id	sid	tid	token	lemma	pos
ct-12705	1	1	1	1	NUM
ct-12705	1	2	contact	contact	PROPN
ct-12705	1	3	maria	maria	PROPN
ct-12705	1	4	ferrer	ferrer	PROPN
ct-12705	1	5	msferrer@uga.edu	msferrer@uga.edu	PROPN
ct-12705	1	6	supplemental	supplemental	ADJ
ct-12705	1	7	data	datum	NOUN
ct-12705	1	8	for	for	ADP
ct-12705	1	9	this	this	DET
ct-12705	1	10	article	article	NOUN
ct-12705	1	11	can	can	AUX
ct-12705	1	12	be	be	AUX
ct-12705	1	13	accessed	access	VERB
ct-12705	1	14	online	online	ADV
ct-12705	1	15	at	at	ADP
ct-12705	1	16	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	1	17	©	©	PROPN
ct-12705	1	18	2025	2025	NUM
ct-12705	1	19	the	the	DET
ct-12705	1	20	author(s	author(s	NOUN
ct-12705	1	21	)	)	PUNCT
ct-12705	1	22	.	.	PUNCT
ct-12705	2	1	this	this	PRON
ct-12705	2	2	is	be	AUX
ct-12705	2	3	an	an	DET
ct-12705	2	4	open	open	ADJ
ct-12705	2	5	access	access	NOUN
ct-12705	2	6	article	article	NOUN
ct-12705	2	7	distributed	distribute	VERB
ct-12705	2	8	under	under	ADP
ct-12705	2	9	the	the	DET
ct-12705	2	10	terms	term	NOUN
ct-12705	2	11	of	of	ADP
ct-12705	2	12	the	the	DET
ct-12705	2	13	creative	creative	ADJ
ct-12705	2	14	commons	common	NOUN
ct-12705	2	15	attribution	attribution	NOUN
ct-12705	2	16	-	-	PUNCT
ct-12705	2	17	noncommercial	noncommercial	ADJ
ct-12705	2	18	4.0	4.0	NUM
ct-12705	2	19	international	international	ADJ
ct-12705	2	20	license	license	NOUN
ct-12705	2	21	(	(	PUNCT
ct-12705	2	22	http://	http://	PROPN
ct-12705	2	23	creativecommons.org/licenses/by-nc/4.0/	creativecommons.org/licenses/by-nc/4.0/	NOUN
ct-12705	2	24	)	)	PUNCT
ct-12705	2	25	,	,	PUNCT
ct-12705	2	26	permitting	permit	VERB
ct-12705	2	27	all	all	DET
ct-12705	2	28	noncommercial	noncommercial	ADJ
ct-12705	2	29	use	use	NOUN
ct-12705	2	30	,	,	PUNCT
ct-12705	2	31	distribution	distribution	NOUN
ct-12705	2	32	,	,	PUNCT
ct-12705	2	33	and	and	CCONJ
ct-12705	2	34	reproduction	reproduction	NOUN
ct-12705	2	35	in	in	ADP
ct-12705	2	36	any	any	DET
ct-12705	2	37	medium	medium	NOUN
ct-12705	2	38	,	,	PUNCT
ct-12705	2	39	provided	provide	VERB
ct-12705	2	40	the	the	DET
ct-12705	2	41	original	original	ADJ
ct-12705	2	42	work	work	NOUN
ct-12705	2	43	is	be	AUX
ct-12705	2	44	properly	properly	ADV
ct-12705	2	45	cited	cite	VERB
ct-12705	2	46	.	.	PUNCT
ct-12705	3	1	citation	citation	NOUN
ct-12705	3	2	:	:	PUNCT
ct-12705	3	3	clinical	clinical	ADJ
ct-12705	3	4	theriogenology	theriogenology	NOUN
ct-12705	3	5	2025	2025	NUM
ct-12705	3	6	,	,	PUNCT
ct-12705	3	7	17	17	NUM
ct-12705	3	8	,	,	PUNCT
ct-12705	3	9	12705	12705	NUM
ct-12705	3	10	,	,	PUNCT
ct-12705	3	11	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	ADJ
ct-12705	3	12	research	research	NOUN
ct-12705	3	13	report	report	NOUN
ct-12705	3	14	constitutive	constitutive	ADJ
ct-12705	3	15	expression	expression	NOUN
ct-12705	3	16	of	of	ADP
ct-12705	3	17	toll	toll	NOUN
ct-12705	3	18	-	-	PUNCT
ct-12705	3	19	like	like	ADJ
ct-12705	3	20	receptor	receptor	NOUN
ct-12705	3	21	genes	gene	NOUN
ct-12705	3	22	and	and	CCONJ
ct-12705	3	23	signaling	signal	VERB
ct-12705	3	24	pathways	pathway	NOUN
ct-12705	3	25	in	in	ADP
ct-12705	3	26	stallion	stallion	NOUN
ct-12705	3	27	testis	testis	NOUN
ct-12705	3	28	and	and	CCONJ
ct-12705	3	29	epididymis	epididymis	PROPN
ct-12705	3	30	maria	maria	PROPN
ct-12705	3	31	ferrer	ferrer	PROPN
ct-12705	3	32	,	,	PUNCT
ct-12705	3	33	a	a	DET
ct-12705	3	34	karen	karen	PROPN
ct-12705	3	35	moran	moran	PROPN
ct-12705	3	36	,	,	PUNCT
ct-12705	3	37	b	b	PROPN
ct-12705	3	38	maria	maria	PROPN
ct-12705	3	39	bilbao	bilbao	PROPN
ct-12705	3	40	,	,	PUNCT
ct-12705	3	41	b	b	PROPN
ct-12705	3	42	michele	michele	PROPN
ct-12705	3	43	barletta	barletta	PROPN
ct-12705	3	44	,	,	PUNCT
ct-12705	3	45	a	a	DET
ct-12705	3	46	jared	jared	PROPN
ct-12705	3	47	williams	williams	PROPN
ct-12705	3	48	,	,	PUNCT
ct-12705	3	49	a	a	DET
ct-12705	3	50	julie	julie	PROPN
ct-12705	3	51	gordon	gordon	PROPN
ct-12705	3	52	,	,	PUNCT
ct-12705	3	53	a	a	DET
ct-12705	3	54	julian	julian	PROPN
ct-12705	3	55	bartoloméb	bartoloméb	PROPN
ct-12705	3	56	adepartment	adepartment	NOUN
ct-12705	3	57	of	of	ADP
ct-12705	3	58	large	large	ADJ
ct-12705	3	59	animal	animal	NOUN
ct-12705	3	60	medicine	medicine	NOUN
ct-12705	3	61	,	,	PUNCT
ct-12705	3	62	college	college	NOUN
ct-12705	3	63	of	of	ADP
ct-12705	3	64	veterinary	veterinary	ADJ
ct-12705	3	65	medicine	medicine	NOUN
ct-12705	3	66	,	,	PUNCT
ct-12705	3	67	university	university	NOUN
ct-12705	3	68	of	of	ADP
ct-12705	3	69	georgia	georgia	PROPN
ct-12705	3	70	,	,	PUNCT
ct-12705	3	71	athens	athens	PROPN
ct-12705	3	72	,	,	PUNCT
ct-12705	3	73	ga	ga	PROPN
ct-12705	3	74	,	,	PUNCT
ct-12705	3	75	usa	usa	PROPN
ct-12705	3	76	bfacultad	bfacultad	PROPN
ct-12705	3	77	de	de	PROPN
ct-12705	3	78	ciencias	ciencias	PROPN
ct-12705	3	79	veterinarias	veterinaria	VERB
ct-12705	3	80	,	,	PUNCT
ct-12705	3	81	universidad	universidad	PROPN
ct-12705	3	82	nacional	nacional	PROPN
ct-12705	3	83	de	de	X
ct-12705	3	84	la	la	PROPN
ct-12705	3	85	pampa	pampa	PROPN
ct-12705	3	86	,	,	PUNCT
ct-12705	3	87	la	la	PROPN
ct-12705	3	88	pampa	pampa	PROPN
ct-12705	3	89	,	,	PUNCT
ct-12705	3	90	argentina	argentina	PROPN
ct-12705	3	91	abstract	abstract	ADJ
ct-12705	3	92	toll	toll	NOUN
ct-12705	3	93	-	-	PUNCT
ct-12705	3	94	like	like	ADJ
ct-12705	3	95	receptors	receptor	NOUN
ct-12705	3	96	(	(	PUNCT
ct-12705	3	97	tlrs	tlrs	NOUN
ct-12705	3	98	)	)	PUNCT
ct-12705	3	99	expression	expression	NOUN
ct-12705	3	100	pattern	pattern	NOUN
ct-12705	3	101	and	and	CCONJ
ct-12705	3	102	their	their	PRON
ct-12705	3	103	associated	associated	ADJ
ct-12705	3	104	molecules	molecule	NOUN
ct-12705	3	105	have	have	AUX
ct-12705	3	106	not	not	PART
ct-12705	3	107	been	be	AUX
ct-12705	3	108	described	describe	VERB
ct-12705	3	109	in	in	ADP
ct-12705	3	110	stallions	stallion	NOUN
ct-12705	3	111	.	.	PUNCT
ct-12705	4	1	understanding	understand	VERB
ct-12705	4	2	the	the	DET
ct-12705	4	3	tlr	tlr	PROPN
ct-12705	4	4	expression	expression	NOUN
ct-12705	4	5	and	and	CCONJ
ct-12705	4	6	their	their	PRON
ct-12705	4	7	responses	response	NOUN
ct-12705	4	8	to	to	ADP
ct-12705	4	9	activation	activation	NOUN
ct-12705	4	10	is	be	AUX
ct-12705	4	11	key	key	ADJ
ct-12705	4	12	in	in	ADP
ct-12705	4	13	interpreting	interpret	VERB
ct-12705	4	14	the	the	DET
ct-12705	4	15	interactions	interaction	NOUN
ct-12705	4	16	between	between	ADP
ct-12705	4	17	immune	immune	ADJ
ct-12705	4	18	system	system	NOUN
ct-12705	4	19	and	and	CCONJ
ct-12705	4	20	reproductive	reproductive	ADJ
ct-12705	4	21	system	system	NOUN
ct-12705	4	22	in	in	ADP
ct-12705	4	23	healthy	healthy	ADJ
ct-12705	4	24	and	and	CCONJ
ct-12705	4	25	ill	ill	ADJ
ct-12705	4	26	animals	animal	NOUN
ct-12705	4	27	.	.	PUNCT
ct-12705	5	1	objective	objective	NOUN
ct-12705	5	2	of	of	ADP
ct-12705	5	3	this	this	DET
ct-12705	5	4	study	study	NOUN
ct-12705	5	5	was	be	AUX
ct-12705	5	6	to	to	PART
ct-12705	5	7	describe	describe	VERB
ct-12705	5	8	the	the	DET
ct-12705	5	9	constitutive	constitutive	ADJ
ct-12705	5	10	expression	expression	NOUN
ct-12705	5	11	pattern	pattern	NOUN
ct-12705	5	12	of	of	ADP
ct-12705	5	13	tlrs	tlrs	NOUN
ct-12705	5	14	and	and	CCONJ
ct-12705	5	15	their	their	PRON
ct-12705	5	16	signaling	signal	VERB
ct-12705	5	17	pathways	pathway	NOUN
ct-12705	5	18	in	in	ADP
ct-12705	5	19	stallion	stallion	NOUN
ct-12705	5	20	’s	’s	PART
ct-12705	5	21	testis	testis	NOUN
ct-12705	5	22	and	and	CCONJ
ct-12705	5	23	epididymis	epididymis	NOUN
ct-12705	5	24	.	.	PUNCT
ct-12705	6	1	it	it	PRON
ct-12705	6	2	was	be	AUX
ct-12705	6	3	hypothesized	hypothesize	VERB
ct-12705	6	4	that	that	SCONJ
ct-12705	6	5	all	all	DET
ct-12705	6	6	tlrs	tlrs	ADJ
ct-12705	6	7	and	and	CCONJ
ct-12705	6	8	downstream	downstream	ADJ
ct-12705	6	9	signaling	signal	VERB
ct-12705	6	10	molecules	molecule	NOUN
ct-12705	6	11	are	be	AUX
ct-12705	6	12	constitutively	constitutively	ADV
ct-12705	6	13	expressed	express	VERB
ct-12705	6	14	in	in	ADP
ct-12705	6	15	these	these	DET
ct-12705	6	16	tissues	tissue	NOUN
ct-12705	6	17	in	in	ADP
ct-12705	6	18	reproductively	reproductively	ADV
ct-12705	6	19	normal	normal	ADJ
ct-12705	6	20	stallions	stallion	NOUN
ct-12705	6	21	.	.	PUNCT
ct-12705	7	1	transcriptome	transcriptome	ADJ
ct-12705	7	2	analysis	analysis	NOUN
ct-12705	7	3	was	be	AUX
ct-12705	7	4	performed	perform	VERB
ct-12705	7	5	in	in	ADP
ct-12705	7	6	testicular	testicular	ADJ
ct-12705	7	7	and	and	CCONJ
ct-12705	7	8	epididymal	epididymal	ADJ
ct-12705	7	9	samples	sample	NOUN
ct-12705	7	10	from	from	ADP
ct-12705	7	11	reproductively	reproductively	ADV
ct-12705	7	12	normal	normal	ADJ
ct-12705	7	13	stallions	stallion	NOUN
ct-12705	7	14	(	(	PUNCT
ct-12705	7	15	n	n	NOUN
ct-12705	7	16	=	=	SYM
ct-12705	7	17	8)	8)	NUM
ct-12705	7	18	.	.	PUNCT
ct-12705	8	1	a	a	DET
ct-12705	8	2	detectable	detectable	ADJ
ct-12705	8	3	constitutive	constitutive	ADJ
ct-12705	8	4	expression	expression	NOUN
ct-12705	8	5	of	of	ADP
ct-12705	8	6	all	all	DET
ct-12705	8	7	tlrs	tlrs	NOUN
ct-12705	8	8	,	,	PUNCT
ct-12705	8	9	costimulatory	costimulatory	NOUN
ct-12705	8	10	molecules	molecule	NOUN
ct-12705	8	11	,	,	PUNCT
ct-12705	8	12	and	and	CCONJ
ct-12705	8	13	most	most	ADV
ct-12705	8	14	downstream	downstream	ADJ
ct-12705	8	15	adaptors	adaptor	NOUN
ct-12705	8	16	and	and	CCONJ
ct-12705	8	17	effectors	effector	NOUN
ct-12705	8	18	was	be	AUX
ct-12705	8	19	identified	identify	VERB
ct-12705	8	20	in	in	ADP
ct-12705	8	21	stallion	stallion	NOUN
ct-12705	8	22	reproductive	reproductive	ADJ
ct-12705	8	23	tissues	tissue	NOUN
ct-12705	8	24	.	.	PUNCT
ct-12705	9	1	most	most	ADJ
ct-12705	9	2	significant	significant	ADJ
ct-12705	9	3	pathways	pathway	NOUN
ct-12705	9	4	were	be	AUX
ct-12705	9	5	associated	associate	VERB
ct-12705	9	6	with	with	ADP
ct-12705	9	7	tlr3	tlr3	NOUN
ct-12705	9	8	,	,	PUNCT
ct-12705	9	9	tlr2	tlr2	PROPN
ct-12705	9	10	/	/	SYM
ct-12705	9	11	tlr1	tlr1	PROPN
ct-12705	9	12	,	,	PUNCT
ct-12705	9	13	tlr2	tlr2	PROPN
ct-12705	9	14	/	/	SYM
ct-12705	9	15	tlr6	tlr6	PROPN
ct-12705	9	16	,	,	PUNCT
ct-12705	9	17	and	and	CCONJ
ct-12705	9	18	the	the	DET
ct-12705	9	19	effector	effector	NOUN
ct-12705	9	20	molecules	molecule	NOUN
ct-12705	9	21	c	c	NOUN
ct-12705	9	22	-	-	PUNCT
ct-12705	9	23	c	c	NOUN
ct-12705	9	24	motif	motif	NOUN
ct-12705	9	25	ligand	ligand	NOUN
ct-12705	9	26	5	5	NUM
ct-12705	9	27	(	(	PUNCT
ct-12705	9	28	ccl5	ccl5	PROPN
ct-12705	9	29	)	)	PUNCT
ct-12705	9	30	and	and	CCONJ
ct-12705	9	31	cd40	cd40	PROPN
ct-12705	9	32	.	.	PUNCT
ct-12705	10	1	most	most	ADJ
ct-12705	10	2	genes	gene	NOUN
ct-12705	10	3	were	be	AUX
ct-12705	10	4	overexpressed	overexpresse	VERB
ct-12705	10	5	in	in	ADP
ct-12705	10	6	the	the	DET
ct-12705	10	7	epididymis	epididymis	NOUN
ct-12705	10	8	compared	compare	VERB
ct-12705	10	9	to	to	ADP
ct-12705	10	10	testis	testis	PRON
ct-12705	10	11	.	.	PUNCT
ct-12705	11	1	widespread	widespread	ADJ
ct-12705	11	2	and	and	CCONJ
ct-12705	11	3	abundant	abundant	ADJ
ct-12705	11	4	expression	expression	NOUN
ct-12705	11	5	of	of	ADP
ct-12705	11	6	these	these	DET
ct-12705	11	7	genes	gene	NOUN
ct-12705	11	8	supports	support	VERB
ct-12705	11	9	an	an	DET
ct-12705	11	10	important	important	ADJ
ct-12705	11	11	function	function	NOUN
ct-12705	11	12	of	of	ADP
ct-12705	11	13	the	the	DET
ct-12705	11	14	innate	innate	ADJ
ct-12705	11	15	immunity	immunity	NOUN
ct-12705	11	16	in	in	ADP
ct-12705	11	17	testicular	testicular	NOUN
ct-12705	11	18	and	and	CCONJ
ct-12705	11	19	epididymal	epididymal	ADJ
ct-12705	11	20	defense	defense	NOUN
ct-12705	11	21	.	.	PUNCT
ct-12705	12	1	these	these	DET
ct-12705	12	2	tlrs	tlrs	NOUN
ct-12705	12	3	may	may	AUX
ct-12705	12	4	also	also	ADV
ct-12705	12	5	have	have	VERB
ct-12705	12	6	a	a	DET
ct-12705	12	7	physiological	physiological	ADJ
ct-12705	12	8	role	role	NOUN
ct-12705	12	9	in	in	ADP
ct-12705	12	10	maintaining	maintain	VERB
ct-12705	12	11	the	the	DET
ct-12705	12	12	tolerogenic	tolerogenic	ADJ
ct-12705	12	13	environment	environment	NOUN
ct-12705	12	14	,	,	PUNCT
ct-12705	12	15	supporting	support	VERB
ct-12705	12	16	posttesticular	posttesticular	ADJ
ct-12705	12	17	maturation	maturation	NOUN
ct-12705	12	18	,	,	PUNCT
ct-12705	12	19	or	or	CCONJ
ct-12705	12	20	removing	remove	VERB
ct-12705	12	21	defective	defective	ADJ
ct-12705	12	22	sperm	sperm	NOUN
ct-12705	12	23	from	from	ADP
ct-12705	12	24	the	the	DET
ct-12705	12	25	tubular	tubular	ADJ
ct-12705	12	26	system	system	NOUN
ct-12705	12	27	.	.	PUNCT
ct-12705	13	1	keywords	keyword	NOUN
ct-12705	13	2	:	:	PUNCT
ct-12705	13	3	horse	horse	NOUN
ct-12705	13	4	,	,	PUNCT
ct-12705	13	5	testis	testis	NOUN
ct-12705	13	6	,	,	PUNCT
ct-12705	13	7	epididymis	epididymis	NOUN
ct-12705	13	8	,	,	PUNCT
ct-12705	13	9	toll	toll	NOUN
ct-12705	13	10	-	-	PUNCT
ct-12705	13	11	like	like	ADJ
ct-12705	13	12	receptor	receptor	NOUN
ct-12705	13	13	,	,	PUNCT
ct-12705	13	14	innate	innate	ADJ
ct-12705	13	15	immunity	immunity	NOUN
ct-12705	13	16	,	,	PUNCT
ct-12705	13	17	transcriptome	transcriptome	ADJ
ct-12705	13	18	introduction	introduction	NOUN
ct-12705	13	19	equine	equine	NOUN
ct-12705	13	20	toll	toll	NOUN
ct-12705	13	21	-	-	PUNCT
ct-12705	13	22	like	like	ADJ
ct-12705	13	23	receptor	receptor	NOUN
ct-12705	13	24	(	(	PUNCT
ct-12705	13	25	tlr	tlr	PROPN
ct-12705	13	26	)	)	PUNCT
ct-12705	13	27	family	family	NOUN
ct-12705	13	28	includes	include	VERB
ct-12705	13	29	12	12	NUM
ct-12705	13	30	reported	report	VERB
ct-12705	13	31	transmembrane	transmembrane	ADJ
ct-12705	13	32	proteins	protein	NOUN
ct-12705	13	33	localized	localize	VERB
ct-12705	13	34	on	on	ADP
ct-12705	13	35	the	the	DET
ct-12705	13	36	plasma	plasma	NOUN
ct-12705	13	37	membrane	membrane	NOUN
ct-12705	13	38	(	(	PUNCT
ct-12705	13	39	tlr1	tlr1	PROPN
ct-12705	13	40	,	,	PUNCT
ct-12705	13	41	tlr2	tlr2	PROPN
ct-12705	13	42	,	,	PUNCT
ct-12705	13	43	tlr4	tlr4	PROPN
ct-12705	13	44	,	,	PUNCT
ct-12705	13	45	tlr5	tlr5	PROPN
ct-12705	13	46	,	,	PUNCT
ct-12705	13	47	tlr6	tlr6	PROPN
ct-12705	13	48	,	,	PUNCT
ct-12705	13	49	tlr10	tlr10	PROPN
ct-12705	13	50	,	,	PUNCT
ct-12705	13	51	tlr11	tlr11	PROPN
ct-12705	13	52	)	)	PUNCT
ct-12705	13	53	or	or	CCONJ
ct-12705	13	54	cytosolic	cytosolic	ADJ
ct-12705	13	55	endosomal	endosomal	ADJ
ct-12705	13	56	membranes	membrane	NOUN
ct-12705	13	57	(	(	PUNCT
ct-12705	13	58	tlr3	tlr3	NOUN
ct-12705	13	59	,	,	PUNCT
ct-12705	13	60	tlr7	tlr7	NOUN
ct-12705	13	61	,	,	PUNCT
ct-12705	13	62	tlr8	tlr8	NOUN
ct-12705	13	63	,	,	PUNCT
ct-12705	13	64	tlr9	tlr9	NOUN
ct-12705	13	65	,	,	PUNCT
ct-12705	13	66	tlr12).1,2	tlr12).1,2	ADP
ct-12705	13	67	these	these	DET
ct-12705	13	68	receptors	receptor	NOUN
ct-12705	13	69	are	be	AUX
ct-12705	13	70	essential	essential	ADJ
ct-12705	13	71	for	for	ADP
ct-12705	13	72	the	the	DET
ct-12705	13	73	initiation	initiation	NOUN
ct-12705	13	74	of	of	ADP
ct-12705	13	75	the	the	DET
ct-12705	13	76	innate	innate	ADJ
ct-12705	13	77	immune	immune	ADJ
ct-12705	13	78	response	response	NOUN
ct-12705	13	79	through	through	ADP
ct-12705	13	80	recognition	recognition	NOUN
ct-12705	13	81	of	of	ADP
ct-12705	13	82	conserved	conserved	ADJ
ct-12705	13	83	pathogen	pathogen	NOUN
ct-12705	13	84	-	-	PUNCT
ct-12705	13	85	associated	associate	VERB
ct-12705	13	86	molecular	molecular	ADJ
ct-12705	13	87	patterns	pattern	NOUN
ct-12705	13	88	(	(	PUNCT
ct-12705	13	89	pamps	pamp	NOUN
ct-12705	13	90	)	)	PUNCT
ct-12705	13	91	.	.	PUNCT
ct-12705	14	1	although	although	SCONJ
ct-12705	14	2	surface	surface	NOUN
ct-12705	14	3	tlrs	tlrs	NOUN
ct-12705	14	4	identify	identify	VERB
ct-12705	14	5	bacterial	bacterial	ADJ
ct-12705	14	6	,	,	PUNCT
ct-12705	14	7	fungal	fungal	ADJ
ct-12705	14	8	and	and	CCONJ
ct-12705	14	9	protozoal	protozoal	NOUN
ct-12705	14	10	peptides	peptide	NOUN
ct-12705	14	11	and	and	CCONJ
ct-12705	14	12	lipopolysaccharides	lipopolysaccharide	NOUN
ct-12705	14	13	,	,	PUNCT
ct-12705	14	14	cytosolic	cytosolic	ADJ
ct-12705	14	15	tlrs	tlrs	NOUN
ct-12705	14	16	identify	identify	VERB
ct-12705	14	17	viral	viral	ADJ
ct-12705	14	18	and	and	CCONJ
ct-12705	14	19	bacterial	bacterial	ADJ
ct-12705	14	20	nucleic	nucleic	ADJ
ct-12705	14	21	acids	acid	NOUN
ct-12705	14	22	.	.	PUNCT
ct-12705	15	1	in	in	ADP
ct-12705	15	2	mammals	mammal	NOUN
ct-12705	15	3	,	,	PUNCT
ct-12705	15	4	most	most	ADV
ct-12705	15	5	tlrs	tlrs	NOUN
ct-12705	15	6	bind	bind	VERB
ct-12705	15	7	several	several	ADJ
ct-12705	15	8	ligands	ligand	NOUN
ct-12705	15	9	by	by	ADP
ct-12705	15	10	forming	form	VERB
ct-12705	15	11	homodimers	homodimer	NOUN
ct-12705	15	12	;	;	PUNCT
ct-12705	15	13	however	however	ADV
ct-12705	15	14	,	,	PUNCT
ct-12705	15	15	tlr2	tlr2	PROPN
ct-12705	15	16	forms	form	NOUN
ct-12705	15	17	heterodimers	heterodimer	NOUN
ct-12705	15	18	with	with	ADP
ct-12705	15	19	tlr1	tlr1	PROPN
ct-12705	15	20	or	or	CCONJ
ct-12705	15	21	tlr6	tlr6	PROPN
ct-12705	15	22	.	.	PUNCT
ct-12705	16	1	dimer	dimer	PROPN
ct-12705	16	2	type	type	NOUN
ct-12705	16	3	influences	influence	VERB
ct-12705	16	4	the	the	DET
ct-12705	16	5	affinity	affinity	NOUN
ct-12705	16	6	and	and	CCONJ
ct-12705	16	7	magnitude	magnitude	NOUN
ct-12705	16	8	of	of	ADP
ct-12705	16	9	the	the	DET
ct-12705	16	10	tlr	tlr	PROPN
ct-12705	16	11	response	response	NOUN
ct-12705	16	12	to	to	ADP
ct-12705	16	13	its	its	PRON
ct-12705	16	14	ligand	ligand	NOUN
ct-12705	16	15	.	.	PUNCT
ct-12705	17	1	the	the	DET
ct-12705	17	2	heterodimer	heterodimer	NOUN
ct-12705	17	3	tlr2/1	tlr2/1	PUNCT
ct-12705	17	4	has	have	VERB
ct-12705	17	5	higher	high	ADJ
ct-12705	17	6	affinity	affinity	NOUN
ct-12705	17	7	and	and	CCONJ
ct-12705	17	8	a	a	DET
ct-12705	17	9	more	more	ADV
ct-12705	17	10	potent	potent	ADJ
ct-12705	17	11	response	response	NOUN
ct-12705	17	12	to	to	ADP
ct-12705	17	13	bacterial	bacterial	ADJ
ct-12705	17	14	lipopeptides	lipopeptide	NOUN
ct-12705	17	15	than	than	ADP
ct-12705	17	16	tlr2/6	tlr2/6	PROPN
ct-12705	17	17	in	in	ADP
ct-12705	17	18	the	the	DET
ct-12705	17	19	horse.3	horse.3	PROPN
ct-12705	17	20	upon	upon	SCONJ
ct-12705	17	21	engagement	engagement	NOUN
ct-12705	17	22	with	with	ADP
ct-12705	17	23	the	the	DET
ct-12705	17	24	ligand	ligand	NOUN
ct-12705	17	25	,	,	PUNCT
ct-12705	17	26	tlr	tlr	PROPN
ct-12705	17	27	dimers	dimer	NOUN
ct-12705	17	28	initiate	initiate	VERB
ct-12705	17	29	the	the	DET
ct-12705	17	30	myeloid	myeloid	ADJ
ct-12705	17	31	differentiation	differentiation	NOUN
ct-12705	17	32	protein	protein	NOUN
ct-12705	17	33	88	88	NUM
ct-12705	17	34	(	(	PUNCT
ct-12705	17	35	myd88)-dependent	myd88)-dependent	NOUN
ct-12705	17	36	pathway	pathway	NOUN
ct-12705	17	37	.	.	PUNCT
ct-12705	18	1	recruitment	recruitment	NOUN
ct-12705	18	2	of	of	ADP
ct-12705	18	3	the	the	DET
ct-12705	18	4	adaptor	adaptor	NOUN
ct-12705	18	5	proteins	protein	NOUN
ct-12705	18	6	myd88	myd88	ADJ
ct-12705	18	7	and	and	CCONJ
ct-12705	18	8	tir	tir	PROPN
ct-12705	18	9	domain	domain	NOUN
ct-12705	18	10	containing	contain	VERB
ct-12705	18	11	adaptor	adaptor	NOUN
ct-12705	18	12	protein	protein	NOUN
ct-12705	18	13	(	(	PUNCT
ct-12705	18	14	tirap	tirap	NOUN
ct-12705	18	15	)	)	PUNCT
ct-12705	18	16	results	result	NOUN
ct-12705	18	17	in	in	ADP
ct-12705	18	18	activation	activation	NOUN
ct-12705	18	19	of	of	ADP
ct-12705	18	20	the	the	DET
ct-12705	18	21	cytosolic	cytosolic	ADJ
ct-12705	18	22	nuclear	nuclear	ADJ
ct-12705	18	23	factor	factor	NOUN
ct-12705	18	24	kappa	kappa	PROPN
ct-12705	18	25	b	b	PROPN
ct-12705	18	26	(	(	PUNCT
ct-12705	18	27	nf	nf	PROPN
ct-12705	18	28	-	-	PUNCT
ct-12705	18	29	kb	kb	NOUN
ct-12705	18	30	)	)	PUNCT
ct-12705	18	31	,	,	PUNCT
ct-12705	18	32	its	its	PRON
ct-12705	18	33	translocation	translocation	NOUN
ct-12705	18	34	to	to	ADP
ct-12705	18	35	the	the	DET
ct-12705	18	36	nucleus	nucleus	NOUN
ct-12705	18	37	,	,	PUNCT
ct-12705	18	38	and	and	CCONJ
ct-12705	18	39	transcription	transcription	NOUN
ct-12705	18	40	of	of	ADP
ct-12705	18	41	proinflammatory	proinflammatory	ADJ
ct-12705	18	42	cytokine	cytokine	NOUN
ct-12705	18	43	genes	gene	NOUN
ct-12705	18	44	,	,	PUNCT
ct-12705	18	45	such	such	ADJ
ct-12705	18	46	as	as	ADP
ct-12705	18	47	tnfα	tnfα	NOUN
ct-12705	18	48	,	,	PUNCT
ct-12705	18	49	il-6	il-6	NUM
ct-12705	18	50	,	,	PUNCT
ct-12705	18	51	il-1	il-1	ADP
ct-12705	18	52	,	,	PUNCT
ct-12705	18	53	and	and	CCONJ
ct-12705	18	54	il-12.4	il-12.4	VERB
ct-12705	18	55	the	the	DET
ct-12705	18	56	exception	exception	NOUN
ct-12705	18	57	to	to	ADP
ct-12705	18	58	this	this	DET
ct-12705	18	59	pathway	pathway	NOUN
ct-12705	18	60	is	be	AUX
ct-12705	18	61	tlr3	tlr3	NOUN
ct-12705	18	62	,	,	PUNCT
ct-12705	18	63	whose	whose	DET
ct-12705	18	64	activation	activation	NOUN
ct-12705	18	65	triggers	trigger	VERB
ct-12705	18	66	the	the	DET
ct-12705	18	67	toll	toll	NOUN
ct-12705	18	68	/	/	SYM
ct-12705	18	69	il-1r	il-1r	PROPN
ct-12705	18	70	domain	domain	NOUN
ct-12705	18	71	-	-	PUNCT
ct-12705	18	72	containing	contain	VERB
ct-12705	18	73	adaptor	adaptor	NOUN
ct-12705	18	74	inducing	induce	VERB
ct-12705	18	75	interferon	interferon	ADJ
ct-12705	18	76	β	β	X
ct-12705	18	77	(	(	PUNCT
ct-12705	18	78	trif)-dependent	trif)-dependent	NOUN
ct-12705	18	79	pathway	pathway	NOUN
ct-12705	18	80	.	.	PUNCT
ct-12705	19	1	recruitment	recruitment	NOUN
ct-12705	19	2	of	of	ADP
ct-12705	19	3	trif	trif	NOUN
ct-12705	19	4	and	and	CCONJ
ct-12705	19	5	trif	trif	NOUN
ct-12705	19	6	-	-	PUNCT
ct-12705	19	7	related	relate	VERB
ct-12705	19	8	adaptor	adaptor	NOUN
ct-12705	19	9	molecule	molecule	NOUN
ct-12705	19	10	culminates	culminate	VERB
ct-12705	19	11	with	with	ADP
ct-12705	19	12	activation	activation	NOUN
ct-12705	19	13	and	and	CCONJ
ct-12705	19	14	nuclear	nuclear	ADJ
ct-12705	19	15	translocation	translocation	NOUN
ct-12705	19	16	of	of	ADP
ct-12705	19	17	interferon	interferon	ADJ
ct-12705	19	18	regulatory	regulatory	ADJ
ct-12705	19	19	factor	factor	NOUN
ct-12705	19	20	3	3	NUM
ct-12705	19	21	and	and	CCONJ
ct-12705	19	22	expression	expression	NOUN
ct-12705	19	23	of	of	ADP
ct-12705	19	24	type	type	NOUN
ct-12705	19	25	1	1	NUM
ct-12705	19	26	interferons	interferon	NOUN
ct-12705	19	27	(	(	PUNCT
ct-12705	19	28	ifn	ifn	PROPN
ct-12705	19	29	-	-	PUNCT
ct-12705	19	30	α	α	NOUN
ct-12705	19	31	and	and	CCONJ
ct-12705	19	32	ifn	ifn	PROPN
ct-12705	19	33	-	-	PUNCT
ct-12705	19	34	β).2,4	β).2,4	PROPN
ct-12705	19	35	the	the	DET
ct-12705	19	36	tlr4	tlr4	NOUN
ct-12705	19	37	has	have	VERB
ct-12705	19	38	the	the	DET
ct-12705	19	39	ability	ability	NOUN
ct-12705	19	40	to	to	PART
ct-12705	19	41	activate	activate	VERB
ct-12705	19	42	both	both	DET
ct-12705	19	43	pathways	pathway	NOUN
ct-12705	19	44	and	and	CCONJ
ct-12705	19	45	requires	require	VERB
ct-12705	19	46	the	the	DET
ct-12705	19	47	presence	presence	NOUN
ct-12705	19	48	of	of	ADP
ct-12705	19	49	the	the	DET
ct-12705	19	50	co	co	ADJ
ct-12705	19	51	-	-	ADJ
ct-12705	19	52	stimulatory	stimulatory	ADJ
ct-12705	19	53	molecules	molecule	NOUN
ct-12705	19	54	cd14	cd14	PROPN
ct-12705	19	55	and	and	CCONJ
ct-12705	19	56	myeloid	myeloid	ADJ
ct-12705	19	57	differentiation	differentiation	NOUN
ct-12705	19	58	.	.	PUNCT
ct-12705	20	1	although	although	SCONJ
ct-12705	20	2	the	the	DET
ct-12705	20	3	innate	innate	ADJ
ct-12705	20	4	immunity	immunity	NOUN
ct-12705	20	5	has	have	VERB
ct-12705	20	6	a	a	DET
ct-12705	20	7	critical	critical	ADJ
ct-12705	20	8	role	role	NOUN
ct-12705	20	9	in	in	ADP
ct-12705	20	10	the	the	DET
ct-12705	20	11	initial	initial	ADJ
ct-12705	20	12	control	control	NOUN
ct-12705	20	13	of	of	ADP
ct-12705	20	14	infectious	infectious	ADJ
ct-12705	20	15	agents	agent	NOUN
ct-12705	20	16	,	,	PUNCT
ct-12705	20	17	tlrs	tlrs	NOUN
ct-12705	20	18	can	can	AUX
ct-12705	20	19	also	also	ADV
ct-12705	20	20	be	be	AUX
ct-12705	20	21	activated	activate	VERB
ct-12705	20	22	by	by	ADP
ct-12705	20	23	endogenous	endogenous	ADJ
ct-12705	20	24	damage	damage	NOUN
ct-12705	20	25	-	-	PUNCT
ct-12705	20	26	associated	associate	VERB
ct-12705	20	27	molecular	molecular	ADJ
ct-12705	20	28	patterns	pattern	NOUN
ct-12705	20	29	(	(	PUNCT
ct-12705	20	30	damps	damps	PROPN
ct-12705	20	31	)	)	PUNCT
ct-12705	20	32	,	,	PUNCT
ct-12705	20	33	resulting	result	VERB
ct-12705	20	34	in	in	ADP
ct-12705	20	35	sterile	sterile	ADJ
ct-12705	20	36	inflammation.5	inflammation.5	PROPN
ct-12705	20	37	equid	equid	ADJ
ct-12705	20	38	peripheral	peripheral	ADJ
ct-12705	20	39	leucocytes	leucocyte	NOUN
ct-12705	20	40	express	express	VERB
ct-12705	20	41	the	the	DET
ct-12705	20	42	12	12	NUM
ct-12705	20	43	tlrs	tlrs	NOUN
ct-12705	20	44	,	,	PUNCT
ct-12705	20	45	whereas	whereas	SCONJ
ct-12705	20	46	equine	equine	NOUN
ct-12705	20	47	thymus	thymus	NOUN
ct-12705	20	48	,	,	PUNCT
ct-12705	20	49	lung	lung	NOUN
ct-12705	20	50	,	,	PUNCT
ct-12705	20	51	liver	liver	NOUN
ct-12705	20	52	,	,	PUNCT
ct-12705	20	53	jejunum	jejunum	ADJ
ct-12705	20	54	,	,	PUNCT
ct-12705	20	55	colon	colon	NOUN
ct-12705	20	56	,	,	PUNCT
ct-12705	20	57	kidney	kidney	NOUN
ct-12705	20	58	,	,	PUNCT
ct-12705	20	59	and	and	CCONJ
ct-12705	20	60	lymph	lymph	NOUN
ct-12705	20	61	nodes	node	NOUN
ct-12705	20	62	express	express	VERB
ct-12705	20	63	tlr1	tlr1	NOUN
ct-12705	20	64	to	to	ADP
ct-12705	20	65	tlr10.2,6	tlr10.2,6	PROPN
ct-12705	20	66	there	there	PRON
ct-12705	20	67	is	be	VERB
ct-12705	20	68	also	also	ADV
ct-12705	20	69	constitutive	constitutive	ADJ
ct-12705	20	70	expression	expression	NOUN
ct-12705	20	71	of	of	ADP
ct-12705	20	72	tlr4	tlr4	NOUN
ct-12705	20	73	in	in	ADP
ct-12705	20	74	the	the	DET
ct-12705	20	75	equine	equine	NOUN
ct-12705	20	76	gingiva	gingiva	NOUN
ct-12705	20	77	,	,	PUNCT
ct-12705	20	78	hoof	hoof	ADJ
ct-12705	20	79	lamella	lamella	NOUN
ct-12705	20	80	,	,	PUNCT
ct-12705	20	81	eye	eye	NOUN
ct-12705	20	82	,	,	PUNCT
ct-12705	20	83	mailto:msferrer@uga.edu	mailto:msferrer@uga.edu	PROPN
ct-12705	20	84	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	20	85	http://creativecommons.org/licenses/by-nc/4.0/	http://creativecommons.org/licenses/by-nc/4.0/	PROPN
ct-12705	20	86	http://creativecommons.org/licenses/by-nc/4.0/	http://creativecommons.org/licenses/by-nc/4.0/	PROPN
ct-12705	20	87	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	PROPN
ct-12705	20	88	2	2	NUM
ct-12705	20	89	citation	citation	NOUN
ct-12705	20	90	:	:	PUNCT
ct-12705	20	91	clinical	clinical	ADJ
ct-12705	20	92	theriogenology	theriogenology	NOUN
ct-12705	20	93	2025	2025	NUM
ct-12705	20	94	,	,	PUNCT
ct-12705	20	95	17	17	NUM
ct-12705	20	96	,	,	PUNCT
ct-12705	20	97	12705	12705	NUM
ct-12705	20	98	,	,	PUNCT
ct-12705	20	99	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	ADJ
ct-12705	20	100	skeletal	skeletal	ADJ
ct-12705	20	101	muscle	muscle	NOUN
ct-12705	20	102	,	,	PUNCT
ct-12705	20	103	cerebrum	cerebrum	NOUN
ct-12705	20	104	,	,	PUNCT
ct-12705	20	105	cerebellum	cerebellum	NOUN
ct-12705	20	106	and	and	CCONJ
ct-12705	20	107	adipose	adipose	ADJ
ct-12705	20	108	tissue	tissue	NOUN
ct-12705	20	109	,	,	PUNCT
ct-12705	20	110	with	with	ADP
ct-12705	20	111	increased	increase	VERB
ct-12705	20	112	expression	expression	NOUN
ct-12705	20	113	induced	induce	VERB
ct-12705	20	114	by	by	ADP
ct-12705	20	115	exercise	exercise	NOUN
ct-12705	20	116	,	,	PUNCT
ct-12705	20	117	cortisol	cortisol	NOUN
ct-12705	20	118	and	and	CCONJ
ct-12705	20	119	heat	heat	NOUN
ct-12705	20	120	in	in	ADP
ct-12705	20	121	skeletal	skeletal	ADJ
ct-12705	20	122	muscle	muscle	NOUN
ct-12705	20	123	and	and	CCONJ
ct-12705	20	124	peripheral	peripheral	ADJ
ct-12705	20	125	leucocytes	leucocyte	NOUN
ct-12705	20	126	,	,	PUNCT
ct-12705	20	127	and	and	CCONJ
ct-12705	20	128	by	by	ADP
ct-12705	20	129	insulin	insulin	NOUN
ct-12705	20	130	resistance	resistance	NOUN
ct-12705	20	131	in	in	ADP
ct-12705	20	132	adipose	adipose	NOUN
ct-12705	20	133	tissue.7–11	tissue.7–11	NOUN
ct-12705	20	134	in	in	ADP
ct-12705	20	135	the	the	DET
ct-12705	20	136	mare	mare	NOUN
ct-12705	20	137	reproductive	reproductive	ADJ
ct-12705	20	138	tract	tract	NOUN
ct-12705	20	139	,	,	PUNCT
ct-12705	20	140	the	the	DET
ct-12705	20	141	chorioallantois	chorioallantois	NOUN
ct-12705	20	142	,	,	PUNCT
ct-12705	20	143	endometrial	endometrial	ADJ
ct-12705	20	144	glandular	glandular	ADJ
ct-12705	20	145	and	and	CCONJ
ct-12705	20	146	luminal	luminal	ADJ
ct-12705	20	147	epithelium	epithelium	NOUN
ct-12705	20	148	,	,	PUNCT
ct-12705	20	149	stromal	stromal	ADJ
ct-12705	20	150	cells	cell	NOUN
ct-12705	20	151	,	,	PUNCT
ct-12705	20	152	leucocytes	leucocyte	NOUN
ct-12705	20	153	,	,	PUNCT
ct-12705	20	154	endothelium	endothelium	NOUN
ct-12705	20	155	,	,	PUNCT
ct-12705	20	156	and	and	CCONJ
ct-12705	20	157	vascular	vascular	ADJ
ct-12705	20	158	smooth	smooth	ADJ
ct-12705	20	159	muscle	muscle	NOUN
ct-12705	20	160	express	express	VERB
ct-12705	20	161	tlr2	tlr2	PROPN
ct-12705	20	162	,	,	PUNCT
ct-12705	20	163	tlr4	tlr4	PROPN
ct-12705	20	164	,	,	PUNCT
ct-12705	20	165	tlr6	tlr6	NOUN
ct-12705	20	166	,	,	PUNCT
ct-12705	20	167	and	and	CCONJ
ct-12705	20	168	tlr7	tlr7	NOUN
ct-12705	20	169	constitutively.12–16	constitutively.12–16	NOUN
ct-12705	20	170	inducible	inducible	ADJ
ct-12705	20	171	expression	expression	NOUN
ct-12705	20	172	increased	increase	VERB
ct-12705	20	173	in	in	ADP
ct-12705	20	174	mares	mare	NOUN
ct-12705	20	175	with	with	ADP
ct-12705	20	176	endometritis	endometritis	NOUN
ct-12705	20	177	and	and	CCONJ
ct-12705	20	178	placentitis.14–16	placentitis.14–16	NOUN
ct-12705	20	179	expression	expression	NOUN
ct-12705	20	180	of	of	ADP
ct-12705	20	181	tlrs	tlrs	NOUN
ct-12705	20	182	in	in	ADP
ct-12705	20	183	the	the	DET
ct-12705	20	184	stallion	stallion	NOUN
ct-12705	20	185	reproductive	reproductive	ADJ
ct-12705	20	186	tract	tract	NOUN
ct-12705	20	187	has	have	AUX
ct-12705	20	188	not	not	PART
ct-12705	20	189	been	be	AUX
ct-12705	20	190	reported	report	VERB
ct-12705	20	191	.	.	PUNCT
ct-12705	21	1	most	most	ADJ
ct-12705	21	2	tlrs	tlrs	NOUN
ct-12705	21	3	and	and	CCONJ
ct-12705	21	4	signaling	signal	VERB
ct-12705	21	5	components	component	NOUN
ct-12705	21	6	are	be	AUX
ct-12705	21	7	expressed	express	VERB
ct-12705	21	8	in	in	ADP
ct-12705	21	9	immune	immune	ADJ
ct-12705	21	10	cells	cell	NOUN
ct-12705	21	11	and	and	CCONJ
ct-12705	21	12	somatic	somatic	ADJ
ct-12705	21	13	and	and	CCONJ
ct-12705	21	14	germ	germ	NOUN
ct-12705	21	15	cells	cell	NOUN
ct-12705	21	16	of	of	ADP
ct-12705	21	17	the	the	DET
ct-12705	21	18	testis	testis	NOUN
ct-12705	21	19	,	,	PUNCT
ct-12705	21	20	epididymis	epididymis	PROPN
ct-12705	21	21	,	,	PUNCT
ct-12705	21	22	vas	vas	X
ct-12705	21	23	deferens	deferens	PROPN
ct-12705	21	24	,	,	PUNCT
ct-12705	21	25	and	and	CCONJ
ct-12705	21	26	accessory	accessory	ADJ
ct-12705	21	27	sex	sex	NOUN
ct-12705	21	28	glands	gland	NOUN
ct-12705	21	29	of	of	ADP
ct-12705	21	30	rodents.17	rodents.17	NOUN
ct-12705	21	31	rodent	rodent	NOUN
ct-12705	21	32	sertoli	sertoli	NOUN
ct-12705	21	33	cells	cell	NOUN
ct-12705	21	34	,	,	PUNCT
ct-12705	21	35	leydig	leydig	NOUN
ct-12705	21	36	cells	cell	NOUN
ct-12705	21	37	,	,	PUNCT
ct-12705	21	38	and	and	CCONJ
ct-12705	21	39	testicular	testicular	ADJ
ct-12705	21	40	macrophages	macrophage	NOUN
ct-12705	21	41	have	have	VERB
ct-12705	21	42	the	the	DET
ct-12705	21	43	widest	wide	ADJ
ct-12705	21	44	tlr	tlr	PROPN
ct-12705	21	45	expression	expression	NOUN
ct-12705	21	46	patterns	pattern	NOUN
ct-12705	21	47	and	and	CCONJ
ct-12705	21	48	express	express	VERB
ct-12705	21	49	proinflammatory	proinflammatory	ADJ
ct-12705	21	50	cytokines	cytokine	NOUN
ct-12705	21	51	upon	upon	SCONJ
ct-12705	21	52	activation.18	activation.18	ADJ
ct-12705	21	53	microbial	microbial	ADJ
ct-12705	21	54	pamps	pamp	NOUN
ct-12705	21	55	and	and	CCONJ
ct-12705	21	56	endogenous	endogenous	ADJ
ct-12705	21	57	damps	damp	NOUN
ct-12705	21	58	released	release	VERB
ct-12705	21	59	by	by	ADP
ct-12705	21	60	germ	germ	NOUN
ct-12705	21	61	cells	cell	NOUN
ct-12705	21	62	induce	induce	VERB
ct-12705	21	63	inflammatory	inflammatory	ADJ
ct-12705	21	64	cytokine	cytokine	NOUN
ct-12705	21	65	production	production	NOUN
ct-12705	21	66	by	by	ADP
ct-12705	21	67	sertoli	sertoli	NOUN
ct-12705	21	68	cells	cell	NOUN
ct-12705	21	69	through	through	ADP
ct-12705	21	70	tlr	tlr	PROPN
ct-12705	21	71	activation.17,19,20	activation.17,19,20	NOUN
ct-12705	21	72	activation	activation	NOUN
ct-12705	21	73	of	of	ADP
ct-12705	21	74	inflammatory	inflammatory	ADJ
ct-12705	21	75	pathways	pathway	NOUN
ct-12705	21	76	in	in	ADP
ct-12705	21	77	sertoli	sertoli	NOUN
ct-12705	21	78	cells	cell	NOUN
ct-12705	21	79	inhibits	inhibit	VERB
ct-12705	21	80	their	their	PRON
ct-12705	21	81	response	response	NOUN
ct-12705	21	82	to	to	PART
ct-12705	21	83	follicle	follicle	VERB
ct-12705	21	84	stimulating	stimulate	VERB
ct-12705	21	85	hormone	hormone	NOUN
ct-12705	21	86	and	and	CCONJ
ct-12705	21	87	androgens	androgen	NOUN
ct-12705	21	88	and	and	CCONJ
ct-12705	21	89	disassembles	disassemble	VERB
ct-12705	21	90	junctional	junctional	ADJ
ct-12705	21	91	complexes	complex	NOUN
ct-12705	21	92	of	of	ADP
ct-12705	21	93	the	the	DET
ct-12705	21	94	blood	blood	NOUN
ct-12705	21	95	-	-	PUNCT
ct-12705	21	96	testis	testis	NOUN
ct-12705	21	97	barrier.17	barrier.17	NOUN
ct-12705	21	98	the	the	DET
ct-12705	21	99	activation	activation	NOUN
ct-12705	21	100	of	of	ADP
ct-12705	21	101	tlrs	tlrs	NOUN
ct-12705	21	102	in	in	ADP
ct-12705	21	103	leydig	leydig	NOUN
ct-12705	21	104	cells	cell	NOUN
ct-12705	21	105	suppresses	suppress	VERB
ct-12705	21	106	steroidogenesis	steroidogenesis	NOUN
ct-12705	21	107	,	,	PUNCT
ct-12705	21	108	altering	alter	VERB
ct-12705	21	109	testicular	testicular	ADJ
ct-12705	21	110	function	function	NOUN
ct-12705	21	111	through	through	ADP
ct-12705	21	112	decreased	decrease	VERB
ct-12705	21	113	intratesticular	intratesticular	ADJ
ct-12705	21	114	testosterone	testosterone	NOUN
ct-12705	21	115	concentrations	concentration	NOUN
ct-12705	21	116	,	,	PUNCT
ct-12705	21	117	whereas	whereas	SCONJ
ct-12705	21	118	the	the	DET
ct-12705	21	119	activation	activation	NOUN
ct-12705	21	120	of	of	ADP
ct-12705	21	121	tlr2	tlr2	PROPN
ct-12705	21	122	and	and	CCONJ
ct-12705	21	123	tlr4	tlr4	NOUN
ct-12705	21	124	in	in	ADP
ct-12705	21	125	germ	germ	NOUN
ct-12705	21	126	cells	cell	NOUN
ct-12705	21	127	directly	directly	ADV
ct-12705	21	128	induces	induce	VERB
ct-12705	21	129	germ	germ	NOUN
ct-12705	21	130	cell	cell	NOUN
ct-12705	21	131	apoptosis.17,21	apoptosis.17,21	NOUN
ct-12705	21	132	activation	activation	NOUN
ct-12705	21	133	of	of	ADP
ct-12705	21	134	tlrs	tlrs	NOUN
ct-12705	21	135	is	be	AUX
ct-12705	21	136	also	also	ADV
ct-12705	21	137	critical	critical	ADJ
ct-12705	21	138	for	for	ADP
ct-12705	21	139	the	the	DET
ct-12705	21	140	development	development	NOUN
ct-12705	21	141	of	of	ADP
ct-12705	21	142	autoimmune	autoimmune	ADJ
ct-12705	21	143	orchitis	orchitis	NOUN
ct-12705	21	144	in	in	ADP
ct-12705	21	145	mice.20,22	mice.20,22	NOUN
ct-12705	21	146	although	although	SCONJ
ct-12705	21	147	the	the	DET
ct-12705	21	148	expression	expression	NOUN
ct-12705	21	149	and	and	CCONJ
ct-12705	21	150	activation	activation	NOUN
ct-12705	21	151	pattern	pattern	NOUN
ct-12705	21	152	of	of	ADP
ct-12705	21	153	tlrs	tlrs	NOUN
ct-12705	21	154	in	in	ADP
ct-12705	21	155	the	the	DET
ct-12705	21	156	rodent	rodent	ADJ
ct-12705	21	157	reproductive	reproductive	ADJ
ct-12705	21	158	tract	tract	NOUN
ct-12705	21	159	has	have	AUX
ct-12705	21	160	been	be	AUX
ct-12705	21	161	characterized	characterize	VERB
ct-12705	21	162	,	,	PUNCT
ct-12705	21	163	their	their	PRON
ct-12705	21	164	expression	expression	NOUN
ct-12705	21	165	in	in	ADP
ct-12705	21	166	the	the	DET
ct-12705	21	167	genital	genital	ADJ
ct-12705	21	168	tract	tract	NOUN
ct-12705	21	169	of	of	ADP
ct-12705	21	170	stallions	stallion	NOUN
ct-12705	21	171	has	have	AUX
ct-12705	21	172	not	not	PART
ct-12705	21	173	been	be	AUX
ct-12705	21	174	described	describe	VERB
ct-12705	21	175	.	.	PUNCT
ct-12705	22	1	understanding	understand	VERB
ct-12705	22	2	the	the	DET
ct-12705	22	3	expression	expression	NOUN
ct-12705	22	4	patterns	pattern	NOUN
ct-12705	22	5	,	,	PUNCT
ct-12705	22	6	ligands	ligand	NOUN
ct-12705	22	7	,	,	PUNCT
ct-12705	22	8	and	and	CCONJ
ct-12705	22	9	responses	response	NOUN
ct-12705	22	10	to	to	ADP
ct-12705	22	11	activation	activation	NOUN
ct-12705	22	12	is	be	AUX
ct-12705	22	13	key	key	ADJ
ct-12705	22	14	to	to	ADP
ct-12705	22	15	interpreting	interpret	VERB
ct-12705	22	16	the	the	DET
ct-12705	22	17	interactions	interaction	NOUN
ct-12705	22	18	between	between	ADP
ct-12705	22	19	the	the	DET
ct-12705	22	20	immune	immune	ADJ
ct-12705	22	21	system	system	NOUN
ct-12705	22	22	and	and	CCONJ
ct-12705	22	23	the	the	DET
ct-12705	22	24	reproductive	reproductive	ADJ
ct-12705	22	25	system	system	NOUN
ct-12705	22	26	in	in	ADP
ct-12705	22	27	healthy	healthy	ADJ
ct-12705	22	28	and	and	CCONJ
ct-12705	22	29	ill	ill	ADJ
ct-12705	22	30	animals	animal	NOUN
ct-12705	22	31	.	.	PUNCT
ct-12705	23	1	objective	objective	NOUN
ct-12705	23	2	of	of	ADP
ct-12705	23	3	this	this	DET
ct-12705	23	4	study	study	NOUN
ct-12705	23	5	was	be	AUX
ct-12705	23	6	to	to	PART
ct-12705	23	7	describe	describe	VERB
ct-12705	23	8	the	the	DET
ct-12705	23	9	constitutive	constitutive	ADJ
ct-12705	23	10	expression	expression	NOUN
ct-12705	23	11	of	of	ADP
ct-12705	23	12	tlrs	tlrs	NOUN
ct-12705	23	13	and	and	CCONJ
ct-12705	23	14	their	their	PRON
ct-12705	23	15	signaling	signal	VERB
ct-12705	23	16	pathways	pathway	NOUN
ct-12705	23	17	in	in	ADP
ct-12705	23	18	stallion	stallion	NOUN
ct-12705	23	19	’s	’s	PART
ct-12705	23	20	testis	testis	NOUN
ct-12705	23	21	and	and	CCONJ
ct-12705	23	22	epididymis	epididymis	NOUN
ct-12705	23	23	.	.	PUNCT
ct-12705	24	1	it	it	PRON
ct-12705	24	2	was	be	AUX
ct-12705	24	3	hypothesized	hypothesize	VERB
ct-12705	24	4	that	that	SCONJ
ct-12705	24	5	the	the	DET
ct-12705	24	6	testis	testis	NOUN
ct-12705	24	7	and	and	CCONJ
ct-12705	24	8	epididymis	epididymis	NOUN
ct-12705	24	9	of	of	ADP
ct-12705	24	10	reproductively	reproductively	ADV
ct-12705	24	11	normal	normal	ADJ
ct-12705	24	12	stallions	stallion	NOUN
ct-12705	24	13	constitutively	constitutively	ADV
ct-12705	24	14	express	express	VERB
ct-12705	24	15	all	all	DET
ct-12705	24	16	tlrs	tlrs	ADJ
ct-12705	24	17	and	and	CCONJ
ct-12705	24	18	downstream	downstream	ADJ
ct-12705	24	19	signaling	signal	VERB
ct-12705	24	20	molecules	molecule	NOUN
ct-12705	24	21	.	.	PUNCT
ct-12705	25	1	materials	material	NOUN
ct-12705	25	2	and	and	CCONJ
ct-12705	25	3	methods	method	NOUN
ct-12705	25	4	animals	animal	NOUN
ct-12705	25	5	and	and	CCONJ
ct-12705	25	6	tissue	tissue	NOUN
ct-12705	25	7	processing	processing	NOUN
ct-12705	25	8	testicular	testicular	NOUN
ct-12705	25	9	and	and	CCONJ
ct-12705	25	10	epididymal	epididymal	ADJ
ct-12705	25	11	samples	sample	NOUN
ct-12705	25	12	were	be	AUX
ct-12705	25	13	collected	collect	VERB
ct-12705	25	14	from	from	ADP
ct-12705	25	15	8	8	NUM
ct-12705	25	16	client	client	NOUN
ct-12705	25	17	-	-	PUNCT
ct-12705	25	18	owned	own	VERB
ct-12705	25	19	stallions	stallion	NOUN
ct-12705	25	20	presenting	present	VERB
ct-12705	25	21	to	to	ADP
ct-12705	25	22	the	the	DET
ct-12705	25	23	veterinary	veterinary	ADJ
ct-12705	25	24	medical	medical	ADJ
ct-12705	25	25	center	center	NOUN
ct-12705	25	26	of	of	ADP
ct-12705	25	27	the	the	DET
ct-12705	25	28	university	university	PROPN
ct-12705	25	29	of	of	ADP
ct-12705	25	30	georgia	georgia	PROPN
ct-12705	25	31	for	for	ADP
ct-12705	25	32	routine	routine	ADJ
ct-12705	25	33	castration	castration	NOUN
ct-12705	25	34	as	as	ADP
ct-12705	25	35	part	part	NOUN
ct-12705	25	36	of	of	ADP
ct-12705	25	37	the	the	DET
ct-12705	25	38	clinical	clinical	ADJ
ct-12705	25	39	services	service	NOUN
ct-12705	25	40	provided	provide	VERB
ct-12705	25	41	by	by	ADP
ct-12705	25	42	the	the	DET
ct-12705	25	43	hospital	hospital	NOUN
ct-12705	25	44	.	.	PUNCT
ct-12705	26	1	our	our	PRON
ct-12705	26	2	institutional	institutional	ADJ
ct-12705	26	3	animal	animal	NOUN
ct-12705	26	4	care	care	NOUN
ct-12705	26	5	and	and	CCONJ
ct-12705	26	6	use	use	NOUN
ct-12705	26	7	committee	committee	NOUN
ct-12705	26	8	does	do	AUX
ct-12705	26	9	not	not	PART
ct-12705	26	10	require	require	VERB
ct-12705	26	11	an	an	DET
ct-12705	26	12	approved	approve	VERB
ct-12705	26	13	animal	animal	NOUN
ct-12705	26	14	use	use	NOUN
ct-12705	26	15	protocol	protocol	NOUN
ct-12705	26	16	for	for	ADP
ct-12705	26	17	the	the	DET
ct-12705	26	18	use	use	NOUN
ct-12705	26	19	of	of	ADP
ct-12705	26	20	discarded	discard	VERB
ct-12705	26	21	clinical	clinical	ADJ
ct-12705	26	22	samples	sample	NOUN
ct-12705	26	23	.	.	PUNCT
ct-12705	27	1	stallions	stallion	NOUN
ct-12705	27	2	were	be	AUX
ct-12705	27	3	2	2	NUM
ct-12705	27	4	-	-	SYM
ct-12705	27	5	13	13	NUM
ct-12705	27	6	years	year	NOUN
ct-12705	27	7	american	american	ADJ
ct-12705	27	8	quarter	quarter	NOUN
ct-12705	27	9	horse	horse	NOUN
ct-12705	27	10	(	(	PUNCT
ct-12705	27	11	n	n	NOUN
ct-12705	27	12	=	=	SYM
ct-12705	27	13	5	5	NUM
ct-12705	27	14	)	)	PUNCT
ct-12705	27	15	,	,	PUNCT
ct-12705	27	16	arabian	arabian	PROPN
ct-12705	27	17	(	(	PUNCT
ct-12705	27	18	n	n	NOUN
ct-12705	27	19	=	=	SYM
ct-12705	27	20	2	2	NUM
ct-12705	27	21	)	)	PUNCT
ct-12705	27	22	and	and	CCONJ
ct-12705	27	23	american	american	ADJ
ct-12705	27	24	paint	paint	NOUN
ct-12705	27	25	horse	horse	NOUN
ct-12705	27	26	breed	breed	NOUN
ct-12705	27	27	(	(	PUNCT
ct-12705	27	28	n	n	NOUN
ct-12705	27	29	=	=	SYM
ct-12705	27	30	1	1	NUM
ct-12705	27	31	)	)	PUNCT
ct-12705	27	32	;	;	PUNCT
ct-12705	27	33	4	4	NUM
ct-12705	27	34	stallions	stallion	NOUN
ct-12705	27	35	were	be	AUX
ct-12705	27	36	castrated	castrate	VERB
ct-12705	27	37	in	in	ADP
ct-12705	27	38	april	april	PROPN
ct-12705	27	39	and	and	CCONJ
ct-12705	27	40	4	4	NUM
ct-12705	27	41	in	in	ADP
ct-12705	27	42	february	february	PROPN
ct-12705	27	43	.	.	PUNCT
ct-12705	28	1	testes	testis	NOUN
ct-12705	28	2	and	and	CCONJ
ct-12705	28	3	epididymides	epididymis	NOUN
ct-12705	28	4	were	be	AUX
ct-12705	28	5	placed	place	VERB
ct-12705	28	6	on	on	ADP
ct-12705	28	7	ice	ice	NOUN
ct-12705	28	8	immediately	immediately	ADV
ct-12705	28	9	after	after	ADP
ct-12705	28	10	castration	castration	NOUN
ct-12705	28	11	and	and	CCONJ
ct-12705	28	12	processed	process	VERB
ct-12705	28	13	within	within	ADP
ct-12705	28	14	10	10	NUM
ct-12705	28	15	minutes	minute	NOUN
ct-12705	28	16	.	.	PUNCT
ct-12705	29	1	sperm	sperm	NOUN
ct-12705	29	2	were	be	AUX
ct-12705	29	3	collected	collect	VERB
ct-12705	29	4	from	from	ADP
ct-12705	29	5	the	the	DET
ct-12705	29	6	vas	vas	X
ct-12705	29	7	deferens	deferens	PROPN
ct-12705	29	8	.	.	PUNCT
ct-12705	30	1	sperm	sperm	NOUN
ct-12705	30	2	morphology	morphology	NOUN
ct-12705	30	3	was	be	AUX
ct-12705	30	4	evaluated	evaluate	VERB
ct-12705	30	5	using	use	VERB
ct-12705	30	6	a	a	DET
ct-12705	30	7	hancock	hancock	NOUN
ct-12705	30	8	stain	stain	NOUN
ct-12705	30	9	and	and	CCONJ
ct-12705	30	10	light	light	ADJ
ct-12705	30	11	microscopy;23	microscopy;23	NOUN
ct-12705	30	12	stallions	stallion	NOUN
ct-12705	30	13	’	’	PART
ct-12705	30	14	fertility	fertility	NOUN
ct-12705	30	15	was	be	AUX
ct-12705	30	16	not	not	PART
ct-12705	30	17	known	know	VERB
ct-12705	30	18	.	.	PUNCT
ct-12705	31	1	given	give	VERB
ct-12705	31	2	that	that	DET
ct-12705	31	3	sperm	sperm	NOUN
ct-12705	31	4	morphology	morphology	NOUN
ct-12705	31	5	is	be	AUX
ct-12705	31	6	associated	associate	VERB
ct-12705	31	7	with	with	ADP
ct-12705	31	8	pregnancy	pregnancy	NOUN
ct-12705	31	9	rate	rate	NOUN
ct-12705	31	10	,	,	PUNCT
ct-12705	31	11	this	this	DET
ct-12705	31	12	parameter	parameter	NOUN
ct-12705	31	13	was	be	AUX
ct-12705	31	14	chosen	choose	VERB
ct-12705	31	15	as	as	ADP
ct-12705	31	16	an	an	DET
ct-12705	31	17	inclusion	inclusion	NOUN
ct-12705	31	18	criterion.23–25	criterion.23–25	PUNCT
ct-12705	31	19	various	various	ADJ
ct-12705	31	20	threshold	threshold	NOUN
ct-12705	31	21	values	value	NOUN
ct-12705	31	22	have	have	AUX
ct-12705	31	23	been	be	AUX
ct-12705	31	24	suggested	suggest	VERB
ct-12705	31	25	for	for	ADP
ct-12705	31	26	fertile	fertile	ADJ
ct-12705	31	27	or	or	CCONJ
ct-12705	31	28	highly	highly	ADV
ct-12705	31	29	fertile	fertile	ADJ
ct-12705	31	30	stallions	stallion	NOUN
ct-12705	31	31	,	,	PUNCT
ct-12705	31	32	ranging	range	VERB
ct-12705	31	33	from	from	ADP
ct-12705	31	34	30	30	NUM
ct-12705	31	35	-	-	SYM
ct-12705	31	36	60%.26–30	60%.26–30	NUM
ct-12705	31	37	the	the	DET
ct-12705	31	38	highest	high	ADJ
ct-12705	31	39	value	value	NOUN
ct-12705	31	40	was	be	AUX
ct-12705	31	41	used	use	VERB
ct-12705	31	42	here	here	ADV
ct-12705	31	43	to	to	PART
ct-12705	31	44	include	include	VERB
ct-12705	31	45	stallions	stallion	NOUN
ct-12705	31	46	assumed	assume	VERB
ct-12705	31	47	to	to	PART
ct-12705	31	48	have	have	VERB
ct-12705	31	49	normal	normal	ADJ
ct-12705	31	50	testicular	testicular	NOUN
ct-12705	31	51	and	and	CCONJ
ct-12705	31	52	epididymal	epididymal	ADJ
ct-12705	31	53	function	function	NOUN
ct-12705	31	54	;	;	PUNCT
ct-12705	31	55	thus	thus	ADV
ct-12705	31	56	,	,	PUNCT
ct-12705	31	57	tissues	tissue	NOUN
ct-12705	31	58	from	from	ADP
ct-12705	31	59	stallions	stallion	NOUN
ct-12705	31	60	with	with	ADP
ct-12705	31	61	≥	≥	NUM
ct-12705	31	62	60	60	NUM
ct-12705	31	63	%	%	NOUN
ct-12705	31	64	morphologically	morphologically	ADV
ct-12705	31	65	normal	normal	ADJ
ct-12705	31	66	sperm	sperm	NOUN
ct-12705	31	67	were	be	AUX
ct-12705	31	68	included	include	VERB
ct-12705	31	69	.	.	PUNCT
ct-12705	32	1	vaginal	vaginal	ADJ
ct-12705	32	2	tunics	tunic	NOUN
ct-12705	32	3	and	and	CCONJ
ct-12705	32	4	connective	connective	ADJ
ct-12705	32	5	tissue	tissue	NOUN
ct-12705	32	6	were	be	AUX
ct-12705	32	7	removed	remove	VERB
ct-12705	32	8	,	,	PUNCT
ct-12705	32	9	and	and	CCONJ
ct-12705	32	10	the	the	DET
ct-12705	32	11	organs	organ	NOUN
ct-12705	32	12	were	be	AUX
ct-12705	32	13	rinsed	rinse	VERB
ct-12705	32	14	with	with	ADP
ct-12705	32	15	sterile	sterile	ADJ
ct-12705	32	16	saline	saline	NOUN
ct-12705	32	17	solution	solution	NOUN
ct-12705	32	18	.	.	PUNCT
ct-12705	33	1	a	a	DET
ct-12705	33	2	1	1	NUM
ct-12705	33	3	x	x	SYM
ct-12705	33	4	1	1	NUM
ct-12705	33	5	cm	cm	NOUN
ct-12705	33	6	tissue	tissue	NOUN
ct-12705	33	7	sample	sample	NOUN
ct-12705	33	8	was	be	AUX
ct-12705	33	9	collected	collect	VERB
ct-12705	33	10	with	with	ADP
ct-12705	33	11	sterile	sterile	ADJ
ct-12705	33	12	instruments	instrument	NOUN
ct-12705	33	13	from	from	ADP
ct-12705	33	14	the	the	DET
ct-12705	33	15	testicular	testicular	ADJ
ct-12705	33	16	parenchyma	parenchyma	NOUN
ct-12705	33	17	and	and	CCONJ
ct-12705	33	18	the	the	DET
ct-12705	33	19	epididymal	epididymal	ADJ
ct-12705	33	20	head	head	NOUN
ct-12705	33	21	,	,	PUNCT
ct-12705	33	22	body	body	NOUN
ct-12705	33	23	,	,	PUNCT
ct-12705	33	24	and	and	CCONJ
ct-12705	33	25	tail	tail	NOUN
ct-12705	33	26	;	;	PUNCT
ct-12705	33	27	1	1	NUM
ct-12705	33	28	testis	testis	NOUN
ct-12705	33	29	and	and	CCONJ
ct-12705	33	30	epididymis	epididymis	NOUN
ct-12705	33	31	were	be	AUX
ct-12705	33	32	included	include	VERB
ct-12705	33	33	per	per	ADP
ct-12705	33	34	stallion	stallion	NOUN
ct-12705	33	35	.	.	PUNCT
ct-12705	34	1	the	the	DET
ct-12705	34	2	side	side	NOUN
ct-12705	34	3	(	(	PUNCT
ct-12705	34	4	left	leave	VERB
ct-12705	34	5	versus	versus	ADP
ct-12705	34	6	right	right	ADJ
ct-12705	34	7	)	)	PUNCT
ct-12705	34	8	was	be	AUX
ct-12705	34	9	randomly	randomly	ADV
ct-12705	34	10	selected	select	VERB
ct-12705	34	11	.	.	PUNCT
ct-12705	35	1	each	each	DET
ct-12705	35	2	tissue	tissue	NOUN
ct-12705	35	3	was	be	AUX
ct-12705	35	4	placed	place	VERB
ct-12705	35	5	in	in	ADP
ct-12705	35	6	individual	individual	ADJ
ct-12705	35	7	tubes	tube	NOUN
ct-12705	35	8	,	,	PUNCT
ct-12705	35	9	snap	snap	NOUN
ct-12705	35	10	-	-	PUNCT
ct-12705	35	11	frozen	frozen	ADJ
ct-12705	35	12	in	in	ADP
ct-12705	35	13	liquid	liquid	ADJ
ct-12705	35	14	nitrogen	nitrogen	NOUN
ct-12705	35	15	,	,	PUNCT
ct-12705	35	16	and	and	CCONJ
ct-12705	35	17	stored	store	VERB
ct-12705	35	18	in	in	ADP
ct-12705	35	19	liquid	liquid	ADJ
ct-12705	35	20	nitrogen	nitrogen	NOUN
ct-12705	35	21	until	until	ADP
ct-12705	35	22	processing	processing	NOUN
ct-12705	35	23	.	.	PUNCT
ct-12705	36	1	total	total	ADJ
ct-12705	36	2	rna	rna	PROPN
ct-12705	36	3	was	be	AUX
ct-12705	36	4	extracted	extract	VERB
ct-12705	36	5	using	use	VERB
ct-12705	36	6	a	a	DET
ct-12705	36	7	commercial	commercial	ADJ
ct-12705	36	8	kit	kit	NOUN
ct-12705	36	9	(	(	PUNCT
ct-12705	36	10	rneasy	rneasy	PROPN
ct-12705	36	11	mini	mini	PROPN
ct-12705	36	12	kit	kit	PROPN
ct-12705	36	13	,	,	PUNCT
ct-12705	36	14	qiagen	qiagen	NOUN
ct-12705	36	15	,	,	PUNCT
ct-12705	36	16	redwood	redwood	NOUN
ct-12705	36	17	city	city	NOUN
ct-12705	36	18	,	,	PUNCT
ct-12705	36	19	ca	ca	PROPN
ct-12705	36	20	,	,	PUNCT
ct-12705	36	21	usa	usa	PROPN
ct-12705	36	22	)	)	PUNCT
ct-12705	36	23	following	follow	VERB
ct-12705	36	24	the	the	DET
ct-12705	36	25	manufacturer	manufacturer	NOUN
ct-12705	36	26	’s	’s	PART
ct-12705	36	27	protocol	protocol	NOUN
ct-12705	36	28	.	.	PUNCT
ct-12705	37	1	approximately	approximately	ADV
ct-12705	37	2	1	1	NUM
ct-12705	37	3	cm3	cm3	NOUN
ct-12705	37	4	of	of	ADP
ct-12705	37	5	tissue	tissue	NOUN
ct-12705	37	6	from	from	ADP
ct-12705	37	7	each	each	DET
ct-12705	37	8	sample	sample	NOUN
ct-12705	37	9	was	be	AUX
ct-12705	37	10	cryopulverized	cryopulverize	VERB
ct-12705	37	11	and	and	CCONJ
ct-12705	37	12	homogenized	homogenize	VERB
ct-12705	37	13	with	with	ADP
ct-12705	37	14	an	an	DET
ct-12705	37	15	omni	omni	ADJ
ct-12705	37	16	th	th	X
ct-12705	37	17	homogenizer	homogenizer	NOUN
ct-12705	37	18	(	(	PUNCT
ct-12705	37	19	vwr	vwr	PROPN
ct-12705	37	20	)	)	PUNCT
ct-12705	37	21	in	in	ADP
ct-12705	37	22	rlt	rlt	NOUN
ct-12705	37	23	lysis	lysis	NOUN
ct-12705	37	24	buffer	buffer	NOUN
ct-12705	37	25	containing	contain	VERB
ct-12705	37	26	1	1	NUM
ct-12705	37	27	%	%	NOUN
ct-12705	37	28	2	2	NUM
ct-12705	37	29	mercaptoethanol	mercaptoethanol	NOUN
ct-12705	37	30	.	.	PUNCT
ct-12705	38	1	the	the	DET
ct-12705	38	2	tissue	tissue	NOUN
ct-12705	38	3	suspension	suspension	NOUN
ct-12705	38	4	was	be	AUX
ct-12705	38	5	centrifuged	centrifuge	VERB
ct-12705	38	6	at	at	ADP
ct-12705	38	7	11,000	11,000	NUM
ct-12705	38	8	×	×	NOUN
ct-12705	38	9	g	g	NOUN
ct-12705	38	10	for	for	ADP
ct-12705	38	11	1	1	NUM
ct-12705	38	12	minute	minute	NOUN
ct-12705	38	13	.	.	PUNCT
ct-12705	39	1	supernatant	supernatant	NOUN
ct-12705	39	2	containing	contain	VERB
ct-12705	39	3	the	the	DET
ct-12705	39	4	total	total	ADJ
ct-12705	39	5	rna	rna	NOUN
ct-12705	39	6	was	be	AUX
ct-12705	39	7	loaded	load	VERB
ct-12705	39	8	on	on	ADP
ct-12705	39	9	a	a	DET
ct-12705	39	10	rneasy	rneasy	NOUN
ct-12705	39	11	spin	spin	NOUN
ct-12705	39	12	column	column	NOUN
ct-12705	39	13	to	to	PART
ct-12705	39	14	remove	remove	VERB
ct-12705	39	15	any	any	DET
ct-12705	39	16	dna	dna	PROPN
ct-12705	39	17	contamination	contamination	NOUN
ct-12705	39	18	and	and	CCONJ
ct-12705	39	19	to	to	PART
ct-12705	39	20	elute	elute	VERB
ct-12705	39	21	the	the	DET
ct-12705	39	22	total	total	ADJ
ct-12705	39	23	rna	rna	NOUN
ct-12705	39	24	.	.	PUNCT
ct-12705	40	1	total	total	ADJ
ct-12705	40	2	rna	rna	PROPN
ct-12705	40	3	was	be	AUX
ct-12705	40	4	frozen	freeze	VERB
ct-12705	40	5	at	at	ADP
ct-12705	40	6	–	–	PUNCT
ct-12705	40	7	80	80	NUM
ct-12705	40	8	°	°	NUM
ct-12705	40	9	c	c	NOUN
ct-12705	40	10	and	and	CCONJ
ct-12705	40	11	shipped	ship	VERB
ct-12705	40	12	on	on	ADP
ct-12705	40	13	dry	dry	ADJ
ct-12705	40	14	ice	ice	NOUN
ct-12705	40	15	to	to	ADP
ct-12705	40	16	a	a	DET
ct-12705	40	17	commercial	commercial	ADJ
ct-12705	40	18	laboratory	laboratory	NOUN
ct-12705	40	19	(	(	PUNCT
ct-12705	40	20	novogene	novogene	PROPN
ct-12705	40	21	,	,	PUNCT
ct-12705	40	22	sacramento	sacramento	PROPN
ct-12705	40	23	,	,	PUNCT
ct-12705	40	24	ca	ca	PROPN
ct-12705	40	25	,	,	PUNCT
ct-12705	40	26	usa	usa	PROPN
ct-12705	40	27	)	)	PUNCT
ct-12705	40	28	for	for	ADP
ct-12705	40	29	quality	quality	NOUN
ct-12705	40	30	control	control	NOUN
ct-12705	40	31	and	and	CCONJ
ct-12705	40	32	rna	rna	NOUN
ct-12705	40	33	sequencing	sequencing	NOUN
ct-12705	40	34	.	.	PUNCT
ct-12705	41	1	library	library	ADJ
ct-12705	41	2	preparation	preparation	NOUN
ct-12705	41	3	for	for	ADP
ct-12705	41	4	transcriptome	transcriptome	ADJ
ct-12705	41	5	sequencing	sequence	VERB
ct-12705	41	6	degradation	degradation	NOUN
ct-12705	41	7	and	and	CCONJ
ct-12705	41	8	contamination	contamination	NOUN
ct-12705	41	9	of	of	ADP
ct-12705	41	10	the	the	DET
ct-12705	41	11	rna	rna	NOUN
ct-12705	41	12	were	be	AUX
ct-12705	41	13	monitored	monitor	VERB
ct-12705	41	14	on	on	ADP
ct-12705	41	15	1	1	NUM
ct-12705	41	16	%	%	NOUN
ct-12705	41	17	agarose	agarose	NOUN
ct-12705	41	18	gels	gel	NOUN
ct-12705	41	19	.	.	PUNCT
ct-12705	42	1	purity	purity	NOUN
ct-12705	42	2	of	of	ADP
ct-12705	42	3	the	the	DET
ct-12705	42	4	rna	rna	NOUN
ct-12705	42	5	was	be	AUX
ct-12705	42	6	evaluated	evaluate	VERB
ct-12705	42	7	using	use	VERB
ct-12705	42	8	the	the	DET
ct-12705	42	9	nanophotometer	nanophotometer	NOUN
ct-12705	42	10	®	®	NOUN
ct-12705	42	11	spectrophotometer	spectrophotometer	NOUN
ct-12705	42	12	(	(	PUNCT
ct-12705	42	13	implen	implen	PROPN
ct-12705	42	14	,	,	PUNCT
ct-12705	42	15	westlake	westlake	PROPN
ct-12705	42	16	village	village	NOUN
ct-12705	42	17	,	,	PUNCT
ct-12705	42	18	ca	ca	PROPN
ct-12705	42	19	,	,	PUNCT
ct-12705	42	20	usa	usa	PROPN
ct-12705	42	21	)	)	PUNCT
ct-12705	42	22	.	.	PUNCT
ct-12705	43	1	the	the	DET
ct-12705	43	2	rna	rna	NOUN
ct-12705	43	3	integrity	integrity	NOUN
ct-12705	43	4	and	and	CCONJ
ct-12705	43	5	quantification	quantification	NOUN
ct-12705	43	6	was	be	AUX
ct-12705	43	7	assessed	assess	VERB
ct-12705	43	8	using	use	VERB
ct-12705	43	9	the	the	DET
ct-12705	43	10	rna	rna	NOUN
ct-12705	43	11	nano	nano	NOUN
ct-12705	43	12	6000	6000	NUM
ct-12705	43	13	assay	assay	NOUN
ct-12705	43	14	kit	kit	NOUN
ct-12705	43	15	of	of	ADP
ct-12705	43	16	the	the	DET
ct-12705	43	17	bioanalyzer	bioanalyzer	ADJ
ct-12705	43	18	2100	2100	NUM
ct-12705	43	19	system	system	NOUN
ct-12705	43	20	(	(	PUNCT
ct-12705	43	21	agilent	agilent	PROPN
ct-12705	43	22	technologies	technologies	PROPN
ct-12705	43	23	,	,	PUNCT
ct-12705	43	24	santa	santa	PROPN
ct-12705	43	25	clara	clara	PROPN
ct-12705	43	26	,	,	PUNCT
ct-12705	43	27	ca	ca	PROPN
ct-12705	43	28	,	,	PUNCT
ct-12705	43	29	usa	usa	PROPN
ct-12705	43	30	)	)	PUNCT
ct-12705	43	31	.	.	PUNCT
ct-12705	44	1	a	a	DET
ct-12705	44	2	total	total	ADJ
ct-12705	44	3	amount	amount	NOUN
ct-12705	44	4	of	of	ADP
ct-12705	44	5	1	1	NUM
ct-12705	44	6	μg	μg	NOUN
ct-12705	44	7	of	of	ADP
ct-12705	44	8	rna	rna	PROPN
ct-12705	44	9	per	per	ADP
ct-12705	44	10	sample	sample	NOUN
ct-12705	44	11	was	be	AUX
ct-12705	44	12	used	use	VERB
ct-12705	44	13	as	as	ADP
ct-12705	44	14	input	input	NOUN
ct-12705	44	15	material	material	NOUN
ct-12705	44	16	for	for	ADP
ct-12705	44	17	the	the	DET
ct-12705	44	18	rna	rna	NOUN
ct-12705	44	19	sample	sample	NOUN
ct-12705	44	20	preparations	preparation	NOUN
ct-12705	44	21	.	.	PUNCT
ct-12705	45	1	sequencing	sequence	VERB
ct-12705	45	2	libraries	library	NOUN
ct-12705	45	3	were	be	AUX
ct-12705	45	4	generated	generate	VERB
ct-12705	45	5	using	use	VERB
ct-12705	45	6	nebnext	nebnext	ADJ
ct-12705	45	7	®	®	NOUN
ct-12705	45	8	ultra	ultra	ADJ
ct-12705	45	9	™	™	ADJ
ct-12705	45	10	rna	rna	NOUN
ct-12705	45	11	library	library	NOUN
ct-12705	45	12	prep	prep	NOUN
ct-12705	45	13	kit	kit	NOUN
ct-12705	45	14	for	for	ADP
ct-12705	45	15	illumina	illumina	PROPN
ct-12705	45	16	®	®	PROPN
ct-12705	45	17	(	(	PUNCT
ct-12705	45	18	illumina	illumina	PROPN
ct-12705	45	19	,	,	PUNCT
ct-12705	45	20	san	san	PROPN
ct-12705	45	21	diego	diego	PROPN
ct-12705	45	22	,	,	PUNCT
ct-12705	45	23	ca	ca	PROPN
ct-12705	45	24	,	,	PUNCT
ct-12705	45	25	usa	usa	PROPN
ct-12705	45	26	)	)	PUNCT
ct-12705	45	27	following	follow	VERB
ct-12705	45	28	the	the	DET
ct-12705	45	29	manufacturer	manufacturer	NOUN
ct-12705	45	30	’s	’s	PART
ct-12705	45	31	recommendations	recommendation	NOUN
ct-12705	45	32	,	,	PUNCT
ct-12705	45	33	and	and	CCONJ
ct-12705	45	34	index	index	NOUN
ct-12705	45	35	codes	code	NOUN
ct-12705	45	36	were	be	AUX
ct-12705	45	37	added	add	VERB
ct-12705	45	38	to	to	PART
ct-12705	45	39	attribute	attribute	VERB
ct-12705	45	40	sequences	sequence	NOUN
ct-12705	45	41	to	to	ADP
ct-12705	45	42	each	each	DET
ct-12705	45	43	sample	sample	NOUN
ct-12705	45	44	.	.	PUNCT
ct-12705	46	1	briefly	briefly	ADV
ct-12705	46	2	,	,	PUNCT
ct-12705	46	3	mrna	mrna	PROPN
ct-12705	46	4	was	be	AUX
ct-12705	46	5	purified	purify	VERB
ct-12705	46	6	from	from	ADP
ct-12705	46	7	total	total	ADJ
ct-12705	46	8	rna	rna	NOUN
ct-12705	46	9	using	use	VERB
ct-12705	46	10	poly	poly	ADJ
ct-12705	46	11	-	-	PUNCT
ct-12705	46	12	t	t	NOUN
ct-12705	46	13	oligo	oligo	NOUN
ct-12705	46	14	-	-	PUNCT
ct-12705	46	15	attached	attach	VERB
ct-12705	46	16	magnetic	magnetic	ADJ
ct-12705	46	17	beads	bead	NOUN
ct-12705	46	18	.	.	PUNCT
ct-12705	47	1	fragmentation	fragmentation	NOUN
ct-12705	47	2	was	be	AUX
ct-12705	47	3	carried	carry	VERB
ct-12705	47	4	out	out	ADP
ct-12705	47	5	using	use	VERB
ct-12705	47	6	divalent	divalent	ADJ
ct-12705	47	7	cations	cation	NOUN
ct-12705	47	8	under	under	ADP
ct-12705	47	9	elevated	elevated	ADJ
ct-12705	47	10	temperature	temperature	NOUN
ct-12705	47	11	in	in	ADP
ct-12705	47	12	neb	neb	PROPN
ct-12705	47	13	and	and	CCONJ
ct-12705	47	14	next	next	ADV
ct-12705	47	15	in	in	ADP
ct-12705	47	16	first	first	ADJ
ct-12705	47	17	strand	strand	NOUN
ct-12705	47	18	synthesis	synthesis	NOUN
ct-12705	47	19	reaction	reaction	NOUN
ct-12705	47	20	buffer	buffer	NOUN
ct-12705	47	21	(	(	PUNCT
ct-12705	47	22	5	5	NUM
ct-12705	47	23	x	x	NOUN
ct-12705	47	24	)	)	PUNCT
ct-12705	47	25	.	.	PUNCT
ct-12705	48	1	first	first	ADJ
ct-12705	48	2	strand	strand	NOUN
ct-12705	48	3	cdna	cdna	PROPN
ct-12705	48	4	was	be	AUX
ct-12705	48	5	synthesized	synthesize	VERB
ct-12705	48	6	using	use	VERB
ct-12705	48	7	random	random	ADJ
ct-12705	48	8	hexamer	hexamer	NOUN
ct-12705	48	9	primer	primer	NOUN
ct-12705	48	10	and	and	CCONJ
ct-12705	48	11	m	m	NOUN
ct-12705	48	12	-	-	ADJ
ct-12705	48	13	mulv	mulv	ADJ
ct-12705	48	14	reverse	reverse	ADJ
ct-12705	48	15	transcriptase	transcriptase	NOUN
ct-12705	48	16	(	(	PUNCT
ct-12705	48	17	rnase	rnase	PROPN
ct-12705	48	18	h	h	PROPN
ct-12705	48	19	)	)	PUNCT
ct-12705	48	20	.	.	PUNCT
ct-12705	49	1	second	second	ADJ
ct-12705	49	2	strand	strand	NOUN
ct-12705	49	3	cdna	cdna	PROPN
ct-12705	49	4	synthesis	synthesis	NOUN
ct-12705	49	5	was	be	AUX
ct-12705	49	6	subsequently	subsequently	ADV
ct-12705	49	7	performed	perform	VERB
ct-12705	49	8	using	use	VERB
ct-12705	49	9	dna	dna	PROPN
ct-12705	49	10	polymerase	polymerase	NOUN
ct-12705	50	1	i	i	PRON
ct-12705	50	2	and	and	CCONJ
ct-12705	50	3	rnase	rnase	PROPN
ct-12705	50	4	h.	h.	PROPN
ct-12705	50	5	remaining	remain	VERB
ct-12705	50	6	overhangs	overhang	NOUN
ct-12705	50	7	were	be	AUX
ct-12705	50	8	converted	convert	VERB
ct-12705	50	9	into	into	ADP
ct-12705	50	10	blunt	blunt	ADJ
ct-12705	50	11	ends	end	NOUN
ct-12705	50	12	via	via	ADP
ct-12705	50	13	exonuclease	exonuclease	NOUN
ct-12705	50	14	/	/	SYM
ct-12705	50	15	polymerase	polymerase	NOUN
ct-12705	50	16	activities	activity	NOUN
ct-12705	50	17	.	.	PUNCT
ct-12705	51	1	after	after	ADP
ct-12705	51	2	adenylation	adenylation	NOUN
ct-12705	51	3	of	of	ADP
ct-12705	51	4	3	3	NUM
ct-12705	51	5	’	'	PUNCT
ct-12705	51	6	ends	end	NOUN
ct-12705	51	7	of	of	ADP
ct-12705	51	8	dna	dna	PROPN
ct-12705	51	9	fragments	fragment	NOUN
ct-12705	51	10	,	,	PUNCT
ct-12705	51	11	neb	neb	PROPN
ct-12705	51	12	and	and	CCONJ
ct-12705	51	13	next	next	ADJ
ct-12705	51	14	adaptor	adaptor	NOUN
ct-12705	51	15	with	with	ADP
ct-12705	51	16	hairpin	hairpin	NOUN
ct-12705	51	17	loop	loop	NOUN
ct-12705	51	18	structure	structure	NOUN
ct-12705	51	19	were	be	AUX
ct-12705	51	20	ligated	ligate	VERB
ct-12705	51	21	to	to	PART
ct-12705	51	22	prepare	prepare	VERB
ct-12705	51	23	for	for	ADP
ct-12705	51	24	hybridization	hybridization	NOUN
ct-12705	51	25	.	.	PUNCT
ct-12705	52	1	to	to	PART
ct-12705	52	2	select	select	VERB
ct-12705	52	3	cdna	cdna	PROPN
ct-12705	52	4	fragments	fragment	NOUN
ct-12705	52	5	of	of	ADP
ct-12705	52	6	preferentially	preferentially	ADV
ct-12705	52	7	150	150	NUM
ct-12705	52	8	-	-	SYM
ct-12705	52	9	200	200	NUM
ct-12705	52	10	base	base	NOUN
ct-12705	52	11	pair	pair	NOUN
ct-12705	52	12	(	(	PUNCT
ct-12705	52	13	bp	bp	PROPN
ct-12705	52	14	)	)	PUNCT
ct-12705	52	15	in	in	ADP
ct-12705	52	16	length	length	NOUN
ct-12705	52	17	,	,	PUNCT
ct-12705	52	18	the	the	DET
ct-12705	52	19	library	library	NOUN
ct-12705	52	20	fragments	fragment	NOUN
ct-12705	52	21	were	be	AUX
ct-12705	52	22	purified	purify	VERB
ct-12705	52	23	with	with	ADP
ct-12705	52	24	ampure	ampure	NOUN
ct-12705	52	25	xp	xp	NOUN
ct-12705	52	26	system	system	PROPN
ct-12705	52	27	(	(	PUNCT
ct-12705	52	28	beckman	beckman	PROPN
ct-12705	52	29	coulter	coulter	PROPN
ct-12705	52	30	,	,	PUNCT
ct-12705	52	31	brea	brea	PROPN
ct-12705	52	32	,	,	PUNCT
ct-12705	52	33	ca	ca	PROPN
ct-12705	52	34	usa	usa	PROPN
ct-12705	52	35	)	)	PUNCT
ct-12705	52	36	;	;	PUNCT
ct-12705	52	37	3	3	NUM
ct-12705	52	38	µl	µl	NOUN
ct-12705	52	39	of	of	ADP
ct-12705	52	40	user	user	NOUN
ct-12705	52	41	enzyme	enzyme	NOUN
ct-12705	52	42	(	(	PUNCT
ct-12705	52	43	neb	neb	PROPN
ct-12705	52	44	,	,	PUNCT
ct-12705	52	45	usa	usa	PROPN
ct-12705	52	46	)	)	PUNCT
ct-12705	52	47	were	be	AUX
ct-12705	52	48	used	use	VERB
ct-12705	52	49	with	with	ADP
ct-12705	52	50	size	size	NOUN
ct-12705	52	51	-	-	PUNCT
ct-12705	52	52	selected	select	VERB
ct-12705	52	53	,	,	PUNCT
ct-12705	52	54	adaptor	adaptor	NOUN
ct-12705	52	55	-	-	PUNCT
ct-12705	52	56	ligated	ligate	VERB
ct-12705	52	57	cdna	cdna	NOUN
ct-12705	52	58	at	at	ADP
ct-12705	52	59	37	37	NUM
ct-12705	52	60	°	°	ADP
ct-12705	52	61	c	c	NOUN
ct-12705	52	62	for	for	ADP
ct-12705	52	63	15	15	NUM
ct-12705	52	64	minutes	minute	NOUN
ct-12705	52	65	,	,	PUNCT
ct-12705	52	66	followed	follow	VERB
ct-12705	52	67	by	by	ADP
ct-12705	52	68	5	5	NUM
ct-12705	52	69	minutes	minute	NOUN
ct-12705	52	70	at	at	ADP
ct-12705	52	71	95	95	NUM
ct-12705	52	72	°	°	NOUN
ct-12705	52	73	c	c	NOUN
ct-12705	52	74	before	before	ADP
ct-12705	52	75	pcr	pcr	PROPN
ct-12705	52	76	.	.	PUNCT
ct-12705	53	1	then	then	ADV
ct-12705	53	2	pcr	pcr	PROPN
ct-12705	53	3	was	be	AUX
ct-12705	53	4	performed	perform	VERB
ct-12705	53	5	with	with	ADP
ct-12705	53	6	phusion	phusion	PROPN
ct-12705	53	7	high	high	ADJ
ct-12705	53	8	-	-	PUNCT
ct-12705	53	9	fidelity	fidelity	NOUN
ct-12705	53	10	dna	dna	PROPN
ct-12705	53	11	polymerase	polymerase	NOUN
ct-12705	53	12	,	,	PUNCT
ct-12705	53	13	universal	universal	ADJ
ct-12705	53	14	pcr	pcr	ADJ
ct-12705	53	15	primers	primer	NOUN
ct-12705	53	16	,	,	PUNCT
ct-12705	53	17	and	and	CCONJ
ct-12705	53	18	index	index	NOUN
ct-12705	53	19	(	(	PUNCT
ct-12705	53	20	x	x	NOUN
ct-12705	53	21	)	)	PUNCT
ct-12705	53	22	primer	primer	NOUN
ct-12705	53	23	.	.	PUNCT
ct-12705	54	1	the	the	DET
ct-12705	54	2	pcr	pcr	PROPN
ct-12705	54	3	products	product	NOUN
ct-12705	54	4	were	be	AUX
ct-12705	54	5	purified	purify	VERB
ct-12705	54	6	(	(	PUNCT
ct-12705	54	7	ampure	ampure	NOUN
ct-12705	54	8	xp	xp	NOUN
ct-12705	54	9	system	system	PROPN
ct-12705	54	10	)	)	PUNCT
ct-12705	54	11	,	,	PUNCT
ct-12705	54	12	and	and	CCONJ
ct-12705	54	13	the	the	DET
ct-12705	54	14	library	library	ADJ
ct-12705	54	15	quality	quality	NOUN
ct-12705	54	16	was	be	AUX
ct-12705	54	17	assessed	assess	VERB
ct-12705	54	18	on	on	ADP
ct-12705	54	19	the	the	DET
ct-12705	54	20	agilent	agilent	PROPN
ct-12705	54	21	bioanalyzer	bioanalyzer	NOUN
ct-12705	54	22	2100	2100	NUM
ct-12705	54	23	system	system	NOUN
ct-12705	54	24	.	.	PUNCT
ct-12705	55	1	the	the	DET
ct-12705	55	2	clustering	clustering	NOUN
ct-12705	55	3	of	of	ADP
ct-12705	55	4	the	the	DET
ct-12705	55	5	index	index	NOUN
ct-12705	55	6	-	-	PUNCT
ct-12705	55	7	coded	code	VERB
ct-12705	55	8	samples	sample	NOUN
ct-12705	55	9	was	be	AUX
ct-12705	55	10	performed	perform	VERB
ct-12705	55	11	on	on	ADP
ct-12705	55	12	a	a	DET
ct-12705	55	13	cbot	cbot	PROPN
ct-12705	55	14	cluster	cluster	NOUN
ct-12705	55	15	generation	generation	NOUN
ct-12705	55	16	system	system	NOUN
ct-12705	55	17	using	use	VERB
ct-12705	55	18	pe	pe	PROPN
ct-12705	55	19	cluster	cluster	NOUN
ct-12705	55	20	kit	kit	NOUN
ct-12705	55	21	cbot	cbot	PROPN
ct-12705	55	22	-	-	PUNCT
ct-12705	55	23	hs	hs	PROPN
ct-12705	55	24	(	(	PUNCT
ct-12705	55	25	illumina	illumina	PROPN
ct-12705	55	26	)	)	PUNCT
ct-12705	55	27	,	,	PUNCT
ct-12705	55	28	according	accord	VERB
ct-12705	55	29	to	to	ADP
ct-12705	55	30	the	the	DET
ct-12705	55	31	manufacturer	manufacturer	NOUN
ct-12705	55	32	’s	’s	PART
ct-12705	55	33	instructions	instruction	NOUN
ct-12705	55	34	.	.	PUNCT
ct-12705	56	1	after	after	ADP
ct-12705	56	2	cluster	cluster	NOUN
ct-12705	56	3	generation	generation	NOUN
ct-12705	56	4	,	,	PUNCT
ct-12705	56	5	the	the	DET
ct-12705	56	6	library	library	ADJ
ct-12705	56	7	preparations	preparation	NOUN
ct-12705	56	8	were	be	AUX
ct-12705	56	9	sequenced	sequence	VERB
ct-12705	56	10	on	on	ADP
ct-12705	56	11	an	an	DET
ct-12705	56	12	illumina	illumina	ADJ
ct-12705	56	13	platform	platform	NOUN
ct-12705	56	14	and	and	CCONJ
ct-12705	56	15	125	125	NUM
ct-12705	56	16	bp/150	bp/150	NOUN
ct-12705	56	17	bp	bp	PROPN
ct-12705	56	18	paired	pair	VERB
ct-12705	56	19	-	-	PUNCT
ct-12705	56	20	end	end	NOUN
ct-12705	56	21	reads	read	NOUN
ct-12705	56	22	were	be	AUX
ct-12705	56	23	generated	generate	VERB
ct-12705	56	24	.	.	PUNCT
ct-12705	57	1	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	PROPN
ct-12705	57	2	citation	citation	NOUN
ct-12705	57	3	:	:	PUNCT
ct-12705	57	4	clinical	clinical	ADJ
ct-12705	57	5	theriogenology	theriogenology	NOUN
ct-12705	57	6	2025	2025	NUM
ct-12705	57	7	,	,	PUNCT
ct-12705	57	8	17	17	NUM
ct-12705	57	9	,	,	PUNCT
ct-12705	57	10	12705	12705	NUM
ct-12705	57	11	,	,	PUNCT
ct-12705	57	12	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	57	13	3	3	NUM
ct-12705	57	14	sequencing	sequence	VERB
ct-12705	57	15	data	datum	NOUN
ct-12705	57	16	analysis	analysis	NOUN
ct-12705	57	17	raw	raw	ADJ
ct-12705	57	18	data	datum	NOUN
ct-12705	57	19	(	(	PUNCT
ct-12705	57	20	raw	raw	ADJ
ct-12705	57	21	reads	read	NOUN
ct-12705	57	22	)	)	PUNCT
ct-12705	57	23	of	of	ADP
ct-12705	57	24	fastq	fastq	ADJ
ct-12705	57	25	format	format	NOUN
ct-12705	57	26	were	be	AUX
ct-12705	57	27	first	first	ADV
ct-12705	57	28	processed	process	VERB
ct-12705	57	29	and	and	CCONJ
ct-12705	57	30	clean	clean	ADJ
ct-12705	57	31	data	datum	NOUN
ct-12705	57	32	(	(	PUNCT
ct-12705	57	33	clean	clean	ADJ
ct-12705	57	34	reads	read	NOUN
ct-12705	57	35	)	)	PUNCT
ct-12705	57	36	were	be	AUX
ct-12705	57	37	obtained	obtain	VERB
ct-12705	57	38	by	by	ADP
ct-12705	57	39	removing	remove	VERB
ct-12705	57	40	reads	read	NOUN
ct-12705	57	41	containing	contain	VERB
ct-12705	57	42	adapters	adapter	NOUN
ct-12705	57	43	,	,	PUNCT
ct-12705	57	44	reads	read	NOUN
ct-12705	57	45	containing	contain	VERB
ct-12705	57	46	ploy	ploy	NOUN
ct-12705	57	47	-	-	PUNCT
ct-12705	57	48	n	n	CCONJ
ct-12705	57	49	,	,	PUNCT
ct-12705	57	50	and	and	CCONJ
ct-12705	57	51	low	low	ADJ
ct-12705	57	52	-	-	PUNCT
ct-12705	57	53	quality	quality	NOUN
ct-12705	57	54	reads	read	NOUN
ct-12705	57	55	from	from	ADP
ct-12705	57	56	the	the	DET
ct-12705	57	57	raw	raw	ADJ
ct-12705	57	58	data	datum	NOUN
ct-12705	57	59	.	.	PUNCT
ct-12705	58	1	all	all	DET
ct-12705	58	2	the	the	DET
ct-12705	58	3	downstream	downstream	ADJ
ct-12705	58	4	analyses	analysis	NOUN
ct-12705	58	5	were	be	AUX
ct-12705	58	6	based	base	VERB
ct-12705	58	7	on	on	ADP
ct-12705	58	8	the	the	DET
ct-12705	58	9	clean	clean	ADJ
ct-12705	58	10	data	datum	NOUN
ct-12705	58	11	with	with	ADP
ct-12705	58	12	high	high	ADJ
ct-12705	58	13	quality	quality	NOUN
ct-12705	58	14	.	.	PUNCT
ct-12705	59	1	the	the	DET
ct-12705	59	2	reference	reference	NOUN
ct-12705	59	3	genome	genome	NOUN
ct-12705	59	4	(	(	PUNCT
ct-12705	59	5	equus	equus	PROPN
ct-12705	59	6	caballus	caballus	PROPN
ct-12705	59	7	,	,	PUNCT
ct-12705	59	8	equcab3	equcab3	PROPN
ct-12705	59	9	)	)	PUNCT
ct-12705	59	10	and	and	CCONJ
ct-12705	59	11	gene	gene	NOUN
ct-12705	59	12	model	model	NOUN
ct-12705	59	13	annotation	annotation	NOUN
ct-12705	59	14	files	file	NOUN
ct-12705	59	15	were	be	AUX
ct-12705	59	16	directly	directly	ADV
ct-12705	59	17	downloaded	download	VERB
ct-12705	59	18	from	from	ADP
ct-12705	59	19	the	the	DET
ct-12705	59	20	genome	genome	NOUN
ct-12705	59	21	website	website	NOUN
ct-12705	59	22	.	.	PUNCT
ct-12705	60	1	the	the	DET
ct-12705	60	2	index	index	NOUN
ct-12705	60	3	of	of	ADP
ct-12705	60	4	the	the	DET
ct-12705	60	5	reference	reference	NOUN
ct-12705	60	6	genome	genome	NOUN
ct-12705	60	7	was	be	AUX
ct-12705	60	8	built	build	VERB
ct-12705	60	9	using	use	VERB
ct-12705	60	10	hisat2	hisat2	PROPN
ct-12705	60	11	2.1.0	2.1.0	NUM
ct-12705	60	12	and	and	CCONJ
ct-12705	60	13	paired	pair	VERB
ct-12705	60	14	-	-	PUNCT
ct-12705	60	15	end	end	NOUN
ct-12705	60	16	clean	clean	ADJ
ct-12705	60	17	reads	read	NOUN
ct-12705	60	18	were	be	AUX
ct-12705	60	19	aligned	align	VERB
ct-12705	60	20	to	to	ADP
ct-12705	60	21	the	the	DET
ct-12705	60	22	reference	reference	NOUN
ct-12705	60	23	genome	genome	NOUN
ct-12705	60	24	using	use	VERB
ct-12705	60	25	hisat2	hisat2	PROPN
ct-12705	60	26	(	(	PUNCT
ct-12705	60	27	johns	johns	PROPN
ct-12705	60	28	hopkins	hopkins	PROPN
ct-12705	60	29	university	university	PROPN
ct-12705	60	30	,	,	PUNCT
ct-12705	60	31	baltimore	baltimore	PROPN
ct-12705	60	32	,	,	PUNCT
ct-12705	60	33	md	md	PROPN
ct-12705	60	34	,	,	PUNCT
ct-12705	60	35	usa	usa	PROPN
ct-12705	60	36	)	)	PUNCT
ct-12705	60	37	.	.	PUNCT
ct-12705	61	1	featurecounts	featurecount	NOUN
ct-12705	61	2	v1.5.0	v1.5.0	PROPN
ct-12705	61	3	-	-	PUNCT
ct-12705	61	4	p3	p3	PROPN
ct-12705	61	5	was	be	AUX
ct-12705	61	6	used	use	VERB
ct-12705	61	7	to	to	PART
ct-12705	61	8	count	count	VERB
ct-12705	61	9	the	the	DET
ct-12705	61	10	reads	read	NOUN
ct-12705	61	11	numbers	number	NOUN
ct-12705	61	12	mapped	map	VERB
ct-12705	61	13	to	to	ADP
ct-12705	61	14	each	each	DET
ct-12705	61	15	gene	gene	NOUN
ct-12705	61	16	.	.	PUNCT
ct-12705	62	1	the	the	DET
ct-12705	62	2	expected	expect	VERB
ct-12705	62	3	number	number	NOUN
ct-12705	62	4	of	of	ADP
ct-12705	62	5	fragments	fragment	NOUN
ct-12705	62	6	per	per	ADP
ct-12705	62	7	kilobase	kilobase	NOUN
ct-12705	62	8	of	of	ADP
ct-12705	62	9	transcript	transcript	NOUN
ct-12705	62	10	sequence	sequence	NOUN
ct-12705	62	11	per	per	ADP
ct-12705	62	12	millions	million	NOUN
ct-12705	62	13	base	base	NOUN
ct-12705	62	14	pairs	pair	NOUN
ct-12705	62	15	sequenced	sequence	VERB
ct-12705	62	16	(	(	PUNCT
ct-12705	62	17	fpkm	fpkm	NOUN
ct-12705	62	18	)	)	PUNCT
ct-12705	62	19	of	of	ADP
ct-12705	62	20	each	each	DET
ct-12705	62	21	gene	gene	NOUN
ct-12705	62	22	was	be	AUX
ct-12705	62	23	calculated	calculate	VERB
ct-12705	62	24	based	base	VERB
ct-12705	62	25	on	on	ADP
ct-12705	62	26	the	the	DET
ct-12705	62	27	length	length	NOUN
ct-12705	62	28	of	of	ADP
ct-12705	62	29	the	the	DET
ct-12705	62	30	gene	gene	NOUN
ct-12705	62	31	and	and	CCONJ
ct-12705	62	32	reads	read	VERB
ct-12705	62	33	count	count	NOUN
ct-12705	62	34	mapped	map	VERB
ct-12705	62	35	to	to	ADP
ct-12705	62	36	this	this	DET
ct-12705	62	37	gene.31	gene.31	ADJ
ct-12705	62	38	differential	differential	ADJ
ct-12705	62	39	expression	expression	NOUN
ct-12705	62	40	analysis	analysis	NOUN
ct-12705	62	41	was	be	AUX
ct-12705	62	42	performed	perform	VERB
ct-12705	62	43	comparing	compare	VERB
ct-12705	62	44	the	the	DET
ct-12705	62	45	testicular	testicular	ADJ
ct-12705	62	46	tissue	tissue	NOUN
ct-12705	62	47	to	to	ADP
ct-12705	62	48	each	each	DET
ct-12705	62	49	segment	segment	NOUN
ct-12705	62	50	of	of	ADP
ct-12705	62	51	the	the	DET
ct-12705	62	52	epididymis	epididymis	NOUN
ct-12705	62	53	using	use	VERB
ct-12705	62	54	the	the	DET
ct-12705	62	55	deseq2	deseq2	PROPN
ct-12705	62	56	r	r	NOUN
ct-12705	62	57	package	package	NOUN
ct-12705	62	58	(	(	PUNCT
ct-12705	62	59	1.14.1	1.14.1	NUM
ct-12705	62	60	,	,	PUNCT
ct-12705	62	61	r	r	NOUN
ct-12705	62	62	core	core	NOUN
ct-12705	62	63	team	team	NOUN
ct-12705	62	64	,	,	PUNCT
ct-12705	62	65	vienna	vienna	PROPN
ct-12705	62	66	,	,	PUNCT
ct-12705	62	67	austria	austria	PROPN
ct-12705	62	68	)	)	PUNCT
ct-12705	62	69	.	.	PUNCT
ct-12705	63	1	deseq2	deseq2	PROPN
ct-12705	63	2	provided	provide	VERB
ct-12705	63	3	statistical	statistical	ADJ
ct-12705	63	4	routines	routine	NOUN
ct-12705	63	5	for	for	ADP
ct-12705	63	6	determining	determine	VERB
ct-12705	63	7	differential	differential	ADJ
ct-12705	63	8	expression	expression	NOUN
ct-12705	63	9	in	in	ADP
ct-12705	63	10	digital	digital	ADJ
ct-12705	63	11	gene	gene	NOUN
ct-12705	63	12	expression	expression	NOUN
ct-12705	63	13	data	datum	NOUN
ct-12705	63	14	using	use	VERB
ct-12705	63	15	a	a	DET
ct-12705	63	16	model	model	NOUN
ct-12705	63	17	based	base	VERB
ct-12705	63	18	on	on	ADP
ct-12705	63	19	the	the	DET
ct-12705	63	20	negative	negative	ADJ
ct-12705	63	21	binomial	binomial	ADJ
ct-12705	63	22	distribution	distribution	NOUN
ct-12705	63	23	.	.	PUNCT
ct-12705	64	1	the	the	DET
ct-12705	64	2	p	p	PROPN
ct-12705	64	3	values	value	NOUN
ct-12705	64	4	were	be	AUX
ct-12705	64	5	adjusted	adjust	VERB
ct-12705	64	6	using	use	VERB
ct-12705	64	7	the	the	DET
ct-12705	64	8	benjamini	benjamini	NOUN
ct-12705	64	9	and	and	CCONJ
ct-12705	64	10	hochberg	hochberg	PROPN
ct-12705	64	11	’s	’s	PART
ct-12705	64	12	approach	approach	NOUN
ct-12705	64	13	for	for	ADP
ct-12705	64	14	controlling	control	VERB
ct-12705	64	15	the	the	DET
ct-12705	64	16	false	false	ADJ
ct-12705	64	17	discovery	discovery	NOUN
ct-12705	64	18	rate	rate	NOUN
ct-12705	64	19	.	.	PUNCT
ct-12705	65	1	genes	gene	NOUN
ct-12705	65	2	with	with	ADP
ct-12705	65	3	an	an	DET
ct-12705	65	4	adjusted	adjust	VERB
ct-12705	65	5	p	p	NOUN
ct-12705	65	6	value	value	NOUN
ct-12705	65	7	<	<	X
ct-12705	65	8	0.05	0.05	NUM
ct-12705	65	9	by	by	ADP
ct-12705	65	10	deseq2	deseq2	PROPN
ct-12705	65	11	were	be	AUX
ct-12705	65	12	considered	consider	VERB
ct-12705	65	13	differentially	differentially	ADV
ct-12705	65	14	expressed.32	expressed.32	VERB
ct-12705	65	15	the	the	DET
ct-12705	65	16	differential	differential	ADJ
ct-12705	65	17	expression	expression	NOUN
ct-12705	65	18	of	of	ADP
ct-12705	65	19	tlrs	tlrs	NOUN
ct-12705	65	20	was	be	AUX
ct-12705	65	21	evaluated	evaluate	VERB
ct-12705	65	22	within	within	ADP
ct-12705	65	23	each	each	DET
ct-12705	65	24	tissue	tissue	NOUN
ct-12705	65	25	sample	sample	NOUN
ct-12705	65	26	by	by	ADP
ct-12705	65	27	comparing	compare	VERB
ct-12705	65	28	mean	mean	ADJ
ct-12705	65	29	fpkm	fpkm	NOUN
ct-12705	65	30	among	among	ADP
ct-12705	65	31	tlrs	tlrs	NOUN
ct-12705	65	32	.	.	PUNCT
ct-12705	66	1	from	from	ADP
ct-12705	66	2	the	the	DET
ct-12705	66	3	entire	entire	ADJ
ct-12705	66	4	data	datum	NOUN
ct-12705	66	5	set	set	VERB
ct-12705	66	6	of	of	ADP
ct-12705	66	7	transcripts	transcript	NOUN
ct-12705	66	8	,	,	PUNCT
ct-12705	66	9	genes	gene	NOUN
ct-12705	66	10	involved	involve	VERB
ct-12705	66	11	in	in	ADP
ct-12705	66	12	the	the	DET
ct-12705	66	13	toll	toll	NOUN
ct-12705	66	14	-	-	PUNCT
ct-12705	66	15	like	like	ADJ
ct-12705	66	16	receptor	receptor	NOUN
ct-12705	66	17	pathway	pathway	NOUN
ct-12705	66	18	(	(	PUNCT
ct-12705	66	19	https://www.genome.jp/pathway/hsa04620	https://www.genome.jp/pathway/hsa04620	NUM
ct-12705	66	20	)	)	PUNCT
ct-12705	66	21	were	be	AUX
ct-12705	66	22	selected	select	VERB
ct-12705	66	23	and	and	CCONJ
ct-12705	66	24	reported	report	VERB
ct-12705	66	25	.	.	PUNCT
ct-12705	67	1	reverse	reverse	ADJ
ct-12705	67	2	transcription	transcription	NOUN
ct-12705	67	3	and	and	CCONJ
ct-12705	67	4	real	real	ADJ
ct-12705	67	5	time	time	NOUN
ct-12705	67	6	polymerase	polymerase	NOUN
ct-12705	67	7	chain	chain	NOUN
ct-12705	67	8	reaction	reaction	NOUN
ct-12705	67	9	real	real	ADJ
ct-12705	67	10	time	time	NOUN
ct-12705	67	11	polymerase	polymerase	NOUN
ct-12705	67	12	chain	chain	NOUN
ct-12705	67	13	reaction	reaction	NOUN
ct-12705	67	14	(	(	PUNCT
ct-12705	67	15	rt	rt	NOUN
ct-12705	67	16	-	-	PUNCT
ct-12705	67	17	pcr	pcr	NOUN
ct-12705	67	18	)	)	PUNCT
ct-12705	67	19	was	be	AUX
ct-12705	67	20	performed	perform	VERB
ct-12705	67	21	in	in	ADP
ct-12705	67	22	a	a	DET
ct-12705	67	23	subset	subset	NOUN
ct-12705	67	24	of	of	ADP
ct-12705	67	25	3	3	NUM
ct-12705	67	26	stallion	stallion	NOUN
ct-12705	67	27	testicular	testicular	NOUN
ct-12705	67	28	samples	sample	NOUN
ct-12705	67	29	to	to	PART
ct-12705	67	30	confirm	confirm	VERB
ct-12705	67	31	expression	expression	NOUN
ct-12705	67	32	of	of	ADP
ct-12705	67	33	tlrs	tlrs	ADJ
ct-12705	67	34	1	1	NUM
ct-12705	67	35	-	-	SYM
ct-12705	67	36	8	8	NUM
ct-12705	67	37	for	for	ADP
ct-12705	67	38	quality	quality	NOUN
ct-12705	67	39	control	control	NOUN
ct-12705	67	40	of	of	ADP
ct-12705	67	41	the	the	DET
ct-12705	67	42	sequencing	sequence	VERB
ct-12705	67	43	analysis	analysis	NOUN
ct-12705	67	44	.	.	PUNCT
ct-12705	68	1	tissue	tissue	NOUN
ct-12705	68	2	collected	collect	VERB
ct-12705	68	3	from	from	ADP
ct-12705	68	4	equine	equine	NOUN
ct-12705	68	5	lymph	lymph	NOUN
ct-12705	68	6	nodes	node	NOUN
ct-12705	68	7	was	be	AUX
ct-12705	68	8	used	use	VERB
ct-12705	68	9	as	as	ADP
ct-12705	68	10	positive	positive	ADJ
ct-12705	68	11	control	control	NOUN
ct-12705	68	12	.	.	PUNCT
ct-12705	69	1	total	total	ADJ
ct-12705	69	2	rna	rna	NOUN
ct-12705	69	3	yield	yield	NOUN
ct-12705	69	4	and	and	CCONJ
ct-12705	69	5	purity	purity	NOUN
ct-12705	69	6	were	be	AUX
ct-12705	69	7	estimated	estimate	VERB
ct-12705	69	8	spectrophotometrically	spectrophotometrically	ADV
ct-12705	69	9	at	at	ADP
ct-12705	69	10	260	260	NUM
ct-12705	69	11	nm	nm	NOUN
ct-12705	69	12	using	use	VERB
ct-12705	69	13	a	a	DET
ct-12705	69	14	nanodrop	nanodrop	NOUN
ct-12705	69	15	(	(	PUNCT
ct-12705	69	16	thermofisher	thermofisher	PROPN
ct-12705	69	17	scientific	scientific	PROPN
ct-12705	69	18	,	,	PUNCT
ct-12705	69	19	waltham	waltham	PROPN
ct-12705	69	20	,	,	PUNCT
ct-12705	69	21	ma	ma	PROPN
ct-12705	69	22	,	,	PUNCT
ct-12705	69	23	usa	usa	PROPN
ct-12705	69	24	)	)	PUNCT
ct-12705	69	25	.	.	PUNCT
ct-12705	70	1	complementary	complementary	ADJ
ct-12705	70	2	dna	dna	PROPN
ct-12705	70	3	(	(	PUNCT
ct-12705	70	4	cdna	cdna	PROPN
ct-12705	70	5	)	)	PUNCT
ct-12705	70	6	was	be	AUX
ct-12705	70	7	synthesized	synthesize	VERB
ct-12705	70	8	from	from	ADP
ct-12705	70	9	1	1	NUM
ct-12705	70	10	µg	µg	ADP
ct-12705	70	11	total	total	ADJ
ct-12705	70	12	rna	rna	NOUN
ct-12705	70	13	using	use	VERB
ct-12705	70	14	qscript	qscript	NOUN
ct-12705	70	15	™	™	VERB
ct-12705	70	16	cdna	cdna	PROPN
ct-12705	70	17	supermix	supermix	PROPN
ct-12705	70	18	(	(	PUNCT
ct-12705	70	19	quanta	quanta	PROPN
ct-12705	70	20	biosciences	biosciences	PROPN
ct-12705	70	21	,	,	PUNCT
ct-12705	70	22	gaithersburg	gaithersburg	PROPN
ct-12705	70	23	,	,	PUNCT
ct-12705	70	24	md	md	PROPN
ct-12705	70	25	,	,	PUNCT
ct-12705	70	26	usa	usa	PROPN
ct-12705	70	27	)	)	PUNCT
ct-12705	70	28	and	and	CCONJ
ct-12705	70	29	nuclease	nuclease	NOUN
ct-12705	70	30	-	-	PUNCT
ct-12705	70	31	free	free	ADJ
ct-12705	70	32	water	water	NOUN
ct-12705	70	33	,	,	PUNCT
ct-12705	70	34	following	follow	VERB
ct-12705	70	35	the	the	DET
ct-12705	70	36	manufacturer	manufacturer	NOUN
ct-12705	70	37	’s	’s	PART
ct-12705	70	38	instructions	instruction	NOUN
ct-12705	70	39	.	.	PUNCT
ct-12705	71	1	reverse	reverse	ADJ
ct-12705	71	2	transcription	transcription	NOUN
ct-12705	71	3	was	be	AUX
ct-12705	71	4	performed	perform	VERB
ct-12705	71	5	at	at	ADP
ct-12705	71	6	25	25	NUM
ct-12705	71	7	°	°	NOUN
ct-12705	71	8	c	c	NOUN
ct-12705	71	9	for	for	ADP
ct-12705	71	10	5	5	NUM
ct-12705	71	11	minutes	minute	NOUN
ct-12705	71	12	,	,	PUNCT
ct-12705	71	13	42	42	NUM
ct-12705	71	14	°	°	ADP
ct-12705	71	15	c	c	NOUN
ct-12705	71	16	for	for	ADP
ct-12705	71	17	30	30	NUM
ct-12705	71	18	minutes	minute	NOUN
ct-12705	71	19	,	,	PUNCT
ct-12705	71	20	followed	follow	VERB
ct-12705	71	21	by	by	ADP
ct-12705	71	22	90	90	NUM
ct-12705	71	23	°	°	NOUN
ct-12705	71	24	c	c	NOUN
ct-12705	71	25	for	for	ADP
ct-12705	71	26	5	5	NUM
ct-12705	71	27	minutes	minute	NOUN
ct-12705	71	28	.	.	PUNCT
ct-12705	72	1	the	the	DET
ct-12705	72	2	cdnas	cdna	NOUN
ct-12705	72	3	obtained	obtain	VERB
ct-12705	72	4	were	be	AUX
ct-12705	72	5	stored	store	VERB
ct-12705	72	6	at	at	ADP
ct-12705	72	7	–	–	PUNCT
ct-12705	72	8	20	20	NUM
ct-12705	72	9	°	°	NUM
ct-12705	72	10	c	c	NOUN
ct-12705	72	11	until	until	ADP
ct-12705	72	12	further	further	ADJ
ct-12705	72	13	investigation	investigation	NOUN
ct-12705	72	14	.	.	PUNCT
ct-12705	73	1	reactions	reaction	NOUN
ct-12705	73	2	without	without	ADP
ct-12705	73	3	reverse	reverse	ADJ
ct-12705	73	4	transcriptase	transcriptase	NOUN
ct-12705	73	5	were	be	AUX
ct-12705	73	6	run	run	VERB
ct-12705	73	7	in	in	ADP
ct-12705	73	8	parallel	parallel	NOUN
ct-12705	73	9	to	to	ADP
ct-12705	73	10	rt	rt	PROPN
ct-12705	73	11	to	to	PART
ct-12705	73	12	confirm	confirm	VERB
ct-12705	73	13	the	the	DET
ct-12705	73	14	absence	absence	NOUN
ct-12705	73	15	of	of	ADP
ct-12705	73	16	any	any	DET
ct-12705	73	17	genomic	genomic	ADJ
ct-12705	73	18	dna	dna	NOUN
ct-12705	73	19	or	or	CCONJ
ct-12705	73	20	contamination	contamination	NOUN
ct-12705	73	21	.	.	PUNCT
ct-12705	74	1	the	the	DET
ct-12705	74	2	tlr	tlr	PROPN
ct-12705	74	3	gene	gene	NOUN
ct-12705	74	4	-	-	PUNCT
ct-12705	74	5	specific	specific	ADJ
ct-12705	74	6	primers	primer	NOUN
ct-12705	74	7	(	(	PUNCT
ct-12705	74	8	table	table	NOUN
ct-12705	74	9	)	)	PUNCT
ct-12705	74	10	were	be	AUX
ct-12705	74	11	designed	design	VERB
ct-12705	74	12	using	use	VERB
ct-12705	74	13	sequences	sequence	NOUN
ct-12705	74	14	published	publish	VERB
ct-12705	74	15	in	in	ADP
ct-12705	74	16	the	the	DET
ct-12705	74	17	national	national	ADJ
ct-12705	74	18	center	center	NOUN
ct-12705	74	19	for	for	ADP
ct-12705	74	20	biotechnology	biotechnology	NOUN
ct-12705	74	21	information	information	NOUN
ct-12705	74	22	database	database	NOUN
ct-12705	74	23	(	(	PUNCT
ct-12705	74	24	ncbi	ncbi	PROPN
ct-12705	74	25	,	,	PUNCT
ct-12705	74	26	bethesda	bethesda	PROPN
ct-12705	74	27	,	,	PUNCT
ct-12705	74	28	md	md	PROPN
ct-12705	74	29	,	,	PUNCT
ct-12705	74	30	usa	usa	PROPN
ct-12705	74	31	)	)	PUNCT
ct-12705	74	32	with	with	ADP
ct-12705	74	33	the	the	DET
ct-12705	74	34	aid	aid	NOUN
ct-12705	74	35	of	of	ADP
ct-12705	74	36	primer3	primer3	ADJ
ct-12705	74	37	software	software	NOUN
ct-12705	74	38	and	and	CCONJ
ct-12705	74	39	purchased	purchase	VERB
ct-12705	74	40	from	from	ADP
ct-12705	74	41	sigma	sigma	PROPN
ct-12705	74	42	.	.	PUNCT
ct-12705	75	1	amplification	amplification	NOUN
ct-12705	75	2	of	of	ADP
ct-12705	75	3	cdna	cdna	PROPN
ct-12705	75	4	was	be	AUX
ct-12705	75	5	performed	perform	VERB
ct-12705	75	6	using	use	VERB
ct-12705	75	7	the	the	DET
ct-12705	75	8	following	following	ADJ
ct-12705	75	9	conditions	condition	NOUN
ct-12705	75	10	:	:	PUNCT
ct-12705	75	11	an	an	DET
ct-12705	75	12	initial	initial	ADJ
ct-12705	75	13	denaturation	denaturation	NOUN
ct-12705	75	14	at	at	ADP
ct-12705	75	15	94	94	NUM
ct-12705	75	16	°	°	ADP
ct-12705	75	17	c	c	NOUN
ct-12705	75	18	for	for	ADP
ct-12705	75	19	5	5	NUM
ct-12705	75	20	 	 	SPACE
ct-12705	75	21	minutes	minute	NOUN
ct-12705	75	22	;	;	PUNCT
ct-12705	75	23	followed	follow	VERB
ct-12705	75	24	by	by	ADP
ct-12705	75	25	39	39	NUM
ct-12705	75	26	cycles	cycle	NOUN
ct-12705	75	27	of	of	ADP
ct-12705	75	28	94	94	NUM
ct-12705	75	29	°	°	ADP
ct-12705	75	30	c	c	NOUN
ct-12705	75	31	for	for	ADP
ct-12705	75	32	30	30	NUM
ct-12705	75	33	seconds	second	NOUN
ct-12705	75	34	,	,	PUNCT
ct-12705	75	35	and	and	CCONJ
ct-12705	75	36	annealing	anneal	VERB
ct-12705	75	37	at	at	ADP
ct-12705	75	38	the	the	DET
ct-12705	75	39	temperature	temperature	NOUN
ct-12705	75	40	specified	specify	VERB
ct-12705	75	41	for	for	ADP
ct-12705	75	42	each	each	DET
ct-12705	75	43	gene	gene	NOUN
ct-12705	75	44	for	for	ADP
ct-12705	75	45	60	60	NUM
ct-12705	75	46	seconds	second	NOUN
ct-12705	75	47	;	;	PUNCT
ct-12705	75	48	with	with	ADP
ct-12705	75	49	a	a	DET
ct-12705	75	50	final	final	ADJ
ct-12705	75	51	extension	extension	NOUN
ct-12705	75	52	at	at	ADP
ct-12705	75	53	72	72	NUM
ct-12705	75	54	°	°	ADP
ct-12705	75	55	c	c	NOUN
ct-12705	75	56	for	for	ADP
ct-12705	75	57	4	4	NUM
ct-12705	75	58	minutes	minute	NOUN
ct-12705	75	59	.	.	PUNCT
ct-12705	76	1	a	a	DET
ct-12705	76	2	dissociation	dissociation	NOUN
ct-12705	76	3	curve	curve	NOUN
ct-12705	76	4	was	be	AUX
ct-12705	76	5	added	add	VERB
ct-12705	76	6	for	for	ADP
ct-12705	76	7	15	15	NUM
ct-12705	76	8	seconds	second	NOUN
ct-12705	76	9	at	at	ADP
ct-12705	76	10	95	95	NUM
ct-12705	76	11	°	°	ADP
ct-12705	76	12	c	c	NOUN
ct-12705	76	13	to	to	PART
ct-12705	76	14	ensure	ensure	VERB
ct-12705	76	15	the	the	DET
ct-12705	76	16	presence	presence	NOUN
ct-12705	76	17	of	of	ADP
ct-12705	76	18	a	a	DET
ct-12705	76	19	single	single	ADJ
ct-12705	76	20	amplicon	amplicon	NOUN
ct-12705	76	21	.	.	PUNCT
ct-12705	77	1	gene	gene	NOUN
ct-12705	77	2	expression	expression	NOUN
ct-12705	77	3	was	be	AUX
ct-12705	77	4	analyzed	analyze	VERB
ct-12705	77	5	using	use	VERB
ct-12705	77	6	sybr	sybr	ADP
ct-12705	77	7	green	green	ADJ
ct-12705	77	8	quantitative	quantitative	ADJ
ct-12705	77	9	rt	rt	NOUN
ct-12705	77	10	-	-	PUNCT
ct-12705	77	11	pcr	pcr	ADJ
ct-12705	77	12	,	,	PUNCT
ct-12705	77	13	and	and	CCONJ
ct-12705	77	14	expression	expression	NOUN
ct-12705	77	15	data	datum	NOUN
ct-12705	77	16	for	for	ADP
ct-12705	77	17	the	the	DET
ct-12705	77	18	different	different	ADJ
ct-12705	77	19	genes	gene	NOUN
ct-12705	77	20	were	be	AUX
ct-12705	77	21	obtained	obtain	VERB
ct-12705	77	22	in	in	ADP
ct-12705	77	23	the	the	DET
ct-12705	77	24	form	form	NOUN
ct-12705	77	25	of	of	ADP
ct-12705	77	26	threshold	threshold	NOUN
ct-12705	77	27	cycle	cycle	NOUN
ct-12705	77	28	(	(	PUNCT
ct-12705	77	29	ct	ct	NOUN
ct-12705	77	30	)	)	PUNCT
ct-12705	77	31	values	value	NOUN
ct-12705	77	32	.	.	PUNCT
ct-12705	78	1	figure	figure	NOUN
ct-12705	78	2	1	1	NUM
ct-12705	78	3	.	.	PUNCT
ct-12705	78	4	toll	toll	NOUN
ct-12705	78	5	-	-	PUNCT
ct-12705	78	6	like	like	ADJ
ct-12705	78	7	receptors	receptor	NOUN
ct-12705	78	8	and	and	CCONJ
ct-12705	78	9	their	their	PRON
ct-12705	78	10	associated	associated	ADJ
ct-12705	78	11	pathways	pathway	NOUN
ct-12705	78	12	,	,	PUNCT
ct-12705	78	13	gray	gray	ADJ
ct-12705	78	14	boxes	box	NOUN
ct-12705	78	15	represent	represent	VERB
ct-12705	78	16	genes	gene	NOUN
ct-12705	78	17	that	that	PRON
ct-12705	78	18	were	be	AUX
ct-12705	78	19	not	not	PART
ct-12705	78	20	constitutively	constitutively	ADV
ct-12705	78	21	expressed	express	VERB
ct-12705	78	22	(	(	PUNCT
ct-12705	78	23	fpkm	fpkm	NOUN
ct-12705	78	24	=	=	SYM
ct-12705	78	25	0	0	NUM
ct-12705	78	26	)	)	PUNCT
ct-12705	78	27	within	within	ADP
ct-12705	78	28	the	the	DET
ct-12705	78	29	stallion	stallion	NOUN
ct-12705	78	30	’s	’s	PART
ct-12705	78	31	reproductive	reproductive	ADJ
ct-12705	78	32	tract	tract	NOUN
ct-12705	78	33	;	;	PUNCT
ct-12705	78	34	fpkm	fpkm	NOUN
ct-12705	78	35	=	=	PUNCT
ct-12705	78	36	fragments	fragment	NOUN
ct-12705	78	37	per	per	ADP
ct-12705	78	38	kilobase	kilobase	NOUN
ct-12705	78	39	of	of	ADP
ct-12705	78	40	transcript	transcript	NOUN
ct-12705	78	41	sequence	sequence	NOUN
ct-12705	78	42	per	per	ADP
ct-12705	78	43	millions	million	NOUN
ct-12705	78	44	base	base	NOUN
ct-12705	78	45	pairs	pair	NOUN
ct-12705	78	46	sequenced	sequence	VERB
ct-12705	78	47	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	78	48	https://www.genome.jp/pathway/hsa04620	https://www.genome.jp/pathway/hsa04620	NUM
ct-12705	78	49	4	4	NUM
ct-12705	78	50	citation	citation	NOUN
ct-12705	78	51	:	:	PUNCT
ct-12705	78	52	clinical	clinical	ADJ
ct-12705	78	53	theriogenology	theriogenology	NOUN
ct-12705	78	54	2025	2025	NUM
ct-12705	78	55	,	,	PUNCT
ct-12705	78	56	17	17	NUM
ct-12705	78	57	,	,	PUNCT
ct-12705	78	58	12705	12705	NUM
ct-12705	78	59	,	,	PUNCT
ct-12705	78	60	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	78	61	results	result	NOUN
ct-12705	78	62	gene	gene	NOUN
ct-12705	78	63	expression	expression	NOUN
ct-12705	78	64	was	be	AUX
ct-12705	78	65	not	not	PART
ct-12705	78	66	affected	affect	VERB
ct-12705	78	67	by	by	ADP
ct-12705	78	68	stallion	stallion	NOUN
ct-12705	78	69	age	age	NOUN
ct-12705	78	70	or	or	CCONJ
ct-12705	78	71	season	season	NOUN
ct-12705	78	72	(	(	PUNCT
ct-12705	78	73	p	p	X
ct-12705	78	74	>	>	X
ct-12705	78	75	0.05	0.05	NUM
ct-12705	78	76	)	)	PUNCT
ct-12705	78	77	;	;	PUNCT
ct-12705	78	78	therefore	therefore	ADV
ct-12705	78	79	,	,	PUNCT
ct-12705	78	80	data	datum	NOUN
ct-12705	78	81	from	from	ADP
ct-12705	78	82	all	all	DET
ct-12705	78	83	stallions	stallion	NOUN
ct-12705	78	84	were	be	AUX
ct-12705	78	85	grouped	group	VERB
ct-12705	78	86	.	.	PUNCT
ct-12705	79	1	detectable	detectable	ADJ
ct-12705	79	2	constitutive	constitutive	ADJ
ct-12705	79	3	expression	expression	NOUN
ct-12705	79	4	of	of	ADP
ct-12705	79	5	all	all	DET
ct-12705	79	6	tlrs	tlrs	NOUN
ct-12705	79	7	,	,	PUNCT
ct-12705	79	8	costimulatory	costimulatory	NOUN
ct-12705	79	9	molecules	molecule	NOUN
ct-12705	79	10	,	,	PUNCT
ct-12705	79	11	and	and	CCONJ
ct-12705	79	12	most	most	ADV
ct-12705	79	13	downstream	downstream	ADJ
ct-12705	79	14	adaptors	adaptor	NOUN
ct-12705	79	15	and	and	CCONJ
ct-12705	79	16	effectors	effector	NOUN
ct-12705	79	17	was	be	AUX
ct-12705	79	18	identified	identify	VERB
ct-12705	79	19	in	in	ADP
ct-12705	79	20	stallion	stallion	NOUN
ct-12705	79	21	reproductive	reproductive	ADJ
ct-12705	79	22	tissues	tissue	NOUN
ct-12705	79	23	,	,	PUNCT
ct-12705	79	24	including	include	VERB
ct-12705	79	25	the	the	DET
ct-12705	79	26	ortholog	ortholog	NOUN
ct-12705	79	27	gene	gene	NOUN
ct-12705	79	28	tlr12	tlr12	PROPN
ct-12705	79	29	(	(	PUNCT
ct-12705	79	30	supplemental	supplemental	ADJ
ct-12705	79	31	table	table	NOUN
ct-12705	79	32	;	;	PUNCT
ct-12705	79	33	figure	figure	NOUN
ct-12705	79	34	1	1	NUM
ct-12705	79	35	)	)	PUNCT
ct-12705	79	36	.	.	PUNCT
ct-12705	80	1	within	within	ADP
ct-12705	80	2	the	the	DET
ct-12705	80	3	testes	testis	NOUN
ct-12705	80	4	,	,	PUNCT
ct-12705	80	5	transcription	transcription	NOUN
ct-12705	80	6	of	of	ADP
ct-12705	80	7	all	all	DET
ct-12705	80	8	tlrs	tlrs	NOUN
ct-12705	80	9	and	and	CCONJ
ct-12705	80	10	most	most	ADJ
ct-12705	80	11	of	of	ADP
ct-12705	80	12	their	their	PRON
ct-12705	80	13	associated	associated	ADJ
ct-12705	80	14	adaptors	adaptor	NOUN
ct-12705	80	15	and	and	CCONJ
ct-12705	80	16	effectors	effector	NOUN
ct-12705	80	17	was	be	AUX
ct-12705	80	18	identified	identify	VERB
ct-12705	80	19	(	(	PUNCT
ct-12705	80	20	supplemental	supplemental	ADJ
ct-12705	80	21	table	table	NOUN
ct-12705	80	22	and	and	CCONJ
ct-12705	80	23	figure	figure	NOUN
ct-12705	80	24	2	2	NUM
ct-12705	80	25	)	)	PUNCT
ct-12705	80	26	.	.	PUNCT
ct-12705	81	1	however	however	ADV
ct-12705	81	2	,	,	PUNCT
ct-12705	81	3	not	not	PART
ct-12705	81	4	all	all	DET
ct-12705	81	5	genes	gene	NOUN
ct-12705	81	6	were	be	AUX
ct-12705	81	7	equally	equally	ADV
ct-12705	81	8	expressed	express	VERB
ct-12705	81	9	.	.	PUNCT
ct-12705	82	1	the	the	DET
ct-12705	82	2	testicular	testicular	ADJ
ct-12705	82	3	expression	expression	NOUN
ct-12705	82	4	of	of	ADP
ct-12705	82	5	tlr3	tlr3	PROPN
ct-12705	82	6	(	(	PUNCT
ct-12705	82	7	fpkm	fpkm	PROPN
ct-12705	82	8	1.57	1.57	NUM
ct-12705	82	9	±	±	NUM
ct-12705	82	10	0.4	0.4	NUM
ct-12705	82	11	)	)	PUNCT
ct-12705	82	12	was	be	AUX
ct-12705	82	13	higher	high	ADJ
ct-12705	82	14	(	(	PUNCT
ct-12705	82	15	p	p	X
ct-12705	82	16	=	=	NOUN
ct-12705	82	17	0.002	0.002	NUM
ct-12705	82	18	)	)	PUNCT
ct-12705	82	19	than	than	ADP
ct-12705	82	20	all	all	DET
ct-12705	82	21	other	other	ADJ
ct-12705	82	22	tlrs	tlrs	NOUN
ct-12705	82	23	,	,	PUNCT
ct-12705	82	24	followed	follow	VERB
ct-12705	82	25	by	by	ADP
ct-12705	82	26	tlr2	tlr2	PROPN
ct-12705	82	27	(	(	PUNCT
ct-12705	82	28	0.57	0.57	NUM
ct-12705	82	29	±	±	NUM
ct-12705	82	30	0.1	0.1	NUM
ct-12705	82	31	)	)	PUNCT
ct-12705	82	32	,	,	PUNCT
ct-12705	82	33	tlr6	tlr6	PROPN
ct-12705	82	34	(	(	PUNCT
ct-12705	82	35	0.28	0.28	NUM
ct-12705	82	36	±	±	NUM
ct-12705	82	37	0.05	0.05	NUM
ct-12705	82	38	)	)	PUNCT
ct-12705	82	39	,	,	PUNCT
ct-12705	82	40	and	and	CCONJ
ct-12705	82	41	tlr1	tlr1	PROPN
ct-12705	82	42	(	(	PUNCT
ct-12705	82	43	0.24	0.24	NUM
ct-12705	82	44	±	±	NUM
ct-12705	82	45	0.05	0.05	NUM
ct-12705	82	46	)	)	PUNCT
ct-12705	82	47	.	.	PUNCT
ct-12705	83	1	the	the	DET
ct-12705	83	2	transcription	transcription	NOUN
ct-12705	83	3	of	of	ADP
ct-12705	83	4	tlr4	tlr4	NOUN
ct-12705	83	5	(	(	PUNCT
ct-12705	83	6	0.01	0.01	NUM
ct-12705	83	7	±	±	NOUN
ct-12705	83	8	0.01	0.01	NUM
ct-12705	83	9	)	)	PUNCT
ct-12705	83	10	and	and	CCONJ
ct-12705	83	11	10	10	NUM
ct-12705	83	12	(	(	PUNCT
ct-12705	83	13	0.03	0.03	NUM
ct-12705	83	14	±	±	NUM
ct-12705	83	15	0.01	0.01	NUM
ct-12705	83	16	)	)	PUNCT
ct-12705	83	17	was	be	AUX
ct-12705	83	18	minimal	minimal	ADJ
ct-12705	83	19	(	(	PUNCT
ct-12705	83	20	figure	figure	NOUN
ct-12705	83	21	2	2	NUM
ct-12705	83	22	)	)	PUNCT
ct-12705	83	23	.	.	PUNCT
ct-12705	84	1	furthermore	furthermore	ADV
ct-12705	84	2	,	,	PUNCT
ct-12705	84	3	there	there	PRON
ct-12705	84	4	was	be	VERB
ct-12705	84	5	an	an	DET
ct-12705	84	6	active	active	ADJ
ct-12705	84	7	expression	expression	NOUN
ct-12705	84	8	of	of	ADP
ct-12705	84	9	most	most	ADJ
ct-12705	84	10	adaptor	adaptor	NOUN
ct-12705	84	11	protein	protein	NOUN
ct-12705	84	12	genes	gene	NOUN
ct-12705	84	13	and	and	CCONJ
ct-12705	84	14	downstream	downstream	ADJ
ct-12705	84	15	mediators	mediator	NOUN
ct-12705	84	16	from	from	ADP
ct-12705	84	17	all	all	DET
ct-12705	84	18	signaling	signal	VERB
ct-12705	84	19	pathways	pathway	NOUN
ct-12705	84	20	,	,	PUNCT
ct-12705	84	21	except	except	SCONJ
ct-12705	84	22	for	for	ADP
ct-12705	84	23	phosphoinositide	phosphoinositide	NOUN
ct-12705	84	24	3	3	NUM
ct-12705	84	25	-	-	PUNCT
ct-12705	84	26	kinase	kinase	ADJ
ct-12705	84	27	regulatory	regulatory	ADJ
ct-12705	84	28	subunit	subunit	NOUN
ct-12705	84	29	5	5	NUM
ct-12705	84	30	(	(	PUNCT
ct-12705	84	31	pik3r5	pik3r5	NOUN
ct-12705	84	32	)	)	PUNCT
ct-12705	84	33	.	.	PUNCT
ct-12705	85	1	genes	gene	NOUN
ct-12705	85	2	for	for	ADP
ct-12705	85	3	most	most	ADJ
ct-12705	85	4	of	of	ADP
ct-12705	85	5	the	the	DET
ct-12705	85	6	resulting	result	VERB
ct-12705	85	7	cytokines	cytokine	NOUN
ct-12705	85	8	and	and	CCONJ
ct-12705	85	9	effector	effector	NOUN
ct-12705	85	10	proteins	protein	NOUN
ct-12705	85	11	were	be	AUX
ct-12705	85	12	also	also	ADV
ct-12705	85	13	expressed	express	VERB
ct-12705	85	14	in	in	ADP
ct-12705	85	15	the	the	DET
ct-12705	85	16	testis	testis	NOUN
ct-12705	85	17	,	,	PUNCT
ct-12705	85	18	except	except	SCONJ
ct-12705	85	19	for	for	ADP
ct-12705	85	20	interleukin	interleukin	NOUN
ct-12705	85	21	8	8	NUM
ct-12705	85	22	(	(	PUNCT
ct-12705	85	23	il8	il8	PROPN
ct-12705	85	24	)	)	PUNCT
ct-12705	85	25	,	,	PUNCT
ct-12705	85	26	interferon	interferon	ADJ
ct-12705	85	27	alpha	alpha	NOUN
ct-12705	85	28	2	2	NUM
ct-12705	85	29	  	  	SPACE
ct-12705	85	30	(	(	PUNCT
ct-12705	85	31	ifna2	ifna2	NOUN
ct-12705	85	32	)	)	PUNCT
ct-12705	85	33	,	,	PUNCT
ct-12705	85	34	interferon	interferon	ADJ
ct-12705	85	35	beta	beta	NOUN
ct-12705	85	36	1	1	NUM
ct-12705	85	37	(	(	PUNCT
ct-12705	85	38	ifnb1	ifnb1	NOUN
ct-12705	85	39	)	)	PUNCT
ct-12705	85	40	,	,	PUNCT
ct-12705	85	41	and	and	CCONJ
ct-12705	85	42	c	c	X
ct-12705	85	43	-	-	PUNCT
ct-12705	85	44	x	x	NOUN
ct-12705	85	45	-	-	NOUN
ct-12705	85	46	c	c	ADJ
ct-12705	85	47	motif	motif	NOUN
ct-12705	85	48	ligand	ligand	NOUN
ct-12705	85	49	  	  	SPACE
ct-12705	85	50	9	9	NUM
ct-12705	85	51	  	  	SPACE
ct-12705	85	52	(	(	PUNCT
ct-12705	85	53	cxcl9	cxcl9	PROPN
ct-12705	85	54	)	)	PUNCT
ct-12705	85	55	(	(	PUNCT
ct-12705	85	56	figure	figure	NOUN
ct-12705	85	57	1	1	NUM
ct-12705	85	58	and	and	CCONJ
ct-12705	85	59	supplemental	supplemental	ADJ
ct-12705	85	60	table	table	NOUN
ct-12705	85	61	)	)	PUNCT
ct-12705	85	62	.	.	PUNCT
ct-12705	86	1	the	the	DET
ct-12705	86	2	most	most	ADV
ct-12705	86	3	significantly	significantly	ADV
ct-12705	86	4	expressed	express	VERB
ct-12705	86	5	effector	effector	NOUN
ct-12705	86	6	chemokine	chemokine	ADJ
ct-12705	86	7	was	be	AUX
ct-12705	86	8	ccl5	ccl5	PROPN
ct-12705	86	9	(	(	PUNCT
ct-12705	86	10	supplemental	supplemental	ADJ
ct-12705	86	11	table	table	NOUN
ct-12705	86	12	)	)	PUNCT
ct-12705	86	13	.	.	PUNCT
ct-12705	87	1	level	level	NOUN
ct-12705	87	2	of	of	ADP
ct-12705	87	3	expression	expression	NOUN
ct-12705	87	4	of	of	ADP
ct-12705	87	5	most	most	ADJ
ct-12705	87	6	genes	gene	NOUN
ct-12705	87	7	differed	differ	VERB
ct-12705	87	8	(	(	PUNCT
ct-12705	87	9	p	p	X
ct-12705	87	10	<	<	X
ct-12705	87	11	0.05	0.05	NUM
ct-12705	87	12	;	;	PUNCT
ct-12705	87	13	supplemental	supplemental	ADJ
ct-12705	87	14	table	table	NOUN
ct-12705	87	15	)	)	PUNCT
ct-12705	87	16	.	.	PUNCT
ct-12705	88	1	expression	expression	NOUN
ct-12705	88	2	of	of	ADP
ct-12705	88	3	tlr1	tlr1	PROPN
ct-12705	88	4	,	,	PUNCT
ct-12705	88	5	tlr2	tlr2	PROPN
ct-12705	88	6	,	,	PUNCT
ct-12705	88	7	tlr3	tlr3	NOUN
ct-12705	88	8	,	,	PUNCT
ct-12705	88	9	and	and	CCONJ
ct-12705	88	10	tlr5	tlr5	NOUN
ct-12705	88	11	-	-	PUNCT
ct-12705	88	12	9	9	NUM
ct-12705	88	13	was	be	AUX
ct-12705	88	14	downregulated	downregulate	VERB
ct-12705	88	15	in	in	ADP
ct-12705	88	16	the	the	DET
ct-12705	88	17	testes	testis	NOUN
ct-12705	88	18	compared	compare	VERB
ct-12705	88	19	to	to	ADP
ct-12705	88	20	epididymis	epididymis	NOUN
ct-12705	88	21	(	(	PUNCT
ct-12705	88	22	figure	figure	NOUN
ct-12705	88	23	2	2	NUM
ct-12705	88	24	)	)	PUNCT
ct-12705	88	25	.	.	PUNCT
ct-12705	89	1	expression	expression	NOUN
ct-12705	89	2	of	of	ADP
ct-12705	89	3	tlr4	tlr4	NOUN
ct-12705	89	4	and	and	CCONJ
ct-12705	89	5	tlr10	tlr10	PROPN
ct-12705	89	6	-	-	PUNCT
ct-12705	89	7	12	12	NUM
ct-12705	89	8	did	do	AUX
ct-12705	89	9	not	not	PART
ct-12705	89	10	differ	differ	VERB
ct-12705	89	11	among	among	ADP
ct-12705	89	12	tissues	tissue	NOUN
ct-12705	89	13	.	.	PUNCT
ct-12705	90	1	expression	expression	NOUN
ct-12705	90	2	of	of	ADP
ct-12705	90	3	most	most	ADJ
ct-12705	90	4	genes	gene	NOUN
ct-12705	90	5	was	be	AUX
ct-12705	90	6	upregulated	upregulate	VERB
ct-12705	90	7	in	in	ADP
ct-12705	90	8	several	several	ADJ
ct-12705	90	9	segments	segment	NOUN
ct-12705	90	10	of	of	ADP
ct-12705	90	11	the	the	DET
ct-12705	90	12	epididymis	epididymis	NOUN
ct-12705	90	13	compared	compare	VERB
ct-12705	90	14	to	to	ADP
ct-12705	90	15	testis	testis	PRON
ct-12705	90	16	.	.	PUNCT
ct-12705	91	1	the	the	DET
ct-12705	91	2	exception	exception	NOUN
ct-12705	91	3	was	be	AUX
ct-12705	91	4	some	some	DET
ct-12705	91	5	proteins	protein	NOUN
ct-12705	91	6	of	of	ADP
ct-12705	91	7	the	the	DET
ct-12705	91	8	pik3	pik3	PROPN
ct-12705	91	9	-	-	PUNCT
ct-12705	91	10	akt	akt	PROPN
ct-12705	91	11	and	and	CCONJ
ct-12705	91	12	myd88dependent	myd88dependent	NOUN
ct-12705	91	13	signaling	signal	VERB
ct-12705	91	14	pathways	pathway	NOUN
ct-12705	91	15	that	that	PRON
ct-12705	91	16	were	be	AUX
ct-12705	91	17	downregulated	downregulate	VERB
ct-12705	91	18	in	in	ADP
ct-12705	91	19	the	the	DET
ct-12705	91	20	epididymis	epididymis	NOUN
ct-12705	91	21	(	(	PUNCT
ct-12705	91	22	supplemental	supplemental	ADJ
ct-12705	91	23	table	table	NOUN
ct-12705	91	24	)	)	PUNCT
ct-12705	91	25	.	.	PUNCT
ct-12705	92	1	similar	similar	ADJ
ct-12705	92	2	to	to	ADP
ct-12705	92	3	testes	testis	NOUN
ct-12705	92	4	,	,	PUNCT
ct-12705	92	5	epididymal	epididymal	ADJ
ct-12705	92	6	expression	expression	NOUN
ct-12705	92	7	of	of	ADP
ct-12705	92	8	tlr3	tlr3	NOUN
ct-12705	92	9	was	be	AUX
ct-12705	92	10	higher	high	ADJ
ct-12705	92	11	than	than	ADP
ct-12705	92	12	all	all	DET
ct-12705	92	13	other	other	ADJ
ct-12705	92	14	tlrs	tlrs	NOUN
ct-12705	92	15	.	.	PUNCT
ct-12705	93	1	the	the	DET
ct-12705	93	2	tlr1	tlr1	PROPN
ct-12705	93	3	,	,	PUNCT
ct-12705	93	4	tlr2	tlr2	PROPN
ct-12705	93	5	,	,	PUNCT
ct-12705	93	6	tlr5	tlr5	PROPN
ct-12705	93	7	,	,	PUNCT
ct-12705	93	8	tlr6	tlr6	PROPN
ct-12705	93	9	,	,	PUNCT
ct-12705	93	10	tlr7	tlr7	NOUN
ct-12705	93	11	and	and	CCONJ
ct-12705	93	12	tlr10	tlr10	PROPN
ct-12705	93	13	were	be	AUX
ct-12705	93	14	abundantly	abundantly	ADV
ct-12705	93	15	expressed	express	VERB
ct-12705	93	16	(	(	PUNCT
ct-12705	93	17	fpkm	fpkm	X
ct-12705	93	18	>	>	X
ct-12705	93	19	1	1	NUM
ct-12705	93	20	)	)	PUNCT
ct-12705	93	21	in	in	ADP
ct-12705	93	22	at	at	ADV
ct-12705	93	23	least	least	ADV
ct-12705	93	24	1	1	NUM
ct-12705	93	25	segment	segment	NOUN
ct-12705	93	26	of	of	ADP
ct-12705	93	27	the	the	DET
ct-12705	93	28	epididymis	epididymis	NOUN
ct-12705	93	29	,	,	PUNCT
ct-12705	93	30	whereas	whereas	SCONJ
ct-12705	93	31	tlr4	tlr4	NOUN
ct-12705	93	32	and	and	CCONJ
ct-12705	93	33	tlr11	tlr11	PROPN
ct-12705	93	34	had	have	VERB
ct-12705	93	35	a	a	DET
ct-12705	93	36	minimal	minimal	ADJ
ct-12705	93	37	level	level	NOUN
ct-12705	93	38	of	of	ADP
ct-12705	93	39	expression	expression	NOUN
ct-12705	93	40	(	(	PUNCT
ct-12705	93	41	fpkm	fpkm	NOUN
ct-12705	93	42	<	<	X
ct-12705	93	43	0.1	0.1	NUM
ct-12705	93	44	)	)	PUNCT
ct-12705	93	45	.	.	PUNCT
ct-12705	94	1	there	there	PRON
ct-12705	94	2	was	be	VERB
ct-12705	94	3	also	also	ADV
ct-12705	94	4	active	active	ADJ
ct-12705	94	5	expression	expression	NOUN
ct-12705	94	6	of	of	ADP
ct-12705	94	7	most	most	ADJ
ct-12705	94	8	adaptor	adaptor	NOUN
ct-12705	94	9	proteins	protein	NOUN
ct-12705	94	10	and	and	CCONJ
ct-12705	94	11	downstream	downstream	ADJ
ct-12705	94	12	mediators	mediator	NOUN
ct-12705	94	13	from	from	ADP
ct-12705	94	14	all	all	DET
ct-12705	94	15	signaling	signal	VERB
ct-12705	94	16	figure	figure	NOUN
ct-12705	94	17	2	2	NUM
ct-12705	94	18	.	.	PUNCT
ct-12705	94	19	differential	differential	ADJ
ct-12705	94	20	expression	expression	NOUN
ct-12705	94	21	of	of	ADP
ct-12705	94	22	equine	equine	NOUN
ct-12705	94	23	toll	toll	NOUN
ct-12705	94	24	-	-	PUNCT
ct-12705	94	25	like	like	ADJ
ct-12705	94	26	receptors	receptor	NOUN
ct-12705	94	27	in	in	ADP
ct-12705	94	28	the	the	DET
ct-12705	94	29	testis	testis	NOUN
ct-12705	94	30	,	,	PUNCT
ct-12705	94	31	epididymal	epididymal	ADJ
ct-12705	94	32	head	head	NOUN
ct-12705	94	33	(	(	PUNCT
ct-12705	94	34	ephead	ephead	ADJ
ct-12705	94	35	)	)	PUNCT
ct-12705	94	36	,	,	PUNCT
ct-12705	94	37	body	body	NOUN
ct-12705	94	38	(	(	PUNCT
ct-12705	94	39	epbody	epbody	NOUN
ct-12705	94	40	)	)	PUNCT
ct-12705	94	41	,	,	PUNCT
ct-12705	94	42	and	and	CCONJ
ct-12705	94	43	tail	tail	NOUN
ct-12705	94	44	(	(	PUNCT
ct-12705	94	45	eptail	eptail	NOUN
ct-12705	94	46	)	)	PUNCT
ct-12705	94	47	.	.	PUNCT
ct-12705	95	1	fpkm	fpkm	PROPN
ct-12705	96	1	=	=	PUNCT
ct-12705	96	2	fragments	fragment	NOUN
ct-12705	96	3	per	per	ADP
ct-12705	96	4	kilobase	kilobase	NOUN
ct-12705	96	5	of	of	ADP
ct-12705	96	6	transcript	transcript	NOUN
ct-12705	96	7	sequence	sequence	NOUN
ct-12705	96	8	per	per	ADP
ct-12705	96	9	millions	million	NOUN
ct-12705	96	10	base	base	NOUN
ct-12705	96	11	pairs	pair	NOUN
ct-12705	96	12	sequenced	sequence	VERB
ct-12705	96	13	;	;	PUNCT
ct-12705	96	14	a	a	DET
ct-12705	96	15	-	-	PUNCT
ct-12705	96	16	cwithin	cwithin	NOUN
ct-12705	96	17	a	a	DET
ct-12705	96	18	tissue	tissue	NOUN
ct-12705	96	19	,	,	PUNCT
ct-12705	96	20	means	mean	VERB
ct-12705	96	21	without	without	ADP
ct-12705	96	22	a	a	DET
ct-12705	96	23	common	common	ADJ
ct-12705	96	24	superscript	superscript	NOUN
ct-12705	96	25	differed	differ	VERB
ct-12705	96	26	(	(	PUNCT
ct-12705	96	27	p	p	X
ct-12705	96	28	<	<	X
ct-12705	96	29	0.05	0.05	NUM
ct-12705	96	30	)	)	PUNCT
ct-12705	96	31	table	table	NOUN
ct-12705	96	32	.	.	PUNCT
ct-12705	97	1	forward	forward	ADV
ct-12705	97	2	and	and	CCONJ
ct-12705	97	3	reverse	reverse	VERB
ct-12705	97	4	primer	primer	NOUN
ct-12705	97	5	sequences	sequence	NOUN
ct-12705	97	6	for	for	ADP
ct-12705	97	7	tlr	tlr	PROPN
ct-12705	97	8	1	1	NUM
ct-12705	97	9	-	-	SYM
ct-12705	97	10	8	8	NUM
ct-12705	97	11	genes	gene	NOUN
ct-12705	97	12	for	for	ADP
ct-12705	97	13	rt	rt	ADJ
ct-12705	97	14	-	-	PUNCT
ct-12705	97	15	pcr	pcr	ADJ
ct-12705	97	16	gene	gene	NOUN
ct-12705	97	17	name	name	NOUN
ct-12705	97	18	gene	gene	NOUN
ct-12705	97	19	symbol	symbol	NOUN
ct-12705	97	20	accession	accession	NOUN
ct-12705	97	21	no	no	INTJ
ct-12705	97	22	.	.	PUNCT
ct-12705	98	1	forward	forward	ADV
ct-12705	98	2	reverse	reverse	ADJ
ct-12705	98	3	product	product	NOUN
ct-12705	98	4	size	size	NOUN
ct-12705	98	5	(	(	PUNCT
ct-12705	98	6	bp	bp	PROPN
ct-12705	98	7	)	)	PUNCT
ct-12705	98	8	toll	toll	NOUN
ct-12705	98	9	-	-	PUNCT
ct-12705	98	10	like	like	ADJ
ct-12705	98	11	receptor	receptor	NOUN
ct-12705	98	12	1	1	NUM
ct-12705	98	13	tlr1	tlr1	PROPN
ct-12705	98	14	nm_001256899.1	nm_001256899.1	PROPN
ct-12705	98	15	gcccatatgcaaagagtttggc	gcccatatgcaaagagtttggc	VERB
ct-12705	98	16	tctgtgttaaggtgtcgaaggc	tctgtgttaaggtgtcgaaggc	NOUN
ct-12705	98	17	183	183	NUM
ct-12705	98	18	toll	toll	NOUN
ct-12705	98	19	-	-	PUNCT
ct-12705	98	20	like	like	ADJ
ct-12705	98	21	receptor	receptor	NOUN
ct-12705	98	22	2	2	NUM
ct-12705	98	23	tlr2	tlr2	NOUN
ct-12705	98	24	nm_001081796.1	nm_001081796.1	NOUN
ct-12705	98	25	catgctttgtggacggtgtg	catgctttgtggacggtgtg	PROPN
ct-12705	98	26	aagacttttcacagctgccg	aagacttttcacagctgccg	PROPN
ct-12705	98	27	168	168	NUM
ct-12705	98	28	toll	toll	NOUN
ct-12705	98	29	-	-	PUNCT
ct-12705	98	30	like	like	ADJ
ct-12705	98	31	receptor	receptor	NOUN
ct-12705	98	32	3	3	NUM
ct-12705	98	33	tlr3	tlr3	NOUN
ct-12705	98	34	nm_001081798.1	nm_001081798.1	VERB
ct-12705	98	35	gagactgttgcccttttggg	gagactgttgcccttttggg	NOUN
ct-12705	98	36	ccgttatgtttgctgggagg	ccgttatgtttgctgggagg	PROPN
ct-12705	98	37	125	125	NUM
ct-12705	98	38	toll	toll	NOUN
ct-12705	98	39	-	-	PUNCT
ct-12705	98	40	like	like	ADJ
ct-12705	98	41	receptor	receptor	NOUN
ct-12705	98	42	4	4	NUM
ct-12705	98	43	tlr4	tlr4	NOUN
ct-12705	98	44	nm_001099769.2	nm_001099769.2	NOUN
ct-12705	98	45	acatccccacatcaaccaagg	acatccccacatcaaccaagg	NOUN
ct-12705	98	46	atggttgaggccctgatatgc	atggttgaggccctgatatgc	VERB
ct-12705	98	47	158	158	NUM
ct-12705	98	48	toll	toll	NOUN
ct-12705	98	49	-	-	PUNCT
ct-12705	98	50	like	like	ADJ
ct-12705	98	51	receptor	receptor	NOUN
ct-12705	98	52	5	5	NUM
ct-12705	98	53	tlr5	tlr5	PROPN
ct-12705	98	54	kwon	kwon	PROPN
ct-12705	98	55	,	,	PUNCT
ct-12705	98	56	et	et	PROPN
ct-12705	98	57	al	al	PROPN
ct-12705	98	58	.	.	PROPN
ct-12705	99	1	2011	2011	NUM
ct-12705	99	2	tccatggagggttgtgatga	tccatggagggttgtgatga	NOUN
ct-12705	99	3	ccccggaactttgtgacaat	ccccggaactttgtgacaat	NOUN
ct-12705	99	4	–	–	PUNCT
ct-12705	99	5	toll	toll	NOUN
ct-12705	99	6	-	-	PUNCT
ct-12705	99	7	like	like	ADJ
ct-12705	99	8	receptor	receptor	NOUN
ct-12705	99	9	6	6	NUM
ct-12705	99	10	tlr6	tlr6	PROPN
ct-12705	99	11	nm_001257142.1	nm_001257142.1	NOUN
ct-12705	99	12	gacttgccaccagaaaccaag	gacttgccaccagaaaccaag	VERB
ct-12705	99	13	aggtaccggatgctattacgg	aggtaccggatgctattacgg	NOUN
ct-12705	99	14	128	128	NUM
ct-12705	99	15	toll	toll	NOUN
ct-12705	99	16	-	-	PUNCT
ct-12705	99	17	like	like	ADJ
ct-12705	99	18	receptor	receptor	NOUN
ct-12705	99	19	7	7	NUM
ct-12705	99	20	tlr7	tlr7	NOUN
ct-12705	99	21	nm_001081771.2	nm_001081771.2	NOUN
ct-12705	99	22	acttctgtagcaggtcacgg	acttctgtagcaggtcacgg	NOUN
ct-12705	99	23	acttaggtccaaggtctgcc	acttaggtccaaggtctgcc	NOUN
ct-12705	99	24	159	159	NUM
ct-12705	99	25	toll	toll	NOUN
ct-12705	99	26	-	-	PUNCT
ct-12705	99	27	like	like	ADJ
ct-12705	99	28	receptor	receptor	NOUN
ct-12705	99	29	8	8	NUM
ct-12705	99	30	tlr8	tlr8	NOUN
ct-12705	99	31	nm_001111301.1	nm_001111301.1	NOUN
ct-12705	99	32	gccgttttggaacttggtgg	gccgttttggaacttggtgg	NOUN
ct-12705	99	33	ggcatctgaaacacacgtcg	ggcatctgaaacacacgtcg	VERB
ct-12705	99	34	186	186	NUM
ct-12705	99	35	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	ADJ
ct-12705	99	36	citation	citation	NOUN
ct-12705	99	37	:	:	PUNCT
ct-12705	99	38	clinical	clinical	ADJ
ct-12705	99	39	theriogenology	theriogenology	NOUN
ct-12705	99	40	2025	2025	NUM
ct-12705	99	41	,	,	PUNCT
ct-12705	99	42	17	17	NUM
ct-12705	99	43	,	,	PUNCT
ct-12705	99	44	12705	12705	NUM
ct-12705	99	45	,	,	PUNCT
ct-12705	99	46	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	99	47	5	5	NUM
ct-12705	99	48	figure	figure	NOUN
ct-12705	99	49	3	3	NUM
ct-12705	99	50	.	.	PUNCT
ct-12705	99	51	rt	rt	ADJ
ct-12705	99	52	-	-	PUNCT
ct-12705	99	53	pcr	pcr	ADJ
ct-12705	99	54	amplification	amplification	NOUN
ct-12705	99	55	curves	curve	NOUN
ct-12705	99	56	of	of	ADP
ct-12705	99	57	toll	toll	NOUN
ct-12705	99	58	-	-	PUNCT
ct-12705	99	59	like	like	ADJ
ct-12705	99	60	receptor	receptor	NOUN
ct-12705	99	61	(	(	PUNCT
ct-12705	99	62	tlr	tlr	PROPN
ct-12705	99	63	)	)	PUNCT
ct-12705	99	64	genes	gene	NOUN
ct-12705	99	65	tlr1	tlr1	NOUN
ct-12705	99	66	(	(	PUNCT
ct-12705	99	67	a	a	NOUN
ct-12705	99	68	)	)	PUNCT
ct-12705	99	69	,	,	PUNCT
ct-12705	99	70	tlr2	tlr2	PROPN
ct-12705	99	71	(	(	PUNCT
ct-12705	99	72	b	b	NOUN
ct-12705	99	73	)	)	PUNCT
ct-12705	99	74	,	,	PUNCT
ct-12705	99	75	tlr3	tlr3	PROPN
ct-12705	99	76	(	(	PUNCT
ct-12705	99	77	c	c	NOUN
ct-12705	99	78	)	)	PUNCT
ct-12705	99	79	,	,	PUNCT
ct-12705	99	80	tlr4	tlr4	NOUN
ct-12705	99	81	(	(	PUNCT
ct-12705	99	82	d	d	NOUN
ct-12705	99	83	)	)	PUNCT
ct-12705	99	84	,	,	PUNCT
ct-12705	99	85	tlr5	tlr5	PROPN
ct-12705	99	86	(	(	PUNCT
ct-12705	99	87	e	e	NOUN
ct-12705	99	88	)	)	PUNCT
ct-12705	99	89	,	,	PUNCT
ct-12705	99	90	tlr6	tlr6	PROPN
ct-12705	99	91	(	(	PUNCT
ct-12705	99	92	f	f	X
ct-12705	99	93	)	)	PUNCT
ct-12705	99	94	,	,	PUNCT
ct-12705	99	95	tlr7	tlr7	NOUN
ct-12705	99	96	(	(	PUNCT
ct-12705	99	97	g	g	NOUN
ct-12705	99	98	)	)	PUNCT
ct-12705	99	99	,	,	PUNCT
ct-12705	99	100	and	and	CCONJ
ct-12705	99	101	tlr8	tlr8	NOUN
ct-12705	99	102	(	(	PUNCT
ct-12705	99	103	h	h	NOUN
ct-12705	99	104	)	)	PUNCT
ct-12705	99	105	and	and	CCONJ
ct-12705	99	106	cq	cq	NOUN
ct-12705	99	107	values	value	NOUN
ct-12705	99	108	of	of	ADP
ct-12705	99	109	individual	individual	ADJ
ct-12705	99	110	samples	sample	NOUN
ct-12705	99	111	(	(	PUNCT
ct-12705	99	112	i	i	NOUN
ct-12705	99	113	)	)	PUNCT
ct-12705	99	114	.	.	PUNCT
ct-12705	100	1	a	a	DET
ct-12705	100	2	=	=	PUNCT
ct-12705	100	3	nontemplate	nontemplate	NOUN
ct-12705	100	4	negative	negative	ADJ
ct-12705	100	5	control	control	NOUN
ct-12705	100	6	,	,	PUNCT
ct-12705	100	7	b	b	NOUN
ct-12705	100	8	=	=	SYM
ct-12705	100	9	positive	positive	ADJ
ct-12705	100	10	control	control	NOUN
ct-12705	100	11	(	(	PUNCT
ct-12705	100	12	lymph	lymph	NOUN
ct-12705	100	13	node	node	ADJ
ct-12705	100	14	tissue	tissue	NOUN
ct-12705	100	15	)	)	PUNCT
ct-12705	100	16	,	,	PUNCT
ct-12705	100	17	c	c	NOUN
ct-12705	100	18	=	=	SYM
ct-12705	100	19	testicular	testicular	ADJ
ct-12705	100	20	tissue	tissue	NOUN
ct-12705	100	21	samples	sample	NOUN
ct-12705	100	22	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	VERB
ct-12705	100	23	6	6	NUM
ct-12705	100	24	citation	citation	NOUN
ct-12705	100	25	:	:	PUNCT
ct-12705	100	26	clinical	clinical	ADJ
ct-12705	100	27	theriogenology	theriogenology	NOUN
ct-12705	100	28	2025	2025	NUM
ct-12705	100	29	,	,	PUNCT
ct-12705	100	30	17	17	NUM
ct-12705	100	31	,	,	PUNCT
ct-12705	100	32	12705	12705	NUM
ct-12705	100	33	,	,	PUNCT
ct-12705	100	34	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	100	35	pathways	pathway	NOUN
ct-12705	100	36	,	,	PUNCT
ct-12705	100	37	except	except	SCONJ
ct-12705	100	38	for	for	ADP
ct-12705	100	39	pik3r5	pik3r5	NOUN
ct-12705	100	40	.	.	PUNCT
ct-12705	101	1	the	the	DET
ct-12705	101	2	resulting	result	VERB
ct-12705	101	3	cytokines	cytokine	NOUN
ct-12705	101	4	involved	involve	VERB
ct-12705	101	5	in	in	ADP
ct-12705	101	6	inflammation	inflammation	NOUN
ct-12705	101	7	,	,	PUNCT
ct-12705	101	8	chemotaxis	chemotaxis	ADJ
ct-12705	101	9	,	,	PUNCT
ct-12705	101	10	and	and	CCONJ
ct-12705	101	11	stimulation	stimulation	NOUN
ct-12705	101	12	of	of	ADP
ct-12705	101	13	the	the	DET
ct-12705	101	14	immune	immune	ADJ
ct-12705	101	15	system	system	NOUN
ct-12705	101	16	were	be	AUX
ct-12705	101	17	upregulated	upregulate	VERB
ct-12705	101	18	in	in	ADP
ct-12705	101	19	the	the	DET
ct-12705	101	20	epididymis	epididymis	NOUN
ct-12705	101	21	,	,	PUNCT
ct-12705	101	22	except	except	SCONJ
ct-12705	101	23	for	for	ADP
ct-12705	101	24	il8	il8	PROPN
ct-12705	101	25	,	,	PUNCT
ct-12705	101	26	ifna1	ifna1	PROPN
ct-12705	101	27	,	,	PUNCT
ct-12705	101	28	ifna2	ifna2	NOUN
ct-12705	101	29	,	,	PUNCT
ct-12705	101	30	ifnb1	ifnb1	NOUN
ct-12705	101	31	,	,	PUNCT
ct-12705	101	32	and	and	CCONJ
ct-12705	101	33	cxcl9	cxcl9	NOUN
ct-12705	101	34	that	that	PRON
ct-12705	101	35	were	be	AUX
ct-12705	101	36	not	not	PART
ct-12705	101	37	detected	detect	VERB
ct-12705	101	38	.	.	PUNCT
ct-12705	102	1	the	the	DET
ct-12705	102	2	most	most	ADV
ct-12705	102	3	significantly	significantly	ADV
ct-12705	102	4	expressed	express	VERB
ct-12705	102	5	effector	effector	NOUN
ct-12705	102	6	chemokine	chemokine	ADJ
ct-12705	102	7	was	be	AUX
ct-12705	102	8	ccl5	ccl5	PROPN
ct-12705	102	9	(	(	PUNCT
ct-12705	102	10	supplement	supplement	NOUN
ct-12705	102	11	table	table	NOUN
ct-12705	102	12	)	)	PUNCT
ct-12705	102	13	.	.	PUNCT
ct-12705	103	1	constitutive	constitutive	ADJ
ct-12705	103	2	testicular	testicular	ADJ
ct-12705	103	3	expression	expression	NOUN
ct-12705	103	4	of	of	ADP
ct-12705	103	5	tlrs	tlrs	ADJ
ct-12705	103	6	1	1	NUM
ct-12705	103	7	-	-	SYM
ct-12705	103	8	8	8	NUM
ct-12705	103	9	was	be	AUX
ct-12705	103	10	confirmed	confirm	VERB
ct-12705	103	11	using	use	VERB
ct-12705	103	12	rt	rt	PROPN
ct-12705	103	13	-	-	PUNCT
ct-12705	103	14	pcr	pcr	NOUN
ct-12705	103	15	(	(	PUNCT
ct-12705	103	16	figure	figure	NOUN
ct-12705	103	17	3	3	NUM
ct-12705	103	18	)	)	PUNCT
ct-12705	103	19	.	.	PUNCT
ct-12705	104	1	discussion	discussion	NOUN
ct-12705	104	2	to	to	ADP
ct-12705	104	3	our	our	PRON
ct-12705	104	4	knowledge	knowledge	NOUN
ct-12705	104	5	,	,	PUNCT
ct-12705	104	6	this	this	PRON
ct-12705	104	7	is	be	AUX
ct-12705	104	8	the	the	DET
ct-12705	104	9	first	first	ADJ
ct-12705	104	10	description	description	NOUN
ct-12705	104	11	of	of	ADP
ct-12705	104	12	constitutive	constitutive	ADJ
ct-12705	104	13	expression	expression	NOUN
ct-12705	104	14	of	of	ADP
ct-12705	104	15	tlr	tlr	PROPN
ct-12705	104	16	genes	gene	NOUN
ct-12705	104	17	and	and	CCONJ
ct-12705	104	18	their	their	PRON
ct-12705	104	19	downstream	downstream	ADJ
ct-12705	104	20	adaptors	adaptor	NOUN
ct-12705	104	21	and	and	CCONJ
ct-12705	104	22	effector	effector	NOUN
ct-12705	104	23	cytokines	cytokine	NOUN
ct-12705	104	24	in	in	ADP
ct-12705	104	25	the	the	DET
ct-12705	104	26	stallion	stallion	NOUN
ct-12705	104	27	’s	’s	PART
ct-12705	104	28	reproductive	reproductive	ADJ
ct-12705	104	29	tract	tract	NOUN
ct-12705	104	30	,	,	PUNCT
ct-12705	104	31	confirming	confirm	VERB
ct-12705	104	32	that	that	SCONJ
ct-12705	104	33	the	the	DET
ct-12705	104	34	equine	equine	NOUN
ct-12705	104	35	testis	testis	NOUN
ct-12705	104	36	and	and	CCONJ
ct-12705	104	37	epididymis	epididymis	NOUN
ct-12705	104	38	are	be	AUX
ct-12705	104	39	fully	fully	ADV
ct-12705	104	40	equipped	equip	VERB
ct-12705	104	41	with	with	ADP
ct-12705	104	42	the	the	DET
ct-12705	104	43	machinery	machinery	NOUN
ct-12705	104	44	needed	need	VERB
ct-12705	104	45	for	for	ADP
ct-12705	104	46	tlr	tlr	PROPN
ct-12705	104	47	stimulation	stimulation	NOUN
ct-12705	104	48	and	and	CCONJ
ct-12705	104	49	function	function	NOUN
ct-12705	104	50	.	.	PUNCT
ct-12705	105	1	limitations	limitation	NOUN
ct-12705	105	2	of	of	ADP
ct-12705	105	3	our	our	PRON
ct-12705	105	4	study	study	NOUN
ct-12705	105	5	are	be	AUX
ct-12705	105	6	:	:	PUNCT
ct-12705	105	7	first	first	ADJ
ct-12705	105	8	,	,	PUNCT
ct-12705	105	9	unavailability	unavailability	NOUN
ct-12705	105	10	of	of	ADP
ct-12705	105	11	stallions	stallion	NOUN
ct-12705	105	12	’	’	PART
ct-12705	105	13	fertility	fertility	NOUN
ct-12705	105	14	history	history	NOUN
ct-12705	105	15	and	and	CCONJ
ct-12705	105	16	second	second	ADJ
ct-12705	105	17	,	,	PUNCT
ct-12705	105	18	histologic	histologic	ADJ
ct-12705	105	19	evaluation	evaluation	NOUN
ct-12705	105	20	of	of	ADP
ct-12705	105	21	the	the	DET
ct-12705	105	22	tissue	tissue	NOUN
ct-12705	105	23	.	.	PUNCT
ct-12705	106	1	however	however	ADV
ct-12705	106	2	,	,	PUNCT
ct-12705	106	3	a	a	DET
ct-12705	106	4	strict	strict	ADJ
ct-12705	106	5	criterion	criterion	NOUN
ct-12705	106	6	was	be	AUX
ct-12705	106	7	used	use	VERB
ct-12705	106	8	to	to	PART
ct-12705	106	9	select	select	VERB
ct-12705	106	10	stallions	stallion	NOUN
ct-12705	106	11	with	with	ADP
ct-12705	106	12	a	a	DET
ct-12705	106	13	high	high	ADJ
ct-12705	106	14	percentage	percentage	NOUN
ct-12705	106	15	of	of	ADP
ct-12705	106	16	morphologically	morphologically	ADV
ct-12705	106	17	normal	normal	ADJ
ct-12705	106	18	sperm	sperm	NOUN
ct-12705	106	19	that	that	PRON
ct-12705	106	20	were	be	AUX
ct-12705	106	21	assumed	assume	VERB
ct-12705	106	22	to	to	PART
ct-12705	106	23	have	have	VERB
ct-12705	106	24	normal	normal	ADJ
ct-12705	106	25	testicular	testicular	NOUN
ct-12705	106	26	and	and	CCONJ
ct-12705	106	27	epididymal	epididymal	ADJ
ct-12705	106	28	function.26–30	function.26–30	NOUN
ct-12705	106	29	in	in	ADP
ct-12705	106	30	this	this	DET
ct-12705	106	31	group	group	NOUN
ct-12705	106	32	of	of	ADP
ct-12705	106	33	stallions	stallion	NOUN
ct-12705	106	34	,	,	PUNCT
ct-12705	106	35	tlr3	tlr3	PROPN
ct-12705	106	36	was	be	AUX
ct-12705	106	37	the	the	DET
ct-12705	106	38	most	most	ADV
ct-12705	106	39	abundant	abundant	ADJ
ct-12705	106	40	transcript	transcript	NOUN
ct-12705	106	41	within	within	ADP
ct-12705	106	42	all	all	DET
ct-12705	106	43	segments	segment	NOUN
ct-12705	106	44	of	of	ADP
ct-12705	106	45	the	the	DET
ct-12705	106	46	stallion	stallion	NOUN
ct-12705	106	47	’s	’s	PART
ct-12705	106	48	genital	genital	ADJ
ct-12705	106	49	tract	tract	NOUN
ct-12705	106	50	evaluated	evaluate	VERB
ct-12705	106	51	.	.	PUNCT
ct-12705	107	1	a	a	DET
ct-12705	107	2	third	third	ADJ
ct-12705	107	3	limitation	limitation	NOUN
ct-12705	107	4	is	be	AUX
ct-12705	107	5	that	that	SCONJ
ct-12705	107	6	we	we	PRON
ct-12705	107	7	did	do	AUX
ct-12705	107	8	not	not	PART
ct-12705	107	9	attempt	attempt	VERB
ct-12705	107	10	to	to	PART
ct-12705	107	11	identify	identify	VERB
ct-12705	107	12	the	the	DET
ct-12705	107	13	cell	cell	NOUN
ct-12705	107	14	types	type	NOUN
ct-12705	107	15	expressing	express	VERB
ct-12705	107	16	each	each	DET
ct-12705	107	17	gene	gene	NOUN
ct-12705	107	18	.	.	PUNCT
ct-12705	108	1	in	in	ADP
ct-12705	108	2	rodents	rodent	NOUN
ct-12705	108	3	,	,	PUNCT
ct-12705	108	4	tlr3	tlr3	PROPN
ct-12705	108	5	was	be	AUX
ct-12705	108	6	abundantly	abundantly	ADV
ct-12705	108	7	expressed	express	VERB
ct-12705	108	8	in	in	ADP
ct-12705	108	9	germ	germ	NOUN
ct-12705	108	10	cells	cell	NOUN
ct-12705	108	11	,	,	PUNCT
ct-12705	108	12	sertoli	sertoli	NOUN
ct-12705	108	13	cells	cell	NOUN
ct-12705	108	14	,	,	PUNCT
ct-12705	108	15	and	and	CCONJ
ct-12705	108	16	peritubular	peritubular	ADJ
ct-12705	108	17	cells.17,33	cells.17,33	NOUN
ct-12705	108	18	toll	toll	NOUN
ct-12705	108	19	-	-	PUNCT
ct-12705	108	20	like	like	ADJ
ct-12705	108	21	receptor	receptor	NOUN
ct-12705	108	22	3	3	NUM
ct-12705	108	23	also	also	ADV
ct-12705	108	24	had	have	VERB
ct-12705	108	25	the	the	DET
ct-12705	108	26	most	most	ADV
ct-12705	108	27	widespread	widespread	ADJ
ct-12705	108	28	and	and	CCONJ
ct-12705	108	29	abundant	abundant	ADJ
ct-12705	108	30	expression	expression	NOUN
ct-12705	108	31	in	in	ADP
ct-12705	108	32	the	the	DET
ct-12705	108	33	rodent	rodent	NOUN
ct-12705	108	34	and	and	CCONJ
ct-12705	108	35	human	human	NOUN
ct-12705	108	36	testis	testis	PROPN
ct-12705	108	37	,	,	PUNCT
ct-12705	108	38	suggesting	suggest	VERB
ct-12705	108	39	an	an	DET
ct-12705	108	40	important	important	ADJ
ct-12705	108	41	role	role	NOUN
ct-12705	108	42	in	in	ADP
ct-12705	108	43	testicular	testicular	ADJ
ct-12705	108	44	function.17,33,34	function.17,33,34	NOUN
ct-12705	108	45	this	this	DET
ct-12705	108	46	cytosolic	cytosolic	ADJ
ct-12705	108	47	receptor	receptor	NOUN
ct-12705	108	48	recognizes	recognize	VERB
ct-12705	108	49	viral	viral	ADJ
ct-12705	108	50	and	and	CCONJ
ct-12705	108	51	mammalian	mammalian	ADJ
ct-12705	108	52	double	double	ADV
ct-12705	108	53	-	-	PUNCT
ct-12705	108	54	stranded	strand	VERB
ct-12705	108	55	dna	dna	NOUN
ct-12705	108	56	.	.	PUNCT
ct-12705	109	1	it	it	PRON
ct-12705	109	2	was	be	AUX
ct-12705	109	3	speculated	speculate	VERB
ct-12705	109	4	that	that	SCONJ
ct-12705	109	5	physiological	physiological	ADJ
ct-12705	109	6	activation	activation	NOUN
ct-12705	109	7	of	of	ADP
ct-12705	109	8	tlr3	tlr3	NOUN
ct-12705	109	9	during	during	ADP
ct-12705	109	10	phagocytosis	phagocytosis	NOUN
ct-12705	109	11	of	of	ADP
ct-12705	109	12	germ	germ	NOUN
ct-12705	109	13	cells	cell	NOUN
ct-12705	109	14	by	by	ADP
ct-12705	109	15	sertoli	sertoli	NOUN
ct-12705	109	16	cells	cell	NOUN
ct-12705	109	17	induced	induce	VERB
ct-12705	109	18	an	an	DET
ct-12705	109	19	inflammation	inflammation	NOUN
ct-12705	109	20	-	-	PUNCT
ct-12705	109	21	like	like	ADJ
ct-12705	109	22	activation	activation	NOUN
ct-12705	109	23	of	of	ADP
ct-12705	109	24	sertoli	sertoli	NOUN
ct-12705	109	25	cells	cell	NOUN
ct-12705	109	26	that	that	PRON
ct-12705	109	27	triggered	trigger	VERB
ct-12705	109	28	the	the	DET
ct-12705	109	29	release	release	NOUN
ct-12705	109	30	of	of	ADP
ct-12705	109	31	critical	critical	ADJ
ct-12705	109	32	spermatogenic	spermatogenic	ADJ
ct-12705	109	33	regulators.35	regulators.35	NOUN
ct-12705	109	34	during	during	ADP
ct-12705	109	35	inflammation	inflammation	NOUN
ct-12705	109	36	,	,	PUNCT
ct-12705	109	37	tlr3	tlr3	PROPN
ct-12705	109	38	activates	activate	VERB
ct-12705	109	39	the	the	DET
ct-12705	109	40	trif	trif	NOUN
ct-12705	109	41	-	-	PUNCT
ct-12705	109	42	dependent	dependent	ADJ
ct-12705	109	43	pathway	pathway	NOUN
ct-12705	109	44	,	,	PUNCT
ct-12705	109	45	resulting	result	VERB
ct-12705	109	46	in	in	ADP
ct-12705	109	47	release	release	NOUN
ct-12705	109	48	of	of	ADP
ct-12705	109	49	interferons	interferon	NOUN
ct-12705	109	50	.	.	PUNCT
ct-12705	110	1	despite	despite	SCONJ
ct-12705	110	2	the	the	DET
ct-12705	110	3	abundance	abundance	NOUN
ct-12705	110	4	of	of	ADP
ct-12705	110	5	tlr3	tlr3	NOUN
ct-12705	110	6	and	and	CCONJ
ct-12705	110	7	its	its	PRON
ct-12705	110	8	mediators	mediator	NOUN
ct-12705	110	9	,	,	PUNCT
ct-12705	110	10	interferons	interferon	NOUN
ct-12705	110	11	were	be	AUX
ct-12705	110	12	not	not	PART
ct-12705	110	13	abundantly	abundantly	ADV
ct-12705	110	14	transcribed	transcribe	VERB
ct-12705	110	15	in	in	ADP
ct-12705	110	16	the	the	DET
ct-12705	110	17	reproductive	reproductive	ADJ
ct-12705	110	18	tract	tract	NOUN
ct-12705	110	19	of	of	ADP
ct-12705	110	20	reproductively	reproductively	ADV
ct-12705	110	21	normal	normal	ADJ
ct-12705	110	22	stallions	stallion	NOUN
ct-12705	110	23	,	,	PUNCT
ct-12705	110	24	suggesting	suggest	VERB
ct-12705	110	25	that	that	SCONJ
ct-12705	110	26	tlr3	tlr3	PROPN
ct-12705	110	27	may	may	AUX
ct-12705	110	28	indeed	indeed	ADV
ct-12705	110	29	serve	serve	VERB
ct-12705	110	30	a	a	DET
ct-12705	110	31	physiological	physiological	ADJ
ct-12705	110	32	function	function	NOUN
ct-12705	110	33	in	in	ADP
ct-12705	110	34	the	the	DET
ct-12705	110	35	absence	absence	NOUN
ct-12705	110	36	of	of	ADP
ct-12705	110	37	inflammation	inflammation	NOUN
ct-12705	110	38	.	.	PUNCT
ct-12705	111	1	several	several	ADJ
ct-12705	111	2	snps	snps	PROPN
ct-12705	111	3	were	be	AUX
ct-12705	111	4	identified	identify	VERB
ct-12705	111	5	in	in	ADP
ct-12705	111	6	the	the	DET
ct-12705	111	7	coding	code	VERB
ct-12705	111	8	regions	region	NOUN
ct-12705	111	9	of	of	ADP
ct-12705	111	10	the	the	DET
ct-12705	111	11	horse	horse	NOUN
ct-12705	111	12	tlr3	tlr3	NOUN
ct-12705	111	13	gene	gene	NOUN
ct-12705	111	14	,	,	PUNCT
ct-12705	111	15	as	as	ADV
ct-12705	111	16	well	well	ADV
ct-12705	111	17	as	as	ADP
ct-12705	111	18	tlr7	tlr7	NOUN
ct-12705	111	19	and	and	CCONJ
ct-12705	111	20	tlr8	tlr8	NOUN
ct-12705	111	21	,	,	PUNCT
ct-12705	111	22	but	but	CCONJ
ct-12705	111	23	their	their	PRON
ct-12705	111	24	effect	effect	NOUN
ct-12705	111	25	on	on	ADP
ct-12705	111	26	pattern	pattern	NOUN
ct-12705	111	27	recognition	recognition	NOUN
ct-12705	111	28	or	or	CCONJ
ct-12705	111	29	function	function	NOUN
ct-12705	111	30	is	be	AUX
ct-12705	111	31	not	not	PART
ct-12705	111	32	known.36	known.36	VERB
ct-12705	111	33	the	the	DET
ct-12705	111	34	next	next	ADJ
ct-12705	111	35	most	most	ADV
ct-12705	111	36	abundantly	abundantly	ADV
ct-12705	111	37	expressed	express	VERB
ct-12705	111	38	receptors	receptor	NOUN
ct-12705	111	39	were	be	AUX
ct-12705	111	40	tlr1	tlr1	PROPN
ct-12705	111	41	,	,	PUNCT
ct-12705	111	42	tlr2	tlr2	PROPN
ct-12705	111	43	,	,	PUNCT
ct-12705	111	44	and	and	CCONJ
ct-12705	111	45	tlr6	tlr6	PROPN
ct-12705	111	46	,	,	PUNCT
ct-12705	111	47	together	together	ADV
ct-12705	111	48	with	with	ADP
ct-12705	111	49	their	their	PRON
ct-12705	111	50	associated	associated	ADJ
ct-12705	111	51	mediators	mediator	NOUN
ct-12705	111	52	of	of	ADP
ct-12705	111	53	the	the	DET
ct-12705	111	54	pik3	pik3	PROPN
ct-12705	111	55	-	-	PUNCT
ct-12705	111	56	akt	akt	PROPN
ct-12705	111	57	signaling	signal	VERB
ct-12705	111	58	pathway	pathway	NOUN
ct-12705	111	59	.	.	PUNCT
ct-12705	112	1	toll	toll	NOUN
ct-12705	112	2	-	-	PUNCT
ct-12705	112	3	like	like	ADJ
ct-12705	112	4	receptor	receptor	NOUN
ct-12705	112	5	2	2	NUM
ct-12705	112	6	was	be	AUX
ct-12705	112	7	ubiquitously	ubiquitously	ADV
ct-12705	112	8	expressed	express	VERB
ct-12705	112	9	in	in	ADP
ct-12705	112	10	rodent	rodent	ADJ
ct-12705	112	11	germ	germ	NOUN
ct-12705	112	12	cells	cell	NOUN
ct-12705	112	13	,	,	PUNCT
ct-12705	112	14	leydig	leydig	NOUN
ct-12705	112	15	cells	cell	NOUN
ct-12705	112	16	,	,	PUNCT
ct-12705	112	17	and	and	CCONJ
ct-12705	112	18	sertoli	sertoli	NOUN
ct-12705	112	19	cells	cell	NOUN
ct-12705	112	20	,	,	PUNCT
ct-12705	112	21	whereas	whereas	SCONJ
ct-12705	112	22	tlr6	tlr6	PROPN
ct-12705	112	23	was	be	AUX
ct-12705	112	24	only	only	ADV
ct-12705	112	25	expressed	express	VERB
ct-12705	112	26	in	in	ADP
ct-12705	112	27	mouse	mouse	NOUN
ct-12705	112	28	sertoli	sertoli	PROPN
ct-12705	112	29	cells.17,33	cells.17,33	PROPN
ct-12705	112	30	cellular	cellular	ADJ
ct-12705	112	31	localization	localization	NOUN
ct-12705	112	32	of	of	ADP
ct-12705	112	33	tlr1	tlr1	PROPN
ct-12705	112	34	in	in	ADP
ct-12705	112	35	the	the	DET
ct-12705	112	36	testis	testis	NOUN
ct-12705	112	37	has	have	AUX
ct-12705	112	38	not	not	PART
ct-12705	112	39	been	be	AUX
ct-12705	112	40	described	describe	VERB
ct-12705	112	41	.	.	PUNCT
ct-12705	113	1	these	these	DET
ct-12705	113	2	tlrs	tlrs	NOUN
ct-12705	113	3	are	be	AUX
ct-12705	113	4	located	locate	VERB
ct-12705	113	5	in	in	ADP
ct-12705	113	6	cell	cell	NOUN
ct-12705	113	7	membranes.1	membranes.1	PROPN
ct-12705	113	8	heterodimers	heterodimers	PROPN
ct-12705	113	9	tlr1	tlr1	PROPN
ct-12705	113	10	/	/	SYM
ct-12705	113	11	tlr2	tlr2	PROPN
ct-12705	113	12	and	and	CCONJ
ct-12705	113	13	tlr2	tlr2	PROPN
ct-12705	113	14	/	/	SYM
ct-12705	113	15	tlr6	tlr6	PROPN
ct-12705	113	16	recognize	recognize	VERB
ct-12705	113	17	lipoproteins	lipoprotein	NOUN
ct-12705	113	18	in	in	ADP
ct-12705	113	19	gram	gram	NOUN
ct-12705	113	20	positive	positive	ADJ
ct-12705	113	21	bacteria	bacteria	NOUN
ct-12705	113	22	.	.	PUNCT
ct-12705	114	1	although	although	SCONJ
ct-12705	114	2	their	their	PRON
ct-12705	114	3	activation	activation	NOUN
ct-12705	114	4	induces	induce	VERB
ct-12705	114	5	the	the	DET
ct-12705	114	6	release	release	NOUN
ct-12705	114	7	of	of	ADP
ct-12705	114	8	several	several	ADJ
ct-12705	114	9	cytokines	cytokine	NOUN
ct-12705	114	10	,	,	PUNCT
ct-12705	114	11	those	those	PRON
ct-12705	114	12	involved	involve	VERB
ct-12705	114	13	in	in	ADP
ct-12705	114	14	innate	innate	ADJ
ct-12705	114	15	chemotaxis	chemotaxis	ADJ
ct-12705	114	16	,	,	PUNCT
ct-12705	114	17	particularly	particularly	ADV
ct-12705	114	18	ccl5	ccl5	PROPN
ct-12705	114	19	,	,	PUNCT
ct-12705	114	20	were	be	AUX
ct-12705	114	21	the	the	DET
ct-12705	114	22	most	most	ADV
ct-12705	114	23	abundantly	abundantly	ADV
ct-12705	114	24	expressed	express	VERB
ct-12705	114	25	in	in	ADP
ct-12705	114	26	stallion	stallion	NOUN
ct-12705	114	27	’s	’s	PART
ct-12705	114	28	testis	testis	NOUN
ct-12705	114	29	and	and	CCONJ
ct-12705	114	30	epididymis	epididymis	NOUN
ct-12705	114	31	.	.	PUNCT
ct-12705	115	1	macrophages	macrophage	NOUN
ct-12705	115	2	in	in	ADP
ct-12705	115	3	the	the	DET
ct-12705	115	4	basal	basal	ADJ
ct-12705	115	5	region	region	NOUN
ct-12705	115	6	of	of	ADP
ct-12705	115	7	the	the	DET
ct-12705	115	8	epididymal	epididymal	ADJ
ct-12705	115	9	epithelium	epithelium	NOUN
ct-12705	115	10	constitutively	constitutively	ADV
ct-12705	115	11	express	express	VERB
ct-12705	115	12	ccl5	ccl5	PROPN
ct-12705	115	13	.	.	PUNCT
ct-12705	116	1	these	these	DET
ct-12705	116	2	macrophages	macrophage	NOUN
ct-12705	116	3	present	present	ADJ
ct-12705	116	4	antigens	antigen	NOUN
ct-12705	116	5	to	to	ADP
ct-12705	116	6	lymphocytes	lymphocyte	NOUN
ct-12705	116	7	and	and	CCONJ
ct-12705	116	8	help	help	VERB
ct-12705	116	9	eliminate	eliminate	VERB
ct-12705	116	10	abnormal	abnormal	ADJ
ct-12705	116	11	sperm.37	sperm.37	NOUN
ct-12705	116	12	concentration	concentration	NOUN
ct-12705	116	13	of	of	ADP
ct-12705	116	14	ccl5	ccl5	PROPN
ct-12705	116	15	in	in	ADP
ct-12705	116	16	seminal	seminal	ADJ
ct-12705	116	17	plasma	plasma	NOUN
ct-12705	116	18	was	be	AUX
ct-12705	116	19	lower	low	ADJ
ct-12705	116	20	in	in	ADP
ct-12705	116	21	men	man	NOUN
ct-12705	116	22	with	with	ADP
ct-12705	116	23	immune	immune	NOUN
ct-12705	116	24	-	-	PUNCT
ct-12705	116	25	mediated	mediate	VERB
ct-12705	116	26	infertility.38	infertility.38	NOUN
ct-12705	116	27	it	it	PRON
ct-12705	116	28	was	be	AUX
ct-12705	116	29	suspected	suspect	VERB
ct-12705	116	30	that	that	SCONJ
ct-12705	116	31	reduced	reduce	VERB
ct-12705	116	32	ccl5	ccl5	PROPN
ct-12705	116	33	concentration	concentration	NOUN
ct-12705	116	34	decreased	decrease	VERB
ct-12705	116	35	the	the	DET
ct-12705	116	36	chemoattraction	chemoattraction	NOUN
ct-12705	116	37	of	of	ADP
ct-12705	116	38	scavenger	scavenger	NOUN
ct-12705	116	39	leukocytes	leukocyte	NOUN
ct-12705	116	40	involved	involve	VERB
ct-12705	116	41	in	in	ADP
ct-12705	116	42	the	the	DET
ct-12705	116	43	physiological	physiological	ADJ
ct-12705	116	44	elimination	elimination	NOUN
ct-12705	116	45	of	of	ADP
ct-12705	116	46	abnormal	abnormal	ADJ
ct-12705	116	47	sperm	sperm	NOUN
ct-12705	116	48	during	during	ADP
ct-12705	116	49	storage	storage	NOUN
ct-12705	116	50	in	in	ADP
ct-12705	116	51	the	the	DET
ct-12705	116	52	genital	genital	ADJ
ct-12705	116	53	tract	tract	NOUN
ct-12705	116	54	,	,	PUNCT
ct-12705	116	55	leading	lead	VERB
ct-12705	116	56	to	to	ADP
ct-12705	116	57	increased	increase	VERB
ct-12705	116	58	exposure	exposure	NOUN
ct-12705	116	59	to	to	ADP
ct-12705	116	60	autoantigens	autoantigen	NOUN
ct-12705	116	61	and	and	CCONJ
ct-12705	116	62	autoimmune	autoimmune	ADJ
ct-12705	116	63	reactions.38	reactions.38	PROPN
ct-12705	116	64	furthermore	furthermore	ADV
ct-12705	116	65	,	,	PUNCT
ct-12705	116	66	ccl5positive	ccl5positive	ADJ
ct-12705	116	67	macrophages	macrophage	NOUN
ct-12705	116	68	are	be	AUX
ct-12705	116	69	involved	involve	VERB
ct-12705	116	70	in	in	ADP
ct-12705	116	71	the	the	DET
ct-12705	116	72	acidification	acidification	NOUN
ct-12705	116	73	of	of	ADP
ct-12705	116	74	the	the	DET
ct-12705	116	75	epididymal	epididymal	ADJ
ct-12705	116	76	luminal	luminal	ADJ
ct-12705	116	77	fluid	fluid	NOUN
ct-12705	116	78	.	.	PUNCT
ct-12705	117	1	this	this	DET
ct-12705	117	2	low	low	ADJ
ct-12705	117	3	ph	ph	NOUN
ct-12705	117	4	is	be	AUX
ct-12705	117	5	necessary	necessary	ADJ
ct-12705	117	6	for	for	ADP
ct-12705	117	7	posttesticular	posttesticular	ADJ
ct-12705	117	8	sperm	sperm	NOUN
ct-12705	117	9	maturation	maturation	NOUN
ct-12705	117	10	and	and	CCONJ
ct-12705	117	11	inhibition	inhibition	NOUN
ct-12705	117	12	of	of	ADP
ct-12705	117	13	sperm	sperm	NOUN
ct-12705	117	14	motility	motility	NOUN
ct-12705	117	15	during	during	ADP
ct-12705	117	16	epididymal	epididymal	ADJ
ct-12705	117	17	storage.37	storage.37	NOUN
ct-12705	117	18	role	role	NOUN
ct-12705	117	19	of	of	ADP
ct-12705	117	20	ccl5	ccl5	PROPN
ct-12705	117	21	in	in	ADP
ct-12705	117	22	the	the	DET
ct-12705	117	23	testicular	testicular	ADJ
ct-12705	117	24	medium	medium	NOUN
ct-12705	117	25	is	be	AUX
ct-12705	117	26	less	less	ADV
ct-12705	117	27	well	well	ADV
ct-12705	117	28	characterized	characterize	VERB
ct-12705	117	29	;	;	PUNCT
ct-12705	117	30	however	however	ADV
ct-12705	117	31	,	,	PUNCT
ct-12705	117	32	since	since	SCONJ
ct-12705	117	33	the	the	DET
ct-12705	117	34	testicular	testicular	ADJ
ct-12705	117	35	luminal	luminal	ADJ
ct-12705	117	36	ph	ph	NOUN
ct-12705	117	37	is	be	AUX
ct-12705	117	38	also	also	ADV
ct-12705	117	39	acidic	acidic	ADJ
ct-12705	117	40	,	,	PUNCT
ct-12705	117	41	ccl5	ccl5	PROPN
ct-12705	117	42	may	may	AUX
ct-12705	117	43	serve	serve	VERB
ct-12705	117	44	a	a	DET
ct-12705	117	45	similar	similar	ADJ
ct-12705	117	46	function	function	NOUN
ct-12705	117	47	in	in	ADP
ct-12705	117	48	the	the	DET
ct-12705	117	49	testis.39	testis.39	NOUN
ct-12705	117	50	effect	effect	NOUN
ct-12705	117	51	of	of	ADP
ct-12705	117	52	tlr2	tlr2	PROPN
ct-12705	117	53	stimulation	stimulation	NOUN
ct-12705	117	54	depends	depend	VERB
ct-12705	117	55	on	on	ADP
ct-12705	117	56	the	the	DET
ct-12705	117	57	relative	relative	ADJ
ct-12705	117	58	expression	expression	NOUN
ct-12705	117	59	of	of	ADP
ct-12705	117	60	tlr1	tlr1	PROPN
ct-12705	117	61	and	and	CCONJ
ct-12705	117	62	tlr6	tlr6	PROPN
ct-12705	117	63	that	that	PRON
ct-12705	117	64	determines	determine	VERB
ct-12705	117	65	heterodimer	heterodimer	NOUN
ct-12705	117	66	predominates	predominate	VERB
ct-12705	117	67	.	.	PUNCT
ct-12705	118	1	heterodimer	heterodimer	PROPN
ct-12705	118	2	tlr2	tlr2	PROPN
ct-12705	118	3	/	/	SYM
ct-12705	118	4	tlr1	tlr1	PROPN
ct-12705	118	5	was	be	AUX
ct-12705	118	6	more	more	ADV
ct-12705	118	7	predominant	predominant	ADJ
ct-12705	118	8	in	in	ADP
ct-12705	118	9	stallion	stallion	NOUN
ct-12705	118	10	’s	’s	PART
ct-12705	118	11	epididymis	epididymis	NOUN
ct-12705	118	12	than	than	ADP
ct-12705	118	13	tlr2	tlr2	PROPN
ct-12705	118	14	/	/	SYM
ct-12705	118	15	tlr6	tlr6	PROPN
ct-12705	118	16	;	;	PUNCT
ct-12705	118	17	heterodimer	heterodimer	PROPN
ct-12705	118	18	is	be	AUX
ct-12705	118	19	thought	think	VERB
ct-12705	118	20	to	to	PART
ct-12705	118	21	have	have	VERB
ct-12705	118	22	an	an	DET
ct-12705	118	23	antiinflammatory	antiinflammatory	NOUN
ct-12705	118	24	role	role	NOUN
ct-12705	118	25	by	by	ADP
ct-12705	118	26	inducing	induce	VERB
ct-12705	118	27	the	the	DET
ct-12705	118	28	production	production	NOUN
ct-12705	118	29	of	of	ADP
ct-12705	118	30	il-10	il-10	NOUN
ct-12705	118	31	and	and	CCONJ
ct-12705	118	32	favoring	favor	VERB
ct-12705	118	33	the	the	DET
ct-12705	118	34	differentiation	differentiation	NOUN
ct-12705	118	35	of	of	ADP
ct-12705	118	36	regulatory	regulatory	ADJ
ct-12705	118	37	t	t	PROPN
ct-12705	118	38	cells.40	cells.40	NOUN
ct-12705	118	39	this	this	DET
ct-12705	118	40	immunosuppressive	immunosuppressive	ADJ
ct-12705	118	41	effect	effect	NOUN
ct-12705	118	42	can	can	AUX
ct-12705	118	43	be	be	AUX
ct-12705	118	44	synergized	synergize	VERB
ct-12705	118	45	by	by	ADP
ct-12705	118	46	low	low	ADJ
ct-12705	118	47	level	level	NOUN
ct-12705	118	48	stimulation	stimulation	NOUN
ct-12705	118	49	of	of	ADP
ct-12705	118	50	cd40	cd40	PROPN
ct-12705	118	51	in	in	ADP
ct-12705	118	52	tolerogenic	tolerogenic	ADJ
ct-12705	118	53	dendritic	dendritic	ADJ
ct-12705	118	54	cells	cell	NOUN
ct-12705	118	55	that	that	PRON
ct-12705	118	56	leads	lead	VERB
ct-12705	118	57	to	to	ADP
ct-12705	118	58	maintenance	maintenance	NOUN
ct-12705	118	59	of	of	ADP
ct-12705	118	60	the	the	DET
ct-12705	118	61	homeostasis	homeostasis	NOUN
ct-12705	118	62	of	of	ADP
ct-12705	118	63	the	the	DET
ct-12705	118	64	immune	immune	ADJ
ct-12705	118	65	system	system	NOUN
ct-12705	118	66	and	and	CCONJ
ct-12705	118	67	a	a	DET
ct-12705	118	68	prevalence	prevalence	NOUN
ct-12705	118	69	of	of	ADP
ct-12705	118	70	a	a	DET
ct-12705	118	71	tolerogenic	tolerogenic	ADJ
ct-12705	118	72	environment.40–43	environment.40–43	NOUN
ct-12705	118	73	of	of	ADP
ct-12705	118	74	the	the	DET
ct-12705	118	75	costimulatory	costimulatory	NOUN
ct-12705	118	76	molecules	molecule	NOUN
ct-12705	118	77	evaluated	evaluate	VERB
ct-12705	118	78	here	here	ADV
ct-12705	118	79	,	,	PUNCT
ct-12705	118	80	cd40	cd40	PROPN
ct-12705	118	81	was	be	AUX
ct-12705	118	82	the	the	DET
ct-12705	118	83	most	most	ADV
ct-12705	118	84	abundantly	abundantly	ADV
ct-12705	118	85	expressed	express	VERB
ct-12705	118	86	.	.	PUNCT
ct-12705	119	1	altogether	altogether	ADV
ct-12705	119	2	,	,	PUNCT
ct-12705	119	3	it	it	PRON
ct-12705	119	4	is	be	AUX
ct-12705	119	5	possible	possible	ADJ
ct-12705	119	6	that	that	SCONJ
ct-12705	119	7	the	the	DET
ct-12705	119	8	prevalent	prevalent	ADJ
ct-12705	119	9	tlrs	tlrs	NOUN
ct-12705	119	10	and	and	CCONJ
ct-12705	119	11	the	the	DET
ct-12705	119	12	effectors	effector	NOUN
ct-12705	119	13	identified	identify	VERB
ct-12705	119	14	in	in	ADP
ct-12705	119	15	our	our	PRON
ct-12705	119	16	study	study	NOUN
ct-12705	119	17	have	have	VERB
ct-12705	119	18	a	a	DET
ct-12705	119	19	physiological	physiological	ADJ
ct-12705	119	20	role	role	NOUN
ct-12705	119	21	maintaining	maintain	VERB
ct-12705	119	22	the	the	DET
ct-12705	119	23	homeostasis	homeostasis	NOUN
ct-12705	119	24	of	of	ADP
ct-12705	119	25	the	the	DET
ct-12705	119	26	immune	immune	ADJ
ct-12705	119	27	system	system	NOUN
ct-12705	119	28	and	and	CCONJ
ct-12705	119	29	removing	remove	VERB
ct-12705	119	30	abnormal	abnormal	ADJ
ct-12705	119	31	sperm	sperm	NOUN
ct-12705	119	32	.	.	PUNCT
ct-12705	120	1	conversely	conversely	ADV
ct-12705	120	2	,	,	PUNCT
ct-12705	120	3	the	the	DET
ct-12705	120	4	expression	expression	NOUN
ct-12705	120	5	of	of	ADP
ct-12705	120	6	tlr4	tlr4	NOUN
ct-12705	120	7	and	and	CCONJ
ct-12705	120	8	its	its	PRON
ct-12705	120	9	costimulatory	costimulatory	NOUN
ct-12705	120	10	molecule	molecule	NOUN
ct-12705	120	11	cd14	cd14	PROPN
ct-12705	120	12	were	be	AUX
ct-12705	120	13	minimal	minimal	ADJ
ct-12705	120	14	in	in	ADP
ct-12705	120	15	the	the	DET
ct-12705	120	16	stallion	stallion	NOUN
ct-12705	120	17	’s	’s	PART
ct-12705	120	18	reproductive	reproductive	ADJ
ct-12705	120	19	tract	tract	NOUN
ct-12705	120	20	,	,	PUNCT
ct-12705	120	21	contradicting	contradict	VERB
ct-12705	120	22	findings	finding	NOUN
ct-12705	120	23	in	in	ADP
ct-12705	120	24	other	other	ADJ
ct-12705	120	25	species	specie	NOUN
ct-12705	120	26	.	.	PUNCT
ct-12705	121	1	expression	expression	NOUN
ct-12705	121	2	of	of	ADP
ct-12705	121	3	tlr4	tlr4	NOUN
ct-12705	121	4	was	be	AUX
ct-12705	121	5	high	high	ADJ
ct-12705	121	6	in	in	ADP
ct-12705	121	7	rodent	rodent	NOUN
ct-12705	121	8	and	and	CCONJ
ct-12705	121	9	human	human	ADJ
ct-12705	121	10	germ	germ	NOUN
ct-12705	121	11	cells	cell	NOUN
ct-12705	121	12	,	,	PUNCT
ct-12705	121	13	and	and	CCONJ
ct-12705	121	14	sertoli	sertoli	NOUN
ct-12705	121	15	cells.17,33,34,44	cells.17,33,34,44	VERB
ct-12705	121	16	conversely	conversely	ADV
ct-12705	121	17	,	,	PUNCT
ct-12705	121	18	as	as	SCONJ
ct-12705	121	19	in	in	ADP
ct-12705	121	20	other	other	ADJ
ct-12705	121	21	species	specie	NOUN
ct-12705	121	22	,	,	PUNCT
ct-12705	121	23	tlr10	tlr10	PROPN
ct-12705	121	24	and	and	CCONJ
ct-12705	121	25	tlr11	tlr11	PROPN
ct-12705	121	26	were	be	AUX
ct-12705	121	27	also	also	ADV
ct-12705	121	28	less	less	ADJ
ct-12705	121	29	abundant.17,33,44	abundant.17,33,44	DET
ct-12705	122	1	it	it	PRON
ct-12705	122	2	is	be	AUX
ct-12705	122	3	possible	possible	ADJ
ct-12705	122	4	that	that	SCONJ
ct-12705	122	5	this	this	DET
ct-12705	122	6	low	low	ADJ
ct-12705	122	7	level	level	NOUN
ct-12705	122	8	of	of	ADP
ct-12705	122	9	expression	expression	NOUN
ct-12705	122	10	indicates	indicate	VERB
ct-12705	122	11	a	a	DET
ct-12705	122	12	less	less	ADV
ct-12705	122	13	important	important	ADJ
ct-12705	122	14	role	role	NOUN
ct-12705	122	15	of	of	ADP
ct-12705	122	16	these	these	DET
ct-12705	122	17	tlrs	tlrs	NOUN
ct-12705	122	18	in	in	ADP
ct-12705	122	19	testicular	testicular	NOUN
ct-12705	122	20	and	and	CCONJ
ct-12705	122	21	epididymal	epididymal	ADJ
ct-12705	122	22	immunity	immunity	NOUN
ct-12705	122	23	.	.	PUNCT
ct-12705	123	1	alternatively	alternatively	ADV
ct-12705	123	2	,	,	PUNCT
ct-12705	123	3	these	these	DET
ct-12705	123	4	tlrs	tlrs	NOUN
ct-12705	123	5	may	may	AUX
ct-12705	123	6	be	be	AUX
ct-12705	123	7	inducible	inducible	ADJ
ct-12705	123	8	,	,	PUNCT
ct-12705	123	9	and	and	CCONJ
ct-12705	123	10	may	may	AUX
ct-12705	123	11	acquire	acquire	VERB
ct-12705	123	12	a	a	DET
ct-12705	123	13	more	more	ADV
ct-12705	123	14	active	active	ADJ
ct-12705	123	15	role	role	NOUN
ct-12705	123	16	in	in	ADP
ct-12705	123	17	the	the	DET
ct-12705	123	18	face	face	NOUN
ct-12705	123	19	of	of	ADP
ct-12705	123	20	infection	infection	NOUN
ct-12705	123	21	.	.	PUNCT
ct-12705	124	1	furthermore	furthermore	ADV
ct-12705	124	2	,	,	PUNCT
ct-12705	124	3	the	the	DET
ct-12705	124	4	low	low	ADJ
ct-12705	124	5	transcriptional	transcriptional	ADJ
ct-12705	124	6	levels	level	NOUN
ct-12705	124	7	may	may	AUX
ct-12705	124	8	be	be	AUX
ct-12705	124	9	due	due	ADJ
ct-12705	124	10	to	to	ADP
ct-12705	124	11	the	the	DET
ct-12705	124	12	cellular	cellular	ADJ
ct-12705	124	13	distribution	distribution	NOUN
ct-12705	124	14	of	of	ADP
ct-12705	124	15	these	these	DET
ct-12705	124	16	tlrs	tlrs	NOUN
ct-12705	124	17	since	since	SCONJ
ct-12705	124	18	the	the	DET
ct-12705	124	19	expression	expression	NOUN
ct-12705	124	20	of	of	ADP
ct-12705	124	21	tlr8	tlr8	NOUN
ct-12705	124	22	,	,	PUNCT
ct-12705	124	23	tlr9	tlr9	NOUN
ct-12705	124	24	and	and	CCONJ
ct-12705	124	25	tlr11	tlr11	PROPN
ct-12705	124	26	was	be	AUX
ct-12705	124	27	limited	limit	VERB
ct-12705	124	28	to	to	ADP
ct-12705	124	29	myeloid	myeloid	ADJ
ct-12705	124	30	cells	cell	NOUN
ct-12705	124	31	within	within	ADP
ct-12705	124	32	the	the	DET
ct-12705	124	33	rodent	rodent	NOUN
ct-12705	124	34	testis.17,33	testis.17,33	SCONJ
ct-12705	124	35	the	the	DET
ct-12705	124	36	majority	majority	NOUN
ct-12705	124	37	of	of	ADP
ct-12705	124	38	the	the	DET
ct-12705	124	39	genes	gene	NOUN
ct-12705	124	40	were	be	AUX
ct-12705	124	41	overexpressed	overexpresse	VERB
ct-12705	124	42	in	in	ADP
ct-12705	124	43	the	the	DET
ct-12705	124	44	epididymis	epididymis	NOUN
ct-12705	124	45	compared	compare	VERB
ct-12705	124	46	to	to	ADP
ct-12705	124	47	testis	testis	PRON
ct-12705	124	48	.	.	PUNCT
ct-12705	125	1	despite	despite	SCONJ
ct-12705	125	2	the	the	DET
ct-12705	125	3	higher	high	ADJ
ct-12705	125	4	gene	gene	NOUN
ct-12705	125	5	expression	expression	NOUN
ct-12705	125	6	of	of	ADP
ct-12705	125	7	the	the	DET
ct-12705	125	8	tlrs	tlrs	NOUN
ct-12705	125	9	and	and	CCONJ
ct-12705	125	10	adaptors	adaptor	NOUN
ct-12705	125	11	,	,	PUNCT
ct-12705	125	12	cytokine	cytokine	ADJ
ct-12705	125	13	expression	expression	NOUN
ct-12705	125	14	was	be	AUX
ct-12705	125	15	also	also	ADV
ct-12705	125	16	relatively	relatively	ADV
ct-12705	125	17	low	low	ADJ
ct-12705	125	18	(	(	PUNCT
ct-12705	125	19	fpkm	fpkm	NOUN
ct-12705	125	20	<	<	X
ct-12705	125	21	1	1	NUM
ct-12705	125	22	)	)	PUNCT
ct-12705	125	23	within	within	ADP
ct-12705	125	24	the	the	DET
ct-12705	125	25	epididymis	epididymis	NOUN
ct-12705	125	26	.	.	PUNCT
ct-12705	126	1	the	the	DET
ct-12705	126	2	overexpression	overexpression	NOUN
ct-12705	126	3	emphasizes	emphasize	VERB
ct-12705	126	4	the	the	DET
ct-12705	126	5	importance	importance	NOUN
ct-12705	126	6	of	of	ADP
ct-12705	126	7	the	the	DET
ct-12705	126	8	innate	innate	ADJ
ct-12705	126	9	immunity	immunity	NOUN
ct-12705	126	10	in	in	ADP
ct-12705	126	11	controlling	control	VERB
ct-12705	126	12	and	and	CCONJ
ct-12705	126	13	preventing	prevent	VERB
ct-12705	126	14	ascending	ascend	VERB
ct-12705	126	15	infections	infection	NOUN
ct-12705	126	16	of	of	ADP
ct-12705	126	17	the	the	DET
ct-12705	126	18	reproductive	reproductive	ADJ
ct-12705	126	19	tract	tract	NOUN
ct-12705	126	20	.	.	PUNCT
ct-12705	127	1	conversely	conversely	ADV
ct-12705	127	2	,	,	PUNCT
ct-12705	127	3	the	the	DET
ct-12705	127	4	innate	innate	ADJ
ct-12705	127	5	immunity	immunity	NOUN
ct-12705	127	6	may	may	AUX
ct-12705	127	7	have	have	VERB
ct-12705	127	8	a	a	DET
ct-12705	127	9	role	role	NOUN
ct-12705	127	10	in	in	ADP
ct-12705	127	11	the	the	DET
ct-12705	127	12	removal	removal	NOUN
ct-12705	127	13	of	of	ADP
ct-12705	127	14	abnormal	abnormal	ADJ
ct-12705	127	15	sperm	sperm	NOUN
ct-12705	127	16	from	from	ADP
ct-12705	127	17	the	the	DET
ct-12705	127	18	epididymis	epididymis	NOUN
ct-12705	127	19	,	,	PUNCT
ct-12705	127	20	preventing	prevent	VERB
ct-12705	127	21	their	their	PRON
ct-12705	127	22	transport	transport	NOUN
ct-12705	127	23	through	through	ADP
ct-12705	127	24	the	the	DET
ct-12705	127	25	tubular	tubular	ADJ
ct-12705	127	26	system	system	NOUN
ct-12705	127	27	into	into	ADP
ct-12705	127	28	the	the	DET
ct-12705	127	29	ejaculate	ejaculate	NOUN
ct-12705	127	30	.	.	PUNCT
ct-12705	128	1	in	in	ADP
ct-12705	128	2	the	the	DET
ct-12705	128	3	rat	rat	NOUN
ct-12705	128	4	epididymis	epididymis	NOUN
ct-12705	128	5	,	,	PUNCT
ct-12705	128	6	all	all	PRON
ct-12705	128	7	tlrs	tlrs	NOUN
ct-12705	128	8	,	,	PUNCT
ct-12705	128	9	except	except	SCONJ
ct-12705	128	10	for	for	ADP
ct-12705	128	11	tlr10	tlr10	PROPN
ct-12705	128	12	,	,	PUNCT
ct-12705	128	13	were	be	AUX
ct-12705	128	14	localized	localize	VERB
ct-12705	128	15	in	in	ADP
ct-12705	128	16	the	the	DET
ct-12705	128	17	epithelial	epithelial	ADJ
ct-12705	128	18	cells.44	cells.44	NOUN
ct-12705	128	19	although	although	SCONJ
ct-12705	128	20	seasonal	seasonal	ADJ
ct-12705	128	21	variations	variation	NOUN
ct-12705	128	22	were	be	AUX
ct-12705	128	23	reported	report	VERB
ct-12705	128	24	in	in	ADP
ct-12705	128	25	the	the	DET
ct-12705	128	26	donkey	donkey	NOUN
ct-12705	128	27	epididymal	epididymal	ADJ
ct-12705	128	28	epithelium	epithelium	NOUN
ct-12705	128	29	morphology	morphology	NOUN
ct-12705	128	30	and	and	CCONJ
ct-12705	128	31	presence	presence	NOUN
ct-12705	128	32	of	of	ADP
ct-12705	128	33	inflammatory	inflammatory	ADJ
ct-12705	128	34	cells	cell	NOUN
ct-12705	128	35	,	,	PUNCT
ct-12705	128	36	no	no	DET
ct-12705	128	37	differences	difference	NOUN
ct-12705	128	38	in	in	ADP
ct-12705	128	39	gene	gene	NOUN
ct-12705	128	40	expression	expression	NOUN
ct-12705	128	41	were	be	AUX
ct-12705	128	42	identified	identify	VERB
ct-12705	128	43	in	in	ADP
ct-12705	128	44	our	our	PRON
ct-12705	128	45	study	study	NOUN
ct-12705	128	46	between	between	ADP
ct-12705	128	47	samples	sample	NOUN
ct-12705	128	48	collected	collect	VERB
ct-12705	128	49	in	in	ADP
ct-12705	128	50	the	the	DET
ct-12705	128	51	spring	spring	NOUN
ct-12705	128	52	versus	versus	ADP
ct-12705	128	53	winter.45	winter.45	VERB
ct-12705	128	54	our	our	PRON
ct-12705	128	55	study	study	NOUN
ct-12705	128	56	is	be	AUX
ct-12705	128	57	the	the	DET
ct-12705	128	58	first	first	ADJ
ct-12705	128	59	to	to	PART
ct-12705	128	60	identify	identify	VERB
ct-12705	128	61	the	the	DET
ct-12705	128	62	expression	expression	NOUN
ct-12705	128	63	of	of	ADP
ct-12705	128	64	tlr12	tlr12	PROPN
ct-12705	128	65	in	in	ADP
ct-12705	128	66	equine	equine	NOUN
ct-12705	128	67	tissues	tissue	NOUN
ct-12705	128	68	.	.	PUNCT
ct-12705	129	1	expression	expression	NOUN
ct-12705	129	2	of	of	ADP
ct-12705	129	3	tlr12	tlr12	PROPN
ct-12705	129	4	was	be	AUX
ct-12705	129	5	only	only	ADV
ct-12705	129	6	recently	recently	ADV
ct-12705	129	7	described	describe	VERB
ct-12705	129	8	in	in	ADP
ct-12705	129	9	equine	equine	NOUN
ct-12705	129	10	peripheral	peripheral	ADJ
ct-12705	129	11	leucocytes.2	leucocytes.2	PROPN
ct-12705	129	12	in	in	ADP
ct-12705	129	13	mice	mouse	NOUN
ct-12705	129	14	,	,	PUNCT
ct-12705	129	15	tlr12	tlr12	PROPN
ct-12705	129	16	was	be	AUX
ct-12705	129	17	described	describe	VERB
ct-12705	129	18	as	as	ADP
ct-12705	129	19	an	an	DET
ct-12705	129	20	intracellular	intracellular	ADJ
ct-12705	129	21	receptor	receptor	NOUN
ct-12705	129	22	acting	act	VERB
ct-12705	129	23	in	in	ADP
ct-12705	129	24	cooperation	cooperation	NOUN
ct-12705	129	25	with	with	ADP
ct-12705	129	26	tlr11	tlr11	PROPN
ct-12705	129	27	in	in	ADP
ct-12705	129	28	the	the	DET
ct-12705	129	29	recognition	recognition	NOUN
ct-12705	129	30	of	of	ADP
ct-12705	129	31	toxoplasma	toxoplasma	NOUN
ct-12705	129	32	gondii	gondii	NOUN
ct-12705	129	33	profilin.46	profilin.46	NOUN
ct-12705	129	34	equine	equine	NOUN
ct-12705	129	35	tlr12	tlr12	PROPN
ct-12705	129	36	is	be	AUX
ct-12705	129	37	poorly	poorly	ADV
ct-12705	129	38	characterized	characterize	VERB
ct-12705	129	39	,	,	PUNCT
ct-12705	129	40	and	and	CCONJ
ct-12705	129	41	its	its	PRON
ct-12705	129	42	role	role	NOUN
ct-12705	129	43	in	in	ADP
ct-12705	129	44	equine	equine	NOUN
ct-12705	129	45	immunity	immunity	NOUN
ct-12705	129	46	is	be	AUX
ct-12705	129	47	not	not	PART
ct-12705	129	48	known	know	VERB
ct-12705	129	49	.	.	PUNCT
ct-12705	130	1	future	future	ADJ
ct-12705	130	2	studies	study	NOUN
ct-12705	130	3	should	should	AUX
ct-12705	130	4	consider	consider	VERB
ct-12705	130	5	evaluating	evaluate	VERB
ct-12705	130	6	inducible	inducible	ADJ
ct-12705	130	7	expression	expression	NOUN
ct-12705	130	8	of	of	ADP
ct-12705	130	9	tlrs	tlrs	ADJ
ct-12705	130	10	and	and	CCONJ
ct-12705	130	11	associated	associated	ADJ
ct-12705	130	12	genes	gene	NOUN
ct-12705	130	13	in	in	ADP
ct-12705	130	14	the	the	DET
ct-12705	130	15	testes	testis	NOUN
ct-12705	130	16	and	and	CCONJ
ct-12705	130	17	epididymis	epididymis	NOUN
ct-12705	130	18	of	of	ADP
ct-12705	130	19	stallions	stallion	NOUN
ct-12705	130	20	with	with	ADP
ct-12705	130	21	testicular	testicular	NOUN
ct-12705	130	22	or	or	CCONJ
ct-12705	130	23	epididymal	epididymal	ADJ
ct-12705	130	24	dysfunction	dysfunction	NOUN
ct-12705	130	25	or	or	CCONJ
ct-12705	130	26	suspected	suspect	VERB
ct-12705	130	27	immune	immune	NOUN
ct-12705	130	28	-	-	PUNCT
ct-12705	130	29	mediated	mediate	VERB
ct-12705	130	30	infertility	infertility	NOUN
ct-12705	130	31	to	to	PART
ct-12705	130	32	evaluate	evaluate	VERB
ct-12705	130	33	the	the	DET
ct-12705	130	34	role	role	NOUN
ct-12705	130	35	of	of	ADP
ct-12705	130	36	these	these	DET
ct-12705	130	37	components	component	NOUN
ct-12705	130	38	of	of	ADP
ct-12705	130	39	the	the	DET
ct-12705	130	40	innate	innate	ADJ
ct-12705	130	41	immune	immune	ADJ
ct-12705	130	42	system	system	NOUN
ct-12705	130	43	on	on	ADP
ct-12705	130	44	the	the	DET
ct-12705	130	45	pathophysiology	pathophysiology	NOUN
ct-12705	130	46	of	of	ADP
ct-12705	130	47	these	these	DET
ct-12705	130	48	conditions	condition	NOUN
ct-12705	130	49	.	.	PUNCT
ct-12705	131	1	in	in	ADP
ct-12705	131	2	summary	summary	NOUN
ct-12705	131	3	,	,	PUNCT
ct-12705	131	4	constitutive	constitutive	ADJ
ct-12705	131	5	gene	gene	NOUN
ct-12705	131	6	expression	expression	NOUN
ct-12705	131	7	of	of	ADP
ct-12705	131	8	most	most	ADJ
ct-12705	131	9	tlrs	tlrs	NOUN
ct-12705	131	10	and	and	CCONJ
ct-12705	131	11	associated	associated	ADJ
ct-12705	131	12	proteins	protein	NOUN
ct-12705	131	13	was	be	AUX
ct-12705	131	14	identified	identify	VERB
ct-12705	131	15	in	in	ADP
ct-12705	131	16	stallion	stallion	NOUN
ct-12705	131	17	’s	’s	PART
ct-12705	131	18	testis	testis	NOUN
ct-12705	131	19	and	and	CCONJ
ct-12705	131	20	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	PROPN
ct-12705	131	21	citation	citation	NOUN
ct-12705	131	22	:	:	PUNCT
ct-12705	131	23	clinical	clinical	ADJ
ct-12705	131	24	theriogenology	theriogenology	NOUN
ct-12705	131	25	2025	2025	NUM
ct-12705	131	26	,	,	PUNCT
ct-12705	131	27	17	17	NUM
ct-12705	131	28	,	,	PUNCT
ct-12705	131	29	12705	12705	NUM
ct-12705	131	30	,	,	PUNCT
ct-12705	131	31	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	131	32	7	7	NUM
ct-12705	131	33	epididymis	epididymis	NOUN
ct-12705	131	34	.	.	PUNCT
ct-12705	132	1	their	their	PRON
ct-12705	132	2	widespread	widespread	ADJ
ct-12705	132	3	expression	expression	NOUN
ct-12705	132	4	supports	support	VERB
ct-12705	132	5	an	an	DET
ct-12705	132	6	important	important	ADJ
ct-12705	132	7	function	function	NOUN
ct-12705	132	8	of	of	ADP
ct-12705	132	9	the	the	DET
ct-12705	132	10	innate	innate	ADJ
ct-12705	132	11	immunity	immunity	NOUN
ct-12705	132	12	in	in	ADP
ct-12705	132	13	testicular	testicular	NOUN
ct-12705	132	14	and	and	CCONJ
ct-12705	132	15	epididymal	epididymal	ADJ
ct-12705	132	16	defense	defense	NOUN
ct-12705	132	17	.	.	PUNCT
ct-12705	133	1	the	the	DET
ct-12705	133	2	most	most	ADV
ct-12705	133	3	significant	significant	ADJ
ct-12705	133	4	pathways	pathway	NOUN
ct-12705	133	5	were	be	AUX
ct-12705	133	6	associated	associate	VERB
ct-12705	133	7	with	with	ADP
ct-12705	133	8	tlr3	tlr3	NOUN
ct-12705	133	9	,	,	PUNCT
ct-12705	133	10	tlr2	tlr2	PROPN
ct-12705	133	11	/	/	SYM
ct-12705	133	12	tlr1	tlr1	PROPN
ct-12705	133	13	,	,	PUNCT
ct-12705	133	14	and	and	CCONJ
ct-12705	133	15	tlr2	tlr2	PROPN
ct-12705	133	16	/	/	SYM
ct-12705	133	17	tlr6	tlr6	PROPN
ct-12705	133	18	,	,	PUNCT
ct-12705	133	19	and	and	CCONJ
ct-12705	133	20	the	the	DET
ct-12705	133	21	effector	effector	NOUN
ct-12705	133	22	molecules	molecule	NOUN
ct-12705	133	23	ccl5	ccl5	PROPN
ct-12705	133	24	and	and	CCONJ
ct-12705	133	25	cd40	cd40	PROPN
ct-12705	133	26	.	.	PUNCT
ct-12705	134	1	these	these	DET
ct-12705	134	2	tlr	tlr	PROPN
ct-12705	134	3	pathways	pathways	PROPN
ct-12705	134	4	may	may	AUX
ct-12705	134	5	have	have	VERB
ct-12705	134	6	a	a	DET
ct-12705	134	7	physiological	physiological	ADJ
ct-12705	134	8	role	role	NOUN
ct-12705	134	9	maintaining	maintain	VERB
ct-12705	134	10	the	the	DET
ct-12705	134	11	tolerogenic	tolerogenic	ADJ
ct-12705	134	12	environment	environment	NOUN
ct-12705	134	13	,	,	PUNCT
ct-12705	134	14	supporting	support	VERB
ct-12705	134	15	posttesticular	posttesticular	ADJ
ct-12705	134	16	maturation	maturation	NOUN
ct-12705	134	17	or	or	CCONJ
ct-12705	134	18	removing	remove	VERB
ct-12705	134	19	defective	defective	ADJ
ct-12705	134	20	sperm	sperm	NOUN
ct-12705	134	21	from	from	ADP
ct-12705	134	22	the	the	DET
ct-12705	134	23	tubular	tubular	ADJ
ct-12705	134	24	system	system	NOUN
ct-12705	134	25	.	.	PUNCT
ct-12705	135	1	conflict	conflict	NOUN
ct-12705	135	2	of	of	ADP
ct-12705	135	3	interest	interest	NOUN
ct-12705	135	4	authors	author	NOUN
ct-12705	135	5	have	have	VERB
ct-12705	135	6	no	no	DET
ct-12705	135	7	conflict	conflict	NOUN
ct-12705	135	8	of	of	ADP
ct-12705	135	9	interest	interest	NOUN
ct-12705	135	10	that	that	PRON
ct-12705	135	11	could	could	AUX
ct-12705	135	12	be	be	AUX
ct-12705	135	13	perceived	perceive	VERB
ct-12705	135	14	as	as	ADP
ct-12705	135	15	prejudicing	prejudice	VERB
ct-12705	135	16	against	against	ADP
ct-12705	135	17	the	the	DET
ct-12705	135	18	impartiality	impartiality	NOUN
ct-12705	135	19	of	of	ADP
ct-12705	135	20	the	the	DET
ct-12705	135	21	research	research	NOUN
ct-12705	135	22	reported	report	VERB
ct-12705	135	23	.	.	PUNCT
ct-12705	136	1	funding	fund	VERB
ct-12705	136	2	for	for	ADP
ct-12705	136	3	the	the	DET
ct-12705	136	4	love	love	NOUN
ct-12705	136	5	of	of	ADP
ct-12705	136	6	the	the	DET
ct-12705	136	7	horse	horse	NOUN
ct-12705	136	8	competitive	competitive	ADJ
ct-12705	136	9	research	research	NOUN
ct-12705	136	10	grants	grant	NOUN
ct-12705	136	11	,	,	PUNCT
ct-12705	136	12	university	university	NOUN
ct-12705	136	13	of	of	ADP
ct-12705	136	14	georgia	georgia	PROPN
ct-12705	136	15	.	.	PUNCT
ct-12705	137	1	references	reference	NOUN
ct-12705	137	2	1	1	NUM
ct-12705	137	3	.	.	PUNCT
ct-12705	137	4	werling	werle	VERB
ct-12705	137	5	d	d	PROPN
ct-12705	137	6	,	,	PUNCT
ct-12705	137	7	coffey	coffey	PROPN
ct-12705	137	8	tj	tj	PROPN
ct-12705	137	9	:	:	PUNCT
ct-12705	137	10	pattern	pattern	NOUN
ct-12705	137	11	recognition	recognition	NOUN
ct-12705	137	12	receptors	receptor	NOUN
ct-12705	137	13	in	in	ADP
ct-12705	137	14	companion	companion	NOUN
ct-12705	137	15	and	and	CCONJ
ct-12705	137	16	farm	farm	NOUN
ct-12705	137	17	animals	animal	NOUN
ct-12705	137	18	the	the	DET
ct-12705	137	19	key	key	NOUN
ct-12705	137	20	to	to	ADP
ct-12705	137	21	unlocking	unlock	VERB
ct-12705	137	22	the	the	DET
ct-12705	137	23	door	door	NOUN
ct-12705	137	24	to	to	ADP
ct-12705	137	25	animal	animal	NOUN
ct-12705	137	26	disease	disease	NOUN
ct-12705	137	27	?	?	PUNCT
ct-12705	138	1	vet	vet	NOUN
ct-12705	138	2	j	j	PROPN
ct-12705	138	3	2007;174:240	2007;174:240	NUM
ct-12705	138	4	-	-	SYM
ct-12705	138	5	251	251	NUM
ct-12705	138	6	.	.	PUNCT
ct-12705	139	1	doi	doi	NOUN
ct-12705	139	2	:	:	PUNCT
ct-12705	139	3	10.1016	10.1016	NUM
ct-12705	139	4	/	/	SYM
ct-12705	139	5	j.tvjl.2006.10.010	j.tvjl.2006.10.010	PROPN
ct-12705	139	6	2	2	NUM
ct-12705	139	7	.	.	PUNCT
ct-12705	139	8	stejskalova	stejskalova	PROPN
ct-12705	140	1	k	k	PROPN
ct-12705	140	2	,	,	PUNCT
ct-12705	140	3	janova	janova	PROPN
ct-12705	140	4	e	e	NOUN
ct-12705	140	5	,	,	PUNCT
ct-12705	140	6	splichalova	splichalova	VERB
ct-12705	140	7	p	p	NOUN
ct-12705	140	8	,	,	PUNCT
ct-12705	140	9	et	et	PROPN
ct-12705	140	10	al	al	PROPN
ct-12705	140	11	:	:	PUNCT
ct-12705	140	12	twelve	twelve	NUM
ct-12705	140	13	toll	toll	NOUN
ct-12705	140	14	-	-	PUNCT
ct-12705	140	15	like	like	ADJ
ct-12705	140	16	receptor	receptor	NOUN
ct-12705	140	17	(	(	PUNCT
ct-12705	140	18	tlr	tlr	PROPN
ct-12705	140	19	)	)	PUNCT
ct-12705	140	20	genes	gene	NOUN
ct-12705	140	21	in	in	ADP
ct-12705	140	22	the	the	DET
ct-12705	140	23	family	family	NOUN
ct-12705	140	24	equidae	equidae	NOUN
ct-12705	140	25	–	–	PUNCT
ct-12705	140	26	comparative	comparative	ADJ
ct-12705	140	27	genomics	genomics	NOUN
ct-12705	140	28	,	,	PUNCT
ct-12705	140	29	selection	selection	NOUN
ct-12705	140	30	and	and	CCONJ
ct-12705	140	31	evolution	evolution	NOUN
ct-12705	140	32	.	.	PUNCT
ct-12705	141	1	vet	vet	NOUN
ct-12705	141	2	res	re	NOUN
ct-12705	141	3	comm	comm	NOUN
ct-12705	141	4	2024;48:725	2024;48:725	NOUN
ct-12705	141	5	-	-	SYM
ct-12705	141	6	741	741	NUM
ct-12705	141	7	.	.	PUNCT
ct-12705	142	1	doi	doi	NOUN
ct-12705	142	2	:	:	PUNCT
ct-12705	142	3	10.1007	10.1007	NUM
ct-12705	142	4	/	/	SYM
ct-12705	142	5	s11259	s11259	NOUN
ct-12705	142	6	-	-	PUNCT
ct-12705	142	7	023	023	NUM
ct-12705	142	8	-	-	PUNCT
ct-12705	142	9	10245	10245	NUM
ct-12705	142	10	-	-	SYM
ct-12705	142	11	4	4	NUM
ct-12705	142	12	3	3	NUM
ct-12705	142	13	.	.	PUNCT
ct-12705	143	1	irvine	irvine	PROPN
ct-12705	143	2	kl	kl	PROPN
ct-12705	143	3	,	,	PUNCT
ct-12705	143	4	hopkins	hopkins	PROPN
ct-12705	143	5	lj	lj	PROPN
ct-12705	143	6	,	,	PUNCT
ct-12705	143	7	gangloff	gangloff	NOUN
ct-12705	143	8	m	m	PROPN
ct-12705	143	9	,	,	PUNCT
ct-12705	143	10	et	et	PROPN
ct-12705	143	11	al	al	PROPN
ct-12705	143	12	:	:	PUNCT
ct-12705	143	13	the	the	DET
ct-12705	143	14	molecular	molecular	ADJ
ct-12705	143	15	basis	basis	NOUN
ct-12705	143	16	of	of	ADP
ct-12705	143	17	recognition	recognition	NOUN
ct-12705	143	18	of	of	ADP
ct-12705	143	19	bacterial	bacterial	ADJ
ct-12705	143	20	ligands	ligand	NOUN
ct-12705	143	21	at	at	ADP
ct-12705	143	22	equine	equine	NOUN
ct-12705	143	23	tlr2	tlr2	PROPN
ct-12705	143	24	,	,	PUNCT
ct-12705	143	25	tlr1	tlr1	PROPN
ct-12705	143	26	and	and	CCONJ
ct-12705	143	27	tlr6	tlr6	PROPN
ct-12705	143	28	.	.	PUNCT
ct-12705	144	1	vet	vet	NOUN
ct-12705	144	2	res	re	NOUN
ct-12705	144	3	2023;44:50	2023;44:50	NUM
ct-12705	144	4	.	.	PUNCT
ct-12705	145	1	doi	doi	NOUN
ct-12705	145	2	:	:	PUNCT
ct-12705	145	3	10.1186/1297	10.1186/1297	NUM
ct-12705	145	4	-	-	PUNCT
ct-12705	145	5	9716	9716	NUM
ct-12705	145	6	-	-	PUNCT
ct-12705	145	7	44	44	NUM
ct-12705	145	8	-	-	SYM
ct-12705	145	9	50	50	NUM
ct-12705	145	10	4	4	NUM
ct-12705	145	11	.	.	PUNCT
ct-12705	146	1	chen	chen	PROPN
ct-12705	146	2	jq	jq	PROPN
ct-12705	146	3	,	,	PUNCT
ct-12705	146	4	szodoray	szodoray	VERB
ct-12705	146	5	p	p	NOUN
ct-12705	146	6	,	,	PUNCT
ct-12705	146	7	zeher	zeher	ADJ
ct-12705	146	8	m	m	NOUN
ct-12705	146	9	:	:	PUNCT
ct-12705	146	10	toll	toll	NOUN
ct-12705	146	11	-	-	PUNCT
ct-12705	146	12	like	like	ADJ
ct-12705	146	13	receptor	receptor	NOUN
ct-12705	146	14	pathways	pathway	NOUN
ct-12705	146	15	in	in	ADP
ct-12705	146	16	autoimmune	autoimmune	ADJ
ct-12705	146	17	diseases	disease	NOUN
ct-12705	146	18	.	.	PUNCT
ct-12705	147	1	clin	clin	PROPN
ct-12705	147	2	rev	rev	PROPN
ct-12705	147	3	allergy	allergy	PROPN
ct-12705	147	4	immunol	immunol	NOUN
ct-12705	147	5	2016;501	2016;501	PROPN
ct-12705	147	6	-	-	SYM
ct-12705	147	7	17	17	NUM
ct-12705	147	8	.	.	PUNCT
ct-12705	148	1	doi	doi	NOUN
ct-12705	148	2	:	:	PUNCT
ct-12705	148	3	10.1007	10.1007	NUM
ct-12705	148	4	/	/	SYM
ct-12705	148	5	s12016	s12016	PROPN
ct-12705	148	6	-	-	PUNCT
ct-12705	148	7	015	015	NUM
ct-12705	148	8	-	-	PUNCT
ct-12705	148	9	8473	8473	NUM
ct-12705	148	10	-	-	SYM
ct-12705	148	11	z	z	NOUN
ct-12705	148	12	5	5	NUM
ct-12705	148	13	.	.	PUNCT
ct-12705	148	14	crisan	crisan	ADJ
ct-12705	148	15	to	to	PART
ct-12705	148	16	,	,	PUNCT
ct-12705	148	17	netea	netea	NOUN
ct-12705	148	18	mg	mg	PROPN
ct-12705	148	19	,	,	PUNCT
ct-12705	148	20	joosten	joosten	VERB
ct-12705	148	21	lab	lab	NOUN
ct-12705	148	22	:	:	PUNCT
ct-12705	148	23	innate	innate	ADJ
ct-12705	148	24	immune	immune	ADJ
ct-12705	148	25	memory	memory	NOUN
ct-12705	148	26	:	:	PUNCT
ct-12705	148	27	implications	implication	NOUN
ct-12705	148	28	for	for	ADP
ct-12705	148	29	host	host	NOUN
ct-12705	148	30	responses	response	NOUN
ct-12705	148	31	to	to	ADP
ct-12705	148	32	damage	damage	NOUN
ct-12705	148	33	-	-	PUNCT
ct-12705	148	34	associated	associate	VERB
ct-12705	148	35	molecular	molecular	ADJ
ct-12705	148	36	patterns	pattern	NOUN
ct-12705	148	37	.	.	PUNCT
ct-12705	149	1	eur	eur	PROPN
ct-12705	149	2	j	j	PROPN
ct-12705	149	3	immunol	immunol	NOUN
ct-12705	149	4	2016;46:817	2016;46:817	NOUN
ct-12705	149	5	-	-	SYM
ct-12705	149	6	828	828	NUM
ct-12705	149	7	.	.	PUNCT
ct-12705	150	1	doi	doi	NOUN
ct-12705	150	2	:	:	PUNCT
ct-12705	150	3	10.1002/	10.1002/	NUM
ct-12705	150	4	eji.201545497	eji.201545497	PROPN
ct-12705	150	5	6	6	NUM
ct-12705	150	6	.	.	PUNCT
ct-12705	151	1	tarlinton	tarlinton	PROPN
ct-12705	151	2	re	re	PROPN
ct-12705	151	3	,	,	PUNCT
ct-12705	151	4	alder	alder	PROPN
ct-12705	151	5	l	l	PROPN
ct-12705	151	6	,	,	PUNCT
ct-12705	151	7	moreton	moreton	PROPN
ct-12705	151	8	j	j	PROPN
ct-12705	151	9	,	,	PUNCT
ct-12705	151	10	et	et	PROPN
ct-12705	151	11	al	al	PROPN
ct-12705	151	12	:	:	PUNCT
ct-12705	151	13	rna	rna	NOUN
ct-12705	151	14	expression	expression	NOUN
ct-12705	151	15	of	of	ADP
ct-12705	151	16	tlr10	tlr10	PROPN
ct-12705	151	17	in	in	ADP
ct-12705	151	18	normal	normal	ADJ
ct-12705	151	19	equine	equine	NOUN
ct-12705	151	20	tissues	tissue	NOUN
ct-12705	151	21	.	.	PUNCT
ct-12705	152	1	bmc	bmc	ADJ
ct-12705	152	2	res	re	NOUN
ct-12705	152	3	notes	notes	PROPN
ct-12705	152	4	2016;9:353	2016;9:353	PROPN
ct-12705	152	5	.	.	PUNCT
ct-12705	152	6	doi	doi	PROPN
ct-12705	152	7	:	:	PUNCT
ct-12705	152	8	10.1186	10.1186	NUM
ct-12705	152	9	/	/	SYM
ct-12705	152	10	s13104	s13104	NOUN
ct-12705	152	11	-	-	PUNCT
ct-12705	152	12	016	016	NUM
ct-12705	152	13	-	-	PUNCT
ct-12705	152	14	2161	2161	NUM
ct-12705	152	15	-	-	SYM
ct-12705	152	16	9	9	NUM
ct-12705	152	17	7	7	NUM
ct-12705	152	18	.	.	PUNCT
ct-12705	152	19	de	de	PROPN
ct-12705	152	20	laat	laat	PROPN
ct-12705	152	21	ma	ma	PROPN
ct-12705	152	22	,	,	PUNCT
ct-12705	152	23	clement	clement	PROPN
ct-12705	152	24	ck	ck	PROPN
ct-12705	152	25	,	,	PUNCT
ct-12705	152	26	mcgowan	mcgowan	PROPN
ct-12705	152	27	cm	cm	PROPN
ct-12705	152	28	,	,	PUNCT
ct-12705	152	29	et	et	PROPN
ct-12705	152	30	al	al	PROPN
ct-12705	152	31	:	:	PUNCT
ct-12705	152	32	toll	toll	NOUN
ct-12705	152	33	-	-	PUNCT
ct-12705	152	34	like	like	ADJ
ct-12705	152	35	receptor	receptor	NOUN
ct-12705	152	36	and	and	CCONJ
ct-12705	152	37	pro	pro	ADJ
ct-12705	152	38	-	-	ADJ
ct-12705	152	39	inflammatory	inflammatory	ADJ
ct-12705	152	40	cytokine	cytokine	ADJ
ct-12705	152	41	expression	expression	NOUN
ct-12705	152	42	during	during	ADP
ct-12705	152	43	prolonged	prolonged	ADJ
ct-12705	152	44	hyperinsulinaemia	hyperinsulinaemia	NOUN
ct-12705	152	45	in	in	ADP
ct-12705	152	46	horses	horse	NOUN
ct-12705	152	47	:	:	PUNCT
ct-12705	152	48	implications	implication	NOUN
ct-12705	152	49	for	for	ADP
ct-12705	152	50	laminitis	laminitis	NOUN
ct-12705	152	51	.	.	PUNCT
ct-12705	153	1	vet	vet	NOUN
ct-12705	153	2	immunol	immunol	NOUN
ct-12705	153	3	immunopathol	immunopathol	PROPN
ct-12705	153	4	2014;157:78	2014;157:78	NUM
ct-12705	153	5	-	-	SYM
ct-12705	153	6	86	86	NUM
ct-12705	153	7	.	.	PUNCT
ct-12705	154	1	doi	doi	NOUN
ct-12705	154	2	:	:	PUNCT
ct-12705	154	3	10.1016	10.1016	NUM
ct-12705	154	4	/	/	SYM
ct-12705	154	5	j.	j.	PROPN
ct-12705	154	6	vetimm.2013.10.010	vetimm.2013.10.010	PROPN
ct-12705	154	7	8	8	NUM
ct-12705	154	8	.	.	PUNCT
ct-12705	155	1	kennedy	kennedy	PROPN
ct-12705	155	2	r	r	PROPN
ct-12705	155	3	,	,	PUNCT
ct-12705	155	4	lappin	lappin	NOUN
ct-12705	155	5	df	df	PROPN
ct-12705	155	6	,	,	PUNCT
ct-12705	155	7	dixon	dixon	PROPN
ct-12705	155	8	pm	pm	PROPN
ct-12705	155	9	,	,	PUNCT
ct-12705	155	10	et	et	PROPN
ct-12705	155	11	al	al	PROPN
ct-12705	155	12	:	:	PUNCT
ct-12705	155	13	gingival	gingival	NOUN
ct-12705	155	14	toll	toll	NOUN
ct-12705	155	15	-	-	PUNCT
ct-12705	155	16	like	like	ADJ
ct-12705	155	17	receptor	receptor	NOUN
ct-12705	155	18	and	and	CCONJ
ct-12705	155	19	cytokine	cytokine	ADJ
ct-12705	155	20	messenger	messenger	NOUN
ct-12705	155	21	rna	rna	NOUN
ct-12705	155	22	levels	level	NOUN
ct-12705	155	23	in	in	ADP
ct-12705	155	24	equine	equine	NOUN
ct-12705	155	25	periodontitis	periodontitis	NOUN
ct-12705	155	26	and	and	CCONJ
ct-12705	155	27	oral	oral	ADJ
ct-12705	155	28	health	health	NOUN
ct-12705	155	29	.	.	PUNCT
ct-12705	156	1	equine	equine	NOUN
ct-12705	156	2	vet	vet	NOUN
ct-12705	156	3	2017;49:294	2017;49:294	NOUN
ct-12705	156	4	-	-	SYM
ct-12705	156	5	299	299	NUM
ct-12705	156	6	.	.	PUNCT
ct-12705	157	1	doi	doi	NOUN
ct-12705	157	2	:	:	PUNCT
ct-12705	157	3	10.1111	10.1111	NUM
ct-12705	157	4	/	/	SYM
ct-12705	157	5	evj.12597	evj.12597	NUM
ct-12705	157	6	9	9	NUM
ct-12705	157	7	.	.	PUNCT
ct-12705	158	1	gornik	gornik	PROPN
ct-12705	158	2	k	k	PROPN
ct-12705	158	3	,	,	PUNCT
ct-12705	158	4	moore	moore	PROPN
ct-12705	158	5	p	p	PROPN
ct-12705	158	6	,	,	PUNCT
ct-12705	158	7	figueiredo	figueiredo	PROPN
ct-12705	158	8	m	m	PROPN
ct-12705	158	9	,	,	PUNCT
ct-12705	158	10	et	et	PROPN
ct-12705	158	11	al	al	PROPN
ct-12705	158	12	:	:	PUNCT
ct-12705	158	13	expression	expression	NOUN
ct-12705	158	14	of	of	ADP
ct-12705	158	15	toll	toll	NOUN
ct-12705	158	16	-	-	PUNCT
ct-12705	158	17	like	like	ADJ
ct-12705	158	18	receptors	receptor	NOUN
ct-12705	158	19	2	2	NUM
ct-12705	158	20	,	,	PUNCT
ct-12705	158	21	3	3	NUM
ct-12705	158	22	,	,	PUNCT
ct-12705	158	23	4	4	NUM
ct-12705	158	24	,	,	PUNCT
ct-12705	158	25	6	6	NUM
ct-12705	158	26	,	,	PUNCT
ct-12705	158	27	9	9	NUM
ct-12705	158	28	,	,	PUNCT
ct-12705	158	29	and	and	CCONJ
ct-12705	158	30	md-2	md-2	ADV
ct-12705	158	31	in	in	ADP
ct-12705	158	32	the	the	DET
ct-12705	158	33	normal	normal	ADJ
ct-12705	158	34	equine	equine	NOUN
ct-12705	158	35	cornea	cornea	NOUN
ct-12705	158	36	,	,	PUNCT
ct-12705	158	37	limbus	limbus	NOUN
ct-12705	158	38	,	,	PUNCT
ct-12705	158	39	and	and	CCONJ
ct-12705	158	40	conjunctiva	conjunctiva	NOUN
ct-12705	158	41	.	.	PUNCT
ct-12705	159	1	vet	vet	NOUN
ct-12705	159	2	ophthalmol	ophthalmol	ADJ
ct-12705	159	3	2011;14:80	2011;14:80	NUM
ct-12705	159	4	-	-	SYM
ct-12705	159	5	85	85	NUM
ct-12705	159	6	.	.	PUNCT
ct-12705	160	1	doi	doi	NOUN
ct-12705	160	2	:	:	PUNCT
ct-12705	160	3	10.1111	10.1111	NUM
ct-12705	160	4	/	/	SYM
ct-12705	160	5	j.1463	j.1463	PROPN
ct-12705	160	6	-	-	X
ct-12705	160	7	5224.2010.00844.x	5224.2010.00844.x	NUM
ct-12705	160	8	10	10	NUM
ct-12705	160	9	.	.	PUNCT
ct-12705	161	1	park	park	PROPN
ct-12705	161	2	j	j	PROPN
ct-12705	161	3	-	-	PUNCT
ct-12705	161	4	w	w	PROPN
ct-12705	161	5	,	,	PUNCT
ct-12705	161	6	kim	kim	PROPN
ct-12705	161	7	k	k	PROPN
ct-12705	161	8	-	-	PROPN
ct-12705	161	9	h	h	PROPN
ct-12705	161	10	,	,	PUNCT
ct-12705	161	11	choi	choi	PROPN
ct-12705	161	12	j	j	PROPN
ct-12705	161	13	-	-	PROPN
ct-12705	161	14	k	k	PROPN
ct-12705	161	15	,	,	PUNCT
ct-12705	161	16	et	et	PROPN
ct-12705	161	17	al	al	PROPN
ct-12705	161	18	:	:	PUNCT
ct-12705	161	19	regulation	regulation	NOUN
ct-12705	161	20	of	of	ADP
ct-12705	161	21	toll	toll	NOUN
ct-12705	161	22	-	-	PUNCT
ct-12705	161	23	like	like	ADJ
ct-12705	161	24	receptors	receptor	NOUN
ct-12705	161	25	expression	expression	NOUN
ct-12705	161	26	in	in	ADP
ct-12705	161	27	muscle	muscle	NOUN
ct-12705	161	28	cells	cell	NOUN
ct-12705	161	29	by	by	ADP
ct-12705	161	30	exercise	exercise	NOUN
ct-12705	161	31	-	-	PUNCT
ct-12705	161	32	induced	induce	VERB
ct-12705	161	33	stress	stress	NOUN
ct-12705	161	34	.	.	PUNCT
ct-12705	162	1	anim	anim	NOUN
ct-12705	162	2	biosci	biosci	PROPN
ct-12705	162	3	2021;34:1590	2021;34:1590	PROPN
ct-12705	162	4	.	.	PUNCT
ct-12705	163	1	doi	doi	NOUN
ct-12705	163	2	:	:	PUNCT
ct-12705	163	3	10.5713	10.5713	NUM
ct-12705	163	4	/	/	SYM
ct-12705	163	5	ab.20.0484	ab.20.0484	ADJ
ct-12705	163	6	11	11	NUM
ct-12705	163	7	.	.	PUNCT
ct-12705	164	1	waller	waller	PROPN
ct-12705	164	2	ap	ap	PROPN
ct-12705	164	3	,	,	PUNCT
ct-12705	164	4	huettner	huettner	PROPN
ct-12705	164	5	l	l	PROPN
ct-12705	164	6	,	,	PUNCT
ct-12705	164	7	kohler	kohler	PROPN
ct-12705	164	8	k	k	PROPN
ct-12705	164	9	,	,	PUNCT
ct-12705	164	10	et	et	PROPN
ct-12705	164	11	al	al	PROPN
ct-12705	164	12	:	:	PUNCT
ct-12705	164	13	novel	novel	ADJ
ct-12705	164	14	link	link	NOUN
ct-12705	164	15	between	between	ADP
ct-12705	164	16	inflammation	inflammation	NOUN
ct-12705	164	17	and	and	CCONJ
ct-12705	164	18	impaired	impaired	ADJ
ct-12705	164	19	glucose	glucose	NOUN
ct-12705	164	20	transport	transport	NOUN
ct-12705	164	21	during	during	ADP
ct-12705	164	22	equine	equine	NOUN
ct-12705	164	23	insulin	insulin	NOUN
ct-12705	164	24	resistance	resistance	NOUN
ct-12705	164	25	.	.	PUNCT
ct-12705	165	1	vet	vet	NOUN
ct-12705	165	2	immunol	immunol	NOUN
ct-12705	165	3	immunopathol	immunopathol	PROPN
ct-12705	165	4	2012;149:208	2012;149:208	NUM
ct-12705	165	5	-	-	SYM
ct-12705	165	6	215	215	NUM
ct-12705	165	7	.	.	PUNCT
ct-12705	166	1	doi	doi	NOUN
ct-12705	166	2	:	:	PUNCT
ct-12705	166	3	10.1016	10.1016	NUM
ct-12705	166	4	/	/	SYM
ct-12705	166	5	j.vetimm.2012.07.003	j.vetimm.2012.07.003	PROPN
ct-12705	166	6	12	12	NUM
ct-12705	166	7	.	.	PUNCT
ct-12705	167	1	schöniger	schöniger	PROPN
ct-12705	167	2	s	s	PROPN
ct-12705	167	3	,	,	PUNCT
ct-12705	167	4	gräfe	gräfe	NOUN
ct-12705	167	5	h	h	NOUN
ct-12705	167	6	,	,	PUNCT
ct-12705	167	7	wipplinger	wipplinger	NOUN
ct-12705	167	8	m	m	PROPN
ct-12705	167	9	,	,	PUNCT
ct-12705	167	10	et	et	PROPN
ct-12705	167	11	al	al	PROPN
ct-12705	167	12	:	:	PUNCT
ct-12705	167	13	expression	expression	NOUN
ct-12705	167	14	of	of	ADP
ct-12705	167	15	toll	toll	NOUN
ct-12705	167	16	-	-	PUNCT
ct-12705	167	17	like	like	ADJ
ct-12705	167	18	receptors	receptor	NOUN
ct-12705	167	19	2	2	NUM
ct-12705	167	20	,	,	PUNCT
ct-12705	167	21	4	4	NUM
ct-12705	167	22	and	and	CCONJ
ct-12705	167	23	6	6	NUM
ct-12705	167	24	in	in	ADP
ct-12705	167	25	the	the	DET
ct-12705	167	26	equine	equine	NOUN
ct-12705	167	27	chorioallantois	chorioallantois	NOUN
ct-12705	167	28	.	.	PUNCT
ct-12705	168	1	vet	vet	NOUN
ct-12705	168	2	immunol	immunol	NOUN
ct-12705	168	3	immunopathol	immunopathol	PROPN
ct-12705	168	4	2018;206:49	2018;206:49	NUM
ct-12705	168	5	-	-	SYM
ct-12705	168	6	53	53	NUM
ct-12705	168	7	.	.	PUNCT
ct-12705	169	1	doi	doi	NOUN
ct-12705	169	2	:	:	PUNCT
ct-12705	169	3	10.1016	10.1016	NUM
ct-12705	169	4	/	/	SYM
ct-12705	169	5	j.vetimm.2018.11.010	j.vetimm.2018.11.010	PROPN
ct-12705	169	6	13	13	NUM
ct-12705	169	7	.	.	PUNCT
ct-12705	170	1	schöniger	schöniger	PROPN
ct-12705	170	2	s	s	PROPN
ct-12705	170	3	,	,	PUNCT
ct-12705	170	4	gräfe	gräfe	PROPN
ct-12705	170	5	h	h	NOUN
ct-12705	170	6	,	,	PUNCT
ct-12705	170	7	schoon	schoon	PROPN
ct-12705	170	8	ha	ha	NOUN
ct-12705	170	9	:	:	PUNCT
ct-12705	170	10	expression	expression	NOUN
ct-12705	170	11	of	of	ADP
ct-12705	170	12	toll	toll	NOUN
ct-12705	170	13	-	-	PUNCT
ct-12705	170	14	like	like	ADJ
ct-12705	170	15	receptors	receptor	NOUN
ct-12705	170	16	2	2	NUM
ct-12705	170	17	,	,	PUNCT
ct-12705	170	18	4	4	NUM
ct-12705	170	19	and	and	CCONJ
ct-12705	170	20	6	6	NUM
ct-12705	170	21	in	in	ADP
ct-12705	170	22	different	different	ADJ
ct-12705	170	23	cell	cell	NOUN
ct-12705	170	24	populations	population	NOUN
ct-12705	170	25	of	of	ADP
ct-12705	170	26	the	the	DET
ct-12705	170	27	equine	equine	NOUN
ct-12705	170	28	endometrium	endometrium	NOUN
ct-12705	170	29	.	.	PUNCT
ct-12705	171	1	vet	vet	NOUN
ct-12705	171	2	immunol	immunol	NOUN
ct-12705	171	3	immunopathol	immunopathol	NOUN
ct-12705	171	4	2017;185:7	2017;185:7	NUM
ct-12705	171	5	-	-	SYM
ct-12705	171	6	13	13	NUM
ct-12705	171	7	.	.	PUNCT
ct-12705	172	1	doi	doi	NOUN
ct-12705	172	2	:	:	PUNCT
ct-12705	172	3	10.1016	10.1016	NUM
ct-12705	172	4	/	/	SYM
ct-12705	172	5	j.vetimm.2017.01.002	j.vetimm.2017.01.002	NOUN
ct-12705	172	6	14	14	NUM
ct-12705	172	7	.	.	PUNCT
ct-12705	173	1	siemieniuch	siemieniuch	PROPN
ct-12705	173	2	mj	mj	PROPN
ct-12705	173	3	,	,	PUNCT
ct-12705	173	4	szóstek	szóstek	PROPN
ct-12705	173	5	az	az	PROPN
ct-12705	173	6	,	,	PUNCT
ct-12705	173	7	gajos	gajos	PROPN
ct-12705	173	8	k	k	PROPN
ct-12705	173	9	,	,	PUNCT
ct-12705	173	10	et	et	PROPN
ct-12705	173	11	al	al	PROPN
ct-12705	173	12	:	:	PUNCT
ct-12705	173	13	type	type	NOUN
ct-12705	173	14	of	of	ADP
ct-12705	173	15	inflammation	inflammation	NOUN
ct-12705	173	16	differentially	differentially	ADV
ct-12705	173	17	affects	affect	VERB
ct-12705	173	18	expression	expression	NOUN
ct-12705	173	19	of	of	ADP
ct-12705	173	20	interleukin	interleukin	NOUN
ct-12705	173	21	1β	1β	NUM
ct-12705	173	22	and	and	CCONJ
ct-12705	173	23	6	6	NUM
ct-12705	173	24	,	,	PUNCT
ct-12705	173	25	tumor	tumor	NOUN
ct-12705	173	26	necrosis	necrosis	NOUN
ct-12705	173	27	factor	factor	NOUN
ct-12705	173	28	-	-	PUNCT
ct-12705	173	29	α	α	NOUN
ct-12705	173	30	and	and	CCONJ
ct-12705	173	31	toll	toll	NOUN
ct-12705	173	32	-	-	PUNCT
ct-12705	173	33	like	like	ADJ
ct-12705	173	34	receptors	receptor	NOUN
ct-12705	173	35	in	in	ADP
ct-12705	173	36	subclinical	subclinical	ADJ
ct-12705	173	37	endometritis	endometritis	NOUN
ct-12705	173	38	in	in	ADP
ct-12705	173	39	mares	mare	NOUN
ct-12705	173	40	.	.	PUNCT
ct-12705	174	1	plos	plos	PROPN
ct-12705	174	2	one	one	NUM
ct-12705	174	3	2016;11	2016;11	NOUN
ct-12705	174	4	:	:	PUNCT
ct-12705	174	5	e0154934	e0154934	NOUN
ct-12705	174	6	.	.	PUNCT
ct-12705	175	1	doi	doi	NOUN
ct-12705	175	2	:	:	PUNCT
ct-12705	175	3	10.1371	10.1371	NUM
ct-12705	175	4	/	/	SYM
ct-12705	175	5	journal	journal	NOUN
ct-12705	175	6	.	.	PUNCT
ct-12705	176	1	pone.0154934	pone.0154934	PROPN
ct-12705	176	2	15	15	NUM
ct-12705	176	3	.	.	PUNCT
ct-12705	177	1	el	el	PROPN
ct-12705	177	2	-	-	PUNCT
ct-12705	177	3	sheikh	sheikh	PROPN
ct-12705	177	4	ali	ali	PROPN
ct-12705	177	5	h	h	PROPN
ct-12705	177	6	,	,	PUNCT
ct-12705	177	7	dini	dini	NOUN
ct-12705	177	8	p	p	NOUN
ct-12705	177	9	,	,	PUNCT
ct-12705	177	10	scoggin	scoggin	NOUN
ct-12705	177	11	k	k	PROPN
ct-12705	177	12	,	,	PUNCT
ct-12705	177	13	et	et	PROPN
ct-12705	177	14	al	al	PROPN
ct-12705	177	15	:	:	PUNCT
ct-12705	177	16	transcriptomic	transcriptomic	ADJ
ct-12705	177	17	analysis	analysis	NOUN
ct-12705	177	18	of	of	ADP
ct-12705	177	19	 	 	SPACE
ct-12705	177	20	equine	equine	NOUN
ct-12705	177	21	placenta	placenta	NOUN
ct-12705	177	22	reveals	reveal	VERB
ct-12705	177	23	key	key	ADJ
ct-12705	177	24	regulators	regulator	NOUN
ct-12705	177	25	and	and	CCONJ
ct-12705	177	26	pathways	pathway	NOUN
ct-12705	177	27	involved	involve	VERB
ct-12705	177	28	 	 	SPACE
ct-12705	177	29	in	in	ADP
ct-12705	177	30	ascending	ascend	VERB
ct-12705	177	31	placentitis	placentitis	PROPN
ct-12705	177	32	.	.	PUNCT
ct-12705	178	1	biol	biol	PROPN
ct-12705	178	2	reprod	reprod	PROPN
ct-12705	178	3	2021;104:638	2021;104:638	NUM
ct-12705	178	4	-	-	SYM
ct-12705	178	5	656	656	NUM
ct-12705	178	6	.	.	PUNCT
ct-12705	179	1	doi	doi	NOUN
ct-12705	179	2	:	:	PUNCT
ct-12705	179	3	10.1093	10.1093	NUM
ct-12705	179	4	/	/	SYM
ct-12705	179	5	biolre	biolre	NOUN
ct-12705	179	6	/	/	SYM
ct-12705	179	7	ioaa209	ioaa209	PROPN
ct-12705	179	8	16	16	NUM
ct-12705	179	9	.	.	PUNCT
ct-12705	180	1	marth	marth	PROPN
ct-12705	180	2	cd	cd	PROPN
ct-12705	180	3	,	,	PUNCT
ct-12705	180	4	firestone	firestone	PROPN
ct-12705	180	5	sm	sm	PROPN
ct-12705	180	6	,	,	PUNCT
ct-12705	180	7	glenton	glenton	PROPN
ct-12705	180	8	ly	ly	PROPN
ct-12705	180	9	,	,	PUNCT
ct-12705	180	10	et	et	PROPN
ct-12705	180	11	al	al	PROPN
ct-12705	180	12	:	:	PUNCT
ct-12705	180	13	oestrous	oestrous	ADJ
ct-12705	180	14	cycle	cycle	NOUN
ct-12705	180	15	-	-	PUNCT
ct-12705	180	16	dependent	dependent	ADJ
ct-12705	180	17	equine	equine	NOUN
ct-12705	180	18	uterine	uterine	ADJ
ct-12705	180	19	immune	immune	ADJ
ct-12705	180	20	response	response	NOUN
ct-12705	180	21	to	to	AUX
ct-12705	180	22	induced	induce	VERB
ct-12705	180	23	infectious	infectious	ADJ
ct-12705	180	24	endometritis	endometritis	NOUN
ct-12705	180	25	.	.	PUNCT
ct-12705	181	1	vet	vet	NOUN
ct-12705	181	2	res	re	NOUN
ct-12705	181	3	2016;47:110	2016;47:110	NUM
ct-12705	181	4	.	.	PUNCT
ct-12705	182	1	doi	doi	NOUN
ct-12705	182	2	:	:	PUNCT
ct-12705	182	3	10.1186	10.1186	NUM
ct-12705	182	4	/	/	SYM
ct-12705	182	5	s13567	s13567	NOUN
ct-12705	182	6	-	-	PUNCT
ct-12705	182	7	016	016	NUM
ct-12705	182	8	-	-	PUNCT
ct-12705	182	9	0398	0398	NUM
ct-12705	182	10	-	-	PUNCT
ct-12705	182	11	x	x	SYM
ct-12705	182	12	17	17	NUM
ct-12705	182	13	.	.	PUNCT
ct-12705	183	1	hedger	hedger	PROPN
ct-12705	183	2	mp	mp	PROPN
ct-12705	183	3	:	:	PUNCT
ct-12705	183	4	toll	toll	NOUN
ct-12705	183	5	-	-	PUNCT
ct-12705	183	6	like	like	ADJ
ct-12705	183	7	receptors	receptor	NOUN
ct-12705	183	8	and	and	CCONJ
ct-12705	183	9	signaling	signal	VERB
ct-12705	183	10	in	in	ADP
ct-12705	183	11	spermatogenesis	spermatogenesis	NOUN
ct-12705	183	12	and	and	CCONJ
ct-12705	183	13	testicular	testicular	ADJ
ct-12705	183	14	responses	response	NOUN
ct-12705	183	15	to	to	PART
ct-12705	183	16	inflammation	inflammation	NOUN
ct-12705	183	17	a	a	DET
ct-12705	183	18	perspective	perspective	NOUN
ct-12705	183	19	.	.	PUNCT
ct-12705	184	1	j	j	PROPN
ct-12705	184	2	reprod	reprod	PROPN
ct-12705	184	3	immunol	immunol	PROPN
ct-12705	184	4	2011;88:130	2011;88:130	PROPN
ct-12705	184	5	-	-	PUNCT
ct-12705	184	6	41	41	NUM
ct-12705	184	7	.	.	PUNCT
ct-12705	185	1	doi	doi	NOUN
ct-12705	185	2	:	:	PUNCT
ct-12705	185	3	10.1016	10.1016	NUM
ct-12705	185	4	/	/	SYM
ct-12705	185	5	j.jri.2011.01.010	j.jri.2011.01.010	PROPN
ct-12705	185	6	18	18	NUM
ct-12705	185	7	.	.	PUNCT
ct-12705	186	1	bhushan	bhushan	PROPN
ct-12705	186	2	s	s	PROPN
ct-12705	186	3	,	,	PUNCT
ct-12705	186	4	schuppe	schuppe	PROPN
ct-12705	186	5	hc	hc	PROPN
ct-12705	186	6	,	,	PUNCT
ct-12705	186	7	fijak	fijak	ADV
ct-12705	186	8	m	m	PROPN
ct-12705	186	9	,	,	PUNCT
ct-12705	186	10	et	et	PROPN
ct-12705	186	11	al	al	PROPN
ct-12705	186	12	:	:	PUNCT
ct-12705	186	13	testicular	testicular	ADJ
ct-12705	186	14	infection	infection	NOUN
ct-12705	186	15	:	:	PUNCT
ct-12705	186	16	microorganisms	microorganism	NOUN
ct-12705	186	17	,	,	PUNCT
ct-12705	186	18	clinical	clinical	ADJ
ct-12705	186	19	implications	implication	NOUN
ct-12705	186	20	and	and	CCONJ
ct-12705	186	21	host	host	NOUN
ct-12705	186	22	–	–	PUNCT
ct-12705	186	23	pathogen	pathogen	NOUN
ct-12705	186	24	interaction	interaction	NOUN
ct-12705	186	25	.	.	PUNCT
ct-12705	187	1	j	j	PROPN
ct-12705	187	2	reprod	reprod	PROPN
ct-12705	187	3	immunol	immunol	PROPN
ct-12705	187	4	2009;83:164	2009;83:164	NUM
ct-12705	187	5	-	-	SYM
ct-12705	187	6	167	167	NUM
ct-12705	187	7	.	.	PUNCT
ct-12705	188	1	doi	doi	NOUN
ct-12705	188	2	:	:	PUNCT
ct-12705	188	3	10.1016	10.1016	NUM
ct-12705	188	4	/	/	SYM
ct-12705	188	5	j.	j.	PROPN
ct-12705	188	6	jri.2009.07.007	jri.2009.07.007	PROPN
ct-12705	188	7	19	19	NUM
ct-12705	188	8	.	.	PUNCT
ct-12705	189	1	michailidis	michailidis	PROPN
ct-12705	189	2	g	g	PROPN
ct-12705	189	3	,	,	PUNCT
ct-12705	189	4	anastasiadou	anastasiadou	NOUN
ct-12705	189	5	m	m	PROPN
ct-12705	189	6	,	,	PUNCT
ct-12705	189	7	guibert	guibert	ADJ
ct-12705	189	8	e	e	NOUN
ct-12705	189	9	,	,	PUNCT
ct-12705	189	10	et	et	PROPN
ct-12705	189	11	al	al	PROPN
ct-12705	189	12	:	:	PUNCT
ct-12705	189	13	activation	activation	NOUN
ct-12705	189	14	of	of	ADP
ct-12705	189	15	innate	innate	ADJ
ct-12705	189	16	immune	immune	ADJ
ct-12705	189	17	system	system	NOUN
ct-12705	189	18	in	in	ADP
ct-12705	189	19	response	response	NOUN
ct-12705	189	20	to	to	PART
ct-12705	189	21	lipopolysaccharide	lipopolysaccharide	VERB
ct-12705	189	22	in	in	ADP
ct-12705	189	23	chicken	chicken	NOUN
ct-12705	189	24	sertoli	sertoli	NOUN
ct-12705	189	25	cells	cell	NOUN
ct-12705	189	26	.	.	PUNCT
ct-12705	190	1	reproduction	reproduction	NOUN
ct-12705	190	2	2014;148259	2014;148259	NUM
ct-12705	190	3	-	-	SYM
ct-12705	190	4	270	270	NUM
ct-12705	190	5	.	.	PUNCT
ct-12705	191	1	doi	doi	NOUN
ct-12705	191	2	:	:	PUNCT
ct-12705	191	3	10.1530	10.1530	NUM
ct-12705	191	4	/	/	SYM
ct-12705	191	5	rep-14	rep-14	NOUN
ct-12705	191	6	-	-	NOUN
ct-12705	191	7	0064	0064	NUM
ct-12705	191	8	20	20	NUM
ct-12705	191	9	.	.	PUNCT
ct-12705	192	1	zhang	zhang	PROPN
ct-12705	192	2	x	x	PROPN
ct-12705	192	3	,	,	PUNCT
ct-12705	192	4	wang	wang	PROPN
ct-12705	192	5	t	t	PROPN
ct-12705	192	6	,	,	PUNCT
ct-12705	192	7	deng	deng	PROPN
ct-12705	192	8	t	t	PROPN
ct-12705	192	9	,	,	PUNCT
ct-12705	192	10	et	et	PROPN
ct-12705	192	11	al	al	PROPN
ct-12705	192	12	:	:	PUNCT
ct-12705	192	13	damaged	damage	VERB
ct-12705	192	14	spermatogenic	spermatogenic	ADJ
ct-12705	192	15	cells	cell	NOUN
ct-12705	192	16	induce	induce	VERB
ct-12705	192	17	inflammatory	inflammatory	ADJ
ct-12705	192	18	gene	gene	NOUN
ct-12705	192	19	expression	expression	NOUN
ct-12705	192	20	in	in	ADP
ct-12705	192	21	mouse	mouse	NOUN
ct-12705	192	22	sertoli	sertoli	NOUN
ct-12705	192	23	cells	cell	NOUN
ct-12705	192	24	through	through	ADP
ct-12705	192	25	the	the	DET
ct-12705	192	26	activation	activation	NOUN
ct-12705	192	27	of	of	ADP
ct-12705	192	28	toll	toll	NOUN
ct-12705	192	29	-	-	PUNCT
ct-12705	192	30	like	like	ADJ
ct-12705	192	31	receptors	receptor	NOUN
ct-12705	192	32	2	2	NUM
ct-12705	192	33	and	and	CCONJ
ct-12705	192	34	4	4	NUM
ct-12705	192	35	.	.	NOUN
ct-12705	192	36	mol	mol	ADP
ct-12705	192	37	cell	cell	NOUN
ct-12705	192	38	endocrinol	endocrinol	NOUN
ct-12705	192	39	2013;365:162	2013;365:162	NUM
ct-12705	192	40	-	-	PROPN
ct-12705	192	41	173	173	NUM
ct-12705	192	42	.	.	PUNCT
ct-12705	193	1	doi	doi	NOUN
ct-12705	193	2	:	:	PUNCT
ct-12705	193	3	10.1016	10.1016	NUM
ct-12705	193	4	/	/	SYM
ct-12705	193	5	j.mce.2012.10.016	j.mce.2012.10.016	PROPN
ct-12705	193	6	21	21	NUM
ct-12705	193	7	.	.	PUNCT
ct-12705	194	1	fujita	fujita	PROPN
ct-12705	194	2	y	y	PROPN
ct-12705	194	3	,	,	PUNCT
ct-12705	194	4	mihara	mihara	PROPN
ct-12705	194	5	t	t	PROPN
ct-12705	194	6	,	,	PUNCT
ct-12705	194	7	okazaki	okazaki	PROPN
ct-12705	194	8	t	t	PROPN
ct-12705	194	9	,	,	PUNCT
ct-12705	194	10	et	et	PROPN
ct-12705	194	11	al	al	PROPN
ct-12705	194	12	:	:	PUNCT
ct-12705	194	13	toll	toll	NOUN
ct-12705	194	14	-	-	PUNCT
ct-12705	194	15	like	like	ADJ
ct-12705	194	16	receptors	receptor	NOUN
ct-12705	194	17	(	(	PUNCT
ct-12705	194	18	tlr	tlr	PROPN
ct-12705	194	19	)	)	PUNCT
ct-12705	194	20	2	2	NUM
ct-12705	194	21	and	and	CCONJ
ct-12705	194	22	4	4	NUM
ct-12705	194	23	on	on	ADP
ct-12705	194	24	human	human	ADJ
ct-12705	194	25	sperm	sperm	NOUN
ct-12705	194	26	recognize	recognize	VERB
ct-12705	194	27	bacterial	bacterial	ADJ
ct-12705	194	28	endotoxins	endotoxin	NOUN
ct-12705	194	29	and	and	CCONJ
ct-12705	194	30	mediate	mediate	ADJ
ct-12705	194	31	apoptosis	apoptosis	NOUN
ct-12705	194	32	.	.	PUNCT
ct-12705	195	1	human	human	ADJ
ct-12705	195	2	reprod	reprod	PROPN
ct-12705	195	3	2011;26:2799	2011;26:2799	NUM
ct-12705	195	4	-	-	SYM
ct-12705	195	5	2806	2806	NUM
ct-12705	195	6	.	.	PUNCT
ct-12705	196	1	doi	doi	NOUN
ct-12705	196	2	:	:	PUNCT
ct-12705	196	3	10.1093	10.1093	NUM
ct-12705	196	4	/	/	SYM
ct-12705	196	5	humrep/	humrep/	PROPN
ct-12705	196	6	der234	der234	PROPN
ct-12705	196	7	22	22	NUM
ct-12705	196	8	.	.	PUNCT
ct-12705	197	1	liu	liu	PROPN
ct-12705	197	2	z	z	PROPN
ct-12705	197	3	,	,	PUNCT
ct-12705	197	4	zhao	zhao	PROPN
ct-12705	197	5	s	s	PROPN
ct-12705	197	6	,	,	PUNCT
ct-12705	197	7	chen	chen	PROPN
ct-12705	197	8	q	q	PROPN
ct-12705	197	9	,	,	PUNCT
ct-12705	197	10	et	et	PROPN
ct-12705	197	11	al	al	PROPN
ct-12705	197	12	:	:	PUNCT
ct-12705	197	13	roles	role	NOUN
ct-12705	197	14	of	of	ADP
ct-12705	197	15	toll	toll	NOUN
ct-12705	197	16	-	-	PUNCT
ct-12705	197	17	like	like	ADJ
ct-12705	197	18	receptors	receptor	NOUN
ct-12705	197	19	2	2	NUM
ct-12705	197	20	and	and	CCONJ
ct-12705	197	21	4	4	NUM
ct-12705	197	22	in	in	ADP
ct-12705	197	23	mediating	mediate	VERB
ct-12705	197	24	experimental	experimental	ADJ
ct-12705	197	25	autoimmune	autoimmune	ADJ
ct-12705	197	26	orchitis	orchitis	NOUN
ct-12705	197	27	induction	induction	NOUN
ct-12705	197	28	in	in	ADP
ct-12705	197	29	mice	mouse	NOUN
ct-12705	197	30	.	.	PUNCT
ct-12705	198	1	biol	biol	PROPN
ct-12705	198	2	reprod	reprod	PROPN
ct-12705	198	3	2015;92:1	2015;92:1	NUM
ct-12705	198	4	-	-	SYM
ct-12705	198	5	11	11	NUM
ct-12705	198	6	.	.	PUNCT
ct-12705	198	7	doi	doi	NOUN
ct-12705	198	8	:	:	PUNCT
ct-12705	198	9	10.1095	10.1095	NUM
ct-12705	198	10	/	/	SYM
ct-12705	198	11	biolreprod.114.123901	biolreprod.114.123901	NOUN
ct-12705	198	12	23	23	NUM
ct-12705	198	13	.	.	PUNCT
ct-12705	199	1	card	card	NOUN
ct-12705	199	2	c	c	NOUN
ct-12705	199	3	:	:	PUNCT
ct-12705	199	4	cellular	cellular	ADJ
ct-12705	199	5	associations	association	NOUN
ct-12705	199	6	and	and	CCONJ
ct-12705	199	7	the	the	DET
ct-12705	199	8	differential	differential	ADJ
ct-12705	199	9	spermiogram	spermiogram	NOUN
ct-12705	199	10	:	:	PUNCT
ct-12705	199	11	making	make	VERB
ct-12705	199	12	sense	sense	NOUN
ct-12705	199	13	of	of	ADP
ct-12705	199	14	stallion	stallion	NOUN
ct-12705	199	15	spermatozoal	spermatozoal	NOUN
ct-12705	199	16	morphology	morphology	NOUN
ct-12705	199	17	.	.	PUNCT
ct-12705	200	1	theriogenology	theriogenology	NOUN
ct-12705	200	2	2005;64:558	2005;64:558	PROPN
ct-12705	200	3	-	-	SYM
ct-12705	200	4	567	567	NUM
ct-12705	200	5	.	.	PUNCT
ct-12705	200	6	doi	doi	NOUN
ct-12705	200	7	:	:	PUNCT
ct-12705	200	8	10.1016	10.1016	NUM
ct-12705	200	9	/	/	SYM
ct-12705	200	10	j.theriogenology.2005.05.014	j.theriogenology.2005.05.014	PROPN
ct-12705	200	11	24	24	NUM
ct-12705	200	12	.	.	PUNCT
ct-12705	201	1	heckenbichler	heckenbichler	PROPN
ct-12705	201	2	s	s	PROPN
ct-12705	201	3	,	,	PUNCT
ct-12705	201	4	deichsel	deichsel	PROPN
ct-12705	201	5	k	k	PROPN
ct-12705	201	6	,	,	PUNCT
ct-12705	201	7	peters	peters	PROPN
ct-12705	201	8	p	p	PROPN
ct-12705	201	9	,	,	PUNCT
ct-12705	201	10	et	et	PROPN
ct-12705	201	11	al	al	PROPN
ct-12705	201	12	:	:	PUNCT
ct-12705	201	13	quality	quality	NOUN
ct-12705	201	14	,	,	PUNCT
ct-12705	201	15	and	and	CCONJ
ct-12705	201	16	fertility	fertility	NOUN
ct-12705	201	17	of	of	ADP
ct-12705	201	18	cooled	cool	VERB
ct-12705	201	19	-	-	PUNCT
ct-12705	201	20	shipped	ship	VERB
ct-12705	201	21	stallion	stallion	NOUN
ct-12705	201	22	semen	semen	NOUN
ct-12705	201	23	at	at	ADP
ct-12705	201	24	the	the	DET
ct-12705	201	25	time	time	NOUN
ct-12705	201	26	of	of	ADP
ct-12705	201	27	insemination	insemination	NOUN
ct-12705	201	28	.	.	PUNCT
ct-12705	202	1	theriogenology	theriogenology	NOUN
ct-12705	202	2	2011;75:849	2011;75:849	PROPN
ct-12705	202	3	-	-	SYM
ct-12705	202	4	856	856	NUM
ct-12705	202	5	.	.	PUNCT
ct-12705	202	6	doi	doi	NOUN
ct-12705	202	7	:	:	PUNCT
ct-12705	202	8	10.1016	10.1016	NUM
ct-12705	202	9	/	/	SYM
ct-12705	202	10	j.	j.	PROPN
ct-12705	202	11	theriogenology.2010.10.027	theriogenology.2010.10.027	PROPN
ct-12705	203	1	25	25	NUM
ct-12705	203	2	.	.	PUNCT
ct-12705	204	1	morrell	morrell	PROPN
ct-12705	204	2	jm	jm	PROPN
ct-12705	204	3	,	,	PUNCT
ct-12705	204	4	johannisson	johannisson	PROPN
ct-12705	204	5	a	a	PRON
ct-12705	204	6	,	,	PUNCT
ct-12705	204	7	dalin	dalin	PROPN
ct-12705	204	8	a	a	PROPN
ct-12705	204	9	-	-	PUNCT
ct-12705	204	10	m	m	NOUN
ct-12705	204	11	,	,	PUNCT
ct-12705	204	12	et	et	PROPN
ct-12705	204	13	al	al	PROPN
ct-12705	204	14	:	:	PUNCT
ct-12705	204	15	sperm	sperm	NOUN
ct-12705	204	16	morphology	morphology	NOUN
ct-12705	204	17	and	and	CCONJ
ct-12705	204	18	chromatin	chromatin	NOUN
ct-12705	204	19	integrity	integrity	NOUN
ct-12705	204	20	in	in	ADP
ct-12705	204	21	swedish	swedish	ADJ
ct-12705	204	22	warmblood	warmblood	PROPN
ct-12705	204	23	stallions	stallion	NOUN
ct-12705	204	24	and	and	CCONJ
ct-12705	204	25	their	their	PRON
ct-12705	204	26	relationship	relationship	NOUN
ct-12705	204	27	to	to	ADP
ct-12705	204	28	pregnancy	pregnancy	NOUN
ct-12705	204	29	rates	rate	NOUN
ct-12705	204	30	.	.	PUNCT
ct-12705	205	1	acta	acta	PROPN
ct-12705	205	2	vet	vet	PROPN
ct-12705	205	3	scand	scand	PROPN
ct-12705	205	4	2008;50:2	2008;50:2	PROPN
ct-12705	205	5	.	.	PUNCT
ct-12705	206	1	doi	doi	NOUN
ct-12705	206	2	:	:	PUNCT
ct-12705	206	3	10.1186/1751	10.1186/1751	NUM
ct-12705	206	4	-	-	PUNCT
ct-12705	206	5	0147	0147	NUM
ct-12705	206	6	-	-	PUNCT
ct-12705	206	7	50	50	NUM
ct-12705	206	8	-	-	SYM
ct-12705	206	9	2	2	NUM
ct-12705	206	10	26	26	NUM
ct-12705	206	11	.	.	PUNCT
ct-12705	207	1	pickett	pickett	PROPN
ct-12705	207	2	bw	bw	PROPN
ct-12705	207	3	,	,	PUNCT
ct-12705	207	4	voss	voss	PROPN
ct-12705	207	5	jl	jl	PROPN
ct-12705	207	6	,	,	PUNCT
ct-12705	207	7	bowen	bowen	PROPN
ct-12705	207	8	ra	ra	PROPN
ct-12705	207	9	,	,	PUNCT
ct-12705	207	10	et	et	PROPN
ct-12705	207	11	al	al	PROPN
ct-12705	207	12	:	:	PUNCT
ct-12705	207	13	seminal	seminal	ADJ
ct-12705	207	14	characteristics	characteristic	NOUN
ct-12705	207	15	and	and	CCONJ
ct-12705	207	16	total	total	ADJ
ct-12705	207	17	scrotal	scrotal	ADJ
ct-12705	207	18	width	width	NOUN
ct-12705	207	19	(	(	PUNCT
ct-12705	207	20	t.s.w	t.s.w	NOUN
ct-12705	207	21	.	.	PUNCT
ct-12705	207	22	)	)	PUNCT
ct-12705	208	1	of	of	ADP
ct-12705	208	2	normal	normal	ADJ
ct-12705	208	3	and	and	CCONJ
ct-12705	208	4	abnormal	abnormal	ADJ
ct-12705	208	5	stallions	stallion	NOUN
ct-12705	208	6	.	.	PUNCT
ct-12705	209	1	proc	proc	PROPN
ct-12705	209	2	am	be	AUX
ct-12705	209	3	assoc	assoc	PROPN
ct-12705	209	4	equine	equine	PROPN
ct-12705	209	5	pract	pract	PROPN
ct-12705	209	6	1987;33:487	1987;33:487	NUM
ct-12705	209	7	-	-	SYM
ct-12705	209	8	518	518	NUM
ct-12705	209	9	.	.	PUNCT
ct-12705	209	10	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	PROPN
ct-12705	209	11	https://doi.org/10.1016/j.tvjl.2006.10.010	https://doi.org/10.1016/j.tvjl.2006.10.010	PROPN
ct-12705	209	12	https://doi.org/10.1007/s11259-023-10245-4	https://doi.org/10.1007/s11259-023-10245-4	NUM
ct-12705	209	13	https://doi.org/10.1186/1297-9716-44-50	https://doi.org/10.1186/1297-9716-44-50	ADJ
ct-12705	209	14	https://doi.org/10.1007/s12016-015-8473-z	https://doi.org/10.1007/s12016-015-8473-z	NOUN
ct-12705	210	1	https://doi.org/10.1002/eji.201545497	https://doi.org/10.1002/eji.201545497	PROPN
ct-12705	210	2	https://doi.org/10.1002/eji.201545497	https://doi.org/10.1002/eji.201545497	PROPN
ct-12705	210	3	https://doi.org/10.1186/s13104-016-2161-9	https://doi.org/10.1186/s13104-016-2161-9	PROPN
ct-12705	211	1	https://doi.org/10.1016/j.vetimm.2013.10.010	https://doi.org/10.1016/j.vetimm.2013.10.010	NOUN
ct-12705	211	2	https://doi.org/10.1016/j.vetimm.2013.10.010	https://doi.org/10.1016/j.vetimm.2013.10.010	PROPN
ct-12705	211	3	https://doi.org/10.1111/evj.12597	https://doi.org/10.1111/evj.12597	PROPN
ct-12705	211	4	https://doi.org/10.1111/j.1463-5224.2010.00844.x	https://doi.org/10.1111/j.1463-5224.2010.00844.x	PROPN
ct-12705	212	1	https://doi.org/10.5713/ab.20.0484	https://doi.org/10.5713/ab.20.0484	X
ct-12705	212	2	https://doi.org/10.1016/j.vetimm.2012.07.003	https://doi.org/10.1016/j.vetimm.2012.07.003	PROPN
ct-12705	212	3	https://doi.org/10.1016/j.vetimm.2018.11.010	https://doi.org/10.1016/j.vetimm.2018.11.010	PROPN
ct-12705	212	4	https://doi.org/10.1016/j.vetimm.2017.01.002	https://doi.org/10.1016/j.vetimm.2017.01.002	NOUN
ct-12705	212	5	https://doi.org/10.1371/journal.pone.0154934	https://doi.org/10.1371/journal.pone.0154934	NOUN
ct-12705	212	6	https://doi.org/10.1371/journal.pone.0154934	https://doi.org/10.1371/journal.pone.0154934	NOUN
ct-12705	212	7	https://doi.org/10.1093/biolre/ioaa209	https://doi.org/10.1093/biolre/ioaa209	ADV
ct-12705	212	8	https://doi.org/10.1186/s13567-016-0398-x	https://doi.org/10.1186/s13567-016-0398-x	VERB
ct-12705	212	9	https://doi.org/10.1016/j.jri.2011.01.010	https://doi.org/10.1016/j.jri.2011.01.010	PROPN
ct-12705	212	10	https://doi.org/10.1016/j.jri.2009.07.007	https://doi.org/10.1016/j.jri.2009.07.007	PROPN
ct-12705	212	11	https://doi.org/10.1016/j.jri.2009.07.007	https://doi.org/10.1016/j.jri.2009.07.007	PROPN
ct-12705	212	12	https://doi.org/10.1530/rep-14-0064	https://doi.org/10.1530/rep-14-0064	PROPN
ct-12705	212	13	https://doi.org/10.1016/j.mce.2012.10.016	https://doi.org/10.1016/j.mce.2012.10.016	PROPN
ct-12705	212	14	https://doi.org/10.1093/humrep/der234	https://doi.org/10.1093/humrep/der234	ADJ
ct-12705	212	15	https://doi.org/10.1093/humrep/der234	https://doi.org/10.1093/humrep/der234	ADJ
ct-12705	212	16	https://doi.org/10.1095/biolreprod.114.123901	https://doi.org/10.1095/biolreprod.114.123901	NOUN
ct-12705	212	17	https://doi.org/10.1016/j.theriogenology.2005.05.014	https://doi.org/10.1016/j.theriogenology.2005.05.014	PROPN
ct-12705	212	18	https://doi.org/10.1016/j.theriogenology.2010.10.027	https://doi.org/10.1016/j.theriogenology.2010.10.027	PRON
ct-12705	212	19	https://doi.org/10.1016/j.theriogenology.2010.10.027	https://doi.org/10.1016/j.theriogenology.2010.10.027	PROPN
ct-12705	212	20	https://doi.org/10.1186/1751-0147-50-2	https://doi.org/10.1186/1751-0147-50-2	PROPN
ct-12705	212	21	8	8	NUM
ct-12705	212	22	citation	citation	NOUN
ct-12705	212	23	:	:	PUNCT
ct-12705	212	24	clinical	clinical	ADJ
ct-12705	212	25	theriogenology	theriogenology	NOUN
ct-12705	212	26	2025	2025	NUM
ct-12705	212	27	,	,	PUNCT
ct-12705	212	28	17	17	NUM
ct-12705	212	29	,	,	PUNCT
ct-12705	212	30	12705	12705	NUM
ct-12705	212	31	,	,	PUNCT
ct-12705	212	32	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NOUN
ct-12705	212	33	27	27	NUM
ct-12705	212	34	.	.	PUNCT
ct-12705	213	1	kenney	kenney	PROPN
ct-12705	213	2	rm	rm	PROPN
ct-12705	213	3	,	,	PUNCT
ct-12705	213	4	kingston	kingston	PROPN
ct-12705	213	5	rs	rs	PROPN
ct-12705	213	6	,	,	PUNCT
ct-12705	213	7	rajamannon	rajamannon	PROPN
ct-12705	213	8	ah	ah	INTJ
ct-12705	213	9	,	,	PUNCT
ct-12705	213	10	et	et	PROPN
ct-12705	213	11	al	al	PROPN
ct-12705	213	12	:	:	PUNCT
ct-12705	213	13	stallion	stallion	NOUN
ct-12705	213	14	semen	semen	NOUN
ct-12705	213	15	characteristics	characteristic	NOUN
ct-12705	213	16	for	for	ADP
ct-12705	213	17	predicting	predict	VERB
ct-12705	213	18	fertility	fertility	NOUN
ct-12705	213	19	.	.	PUNCT
ct-12705	214	1	proc	proc	PROPN
ct-12705	214	2	am	be	AUX
ct-12705	214	3	assoc	assoc	PROPN
ct-12705	214	4	equine	equine	PROPN
ct-12705	214	5	pract	pract	PROPN
ct-12705	214	6	1971;17:53	1971;17:53	NUM
ct-12705	214	7	-	-	SYM
ct-12705	214	8	67	67	NUM
ct-12705	214	9	.	.	PUNCT
ct-12705	215	1	28	28	NUM
ct-12705	215	2	.	.	PUNCT
ct-12705	216	1	bielanski	bielanski	VERB
ct-12705	216	2	w	w	PROPN
ct-12705	216	3	:	:	PUNCT
ct-12705	216	4	the	the	DET
ct-12705	216	5	evaluation	evaluation	NOUN
ct-12705	216	6	of	of	ADP
ct-12705	216	7	stallion	stallion	NOUN
ct-12705	216	8	semen	semen	NOUN
ct-12705	216	9	in	in	ADP
ct-12705	216	10	aspects	aspect	NOUN
ct-12705	216	11	of	of	ADP
ct-12705	216	12	fertility	fertility	NOUN
ct-12705	216	13	control	control	NOUN
ct-12705	216	14	and	and	CCONJ
ct-12705	216	15	its	its	PRON
ct-12705	216	16	use	use	NOUN
ct-12705	216	17	for	for	ADP
ct-12705	216	18	artificial	artificial	ADJ
ct-12705	216	19	insemination	insemination	NOUN
ct-12705	216	20	.	.	PUNCT
ct-12705	217	1	j	j	PROPN
ct-12705	217	2	reprod	reprod	PROPN
ct-12705	217	3	fertil	fertil	PROPN
ct-12705	217	4	suppl	suppl	ADJ
ct-12705	217	5	1975;23:19	1975;23:19	NUM
ct-12705	217	6	-	-	SYM
ct-12705	217	7	24	24	NUM
ct-12705	217	8	.	.	PUNCT
ct-12705	217	9	29	29	NUM
ct-12705	217	10	.	.	PUNCT
ct-12705	218	1	dott	dott	PROPN
ct-12705	218	2	hm	hm	PROPN
ct-12705	218	3	:	:	PUNCT
ct-12705	218	4	morphology	morphology	NOUN
ct-12705	218	5	of	of	ADP
ct-12705	218	6	stallion	stallion	NOUN
ct-12705	218	7	spermatozoa	spermatozoon	NOUN
ct-12705	218	8	.	.	PUNCT
ct-12705	219	1	j	j	PROPN
ct-12705	219	2	reprod	reprod	PROPN
ct-12705	219	3	fertil	fertil	PROPN
ct-12705	219	4	suppl	suppl	ADJ
ct-12705	219	5	1975;23:19	1975;23:19	NUM
ct-12705	219	6	-	-	SYM
ct-12705	219	7	24	24	NUM
ct-12705	219	8	.	.	PUNCT
ct-12705	219	9	30	30	NUM
ct-12705	219	10	.	.	PUNCT
ct-12705	219	11	stout	stout	PROPN
ct-12705	219	12	tae	tae	PROPN
ct-12705	219	13	,	,	PUNCT
ct-12705	219	14	colenbrander	colenbrander	NOUN
ct-12705	219	15	b	b	NOUN
ct-12705	219	16	:	:	PUNCT
ct-12705	219	17	reproductive	reproductive	ADJ
ct-12705	219	18	parameters	parameter	NOUN
ct-12705	219	19	of	of	ADP
ct-12705	219	20	draft	draft	NOUN
ct-12705	219	21	horse	horse	NOUN
ct-12705	219	22	,	,	PUNCT
ct-12705	219	23	friesian	friesian	PROPN
ct-12705	219	24	,	,	PUNCT
ct-12705	219	25	and	and	CCONJ
ct-12705	219	26	warmblood	warmblood	PROPN
ct-12705	219	27	stallions	stallion	NOUN
ct-12705	219	28	.	.	PUNCT
ct-12705	220	1	in	in	ADP
ct-12705	220	2	:	:	PUNCT
ct-12705	220	3	mckinnon	mckinnon	PROPN
ct-12705	220	4	ao	ao	PROPN
ct-12705	220	5	,	,	PUNCT
ct-12705	220	6	squires	squires	PROPN
ct-12705	220	7	el	el	PROPN
ct-12705	220	8	,	,	PUNCT
ct-12705	220	9	vaala	vaala	VERB
ct-12705	220	10	we	we	PRON
ct-12705	220	11	,	,	PUNCT
ct-12705	220	12	et	et	PROPN
ct-12705	220	13	al	al	PROPN
ct-12705	220	14	:	:	PUNCT
ct-12705	220	15	editors	editor	NOUN
ct-12705	220	16	.	.	PUNCT
ct-12705	221	1	equine	equine	NOUN
ct-12705	221	2	reproduction	reproduction	NOUN
ct-12705	221	3	.	.	PUNCT
ct-12705	222	1	2nd	2nd	PROPN
ct-12705	222	2	edition	edition	PROPN
ct-12705	222	3	,	,	PUNCT
ct-12705	222	4	ames	ames	PROPN
ct-12705	222	5	,	,	PUNCT
ct-12705	222	6	ia	ia	PROPN
ct-12705	222	7	;	;	PUNCT
ct-12705	222	8	wiley	wiley	PROPN
ct-12705	222	9	blackwell	blackwell	PROPN
ct-12705	222	10	:	:	PUNCT
ct-12705	222	11	2011	2011	NUM
ct-12705	222	12	.	.	PUNCT
ct-12705	223	1	p.	p.	NOUN
ct-12705	223	2	1362	1362	NUM
ct-12705	223	3	-	-	SYM
ct-12705	223	4	1366	1366	NUM
ct-12705	223	5	.	.	PUNCT
ct-12705	224	1	31	31	NUM
ct-12705	224	2	.	.	PUNCT
ct-12705	225	1	trapnell	trapnell	PROPN
ct-12705	225	2	c	c	PROPN
ct-12705	225	3	,	,	PUNCT
ct-12705	225	4	williams	williams	PROPN
ct-12705	225	5	ba	ba	PROPN
ct-12705	225	6	,	,	PUNCT
ct-12705	225	7	pertea	pertea	NOUN
ct-12705	225	8	g	g	PROPN
ct-12705	225	9	,	,	PUNCT
ct-12705	225	10	et	et	PROPN
ct-12705	225	11	al	al	PROPN
ct-12705	225	12	:	:	PUNCT
ct-12705	225	13	transcript	transcript	NOUN
ct-12705	225	14	assembly	assembly	NOUN
ct-12705	225	15	and	and	CCONJ
ct-12705	225	16	quantification	quantification	NOUN
ct-12705	225	17	by	by	ADP
ct-12705	225	18	rna	rna	NOUN
ct-12705	225	19	-	-	PUNCT
ct-12705	225	20	seq	seq	NOUN
ct-12705	225	21	reveals	reveal	NOUN
ct-12705	225	22	unannotated	unannotate	VERB
ct-12705	225	23	transcripts	transcript	NOUN
ct-12705	225	24	and	and	CCONJ
ct-12705	225	25	isoform	isoform	NOUN
ct-12705	225	26	switching	switch	VERB
ct-12705	225	27	during	during	ADP
ct-12705	225	28	cell	cell	NOUN
ct-12705	225	29	differentiation	differentiation	NOUN
ct-12705	225	30	.	.	PUNCT
ct-12705	226	1	nat	nat	NOUN
ct-12705	226	2	biotech	biotech	PROPN
ct-12705	226	3	2010;28:511	2010;28:511	NOUN
ct-12705	226	4	-	-	SYM
ct-12705	226	5	515	515	NUM
ct-12705	226	6	.	.	PUNCT
ct-12705	226	7	doi	doi	NOUN
ct-12705	226	8	:	:	PUNCT
ct-12705	226	9	10.1038	10.1038	NUM
ct-12705	226	10	/	/	SYM
ct-12705	226	11	nbt.1621	nbt.1621	PROPN
ct-12705	226	12	32	32	NUM
ct-12705	226	13	.	.	PUNCT
ct-12705	227	1	anders	anders	PROPN
ct-12705	227	2	s	s	PROPN
ct-12705	227	3	,	,	PUNCT
ct-12705	227	4	huber	huber	PROPN
ct-12705	227	5	w	w	PROPN
ct-12705	227	6	:	:	PUNCT
ct-12705	227	7	differential	differential	ADJ
ct-12705	227	8	expression	expression	NOUN
ct-12705	227	9	analysis	analysis	NOUN
ct-12705	227	10	for	for	ADP
ct-12705	227	11	sequence	sequence	NOUN
ct-12705	227	12	count	count	NOUN
ct-12705	227	13	data	datum	NOUN
ct-12705	227	14	.	.	PUNCT
ct-12705	228	1	genome	genome	NOUN
ct-12705	228	2	biol	biol	NOUN
ct-12705	228	3	2010	2010	NUM
ct-12705	228	4	.	.	PUNCT
ct-12705	229	1	doi	doi	NOUN
ct-12705	229	2	:	:	PUNCT
ct-12705	229	3	10.1186	10.1186	NUM
ct-12705	229	4	/	/	SYM
ct-12705	229	5	gb-2010	gb-2010	NOUN
ct-12705	229	6	-	-	PUNCT
ct-12705	229	7	11	11	NUM
ct-12705	229	8	-	-	PUNCT
ct-12705	229	9	10	10	NUM
ct-12705	229	10	-	-	PUNCT
ct-12705	229	11	r106	r106	NUM
ct-12705	229	12	33	33	NUM
ct-12705	229	13	.	.	PUNCT
ct-12705	230	1	wu	wu	PROPN
ct-12705	230	2	h	h	PROPN
ct-12705	230	3	,	,	PUNCT
ct-12705	230	4	wang	wang	PROPN
ct-12705	230	5	h	h	PROPN
ct-12705	230	6	,	,	PUNCT
ct-12705	230	7	xiong	xiong	PROPN
ct-12705	230	8	w	w	PROPN
ct-12705	230	9	,	,	PUNCT
ct-12705	230	10	et	et	PROPN
ct-12705	230	11	al	al	PROPN
ct-12705	230	12	:	:	PUNCT
ct-12705	230	13	expression	expression	NOUN
ct-12705	230	14	patterns	pattern	NOUN
ct-12705	230	15	and	and	CCONJ
ct-12705	230	16	functions	function	NOUN
ct-12705	230	17	of	of	ADP
ct-12705	230	18	toll	toll	NOUN
ct-12705	230	19	-	-	PUNCT
ct-12705	230	20	like	like	ADJ
ct-12705	230	21	receptors	receptor	NOUN
ct-12705	230	22	in	in	ADP
ct-12705	230	23	mouse	mouse	NOUN
ct-12705	230	24	sertoli	sertoli	NOUN
ct-12705	230	25	cells	cell	NOUN
ct-12705	230	26	.	.	PUNCT
ct-12705	231	1	endocrinology	endocrinology	NOUN
ct-12705	231	2	2008;149:4402	2008;149:4402	NUM
ct-12705	231	3	-	-	SYM
ct-12705	231	4	4412	4412	NUM
ct-12705	231	5	.	.	PUNCT
ct-12705	232	1	doi	doi	NOUN
ct-12705	232	2	:	:	PUNCT
ct-12705	232	3	10.1210	10.1210	NUM
ct-12705	232	4	/	/	SYM
ct-12705	232	5	en.2007	en.2007	PROPN
ct-12705	232	6	-	-	PUNCT
ct-12705	232	7	1776	1776	NUM
ct-12705	232	8	34	34	NUM
ct-12705	232	9	.	.	PUNCT
ct-12705	233	1	nishimura	nishimura	PROPN
ct-12705	233	2	m	m	PROPN
ct-12705	233	3	,	,	PUNCT
ct-12705	233	4	naito	naito	PROPN
ct-12705	233	5	s	s	PROPN
ct-12705	233	6	:	:	PUNCT
ct-12705	233	7	tissue	tissue	NOUN
ct-12705	233	8	-	-	PUNCT
ct-12705	233	9	specific	specific	ADJ
ct-12705	233	10	mrna	mrna	NOUN
ct-12705	233	11	expression	expression	NOUN
ct-12705	233	12	profiles	profile	NOUN
ct-12705	233	13	of	of	ADP
ct-12705	233	14	human	human	ADJ
ct-12705	233	15	toll	toll	NOUN
ct-12705	233	16	-	-	PUNCT
ct-12705	233	17	like	like	ADJ
ct-12705	233	18	receptors	receptor	NOUN
ct-12705	233	19	and	and	CCONJ
ct-12705	233	20	related	related	ADJ
ct-12705	233	21	genes	gene	NOUN
ct-12705	233	22	.	.	PUNCT
ct-12705	234	1	biol	biol	PROPN
ct-12705	234	2	pharmacol	pharmacol	PROPN
ct-12705	234	3	bull	bull	PROPN
ct-12705	234	4	2005;28:886	2005;28:886	PROPN
ct-12705	234	5	-	-	SYM
ct-12705	234	6	892	892	NUM
ct-12705	234	7	.	.	PUNCT
ct-12705	235	1	doi	doi	NOUN
ct-12705	235	2	:	:	PUNCT
ct-12705	235	3	10.1248	10.1248	NUM
ct-12705	235	4	/	/	SYM
ct-12705	235	5	bpb.28.886	bpb.28.886	NOUN
ct-12705	235	6	35	35	NUM
ct-12705	235	7	.	.	PUNCT
ct-12705	236	1	girling	girling	PROPN
ct-12705	236	2	je	je	PROPN
ct-12705	236	3	,	,	PUNCT
ct-12705	236	4	hedger	hedger	PROPN
ct-12705	236	5	mp	mp	PROPN
ct-12705	236	6	:	:	PUNCT
ct-12705	236	7	toll	toll	NOUN
ct-12705	236	8	-	-	PUNCT
ct-12705	236	9	like	like	ADJ
ct-12705	236	10	receptors	receptor	NOUN
ct-12705	236	11	in	in	ADP
ct-12705	236	12	the	the	DET
ct-12705	236	13	gonads	gonad	NOUN
ct-12705	236	14	and	and	CCONJ
ct-12705	236	15	reproductive	reproductive	ADJ
ct-12705	236	16	tract	tract	NOUN
ct-12705	236	17	:	:	PUNCT
ct-12705	236	18	emerging	emerge	VERB
ct-12705	236	19	roles	role	NOUN
ct-12705	236	20	in	in	ADP
ct-12705	236	21	reproductive	reproductive	ADJ
ct-12705	236	22	physiology	physiology	NOUN
ct-12705	236	23	and	and	CCONJ
ct-12705	236	24	pathology	pathology	NOUN
ct-12705	236	25	.	.	PUNCT
ct-12705	237	1	immunol	immunol	NOUN
ct-12705	237	2	cell	cell	NOUN
ct-12705	237	3	biol	biol	NOUN
ct-12705	237	4	2007;85:481	2007;85:481	PROPN
ct-12705	237	5	-	-	SYM
ct-12705	237	6	489	489	NUM
ct-12705	237	7	.	.	PUNCT
ct-12705	238	1	doi	doi	NOUN
ct-12705	238	2	:	:	PUNCT
ct-12705	238	3	10.1038/	10.1038/	NUM
ct-12705	238	4	sj.icb.7100086	sj.icb.7100086	NOUN
ct-12705	238	5	36	36	NUM
ct-12705	238	6	.	.	PUNCT
ct-12705	239	1	astakhova	astakhova	PROPN
ct-12705	239	2	nm	nm	PROPN
ct-12705	239	3	,	,	PUNCT
ct-12705	239	4	perelygin	perelygin	VERB
ct-12705	239	5	aa	aa	PROPN
ct-12705	239	6	,	,	PUNCT
ct-12705	239	7	zharkikh	zharkikh	PROPN
ct-12705	239	8	aa	aa	PROPN
ct-12705	239	9	,	,	PUNCT
ct-12705	239	10	et	et	PROPN
ct-12705	239	11	al	al	PROPN
ct-12705	239	12	:	:	PUNCT
ct-12705	239	13	characterization	characterization	NOUN
ct-12705	239	14	of	of	ADP
ct-12705	239	15	equine	equine	NOUN
ct-12705	239	16	and	and	CCONJ
ct-12705	239	17	other	other	ADJ
ct-12705	239	18	vertebrate	vertebrate	ADJ
ct-12705	239	19	tlr3	tlr3	NOUN
ct-12705	239	20	,	,	PUNCT
ct-12705	239	21	tlr7	tlr7	NOUN
ct-12705	239	22	,	,	PUNCT
ct-12705	239	23	and	and	CCONJ
ct-12705	239	24	tlr8	tlr8	NOUN
ct-12705	239	25	genes	gene	NOUN
ct-12705	239	26	.	.	PUNCT
ct-12705	239	27	  	  	SPACE
ct-12705	240	1	immunogenetics	immunogenetic	NOUN
ct-12705	240	2	2009;61:529	2009;61:529	NOUN
ct-12705	240	3	-	-	PUNCT
ct-12705	240	4	539	539	NUM
ct-12705	240	5	.	.	PUNCT
ct-12705	241	1	doi	doi	NOUN
ct-12705	241	2	:	:	PUNCT
ct-12705	241	3	10.1007/	10.1007/	NUM
ct-12705	241	4	s00251	s00251	PROPN
ct-12705	241	5	-	-	PUNCT
ct-12705	241	6	009	009	NUM
ct-12705	241	7	-	-	PUNCT
ct-12705	241	8	0381	0381	NUM
ct-12705	241	9	-	-	PUNCT
ct-12705	241	10	z	z	NOUN
ct-12705	241	11	37	37	NUM
ct-12705	241	12	.	.	PUNCT
ct-12705	242	1	feng	feng	PROPN
ct-12705	242	2	x	x	PROPN
ct-12705	242	3	,	,	PUNCT
ct-12705	242	4	ma	ma	PROPN
ct-12705	242	5	bf	bf	PROPN
ct-12705	242	6	,	,	PUNCT
ct-12705	242	7	liu	liu	PROPN
ct-12705	242	8	b	b	PROPN
ct-12705	242	9	,	,	PUNCT
ct-12705	242	10	et	et	PROPN
ct-12705	242	11	al	al	PROPN
ct-12705	242	12	:	:	PUNCT
ct-12705	242	13	the	the	DET
ct-12705	242	14	involvement	involvement	NOUN
ct-12705	242	15	of	of	ADP
ct-12705	242	16	the	the	DET
ct-12705	242	17	chemokine	chemokine	ADJ
ct-12705	242	18	rantes	rante	NOUN
ct-12705	242	19	in	in	ADP
ct-12705	242	20	regulating	regulate	VERB
ct-12705	242	21	luminal	luminal	ADJ
ct-12705	242	22	acidification	acidification	NOUN
ct-12705	242	23	in	in	ADP
ct-12705	242	24	rat	rat	NOUN
ct-12705	242	25	epididymis	epididymis	NOUN
ct-12705	242	26	.	.	PUNCT
ct-12705	243	1	front	front	ADJ
ct-12705	243	2	immunol	immunol	NOUN
ct-12705	243	3	2020;11:583274	2020;11:583274	PROPN
ct-12705	243	4	.	.	PUNCT
ct-12705	243	5	doi	doi	NOUN
ct-12705	243	6	:	:	PUNCT
ct-12705	243	7	10.3389	10.3389	NUM
ct-12705	243	8	/	/	SYM
ct-12705	243	9	fimmu.2020.583274	fimmu.2020.583274	PROPN
ct-12705	243	10	38	38	NUM
ct-12705	243	11	.	.	PUNCT
ct-12705	244	1	naz	naz	PROPN
ct-12705	244	2	rk	rk	PROPN
ct-12705	244	3	,	,	PUNCT
ct-12705	244	4	leslie	leslie	PROPN
ct-12705	244	5	mh	mh	PROPN
ct-12705	244	6	:	:	PUNCT
ct-12705	244	7	immunobiologic	immunobiologic	ADJ
ct-12705	244	8	implication	implication	NOUN
ct-12705	244	9	of	of	ADP
ct-12705	244	10	rantes	rante	NOUN
ct-12705	244	11	in	in	ADP
ct-12705	244	12	seminal	seminal	ADJ
ct-12705	244	13	plasma	plasma	NOUN
ct-12705	244	14	of	of	ADP
ct-12705	244	15	fertile	fertile	ADJ
ct-12705	244	16	,	,	PUNCT
ct-12705	244	17	infertile	infertile	ADJ
ct-12705	244	18	and	and	CCONJ
ct-12705	244	19	immunoinfertile	immunoinfertile	ADJ
ct-12705	244	20	men	man	NOUN
ct-12705	244	21	.	.	PUNCT
ct-12705	245	1	am	be	AUX
ct-12705	245	2	j	j	PROPN
ct-12705	245	3	reprod	reprod	PROPN
ct-12705	245	4	immunol	immunol	PROPN
ct-12705	245	5	2020;44:197	2020;44:197	PROPN
ct-12705	245	6	-	-	PUNCT
ct-12705	245	7	204	204	NUM
ct-12705	245	8	.	.	PUNCT
ct-12705	246	1	doi	doi	NOUN
ct-12705	246	2	:	:	PUNCT
ct-12705	246	3	10.1111	10.1111	NUM
ct-12705	246	4	/	/	SYM
ct-12705	246	5	j.8755	j.8755	NOUN
ct-12705	246	6	-	-	PUNCT
ct-12705	246	7	8920.2000.440402.x	8920.2000.440402.x	NUM
ct-12705	246	8	39	39	NUM
ct-12705	246	9	.	.	PUNCT
ct-12705	247	1	caflisch	caflisch	PROPN
ct-12705	247	2	cr	cr	PROPN
ct-12705	247	3	,	,	PUNCT
ct-12705	247	4	dubose	dubose	PROPN
ct-12705	247	5	jr	jr	PROPN
ct-12705	247	6	,	,	PUNCT
ct-12705	247	7	td	td	NOUN
ct-12705	247	8	:	:	PUNCT
ct-12705	247	9	cadmium	cadmium	NOUN
ct-12705	247	10	-	-	PUNCT
ct-12705	247	11	induced	induce	VERB
ct-12705	247	12	changes	change	NOUN
ct-12705	247	13	in	in	ADP
ct-12705	247	14	luminal	luminal	ADJ
ct-12705	247	15	ph	ph	NOUN
ct-12705	247	16	in	in	ADP
ct-12705	247	17	testis	testis	NOUN
ct-12705	247	18	and	and	CCONJ
ct-12705	247	19	epididymis	epididymis	NOUN
ct-12705	247	20	of	of	ADP
ct-12705	247	21	the	the	DET
ct-12705	247	22	rat	rat	NOUN
ct-12705	247	23	in	in	ADP
ct-12705	247	24	vivo	vivo	NOUN
ct-12705	247	25	.	.	PUNCT
ct-12705	248	1	j	j	PROPN
ct-12705	248	2	toxicol	toxicol	PROPN
ct-12705	248	3	environ	environ	PROPN
ct-12705	248	4	health	health	PROPN
ct-12705	248	5	1991;32:49	1991;32:49	NUM
ct-12705	248	6	-	-	SYM
ct-12705	248	7	57	57	NUM
ct-12705	248	8	.	.	PUNCT
ct-12705	249	1	doi	doi	NOUN
ct-12705	249	2	:	:	PUNCT
ct-12705	249	3	10.1080/15287399109531464	10.1080/15287399109531464	NUM
ct-12705	249	4	40	40	NUM
ct-12705	249	5	.	.	PUNCT
ct-12705	250	1	chandel	chandel	PROPN
ct-12705	250	2	hs	hs	PROPN
ct-12705	250	3	,	,	PUNCT
ct-12705	250	4	pandey	pandey	PROPN
ct-12705	250	5	sp	sp	PROPN
ct-12705	250	6	,	,	PUNCT
ct-12705	250	7	roy	roy	PROPN
ct-12705	250	8	s	s	PROPN
ct-12705	250	9	,	,	PUNCT
ct-12705	250	10	et	et	PROPN
ct-12705	250	11	al	al	PROPN
ct-12705	250	12	:	:	PUNCT
ct-12705	250	13	tlr	tlr	PROPN
ct-12705	250	14	-	-	PUNCT
ct-12705	250	15	cd40	cd40	PROPN
ct-12705	250	16	cross	cross	NOUN
ct-12705	250	17	-	-	NOUN
ct-12705	250	18	talk	talk	NOUN
ct-12705	250	19	in	in	ADP
ct-12705	250	20	anti	anti	ADJ
ct-12705	250	21	-	-	ADJ
ct-12705	250	22	leishmanial	leishmanial	ADJ
ct-12705	250	23	immune	immune	ADJ
ct-12705	250	24	response	response	NOUN
ct-12705	250	25	.	.	PUNCT
ct-12705	251	1	front	front	ADJ
ct-12705	251	2	immunol	immunol	NOUN
ct-12705	251	3	2014;5:220	2014;5:220	PROPN
ct-12705	251	4	.	.	PUNCT
ct-12705	252	1	doi	doi	NOUN
ct-12705	252	2	:	:	PUNCT
ct-12705	252	3	10.3389	10.3389	NUM
ct-12705	252	4	/	/	SYM
ct-12705	252	5	fimmu.2014.00220	fimmu.2014.00220	NOUN
ct-12705	252	6	41	41	NUM
ct-12705	252	7	.	.	PUNCT
ct-12705	253	1	karimi	karimi	PROPN
ct-12705	253	2	mh	mh	PROPN
ct-12705	253	3	,	,	PUNCT
ct-12705	253	4	pourfathollah	pourfathollah	ADJ
ct-12705	253	5	aa	aa	NOUN
ct-12705	253	6	:	:	PUNCT
ct-12705	253	7	cd40	cd40	PROPN
ct-12705	253	8	and	and	CCONJ
ct-12705	253	9	tolerance	tolerance	NOUN
ct-12705	253	10	induction	induction	NOUN
ct-12705	253	11	.	.	PUNCT
ct-12705	254	1	iran	iran	PROPN
ct-12705	254	2	j	j	PROPN
ct-12705	254	3	allergy	allergy	PROPN
ct-12705	254	4	asthma	asthma	PROPN
ct-12705	254	5	immunol	immunol	PROPN
ct-12705	254	6	2012;11:1	2012;11:1	PROPN
ct-12705	254	7	-	-	SYM
ct-12705	254	8	13	13	NUM
ct-12705	254	9	.	.	PUNCT
ct-12705	255	1	42	42	NUM
ct-12705	255	2	.	.	PUNCT
ct-12705	256	1	tuettenberg	tuettenberg	PROPN
ct-12705	256	2	a	a	PRON
ct-12705	256	3	,	,	PUNCT
ct-12705	256	4	fondel	fondel	PROPN
ct-12705	256	5	s	s	PART
ct-12705	256	6	,	,	PUNCT
ct-12705	256	7	steinbrink	steinbrink	VERB
ct-12705	256	8	k	k	NOUN
ct-12705	256	9	,	,	PUNCT
ct-12705	256	10	et	et	PROPN
ct-12705	256	11	al	al	PROPN
ct-12705	256	12	:	:	PUNCT
ct-12705	257	1	cd40	cd40	PROPN
ct-12705	257	2	signaling	signaling	NOUN
ct-12705	257	3	induces	induce	NOUN
ct-12705	257	4	il-10	il-10	PRON
ct-12705	257	5	-	-	PUNCT
ct-12705	257	6	producing	produce	VERB
ct-12705	257	7	,	,	PUNCT
ct-12705	257	8	tolerogenic	tolerogenic	ADJ
ct-12705	257	9	dendritic	dendritic	ADJ
ct-12705	257	10	cells	cell	NOUN
ct-12705	257	11	.	.	PUNCT
ct-12705	258	1	exp	exp	NOUN
ct-12705	258	2	dermatol	dermatol	NOUN
ct-12705	258	3	2010;19:44	2010;19:44	NUM
ct-12705	258	4	-	-	SYM
ct-12705	258	5	53	53	NUM
ct-12705	258	6	.	.	PUNCT
ct-12705	259	1	doi	doi	NOUN
ct-12705	259	2	:	:	PUNCT
ct-12705	259	3	10.1111	10.1111	NUM
ct-12705	259	4	/	/	SYM
ct-12705	259	5	j.1600	j.1600	NOUN
ct-12705	259	6	-	-	PUNCT
ct-12705	259	7	0625.2009.00975.x	0625.2009.00975.x	PROPN
ct-12705	259	8	43	43	NUM
ct-12705	259	9	.	.	PUNCT
ct-12705	260	1	yi	yi	PROPN
ct-12705	260	2	z	z	PROPN
ct-12705	260	3	,	,	PUNCT
ct-12705	260	4	stunz	stunz	PROPN
ct-12705	260	5	ll	ll	PROPN
ct-12705	260	6	,	,	PUNCT
ct-12705	260	7	bishop	bishop	PROPN
ct-12705	260	8	ga	ga	PROPN
ct-12705	260	9	:	:	PUNCT
ct-12705	260	10	cd40	cd40	NOUN
ct-12705	260	11	-	-	PUNCT
ct-12705	260	12	mediated	mediate	VERB
ct-12705	260	13	maintenance	maintenance	NOUN
ct-12705	260	14	of	of	ADP
ct-12705	260	15	immune	immune	ADJ
ct-12705	260	16	homeostasis	homeostasis	NOUN
ct-12705	260	17	in	in	ADP
ct-12705	260	18	the	the	DET
ct-12705	260	19	adipose	adipose	ADJ
ct-12705	260	20	tissue	tissue	NOUN
ct-12705	260	21	microenvironment	microenvironment	NOUN
ct-12705	260	22	.	.	PUNCT
ct-12705	261	1	diabetes	diabetes	NOUN
ct-12705	261	2	2014;63:2751	2014;63:2751	NUM
ct-12705	261	3	-	-	SYM
ct-12705	261	4	2760	2760	NUM
ct-12705	261	5	.	.	PUNCT
ct-12705	262	1	doi	doi	NOUN
ct-12705	262	2	:	:	PUNCT
ct-12705	262	3	10.2337	10.2337	NUM
ct-12705	262	4	/	/	SYM
ct-12705	262	5	db13	db13	PROPN
ct-12705	262	6	-	-	PUNCT
ct-12705	262	7	1657	1657	NUM
ct-12705	262	8	44	44	NUM
ct-12705	262	9	.	.	PUNCT
ct-12705	263	1	palladino	palladino	PROPN
ct-12705	263	2	ma	ma	PROPN
ct-12705	263	3	,	,	PUNCT
ct-12705	263	4	savarese	savarese	PROPN
ct-12705	263	5	ma	ma	PROPN
ct-12705	263	6	,	,	PUNCT
ct-12705	263	7	chapman	chapman	PROPN
ct-12705	263	8	jl	jl	PROPN
ct-12705	263	9	,	,	PUNCT
ct-12705	263	10	et	et	PROPN
ct-12705	263	11	al	al	PROPN
ct-12705	263	12	:	:	PUNCT
ct-12705	263	13	localization	localization	NOUN
ct-12705	263	14	of	of	ADP
ct-12705	263	15	toll	toll	NOUN
ct-12705	263	16	-	-	PUNCT
ct-12705	263	17	like	like	ADJ
ct-12705	263	18	receptors	receptor	NOUN
ct-12705	263	19	on	on	ADP
ct-12705	263	20	epididymal	epididymal	ADJ
ct-12705	263	21	epithelial	epithelial	ADJ
ct-12705	263	22	cells	cell	NOUN
ct-12705	263	23	and	and	CCONJ
ct-12705	263	24	spermatozoa	spermatozoon	NOUN
ct-12705	263	25	.	.	PUNCT
ct-12705	263	26	am	be	AUX
ct-12705	263	27	j	j	PROPN
ct-12705	263	28	reprod	reprod	PROPN
ct-12705	263	29	immunol	immunol	PROPN
ct-12705	263	30	2008;60:541	2008;60:541	PROPN
ct-12705	263	31	-	-	SYM
ct-12705	263	32	555	555	NUM
ct-12705	263	33	.	.	PUNCT
ct-12705	264	1	doi	doi	NOUN
ct-12705	264	2	:	:	PUNCT
ct-12705	264	3	10.1111	10.1111	NUM
ct-12705	264	4	/	/	SYM
ct-12705	264	5	j.1600	j.1600	NOUN
ct-12705	264	6	-	-	PUNCT
ct-12705	264	7	0897.2008.00654.x	0897.2008.00654.x	ADJ
ct-12705	264	8	45	45	NUM
ct-12705	264	9	.	.	PUNCT
ct-12705	265	1	abdel	abdel	PROPN
ct-12705	265	2	-	-	PUNCT
ct-12705	265	3	maksoud	maksoud	PROPN
ct-12705	265	4	fm	fm	PROPN
ct-12705	265	5	,	,	PUNCT
ct-12705	265	6	zayed	zayed	PROPN
ct-12705	265	7	ae	ae	PROPN
ct-12705	265	8	,	,	PUNCT
ct-12705	265	9	abdelhafez	abdelhafez	VERB
ct-12705	265	10	ea	ea	PROPN
ct-12705	265	11	,	,	PUNCT
ct-12705	265	12	et	et	PROPN
ct-12705	265	13	al	al	PROPN
ct-12705	265	14	:	:	PUNCT
ct-12705	265	15	seasonal	seasonal	ADJ
ct-12705	265	16	variations	variation	NOUN
ct-12705	265	17	of	of	ADP
ct-12705	265	18	the	the	DET
ct-12705	265	19	epididymis	epididymis	NOUN
ct-12705	265	20	in	in	ADP
ct-12705	265	21	donkeys	donkey	NOUN
ct-12705	265	22	(	(	PUNCT
ct-12705	265	23	equus	equus	PROPN
ct-12705	265	24	asinus	asinus	PROPN
ct-12705	265	25	)	)	PUNCT
ct-12705	265	26	with	with	ADP
ct-12705	265	27	special	special	ADJ
ct-12705	265	28	reference	reference	NOUN
ct-12705	265	29	to	to	ADP
ct-12705	265	30	blood	blood	NOUN
ct-12705	265	31	epididymal	epididymal	ADJ
ct-12705	265	32	barrier	barrier	NOUN
ct-12705	265	33	.	.	PUNCT
ct-12705	266	1	microsc	microsc	VERB
ct-12705	266	2	res	re	NOUN
ct-12705	266	3	tech	tech	NOUN
ct-12705	266	4	2024;87:326	2024;87:326	PROPN
ct-12705	266	5	-	-	SYM
ct-12705	266	6	338	338	NUM
ct-12705	266	7	.	.	PUNCT
ct-12705	267	1	doi	doi	NOUN
ct-12705	267	2	:	:	PUNCT
ct-12705	267	3	10.1002	10.1002	NUM
ct-12705	267	4	/	/	SYM
ct-12705	267	5	jemt.24436	jemt.24436	ADJ
ct-12705	267	6	46	46	NUM
ct-12705	267	7	.	.	PUNCT
ct-12705	268	1	raetz	raetz	VERB
ct-12705	268	2	m	m	PROPN
ct-12705	268	3	,	,	PUNCT
ct-12705	268	4	kibardin	kibardin	VERB
ct-12705	268	5	a	a	PRON
ct-12705	268	6	,	,	PUNCT
ct-12705	268	7	sturge	sturge	NOUN
ct-12705	268	8	cr	cr	PROPN
ct-12705	268	9	,	,	PUNCT
ct-12705	268	10	et	et	PROPN
ct-12705	268	11	al	al	PROPN
ct-12705	268	12	:	:	PUNCT
ct-12705	268	13	cooperation	cooperation	NOUN
ct-12705	268	14	of	of	ADP
ct-12705	268	15	tlr12	tlr12	PROPN
ct-12705	268	16	and	and	CCONJ
ct-12705	268	17	tlr11	tlr11	PROPN
ct-12705	268	18	in	in	ADP
ct-12705	268	19	the	the	DET
ct-12705	268	20	irf8	irf8	NOUN
ct-12705	268	21	-	-	PUNCT
ct-12705	268	22	dependent	dependent	ADJ
ct-12705	268	23	il-12	il-12	ADP
ct-12705	268	24	response	response	NOUN
ct-12705	268	25	to	to	ADP
ct-12705	268	26	toxoplasma	toxoplasma	NOUN
ct-12705	268	27	gondii	gondii	NOUN
ct-12705	268	28	profilin	profilin	PROPN
ct-12705	268	29	.	.	PUNCT
ct-12705	269	1	j	j	PROPN
ct-12705	269	2	immunol	immunol	NOUN
ct-12705	269	3	2013;191:4818	2013;191:4818	NUM
ct-12705	269	4	-	-	SYM
ct-12705	269	5	4827	4827	NUM
ct-12705	269	6	.	.	PUNCT
ct-12705	270	1	doi	doi	NOUN
ct-12705	270	2	:	:	PUNCT
ct-12705	270	3	10.4049/	10.4049/	NUM
ct-12705	270	4	jimmunol.1301301	jimmunol.1301301	NUM
ct-12705	270	5	http://dx.doi.org/10.58292/ct.v17.12705	http://dx.doi.org/10.58292/ct.v17.12705	NUM
ct-12705	270	6	https://doi.org/10.1038/nbt.1621	https://doi.org/10.1038/nbt.1621	PROPN
ct-12705	270	7	https://doi.org/10.1186/gb-2010-11-10-r106	https://doi.org/10.1186/gb-2010-11-10-r106	NOUN
ct-12705	270	8	https://doi.org/10.1210/en.2007-1776	https://doi.org/10.1210/en.2007-1776	NOUN
ct-12705	270	9	https://doi.org/10.1248/bpb.28.886	https://doi.org/10.1248/bpb.28.886	NOUN
ct-12705	270	10	https://doi.org/10.1038/sj.icb.7100086	https://doi.org/10.1038/sj.icb.7100086	VERB
ct-12705	270	11	https://doi.org/10.1038/sj.icb.7100086	https://doi.org/10.1038/sj.icb.7100086	VERB
ct-12705	270	12	https://doi.org/10.1007/s00251-009-0381-z	https://doi.org/10.1007/s00251-009-0381-z	NOUN
ct-12705	270	13	https://doi.org/10.1007/s00251-009-0381-z	https://doi.org/10.1007/s00251-009-0381-z	PROPN
ct-12705	270	14	https://doi.org/10.3389/fimmu.2020.583274	https://doi.org/10.3389/fimmu.2020.583274	PROPN
ct-12705	270	15	https://doi.org/10.1111/j.8755-8920.2000.440402.x	https://doi.org/10.1111/j.8755-8920.2000.440402.x	NOUN
ct-12705	270	16	https://doi.org/10.1080/15287399109531464	https://doi.org/10.1080/15287399109531464	NOUN
ct-12705	271	1	https://doi.org/10.3389/fimmu.2014.00220	https://doi.org/10.3389/fimmu.2014.00220	AUX
ct-12705	271	2	https://doi.org/10.1111/j.1600-0625.2009.00975.x	https://doi.org/10.1111/j.1600-0625.2009.00975.x	ADJ
ct-12705	271	3	https://doi.org/10.2337/db13-1657	https://doi.org/10.2337/db13-1657	NOUN
ct-12705	271	4	https://doi.org/10.1111/j.1600-0897.2008.00654.x	https://doi.org/10.1111/j.1600-0897.2008.00654.x	X
ct-12705	271	5	https://doi.org/10.1002/jemt.24436	https://doi.org/10.1002/jemt.24436	VERB
ct-12705	271	6	https://doi.org/10.4049/jimmunol.1301301	https://doi.org/10.4049/jimmunol.1301301	NOUN
ct-12705	271	7	https://doi.org/10.4049/jimmunol.1301301	https://doi.org/10.4049/jimmunol.1301301	NOUN