cet-12545	109	5	is	be	AUX
cet-12545	109	6	clearly	clearly	ADV
cet-12545	109	7	observed	observe	VERB
cet-12545	109	8	that	that	SCONJ
cet-12545	109	9	the	the	DET
cet-12545	109	10	electrode	electrode	NOUN
cet-12545	109	11	impedance	impedance	NOUN
cet-12545	109	12	decreases	decrease	VERB
cet-12545	109	13	considerably	considerably	ADV
cet-12545	109	14	when	when	SCONJ
cet-12545	109	15	the	the	DET
cet-12545	109	16	aunps	aunps	NOUN
cet-12545	109	17	are	be	AUX
cet-12545	109	18	deposited	deposit	VERB
cet-12545	109	19	(	(	PUNCT
cet-12545	109	20	red	red	ADJ
cet-12545	109	21	curves	curve	NOUN
cet-12545	109	22	)	)	PUNCT
cet-12545	109	23	compared	compare	VERB
cet-12545	109	24	to	to	ADP
cet-12545	109	25	the	the	DET
cet-12545	109	26	signal	signal	NOUN
cet-12545	109	27	from	from	ADP
cet-12545	109	28	the	the	DET
cet-12545	109	29	new	new	ADJ
cet-12545	109	30	electrode	electrode	NOUN
cet-12545	109	31	(	(	PUNCT
cet-12545	109	32	black	black	ADJ
cet-12545	109	33	curves	curve	NOUN
cet-12545	109	34	)	)	PUNCT
cet-12545	109	35	.	.	PUNCT
cet-12545	110	1	this	this	PRON
cet-12545	110	2	is	be	AUX
cet-12545	110	3	evidenced	evidence	VERB
cet-12545	110	4	by	by	ADP
cet-12545	110	5	the	the	DET
cet-12545	110	6	decrease	decrease	NOUN
cet-12545	110	7	in	in	ADP
cet-12545	110	8	the	the	DET
cet-12545	110	9	diameter	diameter	NOUN
cet-12545	110	10	of	of	ADP
cet-12545	110	11	the	the	DET
cet-12545	110	12	semicircle	semicircle	NOUN
cet-12545	110	13	.	.	PUNCT
cet-12545	111	1	figure	figure	VERB
cet-12545	111	2	2	2	NUM
cet-12545	111	3	:	:	PUNCT
cet-12545	111	4	current	current	ADJ
cet-12545	111	5	vs	vs	ADP
cet-12545	111	6	time	time	NOUN
cet-12545	111	7	response	response	NOUN
cet-12545	111	8	(	(	PUNCT
cet-12545	111	9	a	a	X
cet-12545	111	10	)	)	PUNCT
cet-12545	111	11	in	in	ADP
cet-12545	111	12	the	the	DET
cet-12545	111	13	chronoamperometric	chronoamperometric	ADJ
cet-12545	111	14	electrodeposition	electrodeposition	NOUN
cet-12545	111	15	of	of	ADP
cet-12545	111	16	aunps	aunps	PROPN
cet-12545	111	17	.	.	PUNCT
cet-12545	112	1	insert	insert	PROPN
cet-12545	112	2	:	:	PUNCT
cet-12545	112	3	sem	sem	ADJ
cet-12545	112	4	image	image	NOUN
cet-12545	112	5	of	of	ADP
cet-12545	112	6	the	the	DET
cet-12545	112	7	aunps	aunps	ADJ
cet-12545	112	8	-	-	PUNCT
cet-12545	112	9	modified	modify	VERB
cet-12545	112	10	surface	surface	NOUN
cet-12545	112	11	of	of	ADP
cet-12545	112	12	spes	spe	NOUN
cet-12545	112	13	(	(	PUNCT
cet-12545	112	14	scale	scale	NOUN
cet-12545	112	15	bar	bar	NOUN
cet-12545	112	16	1	1	NUM
cet-12545	112	17	µm	µm	NOUN
cet-12545	112	18	)	)	PUNCT
cet-12545	112	19	.	.	PUNCT
cet-12545	113	1	eis	eis	PROPN
cet-12545	113	2	response	response	NOUN
cet-12545	113	3	of	of	ADP
cet-12545	113	4	the	the	DET
cet-12545	113	5	biosensor	biosensor	NOUN
cet-12545	113	6	by	by	ADP
cet-12545	113	7	using	use	VERB
cet-12545	113	8	20	20	NUM
cet-12545	113	9	nm	nm	NOUN
cet-12545	113	10	(	(	PUNCT
cet-12545	113	11	b	b	NOUN
cet-12545	113	12	)	)	PUNCT
cet-12545	113	13	,	,	PUNCT
cet-12545	113	14	50	50	NUM
cet-12545	113	15	nm	nm	NOUN
cet-12545	113	16	(	(	PUNCT
cet-12545	113	17	c	c	NOUN
cet-12545	113	18	)	)	PUNCT
cet-12545	113	19	and	and	CCONJ
cet-12545	113	20	100	100	NUM
cet-12545	113	21	nm	nm	NOUN
cet-12545	113	22	(	(	PUNCT
cet-12545	113	23	d	d	NOUN
cet-12545	113	24	)	)	PUNCT
cet-12545	113	25	of	of	ADP
cet-12545	113	26	aqueous	aqueous	ADJ
cet-12545	113	27	solutions	solution	NOUN
cet-12545	113	28	of	of	ADP
cet-12545	113	29	apt917	apt917	PROPN
cet-12545	113	30	.	.	PUNCT
cet-12545	114	1	curves	curve	NOUN
cet-12545	114	2	black	black	ADJ
cet-12545	114	3	,	,	PUNCT
cet-12545	114	4	red	red	ADJ
cet-12545	114	5	and	and	CCONJ
cet-12545	114	6	blue	blue	ADJ
cet-12545	114	7	correspond	correspond	NOUN
cet-12545	114	8	to	to	ADP
cet-12545	114	9	spe	spe	PROPN
cet-12545	114	10	,	,	PUNCT
cet-12545	114	11	spe	spe	PROPN
cet-12545	114	12	/	/	SYM
cet-12545	114	13	aunps	aunps	PROPN
cet-12545	114	14	and	and	CCONJ
cet-12545	114	15	spe	spe	PROPN
cet-12545	114	16	/	/	SYM
cet-12545	114	17	aunps	aunps	ADJ
cet-12545	114	18	/	/	SYM
cet-12545	114	19	apt917	apt917	PROPN
cet-12545	114	20	,	,	PUNCT
cet-12545	114	21	respectively	respectively	ADV
cet-12545	114	22	.	.	PUNCT
cet-12545	115	1	for	for	ADP
cet-12545	115	2	its	its	PRON
cet-12545	115	3	part	part	NOUN
cet-12545	115	4	,	,	PUNCT
cet-12545	115	5	the	the	DET
cet-12545	115	6	use	use	NOUN
cet-12545	115	7	of	of	ADP
cet-12545	115	8	a	a	DET
cet-12545	115	9	concentration	concentration	NOUN
cet-12545	115	10	of	of	ADP
cet-12545	115	11	aptamer	aptamer	NOUN
cet-12545	115	12	of	of	ADP
cet-12545	115	13	20	20	NUM
cet-12545	115	14	nm	nm	NOUN
cet-12545	115	15	does	do	AUX
cet-12545	115	16	not	not	PART
cet-12545	115	17	clearly	clearly	ADV
cet-12545	115	18	modify	modify	VERB
cet-12545	115	19	the	the	DET
cet-12545	115	20	impedance	impedance	NOUN
cet-12545	115	21	of	of	ADP
cet-12545	115	22	the	the	DET
cet-12545	115	23	electrode	electrode	NOUN
cet-12545	115	24	(	(	PUNCT
cet-12545	115	25	blue	blue	ADJ
cet-12545	115	26	curve	curve	NOUN
cet-12545	115	27	in	in	ADP
cet-12545	115	28	figure	figure	NOUN
cet-12545	115	29	2b	2b	NOUN
cet-12545	115	30	)	)	PUNCT
cet-12545	115	31	.	.	PUNCT
cet-12545	116	1	this	this	PRON
cet-12545	116	2	can	can	AUX
cet-12545	116	3	be	be	AUX
cet-12545	116	4	attributed	attribute	VERB
cet-12545	116	5	to	to	ADP
cet-12545	116	6	the	the	DET
cet-12545	116	7	fact	fact	NOUN
cet-12545	116	8	that	that	SCONJ
cet-12545	116	9	this	this	DET
cet-12545	116	10	concentration	concentration	NOUN
cet-12545	116	11	is	be	AUX
cet-12545	116	12	not	not	PART
cet-12545	116	13	sufficient	sufficient	ADJ
cet-12545	116	14	to	to	PART
cet-12545	116	15	immobilize	immobilize	VERB
cet-12545	116	16	a	a	DET
cet-12545	116	17	considerable	considerable	ADJ
cet-12545	116	18	amount	amount	NOUN
cet-12545	116	19	of	of	ADP
cet-12545	116	20	the	the	DET
cet-12545	116	21	aptamer	aptamer	NOUN
cet-12545	116	22	.	.	PUNCT
cet-12545	117	1	on	on	ADP
cet-12545	117	2	the	the	DET
cet-12545	117	3	other	other	ADJ
cet-12545	117	4	hand	hand	NOUN
cet-12545	117	5	,	,	PUNCT
cet-12545	117	6	the	the	DET
cet-12545	117	7	impedance	impedance	NOUN
cet-12545	117	8	of	of	ADP
cet-12545	117	9	the	the	DET
cet-12545	117	10	electrode	electrode	NOUN
cet-12545	117	11	is	be	AUX
cet-12545	117	12	increased	increase	VERB
cet-12545	117	13	when	when	SCONJ
cet-12545	117	14	the	the	DET
cet-12545	117	15	concentrations	concentration	NOUN
cet-12545	117	16	of	of	ADP
cet-12545	117	17	50	50	NUM
cet-12545	117	18	and	and	CCONJ
cet-12545	117	19	100	100	NUM
cet-12545	117	20	nm	nm	NOUN
cet-12545	117	21	are	be	AUX
cet-12545	117	22	used	use	VERB
cet-12545	117	23	(	(	PUNCT
cet-12545	117	24	blue	blue	ADJ
cet-12545	117	25	curves	curve	NOUN
cet-12545	117	26	in	in	ADP
cet-12545	117	27	figure	figure	NOUN
cet-12545	117	28	2c	2c	NOUN
cet-12545	117	29	-	-	PUNCT
cet-12545	117	30	d	d	NOUN
cet-12545	117	31	)	)	PUNCT
cet-12545	117	32	,	,	PUNCT
cet-12545	117	33	being	be	AUX
cet-12545	117	34	notably	notably	ADV
cet-12545	117	35	higher	high	ADJ
cet-12545	117	36	at	at	ADP
cet-12545	117	37	100	100	NUM
cet-12545	117	38	nm	nm	NOUN
cet-12545	117	39	.	.	PUNCT
cet-12545	118	1	this	this	DET
cet-12545	118	2	effect	effect	NOUN
cet-12545	118	3	is	be	AUX
cet-12545	118	4	attributed	attribute	VERB
cet-12545	118	5	to	to	ADP
cet-12545	118	6	the	the	DET
cet-12545	118	7	immobilization	immobilization	NOUN
cet-12545	118	8	of	of	ADP
cet-12545	118	9	the	the	DET
cet-12545	118	10	aptamer	aptamer	NOUN
cet-12545	118	11	on	on	ADP
cet-12545	118	12	the	the	DET
cet-12545	118	13	gold	gold	NOUN
cet-12545	118	14	nanoparticles	nanoparticle	NOUN
cet-12545	118	15	.	.	PUNCT
cet-12545	119	1	3.3	3.3	NUM
cet-12545	119	2	evaluation	evaluation	NOUN
cet-12545	119	3	of	of	ADP
cet-12545	119	4	the	the	DET
cet-12545	119	5	biosensors	biosensor	NOUN
cet-12545	119	6	on	on	ADP
cet-12545	119	7	the	the	DET
cet-12545	119	8	detection	detection	NOUN
cet-12545	119	9	of	of	ADP
cet-12545	119	10	escherichia	escherichia	NOUN
cet-12545	119	11	coli	coli	NOUN
cet-12545	119	12	o157	o157	PROPN
cet-12545	119	13	:	:	PUNCT
cet-12545	119	14	h7	h7	NOUN
cet-12545	119	15	the	the	DET
cet-12545	119	16	prepared	prepare	VERB
cet-12545	119	17	biosensors	biosensor	NOUN
cet-12545	119	18	were	be	AUX
cet-12545	119	19	evaluated	evaluate	VERB
cet-12545	119	20	in	in	ADP
cet-12545	119	21	the	the	DET
cet-12545	119	22	detection	detection	NOUN
cet-12545	119	23	of	of	ADP
cet-12545	119	24	e.	e.	PROPN
cet-12545	119	25	coli	coli	PROPN
cet-12545	119	26	o157	o157	PROPN
cet-12545	119	27	:	:	PUNCT
cet-12545	119	28	h7	h7	NOUN
cet-12545	119	29	at	at	ADP
cet-12545	119	30	concentrations	concentration	NOUN
cet-12545	119	31	between	between	ADP
cet-12545	119	32	0	0	NUM
cet-12545	119	33	and	and	CCONJ
cet-12545	119	34	1000	1000	NUM
cet-12545	119	35	cfu	cfu	NOUN
cet-12545	119	36	/	/	SYM
cet-12545	119	37	ml	ml	NOUN
cet-12545	119	38	,	,	PUNCT
cet-12545	119	39	and	and	CCONJ
cet-12545	119	40	the	the	DET
cet-12545	119	41	results	result	NOUN
cet-12545	119	42	are	be	AUX
cet-12545	119	43	shown	show	VERB
cet-12545	119	44	in	in	ADP
cet-12545	119	45	figure	figure	NOUN
cet-12545	119	46	3	3	NUM
cet-12545	119	47	.	.	PUNCT
cet-12545	120	1	the	the	DET
cet-12545	120	2	biosensor	biosensor	NOUN
cet-12545	120	3	prepared	prepare	VERB
cet-12545	120	4	with	with	ADP
cet-12545	120	5	a	a	DET
cet-12545	120	6	20	20	NUM
cet-12545	120	7	nm	nm	NOUN
cet-12545	120	8	solution	solution	NOUN
cet-12545	120	9	of	of	ADP
cet-12545	120	10	the	the	DET
cet-12545	120	11	aptamer	aptamer	NOUN
cet-12545	120	12	does	do	AUX
cet-12545	120	13	not	not	PART
cet-12545	120	14	show	show	VERB
cet-12545	120	15	changes	change	NOUN
cet-12545	120	16	in	in	ADP
cet-12545	120	17	the	the	DET
cet-12545	120	18	electrochemical	electrochemical	ADJ
cet-12545	120	19	impedance	impedance	NOUN
cet-12545	120	20	signal	signal	NOUN
cet-12545	120	21	when	when	SCONJ
cet-12545	120	22	exposed	expose	VERB
cet-12545	120	23	to	to	ADP
cet-12545	120	24	different	different	ADJ
cet-12545	120	25	concentrations	concentration	NOUN
cet-12545	120	26	of	of	ADP
cet-12545	120	27	the	the	DET
cet-12545	120	28	microorganism	microorganism	NOUN
cet-12545	120	29	(	(	PUNCT
cet-12545	120	30	figure	figure	NOUN
cet-12545	120	31	3a	3a	NUM
cet-12545	120	32	)	)	PUNCT
cet-12545	120	33	.	.	PUNCT
cet-12545	121	1	this	this	PRON
cet-12545	121	2	is	be	AUX
cet-12545	121	3	attributed	attribute	VERB
cet-12545	121	4	to	to	ADP
cet-12545	121	5	the	the	DET
cet-12545	121	6	possible	possible	ADJ
cet-12545	121	7	low	low	ADJ
cet-12545	121	8	or	or	CCONJ
cet-12545	121	9	null	null	ADJ
cet-12545	121	10	amount	amount	NOUN
cet-12545	121	11	of	of	ADP
cet-12545	121	12	the	the	DET
cet-12545	121	13	286	286	NUM
cet-12545	121	14	aptamer	aptamer	NOUN
cet-12545	121	15	on	on	ADP
cet-12545	121	16	the	the	DET
cet-12545	121	17	surface	surface	NOUN
cet-12545	121	18	of	of	ADP
cet-12545	121	19	the	the	DET
cet-12545	121	20	electrode	electrode	NOUN
cet-12545	121	21	,	,	PUNCT
cet-12545	121	22	which	which	PRON
cet-12545	121	23	translates	translate	VERB
cet-12545	121	24	into	into	ADP
cet-12545	121	25	a	a	DET
cet-12545	121	26	null	null	ADJ
cet-12545	121	27	sensitive	sensitive	ADJ
cet-12545	121	28	response	response	NOUN
cet-12545	121	29	of	of	ADP
cet-12545	121	30	the	the	DET
cet-12545	121	31	biosensor	biosensor	NOUN
cet-12545	121	32	towards	towards	ADP
cet-12545	121	33	e.	e.	PROPN
cet-12545	121	34	coli	coli	PROPN
cet-12545	121	35	.	.	PUNCT
cet-12545	122	1	finally	finally	ADV
cet-12545	122	2	,	,	PUNCT
cet-12545	122	3	this	this	PRON
cet-12545	122	4	is	be	AUX
cet-12545	122	5	evidenced	evidence	VERB
cet-12545	122	6	by	by	ADP
cet-12545	122	7	the	the	DET
cet-12545	122	8	fact	fact	NOUN
cet-12545	122	9	that	that	SCONJ
cet-12545	122	10	there	there	PRON
cet-12545	122	11	is	be	VERB
cet-12545	122	12	no	no	DET
cet-12545	122	13	correlation	correlation	NOUN
cet-12545	122	14	between	between	ADP
cet-12545	122	15	the	the	DET
cet-12545	122	16	concentration	concentration	NOUN
cet-12545	122	17	of	of	ADP
cet-12545	122	18	the	the	DET
cet-12545	122	19	microorganism	microorganism	NOUN
cet-12545	122	20	and	and	CCONJ
cet-12545	122	21	the	the	DET
cet-12545	122	22	quantified	quantified	ADJ
cet-12545	122	23	electrochemical	electrochemical	ADJ
cet-12545	122	24	signal	signal	NOUN
cet-12545	122	25	(	(	PUNCT
cet-12545	122	26	figure	figure	NOUN
cet-12545	122	27	3b	3b	NUM
cet-12545	122	28	)	)	PUNCT
cet-12545	122	29	.	.	PUNCT
cet-12545	123	1	figure	figure	VERB
cet-12545	123	2	3	3	NUM
cet-12545	123	3	:	:	PUNCT
cet-12545	123	4	results	result	NOUN
cet-12545	123	5	of	of	ADP
cet-12545	123	6	the	the	DET
cet-12545	123	7	evaluation	evaluation	NOUN
cet-12545	123	8	of	of	ADP
cet-12545	123	9	the	the	DET
cet-12545	123	10	apt917	apt917	NOUN
cet-12545	123	11	-	-	PUNCT
cet-12545	123	12	based	base	VERB
cet-12545	123	13	biosensor	biosensor	NOUN
cet-12545	123	14	.	.	PUNCT
cet-12545	124	1	the	the	DET
cet-12545	124	2	effect	effect	NOUN
cet-12545	124	3	of	of	ADP
cet-12545	124	4	the	the	DET
cet-12545	124	5	concentration	concentration	NOUN
cet-12545	124	6	of	of	ADP
cet-12545	124	7	aptamer	aptamer	NOUN
cet-12545	124	8	was	be	AUX
cet-12545	124	9	evaluated	evaluate	VERB
cet-12545	124	10	.	.	PUNCT
cet-12545	125	1	the	the	DET
cet-12545	125	2	linearization	linearization	NOUN
cet-12545	125	3	of	of	ADP
cet-12545	125	4	response	response	NOUN
cet-12545	125	5	of	of	ADP
cet-12545	125	6	each	each	DET
cet-12545	125	7	biosensor	biosensor	NOUN
cet-12545	125	8	is	be	AUX
cet-12545	125	9	presented	present	VERB
cet-12545	125	10	on	on	ADP
cet-12545	125	11	bottom	bottom	NOUN
cet-12545	125	12	.	.	PUNCT
cet-12545	126	1	the	the	DET
cet-12545	126	2	biosensor	biosensor	NOUN
cet-12545	126	3	prepared	prepare	VERB
cet-12545	126	4	with	with	ADP
cet-12545	126	5	50	50	NUM
cet-12545	126	6	nm	nm	NOUN
cet-12545	126	7	of	of	ADP
cet-12545	126	8	aptamer	aptamer	NOUN
cet-12545	126	9	presented	present	VERB
cet-12545	126	10	an	an	DET
cet-12545	126	11	adequate	adequate	ADJ
cet-12545	126	12	response	response	NOUN
cet-12545	126	13	since	since	SCONJ
cet-12545	126	14	the	the	DET
cet-12545	126	15	electrochemical	electrochemical	ADJ
cet-12545	126	16	impedance	impedance	NOUN
cet-12545	126	17	signal	signal	NOUN
cet-12545	126	18	increases	increase	NOUN
cet-12545	126	19	as	as	ADP
cet-12545	126	20	the	the	DET
cet-12545	126	21	concentration	concentration	NOUN
cet-12545	126	22	of	of	ADP
cet-12545	126	23	e.	e.	PROPN
cet-12545	126	24	coli	coli	PROPN
cet-12545	126	25	increases	increase	NOUN
cet-12545	126	26	(	(	PUNCT
cet-12545	126	27	figure	figure	NOUN
cet-12545	126	28	3c	3c	NUM
cet-12545	126	29	)	)	PUNCT
cet-12545	126	30	.	.	PUNCT
cet-12545	127	1	it	it	PRON
cet-12545	127	2	is	be	AUX
cet-12545	127	3	important	important	ADJ
cet-12545	127	4	to	to	PART
cet-12545	127	5	mention	mention	VERB
cet-12545	127	6	that	that	SCONJ
cet-12545	127	7	at	at	ADP
cet-12545	127	8	low	low	ADJ
cet-12545	127	9	concentrations	concentration	NOUN
cet-12545	127	10	of	of	ADP
cet-12545	127	11	e.	e.	PROPN
cet-12545	127	12	coli	coli	PROPN
cet-12545	127	13	,	,	PUNCT
cet-12545	127	14	the	the	DET
cet-12545	127	15	biosensor	biosensor	NOUN
cet-12545	127	16	presents	present	VERB
cet-12545	127	17	an	an	DET
cet-12545	127	18	apparent	apparent	ADJ
cet-12545	127	19	linear	linear	ADJ
cet-12545	127	20	response	response	NOUN
cet-12545	127	21	,	,	PUNCT
cet-12545	127	22	as	as	SCONJ
cet-12545	127	23	shown	show	VERB
cet-12545	127	24	in	in	ADP
cet-12545	127	25	the	the	DET
cet-12545	127	26	figure	figure	NOUN
cet-12545	127	27	3d	3d	NOUN
cet-12545	127	28	.	.	PUNCT
cet-12545	128	1	finally	finally	ADV
cet-12545	128	2	,	,	PUNCT
cet-12545	128	3	the	the	DET
cet-12545	128	4	immobilization	immobilization	NOUN
cet-12545	128	5	of	of	ADP
cet-12545	128	6	aptamer	aptamer	NOUN
cet-12545	128	7	is	be	AUX
cet-12545	128	8	ensured	ensure	VERB
cet-12545	128	9	when	when	SCONJ
cet-12545	128	10	concentrations	concentration	NOUN
cet-12545	128	11	of	of	ADP
cet-12545	128	12	100	100	NUM
cet-12545	128	13	nm	nm	NOUN
cet-12545	128	14	are	be	AUX
cet-12545	128	15	used	use	VERB
cet-12545	128	16	,	,	PUNCT
cet-12545	128	17	but	but	CCONJ
cet-12545	128	18	this	this	PRON
cet-12545	128	19	results	result	VERB
cet-12545	128	20	in	in	ADP
cet-12545	128	21	a	a	DET
cet-12545	128	22	saturation	saturation	NOUN
cet-12545	128	23	of	of	ADP
cet-12545	128	24	the	the	DET
cet-12545	128	25	surface	surface	NOUN
cet-12545	128	26	of	of	ADP
cet-12545	128	27	the	the	DET
cet-12545	128	28	electrode	electrode	NOUN
cet-12545	128	29	when	when	SCONJ
cet-12545	128	30	interacting	interact	VERB
cet-12545	128	31	with	with	ADP
cet-12545	128	32	the	the	DET
cet-12545	128	33	bacteria	bacteria	NOUN
cet-12545	128	34	.	.	PUNCT
cet-12545	129	1	this	this	PRON
cet-12545	129	2	is	be	AUX
cet-12545	129	3	reflected	reflect	VERB
cet-12545	129	4	by	by	ADP
cet-12545	129	5	the	the	DET
cet-12545	129	6	formation	formation	NOUN
cet-12545	129	7	of	of	ADP
cet-12545	129	8	two	two	NUM
cet-12545	129	9	semicircles	semicircle	NOUN
cet-12545	129	10	at	at	ADP
cet-12545	129	11	concentrations	concentration	NOUN
cet-12545	129	12	above	above	ADP
cet-12545	129	13	100	100	NUM
cet-12545	129	14	cfu	cfu	NOUN
cet-12545	129	15	/	/	SYM
cet-12545	129	16	ml	ml	PROPN
cet-12545	129	17	(	(	PUNCT
cet-12545	129	18	figure	figure	NOUN
cet-12545	129	19	3d	3d	NUM
cet-12545	129	20	)	)	PUNCT
cet-12545	129	21	.	.	PUNCT
cet-12545	130	1	finally	finally	ADV
cet-12545	130	2	,	,	PUNCT
cet-12545	130	3	this	this	PRON
cet-12545	130	4	results	result	VERB
cet-12545	130	5	that	that	SCONJ
cet-12545	130	6	the	the	DET
cet-12545	130	7	electrode	electrode	NOUN
cet-12545	130	8	does	do	AUX
cet-12545	130	9	not	not	PART
cet-12545	130	10	present	present	VERB
cet-12545	130	11	a	a	DET
cet-12545	130	12	linear	linear	ADJ
cet-12545	130	13	response	response	NOUN
cet-12545	130	14	between	between	ADP
cet-12545	130	15	the	the	DET
cet-12545	130	16	measured	measure	VERB
cet-12545	130	17	signal	signal	NOUN
cet-12545	130	18	and	and	CCONJ
cet-12545	130	19	the	the	DET
cet-12545	130	20	concentration	concentration	NOUN
cet-12545	130	21	of	of	ADP
cet-12545	130	22	e.	e.	PROPN
cet-12545	130	23	coli	coli	PROPN
cet-12545	130	24	in	in	ADP
cet-12545	130	25	the	the	DET
cet-12545	130	26	matrix	matrix	NOUN
cet-12545	130	27	(	(	PUNCT
cet-12545	130	28	figure	figure	NOUN
cet-12545	130	29	3e	3e	NOUN
cet-12545	130	30	)	)	PUNCT
cet-12545	130	31	.	.	PUNCT
cet-12545	131	1	the	the	DET
cet-12545	131	2	estimated	estimate	VERB
cet-12545	131	3	values	value	NOUN
cet-12545	131	4	of	of	ADP
cet-12545	131	5	the	the	DET
cet-12545	131	6	limits	limit	NOUN
cet-12545	131	7	of	of	ADP
cet-12545	131	8	detection	detection	NOUN
cet-12545	131	9	and	and	CCONJ
cet-12545	131	10	quantification	quantification	NOUN
cet-12545	131	11	calculated	calculate	VERB
cet-12545	131	12	for	for	ADP
cet-12545	131	13	the	the	DET
cet-12545	131	14	biosensor	biosensor	NOUN
cet-12545	131	15	prepared	prepare	VERB
cet-12545	131	16	with	with	ADP
cet-12545	131	17	50	50	NUM
cet-12545	131	18	nm	nm	NOUN
cet-12545	131	19	of	of	ADP
cet-12545	131	20	apt917	apt917	PROPN
cet-12545	131	21	are	be	AUX
cet-12545	131	22	8	8	NUM
cet-12545	131	23	and	and	CCONJ
cet-12545	131	24	27	27	NUM
cet-12545	131	25	cfu	cfu	NOUN
cet-12545	131	26	/	/	SYM
cet-12545	131	27	ml	ml	NOUN
cet-12545	131	28	,	,	PUNCT
cet-12545	131	29	respectively	respectively	ADV
cet-12545	131	30	.	.	PUNCT
cet-12545	132	1	however	however	ADV
cet-12545	132	2	,	,	PUNCT
cet-12545	132	3	it	it	PRON
cet-12545	132	4	is	be	AUX
cet-12545	132	5	necessary	necessary	ADJ
cet-12545	132	6	to	to	PART
cet-12545	132	7	evaluate	evaluate	VERB
cet-12545	132	8	lower	low	ADJ
cet-12545	132	9	concentrations	concentration	NOUN
cet-12545	132	10	of	of	ADP
cet-12545	132	11	the	the	DET
cet-12545	132	12	microorganism	microorganism	NOUN
cet-12545	132	13	to	to	PART
cet-12545	132	14	carry	carry	VERB
cet-12545	132	15	out	out	ADP
cet-12545	132	16	an	an	DET
cet-12545	132	17	adequate	adequate	ADJ
cet-12545	132	18	validation	validation	NOUN
cet-12545	132	19	of	of	ADP
cet-12545	132	20	the	the	DET
cet-12545	132	21	system	system	NOUN
cet-12545	132	22	.	.	PUNCT
cet-12545	133	1	preliminary	preliminary	ADJ
cet-12545	133	2	tests	test	NOUN
cet-12545	133	3	were	be	AUX
cet-12545	133	4	carried	carry	VERB
cet-12545	133	5	out	out	ADP
cet-12545	133	6	to	to	PART
cet-12545	133	7	evaluate	evaluate	VERB
cet-12545	133	8	the	the	DET
cet-12545	133	9	specificity	specificity	NOUN
cet-12545	133	10	of	of	ADP
cet-12545	133	11	the	the	DET
cet-12545	133	12	biosensor	biosensor	NOUN
cet-12545	133	13	prepared	prepare	VERB
cet-12545	133	14	with	with	ADP
cet-12545	133	15	50	50	NUM
cet-12545	133	16	nm	nm	NOUN
cet-12545	133	17	of	of	ADP
cet-12545	133	18	apt917	apt917	NOUN
cet-12545	133	19	towards	towards	ADP
cet-12545	133	20	e.	e.	PROPN
cet-12545	133	21	coli	coli	NOUN
cet-12545	133	22	in	in	ADP
cet-12545	133	23	the	the	DET
cet-12545	133	24	presence	presence	NOUN
cet-12545	133	25	of	of	ADP
cet-12545	133	26	other	other	ADJ
cet-12545	133	27	model	model	NOUN
cet-12545	133	28	microorganisms	microorganism	NOUN
cet-12545	133	29	that	that	PRON
cet-12545	133	30	may	may	AUX
cet-12545	133	31	be	be	AUX
cet-12545	133	32	present	present	ADJ
cet-12545	133	33	in	in	ADP
cet-12545	133	34	water	water	NOUN
cet-12545	133	35	,	,	PUNCT
cet-12545	133	36	such	such	ADJ
cet-12545	133	37	as	as	ADP
cet-12545	133	38	staphylococcus	staphylococcus	NOUN
cet-12545	133	39	aureus	aureus	NOUN
cet-12545	133	40	and	and	CCONJ
cet-12545	133	41	pseudomonas	pseudomona	NOUN
cet-12545	133	42	aeruginosa	aeruginosa	NOUN
cet-12545	133	43	.	.	PUNCT
cet-12545	134	1	concentrations	concentration	NOUN
cet-12545	134	2	of	of	ADP
cet-12545	134	3	50	50	NUM
cet-12545	134	4	and	and	CCONJ
cet-12545	134	5	100	100	NUM
cet-12545	134	6	cfu	cfu	NOUN
cet-12545	134	7	/	/	SYM
cet-12545	134	8	ml	ml	NOUN
cet-12545	134	9	of	of	ADP
cet-12545	134	10	each	each	DET
cet-12545	134	11	microorganism	microorganism	NOUN
cet-12545	134	12	were	be	AUX
cet-12545	134	13	evaluated	evaluate	VERB
cet-12545	134	14	,	,	PUNCT
cet-12545	134	15	and	and	CCONJ
cet-12545	134	16	the	the	DET
cet-12545	134	17	results	result	NOUN
cet-12545	134	18	are	be	AUX
cet-12545	134	19	presented	present	VERB
cet-12545	134	20	in	in	ADP
cet-12545	134	21	figure	figure	NOUN
cet-12545	134	22	4	4	NUM
cet-12545	134	23	.	.	PUNCT
cet-12545	134	24	figure	figure	VERB
cet-12545	134	25	4	4	NUM
cet-12545	134	26	:	:	PUNCT
cet-12545	134	27	results	result	NOUN
cet-12545	134	28	of	of	ADP
cet-12545	134	29	the	the	DET
cet-12545	134	30	evaluation	evaluation	NOUN
cet-12545	134	31	of	of	ADP
cet-12545	134	32	the	the	DET
cet-12545	134	33	selectivity	selectivity	NOUN
cet-12545	134	34	of	of	ADP
cet-12545	134	35	biosensor	biosensor	NOUN
cet-12545	134	36	towards	towards	ADP
cet-12545	134	37	e.	e.	PROPN
cet-12545	134	38	coli	coli	PROPN
cet-12545	134	39	.	.	PUNCT
cet-12545	135	1	the	the	DET
cet-12545	135	2	difference	difference	NOUN
cet-12545	135	3	in	in	ADP
cet-12545	135	4	the	the	DET
cet-12545	135	5	electrochemical	electrochemical	ADJ
cet-12545	135	6	response	response	NOUN
cet-12545	135	7	of	of	ADP
cet-12545	135	8	the	the	DET
cet-12545	135	9	biosensor	biosensor	NOUN
cet-12545	135	10	(	(	PUNCT
cet-12545	135	11	rnormalized	rnormalize	VERB
cet-12545	135	12	)	)	PUNCT
cet-12545	135	13	between	between	ADP
cet-12545	135	14	the	the	DET
cet-12545	135	15	blank	blank	NOUN
cet-12545	135	16	and	and	CCONJ
cet-12545	135	17	s.	s.	PROPN
cet-12545	135	18	aureus	aureus	PROPN
cet-12545	135	19	is	be	AUX
cet-12545	135	20	not	not	PART
cet-12545	135	21	significant	significant	ADJ
cet-12545	135	22	at	at	ADP
cet-12545	135	23	a	a	DET
cet-12545	135	24	concentration	concentration	NOUN
cet-12545	135	25	of	of	ADP
cet-12545	135	26	microorganisms	microorganism	NOUN
cet-12545	135	27	of	of	ADP
cet-12545	135	28	50	50	NUM
cet-12545	135	29	cfu	cfu	NOUN
cet-12545	135	30	/	/	SYM
cet-12545	135	31	ml	ml	NOUN
cet-12545	135	32	.	.	PUNCT
cet-12545	136	1	considering	consider	VERB
cet-12545	136	2	that	that	SCONJ
cet-12545	136	3	this	this	DET
cet-12545	136	4	microorganism	microorganism	NOUN
cet-12545	136	5	is	be	AUX
cet-12545	136	6	gram	gram	NOUN
cet-12545	136	7	-	-	PUNCT
cet-12545	136	8	positive	positive	ADJ
cet-12545	136	9	,	,	PUNCT
cet-12545	136	10	this	this	PRON
cet-12545	136	11	indicates	indicate	VERB
cet-12545	136	12	that	that	SCONJ
cet-12545	136	13	the	the	DET
cet-12545	136	14	biosensor	biosensor	NOUN
cet-12545	136	15	could	could	AUX
cet-12545	136	16	differentiate	differentiate	VERB
cet-12545	136	17	this	this	DET
cet-12545	136	18	type	type	NOUN
cet-12545	136	19	of	of	ADP
cet-12545	136	20	bacteria	bacteria	NOUN
cet-12545	136	21	at	at	ADP
cet-12545	136	22	low	low	ADJ
cet-12545	136	23	concentrations	concentration	NOUN
cet-12545	136	24	.	.	PUNCT
cet-12545	137	1	in	in	ADP
cet-12545	137	2	the	the	DET
cet-12545	137	3	case	case	NOUN
cet-12545	137	4	of	of	ADP
cet-12545	137	5	p.	p.	PROPN
cet-12545	137	6	aeruginosa	aeruginosa	PROPN
cet-12545	137	7	,	,	PUNCT
cet-12545	137	8	there	there	PRON
cet-12545	137	9	is	be	VERB
cet-12545	137	10	a	a	DET
cet-12545	137	11	significant	significant	ADJ
cet-12545	137	12	difference	difference	NOUN
cet-12545	137	13	with	with	ADP
cet-12545	137	14	the	the	DET
cet-12545	137	15	e.	e.	PROPN
cet-12545	137	16	coli	coli	NOUN
cet-12545	137	17	response	response	NOUN
cet-12545	137	18	,	,	PUNCT
cet-12545	137	19	but	but	CCONJ
cet-12545	137	20	the	the	DET
cet-12545	137	21	biosensor	biosensor	NOUN
cet-12545	137	22	is	be	AUX
cet-12545	137	23	still	still	ADV
cet-12545	137	24	capable	capable	ADJ
cet-12545	137	25	of	of	ADP
cet-12545	137	26	detecting	detect	VERB
cet-12545	137	27	the	the	DET
cet-12545	137	28	former	former	ADJ
cet-12545	137	29	,	,	PUNCT
cet-12545	137	30	possibly	possibly	ADV
cet-12545	137	31	related	relate	VERB
cet-12545	137	32	to	to	ADP
cet-12545	137	33	this	this	DET
cet-12545	137	34	group	group	NOUN
cet-12545	137	35	of	of	ADP
cet-12545	137	36	gram	gram	NOUN
cet-12545	137	37	-	-	PUNCT
cet-12545	137	38	negative	negative	ADJ
cet-12545	137	39	bacteria	bacteria	NOUN
cet-12545	137	40	.	.	PUNCT
cet-12545	138	1	this	this	PRON
cet-12545	138	2	is	be	AUX
cet-12545	138	3	possible	possible	ADJ
cet-12545	138	4	also	also	ADV
cet-12545	138	5	considering	consider	VERB
cet-12545	138	6	that	that	SCONJ
cet-12545	138	7	the	the	DET
cet-12545	138	8	aptamer	aptamer	NOUN
cet-12545	138	9	has	have	AUX
cet-12545	138	10	been	be	AUX
cet-12545	138	11	designed	design	VERB
cet-12545	138	12	to	to	PART
cet-12545	138	13	detect	detect	VERB
cet-12545	138	14	the	the	DET
cet-12545	138	15	whole	whole	ADJ
cet-12545	138	16	e.	e.	PROPN
cet-12545	138	17	coli	coli	PROPN
cet-12545	138	18	,	,	PUNCT
cet-12545	138	19	and	and	CCONJ
cet-12545	138	20	not	not	PART
cet-12545	138	21	towards	towards	ADP
cet-12545	138	22	specific	specific	ADJ
cet-12545	138	23	targets	target	NOUN
cet-12545	138	24	on	on	ADP
cet-12545	138	25	the	the	DET
cet-12545	138	26	cell	cell	NOUN
cet-12545	138	27	membrane	membrane	NOUN
cet-12545	138	28	.	.	PUNCT
cet-12545	139	1	287	287	NUM
cet-12545	139	2	4	4	NUM
cet-12545	139	3	.	.	PUNCT
cet-12545	139	4	conclusions	conclusion	NOUN
cet-12545	139	5	an	an	DET
cet-12545	139	6	aptamer	aptamer	NOUN
cet-12545	139	7	(	(	PUNCT
cet-12545	139	8	named	name	VERB
cet-12545	139	9	apt917	apt917	NOUN
cet-12545	139	10	)	)	PUNCT
cet-12545	139	11	was	be	AUX
cet-12545	139	12	designed	design	VERB
cet-12545	139	13	by	by	ADP
cet-12545	139	14	bioinformatic	bioinformatic	ADJ
cet-12545	139	15	tools	tool	NOUN
cet-12545	139	16	based	base	VERB
cet-12545	139	17	on	on	ADP
cet-12545	139	18	sequences	sequence	NOUN
cet-12545	139	19	reported	report	VERB
cet-12545	139	20	in	in	ADP
cet-12545	139	21	the	the	DET
cet-12545	139	22	literature	literature	NOUN
cet-12545	139	23	.	.	PUNCT
cet-12545	140	1	apt917	apt917	NOUN
cet-12545	140	2	has	have	VERB
cet-12545	140	3	two	two	NUM
cet-12545	140	4	loops	loop	NOUN
cet-12545	140	5	in	in	ADP
cet-12545	140	6	its	its	PRON
cet-12545	140	7	structure	structure	NOUN
cet-12545	140	8	and	and	CCONJ
cet-12545	140	9	can	can	AUX
cet-12545	140	10	recognize	recognize	VERB
cet-12545	140	11	whole	whole	ADJ
cet-12545	140	12	cells	cell	NOUN
cet-12545	140	13	of	of	ADP
cet-12545	140	14	e.	e.	PROPN
cet-12545	140	15	coli	coli	PROPN
cet-12545	140	16	o157	o157	PROPN
cet-12545	140	17	:	:	PUNCT
cet-12545	140	18	h7	h7	PROPN
cet-12545	140	19	.	.	PUNCT
cet-12545	141	1	apt917	apt917	PROPN
cet-12545	141	2	was	be	AUX
cet-12545	141	3	immobilized	immobilize	VERB
cet-12545	141	4	on	on	ADP
cet-12545	141	5	gold	gold	ADJ
cet-12545	141	6	nanoparticles	nanoparticle	NOUN
cet-12545	141	7	-	-	PUNCT
cet-12545	141	8	modified	modify	VERB
cet-12545	141	9	screen	screen	NOUN
cet-12545	141	10	-	-	PUNCT
cet-12545	141	11	printed	print	VERB
cet-12545	141	12	electrodes	electrode	NOUN
cet-12545	141	13	.	.	PUNCT
cet-12545	142	1	the	the	DET
cet-12545	142	2	electrochemical	electrochemical	ADJ
cet-12545	142	3	evaluation	evaluation	NOUN
cet-12545	142	4	of	of	ADP
cet-12545	142	5	the	the	DET
cet-12545	142	6	obtained	obtain	VERB
cet-12545	142	7	biosensor	biosensor	NOUN
cet-12545	142	8	shows	show	VERB
cet-12545	142	9	that	that	SCONJ
cet-12545	142	10	the	the	DET
cet-12545	142	11	device	device	NOUN
cet-12545	142	12	can	can	AUX
cet-12545	142	13	be	be	AUX
cet-12545	142	14	able	able	ADJ
cet-12545	142	15	to	to	PART
cet-12545	142	16	recognize	recognize	VERB
cet-12545	142	17	e.	e.	PROPN
cet-12545	142	18	coli	coli	NOUN
cet-12545	142	19	at	at	ADP
cet-12545	142	20	low	low	ADJ
cet-12545	142	21	concentrations	concentration	NOUN
cet-12545	142	22	.	.	PUNCT
cet-12545	143	1	also	also	ADV
cet-12545	143	2	,	,	PUNCT
cet-12545	143	3	the	the	DET
cet-12545	143	4	biosensor	biosensor	NOUN
cet-12545	143	5	shows	show	VERB
cet-12545	143	6	good	good	ADJ
cet-12545	143	7	specificity	specificity	NOUN
cet-12545	143	8	towards	towards	ADP
cet-12545	143	9	e.	e.	PROPN
cet-12545	143	10	coli	coli	PROPN
cet-12545	143	11	compared	compare	VERB
cet-12545	143	12	to	to	ADP
cet-12545	143	13	a	a	DET
cet-12545	143	14	gram	gram	NOUN
cet-12545	143	15	-	-	PUNCT
cet-12545	143	16	positive	positive	ADJ
cet-12545	143	17	bacterium	bacterium	NOUN
cet-12545	143	18	such	such	ADJ
cet-12545	143	19	as	as	ADP
cet-12545	143	20	s.	s.	PROPN
cet-12545	143	21	aureus	aureus	PROPN
cet-12545	143	22	.	.	PUNCT
cet-12545	144	1	however	however	ADV
cet-12545	144	2	,	,	PUNCT
cet-12545	144	3	at	at	ADP
cet-12545	144	4	high	high	ADJ
cet-12545	144	5	concentrations	concentration	NOUN
cet-12545	144	6	of	of	ADP
cet-12545	144	7	p.	p.	NOUN
cet-12545	144	8	aeruginosa	aeruginosa	NOUN
cet-12545	144	9	it	it	PRON
cet-12545	144	10	is	be	AUX
cet-12545	144	11	difficult	difficult	ADJ
cet-12545	144	12	to	to	PART
cet-12545	144	13	differentiate	differentiate	VERB
cet-12545	144	14	one	one	NUM
cet-12545	144	15	or	or	CCONJ
cet-12545	144	16	another	another	DET
cet-12545	144	17	microorganism	microorganism	NOUN
cet-12545	144	18	.	.	PUNCT
cet-12545	145	1	in	in	ADP
cet-12545	145	2	any	any	DET
cet-12545	145	3	case	case	NOUN
cet-12545	145	4	,	,	PUNCT
cet-12545	145	5	this	this	DET
cet-12545	145	6	two	two	NUM
cet-12545	145	7	-	-	PUNCT
cet-12545	145	8	loop	loop	NOUN
cet-12545	145	9	aptamer	aptamer	NOUN
cet-12545	145	10	-	-	PUNCT
cet-12545	145	11	based	base	VERB
cet-12545	145	12	system	system	NOUN
cet-12545	145	13	becomes	become	VERB
cet-12545	145	14	an	an	DET
cet-12545	145	15	important	important	ADJ
cet-12545	145	16	basis	basis	NOUN
cet-12545	145	17	for	for	ADP
cet-12545	145	18	the	the	DET
cet-12545	145	19	subsequent	subsequent	ADJ
cet-12545	145	20	design	design	NOUN
cet-12545	145	21	of	of	ADP
cet-12545	145	22	new	new	ADJ
cet-12545	145	23	recognition	recognition	NOUN
cet-12545	145	24	molecules	molecule	NOUN
cet-12545	145	25	with	with	ADP
cet-12545	145	26	increased	increase	VERB
cet-12545	145	27	specificity	specificity	NOUN
cet-12545	145	28	towards	towards	ADP
cet-12545	145	29	e.	e.	PROPN
cet-12545	145	30	coli	coli	PROPN
cet-12545	145	31	at	at	ADP
cet-12545	145	32	low	low	ADJ
cet-12545	145	33	concentrations	concentration	NOUN
cet-12545	145	34	.	.	PUNCT
cet-12545	146	1	acknowledgments	acknowledgment	NOUN
cet-12545	146	2	this	this	DET
cet-12545	146	3	research	research	NOUN
cet-12545	146	4	was	be	AUX
cet-12545	146	5	supported	support	VERB
cet-12545	146	6	by	by	ADP
cet-12545	146	7	minciencias	minciencia	NOUN
cet-12545	146	8	under	under	ADP
cet-12545	146	9	grant	grant	NOUN
cet-12545	146	10	number	number	NOUN
cet-12545	146	11	ct	ct	NUM
cet-12545	146	12	596	596	NUM
cet-12545	146	13	-	-	SYM
cet-12545	146	14	2018	2018	NUM
cet-12545	146	15	.	.	PUNCT
cet-12545	147	1	references	reference	NOUN
cet-12545	147	2	albanese	albanese	PROPN
cet-12545	147	3	,	,	PUNCT
cet-12545	147	4	d.	d.	PROPN
cet-12545	147	5	,	,	PUNCT
cet-12545	147	6	garofalo	garofalo	PROPN
cet-12545	147	7	,	,	PUNCT
cet-12545	147	8	f.	f.	PROPN
cet-12545	147	9	,	,	PUNCT
cet-12545	147	10	pilloton	pilloton	PROPN
cet-12545	147	11	,	,	PUNCT
cet-12545	147	12	r.	r.	PROPN
cet-12545	147	13	,	,	PUNCT
cet-12545	147	14	capo	capo	PROPN
cet-12545	147	15	,	,	PUNCT
cet-12545	147	16	s.	s.	PROPN
cet-12545	147	17	,	,	PUNCT
cet-12545	147	18	&	&	CCONJ
cet-12545	147	19	malvano	malvano	PROPN
cet-12545	147	20	,	,	PUNCT
cet-12545	147	21	f.	f.	PROPN
cet-12545	147	22	(	(	PUNCT
cet-12545	147	23	2019	2019	NUM
cet-12545	147	24	)	)	PUNCT
cet-12545	147	25	.	.	PUNCT
cet-12545	148	1	development	development	NOUN
cet-12545	148	2	of	of	ADP
cet-12545	148	3	an	an	DET
cet-12545	148	4	antimicrobial	antimicrobial	ADJ
cet-12545	148	5	peptidebased	peptidebase	VERB
cet-12545	148	6	biosensor	biosensor	NOUN
cet-12545	148	7	for	for	ADP
cet-12545	148	8	the	the	DET
cet-12545	148	9	monitoring	monitoring	NOUN
cet-12545	148	10	of	of	ADP
cet-12545	148	11	bacterial	bacterial	ADJ
cet-12545	148	12	contaminations	contamination	NOUN
cet-12545	148	13	.	.	PUNCT
cet-12545	149	1	chemical	chemical	NOUN
cet-12545	149	2	engineering	engineering	NOUN
cet-12545	149	3	transactions	transaction	NOUN
cet-12545	149	4	,	,	PUNCT
cet-12545	149	5	75(july	75(july	NUM
cet-12545	149	6	2018	2018	NUM
cet-12545	149	7	)	)	PUNCT
cet-12545	149	8	,	,	PUNCT
cet-12545	149	9	61–66	61–66	NUM
cet-12545	149	10	.	.	PUNCT
cet-12545	149	11	antczak	antczak	PROPN
cet-12545	149	12	,	,	PUNCT
cet-12545	149	13	m.	m.	NOUN
cet-12545	149	14	,	,	PUNCT
cet-12545	149	15	popenda	popenda	ADJ
cet-12545	149	16	,	,	PUNCT
cet-12545	149	17	m.	m.	NOUN
cet-12545	149	18	,	,	PUNCT
cet-12545	149	19	zok	zok	PROPN
cet-12545	149	20	,	,	PUNCT
cet-12545	149	21	t.	t.	PROPN
cet-12545	149	22	,	,	PUNCT
cet-12545	149	23	sarzynska	sarzynska	PROPN
cet-12545	149	24	,	,	PUNCT
cet-12545	149	25	j.	j.	PROPN
cet-12545	149	26	,	,	PUNCT
cet-12545	149	27	ratajczak	ratajczak	PROPN
cet-12545	149	28	,	,	PUNCT
cet-12545	149	29	t.	t.	PROPN
cet-12545	149	30	,	,	PUNCT
cet-12545	149	31	tomczyk	tomczyk	NOUN
cet-12545	149	32	,	,	PUNCT
cet-12545	149	33	k.	k.	PROPN
cet-12545	149	34	,	,	PUNCT
cet-12545	149	35	adamiak	adamiak	PROPN
cet-12545	149	36	,	,	PUNCT
cet-12545	149	37	r.	r.	PROPN
cet-12545	149	38	w.	w.	PROPN
cet-12545	149	39	,	,	PUNCT
cet-12545	149	40	&	&	CCONJ
cet-12545	149	41	szachniuk	szachniuk	PROPN
cet-12545	149	42	,	,	PUNCT
cet-12545	149	43	m.	m.	NOUN
cet-12545	149	44	(	(	PUNCT
cet-12545	149	45	2017	2017	NUM
cet-12545	149	46	)	)	PUNCT
cet-12545	149	47	.	.	PUNCT
cet-12545	150	1	new	new	ADJ
cet-12545	150	2	functionality	functionality	NOUN
cet-12545	150	3	of	of	ADP
cet-12545	150	4	rnacomposer	rnacomposer	NOUN
cet-12545	150	5	:	:	PUNCT
cet-12545	150	6	application	application	NOUN
cet-12545	150	7	to	to	PART
cet-12545	150	8	shape	shape	VERB
cet-12545	150	9	the	the	DET
cet-12545	150	10	axis	axis	NOUN
cet-12545	150	11	of	of	ADP
cet-12545	150	12	mir160	mir160	NOUN
cet-12545	150	13	precursor	precursor	NOUN
cet-12545	150	14	structure	structure	NOUN
cet-12545	150	15	.	.	PUNCT
cet-12545	151	1	acta	acta	PROPN
cet-12545	151	2	biochimica	biochimica	PROPN
cet-12545	151	3	polonica	polonica	PROPN
cet-12545	151	4	,	,	PUNCT
cet-12545	151	5	63(4	63(4	NOUN
cet-12545	151	6	)	)	PUNCT
cet-12545	151	7	.	.	PUNCT
cet-12545	152	1	balamurugan	balamurugan	PROPN
cet-12545	152	2	,	,	PUNCT
cet-12545	152	3	s.	s.	PROPN
cet-12545	152	4	,	,	PUNCT
cet-12545	152	5	obubuafo	obubuafo	PROPN
cet-12545	152	6	,	,	PUNCT
cet-12545	152	7	a.	a.	NOUN
cet-12545	152	8	,	,	PUNCT
cet-12545	152	9	mccarley	mccarley	PROPN
cet-12545	152	10	,	,	PUNCT
cet-12545	152	11	r.	r.	PROPN
cet-12545	152	12	l.	l.	PROPN
cet-12545	152	13	,	,	PUNCT
cet-12545	152	14	soper	soper	PROPN
cet-12545	152	15	,	,	PUNCT
cet-12545	152	16	s.	s.	PROPN
cet-12545	152	17	a.	a.	PROPN
cet-12545	152	18	,	,	PUNCT
cet-12545	152	19	&	&	CCONJ
cet-12545	152	20	spivak	spivak	PROPN
cet-12545	152	21	,	,	PUNCT
cet-12545	152	22	d.	d.	PROPN
cet-12545	152	23	a.	a.	PROPN
cet-12545	152	24	(	(	PUNCT
cet-12545	152	25	2008	2008	NUM
cet-12545	152	26	)	)	PUNCT
cet-12545	152	27	.	.	PUNCT
cet-12545	153	1	effect	effect	NOUN
cet-12545	153	2	of	of	ADP
cet-12545	153	3	linker	linker	NOUN
cet-12545	153	4	structure	structure	NOUN
cet-12545	153	5	on	on	ADP
cet-12545	153	6	surface	surface	NOUN
cet-12545	153	7	density	density	NOUN
cet-12545	153	8	of	of	ADP
cet-12545	153	9	aptamer	aptamer	NOUN
cet-12545	153	10	monolayers	monolayer	NOUN
cet-12545	153	11	and	and	CCONJ
cet-12545	153	12	their	their	PRON
cet-12545	153	13	corresponding	corresponding	ADJ
cet-12545	153	14	protein	protein	NOUN
cet-12545	153	15	binding	bind	VERB
cet-12545	153	16	efficiency	efficiency	NOUN
cet-12545	153	17	.	.	PUNCT
cet-12545	154	1	analytical	analytical	ADJ
cet-12545	154	2	chemistry	chemistry	NOUN
cet-12545	154	3	,	,	PUNCT
cet-12545	154	4	80(24	80(24	NUM
cet-12545	154	5	)	)	PUNCT
cet-12545	154	6	,	,	PUNCT
cet-12545	154	7	9630–9634	9630–9634	NUM
cet-12545	154	8	.	.	PUNCT
cet-12545	155	1	dua	dua	PROPN
cet-12545	155	2	,	,	PUNCT
cet-12545	155	3	p.	p.	PROPN
cet-12545	155	4	,	,	PUNCT
cet-12545	155	5	ren	ren	PROPN
cet-12545	155	6	,	,	PUNCT
cet-12545	155	7	s.	s.	PROPN
cet-12545	155	8	,	,	PUNCT
cet-12545	155	9	lee	lee	PROPN
cet-12545	155	10	,	,	PUNCT
cet-12545	155	11	s.	s.	PROPN
cet-12545	155	12	w.	w.	PROPN
cet-12545	155	13	,	,	PUNCT
cet-12545	155	14	kim	kim	PROPN
cet-12545	155	15	,	,	PUNCT
cet-12545	155	16	j.-k	j.-k	PROPN
cet-12545	155	17	.	.	PUNCT
cet-12545	155	18	,	,	PUNCT
cet-12545	155	19	shin	shin	PROPN
cet-12545	155	20	,	,	PUNCT
cet-12545	155	21	h.	h.	PROPN
cet-12545	155	22	,	,	PUNCT
cet-12545	155	23	jeong	jeong	PROPN
cet-12545	155	24	,	,	PUNCT
cet-12545	155	25	o.-c	o.-c	PROPN
cet-12545	155	26	.	.	PUNCT
cet-12545	155	27	,	,	PUNCT
cet-12545	155	28	kim	kim	PROPN
cet-12545	155	29	,	,	PUNCT
cet-12545	155	30	s.	s.	PROPN
cet-12545	155	31	,	,	PUNCT
cet-12545	155	32	&	&	CCONJ
cet-12545	155	33	lee	lee	PROPN
cet-12545	155	34	,	,	PUNCT
cet-12545	155	35	d.-k	d.-k	PROPN
cet-12545	155	36	.	.	PUNCT
cet-12545	156	1	(	(	PUNCT
cet-12545	156	2	2016	2016	NUM
cet-12545	156	3	)	)	PUNCT
cet-12545	156	4	.	.	PUNCT
cet-12545	157	1	cell	cell	NOUN
cet-12545	157	2	-	-	PUNCT
cet-12545	157	3	selex	selex	NOUN
cet-12545	157	4	based	base	VERB
cet-12545	157	5	identification	identification	NOUN
cet-12545	157	6	of	of	ADP
cet-12545	157	7	an	an	DET
cet-12545	157	8	rna	rna	NOUN
cet-12545	157	9	aptamer	aptamer	NOUN
cet-12545	157	10	for	for	ADP
cet-12545	157	11	escherichia	escherichia	NOUN
cet-12545	157	12	coli	coli	NOUN
cet-12545	157	13	and	and	CCONJ
cet-12545	157	14	its	its	PRON
cet-12545	157	15	use	use	NOUN
cet-12545	157	16	in	in	ADP
cet-12545	157	17	various	various	ADJ
cet-12545	157	18	detection	detection	NOUN
cet-12545	157	19	formats	format	NOUN
cet-12545	157	20	.	.	PUNCT
cet-12545	158	1	molecules	molecule	NOUN
cet-12545	158	2	and	and	CCONJ
cet-12545	158	3	cells	cell	NOUN
cet-12545	158	4	,	,	PUNCT
cet-12545	158	5	39(11	39(11	NUM
cet-12545	158	6	)	)	PUNCT
cet-12545	158	7	,	,	PUNCT
cet-12545	158	8	807–813	807–813	NUM
cet-12545	158	9	.	.	PUNCT
cet-12545	158	10	hianik	hianik	PROPN
cet-12545	158	11	,	,	PUNCT
cet-12545	158	12	t.	t.	PROPN
cet-12545	158	13	(	(	PUNCT
cet-12545	158	14	2018	2018	NUM
cet-12545	158	15	)	)	PUNCT
cet-12545	158	16	.	.	PUNCT
cet-12545	159	1	aptamer	aptamer	NOUN
cet-12545	159	2	-	-	PUNCT
cet-12545	159	3	based	base	VERB
cet-12545	159	4	biosensors	biosensor	NOUN
cet-12545	159	5	.	.	PUNCT
cet-12545	160	1	in	in	ADP
cet-12545	160	2	encyclopedia	encyclopedia	NOUN
cet-12545	160	3	of	of	ADP
cet-12545	160	4	interfacial	interfacial	ADJ
cet-12545	160	5	chemistry	chemistry	NOUN
cet-12545	160	6	(	(	PUNCT
cet-12545	160	7	issue	issue	NOUN
cet-12545	160	8	january	january	PROPN
cet-12545	160	9	2017	2017	NUM
cet-12545	160	10	,	,	PUNCT
cet-12545	160	11	pp	pp	ADJ
cet-12545	160	12	.	.	PUNCT
cet-12545	160	13	11	11	NUM
cet-12545	160	14	–	–	PUNCT
cet-12545	160	15	19	19	NUM
cet-12545	160	16	)	)	PUNCT
cet-12545	160	17	.	.	PUNCT
cet-12545	161	1	elsevier	elsevier	PROPN
cet-12545	161	2	.	.	PUNCT
cet-12545	161	3	hoyos	hoyos	PROPN
cet-12545	161	4	-	-	PUNCT
cet-12545	161	5	nogués	nogués	PROPN
cet-12545	161	6	,	,	PUNCT
cet-12545	161	7	m.	m.	NOUN
cet-12545	161	8	,	,	PUNCT
cet-12545	161	9	gil	gil	PROPN
cet-12545	161	10	,	,	PUNCT
cet-12545	161	11	f.	f.	PROPN
cet-12545	161	12	j.	j.	PROPN
cet-12545	161	13	,	,	PUNCT
cet-12545	161	14	&	&	CCONJ
cet-12545	161	15	mas	mas	PROPN
cet-12545	161	16	-	-	PUNCT
cet-12545	161	17	moruno	moruno	PROPN
cet-12545	161	18	,	,	PUNCT
cet-12545	161	19	c.	c.	NOUN
cet-12545	161	20	(	(	PUNCT
cet-12545	161	21	2018	2018	NUM
cet-12545	161	22	)	)	PUNCT
cet-12545	161	23	.	.	PUNCT
cet-12545	162	1	antimicrobial	antimicrobial	ADJ
cet-12545	162	2	peptides	peptide	NOUN
cet-12545	162	3	:	:	PUNCT
cet-12545	162	4	powerful	powerful	ADJ
cet-12545	162	5	biorecognition	biorecognition	NOUN
cet-12545	162	6	elements	element	NOUN
cet-12545	162	7	to	to	PART
cet-12545	162	8	detect	detect	VERB
cet-12545	162	9	bacteria	bacteria	NOUN
cet-12545	162	10	in	in	ADP
cet-12545	162	11	biosensing	biosense	VERB
cet-12545	162	12	technologies	technology	NOUN
cet-12545	162	13	.	.	PUNCT
cet-12545	163	1	molecules	molecule	NOUN
cet-12545	163	2	,	,	PUNCT
cet-12545	163	3	23(7	23(7	NUM
cet-12545	163	4	)	)	PUNCT
cet-12545	163	5	,	,	PUNCT
cet-12545	163	6	1683	1683	NUM
cet-12545	163	7	.	.	PUNCT
cet-12545	164	1	jayasena	jayasena	PROPN
cet-12545	164	2	,	,	PUNCT
cet-12545	164	3	s.	s.	PROPN
cet-12545	164	4	d.	d.	PROPN
cet-12545	164	5	(	(	PUNCT
cet-12545	164	6	1999	1999	NUM
cet-12545	164	7	)	)	PUNCT
cet-12545	164	8	.	.	PUNCT
cet-12545	165	1	aptamers	aptamer	NOUN
cet-12545	165	2	:	:	PUNCT
cet-12545	165	3	an	an	DET
cet-12545	165	4	emerging	emerge	VERB
cet-12545	165	5	class	class	NOUN
cet-12545	165	6	of	of	ADP
cet-12545	165	7	molecules	molecule	NOUN
cet-12545	165	8	that	that	PRON
cet-12545	165	9	rival	rival	ADJ
cet-12545	165	10	antibodies	antibodie	VERB
cet-12545	165	11	in	in	ADP
cet-12545	165	12	diagnostics	diagnostic	NOUN
cet-12545	165	13	.	.	PUNCT
cet-12545	166	1	clinical	clinical	ADJ
cet-12545	166	2	chemistry	chemistry	NOUN
cet-12545	166	3	,	,	PUNCT
cet-12545	166	4	45(9	45(9	NOUN
cet-12545	166	5	)	)	PUNCT
cet-12545	166	6	,	,	PUNCT
cet-12545	166	7	1628–1650	1628–1650	NUM
cet-12545	166	8	.	.	PUNCT
cet-12545	167	1	justino	justino	PROPN
cet-12545	167	2	,	,	PUNCT
cet-12545	167	3	c.	c.	PROPN
cet-12545	167	4	i.	i.	PROPN
cet-12545	167	5	l.	l.	PROPN
cet-12545	167	6	,	,	PUNCT
cet-12545	167	7	freitas	freitas	PROPN
cet-12545	167	8	,	,	PUNCT
cet-12545	167	9	a.	a.	PROPN
cet-12545	167	10	c.	c.	PROPN
cet-12545	167	11	,	,	PUNCT
cet-12545	167	12	pereira	pereira	PROPN
cet-12545	167	13	,	,	PUNCT
cet-12545	167	14	r.	r.	PROPN
cet-12545	167	15	,	,	PUNCT
cet-12545	167	16	duarte	duarte	PROPN
cet-12545	167	17	,	,	PUNCT
cet-12545	167	18	a.	a.	PROPN
cet-12545	167	19	c.	c.	PROPN
cet-12545	167	20	,	,	PUNCT
cet-12545	167	21	&	&	CCONJ
cet-12545	167	22	rocha	rocha	PROPN
cet-12545	167	23	santos	santos	PROPN
cet-12545	167	24	,	,	PUNCT
cet-12545	167	25	t.	t.	PROPN
cet-12545	167	26	a.	a.	PROPN
cet-12545	167	27	p.	p.	PROPN
cet-12545	167	28	(	(	PUNCT
cet-12545	167	29	2015	2015	NUM
cet-12545	167	30	)	)	PUNCT
cet-12545	167	31	.	.	PUNCT
cet-12545	168	1	recent	recent	ADJ
cet-12545	168	2	developments	development	NOUN
cet-12545	168	3	in	in	ADP
cet-12545	168	4	recognition	recognition	NOUN
cet-12545	168	5	elements	element	NOUN
cet-12545	168	6	for	for	ADP
cet-12545	168	7	chemical	chemical	ADJ
cet-12545	168	8	sensors	sensor	NOUN
cet-12545	168	9	and	and	CCONJ
cet-12545	168	10	biosensors	biosensor	NOUN
cet-12545	168	11	.	.	PUNCT
cet-12545	169	1	trac	trac	NOUN
cet-12545	169	2	trends	trend	NOUN
cet-12545	169	3	in	in	ADP
cet-12545	169	4	analytical	analytical	ADJ
cet-12545	169	5	chemistry	chemistry	NOUN
cet-12545	169	6	,	,	PUNCT
cet-12545	169	7	68	68	NUM
cet-12545	169	8	,	,	PUNCT
cet-12545	169	9	2–17	2–17	PROPN
cet-12545	169	10	.	.	PUNCT
cet-12545	170	1	kinghorn	kinghorn	PROPN
cet-12545	170	2	,	,	PUNCT
cet-12545	170	3	a.	a.	PROPN
cet-12545	170	4	,	,	PUNCT
cet-12545	170	5	fraser	fraser	PROPN
cet-12545	170	6	,	,	PUNCT
cet-12545	170	7	l.	l.	PROPN
cet-12545	170	8	,	,	PUNCT
cet-12545	170	9	liang	liang	PROPN
cet-12545	170	10	,	,	PUNCT
cet-12545	170	11	s.	s.	PROPN
cet-12545	170	12	,	,	PUNCT
cet-12545	170	13	shiu	shiu	PROPN
cet-12545	170	14	,	,	PUNCT
cet-12545	170	15	s.	s.	PROPN
cet-12545	170	16	,	,	PUNCT
cet-12545	170	17	&	&	CCONJ
cet-12545	170	18	tanner	tanner	PROPN
cet-12545	170	19	,	,	PUNCT
cet-12545	170	20	j.	j.	PROPN
cet-12545	170	21	(	(	PUNCT
cet-12545	170	22	2017	2017	NUM
cet-12545	170	23	)	)	PUNCT
cet-12545	170	24	.	.	PUNCT
cet-12545	171	1	aptamer	aptamer	NOUN
cet-12545	171	2	bioinformatics	bioinformatics	PROPN
cet-12545	171	3	.	.	PUNCT
cet-12545	172	1	international	international	ADJ
cet-12545	172	2	journal	journal	NOUN
cet-12545	172	3	of	of	ADP
cet-12545	172	4	molecular	molecular	ADJ
cet-12545	172	5	sciences	science	NOUN
cet-12545	172	6	,	,	PUNCT
cet-12545	172	7	18(12	18(12	NUM
cet-12545	172	8	)	)	PUNCT
cet-12545	172	9	,	,	PUNCT
cet-12545	172	10	2516	2516	NUM
cet-12545	172	11	.	.	PUNCT
cet-12545	173	1	kurup	kurup	NOUN
cet-12545	173	2	,	,	PUNCT
cet-12545	173	3	c.	c.	PROPN
cet-12545	173	4	p.	p.	PROPN
cet-12545	173	5	,	,	PUNCT
cet-12545	173	6	tlili	tlili	NOUN
cet-12545	173	7	,	,	PUNCT
cet-12545	173	8	c.	c.	PROPN
cet-12545	173	9	,	,	PUNCT
cet-12545	173	10	zakaria	zakaria	PROPN
cet-12545	173	11	,	,	PUNCT
cet-12545	173	12	s.	s.	PROPN
cet-12545	173	13	n.	n.	PROPN
cet-12545	173	14	a.	a.	PROPN
cet-12545	173	15	,	,	PUNCT
cet-12545	173	16	&	&	CCONJ
cet-12545	173	17	ahmed	ahmed	PROPN
cet-12545	173	18	,	,	PUNCT
cet-12545	173	19	m.	m.	NOUN
cet-12545	173	20	u.	u.	PROPN
cet-12545	173	21	(	(	PUNCT
cet-12545	173	22	2021	2021	NUM
cet-12545	173	23	)	)	PUNCT
cet-12545	173	24	.	.	PUNCT
cet-12545	174	1	recent	recent	ADJ
cet-12545	174	2	trends	trend	NOUN
cet-12545	174	3	in	in	ADP
cet-12545	174	4	design	design	NOUN
cet-12545	174	5	and	and	CCONJ
cet-12545	174	6	development	development	NOUN
cet-12545	174	7	of	of	ADP
cet-12545	174	8	nanomaterial	nanomaterial	NOUN
cet-12545	174	9	-	-	PUNCT
cet-12545	174	10	based	base	VERB
cet-12545	174	11	aptasensors	aptasensor	NOUN
cet-12545	174	12	.	.	PUNCT
cet-12545	175	1	biointerface	biointerface	NOUN
cet-12545	175	2	research	research	NOUN
cet-12545	175	3	in	in	ADP
cet-12545	175	4	applied	apply	VERB
cet-12545	175	5	chemistry	chemistry	NOUN
cet-12545	175	6	,	,	PUNCT
cet-12545	175	7	11(6	11(6	NUM
cet-12545	175	8	)	)	PUNCT
cet-12545	175	9	,	,	PUNCT
cet-12545	175	10	14057–14077	14057–14077	NUM
cet-12545	175	11	.	.	PUNCT
cet-12545	176	1	lee	lee	PROPN
cet-12545	176	2	,	,	PUNCT
cet-12545	176	3	y.	y.	PROPN
cet-12545	176	4	j.	j.	PROPN
cet-12545	176	5	,	,	PUNCT
cet-12545	176	6	han	han	PROPN
cet-12545	176	7	,	,	PUNCT
cet-12545	176	8	s.	s.	PROPN
cet-12545	176	9	r.	r.	PROPN
cet-12545	176	10	,	,	PUNCT
cet-12545	176	11	maeng	maeng	PROPN
cet-12545	176	12	,	,	PUNCT
cet-12545	176	13	j.-s	j.-s	PROPN
cet-12545	176	14	.	.	PUNCT
cet-12545	176	15	,	,	PUNCT
cet-12545	176	16	cho	cho	PROPN
cet-12545	176	17	,	,	PUNCT
cet-12545	176	18	y.-j	y.-j	PROPN
cet-12545	176	19	.	.	PROPN
cet-12545	176	20	,	,	PUNCT
cet-12545	176	21	&	&	CCONJ
cet-12545	176	22	lee	lee	PROPN
cet-12545	176	23	,	,	PUNCT
cet-12545	176	24	s.-w	s.-w	PROPN
cet-12545	176	25	.	.	PUNCT
cet-12545	177	1	(	(	PUNCT
cet-12545	177	2	2012	2012	NUM
cet-12545	177	3	)	)	PUNCT
cet-12545	177	4	.	.	PUNCT
cet-12545	178	1	in	in	ADP
cet-12545	178	2	vitro	vitro	X
cet-12545	178	3	selection	selection	NOUN
cet-12545	178	4	of	of	ADP
cet-12545	178	5	escherichia	escherichia	NOUN
cet-12545	178	6	coli	coli	NOUN
cet-12545	178	7	o157	o157	PROPN
cet-12545	178	8	:	:	PUNCT
cet-12545	178	9	h7	h7	ADJ
cet-12545	178	10	-	-	PUNCT
cet-12545	178	11	specific	specific	ADJ
cet-12545	178	12	rna	rna	NOUN
cet-12545	178	13	aptamer	aptamer	NOUN
cet-12545	178	14	.	.	PUNCT
cet-12545	179	1	biochemical	biochemical	ADJ
cet-12545	179	2	and	and	CCONJ
cet-12545	179	3	biophysical	biophysical	ADJ
cet-12545	179	4	research	research	NOUN
cet-12545	179	5	communications	communication	NOUN
cet-12545	179	6	,	,	PUNCT
cet-12545	179	7	417(1	417(1	NUM
cet-12545	179	8	)	)	PUNCT
cet-12545	179	9	,	,	PUNCT
cet-12545	179	10	414–420	414–420	NUM
cet-12545	179	11	.	.	PUNCT
cet-12545	180	1	palomino	palomino	ADJ
cet-12545	180	2	-	-	PUNCT
cet-12545	180	3	camargo	camargo	PROPN
cet-12545	180	4	,	,	PUNCT
cet-12545	180	5	c.	c.	PROPN
cet-12545	180	6	,	,	PUNCT
cet-12545	180	7	&	&	CCONJ
cet-12545	180	8	gonzález	gonzález	PROPN
cet-12545	180	9	-	-	PUNCT
cet-12545	180	10	muñoz	muñoz	PROPN
cet-12545	180	11	,	,	PUNCT
cet-12545	180	12	y.	y.	PROPN
cet-12545	180	13	(	(	PUNCT
cet-12545	180	14	2014	2014	NUM
cet-12545	180	15	)	)	PUNCT
cet-12545	180	16	.	.	PUNCT
cet-12545	181	1	técnicas	técnicas	PROPN
cet-12545	181	2	moleculares	moleculares	PROPN
cet-12545	181	3	para	para	PROPN
cet-12545	181	4	la	la	PROPN
cet-12545	181	5	detección	detección	PROPN
cet-12545	181	6	e	e	PROPN
cet-12545	181	7	identificación	identificación	PROPN
cet-12545	181	8	de	de	X
cet-12545	181	9	patógenos	patógenos	PROPN
cet-12545	181	10	en	en	PROPN
cet-12545	181	11	alimentos	alimentos	PROPN
cet-12545	181	12	:	:	PUNCT
cet-12545	181	13	ventajas	ventajas	PROPN
cet-12545	181	14	y	y	PROPN
cet-12545	181	15	limitaciones	limitaciones	PROPN
cet-12545	181	16	.	.	PUNCT
cet-12545	182	1	revista	revista	PROPN
cet-12545	182	2	peruana	peruana	PROPN
cet-12545	182	3	de	de	PROPN
cet-12545	182	4	medicina	medicina	PROPN
cet-12545	182	5	experimental	experimental	PROPN
cet-12545	182	6	y	y	PROPN
cet-12545	182	7	salud	salud	PROPN
cet-12545	182	8	pública	pública	PROPN
cet-12545	182	9	,	,	PUNCT
cet-12545	182	10	31(3	31(3	NUM
cet-12545	182	11	)	)	PUNCT
cet-12545	182	12	,	,	PUNCT
cet-12545	182	13	535–546	535–546	NUM
cet-12545	182	14	.	.	PUNCT
cet-12545	183	1	razmi	razmi	PROPN
cet-12545	183	2	,	,	PUNCT
cet-12545	183	3	n.	n.	NOUN
cet-12545	183	4	,	,	PUNCT
cet-12545	183	5	hasanzadeh	hasanzadeh	NOUN
cet-12545	183	6	,	,	PUNCT
cet-12545	183	7	m.	m.	NOUN
cet-12545	183	8	,	,	PUNCT
cet-12545	183	9	willander	willander	NOUN
cet-12545	183	10	,	,	PUNCT
cet-12545	183	11	m.	m.	NOUN
cet-12545	183	12	,	,	PUNCT
cet-12545	183	13	&	&	CCONJ
cet-12545	183	14	nur	nur	PROPN
cet-12545	183	15	,	,	PUNCT
cet-12545	183	16	o.	o.	PROPN
cet-12545	183	17	(	(	PUNCT
cet-12545	183	18	2020	2020	NUM
cet-12545	183	19	)	)	PUNCT
cet-12545	183	20	.	.	PUNCT
cet-12545	184	1	recent	recent	ADJ
cet-12545	184	2	progress	progress	NOUN
cet-12545	184	3	on	on	ADP
cet-12545	184	4	the	the	DET
cet-12545	184	5	electrochemical	electrochemical	ADJ
cet-12545	184	6	biosensing	biosensing	NOUN
cet-12545	184	7	of	of	ADP
cet-12545	184	8	escherichia	escherichia	NOUN
cet-12545	184	9	coli	coli	NOUN
cet-12545	184	10	o157	o157	PROPN
cet-12545	184	11	:	:	PUNCT
cet-12545	184	12	h7	h7	PROPN
cet-12545	184	13	:	:	PUNCT
cet-12545	184	14	material	material	NOUN
cet-12545	184	15	and	and	CCONJ
cet-12545	184	16	methods	method	NOUN
cet-12545	184	17	overview	overview	VERB
cet-12545	184	18	.	.	PUNCT
cet-12545	185	1	biosensors	biosensor	NOUN
cet-12545	185	2	,	,	PUNCT
cet-12545	185	3	10(5	10(5	NUM
cet-12545	185	4	)	)	PUNCT
cet-12545	185	5	,	,	PUNCT
cet-12545	185	6	54	54	NUM
cet-12545	185	7	.	.	PUNCT
cet-12545	185	8	ropero	ropero	NOUN
cet-12545	185	9	-	-	PUNCT
cet-12545	185	10	vega	vega	PROPN
cet-12545	185	11	,	,	PUNCT
cet-12545	185	12	jose	jose	PROPN
cet-12545	185	13	luis	luis	PROPN
cet-12545	185	14	,	,	PUNCT
cet-12545	185	15	redondo	redondo	PROPN
cet-12545	185	16	-	-	PUNCT
cet-12545	185	17	ortega	ortega	PROPN
cet-12545	185	18	,	,	PUNCT
cet-12545	185	19	j.	j.	PROPN
cet-12545	185	20	f.	f.	PROPN
cet-12545	185	21	,	,	PUNCT
cet-12545	185	22	galvis	galvis	NOUN
cet-12545	185	23	-	-	PUNCT
cet-12545	185	24	curubo	curubo	NOUN
cet-12545	185	25	,	,	PUNCT
cet-12545	185	26	y.	y.	PROPN
cet-12545	185	27	j.	j.	PROPN
cet-12545	185	28	,	,	PUNCT
cet-12545	185	29	rondón	rondón	NOUN
cet-12545	185	30	-	-	PUNCT
cet-12545	185	31	villarreal	villarreal	NOUN
cet-12545	185	32	,	,	PUNCT
cet-12545	185	33	p.	p.	NOUN
cet-12545	185	34	,	,	PUNCT
cet-12545	185	35	&	&	CCONJ
cet-12545	185	36	flórez	flórez	PROPN
cet-12545	185	37	-	-	PUNCT
cet-12545	185	38	castillo	castillo	PROPN
cet-12545	185	39	,	,	PUNCT
cet-12545	185	40	j.	j.	PROPN
cet-12545	185	41	m.	m.	PROPN
cet-12545	185	42	(	(	PUNCT
cet-12545	185	43	2021	2021	NUM
cet-12545	185	44	)	)	PUNCT
cet-12545	185	45	.	.	PUNCT
cet-12545	186	1	a	a	DET
cet-12545	186	2	bioinspired	bioinspire	VERB
cet-12545	186	3	peptide	peptide	NOUN
cet-12545	186	4	in	in	ADP
cet-12545	186	5	tir	tir	PROPN
cet-12545	186	6	protein	protein	NOUN
cet-12545	186	7	as	as	ADP
cet-12545	186	8	recognition	recognition	NOUN
cet-12545	186	9	molecule	molecule	NOUN
cet-12545	186	10	on	on	ADP
cet-12545	186	11	electrochemical	electrochemical	ADJ
cet-12545	186	12	biosensors	biosensor	NOUN
cet-12545	186	13	for	for	ADP
cet-12545	186	14	the	the	DET
cet-12545	186	15	detection	detection	NOUN
cet-12545	186	16	of	of	ADP
cet-12545	186	17	e.	e.	PROPN
cet-12545	186	18	coli	coli	PROPN
cet-12545	186	19	o157	o157	PROPN
cet-12545	186	20	:	:	PUNCT
cet-12545	186	21	h7	h7	NOUN
cet-12545	186	22	in	in	ADP
cet-12545	186	23	an	an	DET
cet-12545	186	24	aqueous	aqueous	ADJ
cet-12545	186	25	matrix	matrix	NOUN
cet-12545	186	26	.	.	PUNCT
cet-12545	187	1	molecules	molecule	NOUN
cet-12545	187	2	,	,	PUNCT
cet-12545	187	3	26(9	26(9	NUM
cet-12545	187	4	)	)	PUNCT
cet-12545	187	5	,	,	PUNCT
cet-12545	187	6	2559	2559	NUM
cet-12545	187	7	.	.	PUNCT
cet-12545	188	1	ropero	ropero	NOUN
cet-12545	188	2	-	-	PUNCT
cet-12545	188	3	vega	vega	PROPN
cet-12545	188	4	,	,	PUNCT
cet-12545	188	5	j.l	j.l	PROPN
cet-12545	188	6	.	.	PROPN
cet-12545	188	7	,	,	PUNCT
cet-12545	188	8	albiares	albiare	NOUN
cet-12545	188	9	,	,	PUNCT
cet-12545	188	10	l.	l.	PROPN
cet-12545	188	11	,	,	PUNCT
cet-12545	188	12	leon	leon	PROPN
cet-12545	188	13	,	,	PUNCT
cet-12545	188	14	w.	w.	PROPN
cet-12545	188	15	,	,	PUNCT
cet-12545	188	16	valdivieso	valdivieso	NOUN
cet-12545	188	17	-	-	PUNCT
cet-12545	188	18	quintero	quintero	PROPN
cet-12545	188	19	,	,	PUNCT
cet-12545	188	20	w.	w.	PROPN
cet-12545	188	21	,	,	PUNCT
cet-12545	188	22	&	&	CCONJ
cet-12545	188	23	flórez	flórez	PROPN
cet-12545	188	24	-	-	PUNCT
cet-12545	188	25	castillo	castillo	PROPN
cet-12545	188	26	,	,	PUNCT
cet-12545	188	27	j.	j.	PROPN
cet-12545	188	28	.	.	PUNCT
cet-12545	189	1	(	(	PUNCT
cet-12545	189	2	2022	2022	NUM
cet-12545	189	3	)	)	PUNCT
cet-12545	189	4	.	.	PUNCT
cet-12545	190	1	selected	select	VERB
cet-12545	190	2	articles	article	NOUN
cet-12545	190	3	for	for	ADP
cet-12545	190	4	the	the	DET
cet-12545	190	5	design	design	NOUN
cet-12545	190	6	of	of	ADP
cet-12545	190	7	an	an	DET
cet-12545	190	8	aptamer	aptamer	NOUN
cet-12545	190	9	“	"	PUNCT
cet-12545	190	10	in	in	ADP
cet-12545	190	11	silico	silico	NOUN
cet-12545	190	12	”	"	PUNCT
cet-12545	190	13	for	for	ADP
cet-12545	190	14	the	the	DET
cet-12545	190	15	detection	detection	NOUN
cet-12545	190	16	of	of	ADP
cet-12545	190	17	e.	e.	PROPN
cet-12545	190	18	coli	coli	PROPN
cet-12545	190	19	.	.	PUNCT
cet-12545	191	1	mendeley	mendeley	PROPN
cet-12545	191	2	data	data	PROPN
cet-12545	191	3	,	,	PUNCT
cet-12545	191	4	1	1	X
cet-12545	191	5	.	.	PUNCT
cet-12545	192	1	doi.org/10.17632/xd3txm9wwb.1	doi.org/10.17632/xd3txm9wwb.1	PROPN
cet-12545	192	2	shoaie	shoaie	PROPN
cet-12545	192	3	,	,	PUNCT
cet-12545	192	4	n.	n.	NOUN
cet-12545	192	5	,	,	PUNCT
cet-12545	192	6	forouzandeh	forouzandeh	NOUN
cet-12545	192	7	,	,	PUNCT
cet-12545	192	8	m.	m.	NOUN
cet-12545	192	9	,	,	PUNCT
cet-12545	192	10	&	&	CCONJ
cet-12545	192	11	omidfar	omidfar	PROPN
cet-12545	192	12	,	,	PUNCT
cet-12545	192	13	k.	k.	PROPN
cet-12545	192	14	(	(	PUNCT
cet-12545	192	15	2018	2018	NUM
cet-12545	192	16	)	)	PUNCT
cet-12545	192	17	.	.	PUNCT
cet-12545	193	1	highly	highly	ADV
cet-12545	193	2	sensitive	sensitive	ADJ
cet-12545	193	3	electrochemical	electrochemical	ADJ
cet-12545	193	4	biosensor	biosensor	NOUN
cet-12545	193	5	based	base	VERB
cet-12545	193	6	on	on	ADP
cet-12545	193	7	polyaniline	polyaniline	NOUN
cet-12545	193	8	and	and	CCONJ
cet-12545	193	9	gold	gold	NOUN
cet-12545	193	10	nanoparticles	nanoparticle	NOUN
cet-12545	193	11	for	for	ADP
cet-12545	193	12	dna	dna	PROPN
cet-12545	193	13	detection	detection	NOUN
cet-12545	193	14	.	.	PUNCT
cet-12545	194	1	ieee	ieee	NOUN
cet-12545	194	2	sensors	sensor	NOUN
cet-12545	194	3	journal	journal	PROPN
cet-12545	194	4	,	,	PUNCT
cet-12545	194	5	18(5	18(5	NUM
cet-12545	194	6	)	)	PUNCT
cet-12545	194	7	,	,	PUNCT
cet-12545	194	8	1835–1843	1835–1843	NUM
cet-12545	194	9	.	.	PUNCT
cet-12545	195	1	tuerk	tuerk	NOUN
cet-12545	195	2	,	,	PUNCT
cet-12545	195	3	c.	c.	PROPN
cet-12545	195	4	,	,	PUNCT
cet-12545	195	5	&	&	CCONJ
cet-12545	195	6	gold	gold	NOUN
cet-12545	195	7	,	,	PUNCT
cet-12545	195	8	l.	l.	PROPN
cet-12545	195	9	(	(	PUNCT
cet-12545	195	10	1990	1990	NUM
cet-12545	195	11	)	)	PUNCT
cet-12545	195	12	.	.	PUNCT
cet-12545	196	1	systematic	systematic	ADJ
cet-12545	196	2	evolution	evolution	NOUN
cet-12545	196	3	of	of	ADP
cet-12545	196	4	ligands	ligand	NOUN
cet-12545	196	5	by	by	ADP
cet-12545	196	6	exponential	exponential	ADJ
cet-12545	196	7	enrichment	enrichment	NOUN
cet-12545	196	8	:	:	PUNCT
cet-12545	196	9	rna	rna	NOUN
cet-12545	196	10	ligands	ligand	NOUN
cet-12545	196	11	to	to	ADP
cet-12545	196	12	bacteriophage	bacteriophage	NOUN
cet-12545	196	13	t4	t4	PROPN
cet-12545	196	14	dna	dna	PROPN
cet-12545	196	15	polymerase	polymerase	NOUN
cet-12545	196	16	.	.	PUNCT
cet-12545	197	1	science	science	NOUN
cet-12545	197	2	(	(	PUNCT
cet-12545	197	3	new	new	PROPN
cet-12545	197	4	york	york	PROPN
cet-12545	197	5	,	,	PUNCT
cet-12545	197	6	n.y	n.y	PROPN
cet-12545	197	7	.	.	PROPN
cet-12545	197	8	)	)	PUNCT
cet-12545	197	9	,	,	PUNCT
cet-12545	197	10	249(4968	249(4968	NUM
cet-12545	197	11	)	)	PUNCT
cet-12545	197	12	,	,	PUNCT
cet-12545	197	13	505–510	505–510	NUM
cet-12545	197	14	.	.	PUNCT
cet-12545	198	1	wang	wang	PROPN
cet-12545	198	2	,	,	PUNCT
cet-12545	198	3	h.	h.	PROPN
cet-12545	198	4	,	,	PUNCT
cet-12545	198	5	zhao	zhao	PROPN
cet-12545	198	6	,	,	PUNCT
cet-12545	198	7	y.	y.	PROPN
cet-12545	198	8	,	,	PUNCT
cet-12545	198	9	bie	bie	PROPN
cet-12545	198	10	,	,	PUNCT
cet-12545	198	11	s.	s.	PROPN
cet-12545	198	12	,	,	PUNCT
cet-12545	198	13	suo	suo	PROPN
cet-12545	198	14	,	,	PUNCT
cet-12545	198	15	t.	t.	PROPN
cet-12545	198	16	,	,	PUNCT
cet-12545	198	17	jia	jia	PROPN
cet-12545	198	18	,	,	PUNCT
cet-12545	198	19	g.	g.	PROPN
cet-12545	198	20	,	,	PUNCT
cet-12545	198	21	liu	liu	PROPN
cet-12545	198	22	,	,	PUNCT
cet-12545	198	23	b.	b.	PROPN
cet-12545	198	24	,	,	PUNCT
cet-12545	198	25	ye	ye	PROPN
cet-12545	198	26	,	,	PUNCT
cet-12545	198	27	r.	r.	PROPN
cet-12545	198	28	,	,	PUNCT
cet-12545	198	29	&	&	CCONJ
cet-12545	198	30	li	li	PROPN
cet-12545	198	31	,	,	PUNCT
cet-12545	198	32	z.	z.	PROPN
cet-12545	198	33	(	(	PUNCT
cet-12545	198	34	2019	2019	NUM
cet-12545	198	35	)	)	PUNCT
cet-12545	198	36	.	.	PUNCT
cet-12545	199	1	development	development	NOUN
cet-12545	199	2	of	of	ADP
cet-12545	199	3	an	an	DET
cet-12545	199	4	electrochemical	electrochemical	ADJ
cet-12545	199	5	biosensor	biosensor	NOUN
cet-12545	199	6	for	for	ADP
cet-12545	199	7	rapid	rapid	ADJ
cet-12545	199	8	and	and	CCONJ
cet-12545	199	9	effective	effective	ADJ
cet-12545	199	10	detection	detection	NOUN
cet-12545	199	11	of	of	ADP
cet-12545	199	12	pathogenic	pathogenic	ADJ
cet-12545	199	13	escherichia	escherichia	NOUN
cet-12545	199	14	coli	coli	NOUN
cet-12545	199	15	in	in	ADP
cet-12545	199	16	licorice	licorice	NOUN
cet-12545	199	17	extract	extract	NOUN
cet-12545	199	18	.	.	PUNCT
cet-12545	200	1	applied	apply	VERB
cet-12545	200	2	sciences	science	NOUN
cet-12545	200	3	,	,	PUNCT
cet-12545	200	4	9(2	9(2	NUM
cet-12545	200	5	)	)	PUNCT
cet-12545	200	6	,	,	PUNCT
cet-12545	200	7	295	295	NUM
cet-12545	200	8	.	.	PUNCT
cet-12545	201	1	zhao	zhao	X
cet-12545	201	2	,	,	PUNCT
cet-12545	201	3	y.-w	y.-w	PROPN
cet-12545	201	4	.	.	PROPN
cet-12545	201	5	,	,	PUNCT
cet-12545	201	6	wang	wang	PROPN
cet-12545	201	7	,	,	PUNCT
cet-12545	201	8	h.-x	h.-x	NOUN
cet-12545	201	9	.	.	PROPN
cet-12545	201	10	,	,	PUNCT
cet-12545	201	11	jia	jia	PROPN
cet-12545	201	12	,	,	PUNCT
cet-12545	201	13	g.-c	g.-c	PROPN
cet-12545	201	14	.	.	PUNCT
cet-12545	201	15	,	,	PUNCT
cet-12545	201	16	&	&	CCONJ
cet-12545	201	17	li	li	PROPN
cet-12545	201	18	,	,	PUNCT
cet-12545	201	19	z.	z.	PROPN
cet-12545	201	20	(	(	PUNCT
cet-12545	201	21	2018	2018	NUM
cet-12545	201	22	)	)	PUNCT
cet-12545	201	23	.	.	PUNCT
cet-12545	202	1	application	application	NOUN
cet-12545	202	2	of	of	ADP
cet-12545	202	3	aptamer	aptamer	NOUN
cet-12545	202	4	-	-	PUNCT
cet-12545	202	5	based	base	VERB
cet-12545	202	6	biosensor	biosensor	NOUN
cet-12545	202	7	for	for	ADP
cet-12545	202	8	rapid	rapid	ADJ
cet-12545	202	9	detection	detection	NOUN
cet-12545	202	10	of	of	ADP
cet-12545	202	11	pathogenic	pathogenic	ADJ
cet-12545	202	12	escherichia	escherichia	NOUN
cet-12545	202	13	coli	coli	NOUN
cet-12545	202	14	.	.	PUNCT
cet-12545	203	1	sensors	sensor	NOUN
cet-12545	203	2	,	,	PUNCT
cet-12545	203	3	18(8	18(8	NUM
cet-12545	203	4	)	)	PUNCT
cet-12545	203	5	,	,	PUNCT
cet-12545	203	6	2518	2518	NUM
cet-12545	203	7	.	.	PUNCT
cet-12545	204	1	288	288	NUM
cet-12545	204	2	102roperovega.pdf	102roperovega.pdf	NUM
cet-12545	204	3	detection	detection	NOUN
cet-12545	204	4	of	of	ADP
cet-12545	204	5	pathogenic	pathogenic	ADJ
cet-12545	204	6	e.	e.	PROPN
cet-12545	204	7	coli	coli	NOUN
cet-12545	204	8	by	by	ADP
cet-12545	204	9	electrochemical	electrochemical	ADJ
cet-12545	204	10	biosensors	biosensor	NOUN
cet-12545	204	11	based	base	VERB
cet-12545	204	12	on	on	ADP
cet-12545	204	13	aptamers	aptamer	NOUN
cet-12545	204	14	designed	design	VERB
cet-12545	204	15	by	by	ADP
cet-12545	204	16	bioinformatic	bioinformatic	ADJ
cet-12545	204	17	tools	tool	NOUN