TX_1~ABS:AT/ADD:TX_2~ABS:AT 36 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 ReseaRch aRticle Antibiotic Susceptibility Pattern, Molecular Characterization of Virulence Genes among Pseudomonas aeruginosa Isolated from Burn Patients Mustafa D. Younis1*, Omar F. Bahjat1, Sirwan A. Rashid2 1Department of General Biology, College of Science, Cihan University-Erbil, Kurdistan Region, Iraq, 2Department of Biomedical Sciences, College of Science, Cihan University-Erbil, Kurdistan Region, Iraq. ABSTRACT In this research, a total of 150 samples were obtained from burn and wound patients admitted to the West Erbil Emergence Hospital during period from September 2020 to January 2021. Through cultural, morphological features, biochemical testing, and Vitek 2 Compact Systems, 40 isolates of P. aeruginosa have been identified. P. aeruginosa produced various pigments, including blue/green and yellow/green. The isolates of P. aeruginosa were subjected to 14 different antibiotics. Imipenem was the most effective antimicrobial agents against all P. aeruginosa isolates, and most of isolates showed high resistance degree to ampicillin 100%, chloramphenicol 100%, amoxicillin-clavulanic acid 100%, cefotaxime 100%, and penicillin 100% while for aztreonam 32.5%, meropenem 42.5%, tobramycin 45%, gentamycin 45%, amikacin 45%, ciprofloxacin 62.5%, ceftazidime 67.5%, and tetracycline 80%. All Pseudomonas aeruginosa isolates were screened using multiplex polymerase chain reaction (PCR) to check for the presence of Pvda, LasB, Protease, exoA, exoT, exoU, and plch on its genomic DNA. The findings have shown that Pvda was 55%, LasB 75%, protease 65%, exoA 60%, exoT 75%, exoU 60%, and plch 55% of isolates harbored these genes as a virulence genes. Keywords: Pseudomonas aeruginosa, burn patients, antibiotic resistance, virulence genes, and multiplex PCR INTRODUCTION Pseudomonas aeruginosa is a Gram-negative aerobic non-spore rod with remarkable capacity to survive and persist under many environmental circumstances.[1] In both hospitals and communities, P. aeruginosa is a common, opportunistic human pathogen.[2] Burning and wound infections are a challenge because they slow down the healing process, promote cicatrix, and can lead to bacteremia, sepsis (or organ failure) syndrome, however, organ from several systems cannot regulate homeostasis on its own and need immediate treatment.[3] The most severe pathogenic burn injuries are bacteria and fungi. Multiple species biofilms are formed on burning injuries in 48–72 h of the wound injury.[4] Organisms are acquired by the patient’s own skin, digestive, and respiratory flora, as well as association with contaminated environments and health-care providers.[5] The human skin is considered the principal protective layer of the body’s tissues and may contribute to damage and destruction of bacteria transmitted to the internal blood tissue, which is rich in proteins.[6] Isolation and laboratory diagnosis is used to diagnose P. aeruginosa infection. This aerobic bacterium is needed and thrives in the majority of laboratory culture media. On pseudomonas agar (selective media) and cetrimide agar, bacteria can be isolated, warmth, no spores, flagella morphology, positive, exercise catalase, lactose intolerance (positive oxidase reaction), fruit odor (grape flavor), and ability to grow at 42°C are used to detect bacteria.[7] P. aeruginosa is a ubiquitous microorganism that can quickly develop resistance to various antibiotics of broad spectrum.[2] Moreover, in recent years, resistance to a broad range of antibiotics by these microorganisms has made it difficult to treat infections caused and leads to higher death rates.[8] The development of soluble pyocyanin pigment, a water-soluble blue-green compound formed in large amounts, is one of P. aeruginosa characteristics. Pyocyanin acts as an antibiotic against a variety of bacteria and fungi.[9] P. aeruginosa has a variety of virulence factors in Corresponding Author: Mustafa D. Younis, Department of General Biology, College of Science, Cihan University- Erbil, Kurdistan Region, Iraq. E-mail: mustafa.thanoon@cihanuniversity.edu.iq Received: May 5, 2021 Accepted: June 15, 2021 Published: June 30, 2021 DOI: 10.24086/cuesj.v5n1y2021.pp36-41 Copyright © 2021 Mustafa D. Y. Ali, Omar F. Bahjat, Sirwan A. Rashid. This is an open-access article distributed under the Creative Commons Attribution License (CC BY-NC-ND 4.0). Cihan University-Erbil Scientific Journal (CUESJ) Younis, et al.: Antibiotic Susceptibility, Molecular Characterization of Virulence Genes among P. aeruginosa 37 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 host defenses and infection. These factors include hemolysin production, pyocyanin production, gelatinase, and biofilm formation, which act by enhancing the damage of tissue and helping bacteria to avoid the action of antibiotics.[10] Another virulence factor such as exotoxin A, exoenzyme S, elastase, and sialidase, which are powerfully controlled by cell-to-cell signals. Exotoxin1A (ETA) plays1a major role in the pathogenesis1of infections caused by1this organism as the primary virulence factor provided by most P. aeruginosa isolates. Such exotoxins may contribute to leukopenia, acidosis, and blood circulation, necrosis of the liver, pulmonary edema, bleeding, and kidney tubular necrosis[11] so that the aim of this study is screening of antimicrobial sensitivity profile of P. aeruginosa and detection of certain virulence genes through PCR technique. MATERIALS AND METHODS Patients and Samples Collection One hundred and fifty samples were collected 1from patients admitted to West Erbil Emergency Hospital, during the period from September 2020 to January 2021. Following collection, each sample was cultured on different culture media and P. aeruginosa was identified by cultural characters, biochemical methods, and Vitek 2 Compact System. Antibiotic Sensitivity Pattern The isolates were examined for antibiotic sensitivity in accordance with the National Committee for Clinica1 Laboratory Guidelines 1and the Antimicrobial Susceptibility Testing Protocols by disc diffusion method on Mueller- Hinton agar.[12] Adjustment of the bacterial inoculates to the Clinical and Laboratory Standards Institute of 0.5 McFarland standards.[12] A sterile cotton swab was used to disperse the sample inoculum to Mueller-Hinton agar. The antimicrobial products tested, including: Imipenem (IPM), ceftazidime (CAZ), ampicillin (AM), aztreonam (ATM), chloramphenicol (C), amoxicillin-clavulanic acid (AMC), amikacin (AK), cefotaxime (CTX), gentamycin (CN), ciprofloxacin (CIP), tetracycline (TE), penicillin (P), meropenem (MEM), and tobramycin (TOB) were placed aseptically and incubated overnight. The zones of inhibition were interpreted and measured.[12] Color Production by P. aeruginosa Isolates All isolates had been inoculated on cetrimide agar, incubated for 18–24 h by streaking method at 37°C, and then, the pigment production was examined.[13] DNA Extraction Protocol Two hundred microliters of overnight growth were centrifuged for 30 s at 13,000 rpm, after that 1.5 ml was separated from supernatant in 2 ml microcentrifugal tube. The pellet has been dissolved in 200 μl TL buffer, then removed and fully mixed with 20 ul proteinase K solutions to achieve a uniform suspension. The sample has been incubated in the water bath at 56°C for 10 min until the cells have been completely lysed. Two hundred microliters of GB buffer applied to the specimens, then by vortexing mixed thickly for approximately 15 s up to a uniform mixture and then incubated for 10 min at 56°C. Then, 200 μl of absolute ethanol is added and pipetted or vortexes. The lysate transferred carefully without wetting the rim into the spin column reservoir for 1 min at 10,000 rpm, and the column 1centrifuged the collection tube then discharged containing the flow-through solution a new 2 ml tube has been placed with the GeNet Bio genomic DNA purification column. Five hundred microliters of GW1 buffer were added0 then centrifuged for 1 min at 10,000 rpm, the flow-through discarded and the purification column placed back into the collection tube, 500 μl of GW2 was added to the GeNet Bio genomic DNA purification column, centrifuged for 1 min at 10,000 rpm. Then after centrifuging the tube, remove the flow-through and reassemble the spin column with its collection tube, again, centrifuge at 12,000 rpm for 12 min to extract ethanol completely and check that the droplet is not attached at the bottom of the tube. Then, 1.5 ml of the spin column moved to a new tube to do the elution. Two hundred microliters of the elution buffer were added to the center of the GeNet Bio genomic DNA purification kit column membrane. The genomic DNA elution kept a side at room temperature for 1 min and centrifuged for 1 min at 10,0000 rpm. Then, the purified DNA was immediately removed and stored at −20°C for further applications (PrimePrep Genomic DNA extraction kit, GeNet Bio, Korea) Protocol of PCR Technique PCR conducted for all genes was performed in a 25 μl of reaction volume. Master Mix tube contains l2.5 μl, forward and reverse primers with 1 μl for each primer, DNA template 1 μl, and finally sterile (D. W) deionized water 9.5 μl.[14] Detection of Pvda, LasB, Protease, exoA, exoT, exoU, and plch Virulence Genes in P. aeruginosa Multiplex PCR also was used for the detection of Pvda, LasB, Protease, exoA, exoT, exoU and plch genes in Pseudomonas aeruginosa genome as shown in Table 1: Protocol of Agarose Gel Electrophoresis To perform gel electrophoresis, a method of Judelson[15] was followed with minor modifications. Adding 1.2 g agarose to 100 ml 1x TBE buffer was used as an agarose gel, the mixture melted for 1–2 min in the microwave oven or until it was apparent and fully dissolved. Left to cool at 50°C, 10 μl of primary safe dye was carefully added to the agarose solution then thoroughly mixed with a gentle stirring. The tray borders are sealed with the tape and inserted into the tray the right comb. Then, the agarose gradually poured in the tray and any bubbles were removed with a disposable tip, then kept away to the side at room temperature, the agarose solidified (15–30 min). The tape was removed from the tray and then the tray was placed in the electrophoresis tank. The tank was filled with more TBE buffers so that the ge1 is completely under buffer. The PCR product loaded into the wells (15 μl) with loading buffer. Depending on the size of the PCR sample, the first well (5 ul) (1 kb or 100 bp) was used. The gel runs for 50 min at 100 V. Finally, the UV transilluminator and gel photographed. Younis, et al.: Antibiotic Susceptibility, Molecular Characterization of Virulence Genes among P. aeruginosa 38 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 Table l: Primers sequences, target genes, amplicon sizes and cycling conditions for conventional and multiplex PCR[14] Target gene Primer sequences Amplified segment (bp) Initial denaturation denaturation Annealing Extension Final extension Pvda F-GACTCAGGCAAC TGCAAC l28l 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R-TTCAGGTGCTGG TACAGG LasB F-GGAATGAACGAAGCG TTCTC 300 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R-GGTCCAGTAGTAGCG GTTGG Protease F- ATTTCGCCGACTCC CTGTA 752 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R-GAATAGACGCCGCTG AAATC exoA F-AACCAGCTCAGCCAC ATGTC 207 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R- GCTGGCCCATTCGCTCCAGCGCT exoT F-AATCGCCGTCCAACTGCA TGCG l52 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 minR-TGTTCGCCGAGGTAC TGCTC exoU F-CCGTTGTGGTGCCGT TGAAG l34 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R-CCAGATGTTCACCGA CTCGC plch F-GAAGCCATGGGCTAC TTCAA 307 96°C 5 min 96°C 1 min 55°C 1 min 72°C 2 min 72°C 10 min R-AGAGTGACGAGGAGC GGTAG RESULTS AND DISCUSSION Collection of P. aeruginosa Isolates A series of confirming tests were conducted to verify that out of 150 bacterial isolates only 40 belong to species of P. aeruginosa. These smear preparations of bacterial cells were Gram-negative rods, non-spore forming, arranged in single or short chains. The colonies were thin, rough, or smooth on solid media with flat edges and high appearance, but some were mucoid in aspect. These isolates were found non-lactose ferment creating negative pale yellow colonies on MacConkey agar and on blood agar shows β-hemolytic colonies. Because of the production of the soluble pyocyanin and pyoverdin which are water soluble, the colonies were surrounded by bluish color on nutrient agar. The colonies pigments in selective media (Cetrimide agar) are more apparent yellow-green pigment. Biochemical tests confirmed P. aeruginosa burn contamination confines, biochemical testing was negative for indole, TSI, positive for oxidase and catalase, positive for citrate, positive for urease (slowly hydrolysis the urea), all P. aeruginosa 40 isolates had been also confirmed using Vitek 2’s Compact System bacterium ID method. Antimicrobial Sensitivity Screening Test for P. aeruginosa Forty P. aeruginosa isolates were screened for their resistance to (14) widely used antibiotics including amikacin, amoxicillin-clavulanic acid, ampicillin, cefotaxime, penicillin, ciprofloxacin, chloramphenicol, gentamycin, imipenem, meropenem, tetracycline, ceftazidime, aztreonam, and tobramycin. The results of antibiotic resistance pattern for the bacteria1 isolates understudy are shown in Table 2. Olayinka[16] reported that 20% of P. aeruginosa isolated from clinical samples obtained from the surgical units of Ahmadu Bello University teaching hospital in Nigeria were sensitive for imipenem which disagreed with our results, imipenem and meronem are ß- lactam antibiotics that they have broad-spectrum activity against both Gram-negative and Gram-positive bacteria.[17] All bacterial isolates displayed a low resistance and the majority of Enterobacteriaceae isolates Younis, et al.: Antibiotic Susceptibility, Molecular Characterization of Virulence Genes among P. aeruginosa 39 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 showed no resistance. It might be because they are reserve medicines and they are used as the last option in our hospital environment for multidrug-resistant bacteria which agreed with our result. Ebrahimpour[18] reported that all P. aeruginosa isolated from burn patients were sensitive to IMP. This may be attributed to the inability of P. aeruginosa to produce enzymes that degrade or inactivate the antibiotic. Therefore, IMP is the most effective drug for the treatment of infections caused by P. aeruginosa. In the case of Fattma,[19] 98% of P. aeruginosa isolates resist amikacin, 96% for cefotaxime, 80% for rifampicin, 70% for ampicillin, 70% for augment, and 60% for doxycycline, which is near with our performance. Resistance by P. aeruginosa can both be due to inducible of beta-lactamases, which can make cephalosporin of broad-spectrum inactive and to beta-lactamases mediated by plasmid, which can lead to several penicillin’s and ancient cephalosporin becoming resistant.[20] Mechanisms of aminoglycoside resistance in clinical isolates are usually controlled by enzymatic antibiotic inactivation since nine different enzymes that are capable of catalyzing phosphorylation, acetylation, and aminoglycosides coradenylylation in bacteria had been described.[21] The development of P. aeruginosa multiresistant and its antibiotics mechanisms involves decreased cell permeability, efflux pumps, and changes in target enzymes and antibiotics inactivation.[22] Detection of Pvda, LasB, Protease, exoA, exoT, exoU, and plch Virulence Genes by Multiplex PCR in P. aeruginosa Multiplex polymerase chain reaction (PCR) is a variant of PCR in which two or more loci are simultaneously amplified in the same reaction. Since its first description in l988,[23] this method has been successfully applied in many areas of DNA testing, including analyses of deletions,[24] mutations[25] and polymorphisms,[26] or quantitative assays[27] and reverse transcription PCR.[28] The role of various reagents in PCR has been discussed,[29] and protocols for multiplex PCR have been described by a number of groups. However, few studies[30] have presented an extensive discussion of some of the factors (e.g. primer concentration and cycling profile) that can influence the results of multiplex analysis. In the present study, 40 isolates of P. aeruginosa were tested for the detection of some virulence genes using polymerase chain reaction (multiplex). In our study, detection of virulence genes results showed that Pvda was 55%, LasB 75%, Protease 65%, exoA 60%, exoT 75%, exoU 60%, and plch 55% among tested strains, as shown in Figures 1 and 2. Other findings also showed that in 100 strains of P. aeruginosa, all the virulence genes studied were detected. Therefore, the virulence genes studied might carry strains isolated from bovine meat, fresh fish, and smoked fish. The analysis revealed that the LasB genes are most frequently detected (89.0%) and exoS genes (84.0%) which could be explained by the fact that P. aeruginosa, secrets elastase (LasB).[31] The previous studies showed a high LasB prevalence in P. aeruginosa despite its isolated origin.[32] Another studies obtained by Holban[33] also agreed with our results, who reported that lasB 55%, Protease 75%, exoT 95%, and plch 55%, these virulence genes were detected using multiplex PCR, in P. aeruginosa which isolated from wound secretions. Mitov[34] also agrees with our results, who found that 100% for lasB and 71% for plcH, the protease and lasB both genes encode for proteases activity, and they are found in the majority of tested strains, lending support to the phenotypic data demonstrating that isolates obtained from burned patients can undergo hemolysis. ExoS, exoT, and exoA related exotoxins were distributed differently amongst the genes codified for the Type III Secretion System (T3SS). The most positive for T3SS exotoxins which encode genes in isolates from burn patients were also followed by tracheobronchial isolates. ExoU, codified for a major enzyme involved in pyoverdine synthesis, codifies for a highly cytotoxic exoenzyme ExoU and PVdA gene.[34] P. aeruginosa has been estimated to be involved in between 10% and 22.5% of HAI both in adults and in children,[13] leading to increased costs for health care and prolonged hospital admission, respectively.[35] The clinical results of an infection with a combination of bacteria-related factors (intrinsic and Table 2: Percentage of resistance bacterial isolates to different antibiotics Antibiotics Symbo1 Total no. of isolates No. of resistant isolates % of resistant Amikacin AK 40 18 45 Ampicillin AM 40 40 100 Amoxicillin-clavulanic acid AMC 40 40 100 Aztreonam ATM 40 13 32.5 Chloramphenicol C 40 40 100 Ceftazidime CAZ 40 27 67.5 Ciprofloxacin CIP 40 25 62.5 Gentamycin CN 40 18 45 Cefotaxime CTX 40 40 100 Imipenem IMP 40 0 0 Meropenem MEM 40 17 42.5 Penicillin P 40 40 100 Tetracycline TE 40 32 80 Tobramycin TOB 40 18 45 Younis, et al.: Antibiotic Susceptibility, Molecular Characterization of Virulence Genes among P. aeruginosa 40 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 antimicrobial resistance, prevalence and persistence in the hospital environment, and cocktail expression of a virulence) and individual differences in host susceptibility. In favorable environmental conditions, bacterial virulence is reduced and greatly increased if stressful conditions arise.[36] CONCLUSION P. aeruginosa showed resistance to most antibiotics, and imipenem was the most effective antibiotic against P. aeruginosa isolated from burn patients. Seven virulence genes were detected through the amplification of Pvda, LasB, Protease, exoA, exoT, exoU, and plch by multiplex PCR. REFERENCES 1. S. Santajit and N. J. B. Indrawattana. Mechanisms of antimicrobial resistance in ESKAPE pathogens. BioMed Research International, vol. 2016, p. 2475067, 2016. 2. K. Singh, M. Panghal, S. Kadyan and U. Chaudhary, J. P. J. Yadav. Antibacterial activity of synthesized silver nanoparticles from Tinospora cordifolia against multi drug resistant strains of Pseudomonas aeruginosa isolated from burn patients. Journal of Nanomedicine and Nanotechnology, vol. 5, no. 2, p. 1, 2014. 3. G. Héry-Arnaud, E. Nowak, J. Caillon, V. David, A. Dirou, K. Revert, M. R. Munck, I. Frachon, A. Haloun, D. Horeau-Langlard, J. Le Bihan, I. Danner-Boucher, S. Ramel, M. P. Pelletier, S. Rosec, S. Gouriou, E. Poulhazan, C. Payan, C. Férec, G. Rault, G. Le Gal and R. Le Berre. Evaluation of quantitative PCR for early diagnosis of Pseudomonas aeruginosa infection in cystic fibrosis: A prospective cohort study. Clinical Microbiology and Infection, vol. 23, no. 3, pp. 203-207, 2017. 4. S. Alkaabi. Bacterial isolates and their antibiograms of burn wound infections in burns specialist hospital in Baghdad. Baghdad Science Journal, vol. 10, no. 2, pp. 331-340, 2013. 5. M. E. Altaai, I. H. Aziz and A. A. Marhoon. Identification Pseudomonas aeruginosa by 16s rRNA gene for differentiation from other Pseudomonas species that isolated from patients and environment. Baghdad Science Journal, vol. 11, no. 2, pp. 1028- 1034, 2014. 6. M. D. Y. Ali and Z. F. A. Abdulrahman. Molecular identification, susceptibility pattern, and detection of some virulence genes in Pseudomonas aeruginosa isolated from burn patients. Plant Archives, vol. 20, no. 1, pp. 2573-2580, 2020. 7. M. Hallin, A. Deplano, S. Roisin, V. Boyart, R. De Ryck, C. Nonhoff, B. Byl, Y. Glupczynski and O. Denis. Pseudo-outbreak of extremely drug-resistant Pseudomonas aeruginosa urinary tract infections due to contamination of an automated urine analyzer. Journal of Clinical Microbiology, vol. 50, no. 3, pp. 580-582, 2012. 8. R. J. Fair and Y. Tor. Antibiotics and bacterial resistance in the 21st century. Perspectives in Medicinal Chemistry, vol. 6, p. PMC. S14459, 2014. 9. H. A. Mohammed, H. S. Yossef and F. I. Mohammad. The cytotoxicity effect of pyocyanin on human hepatocellular carcinoma cell line (HepG2). Iraqi Journal of Science, vol. 55, no. 2B, pp. 668-674, 2014. 10. N. Cevahir, M. Demir, I. Kaleli, M. Gurbuz and S. Tikvesli. Evaluation of biofilm production, gelatinase activity, and mannose-resistant hemagglutination in Acinetobacter baumannii strains. Journal of Microbiology, Immunology and Infection, vol. 41, no. 6, pp. 513-518, 2008. 11. F. G. Tafesse, C. P. Guimaraes, T. Maruyama, J. E. Carette, S. Lory, T. R. Brummelkamp and H. L. Ploegh. GPR107, a G-protein-coupled receptor essential for intoxication by Pseudomonas aeruginosa exotoxin a, localizes to the Golgi and is cleaved by furin. Journal of Biological Chemistry, vol. 289, no. 35, pp. 24005-24018, 2014. 12. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. Wayne, PA: Clinical and Laboratory Standards Institute, 2011. 13. H. Loveday, J. Wilson, K. Kerr, R. Pitchers, J. T. Walker and J. Browne. Association between healthcare water systems and Pseudomonas aeruginosa infections: A rapid systematic review. Journal of Hospital Infection, vol. 86, no. 1, pp. 7-15, 2014. 14. A. Simonetti, E. Ottaiano, M. Diana, C. Onza and M. Triassi. Epidemiology of hospital-acquired infections in an adult intensive care unit: Results of a prospective cohort study. Annali di Igiene, vol. 25, no. 4, pp. 281-289, 2013. 15. H. Judelson. Gel Electrophoresis. Protocol: Agarose Gel Electrophoresis Using Bio-Rad, 2001. 16. A. Olayinka, B. Olayinka and B. A. Onile. Antibiotic susceptibility and plasmid pattern of Pseudomonas aeruginosa from the surgical unit of a university teaching hospital in North Central Nigeria. International Journal of Medicine and Medical Sciences, vol. 1, no. 3, pp. 79-83, 2009. Figure 2: PCR amplification of plch, Pvda, and Protease virulence genes of P. aeruginosa through multiplex PCR, lanes 6 negative control, lanes 7, 8, 9, and 10 represent amplified genes with product size amplicon size (307 bp, 1281 bp, and 752 bp) of P. aeruginosa isolates, M representing the ladder 100 bp Figure 1: PCR amplification of exoT, exoU, exoA, plch, Pvda, LasB, and Protease virulence genes of P. aeruginosa through multiplex PCR, lanes (l, 2, 3, 4, and 5) represent amplified genes with product size amplicon size (152 bp, 134 bp, 207 bp, 307 bp, 1281 bp, 300 bp, and 752 bp) of P. aeruginosa isolates, M representing the ladder 100 bp Younis, et al.: Antibiotic Susceptibility, Molecular Characterization of Virulence Genes among P. aeruginosa 41 http://journals.cihanuniversity.edu.iq/index.php/cuesj CUESJ 2021, 5 (1): 36-41 17. M. L. Joly-Guillou, M. Kempf, J. D. Cavallo, M. Chomarat, L. Dubreuil, J. Maugein, C. M. Serieys and M. Roussel-Delvallez. Comparative in vitro activity of Meropenem, Imipenem and Piperacillin/tazobactam against 1071 clinical isolates using 2 different methods: A French multicentre study. BMC Infectious Diseases, vol. 10, no. 1, pp. 1-9, 2010. 18. M. Ebrahimpour, I. Nikokar, Y. Ghasemi, H. S. Ebrahim-Saraie, A. Araghian, M. Farahbakhsh and F. Ghassabi. Antibiotic resistance and frequency of Class 1 integrons among Pseudomonas aeruginosa isolates obtained from wastewaters of a burn center in Northern Iran. Annali di Igiene, vol. 30, no. 2, pp. 112-119, 2018. 19. A. Fattma, M. Ali, Z. A. S. Asaad and M. Shkofa. Isolation and identification of multi drug resistant Pseudomonas aeruginosa causing wound infection in Erbil City. International Journal of Research Studies in Science, Engineering and Technology, no. 4, 2017, pp. 30-36. 20. J. G. Collee, T. J. Mackie and J. E. McCartney. Mackie and McCartney Practical Medical Microbiology. United States: Harcourt Health Sciences, 1996. 21. I. Aibinu, T. Nwanneka and T. Odugbemi. Occurrence of ESBL and MBL in clinical isolates of Pseudomonas aeruginosa from Lagos, Nigeria. Journal of American Science, vol. 3, no. 4, pp. 81-85, 2007. 22. P. A. Lambert. Mechanisms of antibiotic resistance in Pseudomonas aeruginosa. Journal of the Royal Society of Medicine, vol. 95, no. Suppl 41, p. 22, 2002. 23. S. Verheij, J. Harteveld and T. Sijen. A protocol for direct and rapid multiplex PCR amplification on forensically relevant samples. Forensic Science International: Genetics, vol. 6, no. 2, pp. 167-175, 2012. 24. C. S. Carlson, R. O. Emerson, A. M. Sherwood, C. Desmarais, M. W. Chung, J. M. Parsons, M. S. Steen, M. A. LaMadrid- Herrmannsfeldt, D. W. Williamson, R. J. Livingston, D. Wu, B. L. Wood, M. J. Rieder and H. Robins. Using synthetic templates to design an unbiased multiplex PCR assay. Nature Communications, vol. 4, no. 1, pp. 1-9, 2013. 25. Y. Achermann, M. Vogt, M. Leunig, J. Wust and A. Trampuz. Improved diagnosis of periprosthetic joint infection by multiplex PCR of sonication fluid from removed implants. Journal of Clinical Microbiology, vol. 48, no. 4, pp. 1208-1214, 2010. 26. B. Richards, J. Skoletsky, A. P. Shuber, R. Balfour, R. C. Stern, H. L. Dorkin, R. B. Parad, D. Witt and K. W. Klinger. Multiplex PCR amplification from the CFTR gene using DNA prepared from buccal brushes/swabs. Human Molecular Genetics, vol. 2, no. 2, pp. 159-163, 1993. 27. H. J. Monstein, Å. Östholm-Balkhed, M. Nilsson, M. Nilsson, K. Dornbusch and L. J. A. Nilsson. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS, vol. 115, no. 12, pp. 1400-1408, 2007. 28. P. Qin, W. Qu, J. Xu, D. Qiao, L. Yao, F. Xue and W. Chen. A sensitive multiplex PCR protocol for simultaneous detection of chicken, duck, and pork in beef samples. Journal of Food Science and Technology, vol. 56, no. 3, pp. 1266-1274, 2019. 29. L. Poirel, T. R. Walsh, V. Cuvillier and P. Nordmann. Multiplex PCR for detection of acquired carbapenemase genes. Diagnostic Microbiology and Infectious Disease, vol. 70, no. 1, pp. 119-123, 2011. 30. W. J. Mason, J. S. Blevins, K. Beenken, N. Wibowo, N. Ojha and M. S. Smeltzer. Multiplex PCR protocol for the diagnosis of staphylococcal infection. Journal of Clinical Microbiology, vol. 39, no. 9, pp. 3332-3338, 2001. 31. M. Khattab, M. Nour and N. M. ElSheshtawy. Genetic identification of Pseudomonas aeruginosa virulence genes among different isolates. Journal of Microbial and Biochemical Technology, vol. 7, no. 5, pp. 274-277, 2015. 32. K. Streeter and M. Katouli. Pseudomonas aeruginosa: A review of their pathogenesis and prevalence in clinical settings and the environment. IEM, vol. 2, no. 1, pp. 25-32, 2016. 33. A. M. Holban, M. Chifiriuc, A. I. Cotar and C. Bleotu. Virulence markers in Pseudomonas aeruginosa isolates from hospital acquired infections occurred in patients with underlying cardiovascular disease. vol. 18, no. 6, pp. 8843-8854, 2013. 34. I. Mitov, T. Strateva and B. Markova. Prevalence of virulence genes among bulgarian nosocomial and cystic fibrosis isolates of Pseudomonas aeruginosa. The Brazilian Journal of Microbiology, vol. 41, no. 3, pp. 588-595, 2010. 35. D. Jr. Hayes, S. E. West, M. J. Rock, Z. Li, M. L. Splaingard and P. Farrell. Pseudomonas aeruginosa in children with cystic fibrosis diagnosed through newborn screening: Assessment of clinic exposures and microbial genotypes. Pediatric Pulmonology, vol. 45, no. 7, pp. 708-716, 2010. 36. M. Ledizet, T. S. Murray, S. Puttagunta, M. D. Slade, V. J. Quagliarello and B. Kazmierczak. The ability of virulence factor expression by Pseudomonas aeruginosa to predict clinical disease in hospitalized patients. PLoS One, vol. 7, no. 11, p. e49578, 2012.