id	sid	tid	token	lemma	pos
ct-9287	1	1	clinical	clinical	ADJ
ct-9287	1	2	theriogenology	theriogenology	NOUN
ct-9287	1	3	2022	2022	NUM
ct-9287	1	4	;	;	PUNCT
ct-9287	1	5	14	14	NUM
ct-9287	1	6	:	:	SYM
ct-9287	1	7	110	110	NUM
ct-9287	1	8	disorders	disorder	NOUN
ct-9287	1	9	of	of	ADP
ct-9287	1	10	sexual	sexual	ADJ
ct-9287	1	11	development	development	NOUN
ct-9287	1	12	:	:	PUNCT
ct-9287	1	13	a	a	DET
ct-9287	1	14	case	case	NOUN
ct-9287	1	15	of	of	ADP
ct-9287	1	16	xx	xx	NUM
ct-9287	1	17	sex	sex	NOUN
ct-9287	1	18	reversal	reversal	NOUN
ct-9287	1	19	in	in	ADP
ct-9287	1	20	a	a	DET
ct-9287	1	21	mixed	mixed	ADJ
ct-9287	1	22	breed	breed	NOUN
ct-9287	1	23	dog	dog	NOUN
ct-9287	1	24	negative	negative	ADJ
ct-9287	1	25	for	for	ADP
ct-9287	1	26	sry	sry	PROPN
ct-9287	1	27	(	(	PUNCT
ct-9287	1	28	sex	sex	NOUN
ct-9287	1	29	-	-	PUNCT
ct-9287	1	30	determining	determine	VERB
ct-9287	1	31	region	region	NOUN
ct-9287	1	32	on	on	ADP
ct-9287	1	33	the	the	DET
ct-9287	1	34	y	y	PROPN
ct-9287	1	35	chromosome	chromosome	PROPN
ct-9287	1	36	)	)	PUNCT
ct-9287	1	37	gene	gene	NOUN
ct-9287	1	38	kelsey	kelsey	PROPN
ct-9287	1	39	martin	martin	PROPN
ct-9287	1	40	,	,	PUNCT
ct-9287	1	41	a	a	DET
ct-9287	1	42	agata	agata	NOUN
ct-9287	1	43	parsons	parson	NOUN
ct-9287	1	44	,	,	PUNCT
ct-9287	1	45	b	b	PROPN
ct-9287	1	46	greg	greg	PROPN
ct-9287	1	47	burns	burn	NOUN
ct-9287	1	48	,	,	PUNCT
ct-9287	1	49	a	a	DET
ct-9287	1	50	gerrit	gerrit	NOUN
ct-9287	1	51	bouma	bouma	NOUN
ct-9287	1	52	,	,	PUNCT
ct-9287	1	53	b	b	PROPN
ct-9287	1	54	fiona	fiona	PROPN
ct-9287	1	55	hollinsheada	hollinsheada	PROPN
ct-9287	1	56	adepartment	adepartment	PROPN
ct-9287	1	57	of	of	ADP
ct-9287	1	58	clinical	clinical	ADJ
ct-9287	1	59	sciences	science	NOUN
ct-9287	1	60	,	,	PUNCT
ct-9287	1	61	bdepartment	bdepartment	NOUN
ct-9287	1	62	of	of	ADP
ct-9287	1	63	biomedical	biomedical	PROPN
ct-9287	1	64	sciences	sciences	PROPN
ct-9287	1	65	college	college	PROPN
ct-9287	1	66	of	of	ADP
ct-9287	1	67	veterinary	veterinary	ADJ
ct-9287	1	68	medicine	medicine	NOUN
ct-9287	1	69	and	and	CCONJ
ct-9287	1	70	biomedical	biomedical	PROPN
ct-9287	1	71	sciences	sciences	PROPN
ct-9287	1	72	colorado	colorado	PROPN
ct-9287	1	73	state	state	PROPN
ct-9287	1	74	university	university	PROPN
ct-9287	1	75	,	,	PUNCT
ct-9287	1	76	fort	fort	PROPN
ct-9287	1	77	collins	collins	PROPN
ct-9287	1	78	,	,	PUNCT
ct-9287	1	79	co	co	VERB
ct-9287	1	80	abstract	abstract	ADV
ct-9287	1	81	an	an	DET
ct-9287	1	82	8	8	NUM
ct-9287	1	83	-	-	PUNCT
ct-9287	1	84	month	month	NOUN
ct-9287	1	85	mixed	mixed	ADJ
ct-9287	1	86	breed	breed	NOUN
ct-9287	1	87	dog	dog	NOUN
ct-9287	1	88	(	(	PUNCT
ct-9287	1	89	from	from	ADP
ct-9287	1	90	shelter	shelter	NOUN
ct-9287	1	91	)	)	PUNCT
ct-9287	1	92	was	be	AUX
ct-9287	1	93	evaluated	evaluate	VERB
ct-9287	1	94	for	for	ADP
ct-9287	1	95	its	its	PRON
ct-9287	1	96	abnormal	abnormal	ADJ
ct-9287	1	97	external	external	ADJ
ct-9287	1	98	genital	genital	ADJ
ct-9287	1	99	(	(	PUNCT
ct-9287	1	100	enlarged	enlarge	VERB
ct-9287	1	101	os	os	PROPN
ct-9287	1	102	clitoris	clitoris	PROPN
ct-9287	1	103	protruding	protrude	VERB
ct-9287	1	104	externally	externally	ADV
ct-9287	1	105	from	from	ADP
ct-9287	1	106	the	the	DET
ct-9287	1	107	vulva	vulva	NOUN
ct-9287	1	108	)	)	PUNCT
ct-9287	1	109	condition	condition	NOUN
ct-9287	1	110	.	.	PUNCT
ct-9287	2	1	dog	dog	NOUN
ct-9287	2	2	had	have	VERB
ct-9287	2	3	phenotypic	phenotypic	ADJ
ct-9287	2	4	female	female	ADJ
ct-9287	2	5	appearance	appearance	NOUN
ct-9287	2	6	.	.	PUNCT
ct-9287	3	1	testicular	testicular	ADJ
ct-9287	3	2	-	-	PUNCT
ct-9287	3	3	like	like	ADJ
ct-9287	3	4	tissue	tissue	NOUN
ct-9287	3	5	was	be	AUX
ct-9287	3	6	removed	remove	VERB
ct-9287	3	7	via	via	ADP
ct-9287	3	8	laparoscopy	laparoscopy	NOUN
ct-9287	3	9	-	-	PUNCT
ct-9287	3	10	assisted	assist	VERB
ct-9287	3	11	gonadectomy	gonadectomy	NOUN
ct-9287	3	12	.	.	PUNCT
ct-9287	4	1	genotype	genotype	NOUN
ct-9287	4	2	was	be	AUX
ct-9287	4	3	determined	determine	VERB
ct-9287	4	4	using	use	VERB
ct-9287	4	5	blood	blood	NOUN
ct-9287	4	6	and	and	CCONJ
ct-9287	4	7	gonadal	gonadal	ADJ
ct-9287	4	8	tissue	tissue	NOUN
ct-9287	4	9	(	(	PUNCT
ct-9287	4	10	via	via	ADP
ct-9287	4	11	histology	histology	NOUN
ct-9287	4	12	and	and	CCONJ
ct-9287	4	13	immunohistochemistry	immunohistochemistry	NOUN
ct-9287	4	14	)	)	PUNCT
ct-9287	4	15	.	.	PUNCT
ct-9287	5	1	dog	dog	NOUN
ct-9287	5	2	had	have	VERB
ct-9287	5	3	xx	xx	NUM
ct-9287	5	4	chromosomes	chromosome	NOUN
ct-9287	5	5	and	and	CCONJ
ct-9287	5	6	was	be	AUX
ct-9287	5	7	negative	negative	ADJ
ct-9287	5	8	for	for	ADP
ct-9287	5	9	sry	sry	PROPN
ct-9287	5	10	(	(	PUNCT
ct-9287	5	11	sex	sex	NOUN
ct-9287	5	12	-	-	PUNCT
ct-9287	5	13	determining	determine	VERB
ct-9287	5	14	region	region	NOUN
ct-9287	5	15	on	on	ADP
ct-9287	5	16	the	the	DET
ct-9287	5	17	y	y	PROPN
ct-9287	5	18	chromosome	chromosome	NOUN
ct-9287	5	19	)	)	PUNCT
ct-9287	5	20	gene	gene	NOUN
ct-9287	5	21	.	.	PUNCT
ct-9287	6	1	keywords	keyword	NOUN
ct-9287	6	2	:	:	PUNCT
ct-9287	6	3	phenotypic	phenotypic	ADJ
ct-9287	6	4	sex	sex	NOUN
ct-9287	6	5	,	,	PUNCT
ct-9287	6	6	antimüllerian	antimüllerian	ADJ
ct-9287	6	7	hormone	hormone	NOUN
ct-9287	6	8	,	,	PUNCT
ct-9287	6	9	sex	sex	NOUN
ct-9287	6	10	reversal	reversal	NOUN
ct-9287	6	11	background	background	NOUN
ct-9287	6	12	normal	normal	ADJ
ct-9287	6	13	mammalian	mammalian	ADJ
ct-9287	6	14	sexual	sexual	ADJ
ct-9287	6	15	development	development	NOUN
ct-9287	6	16	involves	involve	VERB
ct-9287	6	17	chromosomal	chromosomal	ADJ
ct-9287	6	18	sex	sex	NOUN
ct-9287	6	19	(	(	PUNCT
ct-9287	6	20	xx	xx	NUM
ct-9287	6	21	or	or	CCONJ
ct-9287	6	22	xy	xy	PROPN
ct-9287	7	1	[	[	X
ct-9287	7	2	determined	determine	VERB
ct-9287	7	3	at	at	ADP
ct-9287	7	4	fertilization	fertilization	NOUN
ct-9287	7	5	]	]	PUNCT
ct-9287	7	6	)	)	PUNCT
ct-9287	7	7	,	,	PUNCT
ct-9287	7	8	followed	follow	VERB
ct-9287	7	9	by	by	ADP
ct-9287	7	10	development	development	NOUN
ct-9287	7	11	of	of	ADP
ct-9287	7	12	gonadal	gonadal	ADJ
ct-9287	7	13	sex	sex	NOUN
ct-9287	7	14	(	(	PUNCT
ct-9287	7	15	ovary	ovary	NOUN
ct-9287	7	16	or	or	CCONJ
ct-9287	7	17	testis	testis	NOUN
ct-9287	7	18	)	)	PUNCT
ct-9287	7	19	,	,	PUNCT
ct-9287	7	20	and	and	CCONJ
ct-9287	7	21	finally	finally	ADV
ct-9287	7	22	expression	expression	NOUN
ct-9287	7	23	of	of	ADP
ct-9287	7	24	phenotypic	phenotypic	ADJ
ct-9287	7	25	sex	sex	NOUN
ct-9287	7	26	(	(	PUNCT
ct-9287	7	27	internal	internal	ADJ
ct-9287	7	28	reproductive	reproductive	ADJ
ct-9287	7	29	tract	tract	NOUN
ct-9287	7	30	and	and	CCONJ
ct-9287	7	31	external	external	ADJ
ct-9287	7	32	genitalia).1	genitalia).1	NOUN
ct-9287	7	33	errors	error	NOUN
ct-9287	7	34	in	in	ADP
ct-9287	7	35	these	these	DET
ct-9287	7	36	3	3	NUM
ct-9287	7	37	stages	stage	NOUN
ct-9287	7	38	resulted	result	VERB
ct-9287	7	39	in	in	ADP
ct-9287	7	40	disorders	disorder	NOUN
ct-9287	7	41	of	of	ADP
ct-9287	7	42	sexual	sexual	ADJ
ct-9287	7	43	development	development	NOUN
ct-9287	7	44	(	(	PUNCT
ct-9287	7	45	dsds	dsds	PROPN
ct-9287	7	46	)	)	PUNCT
ct-9287	7	47	,	,	PUNCT
ct-9287	7	48	manifesting	manifest	VERB
ct-9287	7	49	in	in	ADP
ct-9287	7	50	a	a	DET
ct-9287	7	51	variety	variety	NOUN
ct-9287	7	52	of	of	ADP
ct-9287	7	53	anatomical	anatomical	ADJ
ct-9287	7	54	and	and	CCONJ
ct-9287	7	55	physiological	physiological	ADJ
ct-9287	7	56	abnormalities	abnormality	NOUN
ct-9287	7	57	in	in	ADP
ct-9287	7	58	affected	affected	ADJ
ct-9287	7	59	individuals.2	individuals.2	NOUN
ct-9287	7	60	generally	generally	ADV
ct-9287	7	61	,	,	PUNCT
ct-9287	7	62	dsds	dsds	PROPN
ct-9287	7	63	are	be	AUX
ct-9287	7	64	classified	classify	VERB
ct-9287	7	65	based	base	VERB
ct-9287	7	66	on	on	ADP
ct-9287	7	67	the	the	DET
ct-9287	7	68	incongruencies	incongruencie	NOUN
ct-9287	7	69	that	that	PRON
ct-9287	7	70	exist	exist	VERB
ct-9287	7	71	among	among	ADP
ct-9287	7	72	the	the	DET
ct-9287	7	73	stages	stage	NOUN
ct-9287	7	74	of	of	ADP
ct-9287	7	75	sexual	sexual	ADJ
ct-9287	7	76	development	development	NOUN
ct-9287	7	77	.	.	PUNCT
ct-9287	8	1	individuals	individual	NOUN
ct-9287	8	2	that	that	PRON
ct-9287	8	3	demonstrate	demonstrate	VERB
ct-9287	8	4	a	a	DET
ct-9287	8	5	discrepancy	discrepancy	NOUN
ct-9287	8	6	between	between	ADP
ct-9287	8	7	their	their	PRON
ct-9287	8	8	chromosomal	chromosomal	ADJ
ct-9287	8	9	and	and	CCONJ
ct-9287	8	10	gonadal	gonadal	ADJ
ct-9287	8	11	sex	sex	NOUN
ct-9287	8	12	development	development	NOUN
ct-9287	8	13	had	have	VERB
ct-9287	8	14	a	a	DET
ct-9287	8	15	sex	sex	NOUN
ct-9287	8	16	reversal	reversal	NOUN
ct-9287	8	17	(	(	PUNCT
ct-9287	8	18	sr	sr	PROPN
ct-9287	8	19	)	)	PUNCT
ct-9287	8	20	phenotype	phenotype	NOUN
ct-9287	8	21	and	and	CCONJ
ct-9287	8	22	are	be	AUX
ct-9287	8	23	considered	consider	VERB
ct-9287	8	24	either	either	CCONJ
ct-9287	9	1	xx	xx	PRON
ct-9287	9	2	male	male	NOUN
ct-9287	9	3	or	or	CCONJ
ct-9287	9	4	xy	xy	INTJ
ct-9287	9	5	female.3	female.3	ADP
ct-9287	9	6	these	these	DET
ct-9287	9	7	sr	sr	PROPN
ct-9287	9	8	individuals	individual	NOUN
ct-9287	9	9	can	can	AUX
ct-9287	9	10	be	be	AUX
ct-9287	9	11	either	either	CCONJ
ct-9287	9	12	positive	positive	ADJ
ct-9287	9	13	or	or	CCONJ
ct-9287	9	14	negative	negative	ADJ
ct-9287	9	15	for	for	ADP
ct-9287	9	16	sex	sex	NOUN
ct-9287	9	17	-	-	PUNCT
ct-9287	9	18	determining	determine	VERB
ct-9287	9	19	region	region	NOUN
ct-9287	9	20	on	on	ADP
ct-9287	9	21	the	the	DET
ct-9287	9	22	y	y	PROPN
ct-9287	9	23	chromosome	chromosome	PROPN
ct-9287	9	24	(	(	PUNCT
ct-9287	9	25	sry	sry	INTJ
ct-9287	9	26	)	)	PUNCT
ct-9287	9	27	gene	gene	NOUN
ct-9287	9	28	that	that	PRON
ct-9287	9	29	regulates	regulate	VERB
ct-9287	9	30	gonadal	gonadal	ADJ
ct-9287	9	31	differentiation	differentiation	NOUN
ct-9287	9	32	.	.	PUNCT
ct-9287	10	1	absence	absence	NOUN
ct-9287	10	2	of	of	ADP
ct-9287	10	3	sry	sry	INTJ
ct-9287	10	4	gene	gene	NOUN
ct-9287	10	5	causes	cause	VERB
ct-9287	10	6	development	development	NOUN
ct-9287	10	7	of	of	ADP
ct-9287	10	8	ovaries	ovary	NOUN
ct-9287	10	9	and	and	CCONJ
ct-9287	10	10	a	a	DET
ct-9287	10	11	female	female	ADJ
ct-9287	10	12	phenotype	phenotype	NOUN
ct-9287	10	13	.	.	PUNCT
ct-9287	11	1	presence	presence	NOUN
ct-9287	11	2	of	of	ADP
ct-9287	11	3	sry	sry	INTJ
ct-9287	11	4	gene	gene	NOUN
ct-9287	11	5	results	result	NOUN
ct-9287	11	6	in	in	ADP
ct-9287	11	7	activation	activation	NOUN
ct-9287	11	8	of	of	ADP
ct-9287	11	9	genes	gene	NOUN
ct-9287	11	10	,	,	PUNCT
ct-9287	11	11	including	include	VERB
ct-9287	11	12	sox9	sox9	PROPN
ct-9287	11	13	,	,	PUNCT
ct-9287	11	14	triggering	trigger	VERB
ct-9287	11	15	‘	'	PUNCT
ct-9287	11	16	male	male	NOUN
ct-9287	11	17	’	'	PUNCT
ct-9287	11	18	development	development	NOUN
ct-9287	11	19	pathway	pathway	NOUN
ct-9287	11	20	toward	toward	ADP
ct-9287	11	21	formation	formation	NOUN
ct-9287	11	22	of	of	ADP
ct-9287	11	23	testes	testis	NOUN
ct-9287	11	24	with	with	ADP
ct-9287	11	25	internal	internal	ADJ
ct-9287	11	26	and	and	CCONJ
ct-9287	11	27	external	external	ADJ
ct-9287	11	28	masculinization.4	masculinization.4	NOUN
ct-9287	11	29	reports	report	NOUN
ct-9287	11	30	of	of	ADP
ct-9287	11	31	xy	xy	PROPN
ct-9287	11	32	sex	sex	NOUN
ct-9287	11	33	reversal	reversal	NOUN
ct-9287	11	34	in	in	ADP
ct-9287	11	35	dogs	dog	NOUN
ct-9287	11	36	are	be	AUX
ct-9287	11	37	rare.5,6	rare.5,6	ADJ
ct-9287	11	38	conversely	conversely	ADV
ct-9287	11	39	,	,	PUNCT
ct-9287	11	40	reports	report	NOUN
ct-9287	11	41	of	of	ADP
ct-9287	11	42	xx	xx	NUM
ct-9287	11	43	sex	sex	NOUN
ct-9287	11	44	reversal	reversal	NOUN
ct-9287	11	45	in	in	ADP
ct-9287	11	46	dogs	dog	NOUN
ct-9287	11	47	are	be	AUX
ct-9287	11	48	more	more	ADJ
ct-9287	11	49	common.7	common.7	PROPN
ct-9287	11	50	regardless	regardless	ADV
ct-9287	11	51	,	,	PUNCT
ct-9287	11	52	it	it	PRON
ct-9287	11	53	is	be	AUX
ct-9287	11	54	important	important	ADJ
ct-9287	11	55	for	for	SCONJ
ct-9287	11	56	practitioners	practitioner	NOUN
ct-9287	11	57	to	to	PART
ct-9287	11	58	be	be	AUX
ct-9287	11	59	aware	aware	ADJ
ct-9287	11	60	of	of	ADP
ct-9287	11	61	this	this	DET
ct-9287	11	62	clinical	clinical	ADJ
ct-9287	11	63	presentation	presentation	NOUN
ct-9287	11	64	in	in	ADP
ct-9287	11	65	addition	addition	NOUN
ct-9287	11	66	to	to	ADP
ct-9287	11	67	understanding	understand	VERB
ct-9287	11	68	the	the	DET
ct-9287	11	69	development	development	NOUN
ct-9287	11	70	of	of	ADP
ct-9287	11	71	dsds	dsds	NOUN
ct-9287	11	72	and	and	CCONJ
ct-9287	11	73	use	use	VERB
ct-9287	11	74	proper	proper	ADJ
ct-9287	11	75	nomenclature	nomenclature	NOUN
ct-9287	11	76	associated	associate	VERB
ct-9287	11	77	with	with	ADP
ct-9287	11	78	these	these	DET
ct-9287	11	79	syndromes	syndrome	NOUN
ct-9287	11	80	to	to	PART
ct-9287	11	81	systematically	systematically	ADV
ct-9287	11	82	diagnose	diagnose	VERB
ct-9287	11	83	and	and	CCONJ
ct-9287	11	84	appropriately	appropriately	ADV
ct-9287	11	85	manage	manage	VERB
ct-9287	11	86	sr	sr	PROPN
ct-9287	11	87	clinical	clinical	ADJ
ct-9287	11	88	cases	case	NOUN
ct-9287	11	89	.	.	PUNCT
ct-9287	12	1	case	case	NOUN
ct-9287	12	2	presentation	presentation	NOUN
ct-9287	12	3	history	history	NOUN
ct-9287	12	4	an	an	DET
ct-9287	12	5	8	8	NUM
ct-9287	12	6	-	-	PUNCT
ct-9287	12	7	month	month	NOUN
ct-9287	12	8	intact	intact	ADJ
ct-9287	12	9	mixed	mixed	ADJ
ct-9287	12	10	breed	breed	NOUN
ct-9287	12	11	dog	dog	NOUN
ct-9287	12	12	was	be	AUX
ct-9287	12	13	presented	present	VERB
ct-9287	12	14	to	to	ADP
ct-9287	12	15	the	the	DET
ct-9287	12	16	small	small	ADJ
ct-9287	12	17	animal	animal	NOUN
ct-9287	12	18	reproduction	reproduction	NOUN
ct-9287	12	19	service	service	NOUN
ct-9287	12	20	at	at	ADP
ct-9287	12	21	the	the	DET
ct-9287	12	22	colorado	colorado	PROPN
ct-9287	12	23	state	state	PROPN
ct-9287	12	24	university	university	PROPN
ct-9287	12	25	veterinary	veterinary	ADJ
ct-9287	12	26	teaching	teaching	NOUN
ct-9287	12	27	hospital	hospital	NOUN
ct-9287	12	28	for	for	ADP
ct-9287	12	29	evaluation	evaluation	NOUN
ct-9287	12	30	of	of	ADP
ct-9287	12	31	abnormal	abnormal	ADJ
ct-9287	12	32	external	external	ADJ
ct-9287	12	33	genitalia	genitalia	NOUN
ct-9287	12	34	.	.	PUNCT
ct-9287	13	1	referring	refer	VERB
ct-9287	13	2	veterinarian	veterinarian	NOUN
ct-9287	13	3	identified	identify	VERB
ct-9287	13	4	the	the	DET
ct-9287	13	5	abnormality	abnormality	NOUN
ct-9287	13	6	while	while	SCONJ
ct-9287	13	7	managing	manage	VERB
ct-9287	13	8	the	the	DET
ct-9287	13	9	dog	dog	NOUN
ct-9287	13	10	for	for	ADP
ct-9287	13	11	a	a	DET
ct-9287	13	12	urinary	urinary	ADJ
ct-9287	13	13	tract	tract	NOUN
ct-9287	13	14	infection	infection	NOUN
ct-9287	13	15	after	after	ADP
ct-9287	13	16	hematuria	hematuria	NOUN
ct-9287	13	17	(	(	PUNCT
ct-9287	13	18	observed	observe	VERB
ct-9287	13	19	by	by	ADP
ct-9287	13	20	the	the	DET
ct-9287	13	21	owners	owner	NOUN
ct-9287	13	22	shortly	shortly	ADV
ct-9287	13	23	after	after	ADP
ct-9287	13	24	adoption	adoption	NOUN
ct-9287	13	25	)	)	PUNCT
ct-9287	13	26	.	.	PUNCT
ct-9287	14	1	besides	besides	SCONJ
ct-9287	14	2	hematuria	hematuria	PROPN
ct-9287	14	3	,	,	PUNCT
ct-9287	14	4	other	other	ADJ
ct-9287	14	5	presenting	present	VERB
ct-9287	14	6	clinical	clinical	ADJ
ct-9287	14	7	signs	sign	NOUN
ct-9287	14	8	included	include	VERB
ct-9287	14	9	vulvar	vulvar	ADJ
ct-9287	14	10	discharge	discharge	NOUN
ct-9287	14	11	and	and	CCONJ
ct-9287	14	12	perivulvar	perivulvar	NOUN
ct-9287	14	13	dermatitis	dermatitis	NOUN
ct-9287	14	14	.	.	PUNCT
ct-9287	15	1	current	current	ADJ
ct-9287	15	2	owners	owner	NOUN
ct-9287	15	3	reported	report	VERB
ct-9287	15	4	absence	absence	NOUN
ct-9287	15	5	of	of	ADP
ct-9287	15	6	estrous	estrous	ADJ
ct-9287	15	7	or	or	CCONJ
ct-9287	15	8	intact	intact	ADJ
ct-9287	15	9	male	male	ADJ
ct-9287	15	10	behaviors	behavior	NOUN
ct-9287	15	11	.	.	PUNCT
ct-9287	16	1	previous	previous	ADJ
ct-9287	16	2	owners	owner	NOUN
ct-9287	16	3	confirmed	confirm	VERB
ct-9287	16	4	that	that	SCONJ
ct-9287	16	5	the	the	DET
ct-9287	16	6	dog	dog	NOUN
ct-9287	16	7	never	never	ADV
ct-9287	16	8	had	have	VERB
ct-9287	16	9	any	any	DET
ct-9287	16	10	surgery	surgery	NOUN
ct-9287	16	11	(	(	PUNCT
ct-9287	16	12	reproductive	reproductive	ADJ
ct-9287	16	13	alteration	alteration	NOUN
ct-9287	16	14	or	or	CCONJ
ct-9287	16	15	otherwise	otherwise	ADV
ct-9287	16	16	)	)	PUNCT
ct-9287	16	17	.	.	PUNCT
ct-9287	17	1	there	there	PRON
ct-9287	17	2	was	be	VERB
ct-9287	17	3	no	no	DET
ct-9287	17	4	evidence	evidence	NOUN
ct-9287	17	5	of	of	ADP
ct-9287	17	6	underlying	underlie	VERB
ct-9287	17	7	endocrinopathy	endocrinopathy	ADJ
ct-9287	17	8	(	(	PUNCT
ct-9287	17	9	e.g.	e.g.	ADV
ct-9287	17	10	hyperadrenocorticism	hyperadrenocorticism	NOUN
ct-9287	17	11	leading	lead	VERB
ct-9287	17	12	to	to	ADP
ct-9287	17	13	clitoral	clitoral	ADJ
ct-9287	17	14	hypertrophy	hypertrophy	NOUN
ct-9287	17	15	8)	8)	NUM
ct-9287	17	16	nor	nor	CCONJ
ct-9287	17	17	was	be	AUX
ct-9287	17	18	exposure	exposure	NOUN
ct-9287	17	19	to	to	ADP
ct-9287	17	20	androgens	androgen	NOUN
ct-9287	17	21	or	or	CCONJ
ct-9287	17	22	progestins9,10	progestins9,10	NOUN
ct-9287	17	23	during	during	ADP
ct-9287	17	24	pregnancy	pregnancy	NOUN
ct-9287	17	25	or	or	CCONJ
ct-9287	17	26	thereafter	thereafter	ADV
ct-9287	17	27	.	.	PUNCT
ct-9287	18	1	physical	physical	ADJ
ct-9287	18	2	examination	examination	NOUN
ct-9287	18	3	,	,	PUNCT
ct-9287	18	4	vaginal	vaginal	ADJ
ct-9287	18	5	cytology	cytology	NOUN
ct-9287	18	6	,	,	PUNCT
ct-9287	18	7	hematology	hematology	NOUN
ct-9287	18	8	,	,	PUNCT
ct-9287	18	9	serum	serum	NOUN
ct-9287	18	10	biochemistry	biochemistry	NOUN
ct-9287	18	11	dog	dog	NOUN
ct-9287	18	12	had	have	VERB
ct-9287	18	13	female	female	ADJ
ct-9287	18	14	phenotype	phenotype	NOUN
ct-9287	18	15	appearance	appearance	NOUN
ct-9287	18	16	with	with	ADP
ct-9287	18	17	normal	normal	ADJ
ct-9287	18	18	vulvar	vulvar	NOUN
ct-9287	18	19	conformation	conformation	NOUN
ct-9287	18	20	.	.	PUNCT
ct-9287	19	1	however	however	ADV
ct-9287	19	2	,	,	PUNCT
ct-9287	19	3	had	have	VERB
ct-9287	19	4	an	an	DET
ct-9287	19	5	enlarged	enlarge	VERB
ct-9287	19	6	clitoris	clitoris	NOUN
ct-9287	19	7	(	(	PUNCT
ct-9287	19	8	figure	figure	NOUN
ct-9287	19	9	1	1	NUM
ct-9287	19	10	)	)	PUNCT
ct-9287	19	11	with	with	ADP
ct-9287	19	12	a	a	DET
ct-9287	19	13	palpable	palpable	ADJ
ct-9287	19	14	boney	boney	ADJ
ct-9287	19	15	structure	structure	NOUN
ct-9287	19	16	consistent	consistent	ADJ
ct-9287	19	17	with	with	ADP
ct-9287	19	18	os	os	PROPN
ct-9287	19	19	clitoris	clitoris	PROPN
ct-9287	19	20	.	.	PUNCT
ct-9287	20	1	clitoral	clitoral	ADJ
ct-9287	20	2	enlargement	enlargement	NOUN
ct-9287	20	3	was	be	AUX
ct-9287	20	4	noticed	notice	VERB
ct-9287	20	5	along	along	ADP
ct-9287	20	6	the	the	DET
ct-9287	20	7	ventral	ventral	ADJ
ct-9287	20	8	aspect	aspect	NOUN
ct-9287	20	9	of	of	ADP
ct-9287	20	10	vulva	vulva	NOUN
ct-9287	20	11	that	that	PRON
ct-9287	20	12	protruded	protrude	VERB
ct-9287	20	13	~	~	PUNCT
ct-9287	20	14	2	2	NUM
ct-9287	20	15	cm	cm	NOUN
ct-9287	20	16	from	from	ADP
ct-9287	20	17	the	the	DET
ct-9287	20	18	vulvar	vulvar	NOUN
ct-9287	20	19	cleft	cleft	NOUN
ct-9287	20	20	when	when	SCONJ
ct-9287	20	21	the	the	DET
ct-9287	20	22	patient	patient	NOUN
ct-9287	20	23	was	be	AUX
ct-9287	20	24	in	in	ADP
ct-9287	20	25	standing	standing	NOUN
ct-9287	20	26	position	position	NOUN
ct-9287	20	27	.	.	PUNCT
ct-9287	21	1	under	under	ADP
ct-9287	21	2	sedation	sedation	NOUN
ct-9287	21	3	,	,	PUNCT
ct-9287	21	4	it	it	PRON
ct-9287	21	5	was	be	AUX
ct-9287	21	6	determined	determine	VERB
ct-9287	21	7	via	via	ADP
ct-9287	21	8	urethral	urethral	ADJ
ct-9287	21	9	catheterization	catheterization	NOUN
ct-9287	21	10	that	that	PRON
ct-9287	21	11	urination	urination	NOUN
ct-9287	21	12	occurred	occur	VERB
ct-9287	21	13	from	from	ADP
ct-9287	21	14	within	within	ADP
ct-9287	21	15	the	the	DET
ct-9287	21	16	vulva	vulva	NOUN
ct-9287	21	17	just	just	ADV
ct-9287	21	18	cranial	cranial	ADJ
ct-9287	21	19	to	to	ADP
ct-9287	21	20	the	the	DET
ct-9287	21	21	base	base	NOUN
ct-9287	21	22	of	of	ADP
ct-9287	21	23	the	the	DET
ct-9287	21	24	clitoris	clitoris	NOUN
ct-9287	21	25	,	,	PUNCT
ct-9287	21	26	and	and	CCONJ
ct-9287	21	27	not	not	PART
ct-9287	21	28	from	from	ADP
ct-9287	21	29	the	the	DET
ct-9287	21	30	protruding	protrude	VERB
ct-9287	21	31	os	os	NOUN
ct-9287	21	32	clitoris	clitoris	PROPN
ct-9287	21	33	.	.	PUNCT
ct-9287	22	1	there	there	PRON
ct-9287	22	2	were	be	VERB
ct-9287	22	3	no	no	DET
ct-9287	22	4	palpaclinical	palpaclinical	ADJ
ct-9287	22	5	theriogenology	theriogenology	NOUN
ct-9287	22	6	2022	2022	NUM
ct-9287	22	7	;	;	PUNCT
ct-9287	22	8	14	14	NUM
ct-9287	22	9	:	:	SYM
ct-9287	22	10	111	111	NUM
ct-9287	22	11	ble	ble	ADJ
ct-9287	22	12	testes	testis	NOUN
ct-9287	22	13	nor	nor	CCONJ
ct-9287	22	14	scrotal	scrotal	ADJ
ct-9287	22	15	structures	structure	NOUN
ct-9287	22	16	.	.	PUNCT
ct-9287	23	1	internal	internal	ADJ
ct-9287	23	2	reproductive	reproductive	ADJ
ct-9287	23	3	structures	structure	NOUN
ct-9287	23	4	were	be	AUX
ct-9287	23	5	not	not	PART
ct-9287	23	6	identifiable	identifiable	ADJ
ct-9287	23	7	via	via	ADP
ct-9287	23	8	abdominal	abdominal	ADJ
ct-9287	23	9	ultrasonography	ultrasonography	NOUN
ct-9287	23	10	.	.	PUNCT
ct-9287	24	1	figure	figure	NOUN
ct-9287	24	2	1	1	NUM
ct-9287	24	3	.	.	PUNCT
ct-9287	24	4	externally	externally	ADV
ct-9287	24	5	protruding	protrude	VERB
ct-9287	24	6	hyperplastic	hyperplastic	ADJ
ct-9287	24	7	os	os	NOUN
ct-9287	24	8	clitoris	clitoris	VERB
ct-9287	24	9	a	a	DET
ct-9287	24	10	cotton	cotton	NOUN
ct-9287	24	11	tipped	tip	VERB
ct-9287	24	12	plastic	plastic	ADJ
ct-9287	24	13	handle	handle	NOUN
ct-9287	24	14	swab	swab	NOUN
ct-9287	24	15	was	be	AUX
ct-9287	24	16	used	use	VERB
ct-9287	24	17	to	to	PART
ct-9287	24	18	obtain	obtain	VERB
ct-9287	24	19	a	a	DET
ct-9287	24	20	vaginal	vaginal	ADJ
ct-9287	24	21	smear	smear	NOUN
ct-9287	24	22	.	.	PUNCT
ct-9287	25	1	swab	swab	PROPN
ct-9287	25	2	was	be	AUX
ct-9287	25	3	rolled	roll	VERB
ct-9287	25	4	onto	onto	ADP
ct-9287	25	5	a	a	DET
ct-9287	25	6	glass	glass	NOUN
ct-9287	25	7	microscope	microscope	NOUN
ct-9287	25	8	slide	slide	NOUN
ct-9287	25	9	that	that	PRON
ct-9287	25	10	was	be	AUX
ct-9287	25	11	then	then	ADV
ct-9287	25	12	air	air	NOUN
ct-9287	25	13	dried	dry	VERB
ct-9287	25	14	and	and	CCONJ
ct-9287	25	15	stained	stain	VERB
ct-9287	25	16	using	use	VERB
ct-9287	25	17	a	a	DET
ct-9287	25	18	simple	simple	ADJ
ct-9287	25	19	modified	modify	VERB
ct-9287	25	20	wrights	wright	NOUN
ct-9287	25	21	-	-	PUNCT
ct-9287	25	22	giemsa	giemsa	NOUN
ct-9287	25	23	stain	stain	NOUN
ct-9287	25	24	(	(	PUNCT
ct-9287	25	25	diff	diff	NOUN
ct-9287	25	26	-	-	PUNCT
ct-9287	25	27	quik	quik	NOUN
ct-9287	25	28	)	)	PUNCT
ct-9287	25	29	.	.	PUNCT
ct-9287	26	1	vaginal	vaginal	ADJ
ct-9287	26	2	smear	smear	NOUN
ct-9287	26	3	was	be	AUX
ct-9287	26	4	evaluated	evaluate	VERB
ct-9287	26	5	under	under	ADP
ct-9287	26	6	light	light	ADJ
ct-9287	26	7	microscopy	microscopy	NOUN
ct-9287	26	8	(	(	PUNCT
ct-9287	26	9	100	100	NUM
ct-9287	26	10	200	200	NUM
ct-9287	26	11	x	x	NOUN
ct-9287	26	12	magnification	magnification	NOUN
ct-9287	26	13	)	)	PUNCT
ct-9287	26	14	.	.	PUNCT
ct-9287	27	1	predominant	predominant	ADJ
ct-9287	27	2	(	(	PUNCT
ct-9287	27	3	>	>	X
ct-9287	27	4	90	90	NUM
ct-9287	27	5	%	%	NOUN
ct-9287	27	6	)	)	PUNCT
ct-9287	28	1	cells	cell	NOUN
ct-9287	28	2	were	be	AUX
ct-9287	28	3	parabasal	parabasal	ADJ
ct-9287	28	4	cells	cell	NOUN
ct-9287	28	5	,	,	PUNCT
ct-9287	28	6	indicating	indicate	VERB
ct-9287	28	7	lack	lack	NOUN
ct-9287	28	8	of	of	ADP
ct-9287	28	9	estrogenic	estrogenic	ADJ
ct-9287	28	10	influence	influence	NOUN
ct-9287	28	11	.	.	PUNCT
ct-9287	29	1	complete	complete	ADJ
ct-9287	29	2	blood	blood	NOUN
ct-9287	29	3	count	count	NOUN
ct-9287	29	4	and	and	CCONJ
ct-9287	29	5	serum	serum	NOUN
ct-9287	29	6	biochemistry	biochemistry	NOUN
ct-9287	29	7	profiles	profile	NOUN
ct-9287	29	8	were	be	AUX
ct-9287	29	9	within	within	ADP
ct-9287	29	10	normal	normal	ADJ
ct-9287	29	11	canine	canine	NOUN
ct-9287	29	12	reference	reference	NOUN
ct-9287	29	13	ranges	range	NOUN
ct-9287	29	14	.	.	PUNCT
ct-9287	30	1	owners	owner	NOUN
ct-9287	30	2	declined	decline	VERB
ct-9287	30	3	further	further	ADJ
ct-9287	30	4	tests	test	NOUN
ct-9287	30	5	(	(	PUNCT
ct-9287	30	6	e.g.	e.g.	ADV
ct-9287	30	7	serum	serum	NOUN
ct-9287	30	8	antimüllerian	antimüllerian	ADJ
ct-9287	30	9	hormone	hormone	NOUN
ct-9287	30	10	)	)	PUNCT
ct-9287	30	11	and	and	CCONJ
ct-9287	30	12	surgical	surgical	ADJ
ct-9287	30	13	options	option	NOUN
ct-9287	30	14	for	for	ADP
ct-9287	30	15	os	os	PROPN
ct-9287	30	16	clitoris	clitoris	PROPN
ct-9287	30	17	removal	removal	NOUN
ct-9287	30	18	,	,	PUNCT
ct-9287	30	19	but	but	CCONJ
ct-9287	30	20	elected	elect	VERB
ct-9287	30	21	laparoscopic	laparoscopic	NOUN
ct-9287	30	22	-	-	PUNCT
ct-9287	30	23	assisted	assist	VERB
ct-9287	30	24	gonadectomy	gonadectomy	NOUN
ct-9287	30	25	.	.	PUNCT
ct-9287	31	1	gonadectomy	gonadectomy	NOUN
ct-9287	31	2	patient	patient	NOUN
ct-9287	31	3	was	be	AUX
ct-9287	31	4	premedicated	premedicate	VERB
ct-9287	31	5	with	with	ADP
ct-9287	31	6	0.02	0.02	NUM
ct-9287	31	7	mg	mg	NUM
ct-9287	31	8	/	/	SYM
ct-9287	31	9	kg	kg	NOUN
ct-9287	31	10	atropine	atropine	NOUN
ct-9287	31	11	sulfate	sulfate	NOUN
ct-9287	31	12	(	(	PUNCT
ct-9287	31	13	atropine	atropine	NOUN
ct-9287	31	14	sulfate	sulfate	NOUN
ct-9287	31	15	injection	injection	NOUN
ct-9287	31	16	,	,	PUNCT
ct-9287	31	17	west	west	PROPN
ct-9287	31	18	ward	ward	PROPN
ct-9287	31	19	,	,	PUNCT
ct-9287	31	20	eatontown	eatontown	PROPN
ct-9287	31	21	,	,	PUNCT
ct-9287	31	22	nj	nj	PROPN
ct-9287	31	23	)	)	PUNCT
ct-9287	31	24	,	,	PUNCT
ct-9287	31	25	0.03	0.03	NUM
ct-9287	31	26	mg	mg	PROPN
ct-9287	31	27	/	/	SYM
ct-9287	31	28	kg	kg	PROPN
ct-9287	31	29	acepromazine	acepromazine	NOUN
ct-9287	31	30	(	(	PUNCT
ct-9287	31	31	acepromazine	acepromazine	NOUN
ct-9287	31	32	maleate	maleate	NOUN
ct-9287	31	33	injection	injection	NOUN
ct-9287	31	34	,	,	PUNCT
ct-9287	31	35	vetone	vetone	PROPN
ct-9287	31	36	,	,	PUNCT
ct-9287	31	37	boise	boise	PROPN
ct-9287	31	38	,	,	PUNCT
ct-9287	31	39	i	i	PROPN
ct-9287	31	40	d	d	PROPN
ct-9287	31	41	)	)	PUNCT
ct-9287	31	42	and	and	CCONJ
ct-9287	31	43	0.05	0.05	NUM
ct-9287	31	44	mg	mg	PROPN
ct-9287	31	45	/	/	SYM
ct-9287	31	46	kg	kg	PROPN
ct-9287	31	47	hydromorphone	hydromorphone	PROPN
ct-9287	31	48	(	(	PUNCT
ct-9287	31	49	hospira	hospira	PROPN
ct-9287	31	50	inc	inc	PROPN
ct-9287	31	51	.	.	PROPN
ct-9287	31	52	,	,	PUNCT
ct-9287	31	53	lake	lake	PROPN
ct-9287	31	54	forest	forest	PROPN
ct-9287	31	55	,	,	PUNCT
ct-9287	31	56	il	il	PROPN
ct-9287	31	57	)	)	PUNCT
ct-9287	31	58	;	;	PUNCT
ct-9287	31	59	all	all	PRON
ct-9287	31	60	were	be	AUX
ct-9287	31	61	given	give	VERB
ct-9287	31	62	intramuscularly	intramuscularly	ADV
ct-9287	31	63	.	.	PUNCT
ct-9287	32	1	anesthesia	anesthesia	PROPN
ct-9287	32	2	was	be	AUX
ct-9287	32	3	induced	induce	VERB
ct-9287	32	4	with	with	ADP
ct-9287	32	5	2	2	NUM
ct-9287	32	6	mg	mg	PROPN
ct-9287	32	7	/	/	SYM
ct-9287	32	8	kg	kg	PROPN
ct-9287	32	9	ketamine	ketamine	PROPN
ct-9287	32	10	(	(	PUNCT
ct-9287	32	11	ketaset	ketaset	PROPN
ct-9287	32	12	®	®	PROPN
ct-9287	32	13	,	,	PUNCT
ct-9287	32	14	zoetis	zoetis	PROPN
ct-9287	32	15	inc	inc	PROPN
ct-9287	32	16	,	,	PUNCT
ct-9287	32	17	florham	florham	PROPN
ct-9287	32	18	park	park	PROPN
ct-9287	32	19	,	,	PUNCT
ct-9287	32	20	nj	nj	PROPN
ct-9287	32	21	)	)	PUNCT
ct-9287	32	22	and	and	CCONJ
ct-9287	32	23	2	2	NUM
ct-9287	32	24	mg	mg	NUM
ct-9287	32	25	/	/	SYM
ct-9287	32	26	kg	kg	NOUN
ct-9287	32	27	propofol	propofol	NOUN
ct-9287	32	28	(	(	PUNCT
ct-9287	32	29	zoetis	zoetis	PROPN
ct-9287	32	30	,	,	PUNCT
ct-9287	32	31	kalamazoo	kalamazoo	PROPN
ct-9287	32	32	,	,	PUNCT
ct-9287	32	33	mi	mi	PROPN
ct-9287	32	34	)	)	PUNCT
ct-9287	32	35	given	give	VERB
ct-9287	32	36	intravenously	intravenously	ADV
ct-9287	32	37	.	.	PUNCT
ct-9287	33	1	general	general	ADJ
ct-9287	33	2	anesthesia	anesthesia	PROPN
ct-9287	33	3	was	be	AUX
ct-9287	33	4	maintained	maintain	VERB
ct-9287	33	5	with	with	ADP
ct-9287	33	6	isoflurane	isoflurane	NOUN
ct-9287	33	7	(	(	PUNCT
ct-9287	33	8	akorn	akorn	PROPN
ct-9287	33	9	animal	animal	NOUN
ct-9287	33	10	health	health	NOUN
ct-9287	33	11	,	,	PUNCT
ct-9287	33	12	lake	lake	PROPN
ct-9287	33	13	forest	forest	PROPN
ct-9287	33	14	,	,	PUNCT
ct-9287	33	15	il	il	PROPN
ct-9287	33	16	)	)	PUNCT
ct-9287	33	17	in	in	ADP
ct-9287	33	18	oxygen	oxygen	NOUN
ct-9287	33	19	.	.	PUNCT
ct-9287	34	1	a	a	DET
ct-9287	34	2	2	2	NUM
ct-9287	34	3	-	-	PUNCT
ct-9287	34	4	cm	cm	NOUN
ct-9287	34	5	ventral	ventral	ADJ
ct-9287	34	6	midline	midline	NOUN
ct-9287	34	7	incision	incision	NOUN
ct-9287	34	8	was	be	AUX
ct-9287	34	9	made	make	VERB
ct-9287	34	10	just	just	ADV
ct-9287	34	11	caudal	caudal	NOUN
ct-9287	34	12	to	to	ADP
ct-9287	34	13	the	the	DET
ct-9287	34	14	umbilicus	umbilicus	NOUN
ct-9287	34	15	and	and	CCONJ
ct-9287	34	16	a	a	DET
ct-9287	34	17	single	single	ADJ
ct-9287	34	18	incision	incision	NOUN
ct-9287	34	19	laparoscopic	laparoscopic	ADJ
ct-9287	34	20	surgical	surgical	ADJ
ct-9287	34	21	port	port	NOUN
ct-9287	34	22	was	be	AUX
ct-9287	34	23	placed	place	VERB
ct-9287	34	24	into	into	ADP
ct-9287	34	25	the	the	DET
ct-9287	34	26	abdomen	abdoman	NOUN
ct-9287	34	27	to	to	PART
ct-9287	34	28	allow	allow	VERB
ct-9287	34	29	insufflation	insufflation	NOUN
ct-9287	34	30	with	with	ADP
ct-9287	34	31	co2	co2	NOUN
ct-9287	34	32	to	to	ADP
ct-9287	34	33	a	a	DET
ct-9287	34	34	pressure	pressure	NOUN
ct-9287	34	35	of	of	ADP
ct-9287	34	36	10	10	NUM
ct-9287	34	37	mm	mm	NUM
ct-9287	34	38	hg	hg	NOUN
ct-9287	34	39	.	.	PUNCT
ct-9287	35	1	a	a	DET
ct-9287	35	2	zero	zero	NUM
ct-9287	35	3	-	-	PUNCT
ct-9287	35	4	degree	degree	NOUN
ct-9287	35	5	laparoscope	laparoscope	NOUN
ct-9287	35	6	was	be	AUX
ct-9287	35	7	inserted	insert	VERB
ct-9287	35	8	into	into	ADP
ct-9287	35	9	1	1	NUM
ct-9287	35	10	of	of	ADP
ct-9287	35	11	the	the	DET
ct-9287	35	12	ports	port	NOUN
ct-9287	35	13	and	and	CCONJ
ct-9287	35	14	the	the	DET
ct-9287	35	15	interior	interior	NOUN
ct-9287	35	16	of	of	ADP
ct-9287	35	17	the	the	DET
ct-9287	35	18	abdomen	abdomen	NOUN
ct-9287	35	19	was	be	AUX
ct-9287	35	20	explored	explore	VERB
ct-9287	35	21	.	.	PUNCT
ct-9287	36	1	left	leave	VERB
ct-9287	36	2	gonad	gonad	NOUN
ct-9287	36	3	was	be	AUX
ct-9287	36	4	first	first	ADV
ct-9287	36	5	visualized	visualize	VERB
ct-9287	36	6	and	and	CCONJ
ct-9287	36	7	grossly	grossly	ADV
ct-9287	36	8	appeared	appear	VERB
ct-9287	36	9	like	like	ADP
ct-9287	36	10	testis	testis	NOUN
ct-9287	36	11	.	.	PUNCT
ct-9287	37	1	using	use	VERB
ct-9287	37	2	forceps	forceps	NOUN
ct-9287	37	3	and	and	CCONJ
ct-9287	37	4	ligasure	ligasure	NOUN
ct-9287	37	5	™	™	PROPN
ct-9287	37	6	,	,	PUNCT
ct-9287	37	7	the	the	DET
ct-9287	37	8	tubular	tubular	ADJ
ct-9287	37	9	structure	structure	NOUN
ct-9287	37	10	associated	associate	VERB
ct-9287	37	11	with	with	ADP
ct-9287	37	12	the	the	DET
ct-9287	37	13	gonad	gonad	NOUN
ct-9287	37	14	(	(	PUNCT
ct-9287	37	15	presumed	presume	VERB
ct-9287	37	16	to	to	PART
ct-9287	37	17	be	be	AUX
ct-9287	37	18	the	the	DET
ct-9287	37	19	ductus	ductus	NOUN
ct-9287	37	20	deferens	deferen	NOUN
ct-9287	37	21	and	and	CCONJ
ct-9287	37	22	pampiniform	pampiniform	NOUN
ct-9287	37	23	plexus	plexus	NOUN
ct-9287	37	24	)	)	PUNCT
ct-9287	37	25	were	be	AUX
ct-9287	37	26	ligated	ligate	VERB
ct-9287	37	27	.	.	PUNCT
ct-9287	38	1	vasculature	vasculature	NOUN
ct-9287	38	2	and	and	CCONJ
ct-9287	38	3	presumed	presume	VERB
ct-9287	38	4	ductus	ductus	NOUN
ct-9287	38	5	deferens	deferen	NOUN
ct-9287	38	6	on	on	ADP
ct-9287	38	7	the	the	DET
ct-9287	38	8	right	right	ADJ
ct-9287	38	9	-	-	PUNCT
ct-9287	38	10	hand	hand	NOUN
ct-9287	38	11	side	side	NOUN
ct-9287	38	12	was	be	AUX
ct-9287	38	13	followed	follow	VERB
ct-9287	38	14	into	into	ADP
ct-9287	38	15	the	the	DET
ct-9287	38	16	inguinal	inguinal	ADJ
ct-9287	38	17	ring	ring	NOUN
ct-9287	38	18	and	and	CCONJ
ct-9287	38	19	the	the	DET
ct-9287	38	20	remaining	remain	VERB
ct-9287	38	21	gonad	gonad	NOUN
ct-9287	38	22	was	be	AUX
ct-9287	38	23	identified	identify	VERB
ct-9287	38	24	via	via	ADP
ct-9287	38	25	deep	deep	ADJ
ct-9287	38	26	external	external	ADJ
ct-9287	38	27	palpation	palpation	NOUN
ct-9287	38	28	.	.	PUNCT
ct-9287	39	1	using	use	VERB
ct-9287	39	2	electrocautery	electrocautery	NOUN
ct-9287	39	3	,	,	PUNCT
ct-9287	39	4	a	a	DET
ct-9287	39	5	2	2	NUM
ct-9287	39	6	cm	cm	NOUN
ct-9287	39	7	incision	incision	NOUN
ct-9287	39	8	above	above	ADP
ct-9287	39	9	the	the	DET
ct-9287	39	10	inguinal	inguinal	ADJ
ct-9287	39	11	ring	ring	NOUN
ct-9287	39	12	(	(	PUNCT
ct-9287	39	13	where	where	SCONJ
ct-9287	39	14	the	the	DET
ct-9287	39	15	testis	testis	NOUN
ct-9287	39	16	-	-	PUNCT
ct-9287	39	17	like	like	ADJ
ct-9287	39	18	gonad	gonad	NOUN
ct-9287	39	19	was	be	AUX
ct-9287	39	20	located	locate	VERB
ct-9287	39	21	)	)	PUNCT
ct-9287	39	22	was	be	AUX
ct-9287	39	23	made	make	VERB
ct-9287	39	24	and	and	CCONJ
ct-9287	39	25	closed	closed	ADJ
ct-9287	39	26	castration	castration	NOUN
ct-9287	39	27	was	be	AUX
ct-9287	39	28	performed	perform	VERB
ct-9287	39	29	.	.	PUNCT
ct-9287	40	1	abdominal	abdominal	ADJ
ct-9287	40	2	cavity	cavity	NOUN
ct-9287	40	3	was	be	AUX
ct-9287	40	4	examined	examine	VERB
ct-9287	40	5	before	before	ADP
ct-9287	40	6	closure	closure	NOUN
ct-9287	40	7	to	to	PART
ct-9287	40	8	confirm	confirm	VERB
ct-9287	40	9	absence	absence	NOUN
ct-9287	40	10	of	of	ADP
ct-9287	40	11	ovaries	ovary	NOUN
ct-9287	40	12	,	,	PUNCT
ct-9287	40	13	ovotestes	ovotestis	NOUN
ct-9287	40	14	,	,	PUNCT
ct-9287	40	15	uterine	uterine	ADJ
ct-9287	40	16	tubular	tubular	ADJ
ct-9287	40	17	structure(s	structure(s	NOUN
ct-9287	40	18	)	)	PUNCT
ct-9287	40	19	or	or	CCONJ
ct-9287	40	20	prostate	prostate	NOUN
ct-9287	40	21	.	.	PUNCT
ct-9287	41	1	all	all	DET
ct-9287	41	2	incisions	incision	NOUN
ct-9287	41	3	were	be	AUX
ct-9287	41	4	closed	close	VERB
ct-9287	41	5	in	in	ADP
ct-9287	41	6	a	a	DET
ct-9287	41	7	standard	standard	ADJ
ct-9287	41	8	,	,	PUNCT
ct-9287	41	9	multiple	multiple	ADJ
ct-9287	41	10	layer	layer	NOUN
ct-9287	41	11	fashion	fashion	NOUN
ct-9287	41	12	and	and	CCONJ
ct-9287	41	13	there	there	PRON
ct-9287	41	14	were	be	VERB
ct-9287	41	15	no	no	DET
ct-9287	41	16	complications	complication	NOUN
ct-9287	41	17	.	.	PUNCT
ct-9287	42	1	patient	patient	NOUN
ct-9287	42	2	’s	’s	PART
ct-9287	42	3	recovery	recovery	NOUN
ct-9287	42	4	from	from	ADP
ct-9287	42	5	anesthesia	anesthesia	PROPN
ct-9287	42	6	was	be	AUX
ct-9287	42	7	uneventful	uneventful	ADJ
ct-9287	42	8	and	and	CCONJ
ct-9287	42	9	2.2	2.2	NUM
ct-9287	42	10	mg	mg	PROPN
ct-9287	42	11	/	/	SYM
ct-9287	42	12	kg	kg	PROPN
ct-9287	42	13	carprofen	carprofen	PROPN
ct-9287	42	14	(	(	PUNCT
ct-9287	42	15	rimadyl	rimadyl	PROPN
ct-9287	42	16	®	®	NOUN
ct-9287	42	17	,	,	PUNCT
ct-9287	42	18	zoetis	zoetis	PROPN
ct-9287	42	19	)	)	PUNCT
ct-9287	42	20	was	be	AUX
ct-9287	42	21	given	give	VERB
ct-9287	42	22	subcutaneously	subcutaneously	ADV
ct-9287	42	23	for	for	ADP
ct-9287	42	24	postoperative	postoperative	ADJ
ct-9287	42	25	pain	pain	NOUN
ct-9287	42	26	management	management	NOUN
ct-9287	42	27	.	.	PUNCT
ct-9287	43	1	six	six	NUM
ct-9287	43	2	months	month	NOUN
ct-9287	43	3	following	follow	VERB
ct-9287	43	4	surgery	surgery	NOUN
ct-9287	43	5	,	,	PUNCT
ct-9287	43	6	a	a	DET
ct-9287	43	7	follow	follow	NOUN
ct-9287	43	8	up	up	ADP
ct-9287	43	9	phone	phone	NOUN
ct-9287	43	10	consultation	consultation	NOUN
ct-9287	43	11	with	with	ADP
ct-9287	43	12	the	the	DET
ct-9287	43	13	owner	owner	NOUN
ct-9287	43	14	revealed	reveal	VERB
ct-9287	43	15	that	that	SCONJ
ct-9287	43	16	the	the	DET
ct-9287	43	17	clitoral	clitoral	ADJ
ct-9287	43	18	enlargement	enlargement	NOUN
ct-9287	43	19	had	have	AUX
ct-9287	43	20	not	not	PART
ct-9287	43	21	reduced	reduce	VERB
ct-9287	43	22	in	in	ADP
ct-9287	43	23	size	size	NOUN
ct-9287	43	24	.	.	PUNCT
ct-9287	44	1	there	there	PRON
ct-9287	44	2	was	be	VERB
ct-9287	44	3	no	no	DET
ct-9287	44	4	vulvar	vulvar	ADJ
ct-9287	44	5	discharge	discharge	NOUN
ct-9287	44	6	or	or	CCONJ
ct-9287	44	7	perivulvar	perivulvar	NOUN
ct-9287	44	8	dermatitis	dermatitis	NOUN
ct-9287	44	9	nor	nor	CCONJ
ct-9287	44	10	clitoral	clitoral	ADJ
ct-9287	44	11	enlargement	enlargement	NOUN
ct-9287	44	12	causing	cause	VERB
ct-9287	44	13	any	any	DET
ct-9287	44	14	irritation	irritation	NOUN
ct-9287	44	15	or	or	CCONJ
ct-9287	44	16	distraction	distraction	NOUN
ct-9287	44	17	to	to	ADP
ct-9287	44	18	the	the	DET
ct-9287	44	19	patient	patient	NOUN
ct-9287	44	20	.	.	PUNCT
ct-9287	45	1	additionally	additionally	ADV
ct-9287	45	2	,	,	PUNCT
ct-9287	45	3	urination	urination	NOUN
ct-9287	45	4	was	be	AUX
ct-9287	45	5	reported	report	VERB
ct-9287	45	6	to	to	PART
ct-9287	45	7	be	be	AUX
ct-9287	45	8	normal	normal	ADJ
ct-9287	45	9	.	.	PUNCT
ct-9287	46	1	diagnosis	diagnosis	VERB
ct-9287	46	2	a	a	DET
ct-9287	46	3	case	case	NOUN
ct-9287	46	4	of	of	ADP
ct-9287	46	5	dsd	dsd	PROPN
ct-9287	46	6	was	be	AUX
ct-9287	46	7	suspected11	suspected11	NOUN
ct-9287	46	8	and	and	CCONJ
ct-9287	46	9	appropriate	appropriate	ADJ
ct-9287	46	10	tests	test	NOUN
ct-9287	46	11	were	be	AUX
ct-9287	46	12	conducted	conduct	VERB
ct-9287	46	13	(	(	PUNCT
ct-9287	46	14	e.g.	e.g.	ADV
ct-9287	46	15	immunochemical	immunochemical	ADJ
ct-9287	46	16	localization	localization	NOUN
ct-9287	46	17	of	of	ADP
ct-9287	46	18	antimüllerian	antimüllerian	ADJ
ct-9287	46	19	hormone	hormone	NOUN
ct-9287	46	20	[	[	X
ct-9287	46	21	amh]12	amh]12	NOUN
ct-9287	46	22	)	)	PUNCT
ct-9287	46	23	.	.	PUNCT
ct-9287	47	1	histology	histology	NOUN
ct-9287	47	2	of	of	ADP
ct-9287	47	3	gonadal	gonadal	ADJ
ct-9287	47	4	tissue	tissue	NOUN
ct-9287	47	5	(	(	PUNCT
ct-9287	47	6	figure	figure	NOUN
ct-9287	47	7	2	2	NUM
ct-9287	47	8	)	)	PUNCT
ct-9287	47	9	revealed	reveal	VERB
ct-9287	47	10	that	that	SCONJ
ct-9287	47	11	the	the	DET
ct-9287	47	12	architecture	architecture	NOUN
ct-9287	47	13	of	of	ADP
ct-9287	47	14	the	the	DET
ct-9287	47	15	tissue	tissue	NOUN
ct-9287	47	16	was	be	AUX
ct-9287	47	17	consistent	consistent	ADJ
ct-9287	47	18	with	with	ADP
ct-9287	47	19	hypoplastic	hypoplastic	ADJ
ct-9287	47	20	testicular	testicular	ADJ
ct-9287	47	21	tissue	tissue	NOUN
ct-9287	47	22	(	(	PUNCT
ct-9287	47	23	figure	figure	NOUN
ct-9287	47	24	3	3	NUM
ct-9287	47	25	)	)	PUNCT
ct-9287	47	26	.	.	PUNCT
ct-9287	48	1	empty	empty	ADJ
ct-9287	48	2	seminiferous	seminiferous	ADJ
ct-9287	48	3	tubules	tubule	NOUN
ct-9287	48	4	lined	line	VERB
ct-9287	48	5	by	by	ADP
ct-9287	48	6	sertoli	sertoli	NOUN
ct-9287	48	7	cells	cell	NOUN
ct-9287	48	8	were	be	AUX
ct-9287	48	9	noticed	notice	VERB
ct-9287	48	10	in	in	ADP
ct-9287	48	11	both	both	DET
ct-9287	48	12	testes	testis	NOUN
ct-9287	48	13	;	;	PUNCT
ct-9287	48	14	however	however	ADV
ct-9287	48	15	,	,	PUNCT
ct-9287	48	16	testes	testis	NOUN
ct-9287	48	17	had	have	VERB
ct-9287	48	18	no	no	DET
ct-9287	48	19	maturing	mature	VERB
ct-9287	48	20	germ	germ	NOUN
ct-9287	48	21	cells	cell	NOUN
ct-9287	48	22	nor	nor	CCONJ
ct-9287	48	23	obvious	obvious	ADJ
ct-9287	48	24	signs	sign	NOUN
ct-9287	48	25	of	of	ADP
ct-9287	48	26	active	active	ADJ
ct-9287	48	27	spermatogenesis	spermatogenesis	NOUN
ct-9287	48	28	.	.	PUNCT
ct-9287	49	1	interstitial	interstitial	ADJ
ct-9287	49	2	tissue	tissue	NOUN
ct-9287	49	3	of	of	ADP
ct-9287	49	4	testes	testis	NOUN
ct-9287	49	5	had	have	VERB
ct-9287	49	6	leydig	leydig	NOUN
ct-9287	49	7	cells	cell	NOUN
ct-9287	49	8	and	and	CCONJ
ct-9287	49	9	epididymides	epididymis	NOUN
ct-9287	49	10	had	have	VERB
ct-9287	49	11	empty	empty	ADJ
ct-9287	49	12	tubules	tubule	NOUN
ct-9287	49	13	lined	line	VERB
ct-9287	49	14	with	with	ADP
ct-9287	49	15	columnar	columnar	ADJ
ct-9287	49	16	epithelium	epithelium	NOUN
ct-9287	49	17	.	.	PUNCT
ct-9287	50	1	gondal	gondal	ADJ
ct-9287	50	2	tissue	tissue	NOUN
ct-9287	50	3	was	be	AUX
ct-9287	50	4	positive	positive	ADJ
ct-9287	50	5	for	for	ADP
ct-9287	50	6	amh	amh	PROPN
ct-9287	50	7	(	(	PUNCT
ct-9287	50	8	figure	figure	NOUN
ct-9287	50	9	4	4	NUM
ct-9287	50	10	)	)	PUNCT
ct-9287	50	11	,	,	PUNCT
ct-9287	50	12	confirming	confirm	VERB
ct-9287	50	13	functional	functional	ADJ
ct-9287	50	14	sertoli	sertoli	NOUN
ct-9287	50	15	cells	cell	NOUN
ct-9287	50	16	(	(	PUNCT
ct-9287	50	17	low	low	ADJ
ct-9287	50	18	testosterone	testosterone	NOUN
ct-9287	50	19	concentrations	concentration	NOUN
ct-9287	50	20	observed	observe	VERB
ct-9287	50	21	in	in	ADP
ct-9287	50	22	hypogonadism13	hypogonadism13	NOUN
ct-9287	50	23	)	)	PUNCT
ct-9287	50	24	.	.	PUNCT
ct-9287	51	1	figure	figure	NOUN
ct-9287	51	2	2	2	NUM
ct-9287	51	3	.	.	PUNCT
ct-9287	51	4	gross	gross	ADJ
ct-9287	51	5	image	image	NOUN
ct-9287	51	6	of	of	ADP
ct-9287	51	7	the	the	DET
ct-9287	51	8	gonadal	gonadal	ADJ
ct-9287	51	9	tissue	tissue	NOUN
ct-9287	51	10	removed	remove	VERB
ct-9287	51	11	at	at	ADP
ct-9287	51	12	surgery	surgery	NOUN
ct-9287	51	13	figure	figure	NOUN
ct-9287	51	14	3	3	NUM
ct-9287	51	15	.	.	PUNCT
ct-9287	51	16	hematoxylin	hematoxylin	NOUN
ct-9287	51	17	and	and	CCONJ
ct-9287	51	18	eosin	eosin	NOUN
ct-9287	51	19	-	-	PUNCT
ct-9287	51	20	stained	stain	VERB
ct-9287	51	21	sections	section	NOUN
ct-9287	51	22	of	of	ADP
ct-9287	51	23	testis	testis	NOUN
ct-9287	51	24	(	(	PUNCT
ct-9287	51	25	a	a	NOUN
ct-9287	51	26	)	)	PUNCT
ct-9287	51	27	and	and	CCONJ
ct-9287	51	28	epididymis	epididymis	NOUN
ct-9287	51	29	(	(	PUNCT
ct-9287	51	30	b	b	NOUN
ct-9287	51	31	)	)	PUNCT
ct-9287	51	32	;	;	PUNCT
ct-9287	51	33	note	note	VERB
ct-9287	51	34	absence	absence	NOUN
ct-9287	51	35	of	of	ADP
ct-9287	51	36	maturing	mature	VERB
ct-9287	51	37	germ	germ	NOUN
ct-9287	51	38	cells	cell	NOUN
ct-9287	51	39	in	in	ADP
ct-9287	51	40	seminiferous	seminiferous	ADJ
ct-9287	51	41	tubules	tubule	NOUN
ct-9287	51	42	and	and	CCONJ
ct-9287	51	43	normal	normal	ADJ
ct-9287	51	44	epididymal	epididymal	ADJ
ct-9287	51	45	epithelium	epithelium	NOUN
ct-9287	51	46	with	with	ADP
ct-9287	51	47	no	no	DET
ct-9287	51	48	sperm	sperm	NOUN
ct-9287	51	49	(	(	PUNCT
ct-9287	51	50	200	200	NUM
ct-9287	51	51	x	x	NOUN
ct-9287	51	52	magnification	magnification	NOUN
ct-9287	51	53	)	)	PUNCT
ct-9287	51	54	.	.	PUNCT
ct-9287	52	1	figure	figure	NOUN
ct-9287	52	2	4	4	NUM
ct-9287	52	3	.	.	PUNCT
ct-9287	52	4	immunolabeling	immunolabele	VERB
ct-9287	52	5	for	for	ADP
ct-9287	52	6	amh	amh	PROPN
ct-9287	52	7	(	(	PUNCT
ct-9287	52	8	black	black	ADJ
ct-9287	52	9	arrows	arrow	NOUN
ct-9287	52	10	)	)	PUNCT
ct-9287	52	11	within	within	ADP
ct-9287	52	12	the	the	DET
ct-9287	52	13	seminiferous	seminiferous	ADJ
ct-9287	52	14	tubules	tubule	NOUN
ct-9287	52	15	containing	contain	VERB
ct-9287	52	16	sertoli	sertoli	NOUN
ct-9287	52	17	cells	cell	NOUN
ct-9287	52	18	;	;	PUNCT
ct-9287	52	19	note	note	VERB
ct-9287	52	20	negative	negative	ADJ
ct-9287	52	21	control	control	NOUN
ct-9287	52	22	(	(	PUNCT
ct-9287	52	23	small	small	ADJ
ct-9287	52	24	insert	insert	NOUN
ct-9287	52	25	)	)	PUNCT
ct-9287	52	26	without	without	ADP
ct-9287	52	27	primary	primary	ADJ
ct-9287	52	28	antibody	antibody	NOUN
ct-9287	52	29	.	.	PUNCT
ct-9287	53	1	chromosomal	chromosomal	ADJ
ct-9287	53	2	sex	sex	NOUN
ct-9287	53	3	(	(	PUNCT
ct-9287	53	4	i.e.	i.e.	X
ct-9287	53	5	,	,	PUNCT
ct-9287	53	6	xx	xx	NUM
ct-9287	53	7	versus	versus	ADP
ct-9287	53	8	xy	xy	PROPN
ct-9287	53	9	)	)	PUNCT
ct-9287	53	10	pcr	pcr	PROPN
ct-9287	53	11	was	be	AUX
ct-9287	53	12	determined	determine	VERB
ct-9287	53	13	via	via	ADP
ct-9287	53	14	amplifying14	amplifying14	PROPN
ct-9287	53	15	amelogenin	amelogenin	PROPN
ct-9287	53	16	(	(	PUNCT
ct-9287	53	17	amel	amel	PROPN
ct-9287	53	18	)	)	PUNCT
ct-9287	53	19	gene	gene	NOUN
ct-9287	53	20	from	from	ADP
ct-9287	53	21	genomic	genomic	ADJ
ct-9287	53	22	dna	dna	PROPN
ct-9287	53	23	isolated	isolate	VERB
ct-9287	53	24	from	from	ADP
ct-9287	53	25	blood	blood	NOUN
ct-9287	53	26	(	(	PUNCT
ct-9287	53	27	qiagen	qiagen	NOUN
ct-9287	53	28	dneasy	dneasy	NOUN
ct-9287	53	29	blood	blood	NOUN
ct-9287	53	30	&	&	CCONJ
ct-9287	53	31	tissue	tissue	NOUN
ct-9287	53	32	kit	kit	NOUN
ct-9287	53	33	)	)	PUNCT
ct-9287	53	34	.	.	PUNCT
ct-9287	54	1	both	both	DET
ct-9287	54	2	x	x	SYM
ct-9287	54	3	and	and	CCONJ
ct-9287	54	4	y	y	PROPN
ct-9287	54	5	chromosomes	chromosome	NOUN
ct-9287	54	6	were	be	AUX
ct-9287	54	7	positive	positive	ADJ
ct-9287	54	8	for	for	ADP
ct-9287	54	9	amel	amel	PROPN
ct-9287	54	10	and	and	CCONJ
ct-9287	54	11	their	their	PRON
ct-9287	54	12	gene	gene	NOUN
ct-9287	54	13	length	length	NOUN
ct-9287	54	14	polymorphism	polymorphism	NOUN
ct-9287	54	15	allowed	allow	VERB
ct-9287	54	16	for	for	ADP
ct-9287	54	17	genetic	genetic	ADJ
ct-9287	54	18	sex	sex	NOUN
ct-9287	54	19	identification	identification	NOUN
ct-9287	54	20	.	.	PUNCT
ct-9287	55	1	pcr	pcr	PROPN
ct-9287	55	2	was	be	AUX
ct-9287	55	3	performed	perform	VERB
ct-9287	55	4	using	use	VERB
ct-9287	55	5	platinumtm	platinumtm	PROPN
ct-9287	55	6	ii	ii	PROPN
ct-9287	55	7	taq	taq	NOUN
ct-9287	55	8	hot	hot	ADJ
ct-9287	55	9	-	-	PUNCT
ct-9287	55	10	start	start	NOUN
ct-9287	55	11	dna	dna	NOUN
ct-9287	55	12	polymerase	polymerase	NOUN
ct-9287	55	13	(	(	PUNCT
ct-9287	55	14	invitrogen	invitrogen	PROPN
ct-9287	55	15	)	)	PUNCT
ct-9287	55	16	,	,	PUNCT
ct-9287	55	17	with	with	ADP
ct-9287	55	18	0.5	0.5	NUM
ct-9287	55	19	μl	μl	NUM
ct-9287	55	20	of	of	ADP
ct-9287	55	21	the	the	DET
ct-9287	55	22	amelx	amelx	ADJ
ct-9287	55	23	/	/	SYM
ct-9287	55	24	amely	amely	ADJ
ct-9287	55	25	primers	primer	NOUN
ct-9287	55	26	(	(	PUNCT
ct-9287	55	27	5	5	NUM
ct-9287	55	28	μm	μm	NUM
ct-9287	55	29	)	)	PUNCT
ct-9287	55	30	,	,	PUNCT
ct-9287	55	31	and	and	CCONJ
ct-9287	55	32	cycle	cycle	NOUN
ct-9287	55	33	conditions	condition	NOUN
ct-9287	55	34	95	95	NUM
ct-9287	55	35	°	°	SYM
ct-9287	55	36	c	c	NOUN
ct-9287	55	37	for	for	ADP
ct-9287	55	38	4	4	NUM
ct-9287	55	39	minutes	minute	NOUN
ct-9287	55	40	,	,	PUNCT
ct-9287	55	41	95	95	NUM
ct-9287	55	42	°	°	NUM
ct-9287	55	43	c	c	NOUN
ct-9287	55	44	for	for	ADP
ct-9287	55	45	30	30	NUM
ct-9287	55	46	seconds	second	NOUN
ct-9287	55	47	,	,	PUNCT
ct-9287	55	48	55	55	NUM
ct-9287	55	49	°	°	NOUN
ct-9287	55	50	c	c	NOUN
ct-9287	55	51	for	for	ADP
ct-9287	55	52	30	30	NUM
ct-9287	55	53	seconds	second	NOUN
ct-9287	55	54	,	,	PUNCT
ct-9287	55	55	and	and	CCONJ
ct-9287	55	56	72	72	NUM
ct-9287	55	57	°	°	NOUN
ct-9287	55	58	c	c	NOUN
ct-9287	55	59	for	for	ADP
ct-9287	55	60	20	20	NUM
ct-9287	55	61	seconds	second	NOUN
ct-9287	55	62	,	,	PUNCT
ct-9287	55	63	with	with	ADP
ct-9287	55	64	the	the	DET
ct-9287	55	65	last	last	ADJ
ct-9287	55	66	3	3	NUM
ct-9287	55	67	steps	step	NOUN
ct-9287	55	68	repeated	repeat	VERB
ct-9287	55	69	35	35	NUM
ct-9287	55	70	times	time	NOUN
ct-9287	55	71	,	,	PUNCT
ct-9287	55	72	followed	follow	VERB
ct-9287	55	73	by	by	ADP
ct-9287	55	74	a	a	DET
ct-9287	55	75	final	final	ADJ
ct-9287	55	76	step	step	NOUN
ct-9287	55	77	of	of	ADP
ct-9287	55	78	72	72	NUM
ct-9287	55	79	°	°	ADP
ct-9287	55	80	c	c	NOUN
ct-9287	55	81	for	for	ADP
ct-9287	55	82	10	10	NUM
ct-9287	55	83	minutes	minute	NOUN
ct-9287	55	84	.	.	PUNCT
ct-9287	56	1	pcr	pcr	ADJ
ct-9287	56	2	amplification	amplification	NOUN
ct-9287	56	3	using	use	VERB
ct-9287	56	4	amelx	amelx	PROPN
ct-9287	56	5	(	(	PUNCT
ct-9287	56	6	on	on	ADP
ct-9287	56	7	the	the	DET
ct-9287	56	8	x	x	PUNCT
ct-9287	56	9	chromosome	chromosome	NOUN
ct-9287	56	10	)	)	PUNCT
ct-9287	56	11	and	and	CCONJ
ct-9287	56	12	amely	amely	ADV
ct-9287	56	13	(	(	PUNCT
ct-9287	56	14	on	on	ADP
ct-9287	56	15	the	the	DET
ct-9287	56	16	y	y	PROPN
ct-9287	56	17	chromosome	chromosome	PROPN
ct-9287	56	18	)	)	PUNCT
ct-9287	56	19	specific	specific	ADJ
ct-9287	56	20	primers	primer	NOUN
ct-9287	56	21	yielded	yield	VERB
ct-9287	56	22	a	a	DET
ct-9287	56	23	215	215	NUM
ct-9287	56	24	bp	bp	NOUN
ct-9287	56	25	amplification	amplification	NOUN
ct-9287	56	26	product	product	NOUN
ct-9287	56	27	for	for	ADP
ct-9287	56	28	amelx	amelx	ADJ
ct-9287	56	29	and	and	CCONJ
ct-9287	56	30	247	247	NUM
ct-9287	56	31	bp	bp	NOUN
ct-9287	56	32	for	for	ADP
ct-9287	56	33	amely	amely	ADV
ct-9287	56	34	(	(	PUNCT
ct-9287	56	35	figure	figure	NOUN
ct-9287	56	36	5	5	NUM
ct-9287	56	37	)	)	PUNCT
ct-9287	56	38	.	.	PUNCT
ct-9287	57	1	furthermore	furthermore	ADV
ct-9287	57	2	,	,	PUNCT
ct-9287	57	3	in	in	ADP
ct-9287	57	4	a	a	DET
ct-9287	57	5	separate	separate	ADJ
ct-9287	57	6	pcr	pcr	NOUN
ct-9287	57	7	assay	assay	NOUN
ct-9287	57	8	,	,	PUNCT
ct-9287	57	9	2	2	NUM
ct-9287	57	10	pcr	pcr	NOUN
ct-9287	57	11	primer	primer	NOUN
ct-9287	57	12	sets	set	NOUN
ct-9287	57	13	were	be	AUX
ct-9287	57	14	designed	design	VERB
ct-9287	57	15	to	to	PART
ct-9287	57	16	amplify	amplify	VERB
ct-9287	57	17	a	a	DET
ct-9287	57	18	350	350	NUM
ct-9287	57	19	or	or	CCONJ
ct-9287	57	20	480	480	NUM
ct-9287	57	21	bp	bp	PROPN
ct-9287	57	22	fragment	fragment	NOUN
ct-9287	57	23	of	of	ADP
ct-9287	57	24	canine	canine	PROPN
ct-9287	57	25	sry	sry	INTJ
ct-9287	57	26	gene	gene	NOUN
ct-9287	57	27	(	(	PUNCT
ct-9287	57	28	table	table	NOUN
ct-9287	57	29	)	)	PUNCT
ct-9287	57	30	to	to	PART
ct-9287	57	31	determine	determine	VERB
ct-9287	57	32	if	if	SCONJ
ct-9287	57	33	sry	sry	PROPN
ct-9287	57	34	gene	gene	NOUN
ct-9287	57	35	was	be	AUX
ct-9287	57	36	present	present	ADJ
ct-9287	57	37	in	in	ADP
ct-9287	57	38	the	the	DET
ct-9287	57	39	dna	dna	NOUN
ct-9287	57	40	.	.	PUNCT
ct-9287	58	1	pcr	pcr	ADJ
ct-9287	58	2	analysis	analysis	NOUN
ct-9287	58	3	of	of	ADP
ct-9287	58	4	dna	dna	PROPN
ct-9287	58	5	isolated	isolate	VERB
ct-9287	58	6	from	from	ADP
ct-9287	58	7	a	a	DET
ct-9287	58	8	known	know	VERB
ct-9287	58	9	male	male	ADJ
ct-9287	58	10	dog	dog	NOUN
ct-9287	58	11	was	be	AUX
ct-9287	58	12	positive	positive	ADJ
ct-9287	58	13	for	for	ADP
ct-9287	58	14	sry	sry	PROPN
ct-9287	58	15	(	(	PUNCT
ct-9287	58	16	figure	figure	NOUN
ct-9287	58	17	6	6	NUM
ct-9287	58	18	)	)	PUNCT
ct-9287	58	19	.	.	PUNCT
ct-9287	59	1	pcr	pcr	ADJ
ct-9287	59	2	cycle	cycle	NOUN
ct-9287	59	3	conditions	condition	NOUN
ct-9287	59	4	for	for	ADP
ct-9287	59	5	amplification	amplification	NOUN
ct-9287	59	6	of	of	ADP
ct-9287	59	7	sry	sry	INTJ
ct-9287	59	8	were	be	AUX
ct-9287	59	9	:	:	PUNCT
ct-9287	59	10	95	95	NUM
ct-9287	59	11	°	°	NUM
ct-9287	59	12	c	c	NOUN
ct-9287	59	13	for	for	ADP
ct-9287	59	14	4	4	NUM
ct-9287	59	15	minutes	minute	NOUN
ct-9287	59	16	,	,	PUNCT
ct-9287	59	17	95	95	NUM
ct-9287	59	18	°	°	NUM
ct-9287	59	19	c	c	NOUN
ct-9287	59	20	for	for	ADP
ct-9287	59	21	30	30	NUM
ct-9287	59	22	seconds	second	NOUN
ct-9287	59	23	,	,	PUNCT
ct-9287	59	24	60	60	NUM
ct-9287	59	25	°	°	NUM
ct-9287	59	26	c	c	NOUN
ct-9287	59	27	for	for	ADP
ct-9287	59	28	30	30	NUM
ct-9287	59	29	seconds	second	NOUN
ct-9287	59	30	,	,	PUNCT
ct-9287	59	31	and	and	CCONJ
ct-9287	59	32	72	72	NUM
ct-9287	59	33	°	°	NOUN
ct-9287	59	34	c	c	NOUN
ct-9287	59	35	for	for	ADP
ct-9287	59	36	15	15	NUM
ct-9287	59	37	seconds	second	NOUN
ct-9287	59	38	,	,	PUNCT
ct-9287	59	39	with	with	SCONJ
ct-9287	59	40	the	the	DET
ct-9287	59	41	last	last	ADJ
ct-9287	59	42	steps	step	NOUN
ct-9287	59	43	repeated	repeat	VERB
ct-9287	59	44	40	40	NUM
ct-9287	59	45	times	time	NOUN
ct-9287	59	46	,	,	PUNCT
ct-9287	59	47	followed	follow	VERB
ct-9287	59	48	by	by	ADP
ct-9287	59	49	a	a	DET
ct-9287	59	50	final	final	ADJ
ct-9287	59	51	step	step	NOUN
ct-9287	59	52	of	of	ADP
ct-9287	59	53	72	72	NUM
ct-9287	59	54	°	°	ADP
ct-9287	59	55	c	c	NOUN
ct-9287	59	56	for	for	ADP
ct-9287	59	57	1	1	NUM
ct-9287	59	58	minute	minute	NOUN
ct-9287	59	59	.	.	PUNCT
ct-9287	60	1	sry	sry	PROPN
ct-9287	60	2	was	be	AUX
ct-9287	60	3	not	not	PART
ct-9287	60	4	detected	detect	VERB
ct-9287	60	5	in	in	ADP
ct-9287	60	6	the	the	DET
ct-9287	60	7	genomic	genomic	NOUN
ct-9287	60	8	dna	dna	NOUN
ct-9287	60	9	isolated	isolate	VERB
ct-9287	60	10	from	from	ADP
ct-9287	60	11	the	the	DET
ct-9287	60	12	patient	patient	NOUN
ct-9287	60	13	.	.	PUNCT
ct-9287	61	1	this	this	DET
ct-9287	61	2	finding	finding	NOUN
ct-9287	61	3	suggested	suggest	VERB
ct-9287	61	4	that	that	SCONJ
ct-9287	61	5	alternative	alternative	NOUN
ct-9287	61	6	and	and	CCONJ
ct-9287	61	7	unknown	unknown	ADJ
ct-9287	61	8	nonsry	nonsry	NOUN
ct-9287	61	9	-	-	PUNCT
ct-9287	61	10	mediated	mediate	VERB
ct-9287	61	11	mechanism(s	mechanism(s	NOUN
ct-9287	61	12	)	)	PUNCT
ct-9287	61	13	might	might	AUX
ct-9287	61	14	have	have	AUX
ct-9287	61	15	occurred	occur	VERB
ct-9287	61	16	,	,	PUNCT
ct-9287	61	17	leading	lead	VERB
ct-9287	61	18	to	to	ADP
ct-9287	61	19	testes	testis	NOUN
ct-9287	61	20	development.15	development.15	NOUN
ct-9287	61	21	a	a	DET
ct-9287	61	22	b	b	NOUN
ct-9287	61	23	figure	figure	NOUN
ct-9287	61	24	3	3	NUM
ct-9287	61	25	.	.	PUNCT
ct-9287	61	26	hematoxylin	hematoxylin	NOUN
ct-9287	61	27	and	and	CCONJ
ct-9287	61	28	eosin	eosin	NOUN
ct-9287	61	29	-	-	PUNCT
ct-9287	61	30	stained	stain	VERB
ct-9287	61	31	sections	section	NOUN
ct-9287	61	32	of	of	ADP
ct-9287	61	33	testis	testis	NOUN
ct-9287	61	34	(	(	PUNCT
ct-9287	61	35	a	a	NOUN
ct-9287	61	36	)	)	PUNCT
ct-9287	61	37	and	and	CCONJ
ct-9287	61	38	epididymis	epididymis	NOUN
ct-9287	61	39	(	(	PUNCT
ct-9287	61	40	b	b	NOUN
ct-9287	61	41	)	)	PUNCT
ct-9287	61	42	;	;	PUNCT
ct-9287	61	43	note	note	VERB
ct-9287	61	44	absence	absence	NOUN
ct-9287	61	45	of	of	ADP
ct-9287	61	46	maturing	mature	VERB
ct-9287	61	47	germ	germ	NOUN
ct-9287	61	48	cells	cell	NOUN
ct-9287	61	49	in	in	ADP
ct-9287	61	50	seminiferous	seminiferous	ADJ
ct-9287	61	51	tubules	tubule	NOUN
ct-9287	61	52	and	and	CCONJ
ct-9287	61	53	normal	normal	ADJ
ct-9287	61	54	epididymal	epididymal	ADJ
ct-9287	61	55	epithelium	epithelium	NOUN
ct-9287	61	56	with	with	ADP
ct-9287	61	57	no	no	DET
ct-9287	61	58	sperm	sperm	NOUN
ct-9287	61	59	(	(	PUNCT
ct-9287	61	60	200	200	NUM
ct-9287	61	61	x	x	NOUN
ct-9287	61	62	magnification	magnification	NOUN
ct-9287	61	63	)	)	PUNCT
ct-9287	61	64	.	.	PUNCT
ct-9287	62	1	clinical	clinical	ADJ
ct-9287	62	2	theriogenology	theriogenology	NOUN
ct-9287	62	3	2022	2022	NUM
ct-9287	62	4	;	;	PUNCT
ct-9287	62	5	14	14	NUM
ct-9287	62	6	:	:	SYM
ct-9287	62	7	112	112	NUM
ct-9287	62	8	figure	figure	NOUN
ct-9287	62	9	4	4	NUM
ct-9287	62	10	.	.	X
ct-9287	62	11	immunolabeling	immunolabele	VERB
ct-9287	62	12	for	for	ADP
ct-9287	62	13	amh	amh	PROPN
ct-9287	62	14	(	(	PUNCT
ct-9287	62	15	black	black	ADJ
ct-9287	62	16	arrows	arrow	NOUN
ct-9287	62	17	)	)	PUNCT
ct-9287	62	18	within	within	ADP
ct-9287	62	19	the	the	DET
ct-9287	62	20	seminiferous	seminiferous	ADJ
ct-9287	62	21	tubules	tubule	NOUN
ct-9287	62	22	containing	contain	VERB
ct-9287	62	23	sertoli	sertoli	NOUN
ct-9287	62	24	cells	cell	NOUN
ct-9287	62	25	;	;	PUNCT
ct-9287	62	26	note	note	VERB
ct-9287	62	27	negative	negative	ADJ
ct-9287	62	28	control	control	NOUN
ct-9287	62	29	(	(	PUNCT
ct-9287	62	30	small	small	ADJ
ct-9287	62	31	insert	insert	NOUN
ct-9287	62	32	)	)	PUNCT
ct-9287	62	33	without	without	ADP
ct-9287	62	34	primary	primary	ADJ
ct-9287	62	35	antibody	antibody	NOUN
ct-9287	62	36	.	.	PUNCT
ct-9287	63	1	chromosomal	chromosomal	ADJ
ct-9287	63	2	sex	sex	NOUN
ct-9287	63	3	(	(	PUNCT
ct-9287	63	4	i.e.	i.e.	X
ct-9287	63	5	xx	xx	X
ct-9287	63	6	versus	versus	ADP
ct-9287	63	7	xy	xy	NOUN
ct-9287	63	8	)	)	PUNCT
ct-9287	63	9	pcr	pcr	PROPN
ct-9287	63	10	was	be	AUX
ct-9287	63	11	determined	determine	VERB
ct-9287	63	12	via	via	ADP
ct-9287	63	13	amplifying14	amplifying14	PROPN
ct-9287	63	14	amelogenin	amelogenin	PROPN
ct-9287	63	15	(	(	PUNCT
ct-9287	63	16	amel	amel	PROPN
ct-9287	63	17	)	)	PUNCT
ct-9287	63	18	gene	gene	NOUN
ct-9287	63	19	from	from	ADP
ct-9287	63	20	genomic	genomic	ADJ
ct-9287	63	21	dna	dna	PROPN
ct-9287	63	22	isolated	isolate	VERB
ct-9287	63	23	from	from	ADP
ct-9287	63	24	blood	blood	NOUN
ct-9287	63	25	(	(	PUNCT
ct-9287	63	26	qiagen	qiagen	NOUN
ct-9287	63	27	dneasy	dneasy	NOUN
ct-9287	63	28	blood	blood	NOUN
ct-9287	63	29	&	&	CCONJ
ct-9287	63	30	tissue	tissue	NOUN
ct-9287	63	31	kit	kit	NOUN
ct-9287	63	32	)	)	PUNCT
ct-9287	63	33	.	.	PUNCT
ct-9287	64	1	both	both	DET
ct-9287	64	2	x	x	SYM
ct-9287	64	3	and	and	CCONJ
ct-9287	64	4	y	y	PROPN
ct-9287	64	5	chromosomes	chromosome	NOUN
ct-9287	64	6	were	be	AUX
ct-9287	64	7	positive	positive	ADJ
ct-9287	64	8	for	for	ADP
ct-9287	64	9	amel	amel	PROPN
ct-9287	64	10	and	and	CCONJ
ct-9287	64	11	their	their	PRON
ct-9287	64	12	gene	gene	NOUN
ct-9287	64	13	length	length	NOUN
ct-9287	64	14	polymorphism	polymorphism	NOUN
ct-9287	64	15	allowed	allow	VERB
ct-9287	64	16	for	for	ADP
ct-9287	64	17	genetic	genetic	ADJ
ct-9287	64	18	sex	sex	NOUN
ct-9287	64	19	identification	identification	NOUN
ct-9287	64	20	.	.	PUNCT
ct-9287	65	1	pcr	pcr	PROPN
ct-9287	65	2	was	be	AUX
ct-9287	65	3	performed	perform	VERB
ct-9287	65	4	using	use	VERB
ct-9287	65	5	platinumtm	platinumtm	PROPN
ct-9287	65	6	ii	ii	PROPN
ct-9287	65	7	taq	taq	NOUN
ct-9287	65	8	hot	hot	ADJ
ct-9287	65	9	-	-	PUNCT
ct-9287	65	10	start	start	NOUN
ct-9287	65	11	dna	dna	NOUN
ct-9287	65	12	polymerase	polymerase	NOUN
ct-9287	65	13	(	(	PUNCT
ct-9287	65	14	invitrogen	invitrogen	PROPN
ct-9287	65	15	)	)	PUNCT
ct-9287	65	16	,	,	PUNCT
ct-9287	65	17	with	with	ADP
ct-9287	65	18	0.5	0.5	NUM
ct-9287	65	19	μl	μl	NUM
ct-9287	65	20	of	of	ADP
ct-9287	65	21	the	the	DET
ct-9287	65	22	amelx	amelx	ADJ
ct-9287	65	23	/	/	SYM
ct-9287	65	24	amely	amely	ADJ
ct-9287	65	25	primers	primer	NOUN
ct-9287	65	26	(	(	PUNCT
ct-9287	65	27	5	5	NUM
ct-9287	65	28	μm	μm	NUM
ct-9287	65	29	)	)	PUNCT
ct-9287	65	30	,	,	PUNCT
ct-9287	65	31	and	and	CCONJ
ct-9287	65	32	cycle	cycle	NOUN
ct-9287	65	33	conditions	condition	NOUN
ct-9287	65	34	95	95	NUM
ct-9287	65	35	°	°	SYM
ct-9287	65	36	c	c	NOUN
ct-9287	65	37	for	for	ADP
ct-9287	65	38	4	4	NUM
ct-9287	65	39	minutes	minute	NOUN
ct-9287	65	40	,	,	PUNCT
ct-9287	65	41	95	95	NUM
ct-9287	65	42	°	°	NUM
ct-9287	65	43	c	c	NOUN
ct-9287	65	44	for	for	ADP
ct-9287	65	45	30	30	NUM
ct-9287	65	46	seconds	second	NOUN
ct-9287	65	47	,	,	PUNCT
ct-9287	65	48	55	55	NUM
ct-9287	65	49	°	°	NOUN
ct-9287	65	50	c	c	NOUN
ct-9287	65	51	for	for	ADP
ct-9287	65	52	30	30	NUM
ct-9287	65	53	seconds	second	NOUN
ct-9287	65	54	,	,	PUNCT
ct-9287	65	55	and	and	CCONJ
ct-9287	65	56	72	72	NUM
ct-9287	65	57	°	°	NOUN
ct-9287	65	58	c	c	NOUN
ct-9287	65	59	for	for	ADP
ct-9287	65	60	20	20	NUM
ct-9287	65	61	seconds	second	NOUN
ct-9287	65	62	,	,	PUNCT
ct-9287	65	63	with	with	ADP
ct-9287	65	64	the	the	DET
ct-9287	65	65	last	last	ADJ
ct-9287	65	66	3	3	NUM
ct-9287	65	67	steps	step	NOUN
ct-9287	65	68	repeated	repeat	VERB
ct-9287	65	69	35	35	NUM
ct-9287	65	70	times	time	NOUN
ct-9287	65	71	,	,	PUNCT
ct-9287	65	72	followed	follow	VERB
ct-9287	65	73	by	by	ADP
ct-9287	65	74	a	a	DET
ct-9287	65	75	final	final	ADJ
ct-9287	65	76	step	step	NOUN
ct-9287	65	77	of	of	ADP
ct-9287	65	78	72	72	NUM
ct-9287	65	79	°	°	ADP
ct-9287	65	80	c	c	NOUN
ct-9287	65	81	for	for	ADP
ct-9287	65	82	10	10	NUM
ct-9287	65	83	minutes	minute	NOUN
ct-9287	65	84	.	.	PUNCT
ct-9287	66	1	pcr	pcr	ADJ
ct-9287	66	2	amplification	amplification	NOUN
ct-9287	66	3	using	use	VERB
ct-9287	66	4	amelx	amelx	PROPN
ct-9287	66	5	(	(	PUNCT
ct-9287	66	6	on	on	ADP
ct-9287	66	7	the	the	DET
ct-9287	66	8	x	x	PUNCT
ct-9287	66	9	chromosome	chromosome	NOUN
ct-9287	66	10	)	)	PUNCT
ct-9287	66	11	and	and	CCONJ
ct-9287	66	12	amely	amely	ADV
ct-9287	66	13	(	(	PUNCT
ct-9287	66	14	on	on	ADP
ct-9287	66	15	the	the	DET
ct-9287	66	16	y	y	PROPN
ct-9287	66	17	chromosome	chromosome	PROPN
ct-9287	66	18	)	)	PUNCT
ct-9287	66	19	specific	specific	ADJ
ct-9287	66	20	primers	primer	NOUN
ct-9287	66	21	yielded	yield	VERB
ct-9287	66	22	a	a	DET
ct-9287	66	23	215	215	NUM
ct-9287	66	24	bp	bp	NOUN
ct-9287	66	25	amplification	amplification	NOUN
ct-9287	66	26	product	product	NOUN
ct-9287	66	27	for	for	ADP
ct-9287	66	28	amelx	amelx	ADJ
ct-9287	66	29	and	and	CCONJ
ct-9287	66	30	247	247	NUM
ct-9287	66	31	bp	bp	NOUN
ct-9287	66	32	for	for	ADP
ct-9287	66	33	amely	amely	ADV
ct-9287	66	34	(	(	PUNCT
ct-9287	66	35	figure	figure	NOUN
ct-9287	66	36	5	5	NUM
ct-9287	66	37	)	)	PUNCT
ct-9287	66	38	.	.	PUNCT
ct-9287	67	1	furthermore	furthermore	ADV
ct-9287	67	2	,	,	PUNCT
ct-9287	67	3	in	in	ADP
ct-9287	67	4	a	a	DET
ct-9287	67	5	separate	separate	ADJ
ct-9287	67	6	pcr	pcr	NOUN
ct-9287	67	7	assay	assay	NOUN
ct-9287	67	8	,	,	PUNCT
ct-9287	67	9	2	2	NUM
ct-9287	67	10	pcr	pcr	NOUN
ct-9287	67	11	primer	primer	NOUN
ct-9287	67	12	sets	set	NOUN
ct-9287	67	13	were	be	AUX
ct-9287	67	14	designed	design	VERB
ct-9287	67	15	to	to	PART
ct-9287	67	16	amplify	amplify	VERB
ct-9287	67	17	a	a	DET
ct-9287	67	18	350	350	NUM
ct-9287	67	19	or	or	CCONJ
ct-9287	67	20	480	480	NUM
ct-9287	67	21	bp	bp	PROPN
ct-9287	67	22	fragment	fragment	NOUN
ct-9287	67	23	of	of	ADP
ct-9287	67	24	canine	canine	PROPN
ct-9287	67	25	sry	sry	INTJ
ct-9287	67	26	gene	gene	NOUN
ct-9287	67	27	(	(	PUNCT
ct-9287	67	28	table	table	NOUN
ct-9287	67	29	)	)	PUNCT
ct-9287	67	30	to	to	PART
ct-9287	67	31	determine	determine	VERB
ct-9287	67	32	if	if	SCONJ
ct-9287	67	33	sry	sry	PROPN
ct-9287	67	34	gene	gene	NOUN
ct-9287	67	35	was	be	AUX
ct-9287	67	36	present	present	ADJ
ct-9287	67	37	in	in	ADP
ct-9287	67	38	the	the	DET
ct-9287	67	39	dna	dna	NOUN
ct-9287	67	40	.	.	PUNCT
ct-9287	68	1	pcr	pcr	ADJ
ct-9287	68	2	analysis	analysis	NOUN
ct-9287	68	3	of	of	ADP
ct-9287	68	4	dna	dna	PROPN
ct-9287	68	5	isolated	isolate	VERB
ct-9287	68	6	from	from	ADP
ct-9287	68	7	a	a	DET
ct-9287	68	8	known	know	VERB
ct-9287	68	9	male	male	ADJ
ct-9287	68	10	dog	dog	NOUN
ct-9287	68	11	was	be	AUX
ct-9287	68	12	positive	positive	ADJ
ct-9287	68	13	for	for	ADP
ct-9287	68	14	sry	sry	PROPN
ct-9287	68	15	(	(	PUNCT
ct-9287	68	16	figure	figure	NOUN
ct-9287	68	17	6	6	NUM
ct-9287	68	18	)	)	PUNCT
ct-9287	68	19	.	.	PUNCT
ct-9287	69	1	pcr	pcr	ADJ
ct-9287	69	2	cycle	cycle	NOUN
ct-9287	69	3	conditions	condition	NOUN
ct-9287	69	4	for	for	ADP
ct-9287	69	5	amplification	amplification	NOUN
ct-9287	69	6	of	of	ADP
ct-9287	69	7	sry	sry	INTJ
ct-9287	69	8	were	be	AUX
ct-9287	69	9	:	:	PUNCT
ct-9287	69	10	95	95	NUM
ct-9287	69	11	°	°	NUM
ct-9287	69	12	c	c	NOUN
ct-9287	69	13	for	for	ADP
ct-9287	69	14	4	4	NUM
ct-9287	69	15	minutes	minute	NOUN
ct-9287	69	16	,	,	PUNCT
ct-9287	69	17	95	95	NUM
ct-9287	69	18	°	°	NUM
ct-9287	69	19	c	c	NOUN
ct-9287	69	20	for	for	ADP
ct-9287	69	21	30	30	NUM
ct-9287	69	22	seconds	second	NOUN
ct-9287	69	23	,	,	PUNCT
ct-9287	69	24	60	60	NUM
ct-9287	69	25	°	°	NUM
ct-9287	69	26	c	c	NOUN
ct-9287	69	27	for	for	ADP
ct-9287	69	28	30	30	NUM
ct-9287	69	29	seconds	second	NOUN
ct-9287	69	30	,	,	PUNCT
ct-9287	69	31	and	and	CCONJ
ct-9287	69	32	72	72	NUM
ct-9287	69	33	°	°	NOUN
ct-9287	69	34	c	c	NOUN
ct-9287	69	35	for	for	ADP
ct-9287	69	36	15	15	NUM
ct-9287	69	37	seconds	second	NOUN
ct-9287	69	38	,	,	PUNCT
ct-9287	69	39	with	with	SCONJ
ct-9287	69	40	the	the	DET
ct-9287	69	41	last	last	ADJ
ct-9287	69	42	steps	step	NOUN
ct-9287	69	43	repeated	repeat	VERB
ct-9287	69	44	40	40	NUM
ct-9287	69	45	times	time	NOUN
ct-9287	69	46	,	,	PUNCT
ct-9287	69	47	followed	follow	VERB
ct-9287	69	48	by	by	ADP
ct-9287	69	49	a	a	DET
ct-9287	69	50	final	final	ADJ
ct-9287	69	51	step	step	NOUN
ct-9287	69	52	of	of	ADP
ct-9287	69	53	72	72	NUM
ct-9287	69	54	°	°	ADP
ct-9287	69	55	c	c	NOUN
ct-9287	69	56	for	for	ADP
ct-9287	69	57	1	1	NUM
ct-9287	69	58	minute	minute	NOUN
ct-9287	69	59	.	.	PUNCT
ct-9287	70	1	sry	sry	PROPN
ct-9287	70	2	was	be	AUX
ct-9287	70	3	not	not	PART
ct-9287	70	4	detected	detect	VERB
ct-9287	70	5	in	in	ADP
ct-9287	70	6	the	the	DET
ct-9287	70	7	genomic	genomic	NOUN
ct-9287	70	8	dna	dna	NOUN
ct-9287	70	9	isolated	isolate	VERB
ct-9287	70	10	from	from	ADP
ct-9287	70	11	the	the	DET
ct-9287	70	12	patient	patient	NOUN
ct-9287	70	13	.	.	PUNCT
ct-9287	71	1	this	this	DET
ct-9287	71	2	finding	finding	NOUN
ct-9287	71	3	suggested	suggest	VERB
ct-9287	71	4	that	that	SCONJ
ct-9287	71	5	alternative	alternative	NOUN
ct-9287	71	6	and	and	CCONJ
ct-9287	71	7	unknown	unknown	ADJ
ct-9287	71	8	nonsry	nonsry	NOUN
ct-9287	71	9	-	-	PUNCT
ct-9287	71	10	mediated	mediate	VERB
ct-9287	71	11	mechanism(s	mechanism(s	NOUN
ct-9287	71	12	)	)	PUNCT
ct-9287	71	13	might	might	AUX
ct-9287	71	14	have	have	AUX
ct-9287	71	15	occurred	occur	VERB
ct-9287	71	16	,	,	PUNCT
ct-9287	71	17	leading	lead	VERB
ct-9287	71	18	to	to	ADP
ct-9287	71	19	testes	testis	NOUN
ct-9287	71	20	development.15	development.15	NOUN
ct-9287	71	21	figure	figure	NOUN
ct-9287	71	22	5	5	NUM
ct-9287	71	23	.	.	PUNCT
ct-9287	72	1	amplified	amplify	VERB
ct-9287	72	2	bands	band	NOUN
ct-9287	72	3	represent	represent	VERB
ct-9287	72	4	amelogenin	amelogenin	PROPN
ct-9287	72	5	(	(	PUNCT
ct-9287	72	6	amel	amel	PROPN
ct-9287	72	7	)	)	PUNCT
ct-9287	72	8	;	;	PUNCT
ct-9287	72	9	bottom	bottom	ADJ
ct-9287	72	10	band	band	NOUN
ct-9287	72	11	is	be	AUX
ct-9287	72	12	amel	amel	PROPN
ct-9287	72	13	present	present	ADJ
ct-9287	72	14	on	on	ADP
ct-9287	72	15	the	the	DET
ct-9287	72	16	x	x	PUNCT
ct-9287	72	17	chromosome	chromosome	NOUN
ct-9287	72	18	(	(	PUNCT
ct-9287	72	19	215	215	NUM
ct-9287	72	20	bp	bp	NOUN
ct-9287	72	21	)	)	PUNCT
ct-9287	72	22	,	,	PUNCT
ct-9287	72	23	and	and	CCONJ
ct-9287	72	24	the	the	DET
ct-9287	72	25	top	top	ADJ
ct-9287	72	26	band	band	NOUN
ct-9287	72	27	is	be	AUX
ct-9287	72	28	amel	amel	PROPN
ct-9287	72	29	present	present	ADJ
ct-9287	72	30	on	on	ADP
ct-9287	72	31	the	the	DET
ct-9287	72	32	y	y	PROPN
ct-9287	72	33	chromosome	chromosome	NOUN
ct-9287	72	34	(	(	PUNCT
ct-9287	72	35	247	247	NUM
ct-9287	72	36	bp	bp	NOUN
ct-9287	72	37	)	)	PUNCT
ct-9287	72	38	.	.	PUNCT
ct-9287	73	1	lane	lane	NOUN
ct-9287	73	2	1	1	NUM
ct-9287	73	3	:	:	PUNCT
ct-9287	73	4	h20	h20	PROPN
ct-9287	73	5	(	(	PUNCT
ct-9287	73	6	negative	negative	ADJ
ct-9287	73	7	control	control	NOUN
ct-9287	73	8	)	)	PUNCT
ct-9287	73	9	.	.	PUNCT
ct-9287	74	1	lane	lane	PROPN
ct-9287	74	2	2	2	NUM
ct-9287	74	3	&	&	CCONJ
ct-9287	74	4	3	3	NUM
ct-9287	74	5	:	:	PUNCT
ct-9287	74	6	genomic	genomic	ADJ
ct-9287	74	7	dna	dna	NOUN
ct-9287	74	8	from	from	ADP
ct-9287	74	9	the	the	DET
ct-9287	74	10	hermaphrodite	hermaphrodite	PROPN
ct-9287	74	11	dog	dog	NOUN
ct-9287	74	12	.	.	PUNCT
ct-9287	75	1	lanes	lane	NOUN
ct-9287	75	2	4	4	NUM
ct-9287	75	3	&	&	CCONJ
ct-9287	75	4	5	5	NUM
ct-9287	75	5	:	:	PUNCT
ct-9287	75	6	genomic	genomic	ADJ
ct-9287	75	7	dna	dna	NOUN
ct-9287	75	8	from	from	ADP
ct-9287	75	9	a	a	DET
ct-9287	75	10	known	know	VERB
ct-9287	75	11	male	male	NOUN
ct-9287	75	12	(	(	PUNCT
ct-9287	75	13	xy	xy	NOUN
ct-9287	75	14	)	)	PUNCT
ct-9287	75	15	dog	dog	NOUN
ct-9287	75	16	.	.	PUNCT
ct-9287	76	1	l	l	NOUN
ct-9287	76	2	=	=	PUNCT
ct-9287	76	3	100	100	NUM
ct-9287	76	4	bp	bp	PROPN
ct-9287	76	5	ladder	ladder	NOUN
ct-9287	76	6	.	.	PUNCT
ct-9287	77	1	table	table	NOUN
ct-9287	77	2	.	.	PUNCT
ct-9287	78	1	primer	primer	NOUN
ct-9287	78	2	sequences	sequence	NOUN
ct-9287	78	3	and	and	CCONJ
ct-9287	78	4	amplicon	amplicon	NOUN
ct-9287	78	5	sizes	size	NOUN
ct-9287	78	6	generated	generate	VERB
ct-9287	78	7	by	by	ADP
ct-9287	78	8	pcr	pcr	ADJ
ct-9287	78	9	amplification	amplification	NOUN
ct-9287	78	10	name	name	NOUN
ct-9287	78	11	primer	primer	NOUN
ct-9287	78	12	seq	seq	NOUN
ct-9287	78	13	(	(	PUNCT
ct-9287	78	14	5	5	NUM
ct-9287	78	15	’	'	PUNCT
ct-9287	78	16	to	to	ADP
ct-9287	78	17	3	3	NUM
ct-9287	78	18	’	'	PUNCT
ct-9287	78	19	)	)	PUNCT
ct-9287	78	20	amplicon	amplicon	NOUN
ct-9287	78	21	size	size	NOUN
ct-9287	78	22	(	(	PUNCT
ct-9287	78	23	bp	bp	PROPN
ct-9287	78	24	)	)	PUNCT
ct-9287	78	25	amelx	amelx	PROPN
ct-9287	78	26	ataatgacaaagaaaacatgac	ataatgacaaagaaaacatgac	PROPN
ct-9287	78	27	215	215	NUM
ct-9287	78	28	(	(	PUNCT
ct-9287	78	29	amelx	amelx	ADJ
ct-9287	78	30	)	)	PUNCT
ct-9287	78	31	amely	amely	ADV
ct-9287	78	32	ctgctgagctggcaccat	ctgctgagctggcaccat	NOUN
ct-9287	78	33	247	247	NUM
ct-9287	78	34	(	(	PUNCT
ct-9287	78	35	amely	amely	ADV
ct-9287	78	36	)	)	PUNCT
ct-9287	78	37	dogsry1	dogsry1	PROPN
ct-9287	78	38	-	-	PUNCT
ct-9287	78	39	f	f	PROPN
ct-9287	78	40	ggtgcagcggtacaacaaaa	ggtgcagcggtacaacaaaa	NOUN
ct-9287	78	41	350	350	NUM
ct-9287	78	42	dogsry1	dogsry1	NOUN
ct-9287	78	43	-	-	PUNCT
ct-9287	78	44	r	r	NOUN
ct-9287	78	45	ttccgacgaggtcggtattt	ttccgacgaggtcggtattt	NOUN
ct-9287	78	46	dogsry2	dogsry2	NOUN
ct-9287	78	47	-	-	PUNCT
ct-9287	78	48	f	f	PROPN
ct-9287	78	49	ggtgcagcggtacaacaaaa	ggtgcagcggtacaacaaaa	NOUN
ct-9287	78	50	482	482	NUM
ct-9287	78	51	dogsry2	dogsry2	NOUN
ct-9287	78	52	-	-	PUNCT
ct-9287	78	53	r	r	NOUN
ct-9287	78	54	cgtgtgtgtgcagccctact	cgtgtgtgtgcagccctact	NOUN
ct-9287	78	55	figure	figure	NOUN
ct-9287	78	56	6	6	NUM
ct-9287	78	57	.	.	PUNCT
ct-9287	79	1	amplified	amplify	VERB
ct-9287	79	2	bands	band	NOUN
ct-9287	79	3	represent	represent	VERB
ct-9287	79	4	sry	sry	INTJ
ct-9287	79	5	clinical	clinical	ADJ
ct-9287	79	6	theriogenology	theriogenology	NOUN
ct-9287	79	7	2022	2022	NUM
ct-9287	79	8	;	;	PUNCT
ct-9287	79	9	14	14	NUM
ct-9287	79	10	:	:	SYM
ct-9287	79	11	113	113	NUM
ct-9287	79	12	discussion	discussion	NOUN
ct-9287	79	13	diagnosis	diagnosis	NOUN
ct-9287	79	14	(	(	PUNCT
ct-9287	79	15	sry	sry	INTJ
ct-9287	79	16	-	-	ADJ
ct-9287	79	17	negative	negative	ADJ
ct-9287	79	18	xx	xx	NUM
ct-9287	79	19	male	male	NOUN
ct-9287	79	20	with	with	ADP
ct-9287	79	21	testes	testis	NOUN
ct-9287	79	22	)	)	PUNCT
ct-9287	79	23	was	be	AUX
ct-9287	79	24	confirmed	confirm	VERB
ct-9287	79	25	by	by	ADP
ct-9287	79	26	histomorphological	histomorphological	ADJ
ct-9287	79	27	evaluation	evaluation	NOUN
ct-9287	79	28	of	of	ADP
ct-9287	79	29	the	the	DET
ct-9287	79	30	gonads	gonad	NOUN
ct-9287	79	31	,	,	PUNCT
ct-9287	79	32	determination	determination	NOUN
ct-9287	79	33	of	of	ADP
ct-9287	79	34	the	the	DET
ct-9287	79	35	chromosomal	chromosomal	ADJ
ct-9287	79	36	sex	sex	NOUN
ct-9287	79	37	and	and	CCONJ
ct-9287	79	38	absence	absence	NOUN
ct-9287	79	39	of	of	ADP
ct-9287	79	40	the	the	DET
ct-9287	79	41	sry	sry	PROPN
ct-9287	79	42	gene	gene	NOUN
ct-9287	79	43	by	by	ADP
ct-9287	79	44	pcr	pcr	ADJ
ct-9287	79	45	analysis	analysis	NOUN
ct-9287	79	46	.	.	PUNCT
ct-9287	80	1	cases	case	NOUN
ct-9287	80	2	of	of	ADP
ct-9287	80	3	sry	sry	NOUN
ct-9287	80	4	-	-	ADJ
ct-9287	80	5	negative	negative	ADJ
ct-9287	80	6	xx	xx	NUM
ct-9287	80	7	sr	sr	PROPN
ct-9287	80	8	were	be	AUX
ct-9287	80	9	most	most	ADV
ct-9287	80	10	commonly	commonly	ADV
ct-9287	80	11	reported	report	VERB
ct-9287	80	12	in	in	ADP
ct-9287	80	13	purebred	purebre	VERB
ct-9287	80	14	dogs	dog	NOUN
ct-9287	80	15	,	,	PUNCT
ct-9287	80	16	suggesting	suggest	VERB
ct-9287	80	17	heritability	heritability	NOUN
ct-9287	80	18	most	most	ADV
ct-9287	80	19	often	often	ADV
ct-9287	80	20	as	as	ADP
ct-9287	80	21	an	an	DET
ct-9287	80	22	autosomal	autosomal	ADJ
ct-9287	80	23	recessive	recessive	ADJ
ct-9287	80	24	trait.16–18	trait.16–18	NOUN
ct-9287	80	25	however	however	ADV
ct-9287	80	26	,	,	PUNCT
ct-9287	80	27	in	in	ADP
ct-9287	80	28	this	this	DET
ct-9287	80	29	case	case	NOUN
ct-9287	80	30	of	of	ADP
ct-9287	80	31	a	a	DET
ct-9287	80	32	mixed	mixed	ADJ
ct-9287	80	33	breed	breed	NOUN
ct-9287	80	34	dog	dog	NOUN
ct-9287	80	35	,	,	PUNCT
ct-9287	80	36	the	the	DET
ct-9287	80	37	etiology	etiology	NOUN
ct-9287	80	38	was	be	AUX
ct-9287	80	39	most	most	ADV
ct-9287	80	40	likely	likely	ADJ
ct-9287	80	41	a	a	DET
ct-9287	80	42	spontaneous	spontaneous	ADJ
ct-9287	80	43	event	event	NOUN
ct-9287	80	44	,	,	PUNCT
ct-9287	80	45	due	due	ADP
ct-9287	80	46	to	to	ADP
ct-9287	80	47	either	either	CCONJ
ct-9287	80	48	a	a	DET
ct-9287	80	49	genetic	genetic	ADJ
ct-9287	80	50	gain	gain	NOUN
ct-9287	80	51	-	-	PUNCT
ct-9287	80	52	of	of	ADP
ct-9287	80	53	-	-	PUNCT
ct-9287	80	54	function	function	NOUN
ct-9287	80	55	mutation	mutation	NOUN
ct-9287	80	56	or	or	CCONJ
ct-9287	80	57	loss	loss	NOUN
ct-9287	80	58	-	-	PUNCT
ct-9287	80	59	of	of	ADP
ct-9287	80	60	-	-	PUNCT
ct-9287	80	61	function	function	NOUN
ct-9287	80	62	mutation	mutation	NOUN
ct-9287	80	63	that	that	PRON
ct-9287	80	64	altered	alter	VERB
ct-9287	80	65	expression	expression	NOUN
ct-9287	80	66	of	of	ADP
ct-9287	80	67	key	key	ADJ
ct-9287	80	68	regulatory	regulatory	ADJ
ct-9287	80	69	genes	gene	NOUN
ct-9287	80	70	necessary	necessary	ADJ
ct-9287	80	71	for	for	ADP
ct-9287	80	72	female	female	ADJ
ct-9287	80	73	or	or	CCONJ
ct-9287	80	74	male	male	ADJ
ct-9287	80	75	sexual	sexual	ADJ
ct-9287	80	76	development	development	NOUN
ct-9287	80	77	.	.	PUNCT
ct-9287	81	1	it	it	PRON
ct-9287	81	2	is	be	AUX
ct-9287	81	3	possible	possible	ADJ
ct-9287	81	4	that	that	SCONJ
ct-9287	81	5	overexpression	overexpression	NOUN
ct-9287	81	6	of	of	ADP
ct-9287	81	7	the	the	DET
ct-9287	81	8	sox9	sox9	PROPN
ct-9287	81	9	gene	gene	NOUN
ct-9287	81	10	had	have	VERB
ct-9287	81	11	a	a	DET
ct-9287	81	12	key	key	ADJ
ct-9287	81	13	role	role	NOUN
ct-9287	81	14	in	in	ADP
ct-9287	81	15	testicular	testicular	ADJ
ct-9287	81	16	differentiation	differentiation	NOUN
ct-9287	81	17	and	and	CCONJ
ct-9287	81	18	development	development	NOUN
ct-9287	81	19	in	in	ADP
ct-9287	81	20	the	the	DET
ct-9287	81	21	formation	formation	NOUN
ct-9287	81	22	of	of	ADP
ct-9287	81	23	testes	testis	NOUN
ct-9287	81	24	in	in	ADP
ct-9287	81	25	this	this	DET
ct-9287	81	26	case	case	NOUN
ct-9287	81	27	.	.	PUNCT
ct-9287	82	1	duplications	duplication	NOUN
ct-9287	82	2	within	within	ADP
ct-9287	82	3	the	the	DET
ct-9287	82	4	sox9	sox9	PROPN
ct-9287	82	5	gene	gene	NOUN
ct-9287	82	6	,	,	PUNCT
ct-9287	82	7	often	often	ADV
ct-9287	82	8	in	in	ADP
ct-9287	82	9	the	the	DET
ct-9287	82	10	promoter	promoter	NOUN
ct-9287	82	11	region	region	NOUN
ct-9287	82	12	,	,	PUNCT
ct-9287	82	13	was	be	AUX
ct-9287	82	14	the	the	DET
ct-9287	82	15	most	most	ADV
ct-9287	82	16	common	common	ADJ
ct-9287	82	17	mutation	mutation	NOUN
ct-9287	82	18	leading	lead	VERB
ct-9287	82	19	to	to	ADP
ct-9287	82	20	sry	sry	NOUN
ct-9287	82	21	-	-	ADJ
ct-9287	82	22	negative	negative	ADJ
ct-9287	82	23	xx	xx	NUM
ct-9287	82	24	sr	sr	PROPN
ct-9287	82	25	phenotypes	phenotype	NOUN
ct-9287	82	26	in	in	ADP
ct-9287	82	27	dogs.4,19	dogs.4,19	PROPN
ct-9287	82	28	therefore	therefore	ADV
ct-9287	82	29	,	,	PUNCT
ct-9287	82	30	overexpression	overexpression	NOUN
ct-9287	82	31	of	of	ADP
ct-9287	82	32	the	the	DET
ct-9287	82	33	sox9	sox9	PROPN
ct-9287	82	34	gene	gene	NOUN
ct-9287	82	35	might	might	AUX
ct-9287	82	36	have	have	AUX
ct-9287	82	37	been	be	AUX
ct-9287	82	38	a	a	DET
ct-9287	82	39	key	key	ADJ
ct-9287	82	40	factor	factor	NOUN
ct-9287	82	41	for	for	ADP
ct-9287	82	42	testes	testis	NOUN
ct-9287	82	43	induction	induction	NOUN
ct-9287	82	44	in	in	ADP
ct-9287	82	45	the	the	DET
ct-9287	82	46	absence	absence	NOUN
ct-9287	82	47	of	of	ADP
ct-9287	82	48	sry	sry	PROPN
ct-9287	82	49	.	.	PUNCT
ct-9287	83	1	however	however	ADV
ct-9287	83	2	,	,	PUNCT
ct-9287	83	3	mutations	mutation	NOUN
ct-9287	83	4	in	in	ADP
ct-9287	83	5	this	this	DET
ct-9287	83	6	gene	gene	NOUN
ct-9287	83	7	are	be	AUX
ct-9287	83	8	not	not	PART
ct-9287	83	9	always	always	ADV
ct-9287	83	10	the	the	DET
ct-9287	83	11	cause	cause	NOUN
ct-9287	83	12	of	of	ADP
ct-9287	83	13	sry	sry	NOUN
ct-9287	83	14	-	-	ADJ
ct-9287	83	15	negative	negative	ADJ
ct-9287	83	16	xx	xx	NUM
ct-9287	83	17	sr	sr	PROPN
ct-9287	83	18	,	,	PUNCT
ct-9287	83	19	and	and	CCONJ
ct-9287	83	20	inactivating	inactivate	VERB
ct-9287	83	21	mutations	mutation	NOUN
ct-9287	83	22	of	of	ADP
ct-9287	83	23	ovarian	ovarian	ADJ
ct-9287	83	24	determining	determine	VERB
ct-9287	83	25	genes	gene	NOUN
ct-9287	83	26	such	such	ADJ
ct-9287	83	27	as	as	ADP
ct-9287	83	28	rspo1	rspo1	NOUN
ct-9287	83	29	or	or	CCONJ
ct-9287	83	30	ctnnb1	ctnnb1	NOUN
ct-9287	83	31	could	could	AUX
ct-9287	83	32	be	be	AUX
ct-9287	83	33	responsible	responsible	ADJ
ct-9287	83	34	for	for	ADP
ct-9287	83	35	the	the	DET
ct-9287	83	36	observed	observe	VERB
ct-9287	83	37	external	external	ADJ
ct-9287	83	38	female	female	ADJ
ct-9287	83	39	phenotype	phenotype	NOUN
ct-9287	83	40	in	in	ADP
ct-9287	83	41	this	this	DET
ct-9287	83	42	case	case	NOUN
ct-9287	83	43	.	.	PUNCT
ct-9287	84	1	further	further	ADJ
ct-9287	84	2	genomic	genomic	NOUN
ct-9287	84	3	analyses	analysis	NOUN
ct-9287	84	4	are	be	AUX
ct-9287	84	5	required	require	VERB
ct-9287	84	6	to	to	PART
ct-9287	84	7	better	well	ADV
ct-9287	84	8	understand	understand	VERB
ct-9287	84	9	what	what	PRON
ct-9287	84	10	genetic	genetic	ADJ
ct-9287	84	11	factors	factor	NOUN
ct-9287	84	12	for	for	ADP
ct-9287	84	13	testes	testis	NOUN
ct-9287	84	14	induction	induction	NOUN
ct-9287	84	15	may	may	AUX
ct-9287	84	16	exist.3	exist.3	VERB
ct-9287	84	17	clinically	clinically	ADV
ct-9287	84	18	,	,	PUNCT
ct-9287	84	19	the	the	DET
ct-9287	84	20	challenge	challenge	NOUN
ct-9287	84	21	with	with	ADP
ct-9287	84	22	dsd	dsd	PROPN
ct-9287	84	23	cases	case	NOUN
ct-9287	84	24	is	be	AUX
ct-9287	84	25	that	that	SCONJ
ct-9287	84	26	individuals	individual	NOUN
ct-9287	84	27	can	can	AUX
ct-9287	84	28	present	present	VERB
ct-9287	84	29	with	with	ADP
ct-9287	84	30	a	a	DET
ct-9287	84	31	wide	wide	ADJ
ct-9287	84	32	range	range	NOUN
ct-9287	84	33	of	of	ADP
ct-9287	84	34	anatomical	anatomical	ADJ
ct-9287	84	35	abnormalities	abnormality	NOUN
ct-9287	84	36	including	include	VERB
ct-9287	84	37	ambiguous	ambiguous	ADJ
ct-9287	84	38	external	external	ADJ
ct-9287	84	39	genitalia	genitalia	NOUN
ct-9287	84	40	,	,	PUNCT
ct-9287	84	41	clitoral	clitoral	ADJ
ct-9287	84	42	enlargement	enlargement	NOUN
ct-9287	84	43	,	,	PUNCT
ct-9287	84	44	hypospadias	hypospadia	NOUN
ct-9287	84	45	,	,	PUNCT
ct-9287	84	46	and	and	CCONJ
ct-9287	84	47	cryptorchidism	cryptorchidism	NOUN
ct-9287	84	48	.	.	PUNCT
ct-9287	85	1	these	these	DET
ct-9287	85	2	anatomical	anatomical	ADJ
ct-9287	85	3	abnormalities	abnormality	NOUN
ct-9287	85	4	can	can	AUX
ct-9287	85	5	then	then	ADV
ct-9287	85	6	cause	cause	VERB
ct-9287	85	7	secondary	secondary	ADJ
ct-9287	85	8	clinical	clinical	ADJ
ct-9287	85	9	complications	complication	NOUN
ct-9287	85	10	such	such	ADJ
ct-9287	85	11	as	as	ADP
ct-9287	85	12	vaginitis	vaginitis	NOUN
ct-9287	85	13	,	,	PUNCT
ct-9287	85	14	vulvar	vulvar	NOUN
ct-9287	85	15	discharge	discharge	NOUN
ct-9287	85	16	,	,	PUNCT
ct-9287	85	17	and	and	CCONJ
ct-9287	85	18	urinary	urinary	ADJ
ct-9287	85	19	tract	tract	NOUN
ct-9287	85	20	infections	infection	NOUN
ct-9287	85	21	.	.	PUNCT
ct-9287	86	1	anatomical	anatomical	ADJ
ct-9287	86	2	and	and	CCONJ
ct-9287	86	3	clinical	clinical	ADJ
ct-9287	86	4	developmental	developmental	ADJ
ct-9287	86	5	abnormality	abnormality	NOUN
ct-9287	86	6	type	type	NOUN
ct-9287	86	7	depends	depend	VERB
ct-9287	86	8	on	on	ADP
ct-9287	86	9	the	the	DET
ct-9287	86	10	degree	degree	NOUN
ct-9287	86	11	of	of	ADP
ct-9287	86	12	phenotypic	phenotypic	ADJ
ct-9287	86	13	masculinization	masculinization	NOUN
ct-9287	86	14	.	.	PUNCT
ct-9287	87	1	this	this	PRON
ct-9287	87	2	is	be	AUX
ct-9287	87	3	based	base	VERB
ct-9287	87	4	on	on	ADP
ct-9287	87	5	the	the	DET
ct-9287	87	6	amount	amount	NOUN
ct-9287	87	7	of	of	ADP
ct-9287	87	8	functional	functional	ADJ
ct-9287	87	9	testis	testis	NOUN
ct-9287	87	10	that	that	PRON
ct-9287	87	11	developed	develop	VERB
ct-9287	87	12	and	and	CCONJ
ct-9287	87	13	may	may	AUX
ct-9287	87	14	vary	vary	VERB
ct-9287	87	15	depending	depend	VERB
ct-9287	87	16	on	on	ADP
ct-9287	87	17	the	the	DET
ct-9287	87	18	quantity	quantity	NOUN
ct-9287	87	19	and	and	CCONJ
ct-9287	87	20	timing	timing	NOUN
ct-9287	87	21	of	of	ADP
ct-9287	87	22	testicular	testicular	ADJ
ct-9287	87	23	secretions	secretion	NOUN
ct-9287	87	24	necessary	necessary	ADJ
ct-9287	87	25	to	to	PART
ct-9287	87	26	masculinize	masculinize	VERB
ct-9287	87	27	internal	internal	ADJ
ct-9287	87	28	and	and	CCONJ
ct-9287	87	29	external	external	ADJ
ct-9287	87	30	genitalia.20	genitalia.20	NOUN
ct-9287	87	31	furthermore	furthermore	ADV
ct-9287	87	32	,	,	PUNCT
ct-9287	87	33	testosterone	testosterone	NOUN
ct-9287	87	34	concentrations	concentration	NOUN
ct-9287	87	35	produced	produce	VERB
ct-9287	87	36	are	be	AUX
ct-9287	87	37	insufficient	insufficient	ADJ
ct-9287	87	38	in	in	ADP
ct-9287	87	39	quantity	quantity	NOUN
ct-9287	87	40	or	or	CCONJ
ct-9287	87	41	its	its	PRON
ct-9287	87	42	conversion	conversion	NOUN
ct-9287	87	43	to	to	ADP
ct-9287	87	44	dihydrotestosterone	dihydrotestosterone	NOUN
ct-9287	87	45	by	by	ADP
ct-9287	87	46	5α	5α	ADJ
ct-9287	87	47	-	-	PUNCT
ct-9287	87	48	reductase	reductase	NOUN
ct-9287	87	49	is	be	AUX
ct-9287	87	50	impaired	impair	VERB
ct-9287	87	51	during	during	ADP
ct-9287	87	52	the	the	DET
ct-9287	87	53	critical	critical	ADJ
ct-9287	87	54	period	period	NOUN
ct-9287	87	55	for	for	ADP
ct-9287	87	56	androgen	androgen	NOUN
ct-9287	87	57	-	-	PUNCT
ct-9287	87	58	dependent	dependent	ADJ
ct-9287	87	59	masculinization	masculinization	NOUN
ct-9287	87	60	,	,	PUNCT
ct-9287	87	61	internal	internal	ADJ
ct-9287	87	62	and	and	CCONJ
ct-9287	87	63	external	external	ADJ
ct-9287	87	64	genitalia	genitalia	NOUN
ct-9287	87	65	will	will	AUX
ct-9287	87	66	fail	fail	VERB
ct-9287	87	67	to	to	PART
ct-9287	87	68	masculinize	masculinize	VERB
ct-9287	87	69	in	in	ADP
ct-9287	87	70	whole	whole	ADJ
ct-9287	87	71	or	or	CCONJ
ct-9287	87	72	in	in	ADP
ct-9287	87	73	part	part	NOUN
ct-9287	87	74	,	,	PUNCT
ct-9287	87	75	as	as	ADP
ct-9287	87	76	with	with	ADP
ct-9287	87	77	this	this	DET
ct-9287	87	78	case	case	NOUN
ct-9287	87	79	.	.	PUNCT
ct-9287	88	1	approximately	approximately	ADV
ct-9287	88	2	90	90	NUM
ct-9287	88	3	%	%	NOUN
ct-9287	88	4	of	of	ADP
ct-9287	88	5	xx	xx	NUM
ct-9287	88	6	sex	sex	NOUN
ct-9287	88	7	reversal	reversal	NOUN
ct-9287	88	8	cases	case	NOUN
ct-9287	88	9	occur	occur	VERB
ct-9287	88	10	with	with	ADP
ct-9287	88	11	bilateral	bilateral	ADJ
ct-9287	88	12	ovotestes	ovotestis	NOUN
ct-9287	88	13	and	and	CCONJ
ct-9287	88	14	the	the	DET
ct-9287	88	15	remainder	remainder	NOUN
ct-9287	88	16	(	(	PUNCT
ct-9287	88	17	10	10	NUM
ct-9287	88	18	%	%	NOUN
ct-9287	88	19	)	)	PUNCT
ct-9287	88	20	with	with	ADP
ct-9287	88	21	bilateral	bilateral	ADJ
ct-9287	88	22	testes	testis	NOUN
ct-9287	88	23	.	.	PUNCT
ct-9287	89	1	however	however	ADV
ct-9287	89	2	,	,	PUNCT
ct-9287	89	3	there	there	PRON
ct-9287	89	4	were	be	VERB
ct-9287	89	5	some	some	DET
ct-9287	89	6	cases	case	NOUN
ct-9287	89	7	that	that	PRON
ct-9287	89	8	occasionally	occasionally	ADV
ct-9287	89	9	presented	present	VERB
ct-9287	89	10	with	with	ADP
ct-9287	89	11	an	an	DET
ct-9287	89	12	ovary	ovary	ADJ
ct-9287	89	13	and	and	CCONJ
ct-9287	89	14	ovotestis	ovotestis	NOUN
ct-9287	89	15	or	or	CCONJ
ct-9287	89	16	an	an	DET
ct-9287	89	17	ovotestis	ovotestis	NOUN
ct-9287	89	18	paired	pair	VERB
ct-9287	89	19	with	with	ADP
ct-9287	89	20	a	a	DET
ct-9287	89	21	testis.3	testis.3	NOUN
ct-9287	89	22	in	in	ADP
ct-9287	89	23	this	this	DET
ct-9287	89	24	case	case	NOUN
ct-9287	89	25	,	,	PUNCT
ct-9287	89	26	despite	despite	SCONJ
ct-9287	89	27	having	have	VERB
ct-9287	89	28	2	2	NUM
ct-9287	89	29	testes	testis	NOUN
ct-9287	89	30	,	,	PUNCT
ct-9287	89	31	the	the	DET
ct-9287	89	32	patient	patient	NOUN
ct-9287	89	33	had	have	VERB
ct-9287	89	34	phenotypic	phenotypic	ADJ
ct-9287	89	35	female	female	ADJ
ct-9287	89	36	appearance	appearance	NOUN
ct-9287	89	37	with	with	ADP
ct-9287	89	38	no	no	DET
ct-9287	89	39	anatomical	anatomical	ADJ
ct-9287	89	40	evidence	evidence	NOUN
ct-9287	89	41	of	of	ADP
ct-9287	89	42	a	a	DET
ct-9287	89	43	scrotum	scrotum	NOUN
ct-9287	89	44	or	or	CCONJ
ct-9287	89	45	prepuce	prepuce	NOUN
ct-9287	89	46	,	,	PUNCT
ct-9287	89	47	an	an	DET
ct-9287	89	48	unusual	unusual	ADJ
ct-9287	89	49	presentation	presentation	NOUN
ct-9287	89	50	.	.	PUNCT
ct-9287	90	1	primary	primary	ADJ
ct-9287	90	2	clinical	clinical	ADJ
ct-9287	90	3	concern	concern	NOUN
ct-9287	90	4	was	be	AUX
ct-9287	90	5	the	the	DET
ct-9287	90	6	exposed	expose	VERB
ct-9287	90	7	(	(	PUNCT
ct-9287	90	8	presumed	presume	VERB
ct-9287	90	9	hypertrophied	hypertrophied	ADJ
ct-9287	90	10	)	)	PUNCT
ct-9287	90	11	clitoris	clitoris	NOUN
ct-9287	90	12	and	and	CCONJ
ct-9287	90	13	secondary	secondary	ADJ
ct-9287	90	14	vaginitis	vaginitis	NOUN
ct-9287	90	15	associated	associate	VERB
ct-9287	90	16	with	with	ADP
ct-9287	90	17	a	a	DET
ct-9287	90	18	vulvar	vulvar	NOUN
ct-9287	90	19	discharge	discharge	NOUN
ct-9287	90	20	.	.	PUNCT
ct-9287	91	1	normal	normal	ADJ
ct-9287	91	2	sexual	sexual	ADJ
ct-9287	91	3	development	development	NOUN
ct-9287	91	4	is	be	AUX
ct-9287	91	5	a	a	DET
ct-9287	91	6	process	process	NOUN
ct-9287	91	7	that	that	PRON
ct-9287	91	8	is	be	AUX
ct-9287	91	9	highly	highly	ADV
ct-9287	91	10	dependent	dependent	ADJ
ct-9287	91	11	on	on	ADP
ct-9287	91	12	the	the	DET
ct-9287	91	13	timing	timing	NOUN
ct-9287	91	14	of	of	ADP
ct-9287	91	15	events	event	NOUN
ct-9287	91	16	plus	plus	CCONJ
ct-9287	91	17	the	the	DET
ct-9287	91	18	molecular	molecular	ADJ
ct-9287	91	19	and	and	CCONJ
ct-9287	91	20	hormonal	hormonal	ADJ
ct-9287	91	21	expression	expression	NOUN
ct-9287	91	22	of	of	ADP
ct-9287	91	23	karyotype	karyotype	NOUN
ct-9287	91	24	in	in	ADP
ct-9287	91	25	adequate	adequate	ADJ
ct-9287	91	26	and	and	CCONJ
ct-9287	91	27	appropriate	appropriate	ADJ
ct-9287	91	28	amounts	amount	NOUN
ct-9287	91	29	.	.	PUNCT
ct-9287	92	1	delayed	delay	VERB
ct-9287	92	2	or	or	CCONJ
ct-9287	92	3	insufficient	insufficient	ADJ
ct-9287	92	4	quantity	quantity	NOUN
ct-9287	92	5	of	of	ADP
ct-9287	92	6	amh	amh	PROPN
ct-9287	92	7	secretion	secretion	NOUN
ct-9287	92	8	in	in	ADP
ct-9287	92	9	xy	xy	PROPN
ct-9287	92	10	males	male	NOUN
ct-9287	92	11	during	during	ADP
ct-9287	92	12	the	the	DET
ct-9287	92	13	critical	critical	ADJ
ct-9287	92	14	period	period	NOUN
ct-9287	92	15	(	(	PUNCT
ct-9287	92	16	regression	regression	NOUN
ct-9287	92	17	of	of	ADP
ct-9287	92	18	mullerian	mullerian	ADJ
ct-9287	92	19	duct	duct	NOUN
ct-9287	92	20	)	)	PUNCT
ct-9287	92	21	result	result	NOUN
ct-9287	92	22	in	in	ADP
ct-9287	92	23	persistence	persistence	NOUN
ct-9287	92	24	of	of	ADP
ct-9287	92	25	all	all	DET
ct-9287	92	26	or	or	CCONJ
ct-9287	92	27	part	part	NOUN
ct-9287	92	28	of	of	ADP
ct-9287	92	29	the	the	DET
ct-9287	92	30	mullerian	mullerian	ADJ
ct-9287	92	31	duct	duct	NOUN
ct-9287	92	32	derivatives	derivative	NOUN
ct-9287	92	33	(	(	PUNCT
ct-9287	92	34	oviducts	oviduct	NOUN
ct-9287	92	35	,	,	PUNCT
ct-9287	92	36	uterus	uterus	NOUN
ct-9287	92	37	,	,	PUNCT
ct-9287	92	38	cervix	cervix	NOUN
ct-9287	92	39	,	,	PUNCT
ct-9287	92	40	cranial	cranial	ADJ
ct-9287	92	41	vagina).18	vagina).18	NOUN
ct-9287	92	42	this	this	DET
ct-9287	92	43	xx	xx	NUM
ct-9287	92	44	patient	patient	ADJ
ct-9287	92	45	developed	develop	VERB
ct-9287	92	46	testes	testis	NOUN
ct-9287	92	47	with	with	ADP
ct-9287	92	48	functional	functional	ADJ
ct-9287	92	49	(	(	PUNCT
ct-9287	92	50	able	able	ADJ
ct-9287	92	51	to	to	PART
ct-9287	92	52	produce	produce	VERB
ct-9287	92	53	amh	amh	PROPN
ct-9287	92	54	)	)	PUNCT
ct-9287	92	55	sertoli	sertoli	NOUN
ct-9287	92	56	cells	cell	NOUN
ct-9287	92	57	that	that	PRON
ct-9287	92	58	apparently	apparently	ADV
ct-9287	92	59	suppressed	suppress	VERB
ct-9287	92	60	the	the	DET
ct-9287	92	61	emergence	emergence	NOUN
ct-9287	92	62	of	of	ADP
ct-9287	92	63	mullerian	mullerian	ADJ
ct-9287	92	64	duct	duct	NOUN
ct-9287	92	65	derivatives	derivative	NOUN
ct-9287	92	66	.	.	PUNCT
ct-9287	93	1	learning	learn	VERB
ct-9287	93	2	points	point	NOUN
ct-9287	93	3	•	•	NOUN
ct-9287	93	4	determine	determine	VERB
ct-9287	93	5	the	the	DET
ct-9287	93	6	chromosomal	chromosomal	ADJ
ct-9287	93	7	,	,	PUNCT
ct-9287	93	8	gonadal	gonadal	NOUN
ct-9287	93	9	,	,	PUNCT
ct-9287	93	10	and	and	CCONJ
ct-9287	93	11	phenotypic	phenotypic	ADJ
ct-9287	93	12	sex	sex	NOUN
ct-9287	93	13	of	of	ADP
ct-9287	93	14	a	a	DET
ct-9287	93	15	suspected	suspect	VERB
ct-9287	93	16	dsd	dsd	NOUN
ct-9287	93	17	patient	patient	NOUN
ct-9287	93	18	.	.	PUNCT
ct-9287	94	1	•	•	NOUN
ct-9287	94	2	assess	assess	VERB
ct-9287	94	3	the	the	DET
ct-9287	94	4	effect	effect	NOUN
ct-9287	94	5	abnormal	abnormal	ADJ
ct-9287	94	6	reproductive	reproductive	ADJ
ct-9287	94	7	anatomy	anatomy	NOUN
ct-9287	94	8	on	on	ADP
ct-9287	94	9	the	the	DET
ct-9287	94	10	dog	dog	NOUN
ct-9287	94	11	’s	’s	PART
ct-9287	94	12	health	health	NOUN
ct-9287	94	13	and	and	CCONJ
ct-9287	94	14	welfare	welfare	NOUN
ct-9287	94	15	.	.	PUNCT
ct-9287	95	1	•	•	ADV
ct-9287	95	2	implement	implement	VERB
ct-9287	95	3	a	a	DET
ct-9287	95	4	welfare	welfare	NOUN
ct-9287	95	5	-	-	PUNCT
ct-9287	95	6	orientated	orientate	VERB
ct-9287	95	7	management	management	NOUN
ct-9287	95	8	strategy	strategy	NOUN
ct-9287	95	9	that	that	PRON
ct-9287	95	10	would	would	AUX
ct-9287	95	11	alleviate	alleviate	VERB
ct-9287	95	12	the	the	DET
ct-9287	95	13	secondary	secondary	ADJ
ct-9287	95	14	clinical	clinical	ADJ
ct-9287	95	15	signs	sign	NOUN
ct-9287	95	16	caused	cause	VERB
ct-9287	95	17	by	by	ADP
ct-9287	95	18	clitoral	clitoral	ADJ
ct-9287	95	19	hyperplasia	hyperplasia	NOUN
ct-9287	95	20	.	.	PUNCT
ct-9287	96	1	conflict	conflict	NOUN
ct-9287	96	2	of	of	ADP
ct-9287	96	3	interest	interest	NOUN
ct-9287	96	4	none	none	NOUN
ct-9287	96	5	to	to	PART
ct-9287	96	6	declare	declare	VERB
ct-9287	96	7	.	.	PUNCT
ct-9287	97	1	acknowledgement	acknowledgement	PROPN
ct-9287	97	2	authors	author	NOUN
ct-9287	97	3	thank	thank	VERB
ct-9287	97	4	kelsey	kelsey	PROPN
ct-9287	97	5	tofany	tofany	PROPN
ct-9287	97	6	for	for	ADP
ct-9287	97	7	excellent	excellent	ADJ
ct-9287	97	8	technical	technical	ADJ
ct-9287	97	9	assistance	assistance	NOUN
ct-9287	97	10	(	(	PUNCT
ct-9287	97	11	clinical	clinical	ADJ
ct-9287	97	12	examination	examination	NOUN
ct-9287	97	13	and	and	CCONJ
ct-9287	97	14	blood	blood	NOUN
ct-9287	97	15	withdrawal	withdrawal	NOUN
ct-9287	97	16	)	)	PUNCT
ct-9287	97	17	and	and	CCONJ
ct-9287	97	18	patient	patient	ADJ
ct-9287	97	19	management	management	NOUN
ct-9287	97	20	.	.	PUNCT
ct-9287	98	1	references	reference	NOUN
ct-9287	98	2	1	1	NUM
ct-9287	98	3	.	.	PUNCT
ct-9287	99	1	meyers	meyer	NOUN
ct-9287	99	2	-	-	PUNCT
ct-9287	99	3	wallen	wallen	PROPN
ct-9287	99	4	vn	vn	PROPN
ct-9287	99	5	:	:	PUNCT
ct-9287	99	6	inherited	inherit	VERB
ct-9287	99	7	abnormalities	abnormality	NOUN
ct-9287	99	8	of	of	ADP
ct-9287	99	9	sexual	sexual	ADJ
ct-9287	99	10	development	development	NOUN
ct-9287	99	11	in	in	ADP
ct-9287	99	12	dogs	dog	NOUN
ct-9287	99	13	and	and	CCONJ
ct-9287	99	14	cats	cat	NOUN
ct-9287	99	15	.	.	PUNCT
ct-9287	100	1	in	in	ADP
ct-9287	100	2	:	:	PUNCT
ct-9287	100	3	concannon	concannon	PROPN
ct-9287	100	4	pw	pw	PROPN
ct-9287	100	5	,	,	PUNCT
ct-9287	100	6	england	england	PROPN
ct-9287	100	7	g	g	PROPN
ct-9287	100	8	,	,	PUNCT
ct-9287	100	9	verstegen	verstegen	PROPN
ct-9287	100	10	iii	iii	X
ct-9287	100	11	j	j	PROPN
ct-9287	100	12	,	,	PUNCT
ct-9287	100	13	et	et	PROPN
ct-9287	100	14	al	al	PROPN
ct-9287	100	15	:	:	PUNCT
ct-9287	100	16	editors	editor	NOUN
ct-9287	100	17	.	.	PUNCT
ct-9287	101	1	recent	recent	ADJ
ct-9287	101	2	advances	advance	NOUN
ct-9287	101	3	in	in	ADP
ct-9287	101	4	small	small	ADJ
ct-9287	101	5	animal	animal	NOUN
ct-9287	101	6	reproduction	reproduction	NOUN
ct-9287	101	7	.	.	PUNCT
ct-9287	102	1	1st	1st	PROPN
ct-9287	102	2	edition	edition	PROPN
ct-9287	102	3	,	,	PUNCT
ct-9287	102	4	united	united	PROPN
ct-9287	102	5	states	states	PROPN
ct-9287	102	6	;	;	PUNCT
ct-9287	102	7	international	international	ADJ
ct-9287	102	8	veterinary	veterinary	ADJ
ct-9287	102	9	information	information	NOUN
ct-9287	102	10	service	service	NOUN
ct-9287	102	11	:	:	PUNCT
ct-9287	102	12	2001	2001	NUM
ct-9287	102	13	.	.	PUNCT
ct-9287	103	1	2	2	X
ct-9287	103	2	.	.	X
ct-9287	103	3	poth	poth	PROPN
ct-9287	103	4	t	t	PROPN
ct-9287	103	5	,	,	PUNCT
ct-9287	103	6	breuer	breuer	PROPN
ct-9287	103	7	w	w	PROPN
ct-9287	103	8	,	,	PUNCT
ct-9287	103	9	walter	walter	PROPN
ct-9287	103	10	b	b	PROPN
ct-9287	103	11	,	,	PUNCT
ct-9287	103	12	et	et	PROPN
ct-9287	103	13	al	al	PROPN
ct-9287	103	14	:	:	PUNCT
ct-9287	103	15	disorders	disorder	NOUN
ct-9287	103	16	of	of	ADP
ct-9287	103	17	sex	sex	NOUN
ct-9287	103	18	development	development	NOUN
ct-9287	103	19	in	in	ADP
ct-9287	103	20	the	the	DET
ct-9287	103	21	dog	dog	NOUN
ct-9287	103	22	-	-	PUNCT
ct-9287	103	23	adoption	adoption	NOUN
ct-9287	103	24	of	of	ADP
ct-9287	103	25	a	a	DET
ct-9287	103	26	new	new	ADJ
ct-9287	103	27	nomenclature	nomenclature	NOUN
ct-9287	103	28	and	and	CCONJ
ct-9287	103	29	reclassification	reclassification	NOUN
ct-9287	103	30	of	of	ADP
ct-9287	103	31	reported	report	VERB
ct-9287	103	32	cases	case	NOUN
ct-9287	103	33	.	.	PUNCT
ct-9287	104	1	anim	anim	NOUN
ct-9287	104	2	reprod	reprod	PROPN
ct-9287	104	3	sci	sci	PROPN
ct-9287	104	4	2010;121:197	2010;121:197	PROPN
ct-9287	104	5	-	-	PUNCT
ct-9287	104	6	207	207	NUM
ct-9287	104	7	.	.	PUNCT
ct-9287	105	1	3	3	X
ct-9287	105	2	.	.	X
ct-9287	105	3	parma	parma	PROPN
ct-9287	105	4	p	p	X
ct-9287	105	5	,	,	PUNCT
ct-9287	105	6	veyrunes	veyrune	VERB
ct-9287	105	7	f	f	X
ct-9287	105	8	,	,	PUNCT
ct-9287	105	9	pailhoux	pailhoux	ADJ
ct-9287	105	10	e	e	NOUN
ct-9287	105	11	:	:	PUNCT
ct-9287	105	12	sex	sex	NOUN
ct-9287	105	13	reversal	reversal	NOUN
ct-9287	105	14	in	in	ADP
ct-9287	105	15	non	non	ADJ
ct-9287	105	16	-	-	ADJ
ct-9287	105	17	human	human	ADJ
ct-9287	105	18	placental	placental	NOUN
ct-9287	105	19	mammals	mammal	NOUN
ct-9287	105	20	.	.	PUNCT
ct-9287	106	1	sex	sex	NOUN
ct-9287	106	2	dev	dev	PROPN
ct-9287	106	3	2016;10:326	2016;10:326	PROPN
ct-9287	106	4	-	-	PUNCT
ct-9287	106	5	344	344	NUM
ct-9287	106	6	.	.	NOUN
ct-9287	106	7	4	4	NUM
ct-9287	106	8	.	.	X
ct-9287	106	9	albarella	albarella	PROPN
ct-9287	106	10	s	s	PROPN
ct-9287	106	11	,	,	PUNCT
ct-9287	106	12	de	de	X
ct-9287	106	13	lorenzi	lorenzi	PROPN
ct-9287	106	14	l	l	PROPN
ct-9287	106	15	,	,	PUNCT
ct-9287	106	16	rossi	rossi	ADJ
ct-9287	106	17	e	e	X
ct-9287	106	18	,	,	PUNCT
ct-9287	106	19	et	et	PROPN
ct-9287	106	20	al	al	PROPN
ct-9287	106	21	:	:	PUNCT
ct-9287	106	22	analysis	analysis	NOUN
ct-9287	106	23	of	of	ADP
ct-9287	106	24	xx	xx	NUM
ct-9287	106	25	sry	sry	ADJ
ct-9287	106	26	-	-	ADJ
ct-9287	106	27	negative	negative	ADJ
ct-9287	106	28	sex	sex	NOUN
ct-9287	106	29	reversal	reversal	NOUN
ct-9287	106	30	dogs	dog	NOUN
ct-9287	106	31	.	.	PUNCT
ct-9287	107	1	animals	animal	NOUN
ct-9287	107	2	2020;10:1	2020;10:1	NUM
ct-9287	107	3	-	-	SYM
ct-9287	107	4	13	13	NUM
ct-9287	107	5	.	.	PUNCT
ct-9287	107	6	5	5	NUM
ct-9287	107	7	.	.	X
ct-9287	107	8	chaffaux	chaffaux	PROPN
ct-9287	107	9	s	s	PROPN
ct-9287	107	10	,	,	PUNCT
ct-9287	107	11	cribiu	cribiu	NOUN
ct-9287	107	12	ep	ep	NOUN
ct-9287	107	13	:	:	PUNCT
ct-9287	107	14	clinical	clinical	ADJ
ct-9287	107	15	,	,	PUNCT
ct-9287	107	16	histological	histological	ADJ
ct-9287	107	17	and	and	CCONJ
ct-9287	107	18	cytogenetic	cytogenetic	ADJ
ct-9287	107	19	observations	observation	NOUN
ct-9287	107	20	on	on	ADP
ct-9287	107	21	nine	nine	NUM
ct-9287	107	22	intersex	intersex	ADJ
ct-9287	107	23	dogs	dog	NOUN
ct-9287	107	24	.	.	PUNCT
ct-9287	108	1	genet	genet	PROPN
ct-9287	108	2	sel	sel	PROPN
ct-9287	108	3	evol	evol	NOUN
ct-9287	108	4	1991;23:81	1991;23:81	NUM
ct-9287	108	5	-	-	SYM
ct-9287	108	6	84	84	NUM
ct-9287	108	7	.	.	PUNCT
ct-9287	109	1	6	6	NUM
ct-9287	109	2	.	.	X
ct-9287	109	3	kang	kang	PROPN
ct-9287	109	4	jt	jt	PROPN
ct-9287	109	5	,	,	PUNCT
ct-9287	109	6	kim	kim	PROPN
ct-9287	109	7	hj	hj	PROPN
ct-9287	109	8	,	,	PUNCT
ct-9287	109	9	oh	oh	INTJ
ct-9287	109	10	hj	hj	PROPN
ct-9287	109	11	,	,	PUNCT
ct-9287	109	12	et	et	PROPN
ct-9287	109	13	al	al	PROPN
ct-9287	109	14	:	:	PUNCT
ct-9287	109	15	sry	sry	ADJ
ct-9287	109	16	-	-	ADJ
ct-9287	109	17	positive	positive	ADJ
ct-9287	109	18	78	78	NUM
ct-9287	109	19	,	,	PUNCT
ct-9287	109	20	xy	xy	PROPN
ct-9287	109	21	ovotesticular	ovotesticular	ADJ
ct-9287	109	22	disorder	disorder	NOUN
ct-9287	109	23	of	of	ADP
ct-9287	109	24	sex	sex	NOUN
ct-9287	109	25	development	development	NOUN
ct-9287	109	26	in	in	ADP
ct-9287	109	27	a	a	DET
ct-9287	109	28	wolf	wolf	NOUN
ct-9287	109	29	cloned	clone	VERB
ct-9287	109	30	by	by	ADP
ct-9287	109	31	nuclear	nuclear	ADJ
ct-9287	109	32	transfer	transfer	NOUN
ct-9287	109	33	.	.	PUNCT
ct-9287	110	1	j	j	PROPN
ct-9287	110	2	vet	vet	NOUN
ct-9287	110	3	sci	sci	PROPN
ct-9287	110	4	2012;13:211	2012;13:211	PROPN
ct-9287	110	5	-	-	SYM
ct-9287	110	6	213	213	NUM
ct-9287	110	7	.	.	PUNCT
ct-9287	110	8	7	7	NUM
ct-9287	110	9	.	.	X
ct-9287	110	10	yoon	yoon	PROPN
ct-9287	110	11	h	h	PROPN
ct-9287	110	12	,	,	PUNCT
ct-9287	110	13	han	han	PROPN
ct-9287	110	14	sh	sh	PROPN
ct-9287	110	15	,	,	PUNCT
ct-9287	110	16	kim	kim	PROPN
ct-9287	110	17	j	j	PROPN
ct-9287	110	18	,	,	PUNCT
ct-9287	110	19	et	et	PROPN
ct-9287	110	20	al	al	PROPN
ct-9287	110	21	:	:	PUNCT
ct-9287	110	22	urogenital	urogenital	ADJ
ct-9287	110	23	anomalies	anomaly	NOUN
ct-9287	110	24	and	and	CCONJ
ct-9287	110	25	urinary	urinary	ADJ
ct-9287	110	26	incontinence	incontinence	NOUN
ct-9287	110	27	in	in	ADP
ct-9287	110	28	an	an	DET
ct-9287	110	29	english	english	ADJ
ct-9287	110	30	cocker	cocker	NOUN
ct-9287	110	31	spaniel	spaniel	NOUN
ct-9287	110	32	dog	dog	NOUN
ct-9287	110	33	with	with	ADP
ct-9287	110	34	xx	xx	NUM
ct-9287	110	35	sex	sex	NOUN
ct-9287	110	36	reversal	reversal	NOUN
ct-9287	110	37	.	.	PUNCT
ct-9287	111	1	j	j	PROPN
ct-9287	111	2	vet	vet	NOUN
ct-9287	111	3	intern	intern	NOUN
ct-9287	111	4	med	me	VERB
ct-9287	111	5	.	.	PUNCT
ct-9287	112	1	2018;32:1166	2018;32:1166	NUM
ct-9287	112	2	-	-	SYM
ct-9287	112	3	1171	1171	NUM
ct-9287	112	4	.	.	PUNCT
ct-9287	113	1	8	8	NUM
ct-9287	113	2	.	.	PUNCT
ct-9287	113	3	purswell	purswell	NOUN
ct-9287	113	4	bj	bj	PROPN
ct-9287	113	5	,	,	PUNCT
ct-9287	113	6	kolster	kolster	PROPN
ct-9287	113	7	ka	ka	PROPN
ct-9287	113	8	:	:	PUNCT
ct-9287	113	9	surgical	surgical	ADJ
ct-9287	113	10	disease	disease	NOUN
ct-9287	113	11	of	of	ADP
ct-9287	113	12	the	the	DET
ct-9287	113	13	vulva	vulva	NOUN
ct-9287	113	14	and	and	CCONJ
ct-9287	113	15	vagina	vagina	ADJ
ct-9287	113	16	.	.	PUNCT
ct-9287	114	1	in	in	ADP
ct-9287	114	2	:	:	PUNCT
ct-9287	114	3	bojrab	bojrab	PROPN
ct-9287	114	4	mj	mj	PROPN
ct-9287	114	5	,	,	PUNCT
ct-9287	114	6	monnet	monnet	NOUN
ct-9287	114	7	e	e	NOUN
ct-9287	114	8	:	:	PUNCT
ct-9287	114	9	editors	editor	NOUN
ct-9287	114	10	.	.	PUNCT
ct-9287	115	1	mechanisms	mechanism	NOUN
ct-9287	115	2	of	of	ADP
ct-9287	115	3	disease	disease	NOUN
ct-9287	115	4	in	in	ADP
ct-9287	115	5	small	small	ADJ
ct-9287	115	6	animal	animal	NOUN
ct-9287	115	7	surgery	surgery	NOUN
ct-9287	115	8	.	.	PUNCT
ct-9287	116	1	3rd	3rd	ADJ
ct-9287	116	2	edition	edition	PROPN
ct-9287	116	3	,	,	PUNCT
ct-9287	116	4	jackson	jackson	PROPN
ct-9287	116	5	;	;	PUNCT
ct-9287	116	6	teton	teton	PROPN
ct-9287	116	7	newmedia	newmedia	PROPN
ct-9287	116	8	:	:	PUNCT
ct-9287	116	9	2015	2015	NUM
ct-9287	116	10	.	.	PUNCT
ct-9287	117	1	9	9	X
ct-9287	117	2	.	.	X
ct-9287	118	1	curtis	curtis	PROPN
ct-9287	118	2	em	em	PRON
ct-9287	118	3	,	,	PUNCT
ct-9287	118	4	grant	grant	VERB
ct-9287	118	5	rp	rp	NOUN
ct-9287	118	6	:	:	PUNCT
ct-9287	118	7	masculinization	masculinization	NOUN
ct-9287	118	8	of	of	ADP
ct-9287	118	9	female	female	ADJ
ct-9287	118	10	pups	pup	NOUN
ct-9287	118	11	by	by	ADP
ct-9287	118	12	progestogens	progestogen	NOUN
ct-9287	118	13	.	.	PUNCT
ct-9287	119	1	j	j	PROPN
ct-9287	119	2	am	be	AUX
ct-9287	119	3	vet	vet	NOUN
ct-9287	119	4	med	med	ADJ
ct-9287	119	5	assoc	assoc	PROPN
ct-9287	119	6	1964;144:395	1964;144:395	PROPN
ct-9287	119	7	-	-	SYM
ct-9287	119	8	398	398	NUM
ct-9287	119	9	.	.	PUNCT
ct-9287	120	1	10	10	NUM
ct-9287	120	2	.	.	PUNCT
ct-9287	121	1	sokolowski	sokolowski	PROPN
ct-9287	121	2	jh	jh	PROPN
ct-9287	121	3	,	,	PUNCT
ct-9287	121	4	zimbelman	zimbelman	PROPN
ct-9287	121	5	rg	rg	NOUN
ct-9287	121	6	:	:	PUNCT
ct-9287	121	7	canine	canine	PROPN
ct-9287	121	8	reproduction	reproduction	NOUN
ct-9287	121	9	:	:	PUNCT
ct-9287	122	1	effects	effect	NOUN
ct-9287	122	2	of	of	ADP
ct-9287	122	3	multiple	multiple	ADJ
ct-9287	122	4	treatments	treatment	NOUN
ct-9287	122	5	of	of	ADP
ct-9287	122	6	medroxyprogesterone	medroxyprogesterone	NOUN
ct-9287	122	7	acetate	acetate	NOUN
ct-9287	122	8	on	on	ADP
ct-9287	122	9	reproductive	reproductive	ADJ
ct-9287	122	10	organs	organ	NOUN
ct-9287	122	11	of	of	ADP
ct-9287	122	12	the	the	DET
ct-9287	122	13	bitch	bitch	NOUN
ct-9287	122	14	.	.	PUNCT
ct-9287	123	1	am	be	AUX
ct-9287	123	2	j	j	PROPN
ct-9287	123	3	vet	vet	NOUN
ct-9287	123	4	res	re	NOUN
ct-9287	123	5	1974	1974	NUM
ct-9287	123	6	;	;	PUNCT
ct-9287	123	7	35:1285	35:1285	NUM
ct-9287	123	8	-	-	SYM
ct-9287	123	9	1287	1287	NUM
ct-9287	123	10	.	.	PUNCT
ct-9287	124	1	11	11	NUM
ct-9287	124	2	.	.	PUNCT
ct-9287	125	1	sumner	sumner	PROPN
ct-9287	125	2	sm	sm	PROPN
ct-9287	125	3	,	,	PUNCT
ct-9287	125	4	grimes	grimes	PROPN
ct-9287	125	5	ja	ja	PROPN
ct-9287	125	6	,	,	PUNCT
ct-9287	125	7	wallace	wallace	PROPN
ct-9287	125	8	ml	ml	PROPN
ct-9287	125	9	,	,	PUNCT
ct-9287	125	10	et	et	PROPN
ct-9287	125	11	al	al	PROPN
ct-9287	125	12	:	:	PUNCT
ct-9287	125	13	os	os	PROPN
ct-9287	125	14	clitoris	clitoris	PROPN
ct-9287	125	15	in	in	ADP
ct-9287	125	16	dogs	dog	NOUN
ct-9287	125	17	:	:	PUNCT
ct-9287	125	18	17	17	NUM
ct-9287	125	19	cases	case	NOUN
ct-9287	125	20	(	(	PUNCT
ct-9287	125	21	2009	2009	NUM
ct-9287	125	22	-	-	SYM
ct-9287	125	23	2017	2017	NUM
ct-9287	125	24	)	)	PUNCT
ct-9287	125	25	.	.	PUNCT
ct-9287	126	1	can	can	AUX
ct-9287	126	2	vet	vet	VERB
ct-9287	126	3	j	j	PROPN
ct-9287	126	4	2018;59:606	2018;59:606	PROPN
ct-9287	126	5	-	-	PUNCT
ct-9287	126	6	610	610	NUM
ct-9287	126	7	.	.	PUNCT
ct-9287	126	8	12	12	NUM
ct-9287	126	9	.	.	PUNCT
ct-9287	127	1	alm	alm	PROPN
ct-9287	127	2	h	h	PROPN
ct-9287	127	3	,	,	PUNCT
ct-9287	127	4	bodil	bodil	PROPN
ct-9287	127	5	sh	sh	PROPN
ct-9287	127	6	:	:	PUNCT
ct-9287	127	7	identifying	identify	VERB
ct-9287	127	8	ovarian	ovarian	ADJ
ct-9287	127	9	tissue	tissue	NOUN
ct-9287	127	10	in	in	ADP
ct-9287	127	11	the	the	DET
ct-9287	127	12	bitch	bitch	NOUN
ct-9287	127	13	using	use	VERB
ct-9287	127	14	anti	anti	ADJ
ct-9287	127	15	-	-	ADJ
ct-9287	127	16	müllerian	müllerian	ADJ
ct-9287	127	17	hormone	hormone	NOUN
ct-9287	127	18	(	(	PUNCT
ct-9287	127	19	amh	amh	PROPN
ct-9287	127	20	)	)	PUNCT
ct-9287	127	21	or	or	CCONJ
ct-9287	127	22	luteinizing	luteinize	VERB
ct-9287	127	23	hormone	hormone	NOUN
ct-9287	127	24	(	(	PUNCT
ct-9287	127	25	lh	lh	PROPN
ct-9287	127	26	)	)	PUNCT
ct-9287	127	27	.	.	PUNCT
ct-9287	128	1	theriogenology	theriogenology	NOUN
ct-9287	128	2	2018;106:15	2018;106:15	NUM
ct-9287	128	3	-	-	SYM
ct-9287	128	4	20	20	NUM
ct-9287	128	5	.	.	PUNCT
ct-9287	129	1	clinical	clinical	ADJ
ct-9287	129	2	theriogenology	theriogenology	NOUN
ct-9287	129	3	2022	2022	NUM
ct-9287	129	4	;	;	PUNCT
ct-9287	129	5	14	14	NUM
ct-9287	129	6	:	:	SYM
ct-9287	129	7	114	114	NUM
ct-9287	129	8	13	13	NUM
ct-9287	129	9	.	.	PUNCT
ct-9287	129	10	grinspon	grinspon	PROPN
ct-9287	129	11	rp	rp	PROPN
ct-9287	129	12	,	,	PUNCT
ct-9287	129	13	bedecarrás	bedecarrás	NOUN
ct-9287	129	14	p	p	NOUN
ct-9287	129	15	,	,	PUNCT
ct-9287	129	16	ballerini	ballerini	PROPN
ct-9287	129	17	mg	mg	PROPN
ct-9287	129	18	,	,	PUNCT
ct-9287	129	19	et	et	PROPN
ct-9287	129	20	al	al	PROPN
ct-9287	129	21	:	:	PUNCT
ct-9287	129	22	early	early	ADJ
ct-9287	129	23	onset	onset	NOUN
ct-9287	129	24	of	of	ADP
ct-9287	129	25	primary	primary	ADJ
ct-9287	129	26	hypogonadism	hypogonadism	NOUN
ct-9287	129	27	revealed	reveal	VERB
ct-9287	129	28	by	by	ADP
ct-9287	129	29	serum	serum	NOUN
ct-9287	129	30	anti	anti	ADJ
ct-9287	129	31	-	-	ADJ
ct-9287	129	32	müllerian	müllerian	ADJ
ct-9287	129	33	hormone	hormone	NOUN
ct-9287	129	34	determination	determination	NOUN
ct-9287	129	35	during	during	ADP
ct-9287	129	36	infancy	infancy	NOUN
ct-9287	129	37	and	and	CCONJ
ct-9287	129	38	childhood	childhood	NOUN
ct-9287	129	39	in	in	ADP
ct-9287	129	40	trisomy	trisomy	NOUN
ct-9287	129	41	21	21	NUM
ct-9287	129	42	.	.	PUNCT
ct-9287	130	1	int	int	PROPN
ct-9287	131	1	j	j	PROPN
ct-9287	131	2	androl	androl	PROPN
ct-9287	131	3	2011;34	2011;34	PROPN
ct-9287	131	4	:	:	PUNCT
ct-9287	131	5	e487	e487	PROPN
ct-9287	131	6	-	-	PUNCT
ct-9287	131	7	e498	e498	PROPN
ct-9287	131	8	.	.	PUNCT
ct-9287	132	1	14.yan	14.yan	PROPN
ct-9287	132	2	s	s	PROPN
ct-9287	132	3	,	,	PUNCT
ct-9287	132	4	bai	bai	PROPN
ct-9287	132	5	c	c	PROPN
ct-9287	132	6	,	,	PUNCT
ct-9287	132	7	li	li	PROPN
ct-9287	132	8	y	y	PROPN
ct-9287	132	9	,	,	PUNCT
ct-9287	132	10	et	et	PROPN
ct-9287	132	11	al	al	PROPN
ct-9287	132	12	:	:	PUNCT
ct-9287	132	13	sex	sex	NOUN
ct-9287	132	14	identification	identification	NOUN
ct-9287	132	15	of	of	ADP
ct-9287	132	16	dog	dog	NOUN
ct-9287	132	17	by	by	ADP
ct-9287	132	18	pcr	pcr	NOUN
ct-9287	132	19	based	base	VERB
ct-9287	132	20	on	on	ADP
ct-9287	132	21	the	the	DET
ct-9287	132	22	differences	difference	NOUN
ct-9287	132	23	in	in	ADP
ct-9287	132	24	the	the	DET
ct-9287	132	25	amelx	amelx	ADJ
ct-9287	132	26	and	and	CCONJ
ct-9287	132	27	amely	amely	ADV
ct-9287	132	28	genes	gene	NOUN
ct-9287	132	29	.	.	PUNCT
ct-9287	133	1	anim	anim	NOUN
ct-9287	133	2	genet	genet	PROPN
ct-9287	133	3	2013;44:604	2013;44:604	PROPN
ct-9287	133	4	-	-	NUM
ct-9287	133	5	607	607	NUM
ct-9287	133	6	.	.	PUNCT
ct-9287	133	7	15	15	NUM
ct-9287	133	8	.	.	PUNCT
ct-9287	134	1	meyers	meyer	NOUN
ct-9287	134	2	-	-	PUNCT
ct-9287	134	3	wallen	wallen	PROPN
ct-9287	134	4	vn	vn	PROPN
ct-9287	134	5	:	:	PUNCT
ct-9287	134	6	gonadal	gonadal	NOUN
ct-9287	134	7	and	and	CCONJ
ct-9287	134	8	sex	sex	NOUN
ct-9287	134	9	differentiation	differentiation	NOUN
ct-9287	134	10	abnormalities	abnormality	NOUN
ct-9287	134	11	of	of	ADP
ct-9287	134	12	dogs	dog	NOUN
ct-9287	134	13	and	and	CCONJ
ct-9287	134	14	cats	cat	NOUN
ct-9287	134	15	.	.	PUNCT
ct-9287	135	1	sex	sex	NOUN
ct-9287	135	2	dev	dev	PROPN
ct-9287	135	3	2012;6:46	2012;6:46	PROPN
ct-9287	135	4	-	-	PUNCT
ct-9287	135	5	60	60	NUM
ct-9287	135	6	.	.	PUNCT
ct-9287	135	7	16	16	NUM
ct-9287	135	8	.	.	PUNCT
ct-9287	136	1	melniczek	melniczek	ADJ
ct-9287	136	2	jr	jr	PROPN
ct-9287	136	3	,	,	PUNCT
ct-9287	136	4	dambach	dambach	NOUN
ct-9287	136	5	d	d	NOUN
ct-9287	136	6	,	,	PUNCT
ct-9287	136	7	prociuk	prociuk	NOUN
ct-9287	136	8	u	u	NOUN
ct-9287	136	9	,	,	PUNCT
ct-9287	136	10	et	et	PROPN
ct-9287	136	11	al	al	PROPN
ct-9287	136	12	:	:	PUNCT
ct-9287	136	13	sry	sry	ADJ
ct-9287	136	14	-	-	ADJ
ct-9287	136	15	negative	negative	ADJ
ct-9287	136	16	xx	xx	NUM
ct-9287	136	17	sex	sex	NOUN
ct-9287	136	18	reversal	reversal	NOUN
ct-9287	136	19	in	in	ADP
ct-9287	136	20	a	a	DET
ct-9287	136	21	family	family	NOUN
ct-9287	136	22	of	of	ADP
ct-9287	136	23	norwegian	norwegian	ADJ
ct-9287	136	24	elkhounds	elkhound	NOUN
ct-9287	136	25	.	.	PUNCT
ct-9287	137	1	j	j	PROPN
ct-9287	137	2	vet	vet	NOUN
ct-9287	137	3	intern	intern	NOUN
ct-9287	137	4	med	me	VERB
ct-9287	137	5	1999;13:564	1999;13:564	NUM
ct-9287	137	6	-	-	PUNCT
ct-9287	137	7	569	569	NUM
ct-9287	137	8	.	.	PUNCT
ct-9287	138	1	17	17	NUM
ct-9287	138	2	.	.	PUNCT
ct-9287	139	1	campos	campos	PROPN
ct-9287	139	2	m	m	PROPN
ct-9287	139	3	,	,	PUNCT
ct-9287	139	4	moreno	moreno	PROPN
ct-9287	139	5	-	-	PUNCT
ct-9287	139	6	manzano	manzano	PROPN
ct-9287	139	7	v	v	PROPN
ct-9287	139	8	,	,	PUNCT
ct-9287	139	9	garcía	garcía	ADJ
ct-9287	139	10	-	-	PUNCT
ct-9287	139	11	roselló	roselló	ADJ
ct-9287	139	12	m	m	NOUN
ct-9287	139	13	,	,	PUNCT
ct-9287	139	14	et	et	PROPN
ct-9287	139	15	al	al	PROPN
ct-9287	139	16	:	:	PUNCT
ct-9287	139	17	srynegative	srynegative	ADJ
ct-9287	139	18	xx	xx	NUM
ct-9287	139	19	sex	sex	NOUN
ct-9287	139	20	reversal	reversal	NOUN
ct-9287	139	21	in	in	ADP
ct-9287	139	22	a	a	DET
ct-9287	139	23	french	french	ADJ
ct-9287	139	24	bulldog	bulldog	NOUN
ct-9287	139	25	.	.	PUNCT
ct-9287	140	1	reprod	reprod	PROPN
ct-9287	140	2	dom	dom	PROPN
ct-9287	140	3	anim	anim	PROPN
ct-9287	140	4	2011;46:185	2011;46:185	PROPN
ct-9287	140	5	-	-	SYM
ct-9287	140	6	188	188	NUM
ct-9287	140	7	.	.	PUNCT
ct-9287	140	8	18	18	NUM
ct-9287	140	9	.	.	PUNCT
ct-9287	141	1	meyers	meyer	NOUN
ct-9287	141	2	-	-	PUNCT
ct-9287	141	3	wallen	wallen	PROPN
ct-9287	141	4	vn	vn	PROPN
ct-9287	141	5	,	,	PUNCT
ct-9287	141	6	schlafer	schlafer	VERB
ct-9287	141	7	d	d	PROPN
ct-9287	141	8	,	,	PUNCT
ct-9287	141	9	barr	barr	PROPN
ct-9287	141	10	i	i	PROPN
ct-9287	141	11	,	,	PUNCT
ct-9287	141	12	et	et	PROPN
ct-9287	141	13	al	al	PROPN
ct-9287	141	14	:	:	PUNCT
ct-9287	141	15	sry	sry	ADJ
ct-9287	141	16	-	-	ADJ
ct-9287	141	17	negative	negative	ADJ
ct-9287	141	18	xx	xx	NUM
ct-9287	141	19	sex	sex	NOUN
ct-9287	141	20	reversal	reversal	NOUN
ct-9287	141	21	in	in	ADP
ct-9287	141	22	purebred	purebre	VERB
ct-9287	141	23	dogs	dog	NOUN
ct-9287	141	24	.	.	PUNCT
ct-9287	142	1	mol	mol	PROPN
ct-9287	142	2	reprod	reprod	PROPN
ct-9287	142	3	dev	dev	PROPN
ct-9287	142	4	1991;53:266	1991;53:266	X
ct-9287	142	5	-	-	SYM
ct-9287	142	6	273	273	NUM
ct-9287	142	7	.	.	NOUN
ct-9287	142	8	19	19	NUM
ct-9287	142	9	.	.	PUNCT
ct-9287	142	10	rossi	rossi	PROPN
ct-9287	142	11	e	e	X
ct-9287	142	12	,	,	PUNCT
ct-9287	142	13	radi	radi	NOUN
ct-9287	142	14	o	o	NOUN
ct-9287	142	15	,	,	PUNCT
ct-9287	142	16	de	de	X
ct-9287	142	17	lorenzi	lorenzi	PROPN
ct-9287	142	18	l	l	PROPN
ct-9287	142	19	,	,	PUNCT
ct-9287	142	20	et	et	PROPN
ct-9287	142	21	al	al	PROPN
ct-9287	142	22	:	:	PUNCT
ct-9287	142	23	sox9	sox9	PROPN
ct-9287	142	24	duplications	duplication	NOUN
ct-9287	142	25	are	be	AUX
ct-9287	142	26	a	a	DET
ct-9287	142	27	relevant	relevant	ADJ
ct-9287	142	28	cause	cause	NOUN
ct-9287	142	29	of	of	ADP
ct-9287	142	30	sry	sry	NOUN
ct-9287	142	31	-	-	ADJ
ct-9287	142	32	negative	negative	ADJ
ct-9287	142	33	xx	xx	NUM
ct-9287	142	34	sex	sex	NOUN
ct-9287	142	35	reversal	reversal	NOUN
ct-9287	142	36	dogs	dog	NOUN
ct-9287	142	37	.	.	PUNCT
ct-9287	143	1	plos	plos	PROPN
ct-9287	143	2	one	one	NUM
ct-9287	143	3	2014;9	2014;9	NUM
ct-9287	143	4	:	:	PUNCT
ct-9287	143	5	e101244	e101244	NOUN
ct-9287	143	6	.	.	PROPN
ct-9287	143	7	20	20	NUM
ct-9287	143	8	.	.	PUNCT
ct-9287	144	1	schlafer	schlafer	VERB
ct-9287	144	2	dh	dh	PROPN
ct-9287	144	3	,	,	PUNCT
ct-9287	144	4	valentine	valentine	PROPN
ct-9287	144	5	b	b	NUM
ct-9287	144	6	,	,	PUNCT
ct-9287	144	7	fahnestock	fahnestock	NOUN
ct-9287	144	8	g	g	PROPN
ct-9287	144	9	,	,	PUNCT
ct-9287	144	10	et	et	PROPN
ct-9287	144	11	al	al	PROPN
ct-9287	144	12	:	:	PUNCT
ct-9287	144	13	a	a	DET
ct-9287	144	14	case	case	NOUN
ct-9287	144	15	of	of	ADP
ct-9287	144	16	srypositive	srypositive	ADJ
ct-9287	144	17	38,xy	38,xy	NUM
ct-9287	144	18	true	true	ADJ
ct-9287	144	19	hermaphroditism	hermaphroditism	NOUN
ct-9287	144	20	(	(	PUNCT
ct-9287	144	21	xy	xy	PROPN
ct-9287	144	22	sex	sex	NOUN
ct-9287	144	23	reversal	reversal	NOUN
ct-9287	144	24	)	)	PUNCT
ct-9287	144	25	in	in	ADP
ct-9287	144	26	a	a	DET
ct-9287	144	27	cat	cat	NOUN
ct-9287	144	28	.	.	PUNCT
ct-9287	145	1	vet	vet	NOUN
ct-9287	145	2	pathol	pathol	NOUN
ct-9287	145	3	2011;48:817	2011;48:817	PROPN
ct-9287	145	4	-	-	PUNCT
ct-9287	145	5	822	822	NUM
ct-9287	145	6	.	.	PUNCT