id	sid	tid	token	lemma	pos
cet-15064	1	1	doi	doi	NOUN
cet-15064	1	2	:	:	PUNCT
cet-15064	1	3	10.3303	10.3303	NUM
cet-15064	1	4	/	/	SYM
cet-15064	1	5	cet24114159	cet24114159	ADJ
cet-15064	1	6	paper	paper	NOUN
cet-15064	1	7	received	receive	VERB
cet-15064	1	8	:	:	PUNCT
cet-15064	1	9	28	28	NUM
cet-15064	1	10	june	june	PROPN
cet-15064	1	11	2024	2024	NUM
cet-15064	1	12	;	;	PUNCT
cet-15064	1	13	revised	revise	VERB
cet-15064	1	14	:	:	PUNCT
cet-15064	1	15	28	28	NUM
cet-15064	1	16	august	august	PROPN
cet-15064	1	17	2024	2024	NUM
cet-15064	1	18	;	;	PUNCT
cet-15064	1	19	accepted	accept	VERB
cet-15064	1	20	:	:	PUNCT
cet-15064	1	21	1	1	NUM
cet-15064	1	22	december	december	PROPN
cet-15064	1	23	2024	2024	NUM
cet-15064	1	24	please	please	INTJ
cet-15064	1	25	cite	cite	VERB
cet-15064	1	26	this	this	DET
cet-15064	1	27	article	article	NOUN
cet-15064	1	28	as	as	ADP
cet-15064	1	29	:	:	PUNCT
cet-15064	1	30	tempfli	tempfli	PROPN
cet-15064	1	31	k.	k.	PROPN
cet-15064	1	32	,	,	PUNCT
cet-15064	1	33	szalai	szalai	PROPN
cet-15064	1	34	k.	k.	PROPN
cet-15064	1	35	,	,	PUNCT
cet-15064	1	36	szabó	szabó	ADJ
cet-15064	1	37	-	-	PUNCT
cet-15064	1	38	sárvári	sárvári	NOUN
cet-15064	1	39	l.	l.	PROPN
cet-15064	1	40	,	,	PUNCT
cet-15064	1	41	alpár	alpár	PROPN
cet-15064	1	42	b.	b.	PROPN
cet-15064	1	43	,	,	PUNCT
cet-15064	1	44	tóth	tóth	PROPN
cet-15064	1	45	t.	t.	PROPN
cet-15064	1	46	,	,	PUNCT
cet-15064	1	47	vojnich	vojnich	PROPN
cet-15064	1	48	v.	v.	ADV
cet-15064	1	49	,	,	PUNCT
cet-15064	1	50	lencsés	lencsés	NOUN
cet-15064	1	51	-	-	PUNCT
cet-15064	1	52	varga	varga	PROPN
cet-15064	1	53	e.	e.	PROPN
cet-15064	1	54	,	,	PUNCT
cet-15064	1	55	2024	2024	NUM
cet-15064	1	56	,	,	PUNCT
cet-15064	1	57	effects	effect	NOUN
cet-15064	1	58	of	of	ADP
cet-15064	1	59	a	a	DET
cet-15064	1	60	probiotic	probiotic	ADJ
cet-15064	1	61	supplement	supplement	NOUN
cet-15064	1	62	on	on	ADP
cet-15064	1	63	the	the	DET
cet-15064	1	64	quantity	quantity	NOUN
cet-15064	1	65	of	of	ADP
cet-15064	1	66	some	some	DET
cet-15064	1	67	bacterial	bacterial	ADJ
cet-15064	1	68	communities	community	NOUN
cet-15064	1	69	in	in	ADP
cet-15064	1	70	fecal	fecal	ADJ
cet-15064	1	71	samples	sample	NOUN
cet-15064	1	72	of	of	ADP
cet-15064	1	73	lactating	lactate	VERB
cet-15064	1	74	sows	sow	NOUN
cet-15064	1	75	,	,	PUNCT
cet-15064	1	76	chemical	chemical	NOUN
cet-15064	1	77	engineering	engineering	NOUN
cet-15064	1	78	transactions	transaction	NOUN
cet-15064	1	79	,	,	PUNCT
cet-15064	1	80	114	114	NUM
cet-15064	1	81	,	,	PUNCT
cet-15064	1	82	949	949	NUM
cet-15064	1	83	-	-	SYM
cet-15064	1	84	954	954	NUM
cet-15064	1	85	doi:10.3303	doi:10.3303	NOUN
cet-15064	1	86	/	/	SYM
cet-15064	1	87	cet24114159	cet24114159	PROPN
cet-15064	1	88	chemical	chemical	PROPN
cet-15064	1	89	engineering	engineering	NOUN
cet-15064	1	90	transactions	transaction	NOUN
cet-15064	1	91	vol	vol	NOUN
cet-15064	1	92	.	.	PROPN
cet-15064	1	93	114	114	NUM
cet-15064	1	94	,	,	PUNCT
cet-15064	1	95	2024	2024	NUM
cet-15064	1	96	a	a	DET
cet-15064	1	97	publication	publication	NOUN
cet-15064	1	98	of	of	ADP
cet-15064	1	99	the	the	DET
cet-15064	1	100	italian	italian	ADJ
cet-15064	1	101	association	association	NOUN
cet-15064	1	102	of	of	ADP
cet-15064	1	103	chemical	chemical	PROPN
cet-15064	1	104	engineering	engineering	NOUN
cet-15064	1	105	online	online	ADV
cet-15064	1	106	at	at	ADP
cet-15064	1	107	www.cetjournal.it	www.cetjournal.it	PROPN
cet-15064	1	108	guest	guest	NOUN
cet-15064	1	109	editors	editor	NOUN
cet-15064	1	110	:	:	PUNCT
cet-15064	1	111	petar	petar	PROPN
cet-15064	1	112	s.	s.	PROPN
cet-15064	1	113	varbanov	varbanov	PROPN
cet-15064	1	114	,	,	PUNCT
cet-15064	1	115	min	min	PROPN
cet-15064	1	116	zeng	zeng	PROPN
cet-15064	1	117	,	,	PUNCT
cet-15064	1	118	yee	yee	PROPN
cet-15064	1	119	van	van	PROPN
cet-15064	1	120	fan	fan	PROPN
cet-15064	1	121	,	,	PUNCT
cet-15064	1	122	xuechao	xuechao	PROPN
cet-15064	1	123	wang	wang	PROPN
cet-15064	1	124	copyright	copyright	PROPN
cet-15064	2	1	©	©	PROPN
cet-15064	2	2	2024	2024	NUM
cet-15064	2	3	,	,	PUNCT
cet-15064	2	4	aidic	aidic	ADJ
cet-15064	2	5	servizi	servizi	PROPN
cet-15064	2	6	s.r.l	s.r.l	NOUN
cet-15064	2	7	.	.	PUNCT
cet-15064	3	1	isbn	isbn	PROPN
cet-15064	3	2	979	979	NUM
cet-15064	3	3	-	-	SYM
cet-15064	3	4	12	12	NUM
cet-15064	3	5	-	-	PUNCT
cet-15064	3	6	81206	81206	NUM
cet-15064	3	7	-	-	SYM
cet-15064	3	8	12	12	NUM
cet-15064	3	9	-	-	SYM
cet-15064	3	10	0	0	NUM
cet-15064	3	11	;	;	PUNCT
cet-15064	3	12	issn	issn	PROPN
cet-15064	3	13	2283	2283	NUM
cet-15064	3	14	-	-	SYM
cet-15064	3	15	9216	9216	NUM
cet-15064	3	16	effects	effect	NOUN
cet-15064	3	17	of	of	ADP
cet-15064	3	18	a	a	DET
cet-15064	3	19	probiotic	probiotic	ADJ
cet-15064	3	20	supplement	supplement	NOUN
cet-15064	3	21	on	on	ADP
cet-15064	3	22	the	the	DET
cet-15064	3	23	quantity	quantity	NOUN
cet-15064	3	24	of	of	ADP
cet-15064	3	25	some	some	DET
cet-15064	3	26	bacterial	bacterial	ADJ
cet-15064	3	27	communities	community	NOUN
cet-15064	3	28	in	in	ADP
cet-15064	3	29	fecal	fecal	ADJ
cet-15064	3	30	samples	sample	NOUN
cet-15064	3	31	of	of	ADP
cet-15064	3	32	lactating	lactate	VERB
cet-15064	3	33	sows	sow	NOUN
cet-15064	3	34	károly	károly	ADJ
cet-15064	3	35	tempflia	tempflia	NOUN
cet-15064	3	36	,	,	PUNCT
cet-15064	3	37	*	*	PROPN
cet-15064	3	38	klaudia	klaudia	PROPN
cet-15064	3	39	szalaia	szalaia	PROPN
cet-15064	3	40	,	,	PUNCT
cet-15064	3	41	loretta	loretta	PROPN
cet-15064	3	42	szabó	szabó	NOUN
cet-15064	3	43	-	-	PUNCT
cet-15064	3	44	sárvária	sárvária	NOUN
cet-15064	3	45	,	,	PUNCT
cet-15064	3	46	botond	botond	NOUN
cet-15064	3	47	alpára	alpára	ADJ
cet-15064	3	48	,	,	PUNCT
cet-15064	3	49	tamás	tamás	ADJ
cet-15064	3	50	tótha	tótha	NOUN
cet-15064	3	51	,	,	PUNCT
cet-15064	3	52	viktor	viktor	NOUN
cet-15064	3	53	vojnichb	vojnichb	NOUN
cet-15064	3	54	,	,	PUNCT
cet-15064	3	55	erika	erika	PROPN
cet-15064	3	56	lencsés	lencsés	PROPN
cet-15064	3	57	-	-	PUNCT
cet-15064	3	58	vargaa	vargaa	NOUN
cet-15064	3	59	aszéchenyi	aszéchenyi	PROPN
cet-15064	3	60	istván	istván	PROPN
cet-15064	3	61	university	university	PROPN
cet-15064	3	62	,	,	PUNCT
cet-15064	3	63	faculty	faculty	NOUN
cet-15064	3	64	of	of	ADP
cet-15064	3	65	agricultural	agricultural	ADJ
cet-15064	3	66	and	and	CCONJ
cet-15064	3	67	food	food	NOUN
cet-15064	3	68	sciences	science	NOUN
cet-15064	3	69	,	,	PUNCT
cet-15064	3	70	department	department	NOUN
cet-15064	3	71	of	of	ADP
cet-15064	3	72	animal	animal	NOUN
cet-15064	3	73	sciences	science	NOUN
cet-15064	3	74	,	,	PUNCT
cet-15064	3	75	2	2	NUM
cet-15064	3	76	vár	vár	NOUN
cet-15064	3	77	square	square	NOUN
cet-15064	3	78	,	,	PUNCT
cet-15064	3	79	9200	9200	NUM
cet-15064	3	80	,	,	PUNCT
cet-15064	3	81	mosonmagyaróvár	mosonmagyaróvár	NOUN
cet-15064	3	82	,	,	PUNCT
cet-15064	3	83	hungary	hungary	NOUN
cet-15064	3	84	buniversity	buniversity	NOUN
cet-15064	3	85	of	of	ADP
cet-15064	3	86	szeged	szeged	PROPN
cet-15064	3	87	,	,	PUNCT
cet-15064	3	88	faculty	faculty	NOUN
cet-15064	3	89	of	of	ADP
cet-15064	3	90	agriculture	agriculture	PROPN
cet-15064	3	91	,	,	PUNCT
cet-15064	3	92	institute	institute	NOUN
cet-15064	3	93	of	of	ADP
cet-15064	3	94	plant	plant	NOUN
cet-15064	3	95	sciences	sciences	PROPN
cet-15064	3	96	and	and	CCONJ
cet-15064	3	97	environmental	environmental	ADJ
cet-15064	3	98	protection	protection	NOUN
cet-15064	3	99	,	,	PUNCT
cet-15064	3	100	15	15	NUM
cet-15064	3	101	andrássy	andrássy	ADJ
cet-15064	3	102	street	street	NOUN
cet-15064	3	103	,	,	PUNCT
cet-15064	3	104	6800	6800	NUM
cet-15064	3	105	,	,	PUNCT
cet-15064	3	106	hódmezővásárhely	hódmezővásárhely	ADV
cet-15064	3	107	,	,	PUNCT
cet-15064	3	108	hungary	hungary	PROPN
cet-15064	3	109	tempfli.karoly@sze.hu	tempfli.karoly@sze.hu	X
cet-15064	4	1	complex	complex	ADJ
cet-15064	4	2	adaptation	adaptation	NOUN
cet-15064	4	3	strategies	strategy	NOUN
cet-15064	4	4	concerning	concern	VERB
cet-15064	4	5	nutrition	nutrition	NOUN
cet-15064	4	6	,	,	PUNCT
cet-15064	4	7	housing	housing	NOUN
cet-15064	4	8	technology	technology	NOUN
cet-15064	4	9	,	,	PUNCT
cet-15064	4	10	and	and	CCONJ
cet-15064	4	11	veterinary	veterinary	ADJ
cet-15064	4	12	treatment	treatment	NOUN
cet-15064	4	13	are	be	AUX
cet-15064	4	14	required	require	VERB
cet-15064	4	15	to	to	PART
cet-15064	4	16	maintain	maintain	VERB
cet-15064	4	17	current	current	ADJ
cet-15064	4	18	production	production	NOUN
cet-15064	4	19	levels	level	NOUN
cet-15064	4	20	under	under	ADP
cet-15064	4	21	increasingly	increasingly	ADV
cet-15064	4	22	stringent	stringent	ADJ
cet-15064	4	23	regulations	regulation	NOUN
cet-15064	4	24	on	on	ADP
cet-15064	4	25	the	the	DET
cet-15064	4	26	preventive	preventive	ADJ
cet-15064	4	27	application	application	NOUN
cet-15064	4	28	of	of	ADP
cet-15064	4	29	antibiotics	antibiotic	NOUN
cet-15064	4	30	.	.	PUNCT
cet-15064	5	1	the	the	DET
cet-15064	5	2	reduced	reduce	VERB
cet-15064	5	3	application	application	NOUN
cet-15064	5	4	of	of	ADP
cet-15064	5	5	antibiotics	antibiotic	NOUN
cet-15064	5	6	is	be	AUX
cet-15064	5	7	recommended	recommend	VERB
cet-15064	5	8	for	for	ADP
cet-15064	5	9	the	the	DET
cet-15064	5	10	sustainability	sustainability	NOUN
cet-15064	5	11	of	of	ADP
cet-15064	5	12	industrial	industrial	ADJ
cet-15064	5	13	pig	pig	NOUN
cet-15064	5	14	production	production	NOUN
cet-15064	5	15	.	.	PUNCT
cet-15064	6	1	probiotic	probiotic	ADJ
cet-15064	6	2	supplementation	supplementation	NOUN
cet-15064	6	3	may	may	AUX
cet-15064	6	4	contribute	contribute	VERB
cet-15064	6	5	to	to	ADP
cet-15064	6	6	improved	improved	ADJ
cet-15064	6	7	sow	sow	NOUN
cet-15064	6	8	and	and	CCONJ
cet-15064	6	9	piglet	piglet	NOUN
cet-15064	6	10	health	health	NOUN
cet-15064	6	11	,	,	PUNCT
cet-15064	6	12	mitigating	mitigate	VERB
cet-15064	6	13	the	the	DET
cet-15064	6	14	need	need	NOUN
cet-15064	6	15	for	for	ADP
cet-15064	6	16	antibiotics	antibiotic	NOUN
cet-15064	6	17	.	.	PUNCT
cet-15064	7	1	the	the	DET
cet-15064	7	2	effects	effect	NOUN
cet-15064	7	3	of	of	ADP
cet-15064	7	4	probiotic	probiotic	ADJ
cet-15064	7	5	supplementation	supplementation	NOUN
cet-15064	7	6	on	on	ADP
cet-15064	7	7	sow	sow	NOUN
cet-15064	7	8	performance	performance	NOUN
cet-15064	7	9	and	and	CCONJ
cet-15064	7	10	the	the	DET
cet-15064	7	11	quantity	quantity	NOUN
cet-15064	7	12	of	of	ADP
cet-15064	7	13	fecal	fecal	ADJ
cet-15064	7	14	bacterial	bacterial	ADJ
cet-15064	7	15	communities	community	NOUN
cet-15064	7	16	in	in	ADP
cet-15064	7	17	lactating	lactate	VERB
cet-15064	7	18	sows	sow	NOUN
cet-15064	7	19	were	be	AUX
cet-15064	7	20	investigated	investigate	VERB
cet-15064	7	21	.	.	PUNCT
cet-15064	8	1	experimental	experimental	ADJ
cet-15064	8	2	sows	sow	NOUN
cet-15064	8	3	received	receive	VERB
cet-15064	8	4	probiotic	probiotic	ADJ
cet-15064	8	5	supplementation	supplementation	NOUN
cet-15064	8	6	(	(	PUNCT
cet-15064	8	7	n=10	n=10	NOUN
cet-15064	8	8	)	)	PUNCT
cet-15064	8	9	and	and	CCONJ
cet-15064	8	10	were	be	AUX
cet-15064	8	11	compared	compare	VERB
cet-15064	8	12	to	to	PART
cet-15064	8	13	control	control	VERB
cet-15064	8	14	sows	sow	NOUN
cet-15064	8	15	(	(	PUNCT
cet-15064	8	16	n=10	n=10	NOUN
cet-15064	8	17	)	)	PUNCT
cet-15064	8	18	.	.	PUNCT
cet-15064	9	1	fecal	fecal	ADJ
cet-15064	9	2	samples	sample	NOUN
cet-15064	9	3	were	be	AUX
cet-15064	9	4	collected	collect	VERB
cet-15064	9	5	from	from	ADP
cet-15064	9	6	20	20	NUM
cet-15064	9	7	sows	sow	NOUN
cet-15064	9	8	in	in	ADP
cet-15064	9	9	the	the	DET
cet-15064	9	10	second	second	ADJ
cet-15064	9	11	week	week	NOUN
cet-15064	9	12	of	of	ADP
cet-15064	9	13	lactation	lactation	NOUN
cet-15064	9	14	.	.	PUNCT
cet-15064	10	1	the	the	DET
cet-15064	10	2	quantitative	quantitative	ADJ
cet-15064	10	3	measurement	measurement	NOUN
cet-15064	10	4	of	of	ADP
cet-15064	10	5	total	total	ADJ
cet-15064	10	6	bacteria	bacteria	NOUN
cet-15064	10	7	,	,	PUNCT
cet-15064	10	8	prevotella	prevotella	NOUN
cet-15064	10	9	genus	genus	NOUN
cet-15064	10	10	,	,	PUNCT
cet-15064	10	11	lactobacillus	lactobacillus	NOUN
cet-15064	10	12	spp	spp	NOUN
cet-15064	10	13	.	.	PUNCT
cet-15064	10	14	,	,	PUNCT
cet-15064	10	15	and	and	CCONJ
cet-15064	10	16	bifidobacterium	bifidobacterium	NOUN
cet-15064	10	17	spp	spp	NOUN
cet-15064	10	18	.	.	PUNCT
cet-15064	10	19	was	be	AUX
cet-15064	10	20	done	do	VERB
cet-15064	10	21	by	by	ADP
cet-15064	10	22	qpcr	qpcr	ADV
cet-15064	10	23	.	.	PUNCT
cet-15064	11	1	differences	difference	NOUN
cet-15064	11	2	in	in	ADP
cet-15064	11	3	backfat	backfat	NOUN
cet-15064	11	4	thickness	thickness	NOUN
cet-15064	11	5	(	(	PUNCT
cet-15064	11	6	bft	bft	NOUN
cet-15064	11	7	)	)	PUNCT
cet-15064	11	8	,	,	PUNCT
cet-15064	11	9	bft	bft	NOUN
cet-15064	11	10	loss	loss	NOUN
cet-15064	11	11	,	,	PUNCT
cet-15064	11	12	and	and	CCONJ
cet-15064	11	13	feed	feed	NOUN
cet-15064	11	14	intake	intake	NOUN
cet-15064	11	15	of	of	ADP
cet-15064	11	16	control	control	NOUN
cet-15064	11	17	and	and	CCONJ
cet-15064	11	18	experimental	experimental	ADJ
cet-15064	11	19	sows	sow	NOUN
cet-15064	11	20	were	be	AUX
cet-15064	11	21	not	not	PART
cet-15064	11	22	significant	significant	ADJ
cet-15064	11	23	(	(	PUNCT
cet-15064	11	24	p>0.05	p>0.05	PROPN
cet-15064	11	25	)	)	PUNCT
cet-15064	11	26	.	.	PUNCT
cet-15064	12	1	the	the	DET
cet-15064	12	2	amount	amount	NOUN
cet-15064	12	3	of	of	ADP
cet-15064	12	4	total	total	ADJ
cet-15064	12	5	bacteria	bacteria	NOUN
cet-15064	12	6	,	,	PUNCT
cet-15064	12	7	prevotella	prevotella	NOUN
cet-15064	12	8	,	,	PUNCT
cet-15064	12	9	and	and	CCONJ
cet-15064	12	10	lactobacillus	lactobacillus	PROPN
cet-15064	12	11	spp	spp	NOUN
cet-15064	12	12	.	.	PUNCT
cet-15064	12	13	was	be	AUX
cet-15064	12	14	lower	low	ADJ
cet-15064	12	15	(	(	PUNCT
cet-15064	12	16	p<0.05	p<0.05	NOUN
cet-15064	12	17	)	)	PUNCT
cet-15064	12	18	in	in	ADP
cet-15064	12	19	the	the	DET
cet-15064	12	20	fecal	fecal	ADJ
cet-15064	12	21	samples	sample	NOUN
cet-15064	12	22	of	of	ADP
cet-15064	12	23	experimental	experimental	ADJ
cet-15064	12	24	sows	sow	NOUN
cet-15064	12	25	.	.	PUNCT
cet-15064	13	1	the	the	DET
cet-15064	13	2	prevotella	prevotella	NOUN
cet-15064	13	3	percentage	percentage	NOUN
cet-15064	13	4	in	in	ADP
cet-15064	13	5	total	total	ADJ
cet-15064	13	6	bacteria	bacteria	NOUN
cet-15064	13	7	decreased	decrease	VERB
cet-15064	13	8	,	,	PUNCT
cet-15064	13	9	whereas	whereas	SCONJ
cet-15064	13	10	bifidobacterium	bifidobacterium	NOUN
cet-15064	13	11	spp	spp	NOUN
cet-15064	13	12	.	.	PUNCT
cet-15064	14	1	the	the	DET
cet-15064	14	2	ratio	ratio	NOUN
cet-15064	14	3	increased	increase	VERB
cet-15064	14	4	in	in	ADP
cet-15064	14	5	experimental	experimental	ADJ
cet-15064	14	6	supplemented	supplement	VERB
cet-15064	14	7	sows	sow	NOUN
cet-15064	14	8	.	.	PUNCT
cet-15064	15	1	overall	overall	ADJ
cet-15064	15	2	,	,	PUNCT
cet-15064	15	3	probiotic	probiotic	ADJ
cet-15064	15	4	supplementation	supplementation	NOUN
cet-15064	15	5	resulted	result	VERB
cet-15064	15	6	in	in	ADP
cet-15064	15	7	notable	notable	ADJ
cet-15064	15	8	alterations	alteration	NOUN
cet-15064	15	9	regarding	regard	VERB
cet-15064	15	10	some	some	PRON
cet-15064	15	11	of	of	ADP
cet-15064	15	12	the	the	DET
cet-15064	15	13	analyzed	analyze	VERB
cet-15064	15	14	bacterial	bacterial	ADJ
cet-15064	15	15	communities	community	NOUN
cet-15064	15	16	.	.	PUNCT
cet-15064	16	1	1	1	X
cet-15064	16	2	.	.	X
cet-15064	16	3	introduction	introduction	NOUN
cet-15064	16	4	the	the	DET
cet-15064	16	5	european	european	PROPN
cet-15064	16	6	union	union	PROPN
cet-15064	16	7	banned	ban	VERB
cet-15064	16	8	the	the	DET
cet-15064	16	9	use	use	NOUN
cet-15064	16	10	of	of	ADP
cet-15064	16	11	antibiotics	antibiotic	NOUN
cet-15064	16	12	as	as	ADP
cet-15064	16	13	growth	growth	NOUN
cet-15064	16	14	promoters	promoter	NOUN
cet-15064	16	15	in	in	ADP
cet-15064	16	16	2006	2006	NUM
cet-15064	16	17	(	(	PUNCT
cet-15064	16	18	regulation	regulation	NOUN
cet-15064	16	19	(	(	PUNCT
cet-15064	16	20	ec	ec	PROPN
cet-15064	16	21	)	)	PUNCT
cet-15064	16	22	no	no	DET
cet-15064	16	23	1831/2003	1831/2003	NUM
cet-15064	16	24	)	)	PUNCT
cet-15064	16	25	,	,	PUNCT
cet-15064	16	26	and	and	CCONJ
cet-15064	16	27	since	since	SCONJ
cet-15064	16	28	january	january	PROPN
cet-15064	16	29	28	28	NUM
cet-15064	16	30	,	,	PUNCT
cet-15064	16	31	2022	2022	NUM
cet-15064	16	32	(	(	PUNCT
cet-15064	16	33	regulation	regulation	NOUN
cet-15064	16	34	(	(	PUNCT
cet-15064	16	35	eu	eu	NOUN
cet-15064	16	36	)	)	PUNCT
cet-15064	16	37	2019/6	2019/6	NUM
cet-15064	16	38	)	)	PUNCT
cet-15064	16	39	,	,	PUNCT
cet-15064	16	40	the	the	DET
cet-15064	16	41	preventive	preventive	ADJ
cet-15064	16	42	use	use	NOUN
cet-15064	16	43	of	of	ADP
cet-15064	16	44	antibiotics	antibiotic	NOUN
cet-15064	16	45	has	have	AUX
cet-15064	16	46	also	also	ADV
cet-15064	16	47	been	be	AUX
cet-15064	16	48	restricted	restrict	VERB
cet-15064	16	49	in	in	ADP
cet-15064	16	50	farm	farm	NOUN
cet-15064	16	51	animal	animal	NOUN
cet-15064	16	52	production	production	NOUN
cet-15064	16	53	due	due	ADP
cet-15064	16	54	to	to	ADP
cet-15064	16	55	the	the	DET
cet-15064	16	56	emergence	emergence	NOUN
cet-15064	16	57	of	of	ADP
cet-15064	16	58	antimicrobial	antimicrobial	ADJ
cet-15064	16	59	resistance	resistance	NOUN
cet-15064	16	60	.	.	PUNCT
cet-15064	17	1	to	to	PART
cet-15064	17	2	mitigate	mitigate	VERB
cet-15064	17	3	the	the	DET
cet-15064	17	4	impact	impact	NOUN
cet-15064	17	5	of	of	ADP
cet-15064	17	6	the	the	DET
cet-15064	17	7	stringent	stringent	ADJ
cet-15064	17	8	regulations	regulation	NOUN
cet-15064	17	9	,	,	PUNCT
cet-15064	17	10	novel	novel	ADJ
cet-15064	17	11	adaptation	adaptation	NOUN
cet-15064	17	12	strategies	strategy	NOUN
cet-15064	17	13	were	be	AUX
cet-15064	17	14	developed	develop	VERB
cet-15064	17	15	,	,	PUNCT
cet-15064	17	16	such	such	ADJ
cet-15064	17	17	as	as	ADP
cet-15064	17	18	the	the	DET
cet-15064	17	19	widespread	widespread	ADJ
cet-15064	17	20	application	application	NOUN
cet-15064	17	21	of	of	ADP
cet-15064	17	22	prebiotic	prebiotic	ADJ
cet-15064	17	23	and	and	CCONJ
cet-15064	17	24	probiotic	probiotic	ADJ
cet-15064	17	25	feed	feed	NOUN
cet-15064	17	26	supplements	supplement	NOUN
cet-15064	17	27	.	.	PUNCT
cet-15064	18	1	prebiotics	prebiotic	NOUN
cet-15064	18	2	and	and	CCONJ
cet-15064	18	3	probiotics	probiotic	NOUN
cet-15064	18	4	can	can	AUX
cet-15064	18	5	contribute	contribute	VERB
cet-15064	18	6	to	to	ADP
cet-15064	18	7	improved	improve	VERB
cet-15064	18	8	intestinal	intestinal	ADJ
cet-15064	18	9	health	health	NOUN
cet-15064	18	10	and	and	CCONJ
cet-15064	18	11	enhanced	enhance	VERB
cet-15064	18	12	immune	immune	ADJ
cet-15064	18	13	functions	function	NOUN
cet-15064	18	14	while	while	SCONJ
cet-15064	18	15	also	also	ADV
cet-15064	18	16	improving	improve	VERB
cet-15064	18	17	production	production	NOUN
cet-15064	18	18	traits	trait	NOUN
cet-15064	18	19	(	(	PUNCT
cet-15064	18	20	e.g.	e.g.	ADV
cet-15064	18	21	,	,	PUNCT
cet-15064	18	22	feed	feed	NOUN
cet-15064	18	23	conversion	conversion	NOUN
cet-15064	18	24	efficiency	efficiency	NOUN
cet-15064	18	25	,	,	PUNCT
cet-15064	18	26	and	and	CCONJ
cet-15064	18	27	growth	growth	NOUN
cet-15064	18	28	rate	rate	NOUN
cet-15064	18	29	)	)	PUNCT
cet-15064	18	30	.	.	PUNCT
cet-15064	19	1	the	the	DET
cet-15064	19	2	most	most	ADV
cet-15064	19	3	widely	widely	ADV
cet-15064	19	4	applied	apply	VERB
cet-15064	19	5	probiotics	probiotic	NOUN
cet-15064	19	6	in	in	ADP
cet-15064	19	7	animal	animal	NOUN
cet-15064	19	8	nutrition	nutrition	NOUN
cet-15064	19	9	primarily	primarily	ADV
cet-15064	19	10	include	include	VERB
cet-15064	19	11	species	specie	NOUN
cet-15064	19	12	from	from	ADP
cet-15064	19	13	the	the	DET
cet-15064	19	14	genera	genera	NOUN
cet-15064	19	15	lactobacillus	lactobacillus	NOUN
cet-15064	19	16	,	,	PUNCT
cet-15064	19	17	bifidobacterium	bifidobacterium	NOUN
cet-15064	19	18	,	,	PUNCT
cet-15064	19	19	bacillus	bacillus	NOUN
cet-15064	19	20	,	,	PUNCT
cet-15064	19	21	and	and	CCONJ
cet-15064	19	22	enterococcus	enterococcus	NOUN
cet-15064	19	23	.	.	PUNCT
cet-15064	20	1	among	among	ADP
cet-15064	20	2	yeasts	yeast	NOUN
cet-15064	20	3	,	,	PUNCT
cet-15064	20	4	s.	s.	PROPN
cet-15064	20	5	cerevisiae	cerevisiae	PROPN
cet-15064	20	6	is	be	AUX
cet-15064	20	7	the	the	DET
cet-15064	20	8	most	most	ADV
cet-15064	20	9	widely	widely	ADV
cet-15064	20	10	used	use	VERB
cet-15064	20	11	feed	feed	NOUN
cet-15064	20	12	supplement	supplement	NOUN
cet-15064	20	13	in	in	ADP
cet-15064	20	14	farm	farm	NOUN
cet-15064	20	15	animal	animal	NOUN
cet-15064	20	16	nutrition	nutrition	NOUN
cet-15064	20	17	.	.	PUNCT
cet-15064	21	1	it	it	PRON
cet-15064	21	2	is	be	AUX
cet-15064	21	3	rich	rich	ADJ
cet-15064	21	4	in	in	ADP
cet-15064	21	5	digestible	digestible	ADJ
cet-15064	21	6	proteins	protein	NOUN
cet-15064	21	7	,	,	PUNCT
cet-15064	21	8	vitamins	vitamin	NOUN
cet-15064	21	9	(	(	PUNCT
cet-15064	21	10	b6	b6	NOUN
cet-15064	21	11	,	,	PUNCT
cet-15064	21	12	thiamine	thiamine	NOUN
cet-15064	21	13	,	,	PUNCT
cet-15064	21	14	biotin	biotin	NOUN
cet-15064	21	15	,	,	PUNCT
cet-15064	21	16	riboflavin	riboflavin	NOUN
cet-15064	21	17	,	,	PUNCT
cet-15064	21	18	nicotinic	nicotinic	ADJ
cet-15064	21	19	acid	acid	NOUN
cet-15064	21	20	,	,	PUNCT
cet-15064	21	21	pantothenic	pantothenic	ADJ
cet-15064	21	22	acid	acid	NOUN
cet-15064	21	23	)	)	PUNCT
cet-15064	21	24	,	,	PUNCT
cet-15064	21	25	magnesium	magnesium	NOUN
cet-15064	21	26	,	,	PUNCT
cet-15064	21	27	and	and	CCONJ
cet-15064	21	28	zinc	zinc	NOUN
cet-15064	21	29	,	,	PUNCT
cet-15064	21	30	although	although	SCONJ
cet-15064	21	31	it	it	PRON
cet-15064	21	32	has	have	VERB
cet-15064	21	33	a	a	DET
cet-15064	21	34	low	low	ADJ
cet-15064	21	35	calcium	calcium	NOUN
cet-15064	21	36	content	content	NOUN
cet-15064	21	37	.	.	PUNCT
cet-15064	22	1	the	the	DET
cet-15064	22	2	cell	cell	NOUN
cet-15064	22	3	wall	wall	NOUN
cet-15064	22	4	of	of	ADP
cet-15064	22	5	s.	s.	PROPN
cet-15064	22	6	cerevisiae	cerevisiae	PROPN
cet-15064	22	7	essentially	essentially	ADV
cet-15064	22	8	consists	consist	VERB
cet-15064	22	9	of	of	ADP
cet-15064	22	10	the	the	DET
cet-15064	22	11	polysaccharides	polysaccharide	NOUN
cet-15064	22	12	α	α	NOUN
cet-15064	22	13	-	-	ADJ
cet-15064	22	14	d	d	NOUN
cet-15064	22	15	-	-	PUNCT
cet-15064	22	16	mannan	mannan	NOUN
cet-15064	22	17	,	,	PUNCT
cet-15064	22	18	chitin	chitin	NOUN
cet-15064	22	19	,	,	PUNCT
cet-15064	22	20	and	and	CCONJ
cet-15064	22	21	β	β	X
cet-15064	22	22	-	-	ADJ
cet-15064	22	23	d	d	NOUN
cet-15064	22	24	-	-	PUNCT
cet-15064	22	25	glucan	glucan	NOUN
cet-15064	22	26	.	.	PUNCT
cet-15064	23	1	notably	notably	ADV
cet-15064	23	2	,	,	PUNCT
cet-15064	23	3	s.	s.	PROPN
cet-15064	23	4	cerevisiae	cerevisiae	PROPN
cet-15064	23	5	is	be	AUX
cet-15064	23	6	not	not	PART
cet-15064	23	7	an	an	DET
cet-15064	23	8	abundant	abundant	ADJ
cet-15064	23	9	natural	natural	ADJ
cet-15064	23	10	component	component	NOUN
cet-15064	23	11	of	of	ADP
cet-15064	23	12	the	the	DET
cet-15064	23	13	gut	gut	NOUN
cet-15064	23	14	microbiota	microbiota	NOUN
cet-15064	23	15	in	in	ADP
cet-15064	23	16	monogastric	monogastric	ADJ
cet-15064	23	17	animals	animal	NOUN
cet-15064	23	18	;	;	PUNCT
cet-15064	23	19	however	however	ADV
cet-15064	23	20	,	,	PUNCT
cet-15064	23	21	it	it	PRON
cet-15064	23	22	can	can	AUX
cet-15064	23	23	function	function	VERB
cet-15064	23	24	as	as	ADP
cet-15064	23	25	a	a	DET
cet-15064	23	26	bioregulator	bioregulator	NOUN
cet-15064	23	27	in	in	ADP
cet-15064	23	28	various	various	ADJ
cet-15064	23	29	processes	process	NOUN
cet-15064	23	30	,	,	PUNCT
cet-15064	23	31	such	such	ADJ
cet-15064	23	32	as	as	ADP
cet-15064	23	33	immunomodulation	immunomodulation	NOUN
cet-15064	23	34	through	through	ADP
cet-15064	23	35	mannoproteins	mannoprotein	NOUN
cet-15064	23	36	and	and	CCONJ
cet-15064	23	37	β	β	NOUN
cet-15064	23	38	-	-	NOUN
cet-15064	23	39	dmannan	dmannan	NOUN
cet-15064	23	40	(	(	PUNCT
cet-15064	23	41	kiarie	kiarie	NOUN
cet-15064	23	42	et	et	PROPN
cet-15064	23	43	al	al	PROPN
cet-15064	23	44	.	.	PROPN
cet-15064	23	45	,	,	PUNCT
cet-15064	23	46	2013	2013	NUM
cet-15064	23	47	)	)	PUNCT
cet-15064	23	48	.	.	PUNCT
cet-15064	24	1	it	it	PRON
cet-15064	24	2	stimulates	stimulate	VERB
cet-15064	24	3	the	the	DET
cet-15064	24	4	iga	iga	PROPN
cet-15064	24	5	response	response	NOUN
cet-15064	24	6	against	against	ADP
cet-15064	24	7	pathogenic	pathogenic	ADJ
cet-15064	24	8	microorganisms	microorganism	NOUN
cet-15064	24	9	and	and	CCONJ
cet-15064	24	10	inhibits	inhibit	VERB
cet-15064	24	11	pathogen	pathogen	NOUN
cet-15064	24	12	adhesion	adhesion	NOUN
cet-15064	24	13	to	to	ADP
cet-15064	24	14	the	the	DET
cet-15064	24	15	mucosa	mucosa	NOUN
cet-15064	24	16	via	via	ADP
cet-15064	24	17	the	the	DET
cet-15064	24	18	mannan	mannan	NOUN
cet-15064	24	19	content	content	NOUN
cet-15064	24	20	of	of	ADP
cet-15064	24	21	its	its	PRON
cet-15064	24	22	outer	outer	ADJ
cet-15064	24	23	cell	cell	NOUN
cet-15064	24	24	wall	wall	NOUN
cet-15064	24	25	.	.	PUNCT
cet-15064	25	1	additionally	additionally	ADV
cet-15064	25	2	,	,	PUNCT
cet-15064	25	3	it	it	PRON
cet-15064	25	4	reduces	reduce	VERB
cet-15064	25	5	the	the	DET
cet-15064	25	6	harmful	harmful	ADJ
cet-15064	25	7	effects	effect	NOUN
cet-15064	25	8	of	of	ADP
cet-15064	25	9	toxins	toxin	NOUN
cet-15064	25	10	and	and	CCONJ
cet-15064	25	11	lowers	lower	VERB
cet-15064	25	12	intestinal	intestinal	ADJ
cet-15064	25	13	ph	ph	NOUN
cet-15064	25	14	by	by	ADP
cet-15064	25	15	secreting	secrete	VERB
cet-15064	25	16	organic	organic	ADJ
cet-15064	25	17	acids	acid	NOUN
cet-15064	25	18	(	(	PUNCT
cet-15064	25	19	lactic	lactic	ADJ
cet-15064	25	20	and	and	CCONJ
cet-15064	25	21	acetic	acetic	ADJ
cet-15064	25	22	acid	acid	NOUN
cet-15064	25	23	)	)	PUNCT
cet-15064	25	24	,	,	PUNCT
cet-15064	25	25	creating	create	VERB
cet-15064	25	26	a	a	DET
cet-15064	25	27	more	more	ADV
cet-15064	25	28	favorable	favorable	ADJ
cet-15064	25	29	environment	environment	NOUN
cet-15064	25	30	for	for	ADP
cet-15064	25	31	the	the	DET
cet-15064	25	32	native	native	ADJ
cet-15064	25	33	gut	gut	NOUN
cet-15064	25	34	microbiota	microbiota	NOUN
cet-15064	25	35	and	and	CCONJ
cet-15064	25	36	decreasing	decrease	VERB
cet-15064	25	37	the	the	DET
cet-15064	25	38	likelihood	likelihood	NOUN
cet-15064	25	39	of	of	ADP
cet-15064	25	40	pathogenic	pathogenic	ADJ
cet-15064	25	41	949	949	NUM
cet-15064	25	42	colonization	colonization	NOUN
cet-15064	25	43	(	(	PUNCT
cet-15064	25	44	chandrasekaran	chandrasekaran	VERB
cet-15064	25	45	et	et	PROPN
cet-15064	25	46	al	al	PROPN
cet-15064	25	47	.	.	PROPN
cet-15064	25	48	,	,	PUNCT
cet-15064	25	49	2024	2024	NUM
cet-15064	25	50	)	)	PUNCT
cet-15064	25	51	.	.	PUNCT
cet-15064	26	1	removing	remove	VERB
cet-15064	26	2	oxygen	oxygen	NOUN
cet-15064	26	3	also	also	ADV
cet-15064	26	4	promotes	promote	VERB
cet-15064	26	5	the	the	DET
cet-15064	26	6	proliferation	proliferation	NOUN
cet-15064	26	7	of	of	ADP
cet-15064	26	8	viable	viable	ADJ
cet-15064	26	9	anaerobic	anaerobic	NOUN
cet-15064	26	10	bacteria	bacteria	NOUN
cet-15064	26	11	,	,	PUNCT
cet-15064	26	12	influencing	influence	VERB
cet-15064	26	13	the	the	DET
cet-15064	26	14	composition	composition	NOUN
cet-15064	26	15	of	of	ADP
cet-15064	26	16	the	the	DET
cet-15064	26	17	gut	gut	NOUN
cet-15064	26	18	microbiome	microbiome	NOUN
cet-15064	26	19	.	.	PUNCT
cet-15064	27	1	supplementing	supplement	VERB
cet-15064	27	2	pig	pig	NOUN
cet-15064	27	3	diets	diet	NOUN
cet-15064	27	4	with	with	ADP
cet-15064	27	5	live	live	ADJ
cet-15064	27	6	yeast	yeast	NOUN
cet-15064	27	7	may	may	AUX
cet-15064	27	8	improve	improve	VERB
cet-15064	27	9	feed	feed	NOUN
cet-15064	27	10	efficiency	efficiency	NOUN
cet-15064	27	11	,	,	PUNCT
cet-15064	27	12	digestibility	digestibility	NOUN
cet-15064	27	13	,	,	PUNCT
cet-15064	27	14	and	and	CCONJ
cet-15064	27	15	animal	animal	NOUN
cet-15064	27	16	performance	performance	NOUN
cet-15064	27	17	and	and	CCONJ
cet-15064	27	18	mitigate	mitigate	VERB
cet-15064	27	19	the	the	DET
cet-15064	27	20	impact	impact	NOUN
cet-15064	27	21	of	of	ADP
cet-15064	27	22	negative	negative	ADJ
cet-15064	27	23	environmental	environmental	ADJ
cet-15064	27	24	factors	factor	NOUN
cet-15064	27	25	on	on	ADP
cet-15064	27	26	animal	animal	NOUN
cet-15064	27	27	production	production	NOUN
cet-15064	27	28	.	.	PUNCT
cet-15064	28	1	derived	derive	VERB
cet-15064	28	2	primarily	primarily	ADV
cet-15064	28	3	from	from	ADP
cet-15064	28	4	the	the	DET
cet-15064	28	5	yeast	yeast	NOUN
cet-15064	28	6	s.	s.	PROPN
cet-15064	28	7	cerevisiae	cerevisiae	PROPN
cet-15064	28	8	,	,	PUNCT
cet-15064	28	9	mos	mos	PROPN
cet-15064	28	10	are	be	AUX
cet-15064	28	11	recognized	recognize	VERB
cet-15064	28	12	for	for	ADP
cet-15064	28	13	their	their	PRON
cet-15064	28	14	prebiotic	prebiotic	ADJ
cet-15064	28	15	properties	property	NOUN
cet-15064	28	16	and	and	CCONJ
cet-15064	28	17	contribute	contribute	VERB
cet-15064	28	18	to	to	ADP
cet-15064	28	19	modulating	modulate	VERB
cet-15064	28	20	the	the	DET
cet-15064	28	21	gut	gut	NOUN
cet-15064	28	22	microbiota	microbiota	NOUN
cet-15064	28	23	.	.	PUNCT
cet-15064	29	1	by	by	ADP
cet-15064	29	2	promoting	promote	VERB
cet-15064	29	3	the	the	DET
cet-15064	29	4	growth	growth	NOUN
cet-15064	29	5	of	of	ADP
cet-15064	29	6	beneficial	beneficial	ADJ
cet-15064	29	7	bacteria	bacteria	NOUN
cet-15064	29	8	such	such	ADJ
cet-15064	29	9	as	as	ADP
cet-15064	29	10	lactobacillus	lactobacillus	NOUN
cet-15064	29	11	and	and	CCONJ
cet-15064	29	12	bifidobacterium	bifidobacterium	NOUN
cet-15064	29	13	species	specie	NOUN
cet-15064	29	14	(	(	PUNCT
cet-15064	29	15	sohail	sohail	PROPN
cet-15064	29	16	et	et	PROPN
cet-15064	29	17	al	al	PROPN
cet-15064	29	18	.	.	PROPN
cet-15064	29	19	2013	2013	NUM
cet-15064	29	20	)	)	PUNCT
cet-15064	29	21	,	,	PUNCT
cet-15064	29	22	mos	mos	PROPN
cet-15064	29	23	improve	improve	VERB
cet-15064	29	24	gut	gut	NOUN
cet-15064	29	25	microbial	microbial	ADJ
cet-15064	29	26	balance	balance	NOUN
cet-15064	29	27	,	,	PUNCT
cet-15064	29	28	which	which	PRON
cet-15064	29	29	is	be	AUX
cet-15064	29	30	crucial	crucial	ADJ
cet-15064	29	31	for	for	ADP
cet-15064	29	32	nutrient	nutrient	NOUN
cet-15064	29	33	absorption	absorption	NOUN
cet-15064	29	34	and	and	CCONJ
cet-15064	29	35	immune	immune	ADJ
cet-15064	29	36	function	function	NOUN
cet-15064	29	37	in	in	ADP
cet-15064	29	38	pigs	pig	NOUN
cet-15064	29	39	.	.	PUNCT
cet-15064	30	1	mos	mos	PROPN
cet-15064	30	2	supplementation	supplementation	NOUN
cet-15064	30	3	can	can	AUX
cet-15064	30	4	enhance	enhance	VERB
cet-15064	30	5	intestinal	intestinal	ADJ
cet-15064	30	6	morphology	morphology	NOUN
cet-15064	30	7	,	,	PUNCT
cet-15064	30	8	including	include	VERB
cet-15064	30	9	increased	increase	VERB
cet-15064	30	10	villus	villus	ADJ
cet-15064	30	11	height	height	NOUN
cet-15064	30	12	,	,	PUNCT
cet-15064	30	13	and	and	CCONJ
cet-15064	30	14	facilitate	facilitate	VERB
cet-15064	30	15	nutrient	nutrient	NOUN
cet-15064	30	16	absorption	absorption	NOUN
cet-15064	30	17	and	and	CCONJ
cet-15064	30	18	growth	growth	NOUN
cet-15064	30	19	performance	performance	NOUN
cet-15064	30	20	.	.	PUNCT
cet-15064	31	1	mos	mos	PROPN
cet-15064	31	2	have	have	AUX
cet-15064	31	3	been	be	AUX
cet-15064	31	4	shown	show	VERB
cet-15064	31	5	to	to	PART
cet-15064	31	6	bind	bind	VERB
cet-15064	31	7	pathogenic	pathogenic	ADJ
cet-15064	31	8	bacteria	bacteria	NOUN
cet-15064	31	9	,	,	PUNCT
cet-15064	31	10	such	such	ADJ
cet-15064	31	11	as	as	ADP
cet-15064	31	12	escherichia	escherichia	NOUN
cet-15064	31	13	coli	coli	NOUN
cet-15064	31	14	and	and	CCONJ
cet-15064	31	15	salmonella	salmonella	NOUN
cet-15064	31	16	typhimurium	typhimurium	NOUN
cet-15064	31	17	,	,	PUNCT
cet-15064	31	18	and	and	CCONJ
cet-15064	31	19	prevent	prevent	VERB
cet-15064	31	20	their	their	PRON
cet-15064	31	21	adhesion	adhesion	NOUN
cet-15064	31	22	to	to	ADP
cet-15064	31	23	the	the	DET
cet-15064	31	24	gut	gut	NOUN
cet-15064	31	25	epithelium	epithelium	NOUN
cet-15064	31	26	reducing	reduce	VERB
cet-15064	31	27	the	the	DET
cet-15064	31	28	incidence	incidence	NOUN
cet-15064	31	29	of	of	ADP
cet-15064	31	30	intestinal	intestinal	ADJ
cet-15064	31	31	infections	infection	NOUN
cet-15064	31	32	(	(	PUNCT
cet-15064	31	33	halas	halas	PROPN
cet-15064	31	34	and	and	CCONJ
cet-15064	31	35	nochta	nochta	NOUN
cet-15064	31	36	,	,	PUNCT
cet-15064	31	37	2012	2012	NUM
cet-15064	31	38	)	)	PUNCT
cet-15064	31	39	.	.	PUNCT
cet-15064	32	1	mos	mos	PROPN
cet-15064	32	2	supplementation	supplementation	NOUN
cet-15064	32	3	has	have	AUX
cet-15064	32	4	been	be	AUX
cet-15064	32	5	associated	associate	VERB
cet-15064	32	6	with	with	ADP
cet-15064	32	7	increased	increase	VERB
cet-15064	32	8	levels	level	NOUN
cet-15064	32	9	of	of	ADP
cet-15064	32	10	igg	igg	PROPN
cet-15064	32	11	immunoglobulins	immunoglobulin	NOUN
cet-15064	32	12	that	that	PRON
cet-15064	32	13	play	play	VERB
cet-15064	32	14	a	a	DET
cet-15064	32	15	vital	vital	ADJ
cet-15064	32	16	role	role	NOUN
cet-15064	32	17	in	in	ADP
cet-15064	32	18	immune	immune	ADJ
cet-15064	32	19	defense	defense	NOUN
cet-15064	32	20	in	in	ADP
cet-15064	32	21	response	response	NOUN
cet-15064	32	22	to	to	ADP
cet-15064	32	23	pathogenic	pathogenic	ADJ
cet-15064	32	24	challenges	challenge	NOUN
cet-15064	32	25	(	(	PUNCT
cet-15064	32	26	li	li	PROPN
cet-15064	32	27	et	et	PROPN
cet-15064	32	28	al	al	PROPN
cet-15064	32	29	.	.	PROPN
cet-15064	32	30	,	,	PUNCT
cet-15064	32	31	2021	2021	NUM
cet-15064	32	32	)	)	PUNCT
cet-15064	32	33	.	.	PUNCT
cet-15064	33	1	in	in	ADP
cet-15064	33	2	the	the	DET
cet-15064	33	3	present	present	ADJ
cet-15064	33	4	study	study	NOUN
cet-15064	33	5	,	,	PUNCT
cet-15064	33	6	the	the	DET
cet-15064	33	7	effects	effect	NOUN
cet-15064	33	8	of	of	ADP
cet-15064	33	9	preand	preand	NOUN
cet-15064	33	10	probiotic	probiotic	ADJ
cet-15064	33	11	feed	feed	NOUN
cet-15064	33	12	supplements	supplement	NOUN
cet-15064	33	13	were	be	AUX
cet-15064	33	14	analyzed	analyze	VERB
cet-15064	33	15	on	on	ADP
cet-15064	33	16	several	several	ADJ
cet-15064	33	17	production	production	NOUN
cet-15064	33	18	traits	trait	NOUN
cet-15064	33	19	of	of	ADP
cet-15064	33	20	lactating	lactate	VERB
cet-15064	33	21	sows	sow	NOUN
cet-15064	33	22	(	(	PUNCT
cet-15064	33	23	daily	daily	ADJ
cet-15064	33	24	feed	feed	NOUN
cet-15064	33	25	intake	intake	NOUN
cet-15064	33	26	,	,	PUNCT
cet-15064	33	27	litter	litter	NOUN
cet-15064	33	28	size	size	NOUN
cet-15064	33	29	,	,	PUNCT
cet-15064	33	30	piglet	piglet	NOUN
cet-15064	33	31	weight	weight	NOUN
cet-15064	33	32	,	,	PUNCT
cet-15064	33	33	sow	sow	VERB
cet-15064	33	34	condition	condition	NOUN
cet-15064	33	35	)	)	PUNCT
cet-15064	33	36	and	and	CCONJ
cet-15064	33	37	on	on	ADP
cet-15064	33	38	the	the	DET
cet-15064	33	39	quantity	quantity	NOUN
cet-15064	33	40	of	of	ADP
cet-15064	33	41	selected	select	VERB
cet-15064	33	42	bacterial	bacterial	ADJ
cet-15064	33	43	communities	community	NOUN
cet-15064	33	44	(	(	PUNCT
cet-15064	33	45	total	total	ADJ
cet-15064	33	46	bacteria	bacteria	NOUN
cet-15064	33	47	,	,	PUNCT
cet-15064	33	48	prevotella	prevotella	NOUN
cet-15064	33	49	genus	genus	NOUN
cet-15064	33	50	,	,	PUNCT
cet-15064	33	51	lactobacillus	lactobacillus	NOUN
cet-15064	33	52	spp	spp	NOUN
cet-15064	33	53	.	.	PROPN
cet-15064	33	54	,	,	PUNCT
cet-15064	33	55	bifidobacterium	bifidobacterium	NOUN
cet-15064	33	56	spp	spp	NOUN
cet-15064	33	57	.	.	PUNCT
cet-15064	33	58	)	)	PUNCT
cet-15064	34	1	in	in	ADP
cet-15064	34	2	fecal	fecal	ADJ
cet-15064	34	3	samples	sample	NOUN
cet-15064	34	4	of	of	ADP
cet-15064	34	5	control	control	NOUN
cet-15064	34	6	and	and	CCONJ
cet-15064	34	7	experimental	experimental	ADJ
cet-15064	34	8	sows	sow	NOUN
cet-15064	34	9	.	.	PUNCT
cet-15064	35	1	the	the	DET
cet-15064	35	2	applied	apply	VERB
cet-15064	35	3	feed	feed	NOUN
cet-15064	35	4	additives	additive	NOUN
cet-15064	35	5	included	include	VERB
cet-15064	35	6	actisaf	actisaf	PROPN
cet-15064	35	7	hr+	hr+	PROPN
cet-15064	35	8	(	(	PUNCT
cet-15064	35	9	phileo	phileo	NOUN
cet-15064	35	10	by	by	ADP
cet-15064	35	11	lesaffre	lesaffre	PROPN
cet-15064	35	12	,	,	PUNCT
cet-15064	35	13	france	france	PROPN
cet-15064	35	14	)	)	PUNCT
cet-15064	35	15	yeast	yeast	NOUN
cet-15064	35	16	probiotics	probiotic	NOUN
cet-15064	35	17	containing	contain	VERB
cet-15064	35	18	a	a	DET
cet-15064	35	19	proprietary	proprietary	ADJ
cet-15064	35	20	strain	strain	NOUN
cet-15064	35	21	of	of	ADP
cet-15064	35	22	saccharomyces	saccharomyce	NOUN
cet-15064	35	23	cerevisiae	cerevisiae	NOUN
cet-15064	35	24	and	and	CCONJ
cet-15064	35	25	safmannan	safmannan	PROPN
cet-15064	35	26	(	(	PUNCT
cet-15064	35	27	phileo	phileo	NOUN
cet-15064	35	28	by	by	ADP
cet-15064	35	29	lesaffre	lesaffre	PROPN
cet-15064	35	30	,	,	PUNCT
cet-15064	35	31	france	france	PROPN
cet-15064	35	32	)	)	PUNCT
cet-15064	35	33	prebiotics	prebiotic	NOUN
cet-15064	35	34	made	make	VERB
cet-15064	35	35	of	of	ADP
cet-15064	35	36	s.	s.	PROPN
cet-15064	35	37	cerevisiae	cerevisiae	PROPN
cet-15064	35	38	wall	wall	PROPN
cet-15064	35	39	fractions	fraction	NOUN
cet-15064	35	40	rich	rich	ADJ
cet-15064	35	41	in	in	ADP
cet-15064	35	42	mannanoligosaccharides	mannanoligosaccharide	NOUN
cet-15064	35	43	(	(	PUNCT
cet-15064	35	44	mos	mos	NOUN
cet-15064	35	45	)	)	PUNCT
cet-15064	35	46	and	and	CCONJ
cet-15064	35	47	beta	beta	NOUN
cet-15064	35	48	-	-	PUNCT
cet-15064	35	49	glucans	glucan	NOUN
cet-15064	35	50	.	.	PUNCT
cet-15064	36	1	potential	potential	ADJ
cet-15064	36	2	changes	change	NOUN
cet-15064	36	3	associated	associate	VERB
cet-15064	36	4	with	with	ADP
cet-15064	36	5	the	the	DET
cet-15064	36	6	experimental	experimental	ADJ
cet-15064	36	7	supplementation	supplementation	NOUN
cet-15064	36	8	may	may	AUX
cet-15064	36	9	highlight	highlight	VERB
cet-15064	36	10	the	the	DET
cet-15064	36	11	benefits	benefit	NOUN
cet-15064	36	12	of	of	ADP
cet-15064	36	13	dietary	dietary	ADJ
cet-15064	36	14	treatments	treatment	NOUN
cet-15064	36	15	in	in	ADP
cet-15064	36	16	the	the	DET
cet-15064	36	17	efforts	effort	NOUN
cet-15064	36	18	to	to	PART
cet-15064	36	19	reduce	reduce	VERB
cet-15064	36	20	antibiotic	antibiotic	ADJ
cet-15064	36	21	pressure	pressure	NOUN
cet-15064	36	22	in	in	ADP
cet-15064	36	23	sustainable	sustainable	ADJ
cet-15064	36	24	pig	pig	NOUN
cet-15064	36	25	production	production	NOUN
cet-15064	36	26	.	.	PUNCT
cet-15064	37	1	2	2	X
cet-15064	37	2	.	.	X
cet-15064	37	3	materials	material	NOUN
cet-15064	37	4	and	and	CCONJ
cet-15064	37	5	methods	method	NOUN
cet-15064	37	6	the	the	DET
cet-15064	37	7	experiment	experiment	NOUN
cet-15064	37	8	and	and	CCONJ
cet-15064	37	9	the	the	DET
cet-15064	37	10	sampling	sampling	NOUN
cet-15064	37	11	were	be	AUX
cet-15064	37	12	conducted	conduct	VERB
cet-15064	37	13	in	in	ADP
cet-15064	37	14	commercial	commercial	ADJ
cet-15064	37	15	settings	setting	NOUN
cet-15064	37	16	in	in	ADP
cet-15064	37	17	a	a	DET
cet-15064	37	18	pig	pig	NOUN
cet-15064	37	19	production	production	NOUN
cet-15064	37	20	facility	facility	NOUN
cet-15064	37	21	in	in	ADP
cet-15064	37	22	somogytarnóca	somogytarnóca	PROPN
cet-15064	37	23	,	,	PUNCT
cet-15064	37	24	hungary	hungary	PROPN
cet-15064	37	25	.	.	PUNCT
cet-15064	38	1	2.1	2.1	NUM
cet-15064	38	2	experimental	experimental	ADJ
cet-15064	38	3	animals	animal	NOUN
cet-15064	38	4	in	in	ADP
cet-15064	38	5	this	this	DET
cet-15064	38	6	experiment	experiment	NOUN
cet-15064	38	7	,	,	PUNCT
cet-15064	38	8	first	first	ADJ
cet-15064	38	9	-	-	PUNCT
cet-15064	38	10	parity	parity	NOUN
cet-15064	38	11	sows	sow	NOUN
cet-15064	38	12	produced	produce	VERB
cet-15064	38	13	by	by	ADP
cet-15064	38	14	crossbreeding	crossbreed	VERB
cet-15064	38	15	large	large	ADJ
cet-15064	38	16	white	white	ADJ
cet-15064	38	17	and	and	CCONJ
cet-15064	38	18	landrace	landrace	ADJ
cet-15064	38	19	breeds	breed	NOUN
cet-15064	38	20	were	be	AUX
cet-15064	38	21	involved	involve	VERB
cet-15064	38	22	.	.	PUNCT
cet-15064	39	1	the	the	DET
cet-15064	39	2	studied	studied	ADJ
cet-15064	39	3	population	population	NOUN
cet-15064	39	4	was	be	AUX
cet-15064	39	5	divided	divide	VERB
cet-15064	39	6	into	into	ADP
cet-15064	39	7	a	a	DET
cet-15064	39	8	control	control	NOUN
cet-15064	39	9	group	group	NOUN
cet-15064	39	10	(	(	PUNCT
cet-15064	39	11	n=10	n=10	NOUN
cet-15064	39	12	)	)	PUNCT
cet-15064	39	13	and	and	CCONJ
cet-15064	39	14	an	an	DET
cet-15064	39	15	experimental	experimental	ADJ
cet-15064	39	16	group	group	NOUN
cet-15064	39	17	(	(	PUNCT
cet-15064	39	18	n=10	n=10	NOUN
cet-15064	39	19	)	)	PUNCT
cet-15064	39	20	.	.	PUNCT
cet-15064	40	1	until	until	ADP
cet-15064	40	2	day	day	NOUN
cet-15064	40	3	85	85	NUM
cet-15064	40	4	of	of	ADP
cet-15064	40	5	gestation	gestation	NOUN
cet-15064	40	6	,	,	PUNCT
cet-15064	40	7	all	all	DET
cet-15064	40	8	sows	sow	NOUN
cet-15064	40	9	were	be	AUX
cet-15064	40	10	fed	feed	VERB
cet-15064	40	11	a	a	DET
cet-15064	40	12	gestation	gestation	NOUN
cet-15064	40	13	diet	diet	NOUN
cet-15064	40	14	.	.	PUNCT
cet-15064	41	1	from	from	ADP
cet-15064	41	2	days	day	NOUN
cet-15064	41	3	104	104	NUM
cet-15064	41	4	to	to	PART
cet-15064	41	5	114	114	NUM
cet-15064	41	6	of	of	ADP
cet-15064	41	7	gestation	gestation	NOUN
cet-15064	41	8	,	,	PUNCT
cet-15064	41	9	the	the	DET
cet-15064	41	10	sows	sow	NOUN
cet-15064	41	11	received	receive	VERB
cet-15064	41	12	a	a	DET
cet-15064	41	13	transition	transition	NOUN
cet-15064	41	14	diet	diet	NOUN
cet-15064	41	15	,	,	PUNCT
cet-15064	41	16	and	and	CCONJ
cet-15064	41	17	following	follow	VERB
cet-15064	41	18	farrowing	farrow	VERB
cet-15064	41	19	(	(	PUNCT
cet-15064	41	20	day	day	NOUN
cet-15064	41	21	115	115	NUM
cet-15064	41	22	)	)	PUNCT
cet-15064	41	23	until	until	ADP
cet-15064	41	24	weaning	weaning	NOUN
cet-15064	41	25	(	(	PUNCT
cet-15064	41	26	26	26	NUM
cet-15064	41	27	days	day	NOUN
cet-15064	41	28	post	post	ADJ
cet-15064	41	29	-	-	ADJ
cet-15064	41	30	farrowing	farrowing	ADJ
cet-15064	41	31	)	)	PUNCT
cet-15064	41	32	,	,	PUNCT
cet-15064	41	33	they	they	PRON
cet-15064	41	34	were	be	AUX
cet-15064	41	35	provided	provide	VERB
cet-15064	41	36	with	with	ADP
cet-15064	41	37	a	a	DET
cet-15064	41	38	lactation	lactation	NOUN
cet-15064	41	39	diet	diet	NOUN
cet-15064	41	40	.	.	PUNCT
cet-15064	42	1	for	for	ADP
cet-15064	42	2	the	the	DET
cet-15064	42	3	experimental	experimental	ADJ
cet-15064	42	4	group	group	NOUN
cet-15064	42	5	,	,	PUNCT
cet-15064	42	6	feed	feed	NOUN
cet-15064	42	7	supplementation	supplementation	NOUN
cet-15064	42	8	included	include	VERB
cet-15064	42	9	1.0	1.0	NUM
cet-15064	42	10	kg	kg	PROPN
cet-15064	42	11	/	/	SYM
cet-15064	42	12	t	t	PROPN
cet-15064	42	13	of	of	ADP
cet-15064	42	14	probiotic	probiotic	ADJ
cet-15064	42	15	actisaf	actisaf	NOUN
cet-15064	42	16	hr+	hr+	PROPN
cet-15064	42	17	and	and	CCONJ
cet-15064	42	18	0.5	0.5	NUM
cet-15064	42	19	kg	kg	PROPN
cet-15064	42	20	/	/	SYM
cet-15064	42	21	t	t	PROPN
cet-15064	42	22	of	of	ADP
cet-15064	42	23	prebiotic	prebiotic	ADJ
cet-15064	42	24	safmannan	safmannan	NOUN
cet-15064	42	25	alongside	alongside	ADP
cet-15064	42	26	the	the	DET
cet-15064	42	27	gestation	gestation	NOUN
cet-15064	42	28	diet	diet	NOUN
cet-15064	42	29	,	,	PUNCT
cet-15064	42	30	and	and	CCONJ
cet-15064	42	31	0.7	0.7	NUM
cet-15064	42	32	kg	kg	NOUN
cet-15064	42	33	/	/	SYM
cet-15064	42	34	t	t	PROPN
cet-15064	42	35	of	of	ADP
cet-15064	42	36	actisaf	actisaf	PROPN
cet-15064	42	37	hr+	hr+	PROPN
cet-15064	42	38	and	and	CCONJ
cet-15064	42	39	0.3	0.3	NUM
cet-15064	42	40	kg	kg	PROPN
cet-15064	42	41	/	/	SYM
cet-15064	42	42	t	t	PROPN
cet-15064	42	43	of	of	ADP
cet-15064	42	44	safmannan	safmannan	PROPN
cet-15064	42	45	alongside	alongside	ADP
cet-15064	42	46	the	the	DET
cet-15064	42	47	lactation	lactation	NOUN
cet-15064	42	48	diet	diet	NOUN
cet-15064	42	49	.	.	PUNCT
cet-15064	43	1	the	the	DET
cet-15064	43	2	experimental	experimental	ADJ
cet-15064	43	3	animals	animal	NOUN
cet-15064	43	4	began	begin	VERB
cet-15064	43	5	consuming	consume	VERB
cet-15064	43	6	the	the	DET
cet-15064	43	7	preand	preand	NOUN
cet-15064	43	8	probiotic	probiotic	ADJ
cet-15064	43	9	yeast	yeast	NOUN
cet-15064	43	10	products	product	NOUN
cet-15064	43	11	(	(	PUNCT
cet-15064	43	12	phileo	phileo	NOUN
cet-15064	43	13	by	by	ADP
cet-15064	43	14	lesaffre	lesaffre	PROPN
cet-15064	43	15	,	,	PUNCT
cet-15064	43	16	france	france	PROPN
cet-15064	43	17	)	)	PUNCT
cet-15064	43	18	from	from	ADP
cet-15064	43	19	day	day	NOUN
cet-15064	43	20	85	85	NUM
cet-15064	43	21	of	of	ADP
cet-15064	43	22	gestation	gestation	NOUN
cet-15064	43	23	.	.	PUNCT
cet-15064	44	1	throughout	throughout	ADP
cet-15064	44	2	the	the	DET
cet-15064	44	3	study	study	NOUN
cet-15064	44	4	,	,	PUNCT
cet-15064	44	5	the	the	DET
cet-15064	44	6	following	follow	VERB
cet-15064	44	7	main	main	ADJ
cet-15064	44	8	production	production	NOUN
cet-15064	44	9	data	datum	NOUN
cet-15064	44	10	were	be	AUX
cet-15064	44	11	collected	collect	VERB
cet-15064	44	12	:	:	PUNCT
cet-15064	44	13	sow	sow	VERB
cet-15064	44	14	live	live	ADJ
cet-15064	44	15	body	body	NOUN
cet-15064	44	16	weight	weight	NOUN
cet-15064	44	17	(	(	PUNCT
cet-15064	44	18	kg	kg	NOUN
cet-15064	44	19	)	)	PUNCT
cet-15064	44	20	and	and	CCONJ
cet-15064	44	21	backfat	backfat	NOUN
cet-15064	44	22	thickness	thickness	NOUN
cet-15064	44	23	(	(	PUNCT
cet-15064	44	24	mm	mm	NOUN
cet-15064	44	25	)	)	PUNCT
cet-15064	44	26	measured	measure	VERB
cet-15064	44	27	by	by	ADP
cet-15064	44	28	ultrasound	ultrasound	NOUN
cet-15064	44	29	upon	upon	SCONJ
cet-15064	44	30	transfer	transfer	NOUN
cet-15064	44	31	to	to	ADP
cet-15064	44	32	the	the	DET
cet-15064	44	33	farrowing	farrow	VERB
cet-15064	44	34	house	house	PROPN
cet-15064	44	35	(	(	PUNCT
cet-15064	44	36	day	day	NOUN
cet-15064	44	37	110	110	NUM
cet-15064	44	38	of	of	ADP
cet-15064	44	39	gestation	gestation	NOUN
cet-15064	44	40	)	)	PUNCT
cet-15064	44	41	,	,	PUNCT
cet-15064	45	1	birth	birth	NOUN
cet-15064	45	2	litter	litter	NOUN
cet-15064	45	3	weight	weight	NOUN
cet-15064	45	4	(	(	PUNCT
cet-15064	45	5	kg	kg	NOUN
cet-15064	45	6	)	)	PUNCT
cet-15064	45	7	on	on	ADP
cet-15064	45	8	day	day	NOUN
cet-15064	45	9	115	115	NUM
cet-15064	45	10	,	,	PUNCT
cet-15064	45	11	and	and	CCONJ
cet-15064	45	12	body	body	NOUN
cet-15064	45	13	weight	weight	NOUN
cet-15064	45	14	and	and	CCONJ
cet-15064	45	15	backfat	backfat	NOUN
cet-15064	45	16	thickness	thickness	NOUN
cet-15064	45	17	at	at	ADP
cet-15064	45	18	the	the	DET
cet-15064	45	19	end	end	NOUN
cet-15064	45	20	of	of	ADP
cet-15064	45	21	the	the	DET
cet-15064	45	22	lactation	lactation	NOUN
cet-15064	45	23	period	period	NOUN
cet-15064	45	24	.	.	PUNCT
cet-15064	46	1	differences	difference	NOUN
cet-15064	46	2	in	in	ADP
cet-15064	46	3	body	body	NOUN
cet-15064	46	4	weight	weight	NOUN
cet-15064	46	5	and	and	CCONJ
cet-15064	46	6	backfat	backfat	NOUN
cet-15064	46	7	thickness	thickness	NOUN
cet-15064	46	8	were	be	AUX
cet-15064	46	9	calculated	calculate	VERB
cet-15064	46	10	between	between	ADP
cet-15064	46	11	the	the	DET
cet-15064	46	12	time	time	NOUN
cet-15064	46	13	of	of	ADP
cet-15064	46	14	entry	entry	NOUN
cet-15064	46	15	into	into	ADP
cet-15064	46	16	the	the	DET
cet-15064	46	17	farrowing	farrow	VERB
cet-15064	46	18	house	house	NOUN
cet-15064	46	19	(	(	PUNCT
cet-15064	46	20	day	day	NOUN
cet-15064	46	21	110	110	NUM
cet-15064	46	22	)	)	PUNCT
cet-15064	46	23	and	and	CCONJ
cet-15064	46	24	near	near	ADP
cet-15064	46	25	the	the	DET
cet-15064	46	26	end	end	NOUN
cet-15064	46	27	of	of	ADP
cet-15064	46	28	the	the	DET
cet-15064	46	29	lactation	lactation	NOUN
cet-15064	46	30	period	period	NOUN
cet-15064	46	31	(	(	PUNCT
cet-15064	46	32	21	21	NUM
cet-15064	46	33	days	day	NOUN
cet-15064	46	34	post	post	ADJ
cet-15064	46	35	-	-	ADJ
cet-15064	46	36	farrowing	farrowing	ADJ
cet-15064	46	37	)	)	PUNCT
cet-15064	46	38	.	.	PUNCT
cet-15064	47	1	additionally	additionally	ADV
cet-15064	47	2	,	,	PUNCT
cet-15064	47	3	average	average	ADJ
cet-15064	47	4	daily	daily	ADJ
cet-15064	47	5	feed	feed	NOUN
cet-15064	47	6	intake	intake	NOUN
cet-15064	47	7	(	(	PUNCT
cet-15064	47	8	kg	kg	X
cet-15064	47	9	)	)	PUNCT
cet-15064	47	10	was	be	AUX
cet-15064	47	11	determined	determine	VERB
cet-15064	47	12	from	from	ADP
cet-15064	47	13	the	the	DET
cet-15064	47	14	start	start	NOUN
cet-15064	47	15	of	of	ADP
cet-15064	47	16	the	the	DET
cet-15064	47	17	experimental	experimental	ADJ
cet-15064	47	18	feeding	feeding	NOUN
cet-15064	47	19	until	until	ADP
cet-15064	47	20	the	the	DET
cet-15064	47	21	end	end	NOUN
cet-15064	47	22	of	of	ADP
cet-15064	47	23	the	the	DET
cet-15064	47	24	lactation	lactation	NOUN
cet-15064	47	25	period	period	NOUN
cet-15064	47	26	.	.	PUNCT
cet-15064	48	1	randomly	randomly	ADV
cet-15064	48	2	selected	select	VERB
cet-15064	48	3	26	26	NUM
cet-15064	48	4	-	-	PUNCT
cet-15064	48	5	day	day	NOUN
cet-15064	48	6	-	-	PUNCT
cet-15064	48	7	old	old	ADJ
cet-15064	48	8	piglets	piglet	NOUN
cet-15064	48	9	from	from	ADP
cet-15064	48	10	both	both	CCONJ
cet-15064	48	11	the	the	DET
cet-15064	48	12	control	control	NOUN
cet-15064	48	13	(	(	PUNCT
cet-15064	48	14	n=100	n=100	NUM
cet-15064	48	15	)	)	PUNCT
cet-15064	48	16	and	and	CCONJ
cet-15064	48	17	the	the	DET
cet-15064	48	18	experimental	experimental	ADJ
cet-15064	48	19	(	(	PUNCT
cet-15064	48	20	n=100	n=100	NUM
cet-15064	48	21	)	)	PUNCT
cet-15064	48	22	groups	group	NOUN
cet-15064	48	23	were	be	AUX
cet-15064	48	24	individually	individually	ADV
cet-15064	48	25	weighed	weigh	VERB
cet-15064	48	26	.	.	PUNCT
cet-15064	49	1	2.2	2.2	NUM
cet-15064	49	2	sample	sample	NOUN
cet-15064	49	3	collection	collection	NOUN
cet-15064	49	4	and	and	CCONJ
cet-15064	49	5	laboratory	laboratory	NOUN
cet-15064	49	6	analysis	analysis	NOUN
cet-15064	49	7	for	for	ADP
cet-15064	49	8	the	the	DET
cet-15064	49	9	analysis	analysis	NOUN
cet-15064	49	10	of	of	ADP
cet-15064	49	11	the	the	DET
cet-15064	49	12	bacterial	bacterial	ADJ
cet-15064	49	13	composition	composition	NOUN
cet-15064	49	14	in	in	ADP
cet-15064	49	15	fecal	fecal	ADJ
cet-15064	49	16	samples	sample	NOUN
cet-15064	49	17	,	,	PUNCT
cet-15064	49	18	fresh	fresh	ADJ
cet-15064	49	19	individual	individual	ADJ
cet-15064	49	20	samples	sample	NOUN
cet-15064	49	21	were	be	AUX
cet-15064	49	22	collected	collect	VERB
cet-15064	49	23	from	from	ADP
cet-15064	49	24	lactating	lactate	VERB
cet-15064	49	25	sows	sow	NOUN
cet-15064	49	26	(	(	PUNCT
cet-15064	49	27	n=10	n=10	NOUN
cet-15064	49	28	control	control	NOUN
cet-15064	49	29	,	,	PUNCT
cet-15064	49	30	n=10	n=10	NOUN
cet-15064	49	31	experimental	experimental	ADJ
cet-15064	49	32	)	)	PUNCT
cet-15064	49	33	.	.	PUNCT
cet-15064	50	1	during	during	ADP
cet-15064	50	2	dna	dna	PROPN
cet-15064	50	3	isolation	isolation	NOUN
cet-15064	50	4	,	,	PUNCT
cet-15064	50	5	fecal	fecal	ADJ
cet-15064	50	6	samples	sample	NOUN
cet-15064	50	7	were	be	AUX
cet-15064	50	8	centrifuged	centrifuge	VERB
cet-15064	50	9	in	in	ADP
cet-15064	50	10	phosphate	phosphate	NOUN
cet-15064	50	11	-	-	PUNCT
cet-15064	50	12	buffered	buffer	VERB
cet-15064	50	13	saline	saline	NOUN
cet-15064	50	14	solution	solution	NOUN
cet-15064	50	15	,	,	PUNCT
cet-15064	50	16	and	and	CCONJ
cet-15064	50	17	the	the	DET
cet-15064	50	18	resulting	result	VERB
cet-15064	50	19	pellet	pellet	NOUN
cet-15064	50	20	was	be	AUX
cet-15064	50	21	homogenized	homogenize	VERB
cet-15064	50	22	using	use	VERB
cet-15064	50	23	tissuelyser	tissuelyser	NOUN
cet-15064	50	24	lt	lt	PROPN
cet-15064	50	25	(	(	PUNCT
cet-15064	50	26	qiagen	qiagen	PROPN
cet-15064	50	27	,	,	PUNCT
cet-15064	50	28	germany	germany	PROPN
cet-15064	50	29	)	)	PUNCT
cet-15064	50	30	.	.	PUNCT
cet-15064	51	1	dna	dna	PROPN
cet-15064	51	2	was	be	AUX
cet-15064	51	3	then	then	ADV
cet-15064	51	4	isolated	isolate	VERB
cet-15064	51	5	using	use	VERB
cet-15064	51	6	the	the	DET
cet-15064	51	7	genomic	genomic	ADJ
cet-15064	51	8	dna	dna	NOUN
cet-15064	51	9	purification	purification	NOUN
cet-15064	51	10	kit	kit	NOUN
cet-15064	51	11	(	(	PUNCT
cet-15064	51	12	thermo	thermo	NOUN
cet-15064	51	13	fisher	fisher	PROPN
cet-15064	51	14	scientific	scientific	PROPN
cet-15064	51	15	,	,	PUNCT
cet-15064	51	16	usa	usa	PROPN
cet-15064	51	17	)	)	PUNCT
cet-15064	51	18	.	.	PUNCT
cet-15064	52	1	the	the	DET
cet-15064	52	2	integrity	integrity	NOUN
cet-15064	52	3	of	of	ADP
cet-15064	52	4	the	the	DET
cet-15064	52	5	dna	dna	PROPN
cet-15064	52	6	samples	sample	NOUN
cet-15064	52	7	was	be	AUX
cet-15064	52	8	verified	verify	VERB
cet-15064	52	9	via	via	ADP
cet-15064	52	10	agarose	agarose	NOUN
cet-15064	52	11	gel	gel	NOUN
cet-15064	52	12	electrophoresis	electrophoresis	NOUN
cet-15064	52	13	,	,	PUNCT
cet-15064	52	14	and	and	CCONJ
cet-15064	52	15	their	their	PRON
cet-15064	52	16	concentration	concentration	NOUN
cet-15064	52	17	was	be	AUX
cet-15064	52	18	measured	measure	VERB
cet-15064	52	19	with	with	ADP
cet-15064	52	20	a	a	DET
cet-15064	52	21	nanodrop	nanodrop	NOUN
cet-15064	52	22	2000	2000	NUM
cet-15064	52	23	spectrophotometer	spectrophotometer	NOUN
cet-15064	52	24	(	(	PUNCT
cet-15064	52	25	thermo	thermo	NOUN
cet-15064	52	26	fisher	fisher	PROPN
cet-15064	52	27	scientific	scientific	PROPN
cet-15064	52	28	,	,	PUNCT
cet-15064	52	29	usa	usa	PROPN
cet-15064	52	30	)	)	PUNCT
cet-15064	52	31	.	.	PUNCT
cet-15064	53	1	the	the	DET
cet-15064	53	2	dna	dna	PROPN
cet-15064	53	3	concentration	concentration	NOUN
cet-15064	53	4	was	be	AUX
cet-15064	53	5	standardized	standardize	VERB
cet-15064	53	6	to	to	ADP
cet-15064	53	7	50	50	NUM
cet-15064	53	8	ng/µl	ng/µl	NUM
cet-15064	53	9	.	.	PUNCT
cet-15064	54	1	specific	specific	ADJ
cet-15064	54	2	regions	region	NOUN
cet-15064	54	3	of	of	ADP
cet-15064	54	4	the	the	DET
cet-15064	54	5	bacterial	bacterial	ADJ
cet-15064	54	6	genera	genera	NOUN
cet-15064	54	7	(	(	PUNCT
cet-15064	54	8	16s	16	NOUN
cet-15064	54	9	rrna	rrna	VERB
cet-15064	54	10	coding	code	VERB
cet-15064	54	11	regions	region	NOUN
cet-15064	54	12	)	)	PUNCT
cet-15064	54	13	were	be	AUX
cet-15064	54	14	amplified	amplify	VERB
cet-15064	54	15	using	use	VERB
cet-15064	54	16	polymerase	polymerase	NOUN
cet-15064	54	17	chain	chain	NOUN
cet-15064	54	18	reaction	reaction	NOUN
cet-15064	54	19	(	(	PUNCT
cet-15064	54	20	pcr	pcr	PROPN
cet-15064	54	21	)	)	PUNCT
cet-15064	54	22	with	with	ADP
cet-15064	54	23	a	a	DET
cet-15064	54	24	hybrid	hybrid	ADJ
cet-15064	54	25	px2	px2	NOUN
cet-15064	54	26	thermal	thermal	ADJ
cet-15064	54	27	cycler	cycler	NOUN
cet-15064	54	28	(	(	PUNCT
cet-15064	54	29	thermo	thermo	PROPN
cet-15064	54	30	fisher	fisher	PROPN
cet-15064	54	31	scientific	scientific	PROPN
cet-15064	54	32	,	,	PUNCT
cet-15064	54	33	usa	usa	PROPN
cet-15064	54	34	)	)	PUNCT
cet-15064	54	35	.	.	PUNCT
cet-15064	55	1	the	the	DET
cet-15064	55	2	20	20	NUM
cet-15064	55	3	µl	µl	ADP
cet-15064	55	4	reaction	reaction	NOUN
cet-15064	55	5	mixture	mixture	NOUN
cet-15064	55	6	consisted	consist	VERB
cet-15064	55	7	of	of	ADP
cet-15064	55	8	10	10	NUM
cet-15064	55	9	µl	µl	NOUN
cet-15064	55	10	of	of	ADP
cet-15064	55	11	2xpcr	2xpcr	NUM
cet-15064	55	12	mastermix	mastermix	NOUN
cet-15064	55	13	(	(	PUNCT
cet-15064	55	14	containing	contain	VERB
cet-15064	55	15	1.5	1.5	NUM
cet-15064	55	16	mm	mm	NOUN
cet-15064	55	17	mgcl2	mgcl2	PROPN
cet-15064	55	18	,	,	PUNCT
cet-15064	55	19	0.6	0.6	NUM
cet-15064	55	20	u	u	NOUN
cet-15064	55	21	taq	taq	PROPN
cet-15064	55	22	dna	dna	PROPN
cet-15064	55	23	polymerase	polymerase	NOUN
cet-15064	55	24	,	,	PUNCT
cet-15064	55	25	and	and	CCONJ
cet-15064	55	26	200	200	NUM
cet-15064	55	27	µm	µm	ADP
cet-15064	55	28	dntps	dntps	NOUN
cet-15064	55	29	)	)	PUNCT
cet-15064	55	30	,	,	PUNCT
cet-15064	55	31	1	1	NUM
cet-15064	55	32	µl	µl	ADP
cet-15064	55	33	each	each	PRON
cet-15064	55	34	of	of	ADP
cet-15064	55	35	forward	forward	ADV
cet-15064	55	36	and	and	CCONJ
cet-15064	55	37	reverse	reverse	VERB
cet-15064	55	38	primers	primer	NOUN
cet-15064	55	39	(	(	PUNCT
cet-15064	55	40	0.4	0.4	NUM
cet-15064	55	41	µm	µm	ADP
cet-15064	55	42	each	each	PRON
cet-15064	55	43	)	)	PUNCT
cet-15064	55	44	,	,	PUNCT
cet-15064	55	45	1	1	NUM
cet-15064	55	46	µl	µl	ADP
cet-15064	55	47	(	(	PUNCT
cet-15064	55	48	50	50	NUM
cet-15064	55	49	ng	ng	NOUN
cet-15064	55	50	)	)	PUNCT
cet-15064	55	51	dna	dna	NOUN
cet-15064	55	52	template	template	NOUN
cet-15064	55	53	,	,	PUNCT
cet-15064	55	54	and	and	CCONJ
cet-15064	55	55	7	7	NUM
cet-15064	55	56	µl	µl	ADP
cet-15064	55	57	nuclease	nuclease	NOUN
cet-15064	55	58	-	-	PUNCT
cet-15064	55	59	free	free	ADJ
cet-15064	55	60	water	water	NOUN
cet-15064	55	61	.	.	PUNCT
cet-15064	56	1	pcr	pcr	ADJ
cet-15064	56	2	conditions	condition	NOUN
cet-15064	56	3	included	include	VERB
cet-15064	56	4	an	an	DET
cet-15064	56	5	initial	initial	ADJ
cet-15064	56	6	denaturation	denaturation	NOUN
cet-15064	56	7	at	at	ADP
cet-15064	56	8	95	95	NUM
cet-15064	56	9	°	°	ADP
cet-15064	56	10	c	c	NOUN
cet-15064	56	11	for	for	ADP
cet-15064	56	12	3	3	NUM
cet-15064	56	13	min	min	NOUN
cet-15064	56	14	,	,	PUNCT
cet-15064	56	15	followed	follow	VERB
cet-15064	56	16	by	by	ADP
cet-15064	56	17	35	35	NUM
cet-15064	56	18	cycles	cycle	NOUN
cet-15064	56	19	950	950	NUM
cet-15064	56	20	of	of	ADP
cet-15064	56	21	denaturation	denaturation	NOUN
cet-15064	56	22	at	at	ADP
cet-15064	56	23	95	95	NUM
cet-15064	56	24	°	°	ADP
cet-15064	56	25	c	c	NOUN
cet-15064	56	26	for	for	ADP
cet-15064	56	27	1	1	NUM
cet-15064	56	28	min	min	NOUN
cet-15064	56	29	,	,	PUNCT
cet-15064	56	30	annealing	anneal	VERB
cet-15064	56	31	at	at	ADP
cet-15064	56	32	52	52	NUM
cet-15064	56	33	-	-	SYM
cet-15064	56	34	63	63	NUM
cet-15064	56	35	°	°	ADP
cet-15064	56	36	c	c	NOUN
cet-15064	56	37	for	for	ADP
cet-15064	56	38	1	1	NUM
cet-15064	56	39	min	min	NOUN
cet-15064	56	40	,	,	PUNCT
cet-15064	56	41	elongation	elongation	NOUN
cet-15064	56	42	at	at	ADP
cet-15064	56	43	72	72	NUM
cet-15064	56	44	°	°	ADP
cet-15064	56	45	c	c	NOUN
cet-15064	56	46	for	for	ADP
cet-15064	56	47	1	1	NUM
cet-15064	56	48	min	min	NOUN
cet-15064	56	49	,	,	PUNCT
cet-15064	56	50	and	and	CCONJ
cet-15064	56	51	a	a	DET
cet-15064	56	52	final	final	ADJ
cet-15064	56	53	elongation	elongation	NOUN
cet-15064	56	54	at	at	ADP
cet-15064	56	55	72	72	NUM
cet-15064	56	56	°	°	ADP
cet-15064	56	57	c	c	NOUN
cet-15064	56	58	for	for	ADP
cet-15064	56	59	5	5	NUM
cet-15064	56	60	min	min	NOUN
cet-15064	56	61	,	,	PUNCT
cet-15064	56	62	with	with	ADP
cet-15064	56	63	optional	optional	ADJ
cet-15064	56	64	storage	storage	NOUN
cet-15064	56	65	at	at	ADP
cet-15064	56	66	4	4	NUM
cet-15064	56	67	°	°	NOUN
cet-15064	56	68	c	c	NOUN
cet-15064	56	69	.	.	PUNCT
cet-15064	57	1	the	the	DET
cet-15064	57	2	presence	presence	NOUN
cet-15064	57	3	of	of	ADP
cet-15064	57	4	specific	specific	ADJ
cet-15064	57	5	pcr	pcr	ADJ
cet-15064	57	6	products	product	NOUN
cet-15064	57	7	was	be	AUX
cet-15064	57	8	verified	verify	VERB
cet-15064	57	9	by	by	ADP
cet-15064	57	10	agarose	agarose	NOUN
cet-15064	57	11	gel	gel	NOUN
cet-15064	57	12	electrophoresis	electrophoresis	NOUN
cet-15064	57	13	,	,	PUNCT
cet-15064	57	14	followed	follow	VERB
cet-15064	57	15	by	by	ADP
cet-15064	57	16	purification	purification	NOUN
cet-15064	57	17	using	use	VERB
cet-15064	57	18	the	the	DET
cet-15064	57	19	promega	promega	PROPN
cet-15064	57	20	wizard	wizard	PROPN
cet-15064	57	21	sv	sv	PROPN
cet-15064	57	22	gel	gel	PROPN
cet-15064	57	23	and	and	CCONJ
cet-15064	57	24	pcr	pcr	PROPN
cet-15064	57	25	clean	clean	ADJ
cet-15064	57	26	-	-	PUNCT
cet-15064	57	27	up	up	ADP
cet-15064	57	28	system	system	NOUN
cet-15064	57	29	kit	kit	NOUN
cet-15064	57	30	.	.	PUNCT
cet-15064	58	1	dilution	dilution	NOUN
cet-15064	58	2	series	series	NOUN
cet-15064	58	3	(	(	PUNCT
cet-15064	58	4	8	8	NUM
cet-15064	58	5	standards	standard	NOUN
cet-15064	58	6	)	)	PUNCT
cet-15064	58	7	were	be	AUX
cet-15064	58	8	prepared	prepare	VERB
cet-15064	58	9	from	from	ADP
cet-15064	58	10	the	the	DET
cet-15064	58	11	purified	purified	ADJ
cet-15064	58	12	pcr	pcr	ADJ
cet-15064	58	13	products	product	NOUN
cet-15064	58	14	to	to	PART
cet-15064	58	15	determine	determine	VERB
cet-15064	58	16	the	the	DET
cet-15064	58	17	efficiency	efficiency	NOUN
cet-15064	58	18	of	of	ADP
cet-15064	58	19	the	the	DET
cet-15064	58	20	qpcr	qpcr	ADJ
cet-15064	58	21	reactions	reaction	NOUN
cet-15064	58	22	.	.	PUNCT
cet-15064	59	1	quantification	quantification	NOUN
cet-15064	59	2	of	of	ADP
cet-15064	59	3	the	the	DET
cet-15064	59	4	various	various	ADJ
cet-15064	59	5	bacterial	bacterial	ADJ
cet-15064	59	6	genera	genera	NOUN
cet-15064	59	7	or	or	CCONJ
cet-15064	59	8	families	family	NOUN
cet-15064	59	9	was	be	AUX
cet-15064	59	10	conducted	conduct	VERB
cet-15064	59	11	using	use	VERB
cet-15064	59	12	qpcr	qpcr	ADV
cet-15064	59	13	(	(	PUNCT
cet-15064	59	14	cfx96	cfx96	ADJ
cet-15064	59	15	real	real	ADJ
cet-15064	59	16	-	-	PUNCT
cet-15064	59	17	time	time	NOUN
cet-15064	59	18	detection	detection	NOUN
cet-15064	59	19	system	system	NOUN
cet-15064	59	20	,	,	PUNCT
cet-15064	59	21	bio	bio	NOUN
cet-15064	59	22	-	-	PROPN
cet-15064	59	23	rad	rad	PROPN
cet-15064	59	24	,	,	PUNCT
cet-15064	59	25	usa	usa	PROPN
cet-15064	59	26	)	)	PUNCT
cet-15064	59	27	.	.	PUNCT
cet-15064	60	1	the	the	DET
cet-15064	60	2	applied	apply	VERB
cet-15064	60	3	primers	primer	NOUN
cet-15064	60	4	are	be	AUX
cet-15064	60	5	listed	list	VERB
cet-15064	60	6	in	in	ADP
cet-15064	60	7	table	table	NOUN
cet-15064	60	8	1	1	NUM
cet-15064	60	9	.	.	PUNCT
cet-15064	61	1	the	the	DET
cet-15064	61	2	25	25	NUM
cet-15064	61	3	µl	µl	ADP
cet-15064	61	4	qpcr	qpcr	ADV
cet-15064	61	5	reaction	reaction	NOUN
cet-15064	61	6	mixture	mixture	NOUN
cet-15064	61	7	comprised	comprise	VERB
cet-15064	61	8	12.5	12.5	NUM
cet-15064	61	9	µl	µl	ADP
cet-15064	61	10	maxima	maxima	NOUN
cet-15064	61	11	sybr	sybr	NOUN
cet-15064	61	12	green	green	ADJ
cet-15064	61	13	qpcr	qpcr	ADJ
cet-15064	61	14	master	master	NOUN
cet-15064	61	15	mix	mix	NOUN
cet-15064	61	16	,	,	PUNCT
cet-15064	61	17	1	1	NUM
cet-15064	61	18	µl	µl	ADP
cet-15064	61	19	each	each	PRON
cet-15064	61	20	of	of	ADP
cet-15064	61	21	forward	forward	ADV
cet-15064	61	22	and	and	CCONJ
cet-15064	61	23	reverse	reverse	VERB
cet-15064	61	24	primers	primer	NOUN
cet-15064	61	25	(	(	PUNCT
cet-15064	61	26	0.4	0.4	NUM
cet-15064	61	27	µm	µm	NOUN
cet-15064	61	28	)	)	PUNCT
cet-15064	61	29	,	,	PUNCT
cet-15064	61	30	2	2	NUM
cet-15064	61	31	µl	µl	ADP
cet-15064	61	32	dna	dna	PROPN
cet-15064	61	33	template	template	NOUN
cet-15064	61	34	(	(	PUNCT
cet-15064	61	35	100	100	NUM
cet-15064	61	36	ng	ng	NOUN
cet-15064	61	37	)	)	PUNCT
cet-15064	61	38	,	,	PUNCT
cet-15064	61	39	and	and	CCONJ
cet-15064	61	40	8.5	8.5	NUM
cet-15064	61	41	µl	µl	ADP
cet-15064	61	42	nuclease	nuclease	NOUN
cet-15064	61	43	-	-	PUNCT
cet-15064	61	44	free	free	ADJ
cet-15064	61	45	water	water	NOUN
cet-15064	61	46	.	.	PUNCT
cet-15064	62	1	the	the	DET
cet-15064	62	2	qpcr	qpcr	ADJ
cet-15064	62	3	protocol	protocol	NOUN
cet-15064	62	4	followed	follow	VERB
cet-15064	62	5	the	the	DET
cet-15064	62	6	manufacturer	manufacturer	NOUN
cet-15064	62	7	's	's	PART
cet-15064	62	8	instructions	instruction	NOUN
cet-15064	62	9	for	for	ADP
cet-15064	62	10	the	the	DET
cet-15064	62	11	maxima	maxima	NOUN
cet-15064	62	12	sybr	sybr	NOUN
cet-15064	62	13	green	green	ADJ
cet-15064	62	14	qpcr	qpcr	ADV
cet-15064	62	15	master	master	NOUN
cet-15064	62	16	mix	mix	NOUN
cet-15064	62	17	(	(	PUNCT
cet-15064	62	18	thermo	thermo	NOUN
cet-15064	62	19	fisher	fisher	PROPN
cet-15064	62	20	scientific	scientific	PROPN
cet-15064	62	21	,	,	PUNCT
cet-15064	62	22	usa	usa	PROPN
cet-15064	62	23	):	):	PUNCT
cet-15064	62	24	initial	initial	ADJ
cet-15064	62	25	denaturation	denaturation	NOUN
cet-15064	62	26	at	at	ADP
cet-15064	62	27	95	95	NUM
cet-15064	62	28	°	°	ADP
cet-15064	62	29	c	c	NOUN
cet-15064	62	30	for	for	ADP
cet-15064	62	31	10	10	NUM
cet-15064	62	32	min	min	NOUN
cet-15064	62	33	,	,	PUNCT
cet-15064	62	34	followed	follow	VERB
cet-15064	62	35	by	by	ADP
cet-15064	62	36	40	40	NUM
cet-15064	62	37	cycles	cycle	NOUN
cet-15064	62	38	of	of	ADP
cet-15064	62	39	denaturation	denaturation	NOUN
cet-15064	62	40	at	at	ADP
cet-15064	62	41	95	95	NUM
cet-15064	62	42	°	°	ADP
cet-15064	62	43	c	c	NOUN
cet-15064	62	44	for	for	ADP
cet-15064	62	45	15	15	NUM
cet-15064	62	46	s	s	NOUN
cet-15064	62	47	,	,	PUNCT
cet-15064	62	48	annealing	anneal	VERB
cet-15064	62	49	at	at	ADP
cet-15064	62	50	55	55	NUM
cet-15064	62	51	or	or	CCONJ
cet-15064	62	52	59	59	NUM
cet-15064	62	53	°	°	NOUN
cet-15064	62	54	c	c	NOUN
cet-15064	62	55	for	for	ADP
cet-15064	62	56	30	30	NUM
cet-15064	62	57	s	s	PART
cet-15064	62	58	(	(	PUNCT
cet-15064	62	59	table	table	NOUN
cet-15064	62	60	1	1	NUM
cet-15064	62	61	)	)	PUNCT
cet-15064	62	62	,	,	PUNCT
cet-15064	62	63	and	and	CCONJ
cet-15064	62	64	elongation	elongation	NOUN
cet-15064	62	65	at	at	ADP
cet-15064	62	66	72	72	NUM
cet-15064	62	67	°	°	ADP
cet-15064	62	68	c	c	NOUN
cet-15064	62	69	for	for	ADP
cet-15064	62	70	30	30	NUM
cet-15064	62	71	s.	s.	PROPN
cet-15064	62	72	to	to	PART
cet-15064	62	73	determine	determine	VERB
cet-15064	62	74	reaction	reaction	NOUN
cet-15064	62	75	efficiency	efficiency	NOUN
cet-15064	62	76	and	and	CCONJ
cet-15064	62	77	copy	copy	NOUN
cet-15064	62	78	number	number	NOUN
cet-15064	62	79	,	,	PUNCT
cet-15064	62	80	a	a	DET
cet-15064	62	81	tenfold	tenfold	ADJ
cet-15064	62	82	dilution	dilution	NOUN
cet-15064	62	83	series	series	NOUN
cet-15064	62	84	(	(	PUNCT
cet-15064	62	85	standards	standard	NOUN
cet-15064	62	86	)	)	PUNCT
cet-15064	62	87	of	of	ADP
cet-15064	62	88	pcr	pcr	NOUN
cet-15064	62	89	products	product	NOUN
cet-15064	62	90	was	be	AUX
cet-15064	62	91	prepared	prepare	VERB
cet-15064	62	92	.	.	PUNCT
cet-15064	63	1	the	the	DET
cet-15064	63	2	copy	copy	NOUN
cet-15064	63	3	number	number	NOUN
cet-15064	63	4	was	be	AUX
cet-15064	63	5	calculated	calculate	VERB
cet-15064	63	6	according	accord	VERB
cet-15064	63	7	to	to	ADP
cet-15064	63	8	the	the	DET
cet-15064	63	9	instructions	instruction	NOUN
cet-15064	63	10	by	by	ADP
cet-15064	63	11	whelan	whelan	PROPN
cet-15064	63	12	et	et	PROPN
cet-15064	63	13	al	al	PROPN
cet-15064	63	14	.	.	PROPN
cet-15064	64	1	(	(	PUNCT
cet-15064	64	2	2003	2003	NUM
cet-15064	64	3	)	)	PUNCT
cet-15064	64	4	.	.	PUNCT
cet-15064	65	1	table	table	NOUN
cet-15064	65	2	1	1	NUM
cet-15064	65	3	:	:	PUNCT
cet-15064	65	4	primer	primer	NOUN
cet-15064	65	5	sequences	sequence	NOUN
cet-15064	65	6	for	for	ADP
cet-15064	65	7	respective	respective	ADJ
cet-15064	65	8	groups	group	NOUN
cet-15064	65	9	of	of	ADP
cet-15064	65	10	bacteria	bacteria	NOUN
cet-15064	65	11	,	,	PUNCT
cet-15064	65	12	based	base	VERB
cet-15064	65	13	on	on	ADP
cet-15064	65	14	(	(	PUNCT
cet-15064	65	15	heinritz	heinritz	PROPN
cet-15064	65	16	et	et	PROPN
cet-15064	65	17	al	al	PROPN
cet-15064	65	18	.	.	PROPN
cet-15064	65	19	,	,	PUNCT
cet-15064	65	20	2016	2016	NUM
cet-15064	65	21	)	)	PUNCT
cet-15064	65	22	target	target	NOUN
cet-15064	65	23	primer	primer	NOUN
cet-15064	65	24	sequence	sequence	NOUN
cet-15064	65	25	(	(	PUNCT
cet-15064	65	26	5’-3	5’-3	NOUN
cet-15064	65	27	’	'	PUNCT
cet-15064	65	28	)	)	PUNCT
cet-15064	65	29	annealing	anneal	VERB
cet-15064	65	30	(	(	PUNCT
cet-15064	65	31	°	°	ADP
cet-15064	65	32	c	c	NOUN
cet-15064	65	33	)	)	PUNCT
cet-15064	65	34	length	length	NOUN
cet-15064	65	35	(	(	PUNCT
cet-15064	65	36	bp	bp	PROPN
cet-15064	65	37	)	)	PUNCT
cet-15064	65	38	efficiency	efficiency	NOUN
cet-15064	65	39	(	(	PUNCT
cet-15064	65	40	%	%	INTJ
cet-15064	65	41	)	)	PUNCT
cet-15064	65	42	total	total	ADJ
cet-15064	65	43	bacteria	bacteria	NOUN
cet-15064	65	44	gtgstgcayggyygtcgtca	gtgstgcayggyygtcgtca	NOUN
cet-15064	65	45	,	,	PUNCT
cet-15064	65	46	acgtcrtccmcnccttcctc	acgtcrtccmcnccttcctc	VERB
cet-15064	65	47	55	55	NUM
cet-15064	65	48	147	147	NUM
cet-15064	65	49	96.8±5.2	96.8±5.2	NUM
cet-15064	65	50	prevotella	prevotella	NOUN
cet-15064	65	51	genus	genus	NOUN
cet-15064	65	52	cacrgtaaacgatggatgcc	cacrgtaaacgatggatgcc	NOUN
cet-15064	65	53	,	,	PUNCT
cet-15064	65	54	ggtcgggttgcagacc	ggtcgggttgcagacc	VERB
cet-15064	65	55	59	59	NUM
cet-15064	65	56	121	121	NUM
cet-15064	65	57	94.6±3.5	94.6±3.5	NUM
cet-15064	65	58	lactobacillus	lactobacillus	NOUN
cet-15064	65	59	spp	spp	NOUN
cet-15064	65	60	.	.	PUNCT
cet-15064	66	1	agaggtagtaactggccttta	agaggtagtaactggccttta	NOUN
cet-15064	66	2	,	,	PUNCT
cet-15064	66	3	gcggaaacctcccaaca	gcggaaacctcccaaca	VERB
cet-15064	66	4	59	59	NUM
cet-15064	66	5	391	391	NUM
cet-15064	66	6	92.2±5.2	92.2±5.2	NUM
cet-15064	66	7	bifidobacterium	bifidobacterium	NOUN
cet-15064	66	8	spp	spp	NOUN
cet-15064	66	9	.	.	PUNCT
cet-15064	67	1	cgcgtccggtgtgaaag	cgcgtccggtgtgaaag	PROPN
cet-15064	67	2	,	,	PUNCT
cet-15064	67	3	cttcccgatatctacacattcca	cttcccgatatctacacattcca	VERB
cet-15064	67	4	59	59	NUM
cet-15064	67	5	126	126	NUM
cet-15064	67	6	95.9±4.2	95.9±4.2	NUM
cet-15064	67	7	2.3	2.3	NUM
cet-15064	67	8	statistical	statistical	ADJ
cet-15064	67	9	analysis	analysis	NOUN
cet-15064	67	10	statistical	statistical	ADJ
cet-15064	67	11	analysis	analysis	NOUN
cet-15064	67	12	was	be	AUX
cet-15064	67	13	performed	perform	VERB
cet-15064	67	14	using	use	VERB
cet-15064	67	15	spss	spss	PROPN
cet-15064	67	16	statistics	statistic	NOUN
cet-15064	67	17	for	for	ADP
cet-15064	67	18	windows	window	NOUN
cet-15064	67	19	v.20.0	v.20.0	PROPN
cet-15064	67	20	(	(	PUNCT
cet-15064	67	21	ibm	ibm	PROPN
cet-15064	67	22	corp	corp	PROPN
cet-15064	67	23	.	.	PROPN
cet-15064	67	24	,	,	PUNCT
cet-15064	67	25	usa	usa	PROPN
cet-15064	67	26	)	)	PUNCT
cet-15064	67	27	.	.	PUNCT
cet-15064	68	1	the	the	DET
cet-15064	68	2	normality	normality	NOUN
cet-15064	68	3	of	of	ADP
cet-15064	68	4	data	datum	NOUN
cet-15064	68	5	distribution	distribution	NOUN
cet-15064	68	6	was	be	AUX
cet-15064	68	7	assessed	assess	VERB
cet-15064	68	8	by	by	ADP
cet-15064	68	9	the	the	DET
cet-15064	68	10	shapiro	shapiro	PROPN
cet-15064	68	11	–	–	PUNCT
cet-15064	68	12	wilk	wilk	NOUN
cet-15064	68	13	test	test	NOUN
cet-15064	68	14	.	.	PUNCT
cet-15064	69	1	group	group	NOUN
cet-15064	69	2	comparisons	comparison	NOUN
cet-15064	69	3	were	be	AUX
cet-15064	69	4	conducted	conduct	VERB
cet-15064	69	5	using	use	VERB
cet-15064	69	6	the	the	DET
cet-15064	69	7	mann	mann	PROPN
cet-15064	69	8	–	–	PUNCT
cet-15064	69	9	whitney	whitney	PROPN
cet-15064	69	10	u	u	PROPN
cet-15064	69	11	test	test	NOUN
cet-15064	69	12	or	or	CCONJ
cet-15064	69	13	independent	independent	ADJ
cet-15064	69	14	samples	sample	NOUN
cet-15064	69	15	t	t	NOUN
cet-15064	69	16	-	-	PUNCT
cet-15064	69	17	test	test	NOUN
cet-15064	69	18	.	.	PUNCT
cet-15064	70	1	3	3	X
cet-15064	70	2	.	.	X
cet-15064	70	3	results	result	NOUN
cet-15064	70	4	and	and	CCONJ
cet-15064	70	5	discussion	discussion	VERB
cet-15064	70	6	the	the	DET
cet-15064	70	7	effects	effect	NOUN
cet-15064	70	8	of	of	ADP
cet-15064	70	9	probiotic	probiotic	ADJ
cet-15064	70	10	supplementation	supplementation	NOUN
cet-15064	70	11	were	be	AUX
cet-15064	70	12	determined	determine	VERB
cet-15064	70	13	on	on	ADP
cet-15064	70	14	sow	sow	VERB
cet-15064	70	15	productivity	productivity	NOUN
cet-15064	70	16	based	base	VERB
cet-15064	70	17	on	on	ADP
cet-15064	70	18	main	main	ADJ
cet-15064	70	19	production	production	NOUN
cet-15064	70	20	traits	trait	NOUN
cet-15064	70	21	that	that	PRON
cet-15064	70	22	were	be	AUX
cet-15064	70	23	monitored	monitor	VERB
cet-15064	70	24	during	during	ADP
cet-15064	70	25	the	the	DET
cet-15064	70	26	experimental	experimental	ADJ
cet-15064	70	27	period	period	NOUN
cet-15064	70	28	and	and	CCONJ
cet-15064	70	29	on	on	ADP
cet-15064	70	30	the	the	DET
cet-15064	70	31	composition	composition	NOUN
cet-15064	70	32	of	of	ADP
cet-15064	70	33	selected	select	VERB
cet-15064	70	34	fecal	fecal	ADJ
cet-15064	70	35	bacterial	bacterial	ADJ
cet-15064	70	36	communities	community	NOUN
cet-15064	70	37	.	.	PUNCT
cet-15064	71	1	3.1	3.1	NUM
cet-15064	71	2	sow	sow	NOUN
cet-15064	71	3	production	production	NOUN
cet-15064	71	4	traits	trait	NOUN
cet-15064	71	5	main	main	ADJ
cet-15064	71	6	production	production	NOUN
cet-15064	71	7	traits	trait	NOUN
cet-15064	71	8	were	be	AUX
cet-15064	71	9	collected	collect	VERB
cet-15064	71	10	and	and	CCONJ
cet-15064	71	11	analyzed	analyze	VERB
cet-15064	71	12	in	in	ADP
cet-15064	71	13	the	the	DET
cet-15064	71	14	control	control	NOUN
cet-15064	71	15	and	and	CCONJ
cet-15064	71	16	experimental	experimental	ADJ
cet-15064	71	17	groups	group	NOUN
cet-15064	71	18	of	of	ADP
cet-15064	71	19	lactating	lactate	VERB
cet-15064	71	20	sows	sow	NOUN
cet-15064	71	21	(	(	PUNCT
cet-15064	71	22	table	table	NOUN
cet-15064	71	23	2	2	NUM
cet-15064	71	24	)	)	PUNCT
cet-15064	71	25	.	.	PUNCT
cet-15064	72	1	based	base	VERB
cet-15064	72	2	on	on	ADP
cet-15064	72	3	the	the	DET
cet-15064	72	4	results	result	NOUN
cet-15064	72	5	,	,	PUNCT
cet-15064	72	6	the	the	DET
cet-15064	72	7	inclusion	inclusion	NOUN
cet-15064	72	8	of	of	ADP
cet-15064	72	9	s.	s.	PROPN
cet-15064	72	10	cerevisiae	cerevisiae	PROPN
cet-15064	72	11	and	and	CCONJ
cet-15064	72	12	mos	mos	NOUN
cet-15064	72	13	in	in	ADP
cet-15064	72	14	the	the	DET
cet-15064	72	15	diet	diet	NOUN
cet-15064	72	16	did	do	AUX
cet-15064	72	17	not	not	PART
cet-15064	72	18	affect	affect	VERB
cet-15064	72	19	significantly	significantly	ADV
cet-15064	72	20	(	(	PUNCT
cet-15064	72	21	p>0.05	p>0.05	PROPN
cet-15064	72	22	)	)	PUNCT
cet-15064	72	23	the	the	DET
cet-15064	72	24	overall	overall	ADJ
cet-15064	72	25	body	body	NOUN
cet-15064	72	26	condition	condition	NOUN
cet-15064	72	27	of	of	ADP
cet-15064	72	28	the	the	DET
cet-15064	72	29	sows	sow	NOUN
cet-15064	72	30	.	.	PUNCT
cet-15064	73	1	according	accord	VERB
cet-15064	73	2	to	to	ADP
cet-15064	73	3	tao	tao	PROPN
cet-15064	73	4	et	et	PROPN
cet-15064	73	5	al	al	PROPN
cet-15064	73	6	.	.	PROPN
cet-15064	74	1	(	(	PUNCT
cet-15064	74	2	2023	2023	NUM
cet-15064	74	3	)	)	PUNCT
cet-15064	74	4	,	,	PUNCT
cet-15064	74	5	dietary	dietary	ADJ
cet-15064	74	6	supplementation	supplementation	NOUN
cet-15064	74	7	with	with	ADP
cet-15064	74	8	yeast	yeast	NOUN
cet-15064	74	9	and	and	CCONJ
cet-15064	74	10	yeast	yeast	NOUN
cet-15064	74	11	-	-	PUNCT
cet-15064	74	12	derived	derive	VERB
cet-15064	74	13	products	product	NOUN
cet-15064	74	14	can	can	AUX
cet-15064	74	15	help	help	VERB
cet-15064	74	16	maintain	maintain	VERB
cet-15064	74	17	body	body	NOUN
cet-15064	74	18	condition	condition	NOUN
cet-15064	74	19	by	by	ADP
cet-15064	74	20	supporting	support	VERB
cet-15064	74	21	gut	gut	NOUN
cet-15064	74	22	health	health	NOUN
cet-15064	74	23	and	and	CCONJ
cet-15064	74	24	nutrient	nutrient	NOUN
cet-15064	74	25	absorption	absorption	NOUN
cet-15064	74	26	,	,	PUNCT
cet-15064	74	27	although	although	SCONJ
cet-15064	74	28	significant	significant	ADJ
cet-15064	74	29	effects	effect	NOUN
cet-15064	74	30	are	be	AUX
cet-15064	74	31	often	often	ADV
cet-15064	74	32	observed	observe	VERB
cet-15064	74	33	more	more	ADV
cet-15064	74	34	prominently	prominently	ADV
cet-15064	74	35	under	under	ADP
cet-15064	74	36	conditions	condition	NOUN
cet-15064	74	37	characterized	characterize	VERB
cet-15064	74	38	by	by	ADP
cet-15064	74	39	nutritional	nutritional	ADJ
cet-15064	74	40	or	or	CCONJ
cet-15064	74	41	environmental	environmental	ADJ
cet-15064	74	42	stress	stress	NOUN
cet-15064	74	43	.	.	PUNCT
cet-15064	75	1	the	the	DET
cet-15064	75	2	slightly	slightly	ADV
cet-15064	75	3	mitigated	mitigate	VERB
cet-15064	75	4	decrease	decrease	NOUN
cet-15064	75	5	in	in	ADP
cet-15064	75	6	backfat	backfat	NOUN
cet-15064	75	7	thickness	thickness	NOUN
cet-15064	75	8	(	(	PUNCT
cet-15064	75	9	bft	bft	NOUN
cet-15064	75	10	)	)	PUNCT
cet-15064	75	11	of	of	ADP
cet-15064	75	12	the	the	DET
cet-15064	75	13	experimental	experimental	ADJ
cet-15064	75	14	group	group	NOUN
cet-15064	75	15	might	might	AUX
cet-15064	75	16	indicate	indicate	VERB
cet-15064	75	17	a	a	DET
cet-15064	75	18	moderate	moderate	ADJ
cet-15064	75	19	improvement	improvement	NOUN
cet-15064	75	20	in	in	ADP
cet-15064	75	21	energy	energy	NOUN
cet-15064	75	22	utilization	utilization	NOUN
cet-15064	75	23	during	during	ADP
cet-15064	75	24	lactation	lactation	NOUN
cet-15064	75	25	,	,	PUNCT
cet-15064	75	26	although	although	SCONJ
cet-15064	75	27	the	the	DET
cet-15064	75	28	difference	difference	NOUN
cet-15064	75	29	was	be	AUX
cet-15064	75	30	not	not	PART
cet-15064	75	31	statistically	statistically	ADV
cet-15064	75	32	significant	significant	ADJ
cet-15064	75	33	(	(	PUNCT
cet-15064	75	34	p>0.05	p>0.05	PROPN
cet-15064	75	35	)	)	PUNCT
cet-15064	75	36	.	.	PUNCT
cet-15064	76	1	the	the	DET
cet-15064	76	2	trend	trend	NOUN
cet-15064	76	3	towards	towards	ADP
cet-15064	76	4	lower	low	ADJ
cet-15064	76	5	average	average	ADJ
cet-15064	76	6	daily	daily	ADJ
cet-15064	76	7	feed	feed	NOUN
cet-15064	76	8	intake	intake	NOUN
cet-15064	76	9	and	and	CCONJ
cet-15064	76	10	slightly	slightly	ADV
cet-15064	76	11	improved	improved	ADJ
cet-15064	76	12	nursing	nursing	NOUN
cet-15064	76	13	skills	skill	NOUN
cet-15064	76	14	in	in	ADP
cet-15064	76	15	the	the	DET
cet-15064	76	16	experimental	experimental	ADJ
cet-15064	76	17	group	group	NOUN
cet-15064	76	18	could	could	AUX
cet-15064	76	19	indicate	indicate	VERB
cet-15064	76	20	improved	improve	VERB
cet-15064	76	21	feed	feed	NOUN
cet-15064	76	22	efficiency	efficiency	NOUN
cet-15064	76	23	.	.	PUNCT
cet-15064	77	1	this	this	DET
cet-15064	77	2	observation	observation	NOUN
cet-15064	77	3	is	be	AUX
cet-15064	77	4	supported	support	VERB
cet-15064	77	5	by	by	ADP
cet-15064	77	6	research	research	NOUN
cet-15064	77	7	showing	show	VERB
cet-15064	77	8	that	that	SCONJ
cet-15064	77	9	yeast	yeast	NOUN
cet-15064	77	10	supplements	supplement	NOUN
cet-15064	77	11	can	can	AUX
cet-15064	77	12	improve	improve	VERB
cet-15064	77	13	feed	feed	NOUN
cet-15064	77	14	efficiency	efficiency	NOUN
cet-15064	77	15	by	by	ADP
cet-15064	77	16	enhancing	enhance	VERB
cet-15064	77	17	gut	gut	NOUN
cet-15064	77	18	health	health	NOUN
cet-15064	77	19	,	,	PUNCT
cet-15064	77	20	which	which	PRON
cet-15064	77	21	may	may	AUX
cet-15064	77	22	allow	allow	VERB
cet-15064	77	23	animals	animal	NOUN
cet-15064	77	24	to	to	PART
cet-15064	77	25	derive	derive	VERB
cet-15064	77	26	more	more	ADJ
cet-15064	77	27	nutrients	nutrient	NOUN
cet-15064	77	28	from	from	ADP
cet-15064	77	29	less	less	ADJ
cet-15064	77	30	feed	feed	NOUN
cet-15064	77	31	(	(	PUNCT
cet-15064	77	32	zhao	zhao	PROPN
cet-15064	77	33	et	et	PROPN
cet-15064	77	34	al	al	PROPN
cet-15064	77	35	.	.	PROPN
cet-15064	77	36	,	,	PUNCT
cet-15064	77	37	2022	2022	NUM
cet-15064	77	38	)	)	PUNCT
cet-15064	77	39	.	.	PUNCT
cet-15064	78	1	méndez	méndez	NOUN
cet-15064	78	2	-	-	PUNCT
cet-15064	78	3	palacios	palacio	NOUN
cet-15064	78	4	et	et	NOUN
cet-15064	78	5	al	al	PROPN
cet-15064	78	6	.	.	PUNCT
cet-15064	79	1	(	(	PUNCT
cet-15064	79	2	2018	2018	NUM
cet-15064	79	3	)	)	PUNCT
cet-15064	79	4	found	find	VERB
cet-15064	79	5	no	no	DET
cet-15064	79	6	differences	difference	NOUN
cet-15064	79	7	in	in	ADP
cet-15064	79	8	average	average	ADJ
cet-15064	79	9	daily	daily	ADJ
cet-15064	79	10	gain	gain	NOUN
cet-15064	79	11	,	,	PUNCT
cet-15064	79	12	daily	daily	ADJ
cet-15064	79	13	feed	feed	NOUN
cet-15064	79	14	intake	intake	NOUN
cet-15064	79	15	,	,	PUNCT
cet-15064	79	16	or	or	CCONJ
cet-15064	79	17	feed	feed	NOUN
cet-15064	79	18	efficiency	efficiency	NOUN
cet-15064	79	19	between	between	ADP
cet-15064	79	20	the	the	DET
cet-15064	79	21	control	control	NOUN
cet-15064	79	22	group	group	NOUN
cet-15064	79	23	and	and	CCONJ
cet-15064	79	24	the	the	DET
cet-15064	79	25	group	group	NOUN
cet-15064	79	26	supplemented	supplement	VERB
cet-15064	79	27	with	with	ADP
cet-15064	79	28	4	4	NUM
cet-15064	79	29	kg	kg	NOUN
cet-15064	79	30	/	/	SYM
cet-15064	79	31	t	t	PROPN
cet-15064	79	32	s.	s.	PROPN
cet-15064	79	33	cerevisiae	cerevisiae	PROPN
cet-15064	79	34	during	during	ADP
cet-15064	79	35	the	the	DET
cet-15064	79	36	21	21	NUM
cet-15064	79	37	-	-	SYM
cet-15064	79	38	150	150	NUM
cet-15064	79	39	days	day	NOUN
cet-15064	79	40	fattening	fatten	VERB
cet-15064	79	41	period	period	NOUN
cet-15064	79	42	of	of	ADP
cet-15064	79	43	pigs	pig	NOUN
cet-15064	79	44	.	.	PUNCT
cet-15064	80	1	in	in	ADP
cet-15064	80	2	contrast	contrast	NOUN
cet-15064	80	3	,	,	PUNCT
cet-15064	80	4	fu	fu	PROPN
cet-15064	80	5	et	et	PROPN
cet-15064	80	6	al	al	PROPN
cet-15064	80	7	.	.	PROPN
cet-15064	81	1	(	(	PUNCT
cet-15064	81	2	2019	2019	NUM
cet-15064	81	3	)	)	PUNCT
cet-15064	81	4	reported	report	VERB
cet-15064	81	5	that	that	SCONJ
cet-15064	81	6	dietary	dietary	ADJ
cet-15064	81	7	yeast	yeast	NOUN
cet-15064	81	8	hydrolysate	hydrolysate	NOUN
cet-15064	81	9	increased	increase	VERB
cet-15064	81	10	daily	daily	ADJ
cet-15064	81	11	gain	gain	NOUN
cet-15064	81	12	and	and	CCONJ
cet-15064	81	13	feed	feed	NOUN
cet-15064	81	14	intake	intake	NOUN
cet-15064	81	15	during	during	ADP
cet-15064	81	16	the	the	DET
cet-15064	81	17	finishing	finish	VERB
cet-15064	81	18	phase	phase	NOUN
cet-15064	81	19	in	in	ADP
cet-15064	81	20	fattening	fatten	VERB
cet-15064	81	21	pigs	pig	NOUN
cet-15064	81	22	,	,	PUNCT
cet-15064	81	23	as	as	ADV
cet-15064	81	24	well	well	ADV
cet-15064	81	25	as	as	ADP
cet-15064	81	26	overall	overall	ADJ
cet-15064	81	27	daily	daily	ADJ
cet-15064	81	28	gain	gain	NOUN
cet-15064	81	29	throughout	throughout	ADP
cet-15064	81	30	the	the	DET
cet-15064	81	31	experiment	experiment	NOUN
cet-15064	81	32	.	.	PUNCT
cet-15064	82	1	similar	similar	ADJ
cet-15064	82	2	results	result	NOUN
cet-15064	82	3	were	be	AUX
cet-15064	82	4	observed	observe	VERB
cet-15064	82	5	in	in	ADP
cet-15064	82	6	weaned	wean	VERB
cet-15064	82	7	piglets	piglet	NOUN
cet-15064	82	8	with	with	ADP
cet-15064	82	9	yeast	yeast	NOUN
cet-15064	82	10	extract	extract	NOUN
cet-15064	82	11	supplementation	supplementation	NOUN
cet-15064	82	12	(	(	PUNCT
cet-15064	82	13	carlson	carlson	PROPN
cet-15064	82	14	et	et	PROPN
cet-15064	82	15	al	al	PROPN
cet-15064	82	16	.	.	PROPN
cet-15064	82	17	,	,	PUNCT
cet-15064	82	18	2005	2005	NUM
cet-15064	82	19	)	)	PUNCT
cet-15064	82	20	.	.	PUNCT
cet-15064	83	1	however	however	ADV
cet-15064	83	2	,	,	PUNCT
cet-15064	83	3	waititu	waititu	PROPN
cet-15064	83	4	et	et	PROPN
cet-15064	83	5	al	al	PROPN
cet-15064	83	6	.	.	PUNCT
cet-15064	84	1	(	(	PUNCT
cet-15064	84	2	2016	2016	NUM
cet-15064	84	3	)	)	PUNCT
cet-15064	84	4	did	do	AUX
cet-15064	84	5	not	not	PART
cet-15064	84	6	find	find	VERB
cet-15064	84	7	a	a	DET
cet-15064	84	8	positive	positive	ADJ
cet-15064	84	9	association	association	NOUN
cet-15064	84	10	between	between	ADP
cet-15064	84	11	growth	growth	NOUN
cet-15064	84	12	traits	trait	NOUN
cet-15064	84	13	and	and	CCONJ
cet-15064	84	14	the	the	DET
cet-15064	84	15	consumption	consumption	NOUN
cet-15064	84	16	of	of	ADP
cet-15064	84	17	yeast	yeast	NOUN
cet-15064	84	18	or	or	CCONJ
cet-15064	84	19	hydrolysates	hydrolysate	NOUN
cet-15064	84	20	in	in	ADP
cet-15064	84	21	pigs	pig	NOUN
cet-15064	84	22	.	.	PUNCT
cet-15064	85	1	951	951	NUM
cet-15064	85	2	table	table	NOUN
cet-15064	85	3	2	2	NUM
cet-15064	85	4	:	:	PUNCT
cet-15064	85	5	production	production	NOUN
cet-15064	85	6	traits	trait	NOUN
cet-15064	85	7	of	of	ADP
cet-15064	85	8	the	the	DET
cet-15064	85	9	control	control	NOUN
cet-15064	85	10	and	and	CCONJ
cet-15064	85	11	the	the	DET
cet-15064	85	12	experimental	experimental	ADJ
cet-15064	85	13	sow	sow	NOUN
cet-15064	85	14	groups	group	NOUN
cet-15064	85	15	traits	trait	NOUN
cet-15064	85	16	control	control	VERB
cet-15064	85	17	sows	sow	VERB
cet-15064	85	18	experimental	experimental	ADJ
cet-15064	85	19	sows	sow	NOUN
cet-15064	85	20	p	p	NOUN
cet-15064	85	21	-	-	PUNCT
cet-15064	85	22	value	value	NOUN
cet-15064	85	23	starting	start	VERB
cet-15064	85	24	weight	weight	NOUN
cet-15064	85	25	(	(	PUNCT
cet-15064	85	26	kg	kg	NOUN
cet-15064	85	27	)	)	PUNCT
cet-15064	86	1	256.7±28.1	256.7±28.1	PROPN
cet-15064	86	2	252.52±31.7	252.52±31.7	NUM
cet-15064	86	3	0.622	0.622	NUM
cet-15064	86	4	sow	sow	NOUN
cet-15064	86	5	weight	weight	NOUN
cet-15064	86	6	at	at	ADP
cet-15064	86	7	weaning	weaning	NOUN
cet-15064	86	8	(	(	PUNCT
cet-15064	86	9	kg	kg	NOUN
cet-15064	86	10	)	)	PUNCT
cet-15064	86	11	195.8±20.9	195.8±20.9	PROPN
cet-15064	86	12	188.64±30.9	188.64±30.9	NUM
cet-15064	86	13	0.341	0.341	NUM
cet-15064	86	14	weight	weight	NOUN
cet-15064	86	15	loss	loss	NOUN
cet-15064	86	16	during	during	ADP
cet-15064	86	17	lactation	lactation	NOUN
cet-15064	86	18	(	(	PUNCT
cet-15064	86	19	kg	kg	X
cet-15064	86	20	)	)	PUNCT
cet-15064	86	21	60,8±19.6	60,8±19.6	NUM
cet-15064	86	22	63.88±15.5	63.88±15.5	NUM
cet-15064	86	23	0.552	0.552	NUM
cet-15064	86	24	starting	start	VERB
cet-15064	86	25	back	back	ADV
cet-15064	86	26	fat	fat	ADJ
cet-15064	86	27	thickness	thickness	NOUN
cet-15064	86	28	(	(	PUNCT
cet-15064	86	29	mm	mm	NOUN
cet-15064	86	30	)	)	PUNCT
cet-15064	86	31	19.2±3.7	19.2±3.7	NUM
cet-15064	86	32	18.16±3.1	18.16±3.1	NUM
cet-15064	86	33	0.286	0.286	NUM
cet-15064	86	34	back	back	ADV
cet-15064	86	35	fat	fat	ADJ
cet-15064	86	36	thickness	thickness	NOUN
cet-15064	86	37	at	at	ADP
cet-15064	86	38	weaning	weaning	NOUN
cet-15064	86	39	(	(	PUNCT
cet-15064	86	40	mm	mm	NOUN
cet-15064	86	41	)	)	PUNCT
cet-15064	86	42	14.6±3.1	14.6±3.1	NUM
cet-15064	86	43	13.92±3.4	13.92±3.4	NUM
cet-15064	86	44	0.463	0.463	NUM
cet-15064	86	45	decrease	decrease	NOUN
cet-15064	86	46	in	in	ADP
cet-15064	86	47	back	back	ADJ
cet-15064	86	48	fat	fat	ADJ
cet-15064	86	49	thickness	thickness	NOUN
cet-15064	86	50	(	(	PUNCT
cet-15064	86	51	mm	mm	NOUN
cet-15064	86	52	)	)	PUNCT
cet-15064	86	53	4.6±3.2	4.6±3.2	PROPN
cet-15064	86	54	4.2±3.9	4.2±3.9	NUM
cet-15064	86	55	0.727	0.727	NUM
cet-15064	86	56	daily	daily	ADJ
cet-15064	86	57	feed	feed	NOUN
cet-15064	86	58	intake	intake	NOUN
cet-15064	86	59	(	(	PUNCT
cet-15064	86	60	kg	kg	NOUN
cet-15064	86	61	)	)	PUNCT
cet-15064	87	1	6.3±1.5	6.3±1.5	PROPN
cet-15064	87	2	5.9±1.3	5.9±1.3	NUM
cet-15064	87	3	0.412	0.412	NUM
cet-15064	87	4	weaning	weaning	NOUN
cet-15064	87	5	to	to	PART
cet-15064	87	6	estrus	estrus	VERB
cet-15064	87	7	interval	interval	NOUN
cet-15064	87	8	(	(	PUNCT
cet-15064	87	9	day	day	NOUN
cet-15064	87	10	)	)	PUNCT
cet-15064	87	11	8,0a±4,8	8,0a±4,8	NUM
cet-15064	87	12	5,4b±3,2	5,4b±3,2	NOUN
cet-15064	87	13	0.043	0.043	NUM
cet-15064	87	14	piglets	piglet	NOUN
cet-15064	87	15	born	bear	VERB
cet-15064	87	16	alive	alive	ADJ
cet-15064	87	17	(	(	PUNCT
cet-15064	87	18	pcs	pc	NOUN
cet-15064	87	19	)	)	PUNCT
cet-15064	87	20	14.2±4.1	14.2±4.1	NUM
cet-15064	87	21	14.3±2.6	14.3±2.6	NUM
cet-15064	87	22	0.902	0.902	NUM
cet-15064	87	23	litter	litter	NOUN
cet-15064	87	24	weight	weight	NOUN
cet-15064	87	25	at	at	ADP
cet-15064	87	26	birth	birth	NOUN
cet-15064	87	27	(	(	PUNCT
cet-15064	87	28	kg	kg	NOUN
cet-15064	87	29	)	)	PUNCT
cet-15064	87	30	19.5±5.7	19.5±5.7	NUM
cet-15064	87	31	19.6±3.4	19.6±3.4	NUM
cet-15064	87	32	0.979	0.979	NUM
cet-15064	87	33	average	average	ADJ
cet-15064	87	34	piglet	piglet	NOUN
cet-15064	87	35	weight	weight	NOUN
cet-15064	87	36	at	at	ADP
cet-15064	87	37	weaning	weaning	NOUN
cet-15064	87	38	(	(	PUNCT
cet-15064	87	39	kg	kg	NOUN
cet-15064	87	40	)	)	PUNCT
cet-15064	87	41	7.3±1.7	7.3±1.7	NUM
cet-15064	87	42	7.5±1.9	7.5±1.9	NUM
cet-15064	87	43	0.582	0.582	NUM
cet-15064	87	44	a	a	DET
cet-15064	87	45	,	,	PUNCT
cet-15064	87	46	b	b	PROPN
cet-15064	87	47	means	mean	NOUN
cet-15064	87	48	with	with	ADP
cet-15064	87	49	different	different	ADJ
cet-15064	87	50	superscripts	superscript	NOUN
cet-15064	87	51	differ	differ	VERB
cet-15064	87	52	significantly	significantly	ADV
cet-15064	87	53	(	(	PUNCT
cet-15064	87	54	p<0.05	p<0.05	NOUN
cet-15064	87	55	)	)	PUNCT
cet-15064	87	56	in	in	ADP
cet-15064	87	57	line	line	NOUN
cet-15064	87	58	with	with	ADP
cet-15064	87	59	the	the	DET
cet-15064	87	60	findings	finding	NOUN
cet-15064	87	61	of	of	ADP
cet-15064	87	62	jang	jang	PROPN
cet-15064	87	63	et	et	PROPN
cet-15064	87	64	al	al	PROPN
cet-15064	87	65	.	.	PROPN
cet-15064	88	1	(	(	PUNCT
cet-15064	88	2	2013	2013	NUM
cet-15064	88	3	)	)	PUNCT
cet-15064	88	4	,	,	PUNCT
cet-15064	88	5	no	no	DET
cet-15064	88	6	significant	significant	ADJ
cet-15064	88	7	differences	difference	NOUN
cet-15064	88	8	(	(	PUNCT
cet-15064	88	9	p>0.05	p>0.05	NOUN
cet-15064	88	10	)	)	PUNCT
cet-15064	88	11	were	be	AUX
cet-15064	88	12	observed	observe	VERB
cet-15064	88	13	in	in	ADP
cet-15064	88	14	average	average	ADJ
cet-15064	88	15	litter	litter	NOUN
cet-15064	88	16	weight	weight	NOUN
cet-15064	88	17	at	at	ADP
cet-15064	88	18	birth	birth	NOUN
cet-15064	88	19	and	and	CCONJ
cet-15064	88	20	the	the	DET
cet-15064	88	21	number	number	NOUN
cet-15064	88	22	of	of	ADP
cet-15064	88	23	live	live	ADV
cet-15064	88	24	-	-	PUNCT
cet-15064	88	25	born	bear	VERB
cet-15064	88	26	piglets	piglet	NOUN
cet-15064	88	27	(	(	PUNCT
cet-15064	88	28	table	table	NOUN
cet-15064	88	29	2	2	NUM
cet-15064	88	30	)	)	PUNCT
cet-15064	88	31	.	.	PUNCT
cet-15064	89	1	however	however	ADV
cet-15064	89	2	,	,	PUNCT
cet-15064	89	3	other	other	ADJ
cet-15064	89	4	studies	study	NOUN
cet-15064	89	5	(	(	PUNCT
cet-15064	89	6	mariella	mariella	PROPN
cet-15064	89	7	et	et	PROPN
cet-15064	89	8	al	al	PROPN
cet-15064	89	9	.	.	PROPN
cet-15064	89	10	,	,	PUNCT
cet-15064	89	11	2009	2009	NUM
cet-15064	89	12	)	)	PUNCT
cet-15064	89	13	reported	report	VERB
cet-15064	89	14	more	more	ADV
cet-15064	89	15	live	live	ADV
cet-15064	89	16	-	-	PUNCT
cet-15064	89	17	born	bear	VERB
cet-15064	89	18	piglets	piglet	NOUN
cet-15064	89	19	in	in	ADP
cet-15064	89	20	groups	group	NOUN
cet-15064	89	21	treated	treat	VERB
cet-15064	89	22	with	with	ADP
cet-15064	89	23	yeast	yeast	NOUN
cet-15064	89	24	supplements	supplement	NOUN
cet-15064	89	25	.	.	PUNCT
cet-15064	90	1	piglets	piglet	NOUN
cet-15064	90	2	from	from	ADP
cet-15064	90	3	experimental	experimental	ADJ
cet-15064	90	4	sows	sow	NOUN
cet-15064	90	5	had	have	VERB
cet-15064	90	6	slightly	slightly	ADV
cet-15064	90	7	higher	high	ADJ
cet-15064	90	8	average	average	ADJ
cet-15064	90	9	weaning	weaning	NOUN
cet-15064	90	10	weights	weight	NOUN
cet-15064	90	11	,	,	PUNCT
cet-15064	90	12	although	although	SCONJ
cet-15064	90	13	the	the	DET
cet-15064	90	14	difference	difference	NOUN
cet-15064	90	15	was	be	AUX
cet-15064	90	16	not	not	PART
cet-15064	90	17	statistically	statistically	ADV
cet-15064	90	18	significant	significant	ADJ
cet-15064	90	19	(	(	PUNCT
cet-15064	90	20	p>0.05	p>0.05	PROPN
cet-15064	90	21	)	)	PUNCT
cet-15064	90	22	.	.	PUNCT
cet-15064	91	1	in	in	ADP
cet-15064	91	2	contrast	contrast	NOUN
cet-15064	91	3	,	,	PUNCT
cet-15064	91	4	shen	shen	PROPN
cet-15064	91	5	et	et	PROPN
cet-15064	91	6	al	al	PROPN
cet-15064	91	7	.	.	PROPN
cet-15064	91	8	(	(	PUNCT
cet-15064	91	9	2011	2011	NUM
cet-15064	91	10	)	)	PUNCT
cet-15064	91	11	reported	report	VERB
cet-15064	91	12	that	that	SCONJ
cet-15064	91	13	supplementation	supplementation	NOUN
cet-15064	91	14	of	of	ADP
cet-15064	91	15	live	live	ADJ
cet-15064	91	16	yeast	yeast	NOUN
cet-15064	91	17	in	in	ADP
cet-15064	91	18	the	the	DET
cet-15064	91	19	diet	diet	NOUN
cet-15064	91	20	of	of	ADP
cet-15064	91	21	pregnant	pregnant	ADJ
cet-15064	91	22	and	and	CCONJ
cet-15064	91	23	lactating	lactate	VERB
cet-15064	91	24	sows	sow	NOUN
cet-15064	91	25	improved	improve	VERB
cet-15064	91	26	the	the	DET
cet-15064	91	27	average	average	ADJ
cet-15064	91	28	daily	daily	ADJ
cet-15064	91	29	weight	weight	NOUN
cet-15064	91	30	gain	gain	NOUN
cet-15064	91	31	of	of	ADP
cet-15064	91	32	their	their	PRON
cet-15064	91	33	piglets	piglet	NOUN
cet-15064	91	34	.	.	PUNCT
cet-15064	92	1	most	most	ADJ
cet-15064	92	2	authors	author	NOUN
cet-15064	92	3	have	have	AUX
cet-15064	92	4	demonstrated	demonstrate	VERB
cet-15064	92	5	the	the	DET
cet-15064	92	6	health	health	NOUN
cet-15064	92	7	benefits	benefit	NOUN
cet-15064	92	8	of	of	ADP
cet-15064	92	9	probiotic	probiotic	ADJ
cet-15064	92	10	yeast	yeast	NOUN
cet-15064	92	11	in	in	ADP
cet-15064	92	12	piglets	piglet	NOUN
cet-15064	92	13	;	;	PUNCT
cet-15064	92	14	supplementation	supplementation	NOUN
cet-15064	92	15	with	with	ADP
cet-15064	92	16	yeast	yeast	NOUN
cet-15064	92	17	or	or	CCONJ
cet-15064	92	18	its	its	PRON
cet-15064	92	19	derivatives	derivative	NOUN
cet-15064	92	20	increased	increase	VERB
cet-15064	92	21	daily	daily	ADJ
cet-15064	92	22	feed	feed	NOUN
cet-15064	92	23	intake	intake	NOUN
cet-15064	92	24	and	and	CCONJ
cet-15064	92	25	growth	growth	NOUN
cet-15064	92	26	(	(	PUNCT
cet-15064	92	27	kiros	kiro	NOUN
cet-15064	92	28	et	et	PROPN
cet-15064	92	29	al	al	PROPN
cet-15064	92	30	.	.	PROPN
cet-15064	92	31	,	,	PUNCT
cet-15064	92	32	2019	2019	NUM
cet-15064	92	33	)	)	PUNCT
cet-15064	92	34	.	.	PUNCT
cet-15064	93	1	it	it	PRON
cet-15064	93	2	stimulated	stimulate	VERB
cet-15064	93	3	mucosal	mucosal	NOUN
cet-15064	93	4	immunity	immunity	NOUN
cet-15064	93	5	by	by	ADP
cet-15064	93	6	increasing	increase	VERB
cet-15064	93	7	the	the	DET
cet-15064	93	8	activity	activity	NOUN
cet-15064	93	9	of	of	ADP
cet-15064	93	10	iga	iga	PROPN
cet-15064	93	11	and	and	CCONJ
cet-15064	93	12	igm	igm	PROPN
cet-15064	93	13	against	against	ADP
cet-15064	93	14	pathogens	pathogen	NOUN
cet-15064	93	15	,	,	PUNCT
cet-15064	93	16	improved	improve	VERB
cet-15064	93	17	intestinal	intestinal	ADJ
cet-15064	93	18	development	development	NOUN
cet-15064	93	19	and	and	CCONJ
cet-15064	93	20	function	function	NOUN
cet-15064	93	21	,	,	PUNCT
cet-15064	93	22	bound	bind	VERB
cet-15064	93	23	mycotoxins	mycotoxin	NOUN
cet-15064	93	24	,	,	PUNCT
cet-15064	93	25	influenced	influence	VERB
cet-15064	93	26	gut	gut	NOUN
cet-15064	93	27	microbiota	microbiota	NOUN
cet-15064	93	28	,	,	PUNCT
cet-15064	93	29	and	and	CCONJ
cet-15064	93	30	reduced	reduce	VERB
cet-15064	93	31	post	post	ADJ
cet-15064	93	32	-	-	ADJ
cet-15064	93	33	weaning	weaning	ADJ
cet-15064	93	34	diarrhea	diarrhea	NOUN
cet-15064	93	35	in	in	ADP
cet-15064	93	36	piglets	piglet	NOUN
cet-15064	93	37	(	(	PUNCT
cet-15064	93	38	jiang	jiang	PROPN
cet-15064	93	39	et	et	PROPN
cet-15064	93	40	al	al	PROPN
cet-15064	93	41	.	.	PROPN
cet-15064	93	42	,	,	PUNCT
cet-15064	93	43	2015	2015	NUM
cet-15064	93	44	)	)	PUNCT
cet-15064	93	45	.	.	PUNCT
cet-15064	94	1	however	however	ADV
cet-15064	94	2	,	,	PUNCT
cet-15064	94	3	kornegay	kornegay	PROPN
cet-15064	94	4	(	(	PUNCT
cet-15064	94	5	1995	1995	NUM
cet-15064	94	6	)	)	PUNCT
cet-15064	94	7	did	do	AUX
cet-15064	94	8	not	not	PART
cet-15064	94	9	observe	observe	VERB
cet-15064	94	10	a	a	DET
cet-15064	94	11	positive	positive	ADJ
cet-15064	94	12	effect	effect	NOUN
cet-15064	94	13	of	of	ADP
cet-15064	94	14	yeast	yeast	NOUN
cet-15064	94	15	supplementation	supplementation	NOUN
cet-15064	94	16	on	on	ADP
cet-15064	94	17	daily	daily	ADJ
cet-15064	94	18	weight	weight	NOUN
cet-15064	94	19	gain	gain	NOUN
cet-15064	94	20	in	in	ADP
cet-15064	94	21	their	their	PRON
cet-15064	94	22	studies	study	NOUN
cet-15064	94	23	with	with	ADP
cet-15064	94	24	weaned	wean	VERB
cet-15064	94	25	piglets	piglet	NOUN
cet-15064	94	26	.	.	PUNCT
cet-15064	95	1	a	a	DET
cet-15064	95	2	significant	significant	ADJ
cet-15064	95	3	reduction	reduction	NOUN
cet-15064	95	4	was	be	AUX
cet-15064	95	5	found	find	VERB
cet-15064	95	6	in	in	ADP
cet-15064	95	7	the	the	DET
cet-15064	95	8	weaning	weaning	NOUN
cet-15064	95	9	to	to	PART
cet-15064	95	10	estrus	estrus	VERB
cet-15064	95	11	interval	interval	NOUN
cet-15064	95	12	in	in	ADP
cet-15064	95	13	the	the	DET
cet-15064	95	14	group	group	NOUN
cet-15064	95	15	of	of	ADP
cet-15064	95	16	the	the	DET
cet-15064	95	17	supplemented	supplement	VERB
cet-15064	95	18	experimental	experimental	ADJ
cet-15064	95	19	sows	sow	NOUN
cet-15064	95	20	.	.	PUNCT
cet-15064	96	1	this	this	PRON
cet-15064	96	2	suggests	suggest	VERB
cet-15064	96	3	that	that	SCONJ
cet-15064	96	4	the	the	DET
cet-15064	96	5	yeast	yeast	NOUN
cet-15064	96	6	probiotics	probiotic	NOUN
cet-15064	96	7	and	and	CCONJ
cet-15064	96	8	prebiotics	prebiotic	NOUN
cet-15064	96	9	(	(	PUNCT
cet-15064	96	10	mos	mos	NOUN
cet-15064	96	11	and	and	CCONJ
cet-15064	96	12	beta	beta	NOUN
cet-15064	96	13	-	-	PUNCT
cet-15064	96	14	glucans	glucan	NOUN
cet-15064	96	15	)	)	PUNCT
cet-15064	96	16	may	may	AUX
cet-15064	96	17	have	have	AUX
cet-15064	96	18	supported	support	VERB
cet-15064	96	19	quicker	quick	ADJ
cet-15064	96	20	recovery	recovery	NOUN
cet-15064	96	21	and	and	CCONJ
cet-15064	96	22	readiness	readiness	NOUN
cet-15064	96	23	for	for	ADP
cet-15064	96	24	the	the	DET
cet-15064	96	25	next	next	ADJ
cet-15064	96	26	reproductive	reproductive	ADJ
cet-15064	96	27	cycle	cycle	NOUN
cet-15064	96	28	.	.	PUNCT
cet-15064	97	1	this	this	PRON
cet-15064	97	2	aligns	align	VERB
cet-15064	97	3	with	with	ADP
cet-15064	97	4	research	research	NOUN
cet-15064	97	5	indicating	indicate	VERB
cet-15064	97	6	that	that	SCONJ
cet-15064	97	7	s.	s.	PROPN
cet-15064	97	8	cerevisiae	cerevisiae	PROPN
cet-15064	97	9	and	and	CCONJ
cet-15064	97	10	mos	mos	PROPN
cet-15064	97	11	can	can	AUX
cet-15064	97	12	modulate	modulate	VERB
cet-15064	97	13	immune	immune	ADJ
cet-15064	97	14	function	function	NOUN
cet-15064	97	15	and	and	CCONJ
cet-15064	97	16	improve	improve	VERB
cet-15064	97	17	gut	gut	NOUN
cet-15064	97	18	integrity	integrity	NOUN
cet-15064	97	19	,	,	PUNCT
cet-15064	97	20	leading	lead	VERB
cet-15064	97	21	to	to	ADP
cet-15064	97	22	better	well	ADJ
cet-15064	97	23	overall	overall	ADJ
cet-15064	97	24	reproductive	reproductive	ADJ
cet-15064	97	25	performance	performance	NOUN
cet-15064	97	26	(	(	PUNCT
cet-15064	97	27	jang	jang	PROPN
cet-15064	97	28	et	et	PROPN
cet-15064	97	29	al	al	PROPN
cet-15064	97	30	.	.	PROPN
cet-15064	97	31	,	,	PUNCT
cet-15064	97	32	2013	2013	NUM
cet-15064	97	33	)	)	PUNCT
cet-15064	97	34	.	.	PUNCT
cet-15064	98	1	the	the	DET
cet-15064	98	2	quicker	quick	ADJ
cet-15064	98	3	return	return	NOUN
cet-15064	98	4	to	to	ADP
cet-15064	98	5	estrus	estrus	NOUN
cet-15064	98	6	may	may	AUX
cet-15064	98	7	be	be	AUX
cet-15064	98	8	attributed	attribute	VERB
cet-15064	98	9	to	to	ADP
cet-15064	98	10	the	the	DET
cet-15064	98	11	enhanced	enhanced	ADJ
cet-15064	98	12	metabolic	metabolic	NOUN
cet-15064	98	13	and	and	CCONJ
cet-15064	98	14	immune	immune	ADJ
cet-15064	98	15	status	status	NOUN
cet-15064	98	16	of	of	ADP
cet-15064	98	17	the	the	DET
cet-15064	98	18	sows	sow	NOUN
cet-15064	98	19	,	,	PUNCT
cet-15064	98	20	which	which	PRON
cet-15064	98	21	are	be	AUX
cet-15064	98	22	critical	critical	ADJ
cet-15064	98	23	during	during	ADP
cet-15064	98	24	the	the	DET
cet-15064	98	25	post	post	ADJ
cet-15064	98	26	-	-	ADJ
cet-15064	98	27	weaning	weaning	ADJ
cet-15064	98	28	period	period	NOUN
cet-15064	98	29	.	.	PUNCT
cet-15064	99	1	3.2	3.2	NUM
cet-15064	99	2	composition	composition	NOUN
cet-15064	99	3	of	of	ADP
cet-15064	99	4	fecal	fecal	ADJ
cet-15064	99	5	bacterial	bacterial	ADJ
cet-15064	99	6	communities	community	NOUN
cet-15064	99	7	the	the	DET
cet-15064	99	8	copy	copy	NOUN
cet-15064	99	9	numbers	number	NOUN
cet-15064	99	10	of	of	ADP
cet-15064	99	11	selected	select	VERB
cet-15064	99	12	bacterial	bacterial	ADJ
cet-15064	99	13	communities	community	NOUN
cet-15064	99	14	were	be	AUX
cet-15064	99	15	determined	determine	VERB
cet-15064	99	16	in	in	ADP
cet-15064	99	17	the	the	DET
cet-15064	99	18	control	control	NOUN
cet-15064	99	19	and	and	CCONJ
cet-15064	99	20	the	the	DET
cet-15064	99	21	experimental	experimental	ADJ
cet-15064	99	22	groups	group	NOUN
cet-15064	99	23	(	(	PUNCT
cet-15064	99	24	table	table	NOUN
cet-15064	99	25	3	3	NUM
cet-15064	99	26	)	)	PUNCT
cet-15064	99	27	.	.	PUNCT
cet-15064	100	1	table	table	NOUN
cet-15064	100	2	3	3	NUM
cet-15064	100	3	:	:	PUNCT
cet-15064	100	4	copy	copy	VERB
cet-15064	100	5	numbers	number	NOUN
cet-15064	100	6	of	of	ADP
cet-15064	100	7	the	the	DET
cet-15064	100	8	analyzed	analyze	VERB
cet-15064	100	9	bacterial	bacterial	ADJ
cet-15064	100	10	communities	community	NOUN
cet-15064	100	11	(	(	PUNCT
cet-15064	100	12	log10	log10	PROPN
cet-15064	100	13	values±sd	values±sd	ADV
cet-15064	100	14	)	)	PUNCT
cet-15064	100	15	bacterial	bacterial	ADJ
cet-15064	100	16	groups	group	NOUN
cet-15064	100	17	control	control	VERB
cet-15064	100	18	sows	sow	VERB
cet-15064	100	19	experimental	experimental	ADJ
cet-15064	100	20	sows	sow	NOUN
cet-15064	100	21	total	total	ADJ
cet-15064	100	22	bacteria	bacteria	NOUN
cet-15064	100	23	9.78a±0.27	9.78a±0.27	NUM
cet-15064	100	24	9.21b±0.20	9.21b±0.20	NUM
cet-15064	100	25	prevotella	prevotella	NOUN
cet-15064	100	26	genus	genus	VERB
cet-15064	100	27	9.45a±0.22	9.45a±0.22	NUM
cet-15064	100	28	8.64b±0.21	8.64b±0.21	NUM
cet-15064	100	29	lactobacillus	lactobacillus	NOUN
cet-15064	100	30	spp	spp	NOUN
cet-15064	100	31	.	.	PROPN
cet-15064	101	1	7.17a±0.14	7.17a±0.14	NUM
cet-15064	101	2	6.71b±0.13	6.71b±0.13	NUM
cet-15064	101	3	bifidobacterium	bifidobacterium	NOUN
cet-15064	101	4	spp	spp	NOUN
cet-15064	101	5	.	.	PUNCT
cet-15064	102	1	6.08±0.10	6.08±0.10	NUM
cet-15064	102	2	6.36±0.11	6.36±0.11	PROPN
cet-15064	102	3	a	a	DET
cet-15064	102	4	,	,	PUNCT
cet-15064	102	5	b	b	NOUN
cet-15064	102	6	means	mean	NOUN
cet-15064	102	7	with	with	ADP
cet-15064	102	8	different	different	ADJ
cet-15064	102	9	superscripts	superscript	NOUN
cet-15064	102	10	differ	differ	VERB
cet-15064	102	11	significantly	significantly	ADV
cet-15064	102	12	(	(	PUNCT
cet-15064	102	13	p<0.05	p<0.05	PROPN
cet-15064	102	14	)	)	PUNCT
cet-15064	102	15	the	the	DET
cet-15064	102	16	total	total	ADJ
cet-15064	102	17	bacterial	bacterial	ADJ
cet-15064	102	18	count	count	NOUN
cet-15064	102	19	in	in	ADP
cet-15064	102	20	the	the	DET
cet-15064	102	21	experimental	experimental	ADJ
cet-15064	102	22	sows	sow	NOUN
cet-15064	102	23	was	be	AUX
cet-15064	102	24	significantly	significantly	ADV
cet-15064	102	25	(	(	PUNCT
cet-15064	102	26	p<0.05	p<0.05	NOUN
cet-15064	102	27	)	)	PUNCT
cet-15064	102	28	lower	low	ADJ
cet-15064	102	29	compared	compare	VERB
cet-15064	102	30	to	to	ADP
cet-15064	102	31	the	the	DET
cet-15064	102	32	control	control	NOUN
cet-15064	102	33	sows	sow	NOUN
cet-15064	102	34	.	.	PUNCT
cet-15064	103	1	the	the	DET
cet-15064	103	2	considerable	considerable	ADJ
cet-15064	103	3	decrease	decrease	NOUN
cet-15064	103	4	in	in	ADP
cet-15064	103	5	total	total	ADJ
cet-15064	103	6	bacterial	bacterial	ADJ
cet-15064	103	7	load	load	NOUN
cet-15064	103	8	suggests	suggest	VERB
cet-15064	103	9	that	that	SCONJ
cet-15064	103	10	the	the	DET
cet-15064	103	11	supplementation	supplementation	NOUN
cet-15064	103	12	with	with	ADP
cet-15064	103	13	s.	s.	PROPN
cet-15064	103	14	cerevisiae	cerevisiae	PROPN
cet-15064	103	15	and	and	CCONJ
cet-15064	103	16	prebiotics	prebiotic	NOUN
cet-15064	103	17	(	(	PUNCT
cet-15064	103	18	mos	mos	NOUN
cet-15064	103	19	and	and	CCONJ
cet-15064	103	20	betaglucans	betaglucan	NOUN
cet-15064	103	21	)	)	PUNCT
cet-15064	103	22	have	have	AUX
cet-15064	103	23	had	have	VERB
cet-15064	103	24	a	a	DET
cet-15064	103	25	modulating	modulating	ADJ
cet-15064	103	26	effect	effect	NOUN
cet-15064	103	27	on	on	ADP
cet-15064	103	28	the	the	DET
cet-15064	103	29	gut	gut	NOUN
cet-15064	103	30	microbiota	microbiota	NOUN
cet-15064	103	31	,	,	PUNCT
cet-15064	103	32	potentially	potentially	ADV
cet-15064	103	33	reducing	reduce	VERB
cet-15064	103	34	the	the	DET
cet-15064	103	35	overall	overall	ADJ
cet-15064	103	36	bacterial	bacterial	ADJ
cet-15064	103	37	load	load	NOUN
cet-15064	103	38	by	by	ADP
cet-15064	103	39	selectively	selectively	ADV
cet-15064	103	40	promoting	promote	VERB
cet-15064	103	41	beneficial	beneficial	ADJ
cet-15064	103	42	bacteria	bacteria	NOUN
cet-15064	103	43	while	while	SCONJ
cet-15064	103	44	suppressing	suppress	VERB
cet-15064	103	45	pathogenic	pathogenic	ADJ
cet-15064	103	46	or	or	CCONJ
cet-15064	103	47	non	non	ADJ
cet-15064	103	48	-	-	ADJ
cet-15064	103	49	beneficial	beneficial	ADJ
cet-15064	103	50	genera	genera	NOUN
cet-15064	103	51	.	.	PUNCT
cet-15064	104	1	this	this	DET
cet-15064	104	2	finding	finding	NOUN
cet-15064	104	3	is	be	AUX
cet-15064	104	4	consistent	consistent	ADJ
cet-15064	104	5	with	with	ADP
cet-15064	104	6	law	law	NOUN
cet-15064	104	7	et	et	PROPN
cet-15064	104	8	al	al	PROPN
cet-15064	104	9	.	.	PROPN
cet-15064	105	1	(	(	PUNCT
cet-15064	105	2	2024	2024	NUM
cet-15064	105	3	)	)	PUNCT
cet-15064	105	4	that	that	PRON
cet-15064	105	5	have	have	AUX
cet-15064	105	6	observed	observe	VERB
cet-15064	105	7	a	a	DET
cet-15064	105	8	balancing	balance	VERB
cet-15064	105	9	effect	effect	NOUN
cet-15064	105	10	of	of	ADP
cet-15064	105	11	yeast	yeast	NOUN
cet-15064	105	12	and	and	CCONJ
cet-15064	105	13	mos	mos	NOUN
cet-15064	105	14	on	on	ADP
cet-15064	105	15	the	the	DET
cet-15064	105	16	gut	gut	NOUN
cet-15064	105	17	microbiota	microbiota	NOUN
cet-15064	105	18	,	,	PUNCT
cet-15064	105	19	leading	lead	VERB
cet-15064	105	20	to	to	ADP
cet-15064	105	21	a	a	DET
cet-15064	105	22	more	more	ADV
cet-15064	105	23	stable	stable	ADJ
cet-15064	105	24	and	and	CCONJ
cet-15064	105	25	beneficial	beneficial	ADJ
cet-15064	105	26	microbial	microbial	ADJ
cet-15064	105	27	community	community	NOUN
cet-15064	105	28	.	.	PUNCT
cet-15064	106	1	the	the	DET
cet-15064	106	2	prevotella	prevotella	NOUN
cet-15064	106	3	genus	genus	NOUN
cet-15064	106	4	–	–	PUNCT
cet-15064	106	5	widely	widely	ADV
cet-15064	106	6	associated	associate	VERB
cet-15064	106	7	with	with	ADP
cet-15064	106	8	the	the	DET
cet-15064	106	9	degradation	degradation	NOUN
cet-15064	106	10	of	of	ADP
cet-15064	106	11	complex	complex	ADJ
cet-15064	106	12	carbohydrates	carbohydrate	NOUN
cet-15064	106	13	and	and	CCONJ
cet-15064	106	14	fiber	fiber	NOUN
cet-15064	106	15	–	–	PUNCT
cet-15064	106	16	also	also	ADV
cet-15064	106	17	showed	show	VERB
cet-15064	106	18	a	a	DET
cet-15064	106	19	significant	significant	ADJ
cet-15064	106	20	(	(	PUNCT
cet-15064	106	21	p<0.05	p<0.05	NOUN
cet-15064	106	22	)	)	PUNCT
cet-15064	106	23	reduction	reduction	NOUN
cet-15064	106	24	in	in	ADP
cet-15064	106	25	the	the	DET
cet-15064	106	26	experimental	experimental	ADJ
cet-15064	106	27	sows	sow	NOUN
cet-15064	106	28	.	.	PUNCT
cet-15064	107	1	the	the	DET
cet-15064	107	2	reduction	reduction	NOUN
cet-15064	107	3	in	in	ADP
cet-15064	107	4	prevotella	prevotella	NOUN
cet-15064	107	5	could	could	AUX
cet-15064	107	6	be	be	AUX
cet-15064	107	7	due	due	ADJ
cet-15064	107	8	to	to	ADP
cet-15064	107	9	the	the	DET
cet-15064	107	10	competition	competition	NOUN
cet-15064	107	11	with	with	ADP
cet-15064	107	12	other	other	ADJ
cet-15064	107	13	bacterial	bacterial	ADJ
cet-15064	107	14	groups	group	NOUN
cet-15064	107	15	that	that	PRON
cet-15064	107	16	were	be	AUX
cet-15064	107	17	promoted	promote	VERB
cet-15064	107	18	by	by	ADP
cet-15064	107	19	the	the	DET
cet-15064	107	20	supplementation	supplementation	NOUN
cet-15064	107	21	,	,	PUNCT
cet-15064	107	22	or	or	CCONJ
cet-15064	107	23	it	it	PRON
cet-15064	107	24	could	could	AUX
cet-15064	107	25	indicate	indicate	VERB
cet-15064	107	26	a	a	DET
cet-15064	107	27	shift	shift	NOUN
cet-15064	107	28	in	in	ADP
cet-15064	107	29	the	the	DET
cet-15064	107	30	substrate	substrate	NOUN
cet-15064	107	31	utilization	utilization	NOUN
cet-15064	107	32	patterns	pattern	NOUN
cet-15064	107	33	within	within	ADP
cet-15064	107	34	the	the	DET
cet-15064	107	35	gut	gut	NOUN
cet-15064	107	36	of	of	ADP
cet-15064	107	37	the	the	DET
cet-15064	107	38	supplemented	supplement	VERB
cet-15064	107	39	sows	sow	NOUN
cet-15064	107	40	.	.	PUNCT
cet-15064	108	1	previous	previous	ADJ
cet-15064	108	2	research	research	NOUN
cet-15064	108	3	has	have	AUX
cet-15064	108	4	indicated	indicate	VERB
cet-15064	108	5	that	that	SCONJ
cet-15064	108	6	dietary	dietary	ADJ
cet-15064	108	7	interventions	intervention	NOUN
cet-15064	108	8	,	,	PUNCT
cet-15064	108	9	including	include	VERB
cet-15064	108	10	yeast	yeast	NOUN
cet-15064	108	11	-	-	PUNCT
cet-15064	108	12	derived	derive	VERB
cet-15064	108	13	prebiotics	prebiotic	NOUN
cet-15064	108	14	such	such	ADJ
cet-15064	108	15	as	as	ADP
cet-15064	108	16	mos	mos	PROPN
cet-15064	108	17	,	,	PUNCT
cet-15064	108	18	can	can	AUX
cet-15064	108	19	influence	influence	VERB
cet-15064	108	20	the	the	DET
cet-15064	108	21	relative	relative	ADJ
cet-15064	108	22	952	952	NUM
cet-15064	108	23	abundance	abundance	NOUN
cet-15064	108	24	of	of	ADP
cet-15064	108	25	the	the	DET
cet-15064	108	26	prevotella	prevotella	NOUN
cet-15064	108	27	genus	genus	NOUN
cet-15064	108	28	,	,	PUNCT
cet-15064	108	29	and	and	CCONJ
cet-15064	108	30	may	may	AUX
cet-15064	108	31	reduce	reduce	VERB
cet-15064	108	32	it	it	PRON
cet-15064	108	33	in	in	ADP
cet-15064	108	34	favor	favor	NOUN
cet-15064	108	35	of	of	ADP
cet-15064	108	36	other	other	ADJ
cet-15064	108	37	beneficial	beneficial	ADJ
cet-15064	108	38	bacteria	bacteria	NOUN
cet-15064	108	39	(	(	PUNCT
cet-15064	108	40	fouhse	fouhse	INTJ
cet-15064	108	41	et	et	NOUN
cet-15064	108	42	al	al	PROPN
cet-15064	108	43	.	.	PROPN
cet-15064	108	44	,	,	PUNCT
cet-15064	108	45	2019	2019	NUM
cet-15064	108	46	)	)	PUNCT
cet-15064	108	47	.	.	PUNCT
cet-15064	109	1	the	the	DET
cet-15064	109	2	lactobacillus	lactobacillus	NOUN
cet-15064	109	3	spp	spp	NOUN
cet-15064	109	4	.	.	PUNCT
cet-15064	109	5	copy	copy	NOUN
cet-15064	109	6	numbers	number	NOUN
cet-15064	109	7	also	also	ADV
cet-15064	109	8	decreased	decrease	VERB
cet-15064	109	9	in	in	ADP
cet-15064	109	10	the	the	DET
cet-15064	109	11	experimental	experimental	ADJ
cet-15064	109	12	group	group	NOUN
cet-15064	109	13	compared	compare	VERB
cet-15064	109	14	to	to	ADP
cet-15064	109	15	the	the	DET
cet-15064	109	16	control	control	NOUN
cet-15064	109	17	group	group	NOUN
cet-15064	109	18	.	.	PUNCT
cet-15064	110	1	lactobacillus	lactobacillus	PROPN
cet-15064	110	2	spp	spp	PROPN
cet-15064	110	3	.	.	PUNCT
cet-15064	110	4	are	be	AUX
cet-15064	110	5	generally	generally	ADV
cet-15064	110	6	considered	consider	VERB
cet-15064	110	7	beneficial	beneficial	ADJ
cet-15064	110	8	,	,	PUNCT
cet-15064	110	9	contributing	contribute	VERB
cet-15064	110	10	to	to	PART
cet-15064	110	11	gut	gut	VERB
cet-15064	110	12	health	health	NOUN
cet-15064	110	13	through	through	ADP
cet-15064	110	14	the	the	DET
cet-15064	110	15	production	production	NOUN
cet-15064	110	16	of	of	ADP
cet-15064	110	17	lactic	lactic	ADJ
cet-15064	110	18	acid	acid	NOUN
cet-15064	110	19	and	and	CCONJ
cet-15064	110	20	other	other	ADJ
cet-15064	110	21	antimicrobial	antimicrobial	ADJ
cet-15064	110	22	compounds	compound	NOUN
cet-15064	110	23	.	.	PUNCT
cet-15064	111	1	in	in	ADP
cet-15064	111	2	contrast	contrast	NOUN
cet-15064	111	3	to	to	ADP
cet-15064	111	4	the	the	DET
cet-15064	111	5	reductions	reduction	NOUN
cet-15064	111	6	observed	observe	VERB
cet-15064	111	7	in	in	ADP
cet-15064	111	8	other	other	ADJ
cet-15064	111	9	bacterial	bacterial	ADJ
cet-15064	111	10	groups	group	NOUN
cet-15064	111	11	,	,	PUNCT
cet-15064	111	12	the	the	DET
cet-15064	111	13	absolute	absolute	ADJ
cet-15064	111	14	quantity	quantity	NOUN
cet-15064	111	15	of	of	ADP
cet-15064	111	16	bifidobacterium	bifidobacterium	NOUN
cet-15064	111	17	spp	spp	NOUN
cet-15064	111	18	.	.	PUNCT
cet-15064	111	19	showed	show	VERB
cet-15064	111	20	an	an	DET
cet-15064	111	21	increase	increase	NOUN
cet-15064	111	22	in	in	ADP
cet-15064	111	23	the	the	DET
cet-15064	111	24	experimental	experimental	ADJ
cet-15064	111	25	sows	sow	NOUN
cet-15064	111	26	.	.	PUNCT
cet-15064	112	1	however	however	ADV
cet-15064	112	2	,	,	PUNCT
cet-15064	112	3	the	the	DET
cet-15064	112	4	difference	difference	NOUN
cet-15064	112	5	was	be	AUX
cet-15064	112	6	not	not	PART
cet-15064	112	7	significant	significant	ADJ
cet-15064	112	8	(	(	PUNCT
cet-15064	112	9	p>0.05	p>0.05	PROPN
cet-15064	112	10	)	)	PUNCT
cet-15064	112	11	.	.	PUNCT
cet-15064	113	1	bifidobacterium	bifidobacterium	NOUN
cet-15064	113	2	is	be	AUX
cet-15064	113	3	another	another	DET
cet-15064	113	4	genus	genus	NOUN
cet-15064	113	5	of	of	ADP
cet-15064	113	6	beneficial	beneficial	ADJ
cet-15064	113	7	bacteria	bacteria	NOUN
cet-15064	113	8	associated	associate	VERB
cet-15064	113	9	with	with	ADP
cet-15064	113	10	the	the	DET
cet-15064	113	11	fermentation	fermentation	NOUN
cet-15064	113	12	of	of	ADP
cet-15064	113	13	oligosaccharides	oligosaccharide	NOUN
cet-15064	113	14	,	,	PUNCT
cet-15064	113	15	leading	lead	VERB
cet-15064	113	16	to	to	ADP
cet-15064	113	17	the	the	DET
cet-15064	113	18	production	production	NOUN
cet-15064	113	19	of	of	ADP
cet-15064	113	20	short	short	ADJ
cet-15064	113	21	-	-	PUNCT
cet-15064	113	22	chain	chain	NOUN
cet-15064	113	23	fatty	fatty	NOUN
cet-15064	113	24	acids	acid	NOUN
cet-15064	113	25	that	that	PRON
cet-15064	113	26	contribute	contribute	VERB
cet-15064	113	27	to	to	ADP
cet-15064	113	28	gut	gut	NOUN
cet-15064	113	29	health	health	NOUN
cet-15064	113	30	.	.	PUNCT
cet-15064	114	1	the	the	DET
cet-15064	114	2	increase	increase	NOUN
cet-15064	114	3	in	in	ADP
cet-15064	114	4	bifidobacterium	bifidobacterium	NOUN
cet-15064	114	5	may	may	AUX
cet-15064	114	6	be	be	AUX
cet-15064	114	7	attributed	attribute	VERB
cet-15064	114	8	to	to	ADP
cet-15064	114	9	the	the	DET
cet-15064	114	10	prebiotic	prebiotic	ADJ
cet-15064	114	11	effects	effect	NOUN
cet-15064	114	12	of	of	ADP
cet-15064	114	13	mos	mos	NOUN
cet-15064	114	14	(	(	PUNCT
cet-15064	114	15	kango	kango	PROPN
cet-15064	114	16	et	et	PROPN
cet-15064	114	17	al	al	PROPN
cet-15064	114	18	.	.	PROPN
cet-15064	114	19	,	,	PUNCT
cet-15064	114	20	2022	2022	NUM
cet-15064	114	21	)	)	PUNCT
cet-15064	114	22	.	.	PUNCT
cet-15064	115	1	due	due	ADP
cet-15064	115	2	to	to	ADP
cet-15064	115	3	remarkable	remarkable	ADJ
cet-15064	115	4	differences	difference	NOUN
cet-15064	115	5	in	in	ADP
cet-15064	115	6	absolute	absolute	ADJ
cet-15064	115	7	quantities	quantity	NOUN
cet-15064	115	8	presented	present	VERB
cet-15064	115	9	in	in	ADP
cet-15064	115	10	log10	log10	PROPN
cet-15064	115	11	copy	copy	VERB
cet-15064	115	12	numbers	number	NOUN
cet-15064	115	13	in	in	ADP
cet-15064	115	14	table	table	NOUN
cet-15064	115	15	3	3	NUM
cet-15064	115	16	,	,	PUNCT
cet-15064	115	17	the	the	DET
cet-15064	115	18	quantity	quantity	NOUN
cet-15064	115	19	of	of	ADP
cet-15064	115	20	selected	select	VERB
cet-15064	115	21	bacterial	bacterial	ADJ
cet-15064	115	22	communities	community	NOUN
cet-15064	115	23	was	be	AUX
cet-15064	115	24	also	also	ADV
cet-15064	115	25	calculated	calculate	VERB
cet-15064	115	26	relative	relative	ADJ
cet-15064	115	27	to	to	ADP
cet-15064	115	28	total	total	ADJ
cet-15064	115	29	bacteria	bacteria	NOUN
cet-15064	115	30	(	(	PUNCT
cet-15064	115	31	table	table	NOUN
cet-15064	115	32	4	4	NUM
cet-15064	115	33	)	)	PUNCT
cet-15064	115	34	.	.	PUNCT
cet-15064	116	1	the	the	DET
cet-15064	116	2	relative	relative	ADJ
cet-15064	116	3	values	value	NOUN
cet-15064	116	4	indicate	indicate	VERB
cet-15064	116	5	a	a	DET
cet-15064	116	6	notable	notable	ADJ
cet-15064	116	7	shift	shift	NOUN
cet-15064	116	8	in	in	ADP
cet-15064	116	9	the	the	DET
cet-15064	116	10	significant	significant	ADJ
cet-15064	116	11	(	(	PUNCT
cet-15064	116	12	p<0.05	p<0.05	NOUN
cet-15064	116	13	)	)	PUNCT
cet-15064	116	14	reduction	reduction	NOUN
cet-15064	116	15	of	of	ADP
cet-15064	116	16	the	the	DET
cet-15064	116	17	prevotella	prevotella	NOUN
cet-15064	116	18	genus	genus	NOUN
cet-15064	116	19	and	and	CCONJ
cet-15064	116	20	an	an	DET
cet-15064	116	21	impressive	impressive	ADJ
cet-15064	116	22	relative	relative	ADJ
cet-15064	116	23	increment	increment	NOUN
cet-15064	116	24	in	in	ADP
cet-15064	116	25	bifidobacterium	bifidobacterium	NOUN
cet-15064	116	26	spp	spp	NOUN
cet-15064	116	27	.	.	PUNCT
cet-15064	116	28	,	,	PUNCT
cet-15064	116	29	while	while	SCONJ
cet-15064	116	30	lactobacillus	lactobacillus	NOUN
cet-15064	116	31	spp	spp	NOUN
cet-15064	116	32	.	.	PUNCT
cet-15064	117	1	relative	relative	ADJ
cet-15064	117	2	quantities	quantity	NOUN
cet-15064	117	3	did	do	AUX
cet-15064	117	4	not	not	PART
cet-15064	117	5	differ	differ	VERB
cet-15064	117	6	(	(	PUNCT
cet-15064	117	7	p>0.05	p>0.05	PROPN
cet-15064	117	8	)	)	PUNCT
cet-15064	117	9	;	;	PUNCT
cet-15064	117	10	however	however	ADV
cet-15064	117	11	,	,	PUNCT
cet-15064	117	12	the	the	DET
cet-15064	117	13	increasing	increase	VERB
cet-15064	117	14	trend	trend	NOUN
cet-15064	117	15	(	(	PUNCT
cet-15064	117	16	0.24	0.24	NUM
cet-15064	117	17	vs	vs	ADP
cet-15064	117	18	0.31	0.31	NUM
cet-15064	117	19	)	)	PUNCT
cet-15064	117	20	indicated	indicate	VERB
cet-15064	117	21	the	the	DET
cet-15064	117	22	beneficial	beneficial	ADJ
cet-15064	117	23	effects	effect	NOUN
cet-15064	117	24	of	of	ADP
cet-15064	117	25	the	the	DET
cet-15064	117	26	supplements	supplement	NOUN
cet-15064	117	27	on	on	ADP
cet-15064	117	28	lactobacilli	lactobacilli	PROPN
cet-15064	117	29	,	,	PUNCT
cet-15064	117	30	as	as	ADV
cet-15064	117	31	well	well	ADV
cet-15064	117	32	.	.	PUNCT
cet-15064	118	1	table	table	NOUN
cet-15064	118	2	4	4	NUM
cet-15064	118	3	:	:	PUNCT
cet-15064	118	4	percentage	percentage	NOUN
cet-15064	118	5	(	(	PUNCT
cet-15064	118	6	%	%	NOUN
cet-15064	118	7	)	)	PUNCT
cet-15064	118	8	of	of	ADP
cet-15064	118	9	the	the	DET
cet-15064	118	10	analyzed	analyze	VERB
cet-15064	118	11	bacterial	bacterial	ADJ
cet-15064	118	12	communities	community	NOUN
cet-15064	118	13	relative	relative	ADJ
cet-15064	118	14	to	to	ADP
cet-15064	118	15	total	total	ADJ
cet-15064	118	16	bacteria	bacteria	NOUN
cet-15064	118	17	bacterial	bacterial	ADJ
cet-15064	118	18	groups	group	NOUN
cet-15064	118	19	control	control	VERB
cet-15064	118	20	sows	sow	VERB
cet-15064	118	21	experimental	experimental	ADJ
cet-15064	118	22	sows	sow	NOUN
cet-15064	118	23	prevotella	prevotella	NOUN
cet-15064	118	24	genus	genus	NOUN
cet-15064	118	25	45.72a±16.39	45.72a±16.39	NUM
cet-15064	118	26	26.37b±9.50	26.37b±9.50	NUM
cet-15064	118	27	lactobacillus	lactobacillus	NOUN
cet-15064	118	28	spp	spp	NOUN
cet-15064	118	29	.	.	PUNCT
cet-15064	119	1	0.24±0.07	0.24±0.07	NOUN
cet-15064	119	2	0.31±0.12	0.31±0.12	DET
cet-15064	119	3	bifidobacterium	bifidobacterium	NOUN
cet-15064	119	4	spp	spp	NOUN
cet-15064	119	5	.	.	PUNCT
cet-15064	120	1	0.0194b±0.0038	0.0194b±0.0038	PROPN
cet-15064	120	2	0.1378a±0.0169	0.1378a±0.0169	PROPN
cet-15064	121	1	a	a	PRON
cet-15064	121	2	,	,	PUNCT
cet-15064	121	3	b	b	PROPN
cet-15064	121	4	means	mean	NOUN
cet-15064	121	5	with	with	ADP
cet-15064	121	6	different	different	ADJ
cet-15064	121	7	superscripts	superscript	NOUN
cet-15064	121	8	differ	differ	VERB
cet-15064	121	9	significantly	significantly	ADV
cet-15064	121	10	(	(	PUNCT
cet-15064	121	11	p<0.05	p<0.05	NOUN
cet-15064	121	12	)	)	PUNCT
cet-15064	121	13	4	4	NUM
cet-15064	121	14	.	.	PUNCT
cet-15064	121	15	conclusions	conclusion	NOUN
cet-15064	121	16	the	the	DET
cet-15064	121	17	supplementation	supplementation	NOUN
cet-15064	121	18	of	of	ADP
cet-15064	121	19	s.	s.	PROPN
cet-15064	121	20	cerevisiae	cerevisiae	PROPN
cet-15064	121	21	and	and	CCONJ
cet-15064	121	22	yeast	yeast	NOUN
cet-15064	121	23	-	-	PUNCT
cet-15064	121	24	derived	derive	VERB
cet-15064	121	25	prebiotics	prebiotic	NOUN
cet-15064	121	26	(	(	PUNCT
cet-15064	121	27	mos	mos	NOUN
cet-15064	121	28	and	and	CCONJ
cet-15064	121	29	beta	beta	NOUN
cet-15064	121	30	-	-	PUNCT
cet-15064	121	31	glucan	glucan	NOUN
cet-15064	121	32	)	)	PUNCT
cet-15064	121	33	in	in	ADP
cet-15064	121	34	the	the	DET
cet-15064	121	35	diet	diet	NOUN
cet-15064	121	36	of	of	ADP
cet-15064	121	37	lategestation	lategestation	NOUN
cet-15064	121	38	and	and	CCONJ
cet-15064	121	39	lactating	lactate	VERB
cet-15064	121	40	sows	sow	NOUN
cet-15064	121	41	demonstrated	demonstrate	VERB
cet-15064	121	42	remarkable	remarkable	ADJ
cet-15064	121	43	effects	effect	NOUN
cet-15064	121	44	on	on	ADP
cet-15064	121	45	the	the	DET
cet-15064	121	46	gut	gut	NOUN
cet-15064	121	47	microbiota	microbiota	NOUN
cet-15064	121	48	composition	composition	NOUN
cet-15064	121	49	and	and	CCONJ
cet-15064	121	50	moderate	moderate	ADJ
cet-15064	121	51	effects	effect	NOUN
cet-15064	121	52	on	on	ADP
cet-15064	121	53	production	production	NOUN
cet-15064	121	54	traits	trait	NOUN
cet-15064	121	55	.	.	PUNCT
cet-15064	122	1	the	the	DET
cet-15064	122	2	experimental	experimental	ADJ
cet-15064	122	3	group	group	NOUN
cet-15064	122	4	exhibited	exhibit	VERB
cet-15064	122	5	a	a	DET
cet-15064	122	6	significant	significant	ADJ
cet-15064	122	7	(	(	PUNCT
cet-15064	122	8	p<0.05	p<0.05	NOUN
cet-15064	122	9	)	)	PUNCT
cet-15064	122	10	reduction	reduction	NOUN
cet-15064	122	11	in	in	ADP
cet-15064	122	12	total	total	ADJ
cet-15064	122	13	bacteria	bacteria	NOUN
cet-15064	122	14	and	and	CCONJ
cet-15064	122	15	other	other	ADJ
cet-15064	122	16	bacterial	bacterial	ADJ
cet-15064	122	17	communities	community	NOUN
cet-15064	122	18	(	(	PUNCT
cet-15064	122	19	prevotella	prevotella	NOUN
cet-15064	122	20	and	and	CCONJ
cet-15064	122	21	lactobacillus	lactobacillus	PROPN
cet-15064	122	22	spp	spp	NOUN
cet-15064	122	23	.	.	PUNCT
cet-15064	122	24	)	)	PUNCT
cet-15064	122	25	,	,	PUNCT
cet-15064	122	26	while	while	SCONJ
cet-15064	122	27	an	an	DET
cet-15064	122	28	increase	increase	NOUN
cet-15064	122	29	was	be	AUX
cet-15064	122	30	observed	observe	VERB
cet-15064	122	31	in	in	ADP
cet-15064	122	32	bifidobacterium	bifidobacterium	NOUN
cet-15064	122	33	spp	spp	NOUN
cet-15064	122	34	.	.	PUNCT
cet-15064	123	1	based	base	VERB
cet-15064	123	2	on	on	ADP
cet-15064	123	3	the	the	DET
cet-15064	123	4	relative	relative	ADJ
cet-15064	123	5	quantities	quantity	NOUN
cet-15064	123	6	,	,	PUNCT
cet-15064	123	7	the	the	DET
cet-15064	123	8	supplementation	supplementation	NOUN
cet-15064	123	9	essentially	essentially	ADV
cet-15064	123	10	promoted	promote	VERB
cet-15064	123	11	lactobacilli	lactobacilli	PROPN
cet-15064	123	12	and	and	CCONJ
cet-15064	123	13	bifidobacteria	bifidobacteria	NOUN
cet-15064	123	14	and	and	CCONJ
cet-15064	123	15	notably	notably	ADV
cet-15064	123	16	decreased	decrease	VERB
cet-15064	123	17	the	the	DET
cet-15064	123	18	ratio	ratio	NOUN
cet-15064	123	19	of	of	ADP
cet-15064	123	20	the	the	DET
cet-15064	123	21	prevotella	prevotella	NOUN
cet-15064	123	22	genus	genus	NOUN
cet-15064	123	23	.	.	PUNCT
cet-15064	124	1	this	this	DET
cet-15064	124	2	shift	shift	NOUN
cet-15064	124	3	suggests	suggest	VERB
cet-15064	124	4	potential	potential	ADJ
cet-15064	124	5	benefits	benefit	NOUN
cet-15064	124	6	in	in	ADP
cet-15064	124	7	enhancing	enhance	VERB
cet-15064	124	8	nutrient	nutrient	ADJ
cet-15064	124	9	absorption	absorption	NOUN
cet-15064	124	10	and	and	CCONJ
cet-15064	124	11	immune	immune	ADJ
cet-15064	124	12	functions	function	NOUN
cet-15064	124	13	and	and	CCONJ
cet-15064	124	14	may	may	AUX
cet-15064	124	15	lead	lead	VERB
cet-15064	124	16	to	to	ADP
cet-15064	124	17	a	a	DET
cet-15064	124	18	shorter	short	ADJ
cet-15064	124	19	weaningto	weaningto	NOUN
cet-15064	124	20	-	-	PUNCT
cet-15064	124	21	estrus	estrus	NOUN
cet-15064	124	22	interval	interval	NOUN
cet-15064	124	23	and	and	CCONJ
cet-15064	124	24	improved	improve	VERB
cet-15064	124	25	readiness	readiness	NOUN
cet-15064	124	26	for	for	ADP
cet-15064	124	27	the	the	DET
cet-15064	124	28	next	next	ADJ
cet-15064	124	29	reproductive	reproductive	ADJ
cet-15064	124	30	cycle	cycle	NOUN
cet-15064	124	31	.	.	PUNCT
cet-15064	125	1	further	further	ADJ
cet-15064	125	2	studies	study	NOUN
cet-15064	125	3	are	be	AUX
cet-15064	125	4	needed	need	VERB
cet-15064	125	5	to	to	PART
cet-15064	125	6	explore	explore	VERB
cet-15064	125	7	the	the	DET
cet-15064	125	8	mechanisms	mechanism	NOUN
cet-15064	125	9	behind	behind	ADP
cet-15064	125	10	these	these	DET
cet-15064	125	11	effects	effect	NOUN
cet-15064	125	12	and	and	CCONJ
cet-15064	125	13	refine	refine	VERB
cet-15064	125	14	dietary	dietary	ADJ
cet-15064	125	15	strategies	strategy	NOUN
cet-15064	125	16	that	that	PRON
cet-15064	125	17	support	support	VERB
cet-15064	125	18	sustainable	sustainable	ADJ
cet-15064	125	19	pig	pig	NOUN
cet-15064	125	20	production	production	NOUN
cet-15064	125	21	under	under	ADP
cet-15064	125	22	the	the	DET
cet-15064	125	23	increasingly	increasingly	ADV
cet-15064	125	24	stringent	stringent	ADJ
cet-15064	125	25	regulations	regulation	NOUN
cet-15064	125	26	on	on	ADP
cet-15064	125	27	antibiotic	antibiotic	ADJ
cet-15064	125	28	use	use	NOUN
cet-15064	125	29	.	.	PUNCT
cet-15064	126	1	acknowledgments	acknowledgment	NOUN
cet-15064	126	2	the	the	DET
cet-15064	126	3	authors	author	NOUN
cet-15064	126	4	are	be	AUX
cet-15064	126	5	grateful	grateful	ADJ
cet-15064	126	6	to	to	ADP
cet-15064	126	7	their	their	PRON
cet-15064	126	8	colleagues	colleague	NOUN
cet-15064	126	9	at	at	ADP
cet-15064	126	10	the	the	DET
cet-15064	126	11	pig	pig	NOUN
cet-15064	126	12	production	production	NOUN
cet-15064	126	13	facility	facility	NOUN
cet-15064	126	14	for	for	ADP
cet-15064	126	15	their	their	PRON
cet-15064	126	16	help	help	NOUN
cet-15064	126	17	in	in	ADP
cet-15064	126	18	data	datum	NOUN
cet-15064	126	19	and	and	CCONJ
cet-15064	126	20	sample	sample	NOUN
cet-15064	126	21	collection	collection	NOUN
cet-15064	126	22	and	and	CCONJ
cet-15064	126	23	the	the	DET
cet-15064	126	24	supervision	supervision	NOUN
cet-15064	126	25	of	of	ADP
cet-15064	126	26	the	the	DET
cet-15064	126	27	experimental	experimental	ADJ
cet-15064	126	28	sow	sow	NOUN
cet-15064	126	29	groups	group	NOUN
cet-15064	126	30	.	.	PUNCT
cet-15064	127	1	references	reference	NOUN
cet-15064	127	2	carlson	carlson	PROPN
cet-15064	127	3	m.s	m.s	PROPN
cet-15064	127	4	.	.	PROPN
cet-15064	127	5	,	,	PUNCT
cet-15064	127	6	veum	veum	PROPN
cet-15064	127	7	t.l	t.l	PROPN
cet-15064	127	8	.	.	PROPN
cet-15064	127	9	,	,	PUNCT
cet-15064	127	10	turk	turk	PROPN
cet-15064	127	11	j.r	j.r	PROPN
cet-15064	127	12	.	.	PROPN
cet-15064	127	13	,	,	PUNCT
cet-15064	127	14	2005	2005	NUM
cet-15064	127	15	,	,	PUNCT
cet-15064	127	16	effects	effect	NOUN
cet-15064	127	17	of	of	ADP
cet-15064	127	18	yeast	yeast	NOUN
cet-15064	127	19	extract	extract	NOUN
cet-15064	127	20	versus	versus	ADP
cet-15064	127	21	animal	animal	NOUN
cet-15064	127	22	plasma	plasma	NOUN
cet-15064	127	23	in	in	ADP
cet-15064	127	24	weanling	weanle	VERB
cet-15064	127	25	pig	pig	NOUN
cet-15064	127	26	diets	diet	NOUN
cet-15064	127	27	on	on	ADP
cet-15064	127	28	growth	growth	NOUN
cet-15064	127	29	performance	performance	NOUN
cet-15064	127	30	,	,	PUNCT
cet-15064	127	31	immune	immune	ADJ
cet-15064	127	32	responses	response	NOUN
cet-15064	127	33	,	,	PUNCT
cet-15064	127	34	and	and	CCONJ
cet-15064	127	35	intestinal	intestinal	ADJ
cet-15064	127	36	morphology	morphology	NOUN
cet-15064	127	37	.	.	PUNCT
cet-15064	128	1	journal	journal	PROPN
cet-15064	128	2	of	of	ADP
cet-15064	128	3	swine	swine	ADJ
cet-15064	128	4	health	health	NOUN
cet-15064	128	5	and	and	CCONJ
cet-15064	128	6	production	production	NOUN
cet-15064	128	7	,	,	PUNCT
cet-15064	128	8	13(4	13(4	NUM
cet-15064	128	9	)	)	PUNCT
cet-15064	128	10	,	,	PUNCT
cet-15064	128	11	204–209	204–209	NUM
cet-15064	128	12	.	.	PUNCT
cet-15064	129	1	chandrasekaran	chandrasekaran	ADJ
cet-15064	129	2	p.	p.	PROPN
cet-15064	129	3	,	,	PUNCT
cet-15064	129	4	weiskirchen	weiskirchen	PROPN
cet-15064	129	5	s.	s.	PROPN
cet-15064	129	6	,	,	PUNCT
cet-15064	129	7	weiskirchen	weiskirchen	PROPN
cet-15064	129	8	r.	r.	PROPN
cet-15064	129	9	,	,	PUNCT
cet-15064	129	10	2024	2024	NUM
cet-15064	129	11	,	,	PUNCT
cet-15064	129	12	effects	effect	NOUN
cet-15064	129	13	of	of	ADP
cet-15064	129	14	probiotics	probiotic	NOUN
cet-15064	129	15	on	on	ADP
cet-15064	129	16	gut	gut	NOUN
cet-15064	129	17	microbiota	microbiota	NOUN
cet-15064	129	18	:	:	PUNCT
cet-15064	129	19	an	an	DET
cet-15064	129	20	overview	overview	NOUN
cet-15064	129	21	.	.	PUNCT
cet-15064	130	1	international	international	ADJ
cet-15064	130	2	journal	journal	NOUN
cet-15064	130	3	of	of	ADP
cet-15064	130	4	molecular	molecular	ADJ
cet-15064	130	5	sciences	science	NOUN
cet-15064	130	6	,	,	PUNCT
cet-15064	130	7	25(11	25(11	NUM
cet-15064	130	8	)	)	PUNCT
cet-15064	130	9	,	,	PUNCT
cet-15064	130	10	6022	6022	NUM
cet-15064	130	11	.	.	PUNCT
cet-15064	131	1	doi	doi	NOUN
cet-15064	131	2	:	:	PUNCT
cet-15064	131	3	10.3390	10.3390	NUM
cet-15064	131	4	/	/	SYM
cet-15064	131	5	ijms25116022	ijms25116022	NOUN
cet-15064	131	6	.	.	PUNCT
cet-15064	132	1	fouhse	fouhse	PROPN
cet-15064	132	2	j.m	j.m	PROPN
cet-15064	132	3	.	.	PROPN
cet-15064	132	4	,	,	PUNCT
cet-15064	132	5	dawson	dawson	PROPN
cet-15064	132	6	k.	k.	PROPN
cet-15064	132	7	,	,	PUNCT
cet-15064	132	8	graugnard	graugnard	PROPN
cet-15064	132	9	d.	d.	PROPN
cet-15064	132	10	,	,	PUNCT
cet-15064	132	11	dyck	dyck	ADJ
cet-15064	132	12	m.	m.	NOUN
cet-15064	132	13	,	,	PUNCT
cet-15064	132	14	willing	willing	ADJ
cet-15064	132	15	b.p	b.p	PROPN
cet-15064	132	16	.	.	PROPN
cet-15064	132	17	,	,	PUNCT
cet-15064	132	18	2019	2019	NUM
cet-15064	132	19	,	,	PUNCT
cet-15064	132	20	dietary	dietary	ADJ
cet-15064	132	21	supplementation	supplementation	NOUN
cet-15064	132	22	of	of	ADP
cet-15064	132	23	weaned	wean	VERB
cet-15064	132	24	piglets	piglet	NOUN
cet-15064	132	25	with	with	ADP
cet-15064	132	26	a	a	DET
cet-15064	132	27	yeast	yeast	NOUN
cet-15064	132	28	-	-	PUNCT
cet-15064	132	29	derived	derive	VERB
cet-15064	132	30	mannan	mannan	NOUN
cet-15064	132	31	-	-	PUNCT
cet-15064	132	32	rich	rich	ADJ
cet-15064	132	33	fraction	fraction	NOUN
cet-15064	132	34	modulates	modulate	VERB
cet-15064	132	35	cecal	cecal	ADJ
cet-15064	132	36	microbial	microbial	ADJ
cet-15064	132	37	profiles	profile	NOUN
cet-15064	132	38	,	,	PUNCT
cet-15064	132	39	jejunal	jejunal	ADJ
cet-15064	132	40	morphology	morphology	NOUN
cet-15064	132	41	and	and	CCONJ
cet-15064	132	42	gene	gene	NOUN
cet-15064	132	43	expression	expression	NOUN
cet-15064	132	44	.	.	PUNCT
cet-15064	133	1	animal	animal	NOUN
cet-15064	133	2	,	,	PUNCT
cet-15064	133	3	13(8	13(8	NUM
cet-15064	133	4	)	)	PUNCT
cet-15064	133	5	,	,	PUNCT
cet-15064	133	6	1591	1591	NUM
cet-15064	133	7	-	-	SYM
cet-15064	133	8	1598	1598	NUM
cet-15064	133	9	,	,	PUNCT
cet-15064	133	10	doi	doi	NOUN
cet-15064	133	11	:	:	PUNCT
cet-15064	133	12	10.1017	10.1017	NUM
cet-15064	133	13	/	/	SYM
cet-15064	133	14	s1751731118003361	s1751731118003361	NOUN
cet-15064	133	15	.	.	PUNCT
cet-15064	134	1	fu	fu	PROPN
cet-15064	134	2	r.	r.	PROPN
cet-15064	134	3	,	,	PUNCT
cet-15064	134	4	chen	chen	PROPN
cet-15064	134	5	d.	d.	PROPN
cet-15064	134	6	,	,	PUNCT
cet-15064	134	7	tian	tian	PROPN
cet-15064	134	8	g.	g.	PROPN
cet-15064	134	9	,	,	PUNCT
cet-15064	134	10	zheng	zheng	PROPN
cet-15064	134	11	p.	p.	PROPN
cet-15064	134	12	,	,	PUNCT
cet-15064	134	13	mao	mao	PROPN
cet-15064	135	1	x.	x.	PROPN
cet-15064	135	2	,	,	PUNCT
cet-15064	135	3	yu	yu	PROPN
cet-15064	135	4	j.	j.	PROPN
cet-15064	135	5	,	,	PUNCT
cet-15064	135	6	he	he	PRON
cet-15064	135	7	j.	j.	PROPN
cet-15064	135	8	,	,	PUNCT
cet-15064	135	9	huang	huang	PROPN
cet-15064	135	10	z.	z.	PROPN
cet-15064	135	11	,	,	PUNCT
cet-15064	135	12	luo	luo	PROPN
cet-15064	135	13	y.	y.	PROPN
cet-15064	135	14	,	,	PUNCT
cet-15064	135	15	yu	yu	PROPN
cet-15064	135	16	b.	b.	PROPN
cet-15064	135	17	,	,	PUNCT
cet-15064	135	18	2019	2019	NUM
cet-15064	135	19	,	,	PUNCT
cet-15064	135	20	effect	effect	NOUN
cet-15064	135	21	of	of	ADP
cet-15064	135	22	dietary	dietary	ADJ
cet-15064	135	23	supplementation	supplementation	NOUN
cet-15064	135	24	of	of	ADP
cet-15064	135	25	bacillus	bacillus	NOUN
cet-15064	135	26	coagulans	coagulan	NOUN
cet-15064	135	27	or	or	CCONJ
cet-15064	135	28	yeast	yeast	NOUN
cet-15064	135	29	hydrolysates	hydrolysate	NOUN
cet-15064	135	30	on	on	ADP
cet-15064	135	31	growth	growth	NOUN
cet-15064	135	32	performance	performance	NOUN
cet-15064	135	33	,	,	PUNCT
cet-15064	135	34	antioxidant	antioxidant	ADJ
cet-15064	135	35	activity	activity	NOUN
cet-15064	135	36	,	,	PUNCT
cet-15064	135	37	cytokines	cytokine	NOUN
cet-15064	135	38	and	and	CCONJ
cet-15064	135	39	intestinal	intestinal	ADJ
cet-15064	135	40	microflora	microflora	NOUN
cet-15064	135	41	of	of	ADP
cet-15064	135	42	growing	grow	VERB
cet-15064	135	43	-	-	PUNCT
cet-15064	135	44	finishing	finish	VERB
cet-15064	135	45	pigs	pig	NOUN
cet-15064	135	46	.	.	PUNCT
cet-15064	136	1	animal	animal	NOUN
cet-15064	136	2	nutrition	nutrition	NOUN
cet-15064	136	3	,	,	PUNCT
cet-15064	136	4	5	5	NUM
cet-15064	136	5	,	,	PUNCT
cet-15064	136	6	366	366	NUM
cet-15064	136	7	-	-	SYM
cet-15064	136	8	372	372	NUM
cet-15064	136	9	,	,	PUNCT
cet-15064	136	10	doi	doi	NOUN
cet-15064	136	11	:	:	PUNCT
cet-15064	136	12	10.1016	10.1016	NUM
cet-15064	136	13	/	/	SYM
cet-15064	136	14	j.aninu.2019.06.003	j.aninu.2019.06.003	NOUN
cet-15064	136	15	.	.	PUNCT
cet-15064	137	1	halas	halas	PROPN
cet-15064	137	2	v.	v.	PROPN
cet-15064	137	3	,	,	PUNCT
cet-15064	137	4	nochta	nochta	PROPN
cet-15064	137	5	i.	i.	PROPN
cet-15064	137	6	,	,	PUNCT
cet-15064	137	7	2012	2012	NUM
cet-15064	137	8	,	,	PUNCT
cet-15064	137	9	mannan	mannan	NOUN
cet-15064	137	10	oligosaccharides	oligosaccharide	NOUN
cet-15064	137	11	in	in	ADP
cet-15064	137	12	nursery	nursery	NOUN
cet-15064	137	13	pig	pig	NOUN
cet-15064	137	14	nutrition	nutrition	NOUN
cet-15064	137	15	and	and	CCONJ
cet-15064	137	16	their	their	PRON
cet-15064	137	17	potential	potential	ADJ
cet-15064	137	18	mode	mode	NOUN
cet-15064	137	19	of	of	ADP
cet-15064	137	20	action	action	NOUN
cet-15064	137	21	.	.	PUNCT
cet-15064	138	1	animals	animal	NOUN
cet-15064	138	2	,	,	PUNCT
cet-15064	138	3	2(2	2(2	NUM
cet-15064	138	4	)	)	PUNCT
cet-15064	138	5	,	,	PUNCT
cet-15064	138	6	261	261	NUM
cet-15064	138	7	-	-	SYM
cet-15064	138	8	274	274	NUM
cet-15064	138	9	.	.	PUNCT
cet-15064	139	1	doi	doi	NOUN
cet-15064	139	2	:	:	PUNCT
cet-15064	139	3	10.3390	10.3390	NUM
cet-15064	139	4	/	/	SYM
cet-15064	139	5	ani2020261	ani2020261	NOUN
cet-15064	139	6	.	.	PUNCT
cet-15064	140	1	953	953	NUM
cet-15064	140	2	heinritz	heinritz	PROPN
cet-15064	140	3	s.n	s.n	PROPN
cet-15064	140	4	.	.	PROPN
cet-15064	140	5	,	,	PUNCT
cet-15064	140	6	weiss	weiss	PROPN
cet-15064	140	7	e.	e.	PROPN
cet-15064	140	8	,	,	PUNCT
cet-15064	140	9	eklund	eklund	PROPN
cet-15064	140	10	m.	m.	PROPN
cet-15064	140	11	,	,	PUNCT
cet-15064	140	12	aumiller	aumiller	PROPN
cet-15064	140	13	t.	t.	PROPN
cet-15064	140	14	,	,	PUNCT
cet-15064	140	15	louis	louis	PROPN
cet-15064	140	16	s.	s.	PROPN
cet-15064	140	17	,	,	PUNCT
cet-15064	140	18	rings	ring	NOUN
cet-15064	140	19	a.	a.	PROPN
cet-15064	140	20	,	,	PUNCT
cet-15064	140	21	messner	messner	PROPN
cet-15064	140	22	s.	s.	PROPN
cet-15064	140	23	,	,	PUNCT
cet-15064	140	24	camarinha	camarinha	NOUN
cet-15064	140	25	-	-	PUNCT
cet-15064	140	26	silva	silva	NOUN
cet-15064	140	27	a.	a.	NOUN
cet-15064	140	28	,	,	PUNCT
cet-15064	140	29	seifert	seifert	PROPN
cet-15064	140	30	j.	j.	PROPN
cet-15064	140	31	,	,	PUNCT
cet-15064	140	32	bischoff	bischoff	PROPN
cet-15064	140	33	c.	c.	PROPN
cet-15064	140	34	,	,	PUNCT
cet-15064	140	35	mosenthin	mosenthin	PROPN
cet-15064	140	36	r.	r.	PROPN
cet-15064	140	37	,	,	PUNCT
cet-15064	140	38	2016	2016	NUM
cet-15064	140	39	,	,	PUNCT
cet-15064	140	40	intestinal	intestinal	ADJ
cet-15064	140	41	microbiota	microbiota	NOUN
cet-15064	140	42	and	and	CCONJ
cet-15064	140	43	microbial	microbial	ADJ
cet-15064	140	44	metabolites	metabolite	NOUN
cet-15064	140	45	are	be	AUX
cet-15064	140	46	changed	change	VERB
cet-15064	140	47	in	in	ADP
cet-15064	140	48	a	a	DET
cet-15064	140	49	pig	pig	NOUN
cet-15064	140	50	model	model	NOUN
cet-15064	140	51	fed	feed	VERB
cet-15064	140	52	a	a	DET
cet-15064	140	53	high	high	ADJ
cet-15064	140	54	-	-	PUNCT
cet-15064	140	55	fat	fat	ADJ
cet-15064	140	56	/	/	SYM
cet-15064	140	57	low	low	ADJ
cet-15064	140	58	-	-	PUNCT
cet-15064	140	59	fiber	fiber	NOUN
cet-15064	140	60	or	or	CCONJ
cet-15064	140	61	a	a	DET
cet-15064	140	62	low	low	ADJ
cet-15064	140	63	-	-	PUNCT
cet-15064	140	64	fat	fat	ADJ
cet-15064	140	65	/	/	SYM
cet-15064	140	66	high	high	ADJ
cet-15064	140	67	-	-	PUNCT
cet-15064	140	68	fiber	fiber	NOUN
cet-15064	140	69	diet	diet	NOUN
cet-15064	140	70	.	.	PUNCT
cet-15064	141	1	plos	plos	PROPN
cet-15064	141	2	one	one	NUM
cet-15064	141	3	,	,	PUNCT
cet-15064	141	4	11	11	NUM
cet-15064	141	5	,	,	PUNCT
cet-15064	141	6	e0154329	e0154329	PROPN
cet-15064	141	7	,	,	PUNCT
cet-15064	141	8	doi	doi	NOUN
cet-15064	141	9	:	:	PUNCT
cet-15064	141	10	10.1371	10.1371	NUM
cet-15064	141	11	/	/	SYM
cet-15064	141	12	journal.pone.0154329	journal.pone.0154329	PROPN
cet-15064	141	13	.	.	PUNCT
cet-15064	142	1	jang	jang	PROPN
cet-15064	142	2	y.d	y.d	PROPN
cet-15064	142	3	.	.	PROPN
cet-15064	142	4	,	,	PUNCT
cet-15064	142	5	kang	kang	PROPN
cet-15064	142	6	k.w	k.w	PROPN
cet-15064	142	7	.	.	PROPN
cet-15064	142	8	,	,	PUNCT
cet-15064	142	9	piao	piao	NOUN
cet-15064	142	10	l.g	l.g	PROPN
cet-15064	142	11	.	.	PROPN
cet-15064	142	12	,	,	PUNCT
cet-15064	142	13	jeong	jeong	PROPN
cet-15064	142	14	t.s	t.s	PROPN
cet-15064	142	15	.	.	PROPN
cet-15064	142	16	,	,	PUNCT
cet-15064	142	17	auclair	auclair	PROPN
cet-15064	142	18	e.	e.	PROPN
cet-15064	142	19	,	,	PUNCT
cet-15064	142	20	jonvel	jonvel	PROPN
cet-15064	142	21	s.	s.	PROPN
cet-15064	142	22	,	,	PUNCT
cet-15064	142	23	d’inca	d’inca	PROPN
cet-15064	142	24	r.	r.	PROPN
cet-15064	142	25	,	,	PUNCT
cet-15064	142	26	kim	kim	PROPN
cet-15064	142	27	y.y	y.y	PROPN
cet-15064	142	28	.	.	PROPN
cet-15064	142	29	,	,	PUNCT
cet-15064	142	30	2013	2013	NUM
cet-15064	142	31	,	,	PUNCT
cet-15064	142	32	effects	effect	NOUN
cet-15064	142	33	of	of	ADP
cet-15064	142	34	live	live	ADJ
cet-15064	142	35	yeast	yeast	NOUN
cet-15064	142	36	supplementation	supplementation	NOUN
cet-15064	142	37	to	to	ADP
cet-15064	142	38	gestation	gestation	NOUN
cet-15064	142	39	and	and	CCONJ
cet-15064	142	40	lactation	lactation	NOUN
cet-15064	142	41	diets	diet	NOUN
cet-15064	142	42	on	on	ADP
cet-15064	142	43	reproductive	reproductive	ADJ
cet-15064	142	44	performance	performance	NOUN
cet-15064	142	45	,	,	PUNCT
cet-15064	142	46	immunological	immunological	ADJ
cet-15064	142	47	parameters	parameter	NOUN
cet-15064	142	48	and	and	CCONJ
cet-15064	142	49	milk	milk	NOUN
cet-15064	142	50	composition	composition	NOUN
cet-15064	142	51	in	in	ADP
cet-15064	142	52	sows	sow	NOUN
cet-15064	142	53	,	,	PUNCT
cet-15064	142	54	livestock	livestock	NOUN
cet-15064	142	55	science	science	NOUN
cet-15064	142	56	,	,	PUNCT
cet-15064	142	57	152	152	NUM
cet-15064	142	58	,	,	PUNCT
cet-15064	142	59	167	167	NUM
cet-15064	142	60	-	-	SYM
cet-15064	142	61	173	173	NUM
cet-15064	142	62	.	.	PUNCT
cet-15064	143	1	doi	doi	NOUN
cet-15064	143	2	:	:	PUNCT
cet-15064	143	3	10.1016	10.1016	NUM
cet-15064	143	4	/	/	SYM
cet-15064	143	5	j.livsci.2012.12.022	j.livsci.2012.12.022	PROPN
cet-15064	143	6	.	.	PUNCT
cet-15064	144	1	jang	jang	PROPN
cet-15064	144	2	y.d	y.d	PROPN
cet-15064	144	3	.	.	PROPN
cet-15064	144	4	,	,	PUNCT
cet-15064	144	5	kang	kang	PROPN
cet-15064	144	6	k.w	k.w	PROPN
cet-15064	144	7	.	.	PROPN
cet-15064	144	8	,	,	PUNCT
cet-15064	144	9	piao	piao	NOUN
cet-15064	144	10	l.g	l.g	PROPN
cet-15064	144	11	.	.	PROPN
cet-15064	144	12	,	,	PUNCT
cet-15064	144	13	jeong	jeong	PROPN
cet-15064	144	14	t.s	t.s	PROPN
cet-15064	144	15	.	.	PROPN
cet-15064	144	16	,	,	PUNCT
cet-15064	144	17	auclair	auclair	PROPN
cet-15064	144	18	e.	e.	PROPN
cet-15064	144	19	,	,	PUNCT
cet-15064	144	20	jonvel	jonvel	PROPN
cet-15064	144	21	s.	s.	PROPN
cet-15064	144	22	,	,	PUNCT
cet-15064	144	23	d’inca	d’inca	PROPN
cet-15064	144	24	r.	r.	PROPN
cet-15064	144	25	,	,	PUNCT
cet-15064	144	26	kim	kim	PROPN
cet-15064	144	27	y.y	y.y	PROPN
cet-15064	144	28	.	.	PROPN
cet-15064	144	29	,	,	PUNCT
cet-15064	144	30	2013	2013	NUM
cet-15064	144	31	,	,	PUNCT
cet-15064	144	32	effects	effect	NOUN
cet-15064	144	33	of	of	ADP
cet-15064	144	34	live	live	ADJ
cet-15064	144	35	yeast	yeast	NOUN
cet-15064	144	36	supplementation	supplementation	NOUN
cet-15064	144	37	to	to	ADP
cet-15064	144	38	gestation	gestation	NOUN
cet-15064	144	39	and	and	CCONJ
cet-15064	144	40	lactation	lactation	NOUN
cet-15064	144	41	diets	diet	NOUN
cet-15064	144	42	on	on	ADP
cet-15064	144	43	reproductive	reproductive	ADJ
cet-15064	144	44	performance	performance	NOUN
cet-15064	144	45	,	,	PUNCT
cet-15064	144	46	immunological	immunological	ADJ
cet-15064	144	47	parameters	parameter	NOUN
cet-15064	144	48	and	and	CCONJ
cet-15064	144	49	milk	milk	NOUN
cet-15064	144	50	composition	composition	NOUN
cet-15064	144	51	in	in	ADP
cet-15064	144	52	sows	sow	NOUN
cet-15064	144	53	.	.	PUNCT
cet-15064	145	1	livestock	livestock	NOUN
cet-15064	145	2	science	science	NOUN
cet-15064	145	3	,	,	PUNCT
cet-15064	145	4	152	152	NUM
cet-15064	145	5	,	,	PUNCT
cet-15064	145	6	167	167	NUM
cet-15064	145	7	-	-	SYM
cet-15064	145	8	173	173	NUM
cet-15064	145	9	,	,	PUNCT
cet-15064	145	10	doi	doi	NOUN
cet-15064	145	11	:	:	PUNCT
cet-15064	145	12	10.1016	10.1016	NUM
cet-15064	145	13	/	/	SYM
cet-15064	145	14	j.livsci.2012.12.022	j.livsci.2012.12.022	PROPN
cet-15064	145	15	.	.	PUNCT
cet-15064	146	1	kango	kango	PROPN
cet-15064	146	2	n.	n.	PROPN
cet-15064	146	3	,	,	PUNCT
cet-15064	146	4	jana	jana	PROPN
cet-15064	146	5	u.k	u.k	PROPN
cet-15064	146	6	.	.	PROPN
cet-15064	146	7	,	,	PUNCT
cet-15064	146	8	choukade	choukade	PROPN
cet-15064	146	9	r.	r.	PROPN
cet-15064	146	10	,	,	PUNCT
cet-15064	146	11	nath	nath	PROPN
cet-15064	146	12	s.	s.	PROPN
cet-15064	146	13	,	,	PUNCT
cet-15064	146	14	2022	2022	NUM
cet-15064	146	15	,	,	PUNCT
cet-15064	146	16	advances	advance	NOUN
cet-15064	146	17	in	in	ADP
cet-15064	146	18	prebiotic	prebiotic	ADJ
cet-15064	146	19	mannooligosaccharides	mannooligosaccharide	NOUN
cet-15064	146	20	.	.	PUNCT
cet-15064	147	1	current	current	ADJ
cet-15064	147	2	opinion	opinion	NOUN
cet-15064	147	3	in	in	ADP
cet-15064	147	4	food	food	NOUN
cet-15064	147	5	science	science	NOUN
cet-15064	147	6	,	,	PUNCT
cet-15064	147	7	47	47	NUM
cet-15064	147	8	,	,	PUNCT
cet-15064	147	9	100883	100883	NUM
cet-15064	147	10	,	,	PUNCT
cet-15064	147	11	doi	doi	NOUN
cet-15064	147	12	:	:	PUNCT
cet-15064	147	13	10.1016	10.1016	NUM
cet-15064	147	14	/	/	SYM
cet-15064	147	15	j.cofs.2022.100883	j.cofs.2022.100883	PROPN
cet-15064	147	16	.	.	PUNCT
cet-15064	148	1	kiarie	kiarie	PROPN
cet-15064	148	2	e.	e.	PROPN
cet-15064	148	3	,	,	PUNCT
cet-15064	148	4	romero	romero	PROPN
cet-15064	148	5	l.f	l.f	PROPN
cet-15064	148	6	.	.	PROPN
cet-15064	148	7	,	,	PUNCT
cet-15064	148	8	nyachoti	nyachoti	PROPN
cet-15064	148	9	c.m	c.m	PROPN
cet-15064	148	10	.	.	PROPN
cet-15064	148	11	,	,	PUNCT
cet-15064	148	12	2013	2013	NUM
cet-15064	148	13	,	,	PUNCT
cet-15064	148	14	the	the	DET
cet-15064	148	15	role	role	NOUN
cet-15064	148	16	of	of	ADP
cet-15064	148	17	added	add	VERB
cet-15064	148	18	feed	feed	NOUN
cet-15064	148	19	enzymes	enzyme	NOUN
cet-15064	148	20	in	in	ADP
cet-15064	148	21	promoting	promote	VERB
cet-15064	148	22	gut	gut	NOUN
cet-15064	148	23	health	health	NOUN
cet-15064	148	24	in	in	ADP
cet-15064	148	25	swine	swine	NOUN
cet-15064	148	26	and	and	CCONJ
cet-15064	148	27	poultry	poultry	NOUN
cet-15064	148	28	.	.	PUNCT
cet-15064	149	1	nutrition	nutrition	NOUN
cet-15064	149	2	research	research	NOUN
cet-15064	149	3	reviews	review	NOUN
cet-15064	149	4	,	,	PUNCT
cet-15064	149	5	26	26	NUM
cet-15064	149	6	,	,	PUNCT
cet-15064	149	7	71	71	NUM
cet-15064	149	8	-	-	SYM
cet-15064	149	9	88	88	NUM
cet-15064	149	10	.	.	PUNCT
cet-15064	150	1	doi	doi	NOUN
cet-15064	150	2	:	:	PUNCT
cet-15064	150	3	10.1017	10.1017	NUM
cet-15064	150	4	/	/	SYM
cet-15064	150	5	s0954422413000048	s0954422413000048	NOUN
cet-15064	150	6	.	.	PUNCT
cet-15064	151	1	kiros	kiros	PROPN
cet-15064	151	2	t.g	t.g	PROPN
cet-15064	151	3	.	.	PROPN
cet-15064	151	4	,	,	PUNCT
cet-15064	151	5	luise	luise	PROPN
cet-15064	151	6	d.	d.	PROPN
cet-15064	151	7	,	,	PUNCT
cet-15064	151	8	derakhshani	derakhshani	PROPN
cet-15064	151	9	h.	h.	PROPN
cet-15064	151	10	,	,	PUNCT
cet-15064	151	11	petri	petri	PROPN
cet-15064	151	12	r.	r.	PROPN
cet-15064	151	13	,	,	PUNCT
cet-15064	151	14	trevisi	trevisi	ADJ
cet-15064	151	15	p.	p.	NOUN
cet-15064	151	16	,	,	PUNCT
cet-15064	151	17	d’inca	d’inca	PROPN
cet-15064	151	18	r.	r.	PROPN
cet-15064	151	19	,	,	PUNCT
cet-15064	151	20	auclair	auclair	PROPN
cet-15064	151	21	e.	e.	PROPN
cet-15064	151	22	,	,	PUNCT
cet-15064	151	23	van	van	PROPN
cet-15064	151	24	kessel	kessel	PROPN
cet-15064	151	25	a.g	a.g	PROPN
cet-15064	151	26	.	.	PROPN
cet-15064	151	27	,	,	PUNCT
cet-15064	151	28	2019	2019	NUM
cet-15064	151	29	,	,	PUNCT
cet-15064	151	30	effect	effect	NOUN
cet-15064	151	31	of	of	ADP
cet-15064	151	32	live	live	ADJ
cet-15064	151	33	yeast	yeast	NOUN
cet-15064	151	34	saccharomyces	saccharomyce	NOUN
cet-15064	151	35	cerevisiae	cerevisiae	NOUN
cet-15064	151	36	supplementation	supplementation	NOUN
cet-15064	151	37	on	on	ADP
cet-15064	151	38	the	the	DET
cet-15064	151	39	performance	performance	NOUN
cet-15064	151	40	and	and	CCONJ
cet-15064	151	41	cecum	cecum	NOUN
cet-15064	151	42	microbial	microbial	ADJ
cet-15064	151	43	profile	profile	NOUN
cet-15064	151	44	of	of	ADP
cet-15064	151	45	suckling	suckling	NOUN
cet-15064	151	46	piglets	piglet	NOUN
cet-15064	151	47	.	.	PUNCT
cet-15064	152	1	plos	plos	PROPN
cet-15064	152	2	one	one	NUM
cet-15064	152	3	,	,	PUNCT
cet-15064	152	4	14(7	14(7	NUM
cet-15064	152	5	)	)	PUNCT
cet-15064	152	6	,	,	PUNCT
cet-15064	152	7	e0219557	e0219557	NOUN
cet-15064	152	8	,	,	PUNCT
cet-15064	152	9	doi	doi	NOUN
cet-15064	152	10	:	:	PUNCT
cet-15064	152	11	10.1371	10.1371	NUM
cet-15064	152	12	/	/	SYM
cet-15064	152	13	journal.pone.0219557	journal.pone.0219557	PROPN
cet-15064	152	14	.	.	PUNCT
cet-15064	153	1	kornegay	kornegay	PROPN
cet-15064	153	2	e.t	e.t	PROPN
cet-15064	153	3	.	.	PROPN
cet-15064	153	4	,	,	PUNCT
cet-15064	153	5	rhein	rhein	NOUN
cet-15064	153	6	-	-	PUNCT
cet-15064	153	7	welker	welker	PROPN
cet-15064	153	8	d.	d.	PROPN
cet-15064	153	9	,	,	PUNCT
cet-15064	153	10	lindemann	lindemann	PROPN
cet-15064	153	11	m.d	m.d	PROPN
cet-15064	153	12	.	.	PROPN
cet-15064	153	13	,	,	PUNCT
cet-15064	153	14	wood	wood	NOUN
cet-15064	153	15	c.m	c.m	PROPN
cet-15064	153	16	.	.	PROPN
cet-15064	153	17	,	,	PUNCT
cet-15064	153	18	1995	1995	NUM
cet-15064	153	19	,	,	PUNCT
cet-15064	153	20	performance	performance	NOUN
cet-15064	153	21	and	and	CCONJ
cet-15064	153	22	nutrient	nutrient	ADJ
cet-15064	153	23	digestibility	digestibility	NOUN
cet-15064	153	24	in	in	ADP
cet-15064	153	25	weanling	weanle	VERB
cet-15064	153	26	pigs	pig	NOUN
cet-15064	153	27	as	as	SCONJ
cet-15064	153	28	influenced	influence	VERB
cet-15064	153	29	by	by	ADP
cet-15064	153	30	yeast	yeast	NOUN
cet-15064	153	31	culture	culture	NOUN
cet-15064	153	32	additions	addition	NOUN
cet-15064	153	33	to	to	ADP
cet-15064	153	34	starter	starter	ADJ
cet-15064	153	35	diets	diet	NOUN
cet-15064	153	36	containing	contain	VERB
cet-15064	153	37	dried	dry	VERB
cet-15064	153	38	whey	whey	NOUN
cet-15064	153	39	or	or	CCONJ
cet-15064	153	40	one	one	NUM
cet-15064	153	41	of	of	ADP
cet-15064	153	42	two	two	NUM
cet-15064	153	43	fiber	fiber	NOUN
cet-15064	153	44	source	source	NOUN
cet-15064	153	45	.	.	PUNCT
cet-15064	154	1	journal	journal	PROPN
cet-15064	154	2	of	of	ADP
cet-15064	154	3	animal	animal	NOUN
cet-15064	154	4	science	science	NOUN
cet-15064	154	5	,	,	PUNCT
cet-15064	154	6	73	73	NUM
cet-15064	154	7	,	,	PUNCT
cet-15064	154	8	1381	1381	NUM
cet-15064	154	9	-	-	SYM
cet-15064	154	10	1389	1389	NUM
cet-15064	154	11	,	,	PUNCT
cet-15064	154	12	doi	doi	NOUN
cet-15064	154	13	:	:	PUNCT
cet-15064	154	14	10.2527/1995.7351381x	10.2527/1995.7351381x	NUM
cet-15064	154	15	.	.	PUNCT
cet-15064	155	1	law	law	PROPN
cet-15064	155	2	k.	k.	PROPN
cet-15064	155	3	,	,	PUNCT
cet-15064	155	4	johnston	johnston	PROPN
cet-15064	155	5	l.j	l.j	PROPN
cet-15064	155	6	.	.	PROPN
cet-15064	155	7	,	,	PUNCT
cet-15064	155	8	urriola	urriola	PROPN
cet-15064	155	9	p.e	p.e	PROPN
cet-15064	155	10	.	.	PROPN
cet-15064	155	11	,	,	PUNCT
cet-15064	155	12	gomez	gomez	PROPN
cet-15064	155	13	a.	a.	PROPN
cet-15064	155	14	,	,	PUNCT
cet-15064	155	15	2024	2024	NUM
cet-15064	155	16	,	,	PUNCT
cet-15064	155	17	maternal	maternal	ADJ
cet-15064	155	18	programming	programming	NOUN
cet-15064	155	19	of	of	ADP
cet-15064	155	20	nursery	nursery	NOUN
cet-15064	155	21	pig	pig	NOUN
cet-15064	155	22	performance	performance	NOUN
cet-15064	155	23	and	and	CCONJ
cet-15064	155	24	gut	gut	NOUN
cet-15064	155	25	microbiome	microbiome	NOUN
cet-15064	155	26	through	through	ADP
cet-15064	155	27	live	live	ADJ
cet-15064	155	28	yeast	yeast	NOUN
cet-15064	155	29	supplementation	supplementation	NOUN
cet-15064	155	30	.	.	PUNCT
cet-15064	156	1	animals	animal	NOUN
cet-15064	156	2	,	,	PUNCT
cet-15064	156	3	14(6	14(6	NOUN
cet-15064	156	4	)	)	PUNCT
cet-15064	156	5	,	,	PUNCT
cet-15064	156	6	910	910	NUM
cet-15064	156	7	,	,	PUNCT
cet-15064	156	8	doi	doi	NOUN
cet-15064	156	9	:	:	PUNCT
cet-15064	156	10	10.3390	10.3390	NUM
cet-15064	156	11	/	/	SYM
cet-15064	156	12	ani14060910	ani14060910	NOUN
cet-15064	156	13	.	.	PUNCT
cet-15064	157	1	li	li	PROPN
cet-15064	158	1	y.s	y.s	PROPN
cet-15064	158	2	.	.	PROPN
cet-15064	158	3	,	,	PUNCT
cet-15064	158	4	san	san	PROPN
cet-15064	158	5	andres	andres	PROPN
cet-15064	158	6	j.v	j.v	PROPN
cet-15064	158	7	.	.	PROPN
cet-15064	158	8	,	,	PUNCT
cet-15064	158	9	trenhaile	trenhaile	ADJ
cet-15064	158	10	-	-	PUNCT
cet-15064	158	11	grannemann	grannemann	NOUN
cet-15064	158	12	m.d	m.d	PROPN
cet-15064	158	13	.	.	PROPN
cet-15064	158	14	,	,	PUNCT
cet-15064	158	15	van	van	PROPN
cet-15064	158	16	sambeek	sambeek	PROPN
cet-15064	158	17	d.m	d.m	PROPN
cet-15064	158	18	.	.	PROPN
cet-15064	158	19	,	,	PUNCT
cet-15064	158	20	moore	moore	PROPN
cet-15064	158	21	k.c	k.c	PROPN
cet-15064	158	22	.	.	PROPN
cet-15064	158	23	,	,	PUNCT
cet-15064	158	24	winkel	winkel	PROPN
cet-15064	158	25	s.m	s.m	PROPN
cet-15064	158	26	.	.	PROPN
cet-15064	158	27	,	,	PUNCT
cet-15064	158	28	fernando	fernando	PROPN
cet-15064	158	29	s.c	s.c	PROPN
cet-15064	158	30	.	.	PROPN
cet-15064	158	31	,	,	PUNCT
cet-15064	158	32	burkey	burkey	PROPN
cet-15064	159	1	t.e	t.e	PROPN
cet-15064	159	2	.	.	PROPN
cet-15064	159	3	,	,	PUNCT
cet-15064	159	4	miller	miller	PROPN
cet-15064	159	5	p.s	p.s	PROPN
cet-15064	159	6	.	.	PROPN
cet-15064	159	7	,	,	PUNCT
cet-15064	159	8	2021	2021	NUM
cet-15064	159	9	,	,	PUNCT
cet-15064	159	10	effects	effect	NOUN
cet-15064	159	11	of	of	ADP
cet-15064	159	12	mannan	mannan	NOUN
cet-15064	159	13	oligosaccharides	oligosaccharide	NOUN
cet-15064	159	14	and	and	CCONJ
cet-15064	159	15	lactobacillus	lactobacillus	PROPN
cet-15064	159	16	mucosae	mucosa	NOUN
cet-15064	159	17	on	on	ADP
cet-15064	159	18	growth	growth	NOUN
cet-15064	159	19	performance	performance	NOUN
cet-15064	159	20	,	,	PUNCT
cet-15064	159	21	immune	immune	ADJ
cet-15064	159	22	response	response	NOUN
cet-15064	159	23	,	,	PUNCT
cet-15064	159	24	and	and	CCONJ
cet-15064	159	25	gut	gut	NOUN
cet-15064	159	26	health	health	NOUN
cet-15064	159	27	of	of	ADP
cet-15064	159	28	weanling	weanle	VERB
cet-15064	159	29	pigs	pig	NOUN
cet-15064	159	30	challenged	challenge	VERB
cet-15064	159	31	with	with	ADP
cet-15064	159	32	escherichia	escherichia	NOUN
cet-15064	159	33	coli	coli	NOUN
cet-15064	159	34	lipopolysaccharides	lipopolysaccharide	NOUN
cet-15064	159	35	.	.	PUNCT
cet-15064	160	1	journal	journal	NOUN
cet-15064	160	2	of	of	ADP
cet-15064	160	3	animal	animal	NOUN
cet-15064	160	4	science	science	NOUN
cet-15064	160	5	,	,	PUNCT
cet-15064	160	6	99(12	99(12	NUM
cet-15064	160	7	)	)	PUNCT
cet-15064	160	8	,	,	PUNCT
cet-15064	160	9	skab286	skab286	PROPN
cet-15064	160	10	,	,	PUNCT
cet-15064	160	11	doi	doi	NOUN
cet-15064	160	12	:	:	PUNCT
cet-15064	160	13	10.1093	10.1093	NUM
cet-15064	160	14	/	/	SYM
cet-15064	160	15	jas	jas	PROPN
cet-15064	160	16	/	/	SYM
cet-15064	160	17	skab286	skab286	PROPN
cet-15064	160	18	.	.	PUNCT
cet-15064	161	1	mariella	mariella	PROPN
cet-15064	161	2	f.	f.	PROPN
cet-15064	161	3	,	,	PUNCT
cet-15064	161	4	agazzi	agazzi	PROPN
cet-15064	161	5	a.	a.	PROPN
cet-15064	161	6	,	,	PUNCT
cet-15064	161	7	invernizzi	invernizzi	VERB
cet-15064	161	8	g.	g.	PROPN
cet-15064	161	9	,	,	PUNCT
cet-15064	161	10	savoini	savoini	PROPN
cet-15064	161	11	g.	g.	PROPN
cet-15064	161	12	,	,	PUNCT
cet-15064	161	13	chevaux	chevaux	PROPN
cet-15064	161	14	e.	e.	PROPN
cet-15064	161	15	,	,	PUNCT
cet-15064	161	16	le	le	PROPN
cet-15064	161	17	treut	treut	PROPN
cet-15064	161	18	y.	y.	PROPN
cet-15064	161	19	,	,	PUNCT
cet-15064	161	20	2009	2009	NUM
cet-15064	161	21	,	,	PUNCT
cet-15064	161	22	inclusion	inclusion	NOUN
cet-15064	161	23	of	of	ADP
cet-15064	161	24	live	live	ADJ
cet-15064	161	25	yeast	yeast	NOUN
cet-15064	161	26	s.	s.	PROPN
cet-15064	161	27	cerevisiae	cerevisiae	PROPN
cet-15064	161	28	boulardii	boulardii	PROPN
cet-15064	161	29	(	(	PUNCT
cet-15064	161	30	cncm	cncm	NOUN
cet-15064	161	31	i-1079	i-1079	PROPN
cet-15064	161	32	)	)	PUNCT
cet-15064	161	33	in	in	ADP
cet-15064	161	34	sow	sow	NOUN
cet-15064	161	35	lactation	lactation	NOUN
cet-15064	161	36	diets	diet	NOUN
cet-15064	161	37	:	:	PUNCT
cet-15064	161	38	effects	effect	NOUN
cet-15064	161	39	on	on	ADP
cet-15064	161	40	sows	sow	NOUN
cet-15064	161	41	and	and	CCONJ
cet-15064	161	42	nest	nest	NOUN
cet-15064	161	43	performances	performance	NOUN
cet-15064	161	44	.	.	PUNCT
cet-15064	162	1	journal	journal	NOUN
cet-15064	162	2	of	of	ADP
cet-15064	162	3	animal	animal	NOUN
cet-15064	162	4	science	science	NOUN
cet-15064	162	5	,	,	PUNCT
cet-15064	162	6	87(suppl	87(suppl	NUM
cet-15064	162	7	.	.	PUNCT
cet-15064	163	1	2	2	NUM
cet-15064	163	2	)	)	PUNCT
cet-15064	163	3	,	,	PUNCT
cet-15064	163	4	491	491	NUM
cet-15064	163	5	.	.	PUNCT
cet-15064	164	1	méndez‐palacios	méndez‐palacio	NOUN
cet-15064	164	2	n.	n.	PROPN
cet-15064	164	3	,	,	PUNCT
cet-15064	164	4	méndez‐mendoza	méndez‐mendoza	PROPN
cet-15064	164	5	m.	m.	NOUN
cet-15064	164	6	,	,	PUNCT
cet-15064	164	7	vázquez‐flores	vázquez‐flore	NOUN
cet-15064	164	8	f.	f.	PROPN
cet-15064	164	9	,	,	PUNCT
cet-15064	164	10	castro‐colombres	castro‐colombre	VERB
cet-15064	164	11	j.g	j.g	PROPN
cet-15064	164	12	.	.	PROPN
cet-15064	164	13	,	,	PUNCT
cet-15064	164	14	ramírez‐bribiesca	ramírez‐bribiesca	PROPN
cet-15064	165	1	j.e	j.e	PROPN
cet-15064	165	2	.	.	PROPN
cet-15064	165	3	,	,	PUNCT
cet-15064	165	4	2018	2018	NUM
cet-15064	165	5	,	,	PUNCT
cet-15064	165	6	productive	productive	ADJ
cet-15064	165	7	and	and	CCONJ
cet-15064	165	8	economic	economic	ADJ
cet-15064	165	9	parameters	parameter	NOUN
cet-15064	165	10	of	of	ADP
cet-15064	165	11	pigs	pig	NOUN
cet-15064	165	12	supplemented	supplement	VERB
cet-15064	165	13	from	from	ADP
cet-15064	165	14	weaning	wean	VERB
cet-15064	165	15	to	to	ADP
cet-15064	165	16	finishing	finish	VERB
cet-15064	165	17	with	with	ADP
cet-15064	165	18	prebiotic	prebiotic	ADJ
cet-15064	165	19	and	and	CCONJ
cet-15064	165	20	probiotic	probiotic	ADJ
cet-15064	165	21	feed	feed	NOUN
cet-15064	165	22	additives	additive	NOUN
cet-15064	165	23	.	.	PUNCT
cet-15064	166	1	animal	animal	NOUN
cet-15064	166	2	science	science	NOUN
cet-15064	166	3	journal	journal	PROPN
cet-15064	166	4	,	,	PUNCT
cet-15064	166	5	89(7	89(7	PROPN
cet-15064	166	6	)	)	PUNCT
cet-15064	166	7	,	,	PUNCT
cet-15064	166	8	994	994	NUM
cet-15064	166	9	-	-	SYM
cet-15064	166	10	1001	1001	NUM
cet-15064	166	11	,	,	PUNCT
cet-15064	166	12	doi	doi	NOUN
cet-15064	166	13	:	:	PUNCT
cet-15064	166	14	10.1111	10.1111	NUM
cet-15064	166	15	/	/	SYM
cet-15064	166	16	asj.13008	asj.13008	PROPN
cet-15064	166	17	.	.	PUNCT
cet-15064	167	1	shen	shen	PROPN
cet-15064	167	2	y.b	y.b	PROPN
cet-15064	167	3	.	.	PROPN
cet-15064	167	4	,	,	PUNCT
cet-15064	167	5	carroll	carroll	PROPN
cet-15064	167	6	j.a	j.a	PROPN
cet-15064	167	7	.	.	PROPN
cet-15064	167	8	,	,	PUNCT
cet-15064	167	9	yoon	yoon	PROPN
cet-15064	167	10	i.	i.	PROPN
cet-15064	167	11	,	,	PUNCT
cet-15064	167	12	mateo	mateo	VERB
cet-15064	167	13	r.d	r.d	PROPN
cet-15064	167	14	.	.	PROPN
cet-15064	167	15	,	,	PUNCT
cet-15064	167	16	kim	kim	PROPN
cet-15064	167	17	s.w	s.w	PROPN
cet-15064	167	18	.	.	PROPN
cet-15064	167	19	,	,	PUNCT
cet-15064	167	20	2011	2011	NUM
cet-15064	167	21	,	,	PUNCT
cet-15064	167	22	effects	effect	NOUN
cet-15064	167	23	of	of	ADP
cet-15064	167	24	supplementing	supplement	VERB
cet-15064	167	25	saccharomyces	saccharomyce	NOUN
cet-15064	167	26	cerevisiae	cerevisiae	NOUN
cet-15064	167	27	fermentation	fermentation	NOUN
cet-15064	167	28	product	product	NOUN
cet-15064	167	29	in	in	ADP
cet-15064	167	30	sow	sow	VERB
cet-15064	167	31	diets	diet	NOUN
cet-15064	167	32	on	on	ADP
cet-15064	167	33	performance	performance	NOUN
cet-15064	167	34	of	of	ADP
cet-15064	167	35	sows	sow	NOUN
cet-15064	167	36	and	and	CCONJ
cet-15064	167	37	nursing	nursing	NOUN
cet-15064	167	38	piglets	piglet	NOUN
cet-15064	167	39	,	,	PUNCT
cet-15064	167	40	journal	journal	NOUN
cet-15064	167	41	of	of	ADP
cet-15064	167	42	animal	animal	NOUN
cet-15064	167	43	science	science	NOUN
cet-15064	167	44	,	,	PUNCT
cet-15064	167	45	89(8	89(8	PROPN
cet-15064	167	46	)	)	PUNCT
cet-15064	167	47	,	,	PUNCT
cet-15064	167	48	2462	2462	NUM
cet-15064	167	49	-	-	SYM
cet-15064	167	50	2471	2471	NUM
cet-15064	167	51	.	.	PUNCT
cet-15064	168	1	doi	doi	NOUN
cet-15064	168	2	:	:	PUNCT
cet-15064	168	3	10.2527	10.2527	NUM
cet-15064	168	4	/	/	SYM
cet-15064	168	5	jas.2010	jas.2010	NUM
cet-15064	168	6	-	-	PUNCT
cet-15064	168	7	3642	3642	NUM
cet-15064	168	8	.	.	PUNCT
cet-15064	169	1	sohail	sohail	PROPN
cet-15064	169	2	m.u	m.u	PROPN
cet-15064	169	3	.	.	PROPN
cet-15064	169	4	,	,	PUNCT
cet-15064	169	5	ijaz	ijaz	PROPN
cet-15064	169	6	a.	a.	PROPN
cet-15064	169	7	,	,	PUNCT
cet-15064	169	8	younus	younus	PROPN
cet-15064	169	9	m.	m.	PROPN
cet-15064	169	10	,	,	PUNCT
cet-15064	169	11	shabbir	shabbir	PROPN
cet-15064	169	12	m.z	m.z	PROPN
cet-15064	169	13	.	.	PROPN
cet-15064	169	14	,	,	PUNCT
cet-15064	169	15	kamran	kamran	PROPN
cet-15064	169	16	z.	z.	PROPN
cet-15064	169	17	,	,	PUNCT
cet-15064	169	18	ahmad	ahmad	PROPN
cet-15064	169	19	s.	s.	PROPN
cet-15064	169	20	,	,	PUNCT
cet-15064	169	21	anwar	anwar	PROPN
cet-15064	169	22	h.	h.	PROPN
cet-15064	169	23	,	,	PUNCT
cet-15064	169	24	yousaf	yousaf	PROPN
cet-15064	169	25	m.s	m.s	PROPN
cet-15064	169	26	.	.	PROPN
cet-15064	169	27	,	,	PUNCT
cet-15064	169	28	ashraf	ashraf	PROPN
cet-15064	169	29	k.	k.	PROPN
cet-15064	169	30	,	,	PUNCT
cet-15064	169	31	shahzad	shahzad	PROPN
cet-15064	170	1	a.h	a.h	PROPN
cet-15064	170	2	.	.	PROPN
cet-15064	170	3	,	,	PUNCT
cet-15064	170	4	rehman	rehman	PROPN
cet-15064	170	5	h.	h.	PROPN
cet-15064	170	6	,	,	PUNCT
cet-15064	170	7	2013	2013	NUM
cet-15064	170	8	,	,	PUNCT
cet-15064	170	9	effect	effect	NOUN
cet-15064	170	10	of	of	ADP
cet-15064	170	11	supplementation	supplementation	NOUN
cet-15064	170	12	of	of	ADP
cet-15064	170	13	mannan	mannan	NOUN
cet-15064	170	14	oligosaccharide	oligosaccharide	NOUN
cet-15064	170	15	and	and	CCONJ
cet-15064	170	16	probiotic	probiotic	ADJ
cet-15064	170	17	on	on	ADP
cet-15064	170	18	growth	growth	NOUN
cet-15064	170	19	performance	performance	NOUN
cet-15064	170	20	,	,	PUNCT
cet-15064	170	21	relative	relative	ADJ
cet-15064	170	22	weights	weight	NOUN
cet-15064	170	23	of	of	ADP
cet-15064	170	24	viscera	viscera	NOUN
cet-15064	170	25	,	,	PUNCT
cet-15064	170	26	and	and	CCONJ
cet-15064	170	27	population	population	NOUN
cet-15064	170	28	of	of	ADP
cet-15064	170	29	selected	select	VERB
cet-15064	170	30	intestinal	intestinal	ADJ
cet-15064	170	31	bacteria	bacteria	NOUN
cet-15064	170	32	in	in	ADP
cet-15064	170	33	cyclic	cyclic	ADJ
cet-15064	170	34	heat	heat	NOUN
cet-15064	170	35	-	-	PUNCT
cet-15064	170	36	stressed	stress	VERB
cet-15064	170	37	broilers	broiler	NOUN
cet-15064	170	38	.	.	PUNCT
cet-15064	171	1	journal	journal	PROPN
cet-15064	171	2	of	of	ADP
cet-15064	171	3	applied	apply	VERB
cet-15064	171	4	poultry	poultry	NOUN
cet-15064	171	5	research	research	NOUN
cet-15064	171	6	,	,	PUNCT
cet-15064	171	7	22(3	22(3	NUM
cet-15064	171	8	)	)	PUNCT
cet-15064	171	9	,	,	PUNCT
cet-15064	171	10	485	485	NUM
cet-15064	171	11	-	-	SYM
cet-15064	171	12	491	491	NUM
cet-15064	171	13	,	,	PUNCT
cet-15064	171	14	doi	doi	NOUN
cet-15064	171	15	:	:	PUNCT
cet-15064	171	16	10.3382	10.3382	NUM
cet-15064	171	17	/	/	SYM
cet-15064	171	18	japr.201200682	japr.201200682	PROPN
cet-15064	171	19	.	.	PUNCT
cet-15064	172	1	tao	tao	PROPN
cet-15064	172	2	z.	z.	PROPN
cet-15064	172	3	,	,	PUNCT
cet-15064	172	4	yuan	yuan	PROPN
cet-15064	172	5	h.	h.	PROPN
cet-15064	172	6	,	,	PUNCT
cet-15064	172	7	liu	liu	PROPN
cet-15064	172	8	m.	m.	PROPN
cet-15064	172	9	,	,	PUNCT
cet-15064	172	10	liu	liu	PROPN
cet-15064	172	11	q.	q.	PROPN
cet-15064	172	12	,	,	PUNCT
cet-15064	172	13	zhang	zhang	PROPN
cet-15064	172	14	s.	s.	PROPN
cet-15064	172	15	,	,	PUNCT
cet-15064	172	16	liu	liu	PROPN
cet-15064	172	17	h.	h.	PROPN
cet-15064	172	18	,	,	PUNCT
cet-15064	172	19	jiang	jiang	PROPN
cet-15064	172	20	y.	y.	PROPN
cet-15064	172	21	,	,	PUNCT
cet-15064	172	22	huang	huang	PROPN
cet-15064	172	23	d.	d.	PROPN
cet-15064	172	24	,	,	PUNCT
cet-15064	172	25	wang	wang	PROPN
cet-15064	172	26	t.	t.	PROPN
cet-15064	172	27	,	,	PUNCT
cet-15064	172	28	2023	2023	NUM
cet-15064	172	29	,	,	PUNCT
cet-15064	172	30	yeast	yeast	NOUN
cet-15064	172	31	extract	extract	NOUN
cet-15064	172	32	:	:	PUNCT
cet-15064	172	33	characteristics	characteristic	NOUN
cet-15064	172	34	,	,	PUNCT
cet-15064	172	35	production	production	NOUN
cet-15064	172	36	,	,	PUNCT
cet-15064	172	37	applications	application	NOUN
cet-15064	172	38	and	and	CCONJ
cet-15064	172	39	future	future	ADJ
cet-15064	172	40	perspectives	perspective	NOUN
cet-15064	172	41	.	.	PUNCT
cet-15064	173	1	journal	journal	NOUN
cet-15064	173	2	of	of	ADP
cet-15064	173	3	microbiology	microbiology	NOUN
cet-15064	173	4	and	and	CCONJ
cet-15064	173	5	biotechnology	biotechnology	NOUN
cet-15064	173	6	,	,	PUNCT
cet-15064	173	7	33(2	33(2	NUM
cet-15064	173	8	)	)	PUNCT
cet-15064	173	9	,	,	PUNCT
cet-15064	173	10	151	151	NUM
cet-15064	173	11	-	-	SYM
cet-15064	173	12	166	166	NUM
cet-15064	173	13	,	,	PUNCT
cet-15064	173	14	doi	doi	NOUN
cet-15064	173	15	:	:	PUNCT
cet-15064	173	16	10.4014	10.4014	NUM
cet-15064	173	17	/	/	SYM
cet-15064	173	18	jmb.2207.07057	jmb.2207.07057	NOUN
cet-15064	173	19	.	.	PUNCT
cet-15064	174	1	waititu	waititu	PROPN
cet-15064	174	2	s.m	s.m	PROPN
cet-15064	174	3	.	.	PROPN
cet-15064	174	4	,	,	PUNCT
cet-15064	174	5	heo	heo	PROPN
cet-15064	174	6	j.m	j.m	PROPN
cet-15064	174	7	.	.	PROPN
cet-15064	174	8	,	,	PUNCT
cet-15064	174	9	patterson	patterson	PROPN
cet-15064	174	10	r.	r.	PROPN
cet-15064	174	11	,	,	PUNCT
cet-15064	174	12	nyachoti	nyachoti	PROPN
cet-15064	174	13	c.m	c.m	PROPN
cet-15064	174	14	.	.	PROPN
cet-15064	174	15	,	,	PUNCT
cet-15064	174	16	2016	2016	NUM
cet-15064	174	17	,	,	PUNCT
cet-15064	174	18	dietary	dietary	ADJ
cet-15064	174	19	yeast	yeast	NOUN
cet-15064	174	20	-	-	PUNCT
cet-15064	174	21	based	base	VERB
cet-15064	174	22	nucleotides	nucleotide	NOUN
cet-15064	174	23	as	as	ADP
cet-15064	174	24	an	an	DET
cet-15064	174	25	alternative	alternative	NOUN
cet-15064	174	26	to	to	ADP
cet-15064	174	27	in	in	ADP
cet-15064	174	28	-	-	PUNCT
cet-15064	174	29	feed	feed	NOUN
cet-15064	174	30	antibiotics	antibiotic	NOUN
cet-15064	174	31	in	in	ADP
cet-15064	174	32	promoting	promote	VERB
cet-15064	174	33	growth	growth	NOUN
cet-15064	174	34	performance	performance	NOUN
cet-15064	174	35	and	and	CCONJ
cet-15064	174	36	nutrient	nutrient	ADJ
cet-15064	174	37	utilization	utilization	NOUN
cet-15064	174	38	in	in	ADP
cet-15064	174	39	weaned	wean	VERB
cet-15064	174	40	pigs	pig	NOUN
cet-15064	174	41	.	.	PUNCT
cet-15064	175	1	canadian	canadian	ADJ
cet-15064	175	2	journal	journal	NOUN
cet-15064	175	3	of	of	ADP
cet-15064	175	4	animal	animal	NOUN
cet-15064	175	5	science	science	NOUN
cet-15064	175	6	,	,	PUNCT
cet-15064	175	7	96	96	NUM
cet-15064	175	8	,	,	PUNCT
cet-15064	175	9	289	289	NUM
cet-15064	175	10	-	-	SYM
cet-15064	175	11	293	293	NUM
cet-15064	175	12	,	,	PUNCT
cet-15064	175	13	doi	doi	NOUN
cet-15064	175	14	:	:	PUNCT
cet-15064	175	15	10.1139	10.1139	NUM
cet-15064	175	16	/	/	SYM
cet-15064	175	17	cjas-2015	cjas-2015	NOUN
cet-15064	175	18	-	-	PUNCT
cet-15064	175	19	0067	0067	NUM
cet-15064	175	20	.	.	PUNCT
cet-15064	176	1	whelan	whelan	PROPN
cet-15064	176	2	j.a	j.a	PROPN
cet-15064	176	3	.	.	PROPN
cet-15064	176	4	,	,	PUNCT
cet-15064	176	5	russell	russell	PROPN
cet-15064	176	6	n.b	n.b	PROPN
cet-15064	176	7	.	.	PROPN
cet-15064	176	8	,	,	PUNCT
cet-15064	176	9	whelan	whelan	PROPN
cet-15064	176	10	m.a	m.a	PROPN
cet-15064	176	11	.	.	PROPN
cet-15064	176	12	,	,	PUNCT
cet-15064	176	13	2003	2003	NUM
cet-15064	176	14	,	,	PUNCT
cet-15064	176	15	a	a	DET
cet-15064	176	16	method	method	NOUN
cet-15064	176	17	for	for	ADP
cet-15064	176	18	the	the	DET
cet-15064	176	19	absolute	absolute	ADJ
cet-15064	176	20	quantification	quantification	NOUN
cet-15064	176	21	of	of	ADP
cet-15064	176	22	cdna	cdna	PROPN
cet-15064	176	23	using	use	VERB
cet-15064	176	24	realtime	realtime	ADJ
cet-15064	176	25	pcr	pcr	NOUN
cet-15064	176	26	.	.	PUNCT
cet-15064	177	1	journal	journal	NOUN
cet-15064	177	2	of	of	ADP
cet-15064	177	3	immunological	immunological	ADJ
cet-15064	177	4	methods	method	NOUN
cet-15064	177	5	,	,	PUNCT
cet-15064	177	6	278	278	NUM
cet-15064	177	7	,	,	PUNCT
cet-15064	177	8	261	261	NUM
cet-15064	177	9	-	-	SYM
cet-15064	177	10	269	269	NUM
cet-15064	177	11	,	,	PUNCT
cet-15064	177	12	doi	doi	NOUN
cet-15064	177	13	:	:	PUNCT
cet-15064	177	14	10.1016	10.1016	NUM
cet-15064	177	15	/	/	SYM
cet-15064	177	16	s0022	s0022	NOUN
cet-15064	177	17	-	-	PUNCT
cet-15064	177	18	1759(03)00223	1759(03)00223	NUM
cet-15064	177	19	-	-	PUNCT
cet-15064	177	20	0	0	NUM
cet-15064	177	21	.	.	PUNCT
cet-15064	178	1	zhao	zhao	PROPN
cet-15064	178	2	y.	y.	PROPN
cet-15064	178	3	,	,	PUNCT
cet-15064	178	4	wang	wang	PROPN
cet-15064	178	5	q.	q.	PROPN
cet-15064	178	6	,	,	PUNCT
cet-15064	178	7	zhou	zhou	PROPN
cet-15064	178	8	p.	p.	PROPN
cet-15064	178	9	,	,	PUNCT
cet-15064	178	10	li	li	PROPN
cet-15064	178	11	z.	z.	PROPN
cet-15064	178	12	,	,	PUNCT
cet-15064	178	13	zhong	zhong	PROPN
cet-15064	178	14	w.	w.	PROPN
cet-15064	178	15	,	,	PUNCT
cet-15064	178	16	zhuo	zhuo	PROPN
cet-15064	178	17	y.	y.	PROPN
cet-15064	178	18	,	,	PUNCT
cet-15064	178	19	che	che	PROPN
cet-15064	178	20	l.	l.	PROPN
cet-15064	178	21	,	,	PUNCT
cet-15064	178	22	xu	xu	PROPN
cet-15064	178	23	s.	s.	PROPN
cet-15064	178	24	,	,	PUNCT
cet-15064	178	25	fang	fang	PROPN
cet-15064	178	26	z.	z.	PROPN
cet-15064	178	27	,	,	PUNCT
cet-15064	178	28	jiang	jiang	PROPN
cet-15064	178	29	x.	x.	PROPN
cet-15064	178	30	,	,	PUNCT
cet-15064	178	31	lin	lin	PROPN
cet-15064	178	32	y.	y.	PROPN
cet-15064	178	33	,	,	PUNCT
cet-15064	178	34	feng	feng	PROPN
cet-15064	178	35	b.	b.	PROPN
cet-15064	178	36	,	,	PUNCT
cet-15064	178	37	wu	wu	PROPN
cet-15064	178	38	d.	d.	PROPN
cet-15064	178	39	,	,	PUNCT
cet-15064	178	40	2022	2022	NUM
cet-15064	178	41	,	,	PUNCT
cet-15064	178	42	effects	effect	NOUN
cet-15064	178	43	of	of	ADP
cet-15064	178	44	yeast	yeast	NOUN
cet-15064	178	45	culture	culture	NOUN
cet-15064	178	46	supplementation	supplementation	NOUN
cet-15064	178	47	from	from	ADP
cet-15064	178	48	late	late	ADJ
cet-15064	178	49	gestation	gestation	NOUN
cet-15064	178	50	to	to	ADP
cet-15064	178	51	weaning	wean	VERB
cet-15064	178	52	on	on	ADP
cet-15064	178	53	performance	performance	NOUN
cet-15064	178	54	of	of	ADP
cet-15064	178	55	lactating	lactate	VERB
cet-15064	178	56	sows	sow	NOUN
cet-15064	178	57	and	and	CCONJ
cet-15064	178	58	growth	growth	NOUN
cet-15064	178	59	of	of	ADP
cet-15064	178	60	nursing	nursing	NOUN
cet-15064	178	61	piglets	piglet	NOUN
cet-15064	178	62	.	.	PUNCT
cet-15064	179	1	animal	animal	NOUN
cet-15064	179	2	,	,	PUNCT
cet-15064	179	3	16(5	16(5	NUM
cet-15064	179	4	)	)	PUNCT
cet-15064	179	5	,	,	PUNCT
cet-15064	179	6	100526	100526	NUM
cet-15064	179	7	,	,	PUNCT
cet-15064	179	8	doi	doi	NOUN
cet-15064	179	9	:	:	PUNCT
cet-15064	179	10	10.1016	10.1016	NUM
cet-15064	179	11	/	/	SYM
cet-15064	179	12	j.animal.2022.100526	j.animal.2022.100526	PROPN
cet-15064	179	13	.	.	PUNCT
cet-15064	180	1	zhou	zhou	PROPN
cet-15064	180	2	h.	h.	PROPN
cet-15064	180	3	,	,	PUNCT
cet-15064	180	4	yu	yu	PROPN
cet-15064	180	5	b.	b.	PROPN
cet-15064	180	6	,	,	PUNCT
cet-15064	180	7	he	he	PRON
cet-15064	180	8	j.	j.	PROPN
cet-15064	180	9	,	,	PUNCT
cet-15064	180	10	mao	mao	PROPN
cet-15064	180	11	x.	x.	PROPN
cet-15064	180	12	,	,	PUNCT
cet-15064	180	13	zheng	zheng	PROPN
cet-15064	180	14	p.	p.	PROPN
cet-15064	180	15	,	,	PUNCT
cet-15064	180	16	yu	yu	PROPN
cet-15064	180	17	j.	j.	PROPN
cet-15064	180	18	,	,	PUNCT
cet-15064	180	19	luo	luo	PROPN
cet-15064	180	20	j.	j.	PROPN
cet-15064	180	21	,	,	PUNCT
cet-15064	180	22	luo	luo	PROPN
cet-15064	180	23	y.	y.	PROPN
cet-15064	180	24	,	,	PUNCT
cet-15064	180	25	yan	yan	PROPN
cet-15064	180	26	h.	h.	PROPN
cet-15064	180	27	,	,	PUNCT
cet-15064	180	28	chen	chen	PROPN
cet-15064	180	29	d.	d.	PROPN
cet-15064	180	30	,	,	PUNCT
cet-15064	180	31	2020	2020	NUM
cet-15064	180	32	,	,	PUNCT
cet-15064	180	33	the	the	DET
cet-15064	180	34	optimal	optimal	ADJ
cet-15064	180	35	combination	combination	NOUN
cet-15064	180	36	of	of	ADP
cet-15064	180	37	dietary	dietary	ADJ
cet-15064	180	38	starch	starch	NOUN
cet-15064	180	39	,	,	PUNCT
cet-15064	180	40	non	non	ADJ
cet-15064	180	41	-	-	ADJ
cet-15064	180	42	starch	starch	ADJ
cet-15064	180	43	polysaccharides	polysaccharide	NOUN
cet-15064	180	44	,	,	PUNCT
cet-15064	180	45	and	and	CCONJ
cet-15064	180	46	mannan	mannan	NOUN
cet-15064	180	47	-	-	PUNCT
cet-15064	180	48	oligosaccharide	oligosaccharide	NOUN
cet-15064	180	49	increases	increase	VERB
cet-15064	180	50	the	the	DET
cet-15064	180	51	growth	growth	NOUN
cet-15064	180	52	performance	performance	NOUN
cet-15064	180	53	and	and	CCONJ
cet-15064	180	54	improves	improve	VERB
cet-15064	180	55	butyrate	butyrate	NOUN
cet-15064	180	56	-	-	PUNCT
cet-15064	180	57	producing	produce	VERB
cet-15064	180	58	bacteria	bacteria	NOUN
cet-15064	180	59	of	of	ADP
cet-15064	180	60	weaned	wean	VERB
cet-15064	180	61	pigs	pig	NOUN
cet-15064	180	62	.	.	PUNCT
cet-15064	181	1	animals	animal	NOUN
cet-15064	181	2	,	,	PUNCT
cet-15064	181	3	10(10	10(10	NUM
cet-15064	181	4	)	)	PUNCT
cet-15064	181	5	,	,	PUNCT
cet-15064	181	6	1745	1745	NUM
cet-15064	181	7	,	,	PUNCT
cet-15064	181	8	doi	doi	NOUN
cet-15064	181	9	:	:	PUNCT
cet-15064	181	10	10.3390	10.3390	NUM
cet-15064	181	11	/	/	SYM
cet-15064	181	12	ani10101745	ani10101745	ADJ
cet-15064	181	13	.	.	PUNCT
cet-15064	182	1	954	954	NUM
cet-15064	182	2	cos24_0234.pdf	cos24_0234.pdf	NOUN
cet-15064	182	3	effects	effect	NOUN
cet-15064	182	4	of	of	ADP
cet-15064	182	5	a	a	DET
cet-15064	182	6	probiotic	probiotic	ADJ
cet-15064	182	7	supplement	supplement	NOUN
cet-15064	182	8	on	on	ADP
cet-15064	182	9	the	the	DET
cet-15064	182	10	quantity	quantity	NOUN
cet-15064	182	11	of	of	ADP
cet-15064	182	12	some	some	DET
cet-15064	182	13	bacterial	bacterial	ADJ
cet-15064	182	14	communities	community	NOUN
cet-15064	182	15	in	in	ADP
cet-15064	182	16	fecal	fecal	ADJ
cet-15064	182	17	samples	sample	NOUN
cet-15064	182	18	of	of	ADP
cet-15064	182	19	lactating	lactate	VERB
cet-15064	182	20	sows	sow	NOUN