id	sid	tid	token	lemma	pos
ct-11260	1	1	2012	2012	NUM
ct-11260	1	2	:	:	PUNCT
ct-11260	1	3	isolation	isolation	NOUN
ct-11260	1	4	and	and	CCONJ
ct-11260	1	5	identification	identification	NOUN
ct-11260	1	6	of	of	ADP
ct-11260	1	7	taylorella	taylorella	NOUN
ct-11260	1	8	asinigenitalis	asinigenitali	NOUN
ct-11260	1	9	from	from	ADP
ct-11260	1	10	a	a	DET
ct-11260	1	11	mare	mare	NOUN
ct-11260	1	12	in	in	ADP
ct-11260	1	13	oklahoma	oklahoma	PROPN
ct-11260	1	14	,	,	PUNCT
ct-11260	1	15	usa	usa	PROPN
ct-11260	1	16	  	  	SPACE
ct-11260	1	17	isolation	isolation	NOUN
ct-11260	1	18	and	and	CCONJ
ct-11260	1	19	identification	identification	NOUN
ct-11260	1	20	of	of	ADP
ct-11260	1	21	taylorella	taylorella	NOUN
ct-11260	1	22	asinigenitalis	asinigenitali	NOUN
ct-11260	1	23	from	from	ADP
ct-11260	1	24	a	a	DET
ct-11260	1	25	mare	mare	NOUN
ct-11260	1	26	in	in	ADP
ct-11260	1	27	oklahoma	oklahoma	PROPN
ct-11260	1	28	,	,	PUNCT
ct-11260	1	29	usa	usa	PROPN
ct-11260	1	30	thomas	thomas	PROPN
ct-11260	1	31	j.	j.	PROPN
ct-11260	1	32	reilly	reilly	PROPN
ct-11260	1	33	,	,	PUNCT
ct-11260	1	34	a	a	PRON
ct-11260	1	35	,	,	PUNCT
ct-11260	1	36	b	b	PROPN
ct-11260	1	37	michael	michael	PROPN
ct-11260	1	38	j.	j.	PROPN
ct-11260	1	39	calcutt	calcutt	PROPN
ct-11260	1	40	,	,	PUNCT
ct-11260	1	41	a	a	DET
ct-11260	1	42	irene	irene	PROPN
ct-11260	1	43	k.	k.	PROPN
ct-11260	1	44	ganjam	ganjam	PROPN
ct-11260	1	45	,	,	PUNCT
ct-11260	1	46	b	b	PROPN
ct-11260	1	47	matthew	matthew	PROPN
ct-11260	1	48	m.	m.	PROPN
ct-11260	1	49	erdman	erdman	PROPN
ct-11260	1	50	,	,	PUNCT
ct-11260	1	51	c	c	PROPN
ct-11260	1	52	alan	alan	PROPN
ct-11260	1	53	m.	m.	PROPN
ct-11260	1	54	aalsburg	aalsburg	PROPN
ct-11260	1	55	,	,	PUNCT
ct-11260	1	56	c	c	PROPN
ct-11260	1	57	joshua	joshua	PROPN
ct-11260	1	58	f.	f.	PROPN
ct-11260	1	59	blyden	blyden	PROPN
ct-11260	1	60	,	,	PUNCT
ct-11260	1	61	d	d	PROPN
ct-11260	1	62	and	and	CCONJ
ct-11260	1	63	william	william	PROPN
ct-11260	1	64	h.	h.	PROPN
ct-11260	1	65	falesa	falesa	PROPN
ct-11260	1	66	,	,	PUNCT
ct-11260	1	67	b	b	PROPN
ct-11260	1	68	college	college	NOUN
ct-11260	1	69	of	of	ADP
ct-11260	1	70	veterinary	veterinary	ADJ
ct-11260	1	71	medicine	medicine	NOUN
ct-11260	1	72	,	,	PUNCT
ct-11260	1	73	adepartment	adepartment	NOUN
ct-11260	1	74	of	of	ADP
ct-11260	1	75	veterinary	veterinary	ADJ
ct-11260	1	76	pathobiology	pathobiology	NOUN
ct-11260	1	77	,	,	PUNCT
ct-11260	1	78	bveterinary	bveterinary	ADJ
ct-11260	1	79	medical	medical	ADJ
ct-11260	1	80	diagnostic	diagnostic	ADJ
ct-11260	1	81	laboratory	laboratory	NOUN
ct-11260	1	82	,	,	PUNCT
ct-11260	1	83	university	university	PROPN
ct-11260	1	84	of	of	ADP
ct-11260	1	85	missouri	missouri	PROPN
ct-11260	1	86	,	,	PUNCT
ct-11260	1	87	columbia	columbia	PROPN
ct-11260	1	88	,	,	PUNCT
ct-11260	1	89	mo	mo	PROPN
ct-11260	1	90	;	;	PUNCT
ct-11260	1	91	usda	usda	NOUN
ct-11260	1	92	,	,	PUNCT
ct-11260	1	93	canimal	canimal	ADJ
ct-11260	1	94	plant	plant	NOUN
ct-11260	1	95	health	health	NOUN
ct-11260	1	96	inspection	inspection	NOUN
ct-11260	1	97	service	service	NOUN
ct-11260	1	98	,	,	PUNCT
ct-11260	1	99	national	national	ADJ
ct-11260	1	100	veterinary	veterinary	ADJ
ct-11260	1	101	services	service	NOUN
ct-11260	1	102	laboratories	laboratory	NOUN
ct-11260	1	103	,	,	PUNCT
ct-11260	1	104	ames	ame	NOUN
ct-11260	1	105	,	,	PUNCT
ct-11260	1	106	ia	ia	PROPN
ct-11260	1	107	;	;	PUNCT
ct-11260	1	108	dnorman	dnorman	VERB
ct-11260	1	109	ok	ok	ADJ
ct-11260	1	110	abstract	abstract	ADJ
ct-11260	1	111	contagious	contagious	ADJ
ct-11260	1	112	equine	equine	NOUN
ct-11260	1	113	metritis	metritis	NOUN
ct-11260	1	114	(	(	PUNCT
ct-11260	1	115	cem	cem	NOUN
ct-11260	1	116	)	)	PUNCT
ct-11260	1	117	is	be	AUX
ct-11260	1	118	a	a	DET
ct-11260	1	119	highly	highly	ADV
ct-11260	1	120	contagious	contagious	ADJ
ct-11260	1	121	venereal	venereal	ADJ
ct-11260	1	122	disease	disease	NOUN
ct-11260	1	123	of	of	ADP
ct-11260	1	124	horses	horse	NOUN
ct-11260	1	125	whose	whose	DET
ct-11260	1	126	etiologic	etiologic	ADJ
ct-11260	1	127	agent	agent	NOUN
ct-11260	1	128	has	have	AUX
ct-11260	1	129	been	be	AUX
ct-11260	1	130	identified	identify	VERB
ct-11260	1	131	as	as	ADP
ct-11260	1	132	taylorella	taylorella	NOUN
ct-11260	1	133	equigenitalis	equigenitalis	PROPN
ct-11260	1	134	.	.	PUNCT
ct-11260	2	1	the	the	DET
ct-11260	2	2	bacterium	bacterium	NOUN
ct-11260	2	3	is	be	AUX
ct-11260	2	4	a	a	DET
ct-11260	2	5	catalase	catalase	NOUN
ct-11260	2	6	and	and	CCONJ
ct-11260	2	7	oxidase	oxidase	VERB
ct-11260	2	8	positive	positive	ADJ
ct-11260	2	9	pleomorphic	pleomorphic	ADJ
ct-11260	2	10	gram	gram	NOUN
ct-11260	2	11	-	-	PUNCT
ct-11260	2	12	negative	negative	ADJ
ct-11260	2	13	coccobacillus	coccobacillus	NOUN
ct-11260	2	14	which	which	PRON
ct-11260	2	15	grows	grow	VERB
ct-11260	2	16	best	well	ADV
ct-11260	2	17	in	in	ADP
ct-11260	2	18	a	a	DET
ct-11260	2	19	humidified	humidify	VERB
ct-11260	2	20	environment	environment	NOUN
ct-11260	2	21	of	of	ADP
ct-11260	2	22	reduced	reduced	ADJ
ct-11260	2	23	oxygen	oxygen	NOUN
ct-11260	2	24	(	(	PUNCT
ct-11260	2	25	95	95	NUM
ct-11260	2	26	%	%	NOUN
ct-11260	2	27	air	air	NOUN
ct-11260	2	28	containing	contain	VERB
ct-11260	2	29	5	5	NUM
ct-11260	2	30	%	%	NOUN
ct-11260	2	31	co2	co2	NOUN
ct-11260	2	32	)	)	PUNCT
ct-11260	2	33	on	on	ADP
ct-11260	2	34	eugon	eugon	VERB
ct-11260	2	35	chocolate	chocolate	NOUN
ct-11260	2	36	agar	agar	NOUN
ct-11260	2	37	.	.	PUNCT
ct-11260	3	1	during	during	ADP
ct-11260	3	2	routine	routine	ADJ
ct-11260	3	3	screening	screening	NOUN
ct-11260	3	4	of	of	ADP
ct-11260	3	5	an	an	DET
ct-11260	3	6	oklahoma	oklahoma	PROPN
ct-11260	3	7	equine	equine	NOUN
ct-11260	3	8	breeding	breed	VERB
ct-11260	3	9	population	population	NOUN
ct-11260	3	10	slated	slate	VERB
ct-11260	3	11	for	for	ADP
ct-11260	3	12	export	export	NOUN
ct-11260	3	13	,	,	PUNCT
ct-11260	3	14	a	a	DET
ct-11260	3	15	t.	t.	NOUN
ct-11260	3	16	equigenitalis	equigenitalis	PROPN
ct-11260	3	17	-	-	PUNCT
ct-11260	3	18	like	like	ADJ
ct-11260	3	19	organism	organism	NOUN
ct-11260	3	20	was	be	AUX
ct-11260	3	21	isolated	isolate	VERB
ct-11260	3	22	.	.	PUNCT
ct-11260	4	1	based	base	VERB
ct-11260	4	2	on	on	ADP
ct-11260	4	3	results	result	NOUN
ct-11260	4	4	from	from	ADP
ct-11260	4	5	requisite	requisite	ADJ
ct-11260	4	6	conditions	condition	NOUN
ct-11260	4	7	for	for	ADP
ct-11260	4	8	cultivation	cultivation	NOUN
ct-11260	4	9	,	,	PUNCT
ct-11260	4	10	biochemical	biochemical	ADJ
ct-11260	4	11	tests	test	NOUN
ct-11260	4	12	,	,	PUNCT
ct-11260	4	13	16s	16	NOUN
ct-11260	4	14	rdna	rdna	NOUN
ct-11260	4	15	and	and	CCONJ
ct-11260	4	16	intergenic	intergenic	ADJ
ct-11260	4	17	spacer	spacer	NOUN
ct-11260	4	18	region	region	NOUN
ct-11260	4	19	(	(	PUNCT
ct-11260	4	20	isr	isr	NOUN
ct-11260	4	21	)	)	PUNCT
ct-11260	4	22	sequence	sequence	NOUN
ct-11260	4	23	analyses	analysis	NOUN
ct-11260	4	24	,	,	PUNCT
ct-11260	4	25	the	the	DET
ct-11260	4	26	isolated	isolated	ADJ
ct-11260	4	27	organism	organism	NOUN
ct-11260	4	28	was	be	AUX
ct-11260	4	29	identified	identify	VERB
ct-11260	4	30	as	as	ADP
ct-11260	4	31	taylorella	taylorella	NOUN
ct-11260	4	32	asinigenitalis	asinigenitali	NOUN
ct-11260	4	33	.	.	PUNCT
ct-11260	5	1	as	as	SCONJ
ct-11260	5	2	required	require	VERB
ct-11260	5	3	by	by	ADP
ct-11260	5	4	federal	federal	ADJ
ct-11260	5	5	regulations	regulation	NOUN
ct-11260	5	6	,	,	PUNCT
ct-11260	5	7	this	this	DET
ct-11260	5	8	identification	identification	NOUN
ct-11260	5	9	was	be	AUX
ct-11260	5	10	confirmed	confirm	VERB
ct-11260	5	11	at	at	ADP
ct-11260	5	12	the	the	DET
ct-11260	5	13	national	national	ADJ
ct-11260	5	14	veterinary	veterinary	ADJ
ct-11260	5	15	services	service	NOUN
ct-11260	5	16	laboratories	laboratory	NOUN
ct-11260	5	17	(	(	PUNCT
ct-11260	5	18	nvsl	nvsl	NOUN
ct-11260	5	19	)	)	PUNCT
ct-11260	5	20	in	in	ADP
ct-11260	5	21	ames	ames	PROPN
ct-11260	5	22	,	,	PUNCT
ct-11260	5	23	ia	ia	PROPN
ct-11260	5	24	.	.	PROPN
ct-11260	5	25	pulsed	pulse	VERB
ct-11260	5	26	-	-	PUNCT
ct-11260	5	27	field	field	NOUN
ct-11260	5	28	gel	gel	NOUN
ct-11260	5	29	electrophoresis	electrophoresis	NOUN
ct-11260	5	30	(	(	PUNCT
ct-11260	5	31	pfge	pfge	NOUN
ct-11260	5	32	)	)	PUNCT
ct-11260	5	33	analysis	analysis	NOUN
ct-11260	5	34	revealed	reveal	VERB
ct-11260	5	35	that	that	SCONJ
ct-11260	5	36	the	the	DET
ct-11260	5	37	newly	newly	ADV
ct-11260	5	38	identified	identify	VERB
ct-11260	5	39	strain	strain	NOUN
ct-11260	5	40	has	have	VERB
ct-11260	5	41	a	a	DET
ct-11260	5	42	distinct	distinct	ADJ
ct-11260	5	43	genomic	genomic	NOUN
ct-11260	5	44	fingerprint	fingerprint	NOUN
ct-11260	5	45	from	from	ADP
ct-11260	5	46	the	the	DET
ct-11260	5	47	two	two	NUM
ct-11260	5	48	previously	previously	ADV
ct-11260	5	49	characterized	characterize	VERB
ct-11260	5	50	t.	t.	NOUN
ct-11260	5	51	asinigenitalis	asinigenitalis	PROPN
ct-11260	5	52	isolates	isolate	NOUN
ct-11260	5	53	from	from	ADP
ct-11260	5	54	the	the	DET
ct-11260	5	55	united	united	PROPN
ct-11260	5	56	states	states	PROPN
ct-11260	5	57	and	and	CCONJ
ct-11260	5	58	represents	represent	VERB
ct-11260	5	59	the	the	DET
ct-11260	5	60	second	second	ADJ
ct-11260	5	61	strain	strain	NOUN
ct-11260	5	62	to	to	PART
ct-11260	5	63	be	be	AUX
ct-11260	5	64	recovered	recover	VERB
ct-11260	5	65	from	from	ADP
ct-11260	5	66	a	a	DET
ct-11260	5	67	horse	horse	NOUN
ct-11260	5	68	in	in	ADP
ct-11260	5	69	the	the	DET
ct-11260	5	70	us	us	PROPN
ct-11260	5	71	.	.	PUNCT
ct-11260	6	1	keywords	keyword	NOUN
ct-11260	6	2	:	:	PUNCT
ct-11260	6	3	contagious	contagious	ADJ
ct-11260	6	4	equine	equine	NOUN
ct-11260	6	5	metritis	metritis	NOUN
ct-11260	6	6	,	,	PUNCT
ct-11260	6	7	taylorella	taylorella	NOUN
ct-11260	6	8	equigenitalis	equigenitalis	PROPN
ct-11260	6	9	,	,	PUNCT
ct-11260	6	10	taylorella	taylorella	NOUN
ct-11260	6	11	asinigenitalis	asinigenitalis	PROPN
ct-11260	6	12	introduction	introduction	NOUN
ct-11260	6	13	contagious	contagious	ADJ
ct-11260	6	14	equine	equine	NOUN
ct-11260	6	15	metritis	metritis	NOUN
ct-11260	6	16	is	be	AUX
ct-11260	6	17	a	a	DET
ct-11260	6	18	bacterial	bacterial	ADJ
ct-11260	6	19	infectious	infectious	ADJ
ct-11260	6	20	disease	disease	NOUN
ct-11260	6	21	of	of	ADP
ct-11260	6	22	horses	horse	NOUN
ct-11260	6	23	caused	cause	VERB
ct-11260	6	24	by	by	ADP
ct-11260	6	25	taylorella	taylorella	PROPN
ct-11260	6	26	equigenitalis	equigenitalis	PROPN
ct-11260	6	27	.	.	PUNCT
ct-11260	7	1	five	five	NUM
ct-11260	7	2	reported	report	VERB
ct-11260	7	3	outbreaks	outbreak	NOUN
ct-11260	7	4	of	of	ADP
ct-11260	7	5	cem	cem	NOUN
ct-11260	7	6	have	have	AUX
ct-11260	7	7	occurred	occur	VERB
ct-11260	7	8	in	in	ADP
ct-11260	7	9	the	the	DET
ct-11260	7	10	united	united	PROPN
ct-11260	7	11	states	states	PROPN
ct-11260	7	12	within	within	ADP
ct-11260	7	13	the	the	DET
ct-11260	7	14	past	past	ADJ
ct-11260	7	15	44	44	NUM
ct-11260	7	16	years	year	NOUN
ct-11260	7	17	including	include	VERB
ct-11260	7	18	those	those	PRON
ct-11260	7	19	in	in	ADP
ct-11260	7	20	kentucky	kentucky	PROPN
ct-11260	7	21	in	in	ADP
ct-11260	7	22	19781	19781	NUM
ct-11260	7	23	and	and	CCONJ
ct-11260	7	24	again	again	ADV
ct-11260	7	25	in	in	ADP
ct-11260	7	26	1979	1979	NUM
ct-11260	7	27	along	along	ADP
ct-11260	7	28	with	with	ADP
ct-11260	7	29	missouri,2	missouri,2	NOUN
ct-11260	7	30	and	and	CCONJ
ct-11260	7	31	a	a	DET
ct-11260	7	32	multi	multi	ADJ
ct-11260	7	33	-	-	ADJ
ct-11260	7	34	state	state	ADJ
ct-11260	7	35	outbreak	outbreak	NOUN
ct-11260	7	36	investigation	investigation	NOUN
ct-11260	7	37	from	from	ADP
ct-11260	7	38	2008	2008	NUM
ct-11260	7	39	to	to	ADP
ct-11260	7	40	2010.3	2010.3	NUM
ct-11260	7	41	incidents	incident	NOUN
ct-11260	7	42	involving	involve	VERB
ct-11260	7	43	a	a	DET
ct-11260	7	44	single	single	ADJ
ct-11260	7	45	horse	horse	NOUN
ct-11260	7	46	have	have	AUX
ct-11260	7	47	also	also	ADV
ct-11260	7	48	been	be	AUX
ct-11260	7	49	reported	report	VERB
ct-11260	7	50	in	in	ADP
ct-11260	7	51	2010	2010	NUM
ct-11260	7	52	and	and	CCONJ
ct-11260	7	53	2011.4	2011.4	NUM
ct-11260	7	54	while	while	SCONJ
ct-11260	7	55	symptomatic	symptomatic	ADJ
ct-11260	7	56	infection	infection	NOUN
ct-11260	7	57	in	in	ADP
ct-11260	7	58	mares	mare	NOUN
ct-11260	7	59	is	be	AUX
ct-11260	7	60	characterized	characterize	VERB
ct-11260	7	61	by	by	ADP
ct-11260	7	62	discharge	discharge	NOUN
ct-11260	7	63	of	of	ADP
ct-11260	7	64	copious	copious	ADJ
ct-11260	7	65	amounts	amount	NOUN
ct-11260	7	66	of	of	ADP
ct-11260	7	67	mucopurulent	mucopurulent	NOUN
ct-11260	7	68	fluid	fluid	NOUN
ct-11260	7	69	from	from	ADP
ct-11260	7	70	the	the	DET
ct-11260	7	71	vagina	vagina	ADJ
ct-11260	7	72	,	,	PUNCT
ct-11260	7	73	infertility	infertility	NOUN
ct-11260	7	74	,	,	PUNCT
ct-11260	7	75	and/or	and/or	CCONJ
ct-11260	7	76	early	early	ADJ
ct-11260	7	77	abortion	abortion	NOUN
ct-11260	7	78	,	,	PUNCT
ct-11260	7	79	stallions	stallion	NOUN
ct-11260	7	80	appear	appear	VERB
ct-11260	7	81	to	to	PART
ct-11260	7	82	remain	remain	VERB
ct-11260	7	83	asymptomatic	asymptomatic	ADJ
ct-11260	7	84	during	during	ADP
ct-11260	7	85	infection	infection	NOUN
ct-11260	7	86	and	and	CCONJ
ct-11260	7	87	serve	serve	VERB
ct-11260	7	88	as	as	ADP
ct-11260	7	89	a	a	DET
ct-11260	7	90	reservoir	reservoir	NOUN
ct-11260	7	91	for	for	ADP
ct-11260	7	92	infection.5	infection.5	PROPN
ct-11260	7	93	cases	case	NOUN
ct-11260	7	94	of	of	ADP
ct-11260	7	95	cem	cem	NOUN
ct-11260	7	96	are	be	AUX
ct-11260	7	97	rarely	rarely	ADV
ct-11260	7	98	,	,	PUNCT
ct-11260	7	99	if	if	SCONJ
ct-11260	7	100	ever	ever	ADV
ct-11260	7	101	,	,	PUNCT
ct-11260	7	102	fatal	fatal	ADJ
ct-11260	7	103	to	to	ADP
ct-11260	7	104	an	an	DET
ct-11260	7	105	adult	adult	NOUN
ct-11260	7	106	animal	animal	NOUN
ct-11260	7	107	and	and	CCONJ
ct-11260	7	108	while	while	SCONJ
ct-11260	7	109	no	no	DET
ct-11260	7	110	prolonged	prolonged	ADJ
ct-11260	7	111	deleterious	deleterious	ADJ
ct-11260	7	112	medical	medical	ADJ
ct-11260	7	113	effects	effect	NOUN
ct-11260	7	114	have	have	AUX
ct-11260	7	115	been	be	AUX
ct-11260	7	116	described	describe	VERB
ct-11260	7	117	,	,	PUNCT
ct-11260	7	118	the	the	DET
ct-11260	7	119	presence	presence	NOUN
ct-11260	7	120	of	of	ADP
ct-11260	7	121	cem	cem	NOUN
ct-11260	7	122	in	in	ADP
ct-11260	7	123	a	a	DET
ct-11260	7	124	breeding	breed	VERB
ct-11260	7	125	equine	equine	NOUN
ct-11260	7	126	population	population	NOUN
ct-11260	7	127	has	have	VERB
ct-11260	7	128	a	a	DET
ct-11260	7	129	significant	significant	ADJ
ct-11260	7	130	economic	economic	ADJ
ct-11260	7	131	impact.6	impact.6	NOUN
ct-11260	7	132	to	to	PART
ct-11260	7	133	avert	avert	VERB
ct-11260	7	134	such	such	ADJ
ct-11260	7	135	financial	financial	ADJ
ct-11260	7	136	losses	loss	NOUN
ct-11260	7	137	,	,	PUNCT
ct-11260	7	138	many	many	ADJ
ct-11260	7	139	countries	country	NOUN
ct-11260	7	140	require	require	VERB
ct-11260	7	141	certified	certify	VERB
ct-11260	7	142	and	and	CCONJ
ct-11260	7	143	validated	validated	ADJ
ct-11260	7	144	cem	cem	NOUN
ct-11260	7	145	-	-	PUNCT
ct-11260	7	146	testing	testing	NOUN
ct-11260	7	147	of	of	ADP
ct-11260	7	148	equine	equine	NOUN
ct-11260	7	149	breeding	breeding	NOUN
ct-11260	7	150	populations	population	NOUN
ct-11260	7	151	prior	prior	ADV
ct-11260	7	152	to	to	ADP
ct-11260	7	153	import	import	NOUN
ct-11260	7	154	or	or	CCONJ
ct-11260	7	155	export	export	NOUN
ct-11260	7	156	into	into	ADP
ct-11260	7	157	or	or	CCONJ
ct-11260	7	158	from	from	ADP
ct-11260	7	159	cem	cem	NOUN
ct-11260	7	160	-	-	PUNCT
ct-11260	7	161	endemic	endemic	ADJ
ct-11260	7	162	countries	country	NOUN
ct-11260	7	163	.	.	PUNCT
ct-11260	8	1	in	in	ADP
ct-11260	8	2	the	the	DET
ct-11260	8	3	united	united	PROPN
ct-11260	8	4	states	states	PROPN
ct-11260	8	5	,	,	PUNCT
ct-11260	8	6	testing	testing	NOUN
ct-11260	8	7	is	be	AUX
ct-11260	8	8	federally	federally	ADV
ct-11260	8	9	regulated	regulate	VERB
ct-11260	8	10	and	and	CCONJ
ct-11260	8	11	conducted	conduct	VERB
ct-11260	8	12	exclusively	exclusively	ADV
ct-11260	8	13	by	by	ADP
ct-11260	8	14	usda	usda	NOUN
ct-11260	8	15	-	-	PUNCT
ct-11260	8	16	approved	approve	VERB
ct-11260	8	17	laboratories	laboratory	NOUN
ct-11260	8	18	and	and	CCONJ
ct-11260	8	19	diagnosticians	diagnostician	NOUN
ct-11260	8	20	.	.	PUNCT
ct-11260	9	1	while	while	SCONJ
ct-11260	9	2	direct	direct	ADJ
ct-11260	9	3	pcr	pcr	ADJ
ct-11260	9	4	methods	method	NOUN
ct-11260	9	5	exist	exist	VERB
ct-11260	9	6	to	to	PART
ct-11260	9	7	detect	detect	VERB
ct-11260	9	8	t.	t.	PROPN
ct-11260	9	9	equigenitalis	equigenitalis	PROPN
ct-11260	9	10	in	in	ADP
ct-11260	9	11	genital	genital	ADJ
ct-11260	9	12	swabs,7	swabs,7	VERB
ct-11260	9	13	-	-	PUNCT
ct-11260	9	14	9	9	NUM
ct-11260	9	15	bacteriologic	bacteriologic	ADJ
ct-11260	9	16	examination	examination	NOUN
ct-11260	9	17	of	of	ADP
ct-11260	9	18	submitted	submit	VERB
ct-11260	9	19	samples	sample	NOUN
ct-11260	9	20	is	be	AUX
ct-11260	9	21	still	still	ADV
ct-11260	9	22	regarded	regard	VERB
ct-11260	9	23	as	as	ADP
ct-11260	9	24	the	the	DET
ct-11260	9	25	only	only	ADJ
ct-11260	9	26	definitive	definitive	ADJ
ct-11260	9	27	means	mean	NOUN
ct-11260	9	28	of	of	ADP
ct-11260	9	29	determining	determine	VERB
ct-11260	9	30	the	the	DET
ct-11260	9	31	presence	presence	NOUN
ct-11260	9	32	or	or	CCONJ
ct-11260	9	33	absence	absence	NOUN
ct-11260	9	34	of	of	ADP
ct-11260	9	35	t.	t.	PROPN
ct-11260	9	36	equigenitalis	equigenitalis	PROPN
ct-11260	9	37	.	.	PUNCT
ct-11260	10	1	the	the	DET
ct-11260	10	2	etiologic	etiologic	ADJ
ct-11260	10	3	agent	agent	NOUN
ct-11260	10	4	of	of	ADP
ct-11260	10	5	cem	cem	NOUN
ct-11260	10	6	,	,	PUNCT
ct-11260	10	7	t.	t.	PROPN
ct-11260	10	8	equigenitalis	equigenitalis	PROPN
ct-11260	10	9	,	,	PUNCT
ct-11260	10	10	is	be	AUX
ct-11260	10	11	a	a	DET
ct-11260	10	12	non	non	ADJ
ct-11260	10	13	-	-	ADJ
ct-11260	10	14	motile	motile	ADJ
ct-11260	10	15	,	,	PUNCT
ct-11260	10	16	gram	gram	NOUN
ct-11260	10	17	-	-	PUNCT
ct-11260	10	18	negative	negative	ADJ
ct-11260	10	19	coccobacillus	coccobacillus	NOUN
ct-11260	10	20	with	with	ADP
ct-11260	10	21	fastidious	fastidious	ADJ
ct-11260	10	22	growth	growth	NOUN
ct-11260	10	23	requirements	requirement	NOUN
ct-11260	10	24	.	.	PUNCT
ct-11260	11	1	the	the	DET
ct-11260	11	2	bacterium	bacterium	NOUN
ct-11260	11	3	is	be	AUX
ct-11260	11	4	microaerophilic	microaerophilic	ADJ
ct-11260	11	5	,	,	PUNCT
ct-11260	11	6	and	and	CCONJ
ct-11260	11	7	grows	grow	VERB
ct-11260	11	8	best	well	ADV
ct-11260	11	9	on	on	ADP
ct-11260	11	10	a	a	DET
ct-11260	11	11	semi	semi	ADJ
ct-11260	11	12	-	-	ADJ
ct-11260	11	13	solid	solid	ADJ
ct-11260	11	14	medium	medium	NOUN
ct-11260	11	15	of	of	ADP
ct-11260	11	16	chocolatized	chocolatize	VERB
ct-11260	11	17	eugon	eugon	NOUN
ct-11260	11	18	agar	agar	NOUN
ct-11260	11	19	or	or	CCONJ
ct-11260	11	20	timoney	timoney	NOUN
ct-11260	11	21	agar	agar	NOUN
ct-11260	11	22	in	in	ADP
ct-11260	11	23	a	a	DET
ct-11260	11	24	humidified	humidify	VERB
ct-11260	11	25	environment	environment	NOUN
ct-11260	11	26	maintained	maintain	VERB
ct-11260	11	27	at	at	ADP
ct-11260	11	28	5	5	NUM
ct-11260	11	29	-	-	SYM
ct-11260	11	30	10	10	NUM
ct-11260	11	31	%	%	NOUN
ct-11260	11	32	co2	co2	NOUN
ct-11260	11	33	,	,	PUNCT
ct-11260	11	34	95	95	NUM
ct-11260	11	35	-	-	SYM
ct-11260	11	36	90	90	NUM
ct-11260	11	37	%	%	NOUN
ct-11260	11	38	air	air	NOUN
ct-11260	11	39	,	,	PUNCT
ct-11260	11	40	and	and	CCONJ
ct-11260	11	41	37	37	NUM
ct-11260	11	42	°	°	NOUN
ct-11260	11	43	c.(5,10	c.(5,10	NOUN
ct-11260	11	44	while	while	SCONJ
ct-11260	11	45	members	member	NOUN
ct-11260	11	46	of	of	ADP
ct-11260	11	47	the	the	DET
ct-11260	11	48	genus	genus	NOUN
ct-11260	11	49	taylorella	taylorella	NOUN
ct-11260	11	50	are	be	AUX
ct-11260	11	51	extremely	extremely	ADV
ct-11260	11	52	limited	limited	ADJ
ct-11260	11	53	in	in	ADP
ct-11260	11	54	the	the	DET
ct-11260	11	55	repertoire	repertoire	NOUN
ct-11260	11	56	of	of	ADP
ct-11260	11	57	easily	easily	ADV
ct-11260	11	58	detectable	detectable	ADJ
ct-11260	11	59	enzyme	enzyme	NOUN
ct-11260	11	60	activities	activity	NOUN
ct-11260	11	61	,	,	PUNCT
ct-11260	11	62	all	all	DET
ct-11260	11	63	known	know	VERB
ct-11260	11	64	isolates	isolate	NOUN
ct-11260	11	65	are	be	AUX
ct-11260	11	66	biochemically	biochemically	ADV
ct-11260	11	67	positive	positive	ADJ
ct-11260	11	68	for	for	ADP
ct-11260	11	69	cytochrome	cytochrome	PROPN
ct-11260	11	70	c	c	PROPN
ct-11260	11	71	oxidase	oxidase	NOUN
ct-11260	11	72	,	,	PUNCT
ct-11260	11	73	catalase	catalase	NOUN
ct-11260	11	74	,	,	PUNCT
ct-11260	11	75	and	and	CCONJ
ct-11260	11	76	alkaline	alkaline	NOUN
ct-11260	11	77	phosphatase	phosphatase	NOUN
ct-11260	11	78	.	.	PUNCT
ct-11260	12	1	in	in	ADP
ct-11260	12	2	addition	addition	NOUN
ct-11260	12	3	,	,	PUNCT
ct-11260	12	4	the	the	DET
ct-11260	12	5	bacterium	bacterium	NOUN
ct-11260	12	6	is	be	AUX
ct-11260	12	7	susceptible	susceptible	ADJ
ct-11260	12	8	to	to	ADP
ct-11260	12	9	most	most	ADJ
ct-11260	12	10	antimicrobial	antimicrobial	ADJ
ct-11260	12	11	agents	agent	NOUN
ct-11260	12	12	except	except	SCONJ
ct-11260	12	13	lincosamides	lincosamide	NOUN
ct-11260	12	14	,	,	PUNCT
ct-11260	12	15	sulphamethoxazole	sulphamethoxazole	NOUN
ct-11260	12	16	,	,	PUNCT
ct-11260	12	17	and	and	CCONJ
ct-11260	12	18	while	while	SCONJ
ct-11260	12	19	streptomycin	streptomycin	PROPN
ct-11260	12	20	-	-	PUNCT
ct-11260	12	21	susceptible	susceptible	ADJ
ct-11260	12	22	strains	strain	NOUN
ct-11260	12	23	have	have	AUX
ct-11260	12	24	been	be	AUX
ct-11260	12	25	recovered	recover	VERB
ct-11260	12	26	,	,	PUNCT
ct-11260	12	27	streptomycin	streptomycin	NOUN
ct-11260	12	28	-	-	PUNCT
ct-11260	12	29	resistant	resistant	ADJ
ct-11260	12	30	strains	strain	NOUN
ct-11260	12	31	have	have	AUX
ct-11260	12	32	been	be	AUX
ct-11260	12	33	described.5	described.5	ADV
ct-11260	12	34	phylogenetic	phylogenetic	ADJ
ct-11260	12	35	analysis	analysis	NOUN
ct-11260	12	36	of	of	ADP
ct-11260	12	37	the	the	DET
ct-11260	12	38	16s	16s	PROPN
ct-11260	12	39	ribosomal	ribosomal	NOUN
ct-11260	12	40	dna	dna	PROPN
ct-11260	12	41	sequence	sequence	NOUN
ct-11260	12	42	revealed	reveal	VERB
ct-11260	12	43	that	that	SCONJ
ct-11260	12	44	taylorella	taylorella	NOUN
ct-11260	12	45	,	,	PUNCT
ct-11260	12	46	while	while	SCONJ
ct-11260	12	47	phenotypically	phenotypically	ADV
ct-11260	12	48	similar	similar	ADJ
ct-11260	12	49	to	to	ADP
ct-11260	12	50	haemophilus	haemophilus	ADJ
ct-11260	12	51	,	,	PUNCT
ct-11260	12	52	occupies	occupy	VERB
ct-11260	12	53	a	a	DET
ct-11260	12	54	unique	unique	ADJ
ct-11260	12	55	niche	niche	NOUN
ct-11260	12	56	in	in	ADP
ct-11260	12	57	the	the	DET
ct-11260	12	58	β	β	NOUN
ct-11260	12	59	-	-	NOUN
ct-11260	12	60	subclass	subclass	NOUN
ct-11260	12	61	of	of	ADP
ct-11260	12	62	the	the	DET
ct-11260	12	63	proteobacteria	proteobacteria	NOUN
ct-11260	12	64	most	most	ADV
ct-11260	12	65	closely	closely	ADV
ct-11260	12	66	related	relate	VERB
ct-11260	12	67	to	to	ADP
ct-11260	12	68	pelistega	pelistega	PROPN
ct-11260	12	69	europaea11	europaea11	NOUN
ct-11260	12	70	and	and	CCONJ
ct-11260	12	71	constitutes	constitute	VERB
ct-11260	12	72	a	a	DET
ct-11260	12	73	new	new	ADJ
ct-11260	12	74	genus	genus	NOUN
ct-11260	12	75	within	within	ADP
ct-11260	12	76	the	the	DET
ct-11260	12	77	subclass	subclass	NOUN
ct-11260	12	78	.	.	PUNCT
ct-11260	13	1	clinical	clinical	ADJ
ct-11260	13	2	theriogenology	theriogenology	NOUN
ct-11260	13	3	•	•	NOUN
ct-11260	13	4	volume	volume	NOUN
ct-11260	13	5	4	4	NUM
ct-11260	13	6	number	number	NOUN
ct-11260	13	7	2	2	NUM
ct-11260	13	8	•	•	NOUN
ct-11260	13	9	june	june	PROPN
ct-11260	13	10	2012163	2012163	NUM
ct-11260	13	11	  	  	SPACE
ct-11260	13	12	in	in	ADP
ct-11260	13	13	the	the	DET
ct-11260	13	14	late	late	ADJ
ct-11260	13	15	1990	1990	NUM
ct-11260	13	16	’s	’s	NOUN
ct-11260	13	17	,	,	PUNCT
ct-11260	13	18	three	three	NUM
ct-11260	13	19	atypical	atypical	ADJ
ct-11260	13	20	taylorella	taylorella	NOUN
ct-11260	13	21	isolates	isolate	NOUN
ct-11260	13	22	were	be	AUX
ct-11260	13	23	obtained	obtain	VERB
ct-11260	13	24	in	in	ADP
ct-11260	13	25	california	california	PROPN
ct-11260	13	26	and	and	CCONJ
ct-11260	13	27	kentucky	kentucky	PROPN
ct-11260	13	28	from	from	ADP
ct-11260	13	29	the	the	DET
ct-11260	13	30	genital	genital	ADJ
ct-11260	13	31	tract	tract	NOUN
ct-11260	13	32	of	of	ADP
ct-11260	13	33	donkey	donkey	NOUN
ct-11260	13	34	jacks	jack	NOUN
ct-11260	13	35	(	(	PUNCT
ct-11260	13	36	equus	equus	PROPN
ct-11260	13	37	asinus	asinus	PROPN
ct-11260	13	38	)	)	PUNCT
ct-11260	13	39	.	.	PUNCT
ct-11260	14	1	these	these	DET
ct-11260	14	2	three	three	NUM
ct-11260	14	3	isolates	isolate	NOUN
ct-11260	14	4	were	be	AUX
ct-11260	14	5	identified	identify	VERB
ct-11260	14	6	during	during	ADP
ct-11260	14	7	routine	routine	ADJ
ct-11260	14	8	regulatory	regulatory	ADJ
ct-11260	14	9	testing	testing	NOUN
ct-11260	14	10	for	for	ADP
ct-11260	14	11	cem	cem	NOUN
ct-11260	14	12	and	and	CCONJ
ct-11260	14	13	were	be	AUX
ct-11260	14	14	found	find	VERB
ct-11260	14	15	to	to	PART
ct-11260	14	16	be	be	AUX
ct-11260	14	17	nearly	nearly	ADV
ct-11260	14	18	indistinguishable	indistinguishable	ADJ
ct-11260	14	19	from	from	ADP
ct-11260	14	20	t.	t.	PROPN
ct-11260	14	21	equigenitalis	equigenitalis	PROPN
ct-11260	14	22	when	when	SCONJ
ct-11260	14	23	assessed	assessed	ADJ
ct-11260	14	24	phenotypically	phenotypically	ADV
ct-11260	14	25	.	.	PUNCT
ct-11260	15	1	results	result	NOUN
ct-11260	15	2	from	from	ADP
ct-11260	15	3	16s	16	NOUN
ct-11260	15	4	ribosomal	ribosomal	NOUN
ct-11260	15	5	dna	dna	PROPN
ct-11260	15	6	sequence	sequence	NOUN
ct-11260	15	7	analysis	analysis	NOUN
ct-11260	15	8	however	however	ADV
ct-11260	15	9	,	,	PUNCT
ct-11260	15	10	together	together	ADV
ct-11260	15	11	with	with	ADP
ct-11260	15	12	genomic	genomic	ADJ
ct-11260	15	13	dna	dna	PROPN
ct-11260	15	14	-	-	PUNCT
ct-11260	15	15	dna	dna	NOUN
ct-11260	15	16	hybridization	hybridization	NOUN
ct-11260	15	17	and	and	CCONJ
ct-11260	15	18	g+c	g+c	ADJ
ct-11260	15	19	composition	composition	NOUN
ct-11260	15	20	studies	study	NOUN
ct-11260	15	21	between	between	ADP
ct-11260	15	22	these	these	DET
ct-11260	15	23	t.	t.	PROPN
ct-11260	15	24	equigenitalis	equigenitalis	PROPN
ct-11260	15	25	-	-	PUNCT
ct-11260	15	26	like	like	ADJ
ct-11260	15	27	organisms	organism	NOUN
ct-11260	15	28	and	and	CCONJ
ct-11260	15	29	t.	t.	PROPN
ct-11260	15	30	equigenitalis	equigenitalis	PROPN
ct-11260	15	31	suggested	suggest	VERB
ct-11260	15	32	that	that	SCONJ
ct-11260	15	33	the	the	DET
ct-11260	15	34	former	former	ADJ
ct-11260	15	35	were	be	AUX
ct-11260	15	36	unique	unique	ADJ
ct-11260	15	37	and	and	CCONJ
ct-11260	15	38	constituted	constitute	VERB
ct-11260	15	39	a	a	DET
ct-11260	15	40	new	new	ADJ
ct-11260	15	41	species	specie	NOUN
ct-11260	15	42	within	within	ADP
ct-11260	15	43	the	the	DET
ct-11260	15	44	genus	genus	NOUN
ct-11260	15	45	which	which	PRON
ct-11260	15	46	was	be	AUX
ct-11260	15	47	named	name	VERB
ct-11260	15	48	taylorella	taylorella	NOUN
ct-11260	15	49	asinigenitalis.12	asinigenitalis.12	NOUN
ct-11260	15	50	significantly	significantly	ADV
ct-11260	15	51	,	,	PUNCT
ct-11260	15	52	following	follow	VERB
ct-11260	15	53	natural	natural	ADJ
ct-11260	15	54	breeding	breeding	NOUN
ct-11260	15	55	,	,	PUNCT
ct-11260	15	56	disease	disease	NOUN
ct-11260	15	57	in	in	ADP
ct-11260	15	58	mares	mare	NOUN
ct-11260	15	59	was	be	AUX
ct-11260	15	60	not	not	PART
ct-11260	15	61	detected	detect	VERB
ct-11260	15	62	;	;	PUNCT
ct-11260	15	63	however	however	ADV
ct-11260	15	64	,	,	PUNCT
ct-11260	15	65	clinical	clinical	ADJ
ct-11260	15	66	signs	sign	NOUN
ct-11260	15	67	were	be	AUX
ct-11260	15	68	noted	note	VERB
ct-11260	15	69	in	in	ADP
ct-11260	15	70	another	another	DET
ct-11260	15	71	study	study	NOUN
ct-11260	15	72	following	follow	VERB
ct-11260	15	73	experimental	experimental	ADJ
ct-11260	15	74	inoculation	inoculation	NOUN
ct-11260	15	75	of	of	ADP
ct-11260	15	76	mares	mare	NOUN
ct-11260	15	77	with	with	ADP
ct-11260	15	78	t.	t.	PROPN
ct-11260	15	79	asinigenitalis.13	asinigenitalis.13	PROPN
ct-11260	15	80	a	a	DET
ct-11260	15	81	recent	recent	ADJ
ct-11260	15	82	publication	publication	NOUN
ct-11260	15	83	on	on	ADP
ct-11260	15	84	the	the	DET
ct-11260	15	85	containment	containment	NOUN
ct-11260	15	86	of	of	ADP
ct-11260	15	87	the	the	DET
ct-11260	15	88	1998	1998	NUM
ct-11260	15	89	outbreak	outbreak	NOUN
ct-11260	15	90	in	in	ADP
ct-11260	15	91	kentucky	kentucky	PROPN
ct-11260	15	92	reported	report	VERB
ct-11260	15	93	that	that	SCONJ
ct-11260	15	94	seven	seven	NUM
ct-11260	15	95	mares	mare	NOUN
ct-11260	15	96	and	and	CCONJ
ct-11260	15	97	one	one	NUM
ct-11260	15	98	stallion	stallion	NOUN
ct-11260	15	99	were	be	AUX
ct-11260	15	100	infected.14	infected.14	NOUN
ct-11260	15	101	in	in	ADP
ct-11260	15	102	2006	2006	NUM
ct-11260	15	103	,	,	PUNCT
ct-11260	15	104	båverud	båverud	NOUN
ct-11260	15	105	et	et	PROPN
ct-11260	15	106	al	al	PROPN
ct-11260	15	107	.	.	PROPN
ct-11260	15	108	reported	report	VERB
ct-11260	15	109	the	the	DET
ct-11260	15	110	isolation	isolation	NOUN
ct-11260	15	111	and	and	CCONJ
ct-11260	15	112	identification	identification	NOUN
ct-11260	15	113	of	of	ADP
ct-11260	15	114	t.	t.	ADJ
ct-11260	15	115	asinigenitalis	asinigenitalis	PROPN
ct-11260	15	116	from	from	ADP
ct-11260	15	117	a	a	DET
ct-11260	15	118	naturally	naturally	ADV
ct-11260	15	119	infected	infect	VERB
ct-11260	15	120	stallion	stallion	NOUN
ct-11260	15	121	in	in	ADP
ct-11260	15	122	sweden	sweden	PROPN
ct-11260	15	123	and	and	CCONJ
ct-11260	15	124	found	find	VERB
ct-11260	15	125	the	the	DET
ct-11260	15	126	16s	16s	PROPN
ct-11260	15	127	rrna	rrna	PROPN
ct-11260	15	128	sequence	sequence	NOUN
ct-11260	15	129	to	to	PART
ct-11260	15	130	be	be	AUX
ct-11260	15	131	identical	identical	ADJ
ct-11260	15	132	to	to	ADP
ct-11260	15	133	that	that	PRON
ct-11260	15	134	of	of	ADP
ct-11260	15	135	the	the	DET
ct-11260	15	136	california	california	PROPN
ct-11260	15	137	ucd-1	ucd-1	DET
ct-11260	15	138	type	type	NOUN
ct-11260	15	139	strain	strain	NOUN
ct-11260	15	140	,	,	PUNCT
ct-11260	15	141	first	first	ADV
ct-11260	15	142	described	describe	VERB
ct-11260	15	143	in	in	ADP
ct-11260	15	144	the	the	DET
ct-11260	15	145	2001	2001	NUM
ct-11260	15	146	report.15	report.15	NOUN
ct-11260	15	147	in	in	ADP
ct-11260	15	148	february	february	PROPN
ct-11260	15	149	2008	2008	NUM
ct-11260	15	150	,	,	PUNCT
ct-11260	15	151	franco	franco	PROPN
ct-11260	15	152	et	et	PROPN
ct-11260	15	153	al	al	PROPN
ct-11260	15	154	.	.	PROPN
ct-11260	15	155	reported	report	VERB
ct-11260	15	156	the	the	DET
ct-11260	15	157	isolation	isolation	NOUN
ct-11260	15	158	of	of	ADP
ct-11260	15	159	taylorella	taylorella	NOUN
ct-11260	15	160	asinigenitalis	asinigenitali	NOUN
ct-11260	15	161	organisms	organism	NOUN
ct-11260	15	162	,	,	PUNCT
ct-11260	15	163	identical	identical	ADJ
ct-11260	15	164	in	in	ADP
ct-11260	15	165	16s	16s	PROPN
ct-11260	15	166	rdna	rdna	NOUN
ct-11260	15	167	sequence	sequence	NOUN
ct-11260	15	168	analysis	analysis	NOUN
ct-11260	15	169	(	(	PUNCT
ct-11260	15	170	nucleotide	nucleotide	NOUN
ct-11260	15	171	505	505	NUM
ct-11260	15	172	-	-	SYM
ct-11260	15	173	1120	1120	NUM
ct-11260	15	174	)	)	PUNCT
ct-11260	15	175	to	to	ADP
ct-11260	15	176	the	the	DET
ct-11260	15	177	t.	t.	PROPN
ct-11260	15	178	asinigenitalis	asinigenitalis	PROPN
ct-11260	15	179	ucd-1	ucd-1	DET
ct-11260	15	180	type	type	NOUN
ct-11260	15	181	strain	strain	NOUN
ct-11260	15	182	(	(	PUNCT
ct-11260	15	183	atcc	atcc	NOUN
ct-11260	15	184	70093	70093	NUM
ct-11260	15	185	)	)	PUNCT
ct-11260	15	186	strain	strain	NOUN
ct-11260	15	187	from	from	ADP
ct-11260	15	188	two	two	NUM
ct-11260	15	189	donkey	donkey	NOUN
ct-11260	15	190	jacks	jack	NOUN
ct-11260	15	191	of	of	ADP
ct-11260	15	192	the	the	DET
ct-11260	15	193	martina	martina	PROPN
ct-11260	15	194	franca	franca	PROPN
ct-11260	15	195	endangered	endanger	VERB
ct-11260	15	196	breed	breed	NOUN
ct-11260	15	197	in	in	ADP
ct-11260	15	198	apulia	apulia	NOUN
ct-11260	15	199	,	,	PUNCT
ct-11260	15	200	italy.16	italy.16	NOUN
ct-11260	15	201	in	in	ADP
ct-11260	15	202	2011	2011	NUM
ct-11260	15	203	,	,	PUNCT
ct-11260	15	204	breuil	breuil	PROPN
ct-11260	15	205	et	et	PROPN
ct-11260	15	206	al	al	PROPN
ct-11260	15	207	.	.	PROPN
ct-11260	15	208	reported	report	VERB
ct-11260	15	209	the	the	DET
ct-11260	15	210	isolation	isolation	NOUN
ct-11260	15	211	of	of	ADP
ct-11260	15	212	three	three	NUM
ct-11260	15	213	french	french	ADJ
ct-11260	15	214	t.	t.	NOUN
ct-11260	15	215	asinigenitalis	asinigenitalis	PROPN
ct-11260	15	216	strains	strain	VERB
ct-11260	15	217	from	from	ADP
ct-11260	15	218	horses	horse	NOUN
ct-11260	15	219	,	,	PUNCT
ct-11260	15	220	each	each	PRON
ct-11260	15	221	of	of	ADP
ct-11260	15	222	which	which	PRON
ct-11260	15	223	could	could	AUX
ct-11260	15	224	be	be	AUX
ct-11260	15	225	distinguished	distinguish	VERB
ct-11260	15	226	by	by	ADP
ct-11260	15	227	a	a	DET
ct-11260	15	228	combination	combination	NOUN
ct-11260	15	229	of	of	ADP
ct-11260	15	230	profiling	profile	VERB
ct-11260	15	231	methods.17	methods.17	NOUN
ct-11260	15	232	interestingly	interestingly	ADV
ct-11260	15	233	,	,	PUNCT
ct-11260	15	234	one	one	NUM
ct-11260	15	235	of	of	ADP
ct-11260	15	236	these	these	DET
ct-11260	15	237	isolates	isolate	NOUN
ct-11260	15	238	was	be	AUX
ct-11260	15	239	collected	collect	VERB
ct-11260	15	240	in	in	ADP
ct-11260	15	241	1995	1995	NUM
ct-11260	15	242	and	and	CCONJ
ct-11260	15	243	was	be	AUX
ct-11260	15	244	,	,	PUNCT
ct-11260	15	245	retrospectively	retrospectively	ADV
ct-11260	15	246	,	,	PUNCT
ct-11260	15	247	the	the	DET
ct-11260	15	248	first	first	ADJ
ct-11260	15	249	t.	t.	ADJ
ct-11260	15	250	asinigenitalis	asinigenitali	NOUN
ct-11260	15	251	to	to	PART
ct-11260	15	252	be	be	AUX
ct-11260	15	253	recovered	recover	VERB
ct-11260	15	254	.	.	PUNCT
ct-11260	16	1	we	we	PRON
ct-11260	16	2	report	report	VERB
ct-11260	16	3	here	here	ADV
ct-11260	16	4	the	the	DET
ct-11260	16	5	isolation	isolation	NOUN
ct-11260	16	6	and	and	CCONJ
ct-11260	16	7	identification	identification	NOUN
ct-11260	16	8	of	of	ADP
ct-11260	16	9	taylorella	taylorella	NOUN
ct-11260	16	10	asinigenitalis	asinigenitali	NOUN
ct-11260	16	11	from	from	ADP
ct-11260	16	12	a	a	DET
ct-11260	16	13	mare	mare	NOUN
ct-11260	16	14	in	in	ADP
ct-11260	16	15	the	the	DET
ct-11260	16	16	state	state	NOUN
ct-11260	16	17	of	of	ADP
ct-11260	16	18	oklahoma	oklahoma	PROPN
ct-11260	16	19	.	.	PUNCT
ct-11260	17	1	the	the	DET
ct-11260	17	2	isolate	isolate	NOUN
ct-11260	17	3	was	be	AUX
ct-11260	17	4	discovered	discover	VERB
ct-11260	17	5	during	during	ADP
ct-11260	17	6	routine	routine	ADJ
ct-11260	17	7	testing	testing	NOUN
ct-11260	17	8	of	of	ADP
ct-11260	17	9	samples	sample	NOUN
ct-11260	17	10	at	at	ADP
ct-11260	17	11	a	a	DET
ct-11260	17	12	time	time	NOUN
ct-11260	17	13	concomitant	concomitant	ADJ
ct-11260	17	14	with	with	ADP
ct-11260	17	15	but	but	CCONJ
ct-11260	17	16	independent	independent	ADJ
ct-11260	17	17	of	of	ADP
ct-11260	17	18	the	the	DET
ct-11260	17	19	united	united	PROPN
ct-11260	17	20	states	states	PROPN
ct-11260	17	21	2008	2008	NUM
ct-11260	17	22	-	-	SYM
ct-11260	17	23	2010	2010	NUM
ct-11260	17	24	cem	cem	NOUN
ct-11260	17	25	investigation	investigation	NOUN
ct-11260	17	26	.	.	PUNCT
ct-11260	18	1	both	both	DET
ct-11260	18	2	phenotypic	phenotypic	ADJ
ct-11260	18	3	and	and	CCONJ
ct-11260	18	4	genotypic	genotypic	NOUN
ct-11260	18	5	properties	property	NOUN
ct-11260	18	6	were	be	AUX
ct-11260	18	7	assessed	assess	VERB
ct-11260	18	8	in	in	ADP
ct-11260	18	9	the	the	DET
ct-11260	18	10	identification	identification	NOUN
ct-11260	18	11	of	of	ADP
ct-11260	18	12	this	this	DET
ct-11260	18	13	isolate	isolate	NOUN
ct-11260	18	14	,	,	PUNCT
ct-11260	18	15	designated	designate	VERB
ct-11260	18	16	t.	t.	PROPN
ct-11260	18	17	asinigenitalis	asinigenitalis	PROPN
ct-11260	18	18	umc-1	umc-1	ADP
ct-11260	18	19	,	,	PUNCT
ct-11260	18	20	which	which	PRON
ct-11260	18	21	also	also	ADV
ct-11260	18	22	demonstrated	demonstrate	VERB
ct-11260	18	23	that	that	SCONJ
ct-11260	18	24	the	the	DET
ct-11260	18	25	strain	strain	NOUN
ct-11260	18	26	is	be	AUX
ct-11260	18	27	distinct	distinct	ADJ
ct-11260	18	28	from	from	ADP
ct-11260	18	29	that	that	PRON
ct-11260	18	30	associated	associate	VERB
ct-11260	18	31	with	with	ADP
ct-11260	18	32	the	the	DET
ct-11260	18	33	1998	1998	NUM
ct-11260	18	34	kentucky	kentucky	PROPN
ct-11260	18	35	outbreak	outbreak	NOUN
ct-11260	18	36	in	in	ADP
ct-11260	18	37	horses	horse	NOUN
ct-11260	18	38	and	and	CCONJ
ct-11260	18	39	from	from	ADP
ct-11260	18	40	the	the	DET
ct-11260	18	41	type	type	NOUN
ct-11260	18	42	strain	strain	NOUN
ct-11260	18	43	identified	identify	VERB
ct-11260	18	44	in	in	ADP
ct-11260	18	45	a	a	DET
ct-11260	18	46	california	california	PROPN
ct-11260	18	47	donkey	donkey	NOUN
ct-11260	18	48	jack	jack	PROPN
ct-11260	18	49	.	.	PUNCT
ct-11260	19	1	methods	method	NOUN
ct-11260	19	2	unless	unless	SCONJ
ct-11260	19	3	noted	note	VERB
ct-11260	19	4	otherwise	otherwise	ADV
ct-11260	19	5	all	all	DET
ct-11260	19	6	strains	strain	NOUN
ct-11260	19	7	used	use	VERB
ct-11260	19	8	in	in	ADP
ct-11260	19	9	this	this	DET
ct-11260	19	10	study	study	NOUN
ct-11260	19	11	were	be	AUX
ct-11260	19	12	cultivated	cultivate	VERB
ct-11260	19	13	for	for	ADP
ct-11260	19	14	48	48	NUM
ct-11260	19	15	-	-	SYM
ct-11260	19	16	72	72	NUM
ct-11260	19	17	hr	hr	NOUN
ct-11260	19	18	at	at	ADP
ct-11260	19	19	37	37	NUM
ct-11260	19	20	°	°	NOUN
ct-11260	19	21	c	c	NOUN
ct-11260	19	22	in	in	ADP
ct-11260	19	23	a	a	DET
ct-11260	19	24	humidified	humidify	VERB
ct-11260	19	25	environment	environment	NOUN
ct-11260	19	26	containing	contain	VERB
ct-11260	19	27	95	95	NUM
ct-11260	19	28	%	%	NOUN
ct-11260	19	29	(	(	PUNCT
ct-11260	19	30	v	v	NOUN
ct-11260	19	31	/	/	SYM
ct-11260	19	32	v	v	NOUN
ct-11260	19	33	)	)	PUNCT
ct-11260	19	34	air	air	NOUN
ct-11260	19	35	and	and	CCONJ
ct-11260	19	36	5	5	NUM
ct-11260	19	37	%	%	NOUN
ct-11260	19	38	(	(	PUNCT
ct-11260	19	39	v	v	NOUN
ct-11260	19	40	/	/	SYM
ct-11260	19	41	v	v	NOUN
ct-11260	19	42	)	)	PUNCT
ct-11260	19	43	co2	co2	VERB
ct-11260	19	44	on	on	ADP
ct-11260	19	45	chocolatized	chocolatize	VERB
ct-11260	19	46	eugon	eugon	NOUN
ct-11260	19	47	and	and	CCONJ
ct-11260	19	48	timoney	timoney	NOUN
ct-11260	19	49	agars	agar	NOUN
ct-11260	19	50	(	(	PUNCT
ct-11260	19	51	biomed	biome	VERB
ct-11260	19	52	diagnostics	diagnostic	NOUN
ct-11260	19	53	,	,	PUNCT
ct-11260	19	54	white	white	ADJ
ct-11260	19	55	city	city	NOUN
ct-11260	19	56	,	,	PUNCT
ct-11260	19	57	or	or	CCONJ
ct-11260	19	58	)	)	PUNCT
ct-11260	19	59	as	as	ADP
ct-11260	19	60	previously	previously	ADV
ct-11260	19	61	described.10	described.10	ADV
ct-11260	19	62	additional	additional	ADJ
ct-11260	19	63	media	medium	NOUN
ct-11260	19	64	including	include	VERB
ct-11260	19	65	tubed	tube	VERB
ct-11260	19	66	biochemical	biochemical	ADJ
ct-11260	19	67	tests	test	NOUN
ct-11260	19	68	,	,	PUNCT
ct-11260	19	69	blood	blood	NOUN
ct-11260	19	70	and	and	CCONJ
ct-11260	19	71	macconkey	macconkey	NOUN
ct-11260	19	72	agars	agar	NOUN
ct-11260	19	73	were	be	AUX
ct-11260	19	74	supplied	supply	VERB
ct-11260	19	75	by	by	ADP
ct-11260	19	76	remel	remel	NOUN
ct-11260	19	77	®	®	NOUN
ct-11260	19	78	(	(	PUNCT
ct-11260	19	79	lenexa	lenexa	NOUN
ct-11260	19	80	,	,	PUNCT
ct-11260	19	81	ks	ks	NOUN
ct-11260	19	82	)	)	PUNCT
ct-11260	19	83	.	.	PUNCT
ct-11260	20	1	initial	initial	ADJ
ct-11260	20	2	oxidase	oxidase	NOUN
ct-11260	20	3	and	and	CCONJ
ct-11260	20	4	catalase	catalase	NOUN
ct-11260	20	5	tests	test	NOUN
ct-11260	20	6	were	be	AUX
ct-11260	20	7	performed	perform	VERB
ct-11260	20	8	on	on	ADP
ct-11260	20	9	colonies	colony	NOUN
ct-11260	20	10	recovered	recover	VERB
ct-11260	20	11	from	from	ADP
ct-11260	20	12	timoney	timoney	NOUN
ct-11260	20	13	media	medium	NOUN
ct-11260	20	14	after	after	ADP
ct-11260	20	15	at	at	ADP
ct-11260	20	16	least	least	ADJ
ct-11260	20	17	48	48	NUM
ct-11260	20	18	-	-	PUNCT
ct-11260	20	19	hr	hr	NOUN
ct-11260	20	20	incubation	incubation	NOUN
ct-11260	20	21	.	.	PUNCT
ct-11260	21	1	the	the	DET
ct-11260	21	2	presence	presence	NOUN
ct-11260	21	3	of	of	ADP
ct-11260	21	4	catalase	catalase	NOUN
ct-11260	21	5	activity	activity	NOUN
ct-11260	21	6	was	be	AUX
ct-11260	21	7	determined	determine	VERB
ct-11260	21	8	by	by	ADP
ct-11260	21	9	exposing	expose	VERB
ct-11260	21	10	selected	select	VERB
ct-11260	21	11	bacterial	bacterial	ADJ
ct-11260	21	12	colonies	colony	NOUN
ct-11260	21	13	to	to	ADP
ct-11260	21	14	3	3	NUM
ct-11260	21	15	%	%	NOUN
ct-11260	21	16	(	(	PUNCT
ct-11260	21	17	v	v	NOUN
ct-11260	21	18	/	/	SYM
ct-11260	21	19	v	v	NOUN
ct-11260	21	20	)	)	PUNCT
ct-11260	21	21	h2o2	h2o2	NOUN
ct-11260	21	22	and	and	CCONJ
ct-11260	21	23	observing	observe	VERB
ct-11260	21	24	the	the	DET
ct-11260	21	25	generation	generation	NOUN
ct-11260	21	26	of	of	ADP
ct-11260	21	27	oxygen	oxygen	NOUN
ct-11260	21	28	.	.	PUNCT
ct-11260	22	1	the	the	DET
ct-11260	22	2	presence	presence	NOUN
ct-11260	22	3	of	of	ADP
ct-11260	22	4	oxidase	oxidase	NOUN
ct-11260	22	5	was	be	AUX
ct-11260	22	6	determined	determine	VERB
ct-11260	22	7	using	use	VERB
ct-11260	22	8	oxoid	oxoid	PROPN
ct-11260	22	9	®	®	NOUN
ct-11260	22	10	oxidase	oxidase	NOUN
ct-11260	22	11	sticks	stick	NOUN
ct-11260	22	12	(	(	PUNCT
ct-11260	22	13	remel	remel	NOUN
ct-11260	22	14	)	)	PUNCT
ct-11260	22	15	.	.	PUNCT
ct-11260	23	1	the	the	DET
ct-11260	23	2	specific	specific	ADJ
ct-11260	23	3	alkaline	alkaline	NOUN
ct-11260	23	4	phosphatase	phosphatase	NOUN
ct-11260	23	5	(	(	PUNCT
ct-11260	23	6	alkp	alkp	NOUN
ct-11260	23	7	)	)	PUNCT
ct-11260	23	8	activity	activity	NOUN
ct-11260	23	9	present	present	ADJ
ct-11260	23	10	in	in	ADP
ct-11260	23	11	crude	crude	ADJ
ct-11260	23	12	bacterial	bacterial	ADJ
ct-11260	23	13	extracts	extract	NOUN
ct-11260	23	14	was	be	AUX
ct-11260	23	15	measured	measure	VERB
ct-11260	23	16	in	in	ADP
ct-11260	23	17	quadruplicate	quadruplicate	NOUN
ct-11260	23	18	using	use	VERB
ct-11260	23	19	a	a	DET
ct-11260	23	20	0.2	0.2	NUM
ct-11260	23	21	ml	ml	NOUN
ct-11260	23	22	discontinuous	discontinuous	ADJ
ct-11260	23	23	colorimetric	colorimetric	ADJ
ct-11260	23	24	assay	assay	NOUN
ct-11260	23	25	consisting	consist	VERB
ct-11260	23	26	of	of	ADP
ct-11260	23	27	100	100	NUM
ct-11260	23	28	mm	mm	NOUN
ct-11260	23	29	tris	tris	NOUN
ct-11260	23	30	ph	ph	VERB
ct-11260	23	31	10.0	10.0	NUM
ct-11260	23	32	,	,	PUNCT
ct-11260	23	33	1	1	NUM
ct-11260	23	34	mm	mm	NOUN
ct-11260	23	35	mgcl2	mgcl2	PROPN
ct-11260	23	36	,	,	PUNCT
ct-11260	23	37	2	2	NUM
ct-11260	23	38	mm	mm	NOUN
ct-11260	23	39	p	p	NOUN
ct-11260	23	40	-	-	PUNCT
ct-11260	23	41	nitrophenylphosphate	nitrophenylphosphate	NOUN
ct-11260	23	42	(	(	PUNCT
ct-11260	23	43	pnpp	pnpp	PROPN
ct-11260	23	44	)	)	PUNCT
ct-11260	23	45	,	,	PUNCT
ct-11260	23	46	and	and	CCONJ
ct-11260	23	47	varying	vary	VERB
ct-11260	23	48	amounts	amount	NOUN
ct-11260	23	49	of	of	ADP
ct-11260	23	50	suspended	suspend	VERB
ct-11260	23	51	bacteria	bacteria	NOUN
ct-11260	23	52	.	.	PUNCT
ct-11260	24	1	the	the	DET
ct-11260	24	2	mixtures	mixture	NOUN
ct-11260	24	3	were	be	AUX
ct-11260	24	4	incubated	incubate	VERB
ct-11260	24	5	at	at	ADP
ct-11260	24	6	37	37	NUM
ct-11260	24	7	c	c	NOUN
ct-11260	24	8	for	for	ADP
ct-11260	24	9	15	15	NUM
ct-11260	24	10	min	min	NOUN
ct-11260	24	11	with	with	ADP
ct-11260	24	12	constant	constant	ADJ
ct-11260	24	13	agitation	agitation	NOUN
ct-11260	24	14	after	after	ADP
ct-11260	24	15	which	which	DET
ct-11260	24	16	time	time	NOUN
ct-11260	24	17	the	the	DET
ct-11260	24	18	concentration	concentration	NOUN
ct-11260	24	19	of	of	ADP
ct-11260	24	20	liberated	liberate	VERB
ct-11260	24	21	p	p	NOUN
ct-11260	24	22	-	-	PUNCT
ct-11260	24	23	nitrophenol	nitrophenol	NOUN
ct-11260	24	24	(	(	PUNCT
ct-11260	24	25	pnp	pnp	PROPN
ct-11260	24	26	)	)	PUNCT
ct-11260	24	27	was	be	AUX
ct-11260	24	28	determined	determine	VERB
ct-11260	24	29	at	at	ADP
ct-11260	24	30	405	405	NUM
ct-11260	24	31	nm	nm	NOUN
ct-11260	24	32	using	use	VERB
ct-11260	24	33	a	a	DET
ct-11260	24	34	model	model	NOUN
ct-11260	24	35	680	680	NUM
ct-11260	24	36	microplate	microplate	NOUN
ct-11260	24	37	reader	reader	NOUN
ct-11260	24	38	(	(	PUNCT
ct-11260	24	39	biorad	biorad	PROPN
ct-11260	24	40	carlsbad	carlsbad	PROPN
ct-11260	24	41	,	,	PUNCT
ct-11260	24	42	ca	ca	PROPN
ct-11260	24	43	)	)	PUNCT
ct-11260	24	44	and	and	CCONJ
ct-11260	24	45	a	a	DET
ct-11260	24	46	standard	standard	ADJ
ct-11260	24	47	curve	curve	NOUN
ct-11260	24	48	of	of	ADP
ct-11260	24	49	known	know	VERB
ct-11260	24	50	concentrations	concentration	NOUN
ct-11260	24	51	of	of	ADP
ct-11260	24	52	pnp	pnp	PROPN
ct-11260	24	53	.	.	PUNCT
ct-11260	25	1	the	the	DET
ct-11260	25	2	protein	protein	NOUN
ct-11260	25	3	concentration	concentration	NOUN
ct-11260	25	4	was	be	AUX
ct-11260	25	5	determined	determine	VERB
ct-11260	25	6	using	use	VERB
ct-11260	25	7	the	the	DET
ct-11260	25	8	bicinchoninic	bicinchoninic	ADJ
ct-11260	25	9	acid	acid	NOUN
ct-11260	25	10	technique	technique	NOUN
ct-11260	25	11	as	as	SCONJ
ct-11260	25	12	previously	previously	ADV
ct-11260	25	13	described18	described18	ADJ
ct-11260	25	14	using	use	VERB
ct-11260	25	15	a	a	DET
ct-11260	25	16	bsa	bsa	PROPN
ct-11260	25	17	standard	standard	NOUN
ct-11260	25	18	.	.	PUNCT
ct-11260	26	1	the	the	DET
ct-11260	26	2	conditions	condition	NOUN
ct-11260	26	3	used	use	VERB
ct-11260	26	4	for	for	ADP
ct-11260	26	5	alkp	alkp	NOUN
ct-11260	26	6	determination	determination	NOUN
ct-11260	26	7	were	be	AUX
ct-11260	26	8	identical	identical	ADJ
ct-11260	26	9	to	to	ADP
ct-11260	26	10	those	those	PRON
ct-11260	26	11	at	at	ADP
ct-11260	26	12	which	which	PRON
ct-11260	26	13	significantly	significantly	ADV
ct-11260	26	14	enhanced	enhance	VERB
ct-11260	26	15	alkp	alkp	NOUN
ct-11260	26	16	activity	activity	NOUN
ct-11260	26	17	was	be	AUX
ct-11260	26	18	noted	note	VERB
ct-11260	26	19	for	for	ADP
ct-11260	26	20	the	the	DET
ct-11260	26	21	purified	purified	ADJ
ct-11260	26	22	recombinant	recombinant	ADJ
ct-11260	26	23	t.	t.	PROPN
ct-11260	26	24	equigenitalis	equigenitalis	PROPN
ct-11260	26	25	alkp	alkp	PROPN
ct-11260	26	26	(	(	PUNCT
ct-11260	26	27	unpublished	unpublished	ADJ
ct-11260	26	28	results	result	NOUN
ct-11260	26	29	)	)	PUNCT
ct-11260	26	30	.	.	PUNCT
ct-11260	27	1	chromosomal	chromosomal	ADJ
ct-11260	27	2	dna	dna	PROPN
ct-11260	27	3	used	use	VERB
ct-11260	27	4	for	for	ADP
ct-11260	27	5	pcr	pcr	NOUN
ct-11260	27	6	and	and	CCONJ
ct-11260	27	7	sequencing	sequencing	NOUN
ct-11260	27	8	was	be	AUX
ct-11260	27	9	initially	initially	ADV
ct-11260	27	10	isolated	isolate	VERB
ct-11260	27	11	from	from	ADP
ct-11260	27	12	48	48	NUM
ct-11260	27	13	-	-	SYM
ct-11260	27	14	72	72	NUM
ct-11260	27	15	hr	hr	NOUN
ct-11260	27	16	cultures	culture	NOUN
ct-11260	27	17	using	use	VERB
ct-11260	27	18	a	a	DET
ct-11260	27	19	wizard	wizard	ADJ
ct-11260	27	20	genomic	genomic	ADJ
ct-11260	27	21	dna	dna	NOUN
ct-11260	27	22	purification	purification	NOUN
ct-11260	27	23	kit	kit	NOUN
ct-11260	27	24	according	accord	VERB
ct-11260	27	25	to	to	ADP
ct-11260	27	26	the	the	DET
ct-11260	27	27	manufacturer	manufacturer	NOUN
ct-11260	27	28	’s	’s	PART
ct-11260	27	29	protocol	protocol	NOUN
ct-11260	27	30	(	(	PUNCT
ct-11260	27	31	promega	promega	PROPN
ct-11260	27	32	,	,	PUNCT
ct-11260	27	33	madison	madison	PROPN
ct-11260	27	34	,	,	PUNCT
ct-11260	27	35	wi	wi	PROPN
ct-11260	27	36	)	)	PUNCT
ct-11260	27	37	.	.	PUNCT
ct-11260	28	1	primers	primer	NOUN
ct-11260	28	2	isr	isr	PROPN
ct-11260	28	3	-	-	PUNCT
ct-11260	28	4	f	f	X
ct-11260	28	5	(	(	PUNCT
ct-11260	28	6	5	5	NUM
ct-11260	28	7	’	'	PUNCT
ct-11260	28	8	ctggggtgaagtcgtaacaag	ctggggtgaagtcgtaacaag	NOUN
ct-11260	28	9	)	)	PUNCT
ct-11260	28	10	and	and	CCONJ
ct-11260	28	11	isr	isr	NOUN
ct-11260	28	12	-	-	PUNCT
ct-11260	28	13	r	r	NOUN
ct-11260	28	14	(	(	PUNCT
ct-11260	28	15	5	5	NUM
ct-11260	28	16	’	'	PUNCT
ct-11260	28	17	tgtgatcgccaaggcatccacc	tgtgatcgccaaggcatccacc	ADJ
ct-11260	28	18	)	)	PUNCT
ct-11260	28	19	were	be	AUX
ct-11260	28	20	used	use	VERB
ct-11260	28	21	for	for	ADP
ct-11260	28	22	pcr	pcr	ADJ
ct-11260	28	23	amplification	amplification	NOUN
ct-11260	28	24	of	of	ADP
ct-11260	28	25	isr	isr	ADJ
ct-11260	28	26	dna	dna	PROPN
ct-11260	28	27	as	as	SCONJ
ct-11260	28	28	described	describe	VERB
ct-11260	28	29	by	by	ADP
ct-11260	28	30	tazumi	tazumi	NOUN
ct-11260	28	31	et	et	NOUN
ct-11260	28	32	al.19	al.19	ADV
ct-11260	28	33	briefly	briefly	ADV
ct-11260	28	34	,	,	PUNCT
ct-11260	28	35	50	50	NUM
ct-11260	28	36	ng	ng	PROPN
ct-11260	28	37	total	total	ADJ
ct-11260	28	38	genomic	genomic	ADJ
ct-11260	28	39	dna	dna	PROPN
ct-11260	28	40	was	be	AUX
ct-11260	28	41	used	use	VERB
ct-11260	28	42	as	as	ADP
ct-11260	28	43	template	template	NOUN
ct-11260	28	44	with	with	ADP
ct-11260	28	45	20	20	NUM
ct-11260	28	46	pmol	pmol	NOUN
ct-11260	28	47	of	of	ADP
ct-11260	28	48	each	each	DET
ct-11260	28	49	primer	primer	NOUN
ct-11260	28	50	in	in	ADP
ct-11260	28	51	standard	standard	ADJ
ct-11260	28	52	buffer	buffer	NOUN
ct-11260	28	53	conditions	condition	NOUN
ct-11260	28	54	for	for	ADP
ct-11260	28	55	phusion	phusion	PROPN
ct-11260	28	56	high	high	ADJ
ct-11260	28	57	-	-	PUNCT
ct-11260	28	58	fidelity	fidelity	NOUN
ct-11260	28	59	dna	dna	NOUN
ct-11260	28	60	polymerase	polymerase	NOUN
ct-11260	28	61	(	(	PUNCT
ct-11260	28	62	new	new	PROPN
ct-11260	28	63	england	england	PROPN
ct-11260	28	64	biolabs	biolabs	PROPN
ct-11260	28	65	,	,	PUNCT
ct-11260	28	66	ipswich	ipswich	PROPN
ct-11260	28	67	,	,	PUNCT
ct-11260	28	68	ma	ma	PROPN
ct-11260	28	69	)	)	PUNCT
ct-11260	28	70	.	.	PUNCT
ct-11260	29	1	following	follow	VERB
ct-11260	29	2	an	an	DET
ct-11260	29	3	initial	initial	ADJ
ct-11260	29	4	denaturation	denaturation	NOUN
ct-11260	29	5	step	step	NOUN
ct-11260	29	6	of	of	ADP
ct-11260	29	7	98	98	NUM
ct-11260	29	8	c	c	VERB
ct-11260	29	9	for	for	ADP
ct-11260	29	10	30	30	NUM
ct-11260	29	11	s	s	NOUN
ct-11260	29	12	,	,	PUNCT
ct-11260	29	13	amplification	amplification	NOUN
ct-11260	29	14	was	be	AUX
ct-11260	29	15	achieved	achieve	VERB
ct-11260	29	16	by	by	ADP
ct-11260	29	17	30	30	NUM
ct-11260	29	18	cycles	cycle	NOUN
ct-11260	29	19	of	of	ADP
ct-11260	29	20	clinical	clinical	ADJ
ct-11260	29	21	theriogenology	theriogenology	NOUN
ct-11260	29	22	•	•	NOUN
ct-11260	29	23	volume	volume	NOUN
ct-11260	29	24	4	4	NUM
ct-11260	29	25	number	number	NOUN
ct-11260	29	26	2	2	NUM
ct-11260	29	27	•	•	NOUN
ct-11260	29	28	june	june	PROPN
ct-11260	29	29	2012	2012	NUM
ct-11260	29	30	164	164	NUM
ct-11260	29	31	  	  	SPACE
ct-11260	29	32	the	the	DET
ct-11260	29	33	following	follow	VERB
ct-11260	29	34	parameters	parameter	NOUN
ct-11260	29	35	:	:	PUNCT
ct-11260	29	36	98	98	NUM
ct-11260	29	37	c	c	VERB
ct-11260	29	38	for	for	ADP
ct-11260	29	39	10	10	NUM
ct-11260	29	40	s	s	NOUN
ct-11260	29	41	,	,	PUNCT
ct-11260	29	42	57	57	NUM
ct-11260	29	43	c	c	NOUN
ct-11260	29	44	for	for	ADP
ct-11260	29	45	30	30	NUM
ct-11260	29	46	s	s	NOUN
ct-11260	29	47	and	and	CCONJ
ct-11260	29	48	72	72	NUM
ct-11260	29	49	c	c	NOUN
ct-11260	29	50	for	for	ADP
ct-11260	29	51	30	30	NUM
ct-11260	29	52	s.	s.	NOUN
ct-11260	29	53	the	the	DET
ct-11260	29	54	resulting	result	VERB
ct-11260	29	55	amplicons	amplicon	NOUN
ct-11260	29	56	were	be	AUX
ct-11260	29	57	purified	purify	VERB
ct-11260	29	58	(	(	PUNCT
ct-11260	29	59	qiaquick	qiaquick	NOUN
ct-11260	29	60	spin	spin	NOUN
ct-11260	29	61	column	column	PROPN
ct-11260	29	62	,	,	PUNCT
ct-11260	29	63	qiagen	qiagen	PROPN
ct-11260	29	64	,	,	PUNCT
ct-11260	29	65	valencia	valencia	PROPN
ct-11260	29	66	ca	can	AUX
ct-11260	29	67	)	)	PUNCT
ct-11260	29	68	and	and	CCONJ
ct-11260	29	69	ligated	ligate	VERB
ct-11260	29	70	into	into	ADP
ct-11260	29	71	the	the	DET
ct-11260	29	72	positive	positive	ADJ
ct-11260	29	73	selection	selection	NOUN
ct-11260	29	74	vector	vector	NOUN
ct-11260	29	75	pjet1.2	pjet1.2	NUM
ct-11260	29	76	(	(	PUNCT
ct-11260	29	77	fermentas	fermenta	NOUN
ct-11260	29	78	,	,	PUNCT
ct-11260	29	79	glen	glen	PROPN
ct-11260	29	80	burnie	burnie	PROPN
ct-11260	29	81	,	,	PUNCT
ct-11260	29	82	md	md	PROPN
ct-11260	29	83	)	)	PUNCT
ct-11260	29	84	.	.	PUNCT
ct-11260	30	1	after	after	ADP
ct-11260	30	2	transformation	transformation	NOUN
ct-11260	30	3	of	of	ADP
ct-11260	30	4	escherichia	escherichia	NOUN
ct-11260	30	5	coli	coli	NOUN
ct-11260	30	6	dh10b	dh10b	NOUN
ct-11260	30	7	competent	competent	ADJ
ct-11260	30	8	cells	cell	NOUN
ct-11260	30	9	(	(	PUNCT
ct-11260	30	10	invitrogen	invitrogen	PROPN
ct-11260	30	11	,	,	PUNCT
ct-11260	30	12	calsbad	calsbad	INTJ
ct-11260	30	13	,	,	PUNCT
ct-11260	30	14	ca	ca	NOUN
ct-11260	30	15	)	)	PUNCT
ct-11260	30	16	,	,	PUNCT
ct-11260	30	17	plasmid	plasmid	VERB
ct-11260	30	18	dna	dna	NOUN
ct-11260	30	19	from	from	ADP
ct-11260	30	20	individual	individual	ADJ
ct-11260	30	21	colonies	colony	NOUN
ct-11260	30	22	was	be	AUX
ct-11260	30	23	prepared	prepare	VERB
ct-11260	30	24	(	(	PUNCT
ct-11260	30	25	qiagen	qiagen	NOUN
ct-11260	30	26	)	)	PUNCT
ct-11260	30	27	and	and	CCONJ
ct-11260	30	28	used	use	VERB
ct-11260	30	29	as	as	ADP
ct-11260	30	30	template	template	NOUN
ct-11260	30	31	for	for	ADP
ct-11260	30	32	dna	dna	NOUN
ct-11260	30	33	sequencing	sequence	VERB
ct-11260	30	34	using	use	VERB
ct-11260	30	35	vector	vector	NOUN
ct-11260	30	36	-	-	PUNCT
ct-11260	30	37	derived	derive	VERB
ct-11260	30	38	primers	primer	NOUN
ct-11260	30	39	and	and	CCONJ
ct-11260	30	40	bigdye	bigdye	NOUN
ct-11260	30	41	terminator	terminator	NOUN
ct-11260	30	42	chemistry	chemistry	NOUN
ct-11260	30	43	.	.	PUNCT
ct-11260	31	1	sequencing	sequence	VERB
ct-11260	31	2	was	be	AUX
ct-11260	31	3	performed	perform	VERB
ct-11260	31	4	at	at	ADP
ct-11260	31	5	the	the	DET
ct-11260	31	6	dna	dna	PROPN
ct-11260	31	7	core	core	NOUN
ct-11260	31	8	facility	facility	NOUN
ct-11260	31	9	at	at	ADP
ct-11260	31	10	the	the	DET
ct-11260	31	11	university	university	PROPN
ct-11260	31	12	of	of	ADP
ct-11260	31	13	missouri	missouri	PROPN
ct-11260	31	14	-	-	PROPN
ct-11260	31	15	columbia	columbia	PROPN
ct-11260	31	16	on	on	ADP
ct-11260	31	17	a	a	DET
ct-11260	31	18	pe	pe	PROPN
ct-11260	31	19	biosystems	biosystems	PROPN
ct-11260	31	20	3730	3730	NUM
ct-11260	31	21	capillary	capillary	ADJ
ct-11260	31	22	dna	dna	NOUN
ct-11260	31	23	sequencer	sequencer	NOUN
ct-11260	31	24	.	.	PUNCT
ct-11260	32	1	the	the	DET
ct-11260	32	2	resulting	result	VERB
ct-11260	32	3	dna	dna	PROPN
ct-11260	32	4	sequences	sequence	NOUN
ct-11260	32	5	were	be	AUX
ct-11260	32	6	queried	query	VERB
ct-11260	32	7	against	against	ADP
ct-11260	32	8	entries	entry	NOUN
ct-11260	32	9	in	in	ADP
ct-11260	32	10	genbank	genbank	PROPN
ct-11260	32	11	available	available	ADJ
ct-11260	32	12	through	through	ADP
ct-11260	32	13	the	the	DET
ct-11260	32	14	national	national	ADJ
ct-11260	32	15	center	center	NOUN
ct-11260	32	16	for	for	ADP
ct-11260	32	17	biotechnology	biotechnology	NOUN
ct-11260	32	18	information	information	NOUN
ct-11260	32	19	.	.	PUNCT
ct-11260	33	1	the	the	DET
ct-11260	33	2	isr	isr	ADJ
ct-11260	33	3	sequences	sequence	NOUN
ct-11260	33	4	reported	report	VERB
ct-11260	33	5	herein	herein	NOUN
ct-11260	33	6	have	have	AUX
ct-11260	33	7	been	be	AUX
ct-11260	33	8	deposited	deposit	VERB
ct-11260	33	9	in	in	ADP
ct-11260	33	10	genbank	genbank	NOUN
ct-11260	33	11	under	under	ADP
ct-11260	33	12	accession	accession	NOUN
ct-11260	33	13	numbers	number	NOUN
ct-11260	33	14	jq783350	jq783350	PROPN
ct-11260	33	15	and	and	CCONJ
ct-11260	33	16	jq783351	jq783351	PROPN
ct-11260	33	17	.	.	PUNCT
ct-11260	34	1	additional	additional	ADJ
ct-11260	34	2	confirmatory	confirmatory	NOUN
ct-11260	34	3	tests	test	NOUN
ct-11260	34	4	were	be	AUX
ct-11260	34	5	performed	perform	VERB
ct-11260	34	6	at	at	ADP
ct-11260	34	7	nvsl	nvsl	PROPN
ct-11260	34	8	.	.	PUNCT
ct-11260	35	1	these	these	DET
ct-11260	35	2	tests	test	NOUN
ct-11260	35	3	included	include	VERB
ct-11260	35	4	16s	16	NOUN
ct-11260	35	5	ribosomal	ribosomal	NOUN
ct-11260	35	6	dna	dna	PROPN
ct-11260	35	7	(	(	PUNCT
ct-11260	35	8	rdna	rdna	NOUN
ct-11260	35	9	)	)	PUNCT
ct-11260	35	10	sequencing	sequence	VERB
ct-11260	35	11	,	,	PUNCT
ct-11260	35	12	slide	slide	NOUN
ct-11260	35	13	agglutination	agglutination	NOUN
ct-11260	35	14	test	test	NOUN
ct-11260	35	15	(	(	PUNCT
ct-11260	35	16	monotayl	monotayl	ADJ
ct-11260	35	17	,	,	PUNCT
ct-11260	35	18	bionor	bionor	NOUN
ct-11260	35	19	laboratories	laboratory	NOUN
ct-11260	35	20	as	as	ADP
ct-11260	35	21	,	,	PUNCT
ct-11260	35	22	skien	skien	NOUN
ct-11260	35	23	,	,	PUNCT
ct-11260	35	24	norway	norway	PROPN
ct-11260	35	25	)	)	PUNCT
ct-11260	35	26	,	,	PUNCT
ct-11260	35	27	and	and	CCONJ
ct-11260	35	28	direct	direct	ADJ
ct-11260	35	29	fluorescent	fluorescent	NOUN
ct-11260	35	30	antibody	antibody	NOUN
ct-11260	35	31	testing	testing	NOUN
ct-11260	35	32	using	use	VERB
ct-11260	35	33	polyclonal	polyclonal	ADJ
ct-11260	35	34	antibody	antibody	NOUN
ct-11260	35	35	conjugate	conjugate	VERB
ct-11260	35	36	.	.	PUNCT
ct-11260	36	1	to	to	PART
ct-11260	36	2	assess	assess	VERB
ct-11260	36	3	for	for	ADP
ct-11260	36	4	streptomycin	streptomycin	PROPN
ct-11260	36	5	susceptibility	susceptibility	NOUN
ct-11260	36	6	,	,	PUNCT
ct-11260	36	7	bacterial	bacterial	ADJ
ct-11260	36	8	isolates	isolate	NOUN
ct-11260	36	9	were	be	AUX
ct-11260	36	10	plated	plate	VERB
ct-11260	36	11	on	on	ADP
ct-11260	36	12	chocolated	chocolate	VERB
ct-11260	36	13	eugon	eugon	NOUN
ct-11260	36	14	agar	agar	NOUN
ct-11260	36	15	with	with	ADP
ct-11260	36	16	or	or	CCONJ
ct-11260	36	17	without	without	ADP
ct-11260	36	18	streptomycin	streptomycin	PROPN
ct-11260	36	19	at	at	ADP
ct-11260	36	20	200	200	NUM
ct-11260	36	21	μg	μg	NOUN
ct-11260	36	22	/	/	SYM
ct-11260	36	23	ml	ml	ADP
ct-11260	36	24	final	final	ADJ
ct-11260	36	25	concentration	concentration	NOUN
ct-11260	36	26	.	.	PUNCT
ct-11260	37	1	plates	plate	NOUN
ct-11260	37	2	were	be	AUX
ct-11260	37	3	incubated	incubate	VERB
ct-11260	37	4	at	at	ADP
ct-11260	37	5	37	37	NUM
ct-11260	37	6	°	°	NOUN
ct-11260	37	7	c	c	NOUN
ct-11260	37	8	in	in	ADP
ct-11260	37	9	5	5	NUM
ct-11260	37	10	%	%	NOUN
ct-11260	37	11	(	(	PUNCT
ct-11260	37	12	v	v	NOUN
ct-11260	37	13	/	/	SYM
ct-11260	37	14	v	v	NOUN
ct-11260	37	15	)	)	PUNCT
ct-11260	37	16	co2	co2	VERB
ct-11260	37	17	for	for	ADP
ct-11260	37	18	at	at	ADV
ct-11260	37	19	least	least	ADV
ct-11260	37	20	seven	seven	NUM
ct-11260	37	21	days	day	NOUN
ct-11260	37	22	.	.	PUNCT
ct-11260	38	1	any	any	DET
ct-11260	38	2	growth	growth	NOUN
ct-11260	38	3	in	in	ADP
ct-11260	38	4	the	the	DET
ct-11260	38	5	presence	presence	NOUN
ct-11260	38	6	of	of	ADP
ct-11260	38	7	streptomycin	streptomycin	PROPN
ct-11260	38	8	indicated	indicate	VERB
ct-11260	38	9	resistance	resistance	NOUN
ct-11260	38	10	.	.	PUNCT
ct-11260	39	1	pulsed	pulse	VERB
ct-11260	39	2	-	-	PUNCT
ct-11260	39	3	field	field	NOUN
ct-11260	39	4	gel	gel	NOUN
ct-11260	39	5	electrophoresis	electrophoresis	NOUN
ct-11260	39	6	(	(	PUNCT
ct-11260	39	7	pfge	pfge	NOUN
ct-11260	39	8	,	,	PUNCT
ct-11260	39	9	chef	chef	NOUN
ct-11260	39	10	-	-	PUNCT
ct-11260	39	11	dr	dr	PROPN
ct-11260	39	12	ii	ii	PROPN
ct-11260	39	13	system	system	NOUN
ct-11260	39	14	,	,	PUNCT
ct-11260	39	15	biorad	biorad	NOUN
ct-11260	39	16	,	,	PUNCT
ct-11260	39	17	carlsbad	carlsbad	PROPN
ct-11260	39	18	,	,	PUNCT
ct-11260	39	19	ca	ca	NOUN
ct-11260	39	20	)	)	PUNCT
ct-11260	39	21	techniques	technique	NOUN
ct-11260	39	22	to	to	PART
ct-11260	39	23	determine	determine	VERB
ct-11260	39	24	the	the	DET
ct-11260	39	25	relatedness	relatedness	NOUN
ct-11260	39	26	of	of	ADP
ct-11260	39	27	taylorella	taylorella	NOUN
ct-11260	39	28	strains	strain	NOUN
ct-11260	39	29	have	have	AUX
ct-11260	39	30	been	be	AUX
ct-11260	39	31	described	describe	VERB
ct-11260	39	32	previously.4	previously.4	NOUN
ct-11260	39	33	briefly	briefly	ADV
ct-11260	39	34	,	,	PUNCT
ct-11260	39	35	cell	cell	NOUN
ct-11260	39	36	suspensions	suspension	NOUN
ct-11260	39	37	in	in	ADP
ct-11260	39	38	100	100	NUM
ct-11260	39	39	mm	mm	NOUN
ct-11260	39	40	tris	tris	NOUN
ct-11260	39	41	hcl	hcl	PROPN
ct-11260	39	42	100	100	NUM
ct-11260	39	43	mm	mm	PROPN
ct-11260	39	44	edta	edta	NOUN
ct-11260	39	45	,	,	PUNCT
ct-11260	39	46	ph	ph	PROPN
ct-11260	39	47	8.0	8.0	NUM
ct-11260	39	48	from	from	ADP
ct-11260	39	49	72	72	NUM
ct-11260	39	50	-	-	SYM
ct-11260	39	51	96	96	NUM
ct-11260	39	52	hour	hour	NOUN
ct-11260	39	53	cultures	culture	NOUN
ct-11260	39	54	grown	grow	VERB
ct-11260	39	55	on	on	ADP
ct-11260	39	56	timoney	timoney	NOUN
ct-11260	39	57	media	medium	NOUN
ct-11260	39	58	were	be	AUX
ct-11260	39	59	used	use	VERB
ct-11260	39	60	to	to	PART
ct-11260	39	61	prepare	prepare	VERB
ct-11260	39	62	agarose	agarose	NOUN
ct-11260	39	63	plugs	plug	NOUN
ct-11260	39	64	containing	contain	VERB
ct-11260	39	65	genomic	genomic	ADJ
ct-11260	39	66	dna	dna	NOUN
ct-11260	39	67	.	.	PUNCT
ct-11260	40	1	the	the	DET
ct-11260	40	2	dna	dna	NOUN
ct-11260	40	3	-	-	PUNCT
ct-11260	40	4	containing	contain	VERB
ct-11260	40	5	plugs	plug	NOUN
ct-11260	40	6	were	be	AUX
ct-11260	40	7	incubated	incubate	VERB
ct-11260	40	8	with	with	ADP
ct-11260	40	9	the	the	DET
ct-11260	40	10	restriction	restriction	NOUN
ct-11260	40	11	enzyme	enzyme	NOUN
ct-11260	40	12	not	not	PART
ct-11260	40	13	i	i	PRON
ct-11260	40	14	(	(	PUNCT
ct-11260	40	15	invitrogen	invitrogen	PROPN
ct-11260	40	16	,	,	PUNCT
ct-11260	40	17	carlsbad	carlsbad	PROPN
ct-11260	40	18	,	,	PUNCT
ct-11260	40	19	ca	ca	NOUN
ct-11260	40	20	)	)	PUNCT
ct-11260	40	21	at	at	ADP
ct-11260	40	22	37	37	NUM
ct-11260	40	23	°	°	NOUN
ct-11260	40	24	c	c	NOUN
ct-11260	40	25	.	.	PUNCT
ct-11260	40	26	resulting	result	VERB
ct-11260	40	27	pfge	pfge	NOUN
ct-11260	40	28	patterns	pattern	NOUN
ct-11260	40	29	were	be	AUX
ct-11260	40	30	standardized	standardize	VERB
ct-11260	40	31	with	with	ADP
ct-11260	40	32	a	a	DET
ct-11260	40	33	universal	universal	ADJ
ct-11260	40	34	sized	sized	ADJ
ct-11260	40	35	standard	standard	ADJ
ct-11260	40	36	salmonella	salmonella	PROPN
ct-11260	40	37	enterica	enterica	PROPN
ct-11260	40	38	subsp	subsp	PROPN
ct-11260	40	39	.	.	PUNCT
ct-11260	41	1	enterica	enterica	PROPN
ct-11260	41	2	serovar	serovar	PROPN
ct-11260	41	3	braenderup	braenderup	NOUN
ct-11260	41	4	h9812	h9812	PROPN
ct-11260	41	5	and	and	CCONJ
ct-11260	41	6	analyzed	analyze	VERB
ct-11260	41	7	(	(	PUNCT
ct-11260	41	8	bionumerics	bionumeric	NOUN
ct-11260	41	9	,	,	PUNCT
ct-11260	41	10	applied	apply	VERB
ct-11260	41	11	maths	math	NOUN
ct-11260	41	12	,	,	PUNCT
ct-11260	41	13	austin	austin	PROPN
ct-11260	41	14	tx	tx	PROPN
ct-11260	41	15	)	)	PUNCT
ct-11260	41	16	.	.	PUNCT
ct-11260	42	1	a	a	DET
ct-11260	42	2	dendogram	dendogram	NOUN
ct-11260	42	3	was	be	AUX
ct-11260	42	4	created	create	VERB
ct-11260	42	5	using	use	VERB
ct-11260	42	6	dice	dice	NOUN
ct-11260	42	7	’s	’s	PART
ct-11260	42	8	coefficient	coefficient	NOUN
ct-11260	42	9	and	and	CCONJ
ct-11260	42	10	upgma	upgma	PROPN
ct-11260	42	11	based	base	VERB
ct-11260	42	12	on	on	ADP
ct-11260	42	13	band	band	NOUN
ct-11260	42	14	position	position	NOUN
ct-11260	42	15	tolerance	tolerance	NOUN
ct-11260	42	16	values	value	NOUN
ct-11260	42	17	of	of	ADP
ct-11260	42	18	1.5	1.5	NUM
ct-11260	42	19	%	%	NOUN
ct-11260	42	20	.	.	PUNCT
ct-11260	43	1	results	result	NOUN
ct-11260	43	2	and	and	CCONJ
ct-11260	43	3	discussion	discussion	NOUN
ct-11260	43	4	assessed	assess	VERB
ct-11260	43	5	after	after	ADP
ct-11260	43	6	48	48	NUM
ct-11260	43	7	-	-	SYM
ct-11260	43	8	72	72	NUM
ct-11260	43	9	hours	hour	NOUN
ct-11260	43	10	of	of	ADP
ct-11260	43	11	incubation	incubation	NOUN
ct-11260	43	12	at	at	ADP
ct-11260	43	13	37	37	NUM
ct-11260	43	14	°	°	NOUN
ct-11260	43	15	c	c	NOUN
ct-11260	43	16	in	in	ADP
ct-11260	43	17	5	5	NUM
ct-11260	43	18	%	%	NOUN
ct-11260	43	19	(	(	PUNCT
ct-11260	43	20	v	v	NOUN
ct-11260	43	21	/	/	SYM
ct-11260	43	22	v	v	NOUN
ct-11260	43	23	)	)	PUNCT
ct-11260	43	24	co2	co2	NOUN
ct-11260	43	25	,	,	PUNCT
ct-11260	43	26	the	the	DET
ct-11260	43	27	umc-1	umc-1	SYM
ct-11260	43	28	isolate	isolate	NOUN
ct-11260	43	29	along	along	ADV
ct-11260	43	30	with	with	ADP
ct-11260	43	31	both	both	DET
ct-11260	43	32	t.	t.	NOUN
ct-11260	43	33	equigenitalis	equigenitalis	PROPN
ct-11260	43	34	and	and	CCONJ
ct-11260	43	35	t.	t.	PROPN
ct-11260	43	36	asinigenitalis	asinigenitalis	PROPN
ct-11260	43	37	control	control	VERB
ct-11260	43	38	strains	strain	NOUN
ct-11260	43	39	were	be	AUX
ct-11260	43	40	gram	gram	NOUN
ct-11260	43	41	-	-	PUNCT
ct-11260	43	42	negative	negative	ADJ
ct-11260	43	43	,	,	PUNCT
ct-11260	43	44	nonmotile	nonmotile	ADJ
ct-11260	43	45	coccobacillary	coccobacillary	ADJ
ct-11260	43	46	organisms	organism	NOUN
ct-11260	43	47	.	.	PUNCT
ct-11260	44	1	all	all	DET
ct-11260	44	2	three	three	NUM
ct-11260	44	3	isolates	isolate	NOUN
ct-11260	44	4	were	be	AUX
ct-11260	44	5	strongly	strongly	ADV
ct-11260	44	6	oxidase	oxidase	NOUN
ct-11260	44	7	and	and	CCONJ
ct-11260	44	8	catalase	catalase	VERB
ct-11260	44	9	positive	positive	ADJ
ct-11260	44	10	resulting	result	VERB
ct-11260	44	11	in	in	ADP
ct-11260	44	12	a	a	DET
ct-11260	44	13	rapid	rapid	ADJ
ct-11260	44	14	darkening	darken	VERB
ct-11260	44	15	color	color	NOUN
ct-11260	44	16	of	of	ADP
ct-11260	44	17	the	the	DET
ct-11260	44	18	oxidase	oxidase	NOUN
ct-11260	44	19	stick	stick	NOUN
ct-11260	44	20	and	and	CCONJ
ct-11260	44	21	generation	generation	NOUN
ct-11260	44	22	of	of	ADP
ct-11260	44	23	copious	copious	ADJ
ct-11260	44	24	amounts	amount	NOUN
ct-11260	44	25	of	of	ADP
ct-11260	44	26	bubbles	bubble	NOUN
ct-11260	44	27	(	(	PUNCT
ct-11260	44	28	oxygen	oxygen	NOUN
ct-11260	44	29	)	)	PUNCT
ct-11260	44	30	in	in	ADP
ct-11260	44	31	the	the	DET
ct-11260	44	32	presence	presence	NOUN
ct-11260	44	33	of	of	ADP
ct-11260	44	34	hydrogen	hydrogen	NOUN
ct-11260	44	35	peroxide	peroxide	NOUN
ct-11260	44	36	,	,	PUNCT
ct-11260	44	37	respectively	respectively	ADV
ct-11260	44	38	.	.	PUNCT
ct-11260	45	1	the	the	DET
ct-11260	45	2	three	three	NUM
ct-11260	45	3	isolates	isolate	NOUN
ct-11260	45	4	were	be	AUX
ct-11260	45	5	deemed	deem	VERB
ct-11260	45	6	streptomycin	streptomycin	PROPN
ct-11260	45	7	resistant	resistant	ADJ
ct-11260	45	8	,	,	PUNCT
ct-11260	45	9	fastidious	fastidious	ADJ
ct-11260	45	10	,	,	PUNCT
ct-11260	45	11	and	and	CCONJ
ct-11260	45	12	co2	co2	NOUN
ct-11260	45	13	-	-	PUNCT
ct-11260	45	14	dependent	dependent	ADJ
ct-11260	45	15	as	as	ADP
ct-11260	45	16	growth	growth	NOUN
ct-11260	45	17	of	of	ADP
ct-11260	45	18	the	the	DET
ct-11260	45	19	microbes	microbe	NOUN
ct-11260	45	20	was	be	AUX
ct-11260	45	21	noted	note	VERB
ct-11260	45	22	only	only	ADV
ct-11260	45	23	on	on	ADP
ct-11260	45	24	chocolated	chocolated	ADJ
ct-11260	45	25	eugon	eugon	NOUN
ct-11260	45	26	and	and	CCONJ
ct-11260	45	27	timoney	timoney	NOUN
ct-11260	45	28	agars	agar	NOUN
ct-11260	45	29	in	in	ADP
ct-11260	45	30	a	a	DET
ct-11260	45	31	humidified	humidify	VERB
ct-11260	45	32	environment	environment	NOUN
ct-11260	45	33	composed	compose	VERB
ct-11260	45	34	of	of	ADP
ct-11260	45	35	95	95	NUM
ct-11260	45	36	%	%	NOUN
ct-11260	45	37	air	air	NOUN
ct-11260	45	38	and	and	CCONJ
ct-11260	45	39	5	5	NUM
ct-11260	45	40	%	%	NOUN
ct-11260	45	41	co2	co2	NOUN
ct-11260	45	42	.	.	PUNCT
ct-11260	46	1	the	the	DET
ct-11260	46	2	growth	growth	NOUN
ct-11260	46	3	of	of	ADP
ct-11260	46	4	the	the	DET
ct-11260	46	5	isolates	isolate	NOUN
ct-11260	46	6	was	be	AUX
ct-11260	46	7	barely	barely	ADV
ct-11260	46	8	perceptible	perceptible	ADJ
ct-11260	46	9	on	on	ADP
ct-11260	46	10	blood	blood	NOUN
ct-11260	46	11	agar	agar	NOUN
ct-11260	46	12	incubated	incubate	VERB
ct-11260	46	13	in	in	ADP
ct-11260	46	14	co2	co2	NOUN
ct-11260	46	15	and	and	CCONJ
ct-11260	46	16	not	not	PART
ct-11260	46	17	at	at	ADV
ct-11260	46	18	all	all	ADV
ct-11260	46	19	on	on	ADP
ct-11260	46	20	any	any	DET
ct-11260	46	21	medium	medium	NOUN
ct-11260	46	22	cultured	cultured	ADJ
ct-11260	46	23	in	in	ADP
ct-11260	46	24	an	an	DET
ct-11260	46	25	aerobic	aerobic	ADJ
ct-11260	46	26	incubator	incubator	NOUN
ct-11260	46	27	.	.	PUNCT
ct-11260	47	1	the	the	DET
ct-11260	47	2	isolates	isolate	NOUN
ct-11260	47	3	also	also	ADV
ct-11260	47	4	failed	fail	VERB
ct-11260	47	5	to	to	PART
ct-11260	47	6	grow	grow	VERB
ct-11260	47	7	anaerobically	anaerobically	ADV
ct-11260	47	8	or	or	CCONJ
ct-11260	47	9	on	on	ADP
ct-11260	47	10	macconkey	macconkey	NOUN
ct-11260	47	11	agar	agar	NOUN
ct-11260	47	12	.	.	PUNCT
ct-11260	48	1	in	in	ADP
ct-11260	48	2	addition	addition	NOUN
ct-11260	48	3	,	,	PUNCT
ct-11260	48	4	pre	pre	ADJ
ct-11260	48	5	-	-	NOUN
ct-11260	48	6	incubation	incubation	NOUN
ct-11260	48	7	of	of	ADP
ct-11260	48	8	the	the	DET
ct-11260	48	9	isolate	isolate	NOUN
ct-11260	48	10	for	for	ADP
ct-11260	48	11	24	24	NUM
ct-11260	48	12	hours	hour	NOUN
ct-11260	48	13	on	on	ADP
ct-11260	48	14	a	a	DET
ct-11260	48	15	rich	rich	ADJ
ct-11260	48	16	medium	medium	NOUN
ct-11260	48	17	in	in	ADP
ct-11260	48	18	an	an	DET
ct-11260	48	19	air	air	NOUN
ct-11260	48	20	incubator	incubator	NOUN
ct-11260	48	21	prior	prior	ADV
ct-11260	48	22	to	to	PART
ct-11260	48	23	transfer	transfer	VERB
ct-11260	48	24	to	to	ADP
ct-11260	48	25	a	a	DET
ct-11260	48	26	co2	co2	NOUN
ct-11260	48	27	incubator	incubator	NOUN
ct-11260	48	28	failed	fail	VERB
ct-11260	48	29	to	to	PART
ct-11260	48	30	result	result	VERB
ct-11260	48	31	in	in	ADP
ct-11260	48	32	observable	observable	ADJ
ct-11260	48	33	growth	growth	NOUN
ct-11260	48	34	.	.	PUNCT
ct-11260	49	1	biochemically	biochemically	ADV
ct-11260	49	2	,	,	PUNCT
ct-11260	49	3	all	all	DET
ct-11260	49	4	three	three	NUM
ct-11260	49	5	isolates	isolate	NOUN
ct-11260	49	6	were	be	AUX
ct-11260	49	7	negative	negative	ADJ
ct-11260	49	8	in	in	ADP
ct-11260	49	9	all	all	DET
ct-11260	49	10	the	the	DET
ct-11260	49	11	tests	test	NOUN
ct-11260	49	12	included	include	VERB
ct-11260	49	13	in	in	ADP
ct-11260	49	14	a	a	DET
ct-11260	49	15	tsi	tsi	PROPN
ct-11260	49	16	series	series	NOUN
ct-11260	49	17	consisting	consist	VERB
ct-11260	49	18	of	of	ADP
ct-11260	49	19	various	various	ADJ
ct-11260	49	20	tubed	tube	VERB
ct-11260	49	21	media	medium	NOUN
ct-11260	49	22	including	include	VERB
ct-11260	49	23	triple	triple	ADJ
ct-11260	49	24	sugar	sugar	NOUN
ct-11260	49	25	iron	iron	NOUN
ct-11260	49	26	agar	agar	NOUN
ct-11260	49	27	,	,	PUNCT
ct-11260	49	28	lysine	lysine	NOUN
ct-11260	49	29	iron	iron	NOUN
ct-11260	49	30	agar	agar	NOUN
ct-11260	49	31	,	,	PUNCT
ct-11260	49	32	motilityindole	motilityindole	ADJ
ct-11260	49	33	-	-	PUNCT
ct-11260	49	34	ornithine	ornithine	ADJ
ct-11260	49	35	decarboxylase	decarboxylase	NOUN
ct-11260	49	36	agar	agar	NOUN
ct-11260	49	37	,	,	PUNCT
ct-11260	49	38	citrate	citrate	NOUN
ct-11260	49	39	and	and	CCONJ
ct-11260	49	40	urea	urea	NOUN
ct-11260	49	41	agar	agar	NOUN
ct-11260	49	42	.	.	PUNCT
ct-11260	50	1	the	the	DET
ct-11260	50	2	specific	specific	ADJ
ct-11260	50	3	alkaline	alkaline	NOUN
ct-11260	50	4	phosphatase	phosphatase	NOUN
ct-11260	50	5	activity	activity	NOUN
ct-11260	50	6	of	of	ADP
ct-11260	50	7	the	the	DET
ct-11260	50	8	umc-1	umc-1	PUNCT
ct-11260	50	9	isolate	isolate	NOUN
ct-11260	50	10	was	be	AUX
ct-11260	50	11	665	665	NUM
ct-11260	50	12	±	±	NUM
ct-11260	50	13	64	64	NUM
ct-11260	50	14	nmole	nmole	NOUN
ct-11260	50	15	pnp	pnp	PROPN
ct-11260	50	16	produced	produce	VERB
ct-11260	50	17	/	/	SYM
ct-11260	50	18	hr	hr	NOUN
ct-11260	50	19	/	/	SYM
ct-11260	50	20	mg	mg	NOUN
ct-11260	50	21	protein	protein	NOUN
ct-11260	50	22	;	;	PUNCT
ct-11260	50	23	that	that	PRON
ct-11260	50	24	of	of	ADP
ct-11260	50	25	the	the	DET
ct-11260	50	26	t.	t.	PROPN
ct-11260	50	27	asinigenitalis	asinigenitalis	PROPN
ct-11260	50	28	type	type	NOUN
ct-11260	50	29	strain	strain	NOUN
ct-11260	50	30	was	be	AUX
ct-11260	50	31	637	637	NUM
ct-11260	50	32	±	±	NUM
ct-11260	50	33	109	109	NUM
ct-11260	50	34	nmole	nmole	NOUN
ct-11260	50	35	pnp	pnp	PROPN
ct-11260	50	36	produced	produce	VERB
ct-11260	50	37	/	/	SYM
ct-11260	50	38	hr	hr	NOUN
ct-11260	50	39	/	/	SYM
ct-11260	50	40	mg	mg	PROPN
ct-11260	50	41	protein	protein	NOUN
ct-11260	50	42	.	.	PUNCT
ct-11260	51	1	the	the	DET
ct-11260	51	2	specific	specific	ADJ
ct-11260	51	3	alkaline	alkaline	NOUN
ct-11260	51	4	phosphatase	phosphatase	NOUN
ct-11260	51	5	activity	activity	NOUN
ct-11260	51	6	of	of	ADP
ct-11260	51	7	the	the	DET
ct-11260	51	8	t.	t.	PROPN
ct-11260	51	9	equigenitalis	equigenitalis	PROPN
ct-11260	51	10	type	type	NOUN
ct-11260	51	11	strain	strain	NOUN
ct-11260	51	12	was	be	AUX
ct-11260	51	13	951	951	NUM
ct-11260	51	14	±	±	NUM
ct-11260	51	15	107	107	NUM
ct-11260	51	16	nmole	nmole	NOUN
ct-11260	51	17	pnp	pnp	PROPN
ct-11260	51	18	produced	produce	VERB
ct-11260	51	19	/	/	SYM
ct-11260	51	20	hr	hr	NOUN
ct-11260	51	21	/	/	SYM
ct-11260	51	22	mg	mg	PROPN
ct-11260	51	23	protein	protein	NOUN
ct-11260	51	24	.	.	PUNCT
ct-11260	52	1	while	while	SCONJ
ct-11260	52	2	certainly	certainly	ADV
ct-11260	52	3	not	not	PART
ct-11260	52	4	definitive	definitive	ADJ
ct-11260	52	5	for	for	ADP
ct-11260	52	6	identification	identification	NOUN
ct-11260	52	7	,	,	PUNCT
ct-11260	52	8	the	the	DET
ct-11260	52	9	alkaline	alkaline	ADJ
ct-11260	52	10	phosphatase	phosphatase	NOUN
ct-11260	52	11	activity	activity	NOUN
ct-11260	52	12	of	of	ADP
ct-11260	52	13	umc-1	umc-1	PUNCT
ct-11260	52	14	was	be	AUX
ct-11260	52	15	consistently	consistently	ADV
ct-11260	52	16	most	most	ADV
ct-11260	52	17	similar	similar	ADJ
ct-11260	52	18	to	to	ADP
ct-11260	52	19	that	that	PRON
ct-11260	52	20	of	of	ADP
ct-11260	52	21	the	the	DET
ct-11260	52	22	reference	reference	NOUN
ct-11260	52	23	t.	t.	PROPN
ct-11260	52	24	asinigenitalis	asinigenitalis	PROPN
ct-11260	52	25	strain	strain	VERB
ct-11260	52	26	than	than	SCONJ
ct-11260	52	27	to	to	ADP
ct-11260	52	28	that	that	PRON
ct-11260	52	29	of	of	ADP
ct-11260	52	30	the	the	DET
ct-11260	52	31	t.	t.	PROPN
ct-11260	52	32	equigenitalis	equigenitalis	PROPN
ct-11260	52	33	strain	strain	VERB
ct-11260	52	34	.	.	PUNCT
ct-11260	53	1	amplification	amplification	NOUN
ct-11260	53	2	with	with	ADP
ct-11260	53	3	isr	isr	ADJ
ct-11260	53	4	-	-	PUNCT
ct-11260	53	5	flanking	flank	VERB
ct-11260	53	6	primers	primer	NOUN
ct-11260	53	7	resulted	result	VERB
ct-11260	53	8	in	in	ADP
ct-11260	53	9	the	the	DET
ct-11260	53	10	generation	generation	NOUN
ct-11260	53	11	of	of	ADP
ct-11260	53	12	multiple	multiple	ADJ
ct-11260	53	13	amplicons	amplicon	NOUN
ct-11260	53	14	in	in	ADP
ct-11260	53	15	the	the	DET
ct-11260	53	16	900	900	NUM
ct-11260	53	17	-	-	SYM
ct-11260	53	18	1000	1000	NUM
ct-11260	53	19	-	-	PUNCT
ct-11260	53	20	bp	bp	NOUN
ct-11260	53	21	approximate	approximate	ADJ
ct-11260	53	22	size	size	NOUN
ct-11260	53	23	range	range	NOUN
ct-11260	53	24	,	,	PUNCT
ct-11260	53	25	as	as	SCONJ
ct-11260	53	26	anticipated	anticipate	VERB
ct-11260	53	27	from	from	ADP
ct-11260	53	28	a	a	DET
ct-11260	53	29	previously	previously	ADV
ct-11260	53	30	published	publish	VERB
ct-11260	53	31	study.19	study.19	NOUN
ct-11260	53	32	after	after	ADP
ct-11260	53	33	cloning	clone	VERB
ct-11260	53	34	into	into	ADP
ct-11260	53	35	a	a	DET
ct-11260	53	36	positive	positive	ADJ
ct-11260	53	37	selection	selection	NOUN
ct-11260	53	38	vector	vector	NOUN
ct-11260	53	39	,	,	PUNCT
ct-11260	53	40	plasmid	plasmid	ADJ
ct-11260	53	41	dnas	dna	NOUN
ct-11260	53	42	corresponding	correspond	VERB
ct-11260	53	43	to	to	ADP
ct-11260	53	44	each	each	PRON
ct-11260	53	45	of	of	ADP
ct-11260	53	46	two	two	NUM
ct-11260	53	47	differently	differently	ADV
ct-11260	53	48	sized	sized	ADJ
ct-11260	53	49	amplicons	amplicon	NOUN
ct-11260	53	50	were	be	AUX
ct-11260	53	51	identified	identify	VERB
ct-11260	53	52	and	and	CCONJ
ct-11260	53	53	subjected	subject	VERB
ct-11260	53	54	to	to	ADP
ct-11260	53	55	dna	dna	PROPN
ct-11260	53	56	sequence	sequence	NOUN
ct-11260	53	57	analysis	analysis	NOUN
ct-11260	53	58	.	.	PUNCT
ct-11260	54	1	each	each	DET
ct-11260	54	2	isr	isr	ADJ
ct-11260	54	3	sequence	sequence	NOUN
ct-11260	54	4	was	be	AUX
ct-11260	54	5	closely	closely	ADV
ct-11260	54	6	related	relate	VERB
ct-11260	54	7	to	to	ADP
ct-11260	54	8	those	those	PRON
ct-11260	54	9	determined	determine	VERB
ct-11260	54	10	for	for	ADP
ct-11260	54	11	other	other	ADJ
ct-11260	54	12	t.	t.	ADJ
ct-11260	54	13	asinigenitalis	asinigenitalis	PROPN
ct-11260	54	14	isolates	isolate	NOUN
ct-11260	54	15	,	,	PUNCT
ct-11260	54	16	and	and	CCONJ
ct-11260	54	17	each	each	PRON
ct-11260	54	18	contained	contain	VERB
ct-11260	54	19	coding	code	VERB
ct-11260	54	20	sequences	sequence	NOUN
ct-11260	54	21	for	for	ADP
ct-11260	54	22	trna	trna	PROPN
ct-11260	54	23	ile	ile	PROPN
ct-11260	54	24	and	and	CCONJ
ct-11260	54	25	trna	trna	PROPN
ct-11260	54	26	ala	ala	PROPN
ct-11260	54	27	.	.	PUNCT
ct-11260	55	1	sequence	sequence	NOUN
ct-11260	55	2	1	1	NUM
ct-11260	55	3	was	be	AUX
ct-11260	55	4	922	922	NUM
ct-11260	55	5	bp	bp	NOUN
ct-11260	55	6	in	in	ADP
ct-11260	55	7	length	length	NOUN
ct-11260	55	8	and	and	CCONJ
ct-11260	55	9	was	be	AUX
ct-11260	55	10	most	most	ADV
ct-11260	55	11	similar	similar	ADJ
ct-11260	55	12	to	to	ADP
ct-11260	55	13	isr	isr	PROPN
ct-11260	55	14	c	c	PROPN
ct-11260	55	15	of	of	ADP
ct-11260	55	16	strains	strain	NOUN
ct-11260	55	17	uk-1	uk-1	X
ct-11260	55	18	and	and	CCONJ
ct-11260	55	19	uk-2	uk-2	X
ct-11260	55	20	(	(	PUNCT
ct-11260	55	21	97	97	NUM
ct-11260	55	22	%	%	NOUN
ct-11260	55	23	)	)	PUNCT
ct-11260	55	24	and	and	CCONJ
ct-11260	55	25	slightly	slightly	ADV
ct-11260	55	26	less	less	ADV
ct-11260	55	27	similar	similar	ADJ
ct-11260	55	28	to	to	ADP
ct-11260	55	29	isr	isr	PROPN
ct-11260	55	30	c	c	PROPN
ct-11260	55	31	of	of	ADP
ct-11260	55	32	strain	strain	NOUN
ct-11260	55	33	ucd-1	ucd-1	PUNCT
ct-11260	55	34	(	(	PUNCT
ct-11260	55	35	93	93	NUM
ct-11260	55	36	%	%	NOUN
ct-11260	55	37	)	)	PUNCT
ct-11260	55	38	as	as	SCONJ
ct-11260	55	39	described	describe	VERB
ct-11260	55	40	by	by	ADP
ct-11260	55	41	tazumi	tazumi	PROPN
ct-11260	55	42	et	et	PROPN
ct-11260	55	43	al	al	PROPN
ct-11260	55	44	.19	.19	NUM
ct-11260	55	45	sequence	sequence	NOUN
ct-11260	55	46	2	2	NUM
ct-11260	55	47	(	(	PUNCT
ct-11260	55	48	1002	1002	NUM
ct-11260	55	49	bp	bp	PROPN
ct-11260	55	50	)	)	PUNCT
ct-11260	55	51	was	be	AUX
ct-11260	55	52	99	99	NUM
ct-11260	55	53	%	%	NOUN
ct-11260	55	54	identical	identical	ADJ
ct-11260	55	55	to	to	ADP
ct-11260	55	56	sequence	sequence	NOUN
ct-11260	55	57	1	1	NUM
ct-11260	55	58	in	in	ADP
ct-11260	55	59	regions	region	NOUN
ct-11260	55	60	of	of	ADP
ct-11260	55	61	overlap	overlap	NOUN
ct-11260	55	62	between	between	ADP
ct-11260	55	63	the	the	DET
ct-11260	55	64	two	two	NUM
ct-11260	55	65	differently	differently	ADV
ct-11260	55	66	clinical	clinical	ADJ
ct-11260	55	67	theriogenology	theriogenology	NOUN
ct-11260	56	1	•	•	NOUN
ct-11260	56	2	volume	volume	NOUN
ct-11260	56	3	4	4	NUM
ct-11260	56	4	number	number	NOUN
ct-11260	56	5	2	2	NUM
ct-11260	56	6	•	•	NOUN
ct-11260	56	7	june	june	PROPN
ct-11260	56	8	2012165	2012165	NUM
ct-11260	56	9	  	  	SPACE
ct-11260	56	10	sized	size	VERB
ct-11260	56	11	isrs	isrs	ADJ
ct-11260	56	12	,	,	PUNCT
ct-11260	56	13	and	and	CCONJ
ct-11260	56	14	shared	share	VERB
ct-11260	56	15	99	99	NUM
ct-11260	56	16	%	%	NOUN
ct-11260	56	17	identical	identical	ADJ
ct-11260	56	18	residues	residue	NOUN
ct-11260	56	19	with	with	ADP
ct-11260	56	20	isr	isr	PROPN
ct-11260	56	21	b	b	PROPN
ct-11260	56	22	of	of	ADP
ct-11260	56	23	strains	strain	NOUN
ct-11260	56	24	uk-1	uk-1	X
ct-11260	56	25	and	and	CCONJ
ct-11260	56	26	uk-2.19	uk-2.19	PROPN
ct-11260	56	27	both	both	DET
ct-11260	56	28	isr	isr	ADJ
ct-11260	56	29	sequences	sequence	NOUN
ct-11260	56	30	determined	determine	VERB
ct-11260	56	31	in	in	ADP
ct-11260	56	32	this	this	DET
ct-11260	56	33	study	study	NOUN
ct-11260	56	34	are	be	AUX
ct-11260	56	35	also	also	ADV
ct-11260	56	36	distinct	distinct	ADJ
ct-11260	56	37	from	from	ADP
ct-11260	56	38	those	those	PRON
ct-11260	56	39	present	present	ADJ
ct-11260	56	40	in	in	ADP
ct-11260	56	41	the	the	DET
ct-11260	56	42	complete	complete	ADJ
ct-11260	56	43	genome	genome	NOUN
ct-11260	56	44	of	of	ADP
ct-11260	56	45	t.	t.	NOUN
ct-11260	56	46	asinigenitalis	asinigenitalis	PROPN
ct-11260	56	47	strain	strain	VERB
ct-11260	56	48	mce9	mce9	PROPN
ct-11260	56	49	(	(	PUNCT
ct-11260	56	50	isolated	isolate	VERB
ct-11260	56	51	in	in	ADP
ct-11260	56	52	2004	2004	NUM
ct-11260	56	53	from	from	ADP
ct-11260	56	54	a	a	DET
ct-11260	56	55	donkey	donkey	NOUN
ct-11260	56	56	jack	jack	NOUN
ct-11260	56	57	in	in	ADP
ct-11260	56	58	france).20	france).20	PROPN
ct-11260	56	59	importantly	importantly	ADV
ct-11260	56	60	,	,	PUNCT
ct-11260	56	61	both	both	DET
ct-11260	56	62	amplicons	amplicon	NOUN
ct-11260	56	63	exhibited	exhibit	VERB
ct-11260	56	64	significantly	significantly	ADV
ct-11260	56	65	less	less	ADJ
ct-11260	56	66	sequence	sequence	NOUN
ct-11260	56	67	identity	identity	NOUN
ct-11260	56	68	to	to	ADP
ct-11260	56	69	isr	isr	ADJ
ct-11260	56	70	regions	region	NOUN
ct-11260	56	71	from	from	ADP
ct-11260	56	72	t.	t.	PROPN
ct-11260	56	73	equigenitalis	equigenitalis	PROPN
ct-11260	56	74	.	.	PUNCT
ct-11260	57	1	sequence	sequence	NOUN
ct-11260	57	2	1	1	NUM
ct-11260	57	3	and	and	CCONJ
ct-11260	57	4	2	2	NUM
ct-11260	57	5	were	be	AUX
ct-11260	57	6	only	only	ADV
ct-11260	57	7	72	72	NUM
ct-11260	57	8	%	%	NOUN
ct-11260	57	9	and	and	CCONJ
ct-11260	57	10	70	70	NUM
ct-11260	57	11	%	%	NOUN
ct-11260	57	12	identical	identical	ADJ
ct-11260	57	13	,	,	PUNCT
ct-11260	57	14	respectively	respectively	ADV
ct-11260	57	15	,	,	PUNCT
ct-11260	57	16	to	to	ADP
ct-11260	57	17	t.	t.	PROPN
ct-11260	57	18	equigenitalis	equigenitalis	PROPN
ct-11260	57	19	eq59	eq59	PROPN
ct-11260	57	20	,	,	PUNCT
ct-11260	57	21	the	the	DET
ct-11260	57	22	most	most	ADV
ct-11260	57	23	closely	closely	ADV
ct-11260	57	24	related	relate	VERB
ct-11260	57	25	strain	strain	NOUN
ct-11260	57	26	of	of	ADP
ct-11260	57	27	this	this	DET
ct-11260	57	28	species	specie	NOUN
ct-11260	57	29	.	.	PUNCT
ct-11260	58	1	as	as	SCONJ
ct-11260	58	2	each	each	DET
ct-11260	58	3	isr	isr	NOUN
ct-11260	58	4	from	from	ADP
ct-11260	58	5	the	the	DET
ct-11260	58	6	mare	mare	NOUN
ct-11260	58	7	isolate	isolate	NOUN
ct-11260	58	8	(	(	PUNCT
ct-11260	58	9	umc-1	umc-1	NOUN
ct-11260	58	10	)	)	PUNCT
ct-11260	58	11	had	have	VERB
ct-11260	58	12	differences	difference	NOUN
ct-11260	58	13	from	from	ADP
ct-11260	58	14	the	the	DET
ct-11260	58	15	published	publish	VERB
ct-11260	58	16	sequences	sequence	NOUN
ct-11260	58	17	,	,	PUNCT
ct-11260	58	18	an	an	DET
ct-11260	58	19	additional	additional	ADJ
ct-11260	58	20	pcr	pcr	NOUN
ct-11260	58	21	/	/	SYM
ct-11260	58	22	cloning	cloning	NOUN
ct-11260	58	23	was	be	AUX
ct-11260	58	24	performed	perform	VERB
ct-11260	58	25	to	to	PART
ct-11260	58	26	eliminate	eliminate	VERB
ct-11260	58	27	the	the	DET
ct-11260	58	28	possibility	possibility	NOUN
ct-11260	58	29	of	of	ADP
ct-11260	58	30	the	the	DET
ct-11260	58	31	introduction	introduction	NOUN
ct-11260	58	32	of	of	ADP
ct-11260	58	33	inadvertent	inadvertent	ADJ
ct-11260	58	34	mutations	mutation	NOUN
ct-11260	58	35	during	during	ADP
ct-11260	58	36	amplification	amplification	NOUN
ct-11260	58	37	.	.	PUNCT
ct-11260	59	1	sequence	sequence	NOUN
ct-11260	59	2	analysis	analysis	NOUN
ct-11260	59	3	of	of	ADP
ct-11260	59	4	independent	independent	ADJ
ct-11260	59	5	plasmid	plasmid	ADJ
ct-11260	59	6	clones	clone	NOUN
ct-11260	59	7	verified	verify	VERB
ct-11260	59	8	the	the	DET
ct-11260	59	9	presence	presence	NOUN
ct-11260	59	10	of	of	ADP
ct-11260	59	11	characteristic	characteristic	ADJ
ct-11260	59	12	patterns	pattern	NOUN
ct-11260	59	13	of	of	ADP
ct-11260	59	14	snps	snps	PROPN
ct-11260	59	15	as	as	ADV
ct-11260	59	16	well	well	ADV
ct-11260	59	17	as	as	ADP
ct-11260	59	18	insertion	insertion	NOUN
ct-11260	59	19	/	/	SYM
ct-11260	59	20	deletion	deletion	NOUN
ct-11260	59	21	(	(	PUNCT
ct-11260	59	22	indels	indels	PROPN
ct-11260	59	23	)	)	PUNCT
ct-11260	59	24	,	,	PUNCT
ct-11260	59	25	which	which	PRON
ct-11260	59	26	may	may	AUX
ct-11260	59	27	prove	prove	VERB
ct-11260	59	28	useful	useful	ADJ
ct-11260	59	29	in	in	ADP
ct-11260	59	30	strain	strain	NOUN
ct-11260	59	31	discrimination	discrimination	NOUN
ct-11260	59	32	as	as	ADP
ct-11260	59	33	additional	additional	ADJ
ct-11260	59	34	t.	t.	ADJ
ct-11260	59	35	asinigenitalis	asinigenitalis	PROPN
ct-11260	59	36	isolates	isolate	NOUN
ct-11260	59	37	are	be	AUX
ct-11260	59	38	identified	identify	VERB
ct-11260	59	39	.	.	PUNCT
ct-11260	60	1	pfge	pfge	NOUN
ct-11260	60	2	analysis	analysis	NOUN
ct-11260	60	3	of	of	ADP
ct-11260	60	4	genomic	genomic	ADJ
ct-11260	60	5	dna	dna	NOUN
ct-11260	60	6	from	from	ADP
ct-11260	60	7	the	the	DET
ct-11260	60	8	umc-1	umc-1	VERB
ct-11260	60	9	strain	strain	NOUN
ct-11260	60	10	showed	show	VERB
ct-11260	60	11	that	that	SCONJ
ct-11260	60	12	it	it	PRON
ct-11260	60	13	differed	differ	VERB
ct-11260	60	14	from	from	ADP
ct-11260	60	15	both	both	CCONJ
ct-11260	60	16	the	the	DET
ct-11260	60	17	uk	uk	PROPN
ct-11260	60	18	isolate	isolate	VERB
ct-11260	60	19	and	and	CCONJ
ct-11260	60	20	the	the	DET
ct-11260	60	21	ucd-1	ucd-1	ADJ
ct-11260	60	22	isolate	isolate	NOUN
ct-11260	60	23	when	when	SCONJ
ct-11260	60	24	digested	digest	VERB
ct-11260	60	25	with	with	ADP
ct-11260	60	26	not	not	PART
ct-11260	60	27	i	i	PRON
ct-11260	60	28	(	(	PUNCT
ct-11260	60	29	figure	figure	NOUN
ct-11260	60	30	)	)	PUNCT
ct-11260	60	31	.	.	PUNCT
ct-11260	61	1	the	the	DET
ct-11260	61	2	pfge	pfge	NOUN
ct-11260	61	3	profile	profile	NOUN
ct-11260	61	4	of	of	ADP
ct-11260	61	5	umc-1	umc-1	PUNCT
ct-11260	61	6	was	be	AUX
ct-11260	61	7	more	more	ADV
ct-11260	61	8	similar	similar	ADJ
ct-11260	61	9	(	(	PUNCT
ct-11260	61	10	88	88	NUM
ct-11260	61	11	%	%	NOUN
ct-11260	61	12	)	)	PUNCT
ct-11260	61	13	to	to	ADP
ct-11260	61	14	the	the	DET
ct-11260	61	15	uk	uk	PROPN
ct-11260	61	16	isolate	isolate	VERB
ct-11260	61	17	and	and	CCONJ
ct-11260	61	18	less	less	ADV
ct-11260	61	19	similar	similar	ADJ
ct-11260	61	20	(	(	PUNCT
ct-11260	61	21	59.4	59.4	NUM
ct-11260	61	22	%	%	NOUN
ct-11260	61	23	)	)	PUNCT
ct-11260	61	24	to	to	ADP
ct-11260	61	25	the	the	DET
ct-11260	61	26	ucd-1	ucd-1	DET
ct-11260	61	27	type	type	NOUN
ct-11260	61	28	strain	strain	NOUN
ct-11260	61	29	.	.	PUNCT
ct-11260	62	1	although	although	SCONJ
ct-11260	62	2	the	the	DET
ct-11260	62	3	time	time	NOUN
ct-11260	62	4	between	between	ADP
ct-11260	62	5	isolations	isolation	NOUN
ct-11260	62	6	of	of	ADP
ct-11260	62	7	umc-1	umc-1	PUNCT
ct-11260	62	8	and	and	CCONJ
ct-11260	62	9	ucd-1	ucd-1	ADV
ct-11260	62	10	/	/	SYM
ct-11260	62	11	uk	uk	PROPN
ct-11260	62	12	strains	strain	VERB
ct-11260	62	13	spans	span	NOUN
ct-11260	62	14	approximately	approximately	ADV
ct-11260	62	15	ten	ten	NUM
ct-11260	62	16	years	year	NOUN
ct-11260	62	17	,	,	PUNCT
ct-11260	62	18	these	these	DET
ct-11260	62	19	results	result	NOUN
ct-11260	62	20	indicate	indicate	VERB
ct-11260	62	21	that	that	SCONJ
ct-11260	62	22	the	the	DET
ct-11260	62	23	umc-1	umc-1	SYM
ct-11260	62	24	isolate	isolate	NOUN
ct-11260	62	25	is	be	AUX
ct-11260	62	26	not	not	PART
ct-11260	62	27	closely	closely	ADV
ct-11260	62	28	related	relate	VERB
ct-11260	62	29	to	to	ADP
ct-11260	62	30	past	past	ADJ
ct-11260	62	31	strains	strain	NOUN
ct-11260	62	32	of	of	ADP
ct-11260	62	33	t.	t.	NOUN
ct-11260	62	34	asinigenitalis	asinigenitalis	PROPN
ct-11260	62	35	found	find	VERB
ct-11260	62	36	in	in	ADP
ct-11260	62	37	the	the	DET
ct-11260	62	38	united	united	PROPN
ct-11260	62	39	states	states	PROPN
ct-11260	62	40	.	.	PUNCT
ct-11260	63	1	in	in	ADP
ct-11260	63	2	conclusion	conclusion	NOUN
ct-11260	63	3	,	,	PUNCT
ct-11260	63	4	small	small	ADJ
ct-11260	63	5	gram	gram	NOUN
ct-11260	63	6	-	-	PUNCT
ct-11260	63	7	negative	negative	ADJ
ct-11260	63	8	coccobacilli	coccobacilli	NOUN
ct-11260	63	9	possessing	possess	VERB
ct-11260	63	10	copious	copious	ADJ
ct-11260	63	11	amounts	amount	NOUN
ct-11260	63	12	of	of	ADP
ct-11260	63	13	catalase	catalase	NOUN
ct-11260	63	14	,	,	PUNCT
ct-11260	63	15	oxidase	oxidase	NOUN
ct-11260	63	16	,	,	PUNCT
ct-11260	63	17	and	and	CCONJ
ct-11260	63	18	alkaline	alkaline	ADJ
ct-11260	63	19	phosphatase	phosphatase	NOUN
ct-11260	63	20	activity	activity	NOUN
ct-11260	63	21	were	be	AUX
ct-11260	63	22	unexpectedly	unexpectedly	ADV
ct-11260	63	23	recovered	recover	VERB
ct-11260	63	24	from	from	ADP
ct-11260	63	25	one	one	NUM
ct-11260	63	26	horse	horse	NOUN
ct-11260	63	27	during	during	ADP
ct-11260	63	28	routine	routine	ADJ
ct-11260	63	29	cem	cem	NOUN
ct-11260	63	30	screening	screening	NOUN
ct-11260	63	31	of	of	ADP
ct-11260	63	32	eight	eight	NUM
ct-11260	63	33	oklahoma	oklahoma	PROPN
ct-11260	63	34	quarter	quarter	NOUN
ct-11260	63	35	horses	horse	NOUN
ct-11260	63	36	for	for	ADP
ct-11260	63	37	export	export	NOUN
ct-11260	63	38	.	.	PUNCT
ct-11260	64	1	while	while	SCONJ
ct-11260	64	2	this	this	DET
ct-11260	64	3	isolate	isolate	NOUN
ct-11260	64	4	was	be	AUX
ct-11260	64	5	nearly	nearly	ADV
ct-11260	64	6	indistinguishable	indistinguishable	ADJ
ct-11260	64	7	from	from	ADP
ct-11260	64	8	the	the	DET
ct-11260	64	9	etiologic	etiologic	ADJ
ct-11260	64	10	agent	agent	NOUN
ct-11260	64	11	of	of	ADP
ct-11260	64	12	cem	cem	NOUN
ct-11260	64	13	,	,	PUNCT
ct-11260	64	14	t.	t.	PROPN
ct-11260	64	15	equigenitalis	equigenitalis	PROPN
ct-11260	64	16	phenotypically	phenotypically	ADV
ct-11260	64	17	,	,	PUNCT
ct-11260	64	18	results	result	NOUN
ct-11260	64	19	from	from	ADP
ct-11260	64	20	genomic	genomic	ADJ
ct-11260	64	21	analysis	analysis	NOUN
ct-11260	64	22	found	find	VERB
ct-11260	64	23	the	the	DET
ct-11260	64	24	t.	t.	PROPN
ct-11260	64	25	asinigenitalis	asinigenitalis	PROPN
ct-11260	64	26	umc-1	umc-1	ADV
ct-11260	64	27	isolate	isolate	VERB
ct-11260	64	28	to	to	PART
ct-11260	64	29	be	be	AUX
ct-11260	64	30	more	more	ADV
ct-11260	64	31	closely	closely	ADV
ct-11260	64	32	related	relate	VERB
ct-11260	64	33	to	to	ADP
ct-11260	64	34	,	,	PUNCT
ct-11260	64	35	though	though	SCONJ
ct-11260	64	36	distinct	distinct	ADJ
ct-11260	64	37	from	from	ADP
ct-11260	64	38	the	the	DET
ct-11260	64	39	ucd-1	ucd-1	DET
ct-11260	64	40	type	type	NOUN
ct-11260	64	41	strain	strain	NOUN
ct-11260	64	42	identified	identify	VERB
ct-11260	64	43	in	in	ADP
ct-11260	64	44	1997	1997	NUM
ct-11260	64	45	.	.	PUNCT
ct-11260	65	1	these	these	DET
ct-11260	65	2	findings	finding	NOUN
ct-11260	65	3	highlight	highlight	VERB
ct-11260	65	4	the	the	DET
ct-11260	65	5	need	need	NOUN
ct-11260	65	6	for	for	ADP
ct-11260	65	7	further	further	ADJ
ct-11260	65	8	epidemiological	epidemiological	ADJ
ct-11260	65	9	studies	study	NOUN
ct-11260	65	10	of	of	ADP
ct-11260	65	11	the	the	DET
ct-11260	65	12	prevalence	prevalence	NOUN
ct-11260	65	13	and	and	CCONJ
ct-11260	65	14	strain	strain	NOUN
ct-11260	65	15	profiles	profile	NOUN
ct-11260	65	16	of	of	ADP
ct-11260	65	17	t.	t.	NOUN
ct-11260	65	18	asinigenitalis	asinigenitalis	PROPN
ct-11260	65	19	isolates	isolate	NOUN
ct-11260	65	20	from	from	ADP
ct-11260	65	21	equid	equid	ADJ
ct-11260	65	22	species	specie	NOUN
ct-11260	65	23	.	.	PUNCT
ct-11260	66	1	figure	figure	NOUN
ct-11260	66	2	:	:	PUNCT
ct-11260	66	3	pfge	pfge	VERB
ct-11260	66	4	analysis	analysis	NOUN
ct-11260	66	5	of	of	ADP
ct-11260	66	6	taylorella	taylorella	NOUN
ct-11260	66	7	asinigenitalis	asinigenitali	NOUN
ct-11260	66	8	strains	strain	VERB
ct-11260	66	9	uk	uk	PROPN
ct-11260	66	10	,	,	PUNCT
ct-11260	66	11	umc-1	umc-1	ADP
ct-11260	66	12	,	,	PUNCT
ct-11260	66	13	and	and	CCONJ
ct-11260	66	14	ucd-1	ucd-1	ADV
ct-11260	66	15	after	after	SCONJ
ct-11260	66	16	digestion	digestion	NOUN
ct-11260	66	17	of	of	ADP
ct-11260	66	18	genomic	genomic	ADJ
ct-11260	66	19	dna	dna	NOUN
ct-11260	66	20	with	with	ADP
ct-11260	66	21	not	not	PART
ct-11260	66	22	i.	i.	NOUN
ct-11260	66	23	dendrogram	dendrogram	PROPN
ct-11260	66	24	was	be	AUX
ct-11260	66	25	created	create	VERB
ct-11260	66	26	using	use	VERB
ct-11260	66	27	dice	dice	NOUN
ct-11260	66	28	’s	’s	PART
ct-11260	66	29	coefficient	coefficient	NOUN
ct-11260	66	30	and	and	CCONJ
ct-11260	66	31	upgma	upgma	PROPN
ct-11260	66	32	and	and	CCONJ
ct-11260	66	33	based	base	VERB
ct-11260	66	34	on	on	ADP
ct-11260	66	35	1.5	1.5	NUM
ct-11260	66	36	%	%	NOUN
ct-11260	66	37	band	band	NOUN
ct-11260	66	38	position	position	NOUN
ct-11260	66	39	tolerance	tolerance	NOUN
ct-11260	66	40	values	value	NOUN
ct-11260	66	41	.	.	PUNCT
ct-11260	67	1	acknowledgement	acknowledgement	NOUN
ct-11260	67	2	this	this	DET
ct-11260	67	3	work	work	NOUN
ct-11260	67	4	was	be	AUX
ct-11260	67	5	supported	support	VERB
ct-11260	67	6	by	by	ADP
ct-11260	67	7	usda	usda	NOUN
ct-11260	67	8	animal	animal	NOUN
ct-11260	67	9	health	health	NOUN
ct-11260	67	10	formula	formula	NOUN
ct-11260	67	11	funds	fund	NOUN
ct-11260	67	12	to	to	ADP
ct-11260	67	13	the	the	DET
ct-11260	67	14	university	university	PROPN
ct-11260	67	15	of	of	ADP
ct-11260	67	16	missouri	missouri	PROPN
ct-11260	67	17	college	college	PROPN
ct-11260	67	18	of	of	ADP
ct-11260	67	19	veterinary	veterinary	ADJ
ct-11260	67	20	medicine	medicine	NOUN
ct-11260	67	21	.	.	PUNCT
ct-11260	68	1	references	reference	NOUN
ct-11260	68	2	1	1	NUM
ct-11260	68	3	.	.	PUNCT
ct-11260	69	1	swerzek	swerzek	PROPN
ct-11260	69	2	tw	tw	PROPN
ct-11260	69	3	:	:	PUNCT
ct-11260	69	4	contagious	contagious	ADJ
ct-11260	69	5	equine	equine	NOUN
ct-11260	69	6	metritis	metritis	NOUN
ct-11260	69	7	in	in	ADP
ct-11260	69	8	usa	usa	PROPN
ct-11260	69	9	.	.	PROPN
ct-11260	69	10	vet	vet	NOUN
ct-11260	69	11	rec	rec	X
ct-11260	69	12	1978;102:512	1978;102:512	X
ct-11260	69	13	-	-	SYM
ct-11260	69	14	513	513	NUM
ct-11260	69	15	.	.	NOUN
ct-11260	70	1	2	2	X
ct-11260	70	2	.	.	X
ct-11260	70	3	fales	fales	PROPN
ct-11260	70	4	wh	wh	PROPN
ct-11260	70	5	,	,	PUNCT
ct-11260	70	6	backburn	backburn	NOUN
ct-11260	70	7	,	,	PUNCT
ct-11260	70	8	bo	bo	PROPN
ct-11260	70	9	,	,	PUNCT
ct-11260	70	10	youngquist	youngquist	NOUN
ct-11260	70	11	,	,	PUNCT
ct-11260	70	12	rs	rs	NOUN
ct-11260	70	13	.	.	PUNCT
ct-11260	70	14	et	et	PROPN
ct-11260	70	15	al	al	PROPN
ct-11260	70	16	:	:	PUNCT
ct-11260	70	17	laboratory	laboratory	NOUN
ct-11260	70	18	methodology	methodology	NOUN
ct-11260	70	19	for	for	ADP
ct-11260	70	20	the	the	DET
ct-11260	70	21	diagnosis	diagnosis	NOUN
ct-11260	70	22	of	of	ADP
ct-11260	70	23	contagious	contagious	ADJ
ct-11260	70	24	equine	equine	NOUN
ct-11260	70	25	metritis	metritis	NOUN
ct-11260	70	26	in	in	ADP
ct-11260	70	27	missouri	missouri	PROPN
ct-11260	70	28	.	.	PUNCT
ct-11260	71	1	proc	proc	PROPN
ct-11260	71	2	22nd	22nd	PROPN
ct-11260	71	3	ann	ann	PROPN
ct-11260	71	4	meeting	meeting	PROPN
ct-11260	71	5	amer	amer	PROPN
ct-11260	71	6	assn	assn	PROPN
ct-11260	71	7	vet	vet	PROPN
ct-11260	71	8	lab	lab	NOUN
ct-11260	71	9	diag	diag	NOUN
ct-11260	71	10	1979	1979	NUM
ct-11260	71	11	;	;	PUNCT
ct-11260	71	12	p.187	p.187	NUM
ct-11260	71	13	-	-	SYM
ct-11260	71	14	197	197	NUM
ct-11260	71	15	.	.	PUNCT
ct-11260	72	1	3	3	X
ct-11260	72	2	.	.	X
ct-11260	72	3	erdman	erdman	PROPN
ct-11260	72	4	,	,	PUNCT
ct-11260	72	5	mm	mm	PROPN
ct-11260	72	6	,	,	PUNCT
ct-11260	72	7	creekmore	creekmore	PROPN
ct-11260	72	8	lh	lh	PROPN
ct-11260	72	9	,	,	PUNCT
ct-11260	72	10	fox	fox	PROPN
ct-11260	72	11	pe	pe	PROPN
ct-11260	72	12	.	.	PUNCT
ct-11260	72	13	et	et	PROPN
ct-11260	72	14	al	al	PROPN
ct-11260	72	15	:	:	PUNCT
ct-11260	72	16	diagnostic	diagnostic	ADJ
ct-11260	72	17	and	and	CCONJ
ct-11260	72	18	epidemiologic	epidemiologic	ADJ
ct-11260	72	19	analysis	analysis	NOUN
ct-11260	72	20	of	of	ADP
ct-11260	72	21	the	the	DET
ct-11260	72	22	2008	2008	NUM
ct-11260	72	23	-	-	SYM
ct-11260	72	24	2010	2010	NUM
ct-11260	72	25	investigation	investigation	NOUN
ct-11260	72	26	of	of	ADP
ct-11260	72	27	a	a	DET
ct-11260	72	28	multi	multi	ADJ
ct-11260	72	29	-	-	ADJ
ct-11260	72	30	year	year	ADJ
ct-11260	72	31	outbreak	outbreak	NOUN
ct-11260	72	32	of	of	ADP
ct-11260	72	33	contagious	contagious	ADJ
ct-11260	72	34	equine	equine	NOUN
ct-11260	72	35	metritis	metritis	NOUN
ct-11260	72	36	in	in	ADP
ct-11260	72	37	the	the	DET
ct-11260	72	38	united	united	PROPN
ct-11260	72	39	states	states	PROPN
ct-11260	72	40	.	.	PUNCT
ct-11260	73	1	prev	prev	PROPN
ct-11260	73	2	vet	vet	VERB
ct-11260	73	3	med	med	ADJ
ct-11260	73	4	2011;101:219	2011;101:219	PROPN
ct-11260	73	5	-	-	SYM
ct-11260	73	6	228	228	NUM
ct-11260	73	7	.	.	PUNCT
ct-11260	74	1	4	4	NUM
ct-11260	74	2	.	.	X
ct-11260	74	3	aalsburg	aalsburg	PROPN
ct-11260	74	4	am	be	AUX
ct-11260	74	5	,	,	PUNCT
ct-11260	74	6	erdman	erdman	PROPN
ct-11260	74	7	mm	mm	NOUN
ct-11260	74	8	:	:	PUNCT
ct-11260	74	9	pulsed	pulse	VERB
ct-11260	74	10	-	-	PUNCT
ct-11260	74	11	field	field	NOUN
ct-11260	74	12	gel	gel	NOUN
ct-11260	74	13	electrophoresis	electrophoresis	NOUN
ct-11260	74	14	genotyping	genotyping	NOUN
ct-11260	74	15	of	of	ADP
ct-11260	74	16	taylorella	taylorella	NOUN
ct-11260	74	17	equigenitalis	equigenitalis	PROPN
ct-11260	74	18	isolates	isolate	NOUN
ct-11260	74	19	collected	collect	VERB
ct-11260	74	20	in	in	ADP
ct-11260	74	21	the	the	DET
ct-11260	74	22	united	united	PROPN
ct-11260	74	23	states	states	PROPN
ct-11260	74	24	from	from	ADP
ct-11260	74	25	1978	1978	NUM
ct-11260	74	26	to	to	ADP
ct-11260	74	27	2010	2010	NUM
ct-11260	74	28	.	.	PUNCT
ct-11260	75	1	j	j	PROPN
ct-11260	75	2	clin	clin	PROPN
ct-11260	75	3	microbiol	microbiol	PROPN
ct-11260	75	4	2011;829	2011;829	NUM
ct-11260	75	5	-	-	PUNCT
ct-11260	75	6	833	833	NUM
ct-11260	75	7	.	.	PUNCT
ct-11260	75	8	5	5	NUM
ct-11260	75	9	.	.	X
ct-11260	75	10	taylor	taylor	PROPN
ct-11260	75	11	ced	ced	PROPN
ct-11260	75	12	,	,	PUNCT
ct-11260	75	13	rosenthal	rosenthal	PROPN
ct-11260	75	14	ro	ro	PROPN
ct-11260	75	15	,	,	PUNCT
ct-11260	75	16	brown	brown	ADJ
ct-11260	75	17	dfj	dfj	NOUN
ct-11260	75	18	:	:	PUNCT
ct-11260	75	19	the	the	DET
ct-11260	75	20	causative	causative	ADJ
ct-11260	75	21	organism	organism	NOUN
ct-11260	75	22	of	of	ADP
ct-11260	75	23	contagious	contagious	ADJ
ct-11260	75	24	equine	equine	NOUN
ct-11260	75	25	metritis	metritis	NOUN
ct-11260	75	26	1977	1977	NUM
ct-11260	75	27	:	:	PUNCT
ct-11260	75	28	proposal	proposal	NOUN
ct-11260	75	29	for	for	ADP
ct-11260	75	30	a	a	DET
ct-11260	75	31	new	new	ADJ
ct-11260	75	32	species	specie	NOUN
ct-11260	75	33	to	to	PART
ct-11260	75	34	be	be	AUX
ct-11260	75	35	known	know	VERB
ct-11260	75	36	as	as	ADP
ct-11260	75	37	haemophilus	haemophilus	PROPN
ct-11260	75	38	equigenitalis	equigenitalis	PROPN
ct-11260	75	39	.	.	PUNCT
ct-11260	76	1	equine	equine	PROPN
ct-11260	76	2	vet	vet	NOUN
ct-11260	76	3	j	j	PROPN
ct-11260	76	4	1978;10:136	1978;10:136	NUM
ct-11260	76	5	-	-	SYM
ct-11260	76	6	144	144	NUM
ct-11260	76	7	.	.	NOUN
ct-11260	76	8	6	6	NUM
ct-11260	76	9	.	.	X
ct-11260	76	10	matsuda	matsuda	PROPN
ct-11260	76	11	m	m	PROPN
ct-11260	76	12	,	,	PUNCT
ct-11260	76	13	moore	moore	PROPN
ct-11260	76	14	je	je	PROPN
ct-11260	76	15	:	:	PUNCT
ct-11260	76	16	recent	recent	ADJ
ct-11260	76	17	advances	advance	NOUN
ct-11260	76	18	in	in	ADP
ct-11260	76	19	molecular	molecular	ADJ
ct-11260	76	20	epidemiology	epidemiology	NOUN
ct-11260	76	21	and	and	CCONJ
ct-11260	76	22	detection	detection	NOUN
ct-11260	76	23	of	of	ADP
ct-11260	76	24	taylorella	taylorella	NOUN
ct-11260	76	25	equigenitalis	equigenitalis	PROPN
ct-11260	76	26	associated	associate	VERB
ct-11260	76	27	with	with	ADP
ct-11260	76	28	contagious	contagious	ADJ
ct-11260	76	29	equine	equine	NOUN
ct-11260	76	30	metritis	metritis	NOUN
ct-11260	76	31	(	(	PUNCT
ct-11260	76	32	cem	cem	NOUN
ct-11260	76	33	)	)	PUNCT
ct-11260	76	34	.	.	PUNCT
ct-11260	77	1	vet	vet	NOUN
ct-11260	77	2	microbiol	microbiol	NOUN
ct-11260	78	1	2003;97:111	2003;97:111	PROPN
ct-11260	78	2	-	-	SYM
ct-11260	78	3	122	122	NUM
ct-11260	78	4	.	.	PUNCT
ct-11260	79	1	10	10	NUM
ct-11260	79	2	0	0	NUM
ct-11260	79	3	90807060	90807060	NUM
ct-11260	79	4	uk	uk	PROPN
ct-11260	79	5	umc-1	umc-1	VERB
ct-11260	79	6	ucd-1	ucd-1	ADV
ct-11260	79	7	clinical	clinical	ADJ
ct-11260	79	8	theriogenology	theriogenology	NOUN
ct-11260	79	9	•	•	NOUN
ct-11260	79	10	volume	volume	NOUN
ct-11260	79	11	4	4	NUM
ct-11260	79	12	number	number	NOUN
ct-11260	79	13	2	2	NUM
ct-11260	79	14	•	•	NOUN
ct-11260	79	15	june	june	PROPN
ct-11260	79	16	2012	2012	NUM
ct-11260	79	17	166	166	NUM
ct-11260	79	18	  	  	SPACE
ct-11260	79	19	7	7	NUM
ct-11260	79	20	.	.	PUNCT
ct-11260	79	21	niwa	niwa	PROPN
ct-11260	79	22	h	h	PROPN
ct-11260	79	23	,	,	PUNCT
ct-11260	79	24	anzai	anzai	PROPN
ct-11260	79	25	t	t	PROPN
ct-11260	79	26	,	,	PUNCT
ct-11260	79	27	hobo	hobo	NOUN
ct-11260	79	28	s	s	PART
ct-11260	79	29	:	:	PUNCT
ct-11260	79	30	construction	construction	NOUN
ct-11260	79	31	of	of	ADP
ct-11260	79	32	a	a	DET
ct-11260	79	33	recombinant	recombinant	ADJ
ct-11260	79	34	plasmid	plasmid	NOUN
ct-11260	79	35	as	as	ADP
ct-11260	79	36	reaction	reaction	NOUN
ct-11260	79	37	control	control	NOUN
ct-11260	79	38	in	in	ADP
ct-11260	79	39	routine	routine	ADJ
ct-11260	79	40	pcr	pcr	NOUN
ct-11260	79	41	for	for	ADP
ct-11260	79	42	detection	detection	NOUN
ct-11260	79	43	of	of	ADP
ct-11260	79	44	contagious	contagious	ADJ
ct-11260	79	45	equine	equine	NOUN
ct-11260	79	46	metritis	metritis	NOUN
ct-11260	79	47	(	(	PUNCT
ct-11260	79	48	cem	cem	NOUN
ct-11260	79	49	-	-	PUNCT
ct-11260	79	50	pcr	pcr	NOUN
ct-11260	79	51	)	)	PUNCT
ct-11260	79	52	.	.	PUNCT
ct-11260	80	1	j	j	PROPN
ct-11260	80	2	vet	vet	PROPN
ct-11260	80	3	med	me	VERB
ct-11260	80	4	sci	sci	PROPN
ct-11260	80	5	2007;69:1199	2007;69:1199	PROPN
ct-11260	80	6	-	-	PROPN
ct-11260	80	7	1201	1201	NUM
ct-11260	80	8	.	.	PUNCT
ct-11260	81	1	8	8	X
ct-11260	81	2	.	.	X
ct-11260	81	3	wakeley	wakeley	PROPN
ct-11260	81	4	pr	pr	PROPN
ct-11260	81	5	,	,	PUNCT
ct-11260	81	6	errington	errington	PROPN
ct-11260	81	7	j	j	PROPN
ct-11260	81	8	,	,	PUNCT
ct-11260	81	9	hannon	hannon	PROPN
ct-11260	81	10	s	s	PROPN
ct-11260	81	11	,	,	PUNCT
ct-11260	81	12	et	et	PROPN
ct-11260	81	13	al	al	PROPN
ct-11260	81	14	:	:	PUNCT
ct-11260	81	15	development	development	NOUN
ct-11260	81	16	of	of	ADP
ct-11260	81	17	a	a	DET
ct-11260	81	18	real	real	ADJ
ct-11260	81	19	time	time	NOUN
ct-11260	81	20	pcr	pcr	NOUN
ct-11260	81	21	for	for	ADP
ct-11260	81	22	the	the	DET
ct-11260	81	23	detectin	detectin	NOUN
ct-11260	81	24	of	of	ADP
ct-11260	81	25	taylorella	taylorella	NOUN
ct-11260	81	26	equigenitalis	equigenitalis	VERB
ct-11260	81	27	directly	directly	ADV
ct-11260	81	28	from	from	ADP
ct-11260	81	29	genital	genital	ADJ
ct-11260	81	30	swabs	swab	NOUN
ct-11260	81	31	and	and	CCONJ
ct-11260	81	32	discrimination	discrimination	NOUN
ct-11260	81	33	from	from	ADP
ct-11260	81	34	taylorella	taylorella	NOUN
ct-11260	81	35	asinigenitalis	asinigenitali	NOUN
ct-11260	81	36	.	.	PUNCT
ct-11260	82	1	vet	vet	NOUN
ct-11260	82	2	micro	micro	X
ct-11260	82	3	2006;118:247	2006;118:247	PROPN
ct-11260	82	4	-	-	SYM
ct-11260	82	5	254	254	NUM
ct-11260	82	6	.	.	PUNCT
ct-11260	83	1	9	9	NUM
ct-11260	83	2	.	.	X
ct-11260	83	3	duquesne	duquesne	PROPN
ct-11260	83	4	f	f	PROPN
ct-11260	83	5	,	,	PUNCT
ct-11260	83	6	pronost	pronost	NOUN
ct-11260	83	7	s	s	SYM
ct-11260	83	8	,	,	PUNCT
ct-11260	83	9	laugier	laugi	ADJ
ct-11260	83	10	c	c	NOUN
ct-11260	83	11	,	,	PUNCT
ct-11260	83	12	et	et	PROPN
ct-11260	83	13	al	al	PROPN
ct-11260	83	14	:	:	PUNCT
ct-11260	83	15	identification	identification	NOUN
ct-11260	83	16	of	of	ADP
ct-11260	83	17	taylorella	taylorella	NOUN
ct-11260	83	18	equigenitalis	equigenitalis	PROPN
ct-11260	83	19	responsible	responsible	ADJ
ct-11260	83	20	for	for	ADP
ct-11260	83	21	contagious	contagious	ADJ
ct-11260	83	22	equine	equine	NOUN
ct-11260	83	23	metritis	metritis	NOUN
ct-11260	83	24	in	in	ADP
ct-11260	83	25	equine	equine	ADJ
ct-11260	83	26	genital	genital	ADJ
ct-11260	83	27	swabs	swab	NOUN
ct-11260	83	28	by	by	ADP
ct-11260	83	29	direct	direct	ADJ
ct-11260	83	30	polymerase	polymerase	NOUN
ct-11260	83	31	reaction	reaction	NOUN
ct-11260	83	32	.	.	PUNCT
ct-11260	84	1	res	re	NOUN
ct-11260	84	2	vet	vet	PROPN
ct-11260	84	3	sci	sci	PROPN
ct-11260	84	4	2007;82:47	2007;82:47	PROPN
ct-11260	84	5	-	-	SYM
ct-11260	84	6	9	9	NUM
ct-11260	84	7	.	.	NOUN
ct-11260	84	8	10	10	NUM
ct-11260	84	9	.	.	PUNCT
ct-11260	84	10	timoney	timoney	PROPN
ct-11260	84	11	pj	pj	PROPN
ct-11260	84	12	,	,	PUNCT
ct-11260	84	13	shin	shin	PROPN
ct-11260	84	14	sj	sj	PROPN
ct-11260	84	15	,	,	PUNCT
ct-11260	84	16	jacobson	jacobson	PROPN
ct-11260	84	17	rh	rh	PROPN
ct-11260	84	18	:	:	PUNCT
ct-11260	84	19	improved	improve	VERB
ct-11260	84	20	selective	selective	ADJ
ct-11260	84	21	medium	medium	NOUN
ct-11260	84	22	for	for	ADP
ct-11260	84	23	isolation	isolation	NOUN
ct-11260	84	24	of	of	ADP
ct-11260	84	25	the	the	DET
ct-11260	84	26	contagious	contagious	ADJ
ct-11260	84	27	equine	equine	NOUN
ct-11260	84	28	metritis	metritis	ADJ
ct-11260	84	29	organism	organism	NOUN
ct-11260	84	30	.	.	PUNCT
ct-11260	85	1	vet	vet	NOUN
ct-11260	85	2	rec	rec	X
ct-11260	85	3	1982;111:107	1982;111:107	PROPN
ct-11260	85	4	-	-	SYM
ct-11260	85	5	108	108	NUM
ct-11260	85	6	.	.	PUNCT
ct-11260	85	7	11	11	NUM
ct-11260	85	8	.	.	PUNCT
ct-11260	86	1	sugimoto	sugimoto	PROPN
ct-11260	86	2	c	c	PROPN
ct-11260	86	3	,	,	PUNCT
ct-11260	86	4	isayama	isayama	PROPN
ct-11260	86	5	y	y	NOUN
ct-11260	86	6	,	,	PUNCT
ct-11260	86	7	sakazaki	sakazaki	ADJ
ct-11260	86	8	r	r	NOUN
ct-11260	86	9	et	et	NOUN
ct-11260	86	10	al	al	PROPN
ct-11260	86	11	:	:	PUNCT
ct-11260	86	12	transfer	transfer	NOUN
ct-11260	86	13	of	of	ADP
ct-11260	86	14	haemophilus	haemophilus	PROPN
ct-11260	86	15	equigenitalis	equigenitalis	PROPN
ct-11260	86	16	taylor	taylor	PROPN
ct-11260	86	17	et	et	PROPN
ct-11260	86	18	al	al	PROPN
ct-11260	86	19	.	.	PROPN
ct-11260	86	20	1978	1978	NUM
ct-11260	86	21	to	to	ADP
ct-11260	86	22	the	the	DET
ct-11260	86	23	genus	genus	PROPN
ct-11260	86	24	taylorella	taylorella	PROPN
ct-11260	86	25	gen	gen	PROPN
ct-11260	86	26	.	.	PROPN
ct-11260	86	27	nov	nov	PROPN
ct-11260	86	28	.	.	PROPN
ct-11260	86	29	as	as	SCONJ
ct-11260	86	30	taylorella	taylorella	NOUN
ct-11260	86	31	equigenitalis	equigenitalis	PROPN
ct-11260	86	32	comb	comb	NOUN
ct-11260	86	33	.	.	PUNCT
ct-11260	87	1	nov	nov	PROPN
ct-11260	87	2	.	.	PROPN
ct-11260	87	3	curr	curr	PROPN
ct-11260	87	4	microiol	microiol	PROPN
ct-11260	87	5	1983;9:155	1983;9:155	NUM
ct-11260	87	6	-	-	SYM
ct-11260	87	7	162	162	NUM
ct-11260	87	8	.	.	PUNCT
ct-11260	87	9	12	12	NUM
ct-11260	87	10	.	.	PUNCT
ct-11260	88	1	jang	jang	PROPN
ct-11260	88	2	ss	ss	PROPN
ct-11260	88	3	,	,	PUNCT
ct-11260	88	4	donahue	donahue	PROPN
ct-11260	88	5	jm	jm	PROPN
ct-11260	88	6	,	,	PUNCT
ct-11260	88	7	arata	arata	PROPN
ct-11260	88	8	ab	ab	PROPN
ct-11260	88	9	,	,	PUNCT
ct-11260	88	10	et	et	PROPN
ct-11260	88	11	al	al	PROPN
ct-11260	88	12	:	:	PUNCT
ct-11260	88	13	taylorella	taylorella	NOUN
ct-11260	88	14	asinigenitalis	asinigenitalis	PROPN
ct-11260	88	15	sp	sp	VERB
ct-11260	88	16	.	.	PUNCT
ct-11260	88	17	nov	nov	PROPN
ct-11260	88	18	.	.	PROPN
ct-11260	88	19	,	,	PUNCT
ct-11260	88	20	a	a	DET
ct-11260	88	21	bacterium	bacterium	NOUN
ct-11260	88	22	isolated	isolate	VERB
ct-11260	88	23	from	from	ADP
ct-11260	88	24	the	the	DET
ct-11260	88	25	genital	genital	ADJ
ct-11260	88	26	tract	tract	NOUN
ct-11260	88	27	of	of	ADP
ct-11260	88	28	male	male	ADJ
ct-11260	88	29	donkeys	donkey	NOUN
ct-11260	88	30	(	(	PUNCT
ct-11260	88	31	equus	equus	PROPN
ct-11260	88	32	asinus	asinus	PROPN
ct-11260	88	33	)	)	PUNCT
ct-11260	88	34	.	.	PUNCT
ct-11260	89	1	int	int	PROPN
ct-11260	89	2	j	j	PROPN
ct-11260	89	3	sys	sys	PROPN
ct-11260	89	4	evol	evol	NOUN
ct-11260	89	5	microbiol	microbiol	NOUN
ct-11260	89	6	.	.	PUNCT
ct-11260	90	1	2001;51:971	2001;51:971	NUM
ct-11260	90	2	-	-	SYM
ct-11260	90	3	976	976	NUM
ct-11260	90	4	.	.	PUNCT
ct-11260	91	1	13	13	NUM
ct-11260	91	2	.	.	PUNCT
ct-11260	92	1	katz	katz	PROPN
ct-11260	92	2	,	,	PUNCT
ct-11260	92	3	jb	jb	PROPN
ct-11260	92	4	.	.	PUNCT
ct-11260	93	1	evans	evans	PROPN
ct-11260	93	2	,	,	PUNCT
ct-11260	93	3	le	le	PROPN
ct-11260	93	4	,	,	PUNCT
ct-11260	93	5	hutto	hutto	PROPN
ct-11260	93	6	,	,	PUNCT
ct-11260	93	7	dl	dl	PROPN
ct-11260	93	8	,	,	PUNCT
ct-11260	93	9	et	et	PROPN
ct-11260	93	10	al	al	PROPN
ct-11260	93	11	.	.	PUNCT
ct-11260	94	1	clinical	clinical	ADJ
ct-11260	94	2	bacteriologic	bacteriologic	ADJ
ct-11260	94	3	pathogenic	pathogenic	ADJ
ct-11260	94	4	features	feature	NOUN
ct-11260	94	5	of	of	ADP
ct-11260	94	6	infections	infection	NOUN
ct-11260	94	7	with	with	ADP
ct-11260	94	8	atypical	atypical	ADJ
ct-11260	94	9	taylorella	taylorella	NOUN
ct-11260	94	10	equigenitalis	equigenitalis	PROPN
ct-11260	94	11	in	in	ADP
ct-11260	94	12	mares	mare	NOUN
ct-11260	94	13	.	.	PUNCT
ct-11260	95	1	j	j	PROPN
ct-11260	95	2	am	be	AUX
ct-11260	95	3	vet	vet	NOUN
ct-11260	95	4	med	med	ADJ
ct-11260	95	5	assoc	assoc	PROPN
ct-11260	95	6	2000:216:1945	2000:216:1945	PROPN
ct-11260	95	7	-	-	SYM
ct-11260	95	8	1948	1948	NUM
ct-11260	95	9	.	.	PUNCT
ct-11260	96	1	14	14	NUM
ct-11260	96	2	.	.	PUNCT
ct-11260	97	1	meade	meade	NOUN
ct-11260	97	2	,	,	PUNCT
ct-11260	97	3	bj	bj	NOUN
ct-11260	97	4	,	,	PUNCT
ct-11260	97	5	timoney	timoney	NOUN
ct-11260	97	6	,	,	PUNCT
ct-11260	97	7	pj	pj	PROPN
ct-11260	97	8	,	,	PUNCT
ct-11260	97	9	donahue	donahue	PROPN
ct-11260	97	10	,	,	PUNCT
ct-11260	97	11	jm	jm	PROPN
ct-11260	97	12	,	,	PUNCT
ct-11260	97	13	et	et	PROPN
ct-11260	97	14	al	al	PROPN
ct-11260	97	15	:	:	PUNCT
ct-11260	97	16	initial	initial	ADJ
ct-11260	97	17	occurrence	occurrence	NOUN
ct-11260	97	18	of	of	ADP
ct-11260	97	19	taylorella	taylorella	NOUN
ct-11260	97	20	asinigenitalis	asinigenitali	NOUN
ct-11260	97	21	and	and	CCONJ
ct-11260	97	22	its	its	PRON
ct-11260	97	23	detection	detection	NOUN
ct-11260	97	24	in	in	ADP
ct-11260	97	25	nurse	nurse	NOUN
ct-11260	97	26	mares	mare	NOUN
ct-11260	97	27	,	,	PUNCT
ct-11260	97	28	a	a	DET
ct-11260	97	29	stallion	stallion	NOUN
ct-11260	97	30	and	and	CCONJ
ct-11260	97	31	donkeys	donkey	NOUN
ct-11260	97	32	in	in	ADP
ct-11260	97	33	kentucky	kentucky	PROPN
ct-11260	97	34	.	.	PUNCT
ct-11260	98	1	prev	prev	PROPN
ct-11260	98	2	vet	vet	VERB
ct-11260	98	3	med	me	VERB
ct-11260	98	4	2010	2010	NUM
ct-11260	98	5	:	:	PUNCT
ct-11260	98	6	95:292	95:292	NUM
ct-11260	98	7	-	-	SYM
ct-11260	98	8	296	296	NUM
ct-11260	98	9	.	.	PUNCT
ct-11260	98	10	15	15	NUM
ct-11260	98	11	.	.	PUNCT
ct-11260	99	1	båverud	båverud	PROPN
ct-11260	99	2	v	v	PROPN
ct-11260	99	3	,	,	PUNCT
ct-11260	99	4	nyström	nyström	ADV
ct-11260	99	5	c	c	X
ct-11260	99	6	,	,	PUNCT
ct-11260	99	7	johansson	johansson	PROPN
ct-11260	99	8	ke	ke	PROPN
ct-11260	99	9	:	:	PUNCT
ct-11260	99	10	isolation	isolation	NOUN
ct-11260	99	11	and	and	CCONJ
ct-11260	99	12	identification	identification	NOUN
ct-11260	99	13	of	of	ADP
ct-11260	99	14	taylorella	taylorella	NOUN
ct-11260	99	15	asinigenitalis	asinigenitali	NOUN
ct-11260	99	16	from	from	ADP
ct-11260	99	17	the	the	DET
ct-11260	99	18	genital	genital	ADJ
ct-11260	99	19	tract	tract	NOUN
ct-11260	99	20	of	of	ADP
ct-11260	99	21	a	a	DET
ct-11260	99	22	stallion	stallion	NOUN
ct-11260	99	23	,	,	PUNCT
ct-11260	99	24	first	first	ADJ
ct-11260	99	25	case	case	NOUN
ct-11260	99	26	of	of	ADP
ct-11260	99	27	natural	natural	ADJ
ct-11260	99	28	infection	infection	NOUN
ct-11260	99	29	.	.	PUNCT
ct-11260	100	1	vet	vet	NOUN
ct-11260	100	2	microbiol	microbiol	NOUN
ct-11260	100	3	2006;116:294	2006;116:294	NUM
ct-11260	100	4	-	-	SYM
ct-11260	100	5	300	300	NUM
ct-11260	100	6	.	.	PUNCT
ct-11260	101	1	16	16	NUM
ct-11260	101	2	.	.	PUNCT
ct-11260	102	1	franco	franco	PROPN
ct-11260	102	2	a	a	PROPN
ct-11260	102	3	,	,	PUNCT
ct-11260	102	4	donati	donati	PROPN
ct-11260	102	5	v	v	NOUN
ct-11260	102	6	,	,	PUNCT
ct-11260	102	7	troiano	troiano	VERB
ct-11260	102	8	p	p	NOUN
ct-11260	102	9	,	,	PUNCT
ct-11260	102	10	et	et	PROPN
ct-11260	102	11	al	al	PROPN
ct-11260	102	12	:	:	PUNCT
ct-11260	102	13	detection	detection	NOUN
ct-11260	102	14	of	of	ADP
ct-11260	102	15	taylorella	taylorella	NOUN
ct-11260	102	16	asinigenitalis	asinigenitali	NOUN
ct-11260	102	17	in	in	ADP
ct-11260	102	18	donkey	donkey	NOUN
ct-11260	102	19	jacks	jack	NOUN
ct-11260	102	20	in	in	ADP
ct-11260	102	21	italy	italy	PROPN
ct-11260	102	22	.	.	PUNCT
ct-11260	103	1	vet	vet	NOUN
ct-11260	103	2	rec	rec	X
ct-11260	103	3	2009;165:540	2009;165:540	NUM
ct-11260	103	4	-	-	SYM
ct-11260	103	5	541	541	NUM
ct-11260	103	6	.	.	PUNCT
ct-11260	103	7	17	17	NUM
ct-11260	103	8	.	.	PUNCT
ct-11260	104	1	breuil	breuil	PROPN
ct-11260	104	2	mf	mf	PROPN
ct-11260	104	3	,	,	PUNCT
ct-11260	104	4	duquesne	duquesne	PROPN
ct-11260	104	5	f	f	PROPN
ct-11260	104	6	,	,	PUNCT
ct-11260	104	7	laugier	laugi	ADJ
ct-11260	104	8	c	c	NOUN
ct-11260	104	9	,	,	PUNCT
ct-11260	104	10	et	et	PROPN
ct-11260	104	11	al	al	PROPN
ct-11260	104	12	:	:	PUNCT
ct-11260	104	13	phenotypic	phenotypic	NOUN
ct-11260	104	14	and	and	CCONJ
ct-11260	104	15	16s	16	NOUN
ct-11260	104	16	ribosomal	ribosomal	NOUN
ct-11260	104	17	rna	rna	NOUN
ct-11260	104	18	gene	gene	NOUN
ct-11260	104	19	diversity	diversity	NOUN
ct-11260	104	20	of	of	ADP
ct-11260	104	21	taylorella	taylorella	NOUN
ct-11260	104	22	asinigenitalis	asinigenitalis	PROPN
ct-11260	104	23	strains	strain	NOUN
ct-11260	104	24	isolated	isolate	VERB
ct-11260	104	25	between	between	ADP
ct-11260	104	26	1995	1995	NUM
ct-11260	104	27	and	and	CCONJ
ct-11260	104	28	2008	2008	NUM
ct-11260	104	29	.	.	PUNCT
ct-11260	105	1	vet	vet	NOUN
ct-11260	105	2	microbiol	microbiol	PROPN
ct-11260	105	3	2011;260	2011;260	NUM
ct-11260	105	4	-	-	PUNCT
ct-11260	105	5	266	266	NUM
ct-11260	105	6	.	.	PUNCT
ct-11260	106	1	18	18	NUM
ct-11260	106	2	.	.	X
ct-11260	106	3	smith	smith	PROPN
ct-11260	106	4	pk	pk	PROPN
ct-11260	106	5	,	,	PUNCT
ct-11260	106	6	krohn	krohn	PROPN
ct-11260	106	7	rl	rl	PROPN
ct-11260	106	8	,	,	PUNCT
ct-11260	106	9	hemanson	hemanson	PROPN
ct-11260	106	10	gt	gt	PROPN
ct-11260	106	11	,	,	PUNCT
ct-11260	106	12	et	et	PROPN
ct-11260	106	13	al	al	PROPN
ct-11260	106	14	:	:	PUNCT
ct-11260	106	15	measurement	measurement	NOUN
ct-11260	106	16	of	of	ADP
ct-11260	106	17	protein	protein	NOUN
ct-11260	106	18	using	use	VERB
ct-11260	106	19	bicinchoninic	bicinchoninic	ADJ
ct-11260	106	20	acid	acid	NOUN
ct-11260	106	21	.	.	PUNCT
ct-11260	107	1	anal	anal	ADJ
ct-11260	107	2	bioch	bioch	PROPN
ct-11260	107	3	1985;150:7685	1985;150:7685	NUM
ct-11260	107	4	.	.	PROPN
ct-11260	107	5	19	19	NUM
ct-11260	107	6	.	.	X
ct-11260	108	1	tazumi	tazumi	PROPN
ct-11260	108	2	a	a	PROPN
ct-11260	108	3	,	,	PUNCT
ct-11260	108	4	ono	ono	PROPN
ct-11260	108	5	s	s	PROPN
ct-11260	108	6	,	,	PUNCT
ct-11260	108	7	sekizuka	sekizuka	PROPN
ct-11260	108	8	t	t	PROPN
ct-11260	108	9	,	,	PUNCT
ct-11260	108	10	et	et	PROPN
ct-11260	108	11	al	al	PROPN
ct-11260	108	12	:	:	PUNCT
ct-11260	108	13	molecular	molecular	ADJ
ct-11260	108	14	characterization	characterization	NOUN
ct-11260	108	15	of	of	ADP
ct-11260	108	16	the	the	DET
ct-11260	108	17	sequences	sequence	NOUN
ct-11260	108	18	of	of	ADP
ct-11260	108	19	the	the	DET
ct-11260	108	20	16s-23s	16s-23s	PROPN
ct-11260	108	21	rdna	rdna	NOUN
ct-11260	108	22	internal	internal	PROPN
ct-11260	108	23	spacer	spacer	NOUN
ct-11260	108	24	region	region	NOUN
ct-11260	108	25	(	(	PUNCT
ct-11260	108	26	isr	isr	NOUN
ct-11260	108	27	)	)	PUNCT
ct-11260	108	28	from	from	ADP
ct-11260	108	29	isolates	isolate	NOUN
ct-11260	108	30	of	of	ADP
ct-11260	108	31	taylorella	taylorella	NOUN
ct-11260	108	32	asinigenitalis	asinigenitali	NOUN
ct-11260	108	33	.	.	PUNCT
ct-11260	109	1	bmc	bmc	ADJ
ct-11260	109	2	res	re	NOUN
ct-11260	109	3	notes	note	NOUN
ct-11260	109	4	.	.	PUNCT
ct-11260	110	1	2009	2009	NUM
ct-11260	110	2	;	;	PUNCT
ct-11260	110	3	2:33	2:33	NUM
ct-11260	110	4	.	.	PUNCT
ct-11260	111	1	20	20	NUM
ct-11260	111	2	.	.	PUNCT
ct-11260	112	1	hébert	hébert	PROPN
ct-11260	112	2	l	l	PROPN
ct-11260	112	3	,	,	PUNCT
ct-11260	112	4	mourmen	mourman	NOUN
ct-11260	112	5	b	b	X
ct-11260	112	6	,	,	PUNCT
ct-11260	112	7	pons	pon	NOUN
ct-11260	112	8	n	n	CCONJ
ct-11260	112	9	,	,	PUNCT
ct-11260	112	10	et	et	PROPN
ct-11260	112	11	al	al	PROPN
ct-11260	112	12	.	.	PUNCT
ct-11260	113	1	genomic	genomic	ADJ
ct-11260	113	2	characterization	characterization	NOUN
ct-11260	113	3	of	of	ADP
ct-11260	113	4	the	the	DET
ct-11260	113	5	taylorella	taylorella	NOUN
ct-11260	113	6	genus	genus	NOUN
ct-11260	113	7	.	.	PUNCT
ct-11260	114	1	plos	plos	PROPN
ct-11260	114	2	one	one	NUM
ct-11260	114	3	201	201	NUM
ct-11260	114	4	e29953	e29953	NOUN
ct-11260	114	5	.	.	PUNCT
ct-11260	115	1	clinical	clinical	ADJ
ct-11260	115	2	theriogenology	theriogenology	NOUN
ct-11260	115	3	•	•	NOUN
ct-11260	115	4	volume	volume	NOUN
ct-11260	115	5	4	4	NUM
ct-11260	115	6	number	number	NOUN
ct-11260	115	7	2	2	NUM
ct-11260	115	8	•	•	NOUN
ct-11260	115	9	june	june	PROPN
ct-11260	115	10	2012167	2012167	NUM