id sid tid token lemma pos ct-9454 1 1 steps step NOUN ct-9454 1 2 toward toward ADP ct-9454 1 3 the the DET ct-9454 1 4 generation generation NOUN ct-9454 1 5 of of ADP ct-9454 1 6 ovarian ovarian ADJ ct-9454 1 7 somatic somatic ADJ ct-9454 1 8 cells cell NOUN ct-9454 1 9 from from ADP ct-9454 1 10 pluripotent pluripotent ADJ ct-9454 1 11 stem stem NOUN ct-9454 1 12 cells cell NOUN ct-9454 1 13                     SPACE ct-9454 1 14 steps step NOUN ct-9454 1 15 toward toward ADP ct-9454 1 16 the the DET ct-9454 1 17 generation generation NOUN ct-9454 1 18 of of ADP ct-9454 1 19 ovarian ovarian ADJ ct-9454 1 20 somatic somatic ADJ ct-9454 1 21 cells cell NOUN ct-9454 1 22 from from ADP ct-9454 1 23 pluripotent pluripotent ADJ ct-9454 1 24 stem stem NOUN ct-9454 1 25 cells cell NOUN ct-9454 1 26 alisha alisha PROPN ct-9454 1 27 bothun bothun PROPN ct-9454 1 28 , , PUNCT ct-9454 1 29 dori dori PROPN ct-9454 1 30 woods woods PROPN ct-9454 1 31 department department PROPN ct-9454 1 32 of of ADP ct-9454 1 33 biology biology NOUN ct-9454 1 34 , , PUNCT ct-9454 1 35 northeastern northeastern ADJ ct-9454 1 36 university university PROPN ct-9454 1 37 , , PUNCT ct-9454 1 38 boston boston PROPN ct-9454 1 39 , , PUNCT ct-9454 1 40 ma ma PROPN ct-9454 1 41 abstract abstract ADJ ct-9454 1 42 the the DET ct-9454 1 43 generation generation NOUN ct-9454 1 44 of of ADP ct-9454 1 45 functional functional ADJ ct-9454 1 46 gametes gamete NOUN ct-9454 1 47 , , PUNCT ct-9454 1 48 both both DET ct-9454 1 49 eggs egg NOUN ct-9454 1 50 and and CCONJ ct-9454 1 51 sperm sperm NOUN ct-9454 1 52 , , PUNCT ct-9454 1 53 from from ADP ct-9454 1 54 murine murine ADJ ct-9454 1 55 pluripotent pluripotent ADJ ct-9454 1 56 stem stem NOUN ct-9454 1 57 cell cell NOUN ct-9454 1 58 ( ( PUNCT ct-9454 1 59 psc psc PROPN ct-9454 1 60 ) ) PUNCT ct-9454 1 61 sources source NOUN ct-9454 1 62 , , PUNCT ct-9454 1 63 has have AUX ct-9454 1 64 set set VERB ct-9454 1 65 the the DET ct-9454 1 66 stage stage NOUN ct-9454 1 67 for for ADP ct-9454 1 68 the the DET ct-9454 1 69 eventual eventual ADJ ct-9454 1 70 use use NOUN ct-9454 1 71 of of ADP ct-9454 1 72 this this DET ct-9454 1 73 emerging emerge VERB ct-9454 1 74 technology technology NOUN ct-9454 1 75 in in ADP ct-9454 1 76 other other ADJ ct-9454 1 77 species specie NOUN ct-9454 1 78 . . PUNCT ct-9454 2 1 with with ADP ct-9454 2 2 the the DET ct-9454 2 3 field field NOUN ct-9454 2 4 enthusiastically enthusiastically ADV ct-9454 2 5 embracing embrace VERB ct-9454 2 6 this this DET ct-9454 2 7 eventuality eventuality NOUN ct-9454 2 8 , , PUNCT ct-9454 2 9 in in ADP ct-9454 2 10 particular particular ADJ ct-9454 2 11 for for ADP ct-9454 2 12 animal animal NOUN ct-9454 2 13 conservation conservation NOUN ct-9454 2 14 efforts effort NOUN ct-9454 2 15 , , PUNCT ct-9454 2 16 there there PRON ct-9454 2 17 are be VERB ct-9454 2 18 a a DET ct-9454 2 19 number number NOUN ct-9454 2 20 of of ADP ct-9454 2 21 key key ADJ ct-9454 2 22 factors factor NOUN ct-9454 2 23 to to PART ct-9454 2 24 consider consider VERB ct-9454 2 25 regarding regard VERB ct-9454 2 26 the the DET ct-9454 2 27 applicability applicability NOUN ct-9454 2 28 of of ADP ct-9454 2 29 these these DET ct-9454 2 30 methods method NOUN ct-9454 2 31 across across ADP ct-9454 2 32 species specie NOUN ct-9454 2 33 , , PUNCT ct-9454 2 34 particularly particularly ADV ct-9454 2 35 with with ADP ct-9454 2 36 regard regard NOUN ct-9454 2 37 to to ADP ct-9454 2 38 the the DET ct-9454 2 39 generation generation NOUN ct-9454 2 40 of of ADP ct-9454 2 41 eggs egg NOUN ct-9454 2 42 . . PUNCT ct-9454 3 1 to to ADP ct-9454 3 2 date date NOUN ct-9454 3 3 , , PUNCT ct-9454 3 4 published publish VERB ct-9454 3 5 studies study NOUN ct-9454 3 6 point point VERB ct-9454 3 7 to to ADP ct-9454 3 8 the the DET ct-9454 3 9 need need NOUN ct-9454 3 10 for for ADP ct-9454 3 11 fetal fetal ADJ ct-9454 3 12 somatic somatic ADJ ct-9454 3 13 tissue tissue NOUN ct-9454 3 14 and and CCONJ ct-9454 3 15 primitive primitive ADJ ct-9454 3 16 granulosa granulosa NOUN ct-9454 3 17 cells cell NOUN ct-9454 3 18 to to PART ct-9454 3 19 serve serve VERB ct-9454 3 20 as as ADP ct-9454 3 21 a a DET ct-9454 3 22 niche niche NOUN ct-9454 3 23 for for ADP ct-9454 3 24 the the DET ct-9454 3 25 growth growth NOUN ct-9454 3 26 and and CCONJ ct-9454 3 27 maturation maturation NOUN ct-9454 3 28 of of ADP ct-9454 3 29 oocytes oocyte NOUN ct-9454 3 30 generated generate VERB ct-9454 3 31 from from ADP ct-9454 3 32 pscs psc NOUN ct-9454 3 33 . . PUNCT ct-9454 4 1 in in ADP ct-9454 4 2 practice practice NOUN ct-9454 4 3 , , PUNCT ct-9454 4 4 the the DET ct-9454 4 5 need need NOUN ct-9454 4 6 for for ADP ct-9454 4 7 such such ADJ ct-9454 4 8 tissue tissue NOUN ct-9454 4 9 represents represent VERB ct-9454 4 10 a a DET ct-9454 4 11 major major ADJ ct-9454 4 12 limitation limitation NOUN ct-9454 4 13 when when SCONJ ct-9454 4 14 attempting attempt VERB ct-9454 4 15 to to PART ct-9454 4 16 apply apply VERB ct-9454 4 17 this this PRON ct-9454 4 18 to to ADP ct-9454 4 19 species specie NOUN ct-9454 4 20 in in ADP ct-9454 4 21 which which PRON ct-9454 4 22 access access NOUN ct-9454 4 23 to to ADP ct-9454 4 24 fetal fetal ADJ ct-9454 4 25 ovaries ovary NOUN ct-9454 4 26 is be AUX ct-9454 4 27 limited limited ADJ ct-9454 4 28 or or CCONJ ct-9454 4 29 unethical unethical ADJ ct-9454 4 30 . . PUNCT ct-9454 5 1 to to PART ct-9454 5 2 circumvent circumvent VERB ct-9454 5 3 this this PRON ct-9454 5 4 , , PUNCT ct-9454 5 5 we we PRON ct-9454 5 6 and and CCONJ ct-9454 5 7 others other NOUN ct-9454 5 8 have have VERB ct-9454 5 9 derived derive VERB ct-9454 5 10 methods method NOUN ct-9454 5 11 to to PART ct-9454 5 12 generate generate VERB ct-9454 5 13 ovarian ovarian ADJ ct-9454 5 14 granulosa granulosa NOUN ct-9454 5 15 cells cell NOUN ct-9454 5 16 from from ADP ct-9454 5 17 pscs psc NOUN ct-9454 5 18 , , PUNCT ct-9454 5 19 albeit albeit SCONJ ct-9454 5 20 with with ADP ct-9454 5 21 low low ADJ ct-9454 5 22 yield yield NOUN ct-9454 5 23 . . PUNCT ct-9454 6 1 herein herein NOUN ct-9454 6 2 we we PRON ct-9454 6 3 present present VERB ct-9454 6 4 an an DET ct-9454 6 5 update update NOUN ct-9454 6 6 on on ADP ct-9454 6 7 the the DET ct-9454 6 8 status status NOUN ct-9454 6 9 of of ADP ct-9454 6 10 generating generate VERB ct-9454 6 11 early early ADJ ct-9454 6 12 stage stage NOUN ct-9454 6 13 granulosa granulosa NOUN ct-9454 6 14 cells cell NOUN ct-9454 6 15 from from ADP ct-9454 6 16 pscs psc NOUN ct-9454 6 17 , , PUNCT ct-9454 6 18 and and CCONJ ct-9454 6 19 provide provide VERB ct-9454 6 20 evidence evidence NOUN ct-9454 6 21 for for ADP ct-9454 6 22 improvements improvement NOUN ct-9454 6 23 based base VERB ct-9454 6 24 on on ADP ct-9454 6 25 a a DET ct-9454 6 26 stepwise stepwise NOUN ct-9454 6 27 , , PUNCT ct-9454 6 28 2 2 NUM ct-9454 6 29 - - PUNCT ct-9454 6 30 dimensional dimensional ADJ ct-9454 6 31 protocol protocol NOUN ct-9454 6 32 for for ADP ct-9454 6 33 the the DET ct-9454 6 34 directed direct VERB ct-9454 6 35 differentiation differentiation NOUN ct-9454 6 36 of of ADP ct-9454 6 37 human human ADJ ct-9454 6 38 pscs psc NOUN ct-9454 6 39 . . PUNCT ct-9454 7 1 keywords keyword NOUN ct-9454 7 2 : : PUNCT ct-9454 7 3 granulosa granulosa NOUN ct-9454 7 4 cell cell NOUN ct-9454 7 5 , , PUNCT ct-9454 7 6 ovarian ovarian ADJ ct-9454 7 7 soma soma NOUN ct-9454 7 8 , , PUNCT ct-9454 7 9 granulosa granulosa NOUN ct-9454 7 10 precursor precursor NOUN ct-9454 7 11 cell cell NOUN ct-9454 7 12 , , PUNCT ct-9454 7 13 pluripotent pluripotent ADJ ct-9454 7 14 stem stem NOUN ct-9454 7 15 cell cell NOUN ct-9454 7 16 introduction introduction NOUN ct-9454 7 17 the the DET ct-9454 7 18 premise premise NOUN ct-9454 7 19 that that SCONJ ct-9454 7 20 oocytes oocyte NOUN ct-9454 7 21 , , PUNCT ct-9454 7 22 and and CCONJ ct-9454 7 23 potentially potentially ADV ct-9454 7 24 eggs egg NOUN ct-9454 7 25 , , PUNCT ct-9454 7 26 could could AUX ct-9454 7 27 be be AUX ct-9454 7 28 generated generate VERB ct-9454 7 29 from from ADP ct-9454 7 30 pluripotent pluripotent ADJ ct-9454 7 31 stem stem NOUN ct-9454 7 32 cells cell NOUN ct-9454 7 33 ( ( PUNCT ct-9454 7 34 pscs psc NOUN ct-9454 7 35 ) ) PUNCT ct-9454 7 36 was be AUX ct-9454 7 37 first first ADV ct-9454 7 38 established establish VERB ct-9454 7 39 in in ADP ct-9454 7 40 2003,1 2003,1 NUM ct-9454 7 41 with with ADP ct-9454 7 42 the the DET ct-9454 7 43 initial initial ADJ ct-9454 7 44 characterization characterization NOUN ct-9454 7 45 of of ADP ct-9454 7 46 oocyte oocyte ADJ ct-9454 7 47 - - PUNCT ct-9454 7 48 like like ADJ ct-9454 7 49 cells cell NOUN ct-9454 7 50 that that PRON ct-9454 7 51 formed form VERB ct-9454 7 52 within within ADP ct-9454 7 53 primitive primitive ADJ ct-9454 7 54 follicle follicle NOUN ct-9454 7 55 - - PUNCT ct-9454 7 56 like like ADJ ct-9454 7 57 structures structure NOUN ct-9454 7 58 . . PUNCT ct-9454 8 1 subsequent subsequent ADJ ct-9454 8 2 attempts attempt NOUN ct-9454 8 3 at at ADP ct-9454 8 4 the the DET ct-9454 8 5 maturation maturation NOUN ct-9454 8 6 and and CCONJ ct-9454 8 7 utilization utilization NOUN ct-9454 8 8 of of ADP ct-9454 8 9 psc psc NOUN ct-9454 8 10 - - PUNCT ct-9454 8 11 derived derive VERB ct-9454 8 12 oocytes oocyte NOUN ct-9454 8 13 were be AUX ct-9454 8 14 largely largely ADV ct-9454 8 15 incremental,2 incremental,2 NOUN ct-9454 9 1 and and CCONJ ct-9454 9 2 it it PRON ct-9454 9 3 was be AUX ct-9454 9 4 not not PART ct-9454 9 5 until until ADP ct-9454 9 6 2012 2012 NUM ct-9454 9 7 that that SCONJ ct-9454 9 8 functional functional ADJ ct-9454 9 9 oocytes oocyte NOUN ct-9454 9 10 capable capable ADJ ct-9454 9 11 of of ADP ct-9454 9 12 maturation maturation NOUN ct-9454 9 13 , , PUNCT ct-9454 9 14 fertilization fertilization NOUN ct-9454 9 15 , , PUNCT ct-9454 9 16 and and CCONJ ct-9454 9 17 the the DET ct-9454 9 18 ability ability NOUN ct-9454 9 19 to to PART ct-9454 9 20 give give VERB ct-9454 9 21 rise rise NOUN ct-9454 9 22 to to ADP ct-9454 9 23 live live ADJ ct-9454 9 24 offspring offspring NOUN ct-9454 9 25 were be AUX ct-9454 9 26 realized.3 realized.3 NOUN ct-9454 9 27 notably notably ADV ct-9454 9 28 , , PUNCT ct-9454 9 29 the the DET ct-9454 9 30 protocol protocol NOUN ct-9454 9 31 that that PRON ct-9454 9 32 was be AUX ct-9454 9 33 used use VERB ct-9454 9 34 to to PART ct-9454 9 35 accomplish accomplish VERB ct-9454 9 36 this this DET ct-9454 9 37 feat feat NOUN ct-9454 9 38 , , PUNCT ct-9454 9 39 as as ADV ct-9454 9 40 well well ADV ct-9454 9 41 as as ADP ct-9454 9 42 a a DET ct-9454 9 43 subsequent subsequent ADJ ct-9454 9 44 report report NOUN ct-9454 9 45 by by ADP ct-9454 9 46 the the DET ct-9454 9 47 same same ADJ ct-9454 9 48 group group NOUN ct-9454 9 49 , , PUNCT ct-9454 9 50 relied rely VERB ct-9454 9 51 on on ADP ct-9454 9 52 the the DET ct-9454 9 53 innate innate ADJ ct-9454 9 54 ability ability NOUN ct-9454 9 55 of of ADP ct-9454 9 56 psc psc NOUN ct-9454 9 57 - - PUNCT ct-9454 9 58 derived derive VERB ct-9454 9 59 primordial primordial ADJ ct-9454 9 60 germ germ NOUN ct-9454 9 61 cell cell NOUN ct-9454 9 62 - - PUNCT ct-9454 9 63 like like ADJ ct-9454 9 64 cells cell NOUN ct-9454 9 65 ( ( PUNCT ct-9454 9 66 pgclcs pgclcs NOUN ct-9454 9 67 ) ) PUNCT ct-9454 9 68 to to PART ct-9454 9 69 interact interact VERB ct-9454 9 70 with with ADP ct-9454 9 71 endogenous endogenous ADJ ct-9454 9 72 fetal fetal ADJ ct-9454 9 73 ovarian ovarian ADJ ct-9454 9 74 tissue tissue NOUN ct-9454 9 75 , , PUNCT ct-9454 9 76 providing provide VERB ct-9454 9 77 the the DET ct-9454 9 78 microenvironment microenvironment NOUN ct-9454 9 79 and and CCONJ ct-9454 9 80 granulosa granulosa NOUN ct-9454 9 81 cells cell NOUN ct-9454 9 82 that that PRON ct-9454 9 83 enabled enable VERB ct-9454 9 84 follicle follicle NOUN ct-9454 9 85 growth growth NOUN ct-9454 9 86 and and CCONJ ct-9454 9 87 maturation maturation NOUN ct-9454 9 88 , , PUNCT ct-9454 9 89 and and CCONJ ct-9454 9 90 with with ADP ct-9454 9 91 it it PRON ct-9454 9 92 oocyte oocyte ADJ ct-9454 9 93 development.3 development.3 PROPN ct-9454 9 94 - - SYM ct-9454 9 95 5 5 NUM ct-9454 9 96 an an DET ct-9454 9 97 additional additional ADJ ct-9454 9 98 recent recent ADJ ct-9454 9 99 report report NOUN ct-9454 9 100 in in ADP ct-9454 9 101 which which PRON ct-9454 9 102 functional functional ADJ ct-9454 9 103 eggs egg NOUN ct-9454 9 104 were be AUX ct-9454 9 105 generated generate VERB ct-9454 9 106 from from ADP ct-9454 9 107 induced induced ADJ ct-9454 9 108 pscs psc NOUN ct-9454 9 109 ( ( PUNCT ct-9454 9 110 ipscs ipscs NOUN ct-9454 9 111 ) ) PUNCT ct-9454 9 112 derived derive VERB ct-9454 9 113 from from ADP ct-9454 9 114 granulosa granulosa NOUN ct-9454 9 115 cells cell NOUN ct-9454 9 116 similarly similarly ADV ct-9454 9 117 used use VERB ct-9454 9 118 fetal fetal ADJ ct-9454 9 119 ovarian ovarian ADJ ct-9454 9 120 tissue.6 tissue.6 PROPN ct-9454 9 121 together together ADV ct-9454 9 122 , , PUNCT ct-9454 9 123 these these DET ct-9454 9 124 reports report NOUN ct-9454 9 125 highlighted highlight VERB ct-9454 9 126 the the DET ct-9454 9 127 notion notion NOUN ct-9454 9 128 that that SCONJ ct-9454 9 129 the the DET ct-9454 9 130 fetal fetal ADJ ct-9454 9 131 ovarian ovarian ADJ ct-9454 9 132 somatic somatic ADJ ct-9454 9 133 microenvironment microenvironment NOUN ct-9454 9 134 is be AUX ct-9454 9 135 not not PART ct-9454 9 136 only only ADV ct-9454 9 137 nurturing nurture VERB ct-9454 9 138 , , PUNCT ct-9454 9 139 but but CCONJ ct-9454 9 140 likely likely ADV ct-9454 9 141 requisite requisite NOUN ct-9454 9 142 for for ADP ct-9454 9 143 the the DET ct-9454 9 144 development development NOUN ct-9454 9 145 of of ADP ct-9454 9 146 functional functional ADJ ct-9454 9 147 eggs egg NOUN ct-9454 9 148 from from ADP ct-9454 9 149 psc psc PROPN ct-9454 9 150 sources source NOUN ct-9454 9 151 . . PUNCT ct-9454 10 1 albeit albeit SCONJ ct-9454 10 2 exciting exciting ADJ ct-9454 10 3 and and CCONJ ct-9454 10 4 groundbreaking groundbreake VERB ct-9454 10 5 for for ADP ct-9454 10 6 the the DET ct-9454 10 7 fields field NOUN ct-9454 10 8 of of ADP ct-9454 10 9 stem stem NOUN ct-9454 10 10 cell cell NOUN ct-9454 10 11 and and CCONJ ct-9454 10 12 reproductive reproductive ADJ ct-9454 10 13 biology biology NOUN ct-9454 10 14 , , PUNCT ct-9454 10 15 adaptation adaptation NOUN ct-9454 10 16 of of ADP ct-9454 10 17 this this DET ct-9454 10 18 technology technology NOUN ct-9454 10 19 to to ADP ct-9454 10 20 species specie NOUN ct-9454 10 21 outside outside ADP ct-9454 10 22 of of ADP ct-9454 10 23 the the DET ct-9454 10 24 easily easily ADV ct-9454 10 25 obtained obtain VERB ct-9454 10 26 and and CCONJ ct-9454 10 27 manipulated manipulate VERB ct-9454 10 28 laboratory laboratory NOUN ct-9454 10 29 mouse mouse NOUN ct-9454 10 30 must must AUX ct-9454 10 31 overcome overcome VERB ct-9454 10 32 the the DET ct-9454 10 33 reliance reliance NOUN ct-9454 10 34 on on ADP ct-9454 10 35 fetal fetal ADJ ct-9454 10 36 tissue tissue NOUN ct-9454 10 37 . . PUNCT ct-9454 11 1 this this PRON ct-9454 11 2 is be AUX ct-9454 11 3 particularly particularly ADV ct-9454 11 4 relevant relevant ADJ ct-9454 11 5 in in ADP ct-9454 11 6 instances instance NOUN ct-9454 11 7 where where SCONJ ct-9454 11 8 obtaining obtain VERB ct-9454 11 9 fetal fetal ADJ ct-9454 11 10 tissue tissue NOUN ct-9454 11 11 is be AUX ct-9454 11 12 unethical unethical ADJ ct-9454 11 13 , , PUNCT ct-9454 11 14 which which PRON ct-9454 11 15 pertains pertain VERB ct-9454 11 16 to to ADP ct-9454 11 17 humans human NOUN ct-9454 11 18 , , PUNCT ct-9454 11 19 or or CCONJ ct-9454 11 20 unpractical unpractical ADJ ct-9454 11 21 , , PUNCT ct-9454 11 22 as as SCONJ ct-9454 11 23 is be AUX ct-9454 11 24 the the DET ct-9454 11 25 case case NOUN ct-9454 11 26 for for ADP ct-9454 11 27 endangered endangered ADJ ct-9454 11 28 species specie NOUN ct-9454 11 29 . . PUNCT ct-9454 12 1 therefore therefore ADV ct-9454 12 2 , , PUNCT ct-9454 12 3 to to PART ct-9454 12 4 circumvent circumvent VERB ct-9454 12 5 this this DET ct-9454 12 6 limitation limitation NOUN ct-9454 12 7 , , PUNCT ct-9454 12 8 an an DET ct-9454 12 9 alternative alternative ADJ ct-9454 12 10 source source NOUN ct-9454 12 11 of of ADP ct-9454 12 12 ovarian ovarian ADJ ct-9454 12 13 granulosa granulosa NOUN ct-9454 12 14 cells cell NOUN ct-9454 12 15 or or CCONJ ct-9454 12 16 their their PRON ct-9454 12 17 precursors precursor NOUN ct-9454 12 18 that that PRON ct-9454 12 19 can can AUX ct-9454 12 20 be be AUX ct-9454 12 21 utilized utilize VERB ct-9454 12 22 in in ADP ct-9454 12 23 conjunction conjunction NOUN ct-9454 12 24 with with ADP ct-9454 12 25 psc psc ADJ ct-9454 12 26 - - PUNCT ct-9454 12 27 derived derive VERB ct-9454 12 28 female female ADJ ct-9454 12 29 gametes gamete NOUN ct-9454 12 30 should should AUX ct-9454 12 31 be be AUX ct-9454 12 32 identified identify VERB ct-9454 12 33 . . PUNCT ct-9454 13 1 although although SCONJ ct-9454 13 2 much much ADJ ct-9454 13 3 research research NOUN ct-9454 13 4 effort effort NOUN ct-9454 13 5 has have AUX ct-9454 13 6 understandably understandably ADV ct-9454 13 7 centered center VERB ct-9454 13 8 on on ADP ct-9454 13 9 the the DET ct-9454 13 10 female female ADJ ct-9454 13 11 germline germline NOUN ct-9454 13 12 , , PUNCT ct-9454 13 13 efforts effort NOUN ct-9454 13 14 to to PART ct-9454 13 15 progress progress VERB ct-9454 13 16 the the DET ct-9454 13 17 derivation derivation NOUN ct-9454 13 18 of of ADP ct-9454 13 19 ovarian ovarian ADJ ct-9454 13 20 somatic somatic ADJ ct-9454 13 21 cells cell NOUN ct-9454 13 22 from from ADP ct-9454 13 23 pscs psc NOUN ct-9454 13 24 have have AUX ct-9454 13 25 not not PART ct-9454 13 26 been be AUX ct-9454 13 27 entirely entirely ADV ct-9454 13 28 lacking lacking ADJ ct-9454 13 29 . . PUNCT ct-9454 14 1 soon soon ADV ct-9454 14 2 after after ADP ct-9454 14 3 the the DET ct-9454 14 4 discovery discovery NOUN ct-9454 14 5 of of ADP ct-9454 14 6 embryonic embryonic ADJ ct-9454 14 7 stem stem NOUN ct-9454 14 8 cells cell NOUN ct-9454 14 9 , , PUNCT ct-9454 14 10 it it PRON ct-9454 14 11 was be AUX ct-9454 14 12 possible possible ADJ ct-9454 14 13 to to ADP ct-9454 14 14 direct direct VERB ct-9454 14 15 embryonic embryonic ADJ ct-9454 14 16 stem stem NOUN ct-9454 14 17 cells cell NOUN ct-9454 14 18 into into ADP ct-9454 14 19 a a DET ct-9454 14 20 steroidogenic steroidogenic ADJ ct-9454 14 21 lineage lineage NOUN ct-9454 14 22 by by ADP ct-9454 14 23 inducing induce VERB ct-9454 14 24 expression expression NOUN ct-9454 14 25 of of ADP ct-9454 14 26 nuclear nuclear ADJ ct-9454 14 27 receptor receptor NOUN ct-9454 14 28 steroidogenic steroidogenic ADJ ct-9454 14 29 factor factor NOUN ct-9454 14 30 1 1 NUM ct-9454 14 31 ( ( PUNCT ct-9454 14 32 sf-1),7 sf-1),7 ADP ct-9454 14 33 a a DET ct-9454 14 34 protein protein NOUN ct-9454 14 35 involved involve VERB ct-9454 14 36 in in ADP ct-9454 14 37 endocrine endocrine NOUN ct-9454 14 38 development development NOUN ct-9454 14 39 and and CCONJ ct-9454 14 40 steroidogenesis steroidogenesis NOUN ct-9454 14 41 . . PUNCT ct-9454 15 1 the the DET ct-9454 15 2 steroidogenic steroidogenic ADJ ct-9454 15 3 cells cell NOUN ct-9454 15 4 produced produce VERB ct-9454 15 5 only only ADV ct-9454 15 6 generated generate VERB ct-9454 15 7 minimal minimal ADJ ct-9454 15 8 amounts amount NOUN ct-9454 15 9 of of ADP ct-9454 15 10 progesterone progesterone NOUN ct-9454 15 11 , , PUNCT ct-9454 15 12 and and CCONJ ct-9454 15 13 were be AUX ct-9454 15 14 unresponsive unresponsive ADJ ct-9454 15 15 to to ADP ct-9454 15 16 human human ADJ ct-9454 15 17 chorionic chorionic ADJ ct-9454 15 18 gonadotropin gonadotropin NOUN ct-9454 15 19 ; ; PUNCT ct-9454 15 20 however however ADV ct-9454 15 21 , , PUNCT ct-9454 15 22 this this DET ct-9454 15 23 work work NOUN ct-9454 15 24 opened open VERB ct-9454 15 25 the the DET ct-9454 15 26 door door NOUN ct-9454 15 27 to to ADP ct-9454 15 28 the the DET ct-9454 15 29 possibility possibility NOUN ct-9454 15 30 of of ADP ct-9454 15 31 generating generate VERB ct-9454 15 32 steroidogenic steroidogenic ADJ ct-9454 15 33 cells cell NOUN ct-9454 15 34 from from ADP ct-9454 15 35 pluripotent pluripotent ADJ ct-9454 15 36 sources source NOUN ct-9454 15 37 . . PUNCT ct-9454 16 1 later later ADV ct-9454 16 2 , , PUNCT ct-9454 16 3 other other ADJ ct-9454 16 4 groups group NOUN ct-9454 16 5 verified verify VERB ct-9454 16 6 the the DET ct-9454 16 7 production production NOUN ct-9454 16 8 of of ADP ct-9454 16 9 steroidogenic steroidogenic ADJ ct-9454 16 10 cells cell NOUN ct-9454 16 11 by by ADP ct-9454 16 12 retrovirus retrovirus NOUN ct-9454 16 13 - - PUNCT ct-9454 16 14 mediated mediate VERB ct-9454 16 15 transfection transfection NOUN ct-9454 16 16 to to PART ct-9454 16 17 transduce transduce VERB ct-9454 16 18 human human ADJ ct-9454 16 19 mesenchymal mesenchymal NOUN ct-9454 16 20 stem stem NOUN ct-9454 16 21 cells cell NOUN ct-9454 16 22 with with ADP ct-9454 16 23 sf-1 sf-1 NUM ct-9454 16 24 , , PUNCT ct-9454 16 25 resulting result VERB ct-9454 16 26 in in ADP ct-9454 16 27 cells cell NOUN ct-9454 16 28 expressing express VERB ct-9454 16 29 various various ADJ ct-9454 16 30 steroidogenic steroidogenic ADJ ct-9454 16 31 genes gene NOUN ct-9454 16 32 and and CCONJ ct-9454 16 33 producing produce VERB ct-9454 16 34 progesterone progesterone NOUN ct-9454 16 35 . . PUNCT ct-9454 17 1 additionally additionally ADV ct-9454 17 2 , , PUNCT ct-9454 17 3 mouse mouse NOUN ct-9454 17 4 embryonic embryonic ADJ ct-9454 17 5 stem stem NOUN ct-9454 17 6 cells cell NOUN ct-9454 17 7 with with ADP ct-9454 17 8 inducible inducible ADJ ct-9454 17 9 sf-1 sf-1 ADP ct-9454 17 10 also also ADV ct-9454 17 11 generated generate VERB ct-9454 17 12 steroidogenic steroidogenic ADJ ct-9454 17 13 cells cell NOUN ct-9454 17 14 resembling resemble VERB ct-9454 17 15 adrenocortical adrenocortical ADJ ct-9454 17 16 cells.8,9 cells.8,9 PROPN ct-9454 17 17 in in ADP ct-9454 17 18 a a DET ct-9454 17 19 study study NOUN ct-9454 17 20 investigating investigate VERB ct-9454 17 21 epigenetic epigenetic ADJ ct-9454 17 22 memory memory NOUN ct-9454 17 23 , , PUNCT ct-9454 17 24 induced induce VERB ct-9454 17 25 pluripotent pluripotent ADJ ct-9454 17 26 stem stem NOUN ct-9454 17 27 cells cell NOUN ct-9454 17 28 ( ( PUNCT ct-9454 17 29 ipscs ipsc NOUN ct-9454 17 30 ) ) PUNCT ct-9454 17 31 were be AUX ct-9454 17 32 generated generate VERB ct-9454 17 33 from from ADP ct-9454 17 34 mouse mouse PROPN ct-9454 17 35 and and CCONJ ct-9454 17 36 human human ADJ ct-9454 17 37 granulosa granulosa NOUN ct-9454 17 38 cells cell NOUN ct-9454 17 39 , , PUNCT ct-9454 17 40 and and CCONJ ct-9454 17 41 were be AUX ct-9454 17 42 then then ADV ct-9454 17 43 clinical clinical ADJ ct-9454 17 44 theriogenology theriogenology NOUN ct-9454 18 1 • • NOUN ct-9454 18 2 volume volume NOUN ct-9454 18 3 12 12 NUM ct-9454 18 4 number number NOUN ct-9454 18 5 4 4 NUM ct-9454 18 6 • • NOUN ct-9454 18 7 december december PROPN ct-9454 18 8 2020529 2020529 NUM ct-9454 18 9                     SPACE ct-9454 18 10 subjected subject VERB ct-9454 18 11 to to ADP ct-9454 18 12 undirected undirected ADJ ct-9454 18 13 differentiation differentiation NOUN ct-9454 18 14 ; ; PUNCT ct-9454 18 15 these these DET ct-9454 18 16 experiments experiment NOUN ct-9454 18 17 yielded yield VERB ct-9454 18 18 cells cell NOUN ct-9454 18 19 capable capable ADJ ct-9454 18 20 of of ADP ct-9454 18 21 producing produce VERB ct-9454 18 22 more more ADJ ct-9454 18 23 estrogen estrogen NOUN ct-9454 18 24 and and CCONJ ct-9454 18 25 progesterone progesterone NOUN ct-9454 18 26 than than ADP ct-9454 18 27 true true ADJ ct-9454 18 28 embryonic embryonic ADJ ct-9454 18 29 stem stem NOUN ct-9454 18 30 cells cell NOUN ct-9454 18 31 or or CCONJ ct-9454 18 32 from from ADP ct-9454 18 33 fibroblast fibroblast ADJ ct-9454 18 34 - - PUNCT ct-9454 18 35 derived derive VERB ct-9454 18 36 ipscs.10 ipscs.10 NOUN ct-9454 18 37 this this DET ct-9454 18 38 work work NOUN ct-9454 18 39 highlighted highlight VERB ct-9454 18 40 the the DET ct-9454 18 41 many many ADJ ct-9454 18 42 uses use NOUN ct-9454 18 43 of of ADP ct-9454 18 44 pluripotent pluripotent ADJ ct-9454 18 45 stem stem NOUN ct-9454 18 46 cells cell NOUN ct-9454 18 47 and and CCONJ ct-9454 18 48 could could AUX ct-9454 18 49 have have VERB ct-9454 18 50 useful useful ADJ ct-9454 18 51 implications implication NOUN ct-9454 18 52 in in ADP ct-9454 18 53 characterizing characterize VERB ct-9454 18 54 the the DET ct-9454 18 55 differentiation differentiation NOUN ct-9454 18 56 stages stage NOUN ct-9454 18 57 required require VERB ct-9454 18 58 to to PART ct-9454 18 59 obtain obtain VERB ct-9454 18 60 high high ADJ ct-9454 18 61 efficiency efficiency NOUN ct-9454 18 62 for for ADP ct-9454 18 63 the the DET ct-9454 18 64 differentiation differentiation NOUN ct-9454 18 65 of of ADP ct-9454 18 66 steroidogenic steroidogenic ADJ ct-9454 18 67 cells cell NOUN ct-9454 18 68 . . PUNCT ct-9454 19 1 generating generate VERB ct-9454 19 2 large large ADJ ct-9454 19 3 numbers number NOUN ct-9454 19 4 of of ADP ct-9454 19 5 granulosa granulosa NOUN ct-9454 19 6 cells cell NOUN ct-9454 19 7 by by ADP ct-9454 19 8 this this DET ct-9454 19 9 method method NOUN ct-9454 19 10 that that PRON ct-9454 19 11 are be AUX ct-9454 19 12 capable capable ADJ ct-9454 19 13 of of ADP ct-9454 19 14 hormone hormone NOUN ct-9454 19 15 synthesis synthesis NOUN ct-9454 19 16 would would AUX ct-9454 19 17 require require VERB ct-9454 19 18 healthy healthy ADJ ct-9454 19 19 granulosa granulosa NOUN ct-9454 19 20 cells cell NOUN ct-9454 19 21 to to PART ct-9454 19 22 generate generate VERB ct-9454 19 23 ipscs ipsc NOUN ct-9454 19 24 , , PUNCT ct-9454 19 25 a a DET ct-9454 19 26 lengthy lengthy ADJ ct-9454 19 27 and and CCONJ ct-9454 19 28 costly costly ADJ ct-9454 19 29 endeavor endeavor NOUN ct-9454 19 30 to to PART ct-9454 19 31 complete complete VERB ct-9454 19 32 on on ADP ct-9454 19 33 a a DET ct-9454 19 34 per per ADJ ct-9454 19 35 person person NOUN ct-9454 19 36 basis basis NOUN ct-9454 19 37 . . PUNCT ct-9454 20 1 furthermore furthermore ADV ct-9454 20 2 , , PUNCT ct-9454 20 3 those those DET ct-9454 20 4 methods method NOUN ct-9454 20 5 would would AUX ct-9454 20 6 be be AUX ct-9454 20 7 impossible impossible ADJ ct-9454 20 8 when when SCONJ ct-9454 20 9 functional functional ADJ ct-9454 20 10 granulosa granulosa NOUN ct-9454 20 11 cells cell NOUN ct-9454 20 12 are be AUX ct-9454 20 13 absent absent ADJ ct-9454 20 14 or or CCONJ ct-9454 20 15 not not PART ct-9454 20 16 obtainable obtainable ADJ ct-9454 20 17 . . PUNCT ct-9454 21 1 the the DET ct-9454 21 2 production production NOUN ct-9454 21 3 of of ADP ct-9454 21 4 steroidogenic steroidogenic ADJ ct-9454 21 5 cells cell NOUN ct-9454 21 6 provided provide VERB ct-9454 21 7 proof proof NOUN ct-9454 21 8 of of ADP ct-9454 21 9 concept concept NOUN ct-9454 21 10 for for ADP ct-9454 21 11 the the DET ct-9454 21 12 use use NOUN ct-9454 21 13 of of ADP ct-9454 21 14 pluripotent pluripotent ADJ ct-9454 21 15 stem stem NOUN ct-9454 21 16 cells cell NOUN ct-9454 21 17 to to PART ct-9454 21 18 generate generate VERB ct-9454 21 19 gonadal gonadal ADJ ct-9454 21 20 lineages lineage NOUN ct-9454 21 21 . . PUNCT ct-9454 22 1 our our PRON ct-9454 22 2 previous previous ADJ ct-9454 22 3 studies study NOUN ct-9454 22 4 built build VERB ct-9454 22 5 upon upon SCONJ ct-9454 22 6 this this PRON ct-9454 22 7 and and CCONJ ct-9454 22 8 demonstrated demonstrate VERB ct-9454 22 9 that that SCONJ ct-9454 22 10 in in ADP ct-9454 22 11 mouse mouse NOUN ct-9454 22 12 models model NOUN ct-9454 22 13 , , PUNCT ct-9454 22 14 embryonic embryonic ADJ ct-9454 22 15 stem stem NOUN ct-9454 22 16 cells cell NOUN ct-9454 22 17 are be AUX ct-9454 22 18 capable capable ADJ ct-9454 22 19 of of ADP ct-9454 22 20 generating generate VERB ct-9454 22 21 functional functional ADJ ct-9454 22 22 granulosa granulosa NOUN ct-9454 22 23 cells.11 cells.11 NOUN ct-9454 22 24 mouse mouse NOUN ct-9454 22 25 embryonic embryonic ADJ ct-9454 22 26 stem stem NOUN ct-9454 22 27 cells cell NOUN ct-9454 22 28 ( ( PUNCT ct-9454 22 29 mescs mesc NOUN ct-9454 22 30 ) ) PUNCT ct-9454 22 31 containing contain VERB ct-9454 22 32 a a DET ct-9454 22 33 dual dual ADJ ct-9454 22 34 - - PUNCT ct-9454 22 35 fluorescence fluorescence NOUN ct-9454 22 36 reporter reporter NOUN ct-9454 22 37 for for ADP ct-9454 22 38 germ germ NOUN ct-9454 22 39 cell cell NOUN ct-9454 22 40 specific specific ADJ ct-9454 22 41 pou5f1 pou5f1 NOUN ct-9454 22 42 - - PUNCT ct-9454 22 43 driven drive VERB ct-9454 22 44 gfp gfp PROPN ct-9454 22 45 reporter reporter NOUN ct-9454 22 46 and and CCONJ ct-9454 22 47 forkhead forkhead VERB ct-9454 22 48 box box NOUN ct-9454 22 49 l2 l2 NOUN ct-9454 22 50 ( ( PUNCT ct-9454 22 51 foxl2)-driven foxl2)-driven ADV ct-9454 22 52 discosoma discosoma NOUN ct-9454 22 53 sp sp PROPN ct-9454 22 54 . . PROPN ct-9454 22 55 red red PROPN ct-9454 22 56 ( ( PUNCT ct-9454 22 57 dsred dsre VERB ct-9454 22 58 ) ) PUNCT ct-9454 22 59 to to PART ct-9454 22 60 label label VERB ct-9454 22 61 granulosa granulosa NOUN ct-9454 22 62 cells cell NOUN ct-9454 22 63 were be AUX ct-9454 22 64 allowed allow VERB ct-9454 22 65 to to PART ct-9454 22 66 spontaneously spontaneously ADV ct-9454 22 67 differentiate differentiate VERB ct-9454 22 68 . . PUNCT ct-9454 23 1 foxl2 foxl2 PROPN ct-9454 23 2 - - PUNCT ct-9454 23 3 dsred dsre VERB ct-9454 23 4 labeled label VERB ct-9454 23 5 cells cell NOUN ct-9454 23 6 localized localize VERB ct-9454 23 7 nearly nearly ADV ct-9454 23 8 exclusively exclusively ADV ct-9454 23 9 with with ADP ct-9454 23 10 pou5f1 pou5f1 PROPN ct-9454 23 11 - - PUNCT ct-9454 23 12 gfp gfp PROPN ct-9454 23 13 positive positive ADJ ct-9454 23 14 cells cell NOUN ct-9454 23 15 , , PUNCT ct-9454 23 16 and and CCONJ ct-9454 23 17 demonstrated demonstrate VERB ct-9454 23 18 a a DET ct-9454 23 19 progressive progressive ADJ ct-9454 23 20 differentiation differentiation NOUN ct-9454 23 21 profile profile NOUN ct-9454 23 22 , , PUNCT ct-9454 23 23 first first ADV ct-9454 23 24 expressing express VERB ct-9454 23 25 primitive primitive ADJ ct-9454 23 26 markers marker NOUN ct-9454 23 27 associated associate VERB ct-9454 23 28 with with ADP ct-9454 23 29 granulosa granulosa NOUN ct-9454 23 30 cell cell NOUN ct-9454 23 31 precursors precursor NOUN ct-9454 23 32 ( ( PUNCT ct-9454 23 33 including include VERB ct-9454 23 34 foxl2 foxl2 NOUN ct-9454 23 35 ; ; PUNCT ct-9454 23 36 wingless wingless NOUN ct-9454 23 37 - - PUNCT ct-9454 23 38 type type NOUN ct-9454 23 39 mmtv mmtv NOUN ct-9454 23 40 integration integration NOUN ct-9454 23 41 site site NOUN ct-9454 23 42 family family NOUN ct-9454 23 43 , , PUNCT ct-9454 23 44 member member NOUN ct-9454 23 45 4 4 NUM ct-9454 23 46 , , PUNCT ct-9454 23 47 wnt4 wnt4 PROPN ct-9454 23 48 ; ; PUNCT ct-9454 23 49 follistatin follistatin NOUN ct-9454 23 50 , , PUNCT ct-9454 23 51 fst fst NOUN ct-9454 23 52 ; ; PUNCT ct-9454 23 53 and and CCONJ ct-9454 23 54 kit kit NOUN ct-9454 23 55 ligand ligand NOUN ct-9454 23 56 kitl kitl PROPN ct-9454 23 57 ) ) PUNCT ct-9454 23 58 , , PUNCT ct-9454 23 59 followed follow VERB ct-9454 23 60 by by ADP ct-9454 23 61 the the DET ct-9454 23 62 acquisition acquisition NOUN ct-9454 23 63 of of ADP ct-9454 23 64 later later ADJ ct-9454 23 65 granulosa granulosa PROPN ct-9454 23 66 cell cell NOUN ct-9454 23 67 makers maker NOUN ct-9454 23 68 , , PUNCT ct-9454 23 69 such such ADJ ct-9454 23 70 as as ADP ct-9454 23 71 follicle follicle NOUN ct-9454 23 72 stimulating stimulate VERB ct-9454 23 73 hormone hormone NOUN ct-9454 23 74 receptor receptor NOUN ct-9454 23 75 ( ( PUNCT ct-9454 23 76 fshr fshr NOUN ct-9454 23 77 ) ) PUNCT ct-9454 23 78 , , PUNCT ct-9454 23 79 cyp19a1 cyp19a1 ADJ ct-9454 23 80 , , PUNCT ct-9454 23 81 and and CCONJ ct-9454 23 82 steroid steroid NOUN ct-9454 23 83 acute acute ADJ ct-9454 23 84 regulatory regulatory ADJ ct-9454 23 85 protein protein NOUN ct-9454 23 86 ( ( PUNCT ct-9454 23 87 star star NOUN ct-9454 23 88 ) ) PUNCT ct-9454 23 89 and and CCONJ ct-9454 23 90 were be AUX ct-9454 23 91 capable capable ADJ ct-9454 23 92 of of ADP ct-9454 23 93 producing produce VERB ct-9454 23 94 progesterone progesterone NOUN ct-9454 23 95 and and CCONJ ct-9454 23 96 estradiol estradiol PROPN ct-9454 23 97 in in ADP ct-9454 23 98 vitro vitro X ct-9454 23 99 . . PUNCT ct-9454 24 1 when when SCONJ ct-9454 24 2 the the DET ct-9454 24 3 mesc mesc NOUN ct-9454 24 4 derived derive VERB ct-9454 24 5 foxl2 foxl2 PROPN ct-9454 24 6 - - PUNCT ct-9454 24 7 dsred dsre VERB ct-9454 24 8 positive positive ADJ ct-9454 24 9 cells cell NOUN ct-9454 24 10 were be AUX ct-9454 24 11 injected inject VERB ct-9454 24 12 into into ADP ct-9454 24 13 neonatal neonatal ADJ ct-9454 24 14 mouse mouse NOUN ct-9454 24 15 ovaries ovary NOUN ct-9454 24 16 , , PUNCT ct-9454 24 17 follicles follicle NOUN ct-9454 24 18 were be AUX ct-9454 24 19 generated generate VERB ct-9454 24 20 incorporating incorporate VERB ct-9454 24 21 the the DET ct-9454 24 22 labeled label VERB ct-9454 24 23 cells cell NOUN ct-9454 24 24 . . PUNCT ct-9454 25 1 this this DET ct-9454 25 2 study study NOUN ct-9454 25 3 not not PART ct-9454 25 4 only only ADV ct-9454 25 5 showed show VERB ct-9454 25 6 that that SCONJ ct-9454 25 7 mescs mesc NOUN ct-9454 25 8 are be AUX ct-9454 25 9 capable capable ADJ ct-9454 25 10 of of ADP ct-9454 25 11 generating generate VERB ct-9454 25 12 steroidogenic steroidogenic ADJ ct-9454 25 13 cells cell NOUN ct-9454 25 14 , , PUNCT ct-9454 25 15 but but CCONJ ct-9454 25 16 that that SCONJ ct-9454 25 17 given give VERB ct-9454 25 18 the the DET ct-9454 25 19 appropriate appropriate ADJ ct-9454 25 20 cues cue NOUN ct-9454 25 21 and and CCONJ ct-9454 25 22 environment environment NOUN ct-9454 25 23 , , PUNCT ct-9454 25 24 they they PRON ct-9454 25 25 are be AUX ct-9454 25 26 capable capable ADJ ct-9454 25 27 of of ADP ct-9454 25 28 participating participate VERB ct-9454 25 29 in in ADP ct-9454 25 30 folliculogenesis folliculogenesis NOUN ct-9454 25 31 and and CCONJ ct-9454 25 32 steroidogenesis steroidogenesis NOUN ct-9454 25 33 . . PUNCT ct-9454 26 1 unfortunately unfortunately ADV ct-9454 26 2 , , PUNCT ct-9454 26 3 the the DET ct-9454 26 4 spontaneous spontaneous ADJ ct-9454 26 5 differentiation differentiation NOUN ct-9454 26 6 rate rate NOUN ct-9454 26 7 of of ADP ct-9454 26 8 mescs mesc NOUN ct-9454 26 9 into into ADP ct-9454 26 10 foxl2 foxl2 NOUN ct-9454 26 11 expressing express VERB ct-9454 26 12 cells cell NOUN ct-9454 26 13 is be AUX ct-9454 26 14 low low ADJ ct-9454 26 15 and and CCONJ ct-9454 26 16 unpredictable unpredictable ADJ ct-9454 26 17 , , PUNCT ct-9454 26 18 and and CCONJ ct-9454 26 19 more more ADV ct-9454 26 20 robust robust ADJ ct-9454 26 21 methods method NOUN ct-9454 26 22 are be AUX ct-9454 26 23 needed need VERB ct-9454 26 24 for for ADP ct-9454 26 25 eventual eventual ADJ ct-9454 26 26 utility utility NOUN ct-9454 26 27 as as ADP ct-9454 26 28 a a DET ct-9454 26 29 substitute substitute NOUN ct-9454 26 30 for for ADP ct-9454 26 31 fetal fetal ADJ ct-9454 26 32 ovarian ovarian ADJ ct-9454 26 33 tissue tissue NOUN ct-9454 26 34 . . PUNCT ct-9454 27 1 here here ADV ct-9454 27 2 , , PUNCT ct-9454 27 3 we we PRON ct-9454 27 4 propose propose VERB ct-9454 27 5 and and CCONJ ct-9454 27 6 test test VERB ct-9454 27 7 a a DET ct-9454 27 8 strategy strategy NOUN ct-9454 27 9 for for ADP ct-9454 27 10 the the DET ct-9454 27 11 directed direct VERB ct-9454 27 12 differentiation differentiation NOUN ct-9454 27 13 of of ADP ct-9454 27 14 granulosa granulosa NOUN ct-9454 27 15 cells cell NOUN ct-9454 27 16 from from ADP ct-9454 27 17 human human ADJ ct-9454 27 18 embryonic embryonic ADJ ct-9454 27 19 stem stem NOUN ct-9454 27 20 cells cell NOUN ct-9454 27 21 . . PUNCT ct-9454 28 1 by by ADP ct-9454 28 2 mimicking mimic VERB ct-9454 28 3 developmental developmental ADJ ct-9454 28 4 pathways pathway NOUN ct-9454 28 5 in in ADP ct-9454 28 6 a a DET ct-9454 28 7 stepwise stepwise NOUN ct-9454 28 8 , , PUNCT ct-9454 28 9 2 2 NUM ct-9454 28 10 - - PUNCT ct-9454 28 11 d d NOUN ct-9454 28 12 differentiation differentiation NOUN ct-9454 28 13 utilizing utilize VERB ct-9454 28 14 small small ADJ ct-9454 28 15 molecules molecule NOUN ct-9454 28 16 and and CCONJ ct-9454 28 17 ligands ligand NOUN ct-9454 28 18 to to PART ct-9454 28 19 target target VERB ct-9454 28 20 specific specific ADJ ct-9454 28 21 pathways pathway NOUN ct-9454 28 22 , , PUNCT ct-9454 28 23 we we PRON ct-9454 28 24 have have AUX ct-9454 28 25 established establish VERB ct-9454 28 26 a a DET ct-9454 28 27 framework framework NOUN ct-9454 28 28 for for ADP ct-9454 28 29 identifying identify VERB ct-9454 28 30 human human ADJ ct-9454 28 31 , , PUNCT ct-9454 28 32 granulosa granulosa NOUN ct-9454 28 33 - - PUNCT ct-9454 28 34 like like ADJ ct-9454 28 35 cells cell NOUN ct-9454 28 36 from from ADP ct-9454 28 37 a a DET ct-9454 28 38 pluripotent pluripotent ADJ ct-9454 28 39 stem stem NOUN ct-9454 28 40 cell cell NOUN ct-9454 28 41 source source NOUN ct-9454 28 42 . . PUNCT ct-9454 29 1 these these DET ct-9454 29 2 cells cell NOUN ct-9454 29 3 will will AUX ct-9454 29 4 form form VERB ct-9454 29 5 the the DET ct-9454 29 6 groundwork groundwork NOUN ct-9454 29 7 for for ADP ct-9454 29 8 establishing establish VERB ct-9454 29 9 the the DET ct-9454 29 10 hormone hormone NOUN ct-9454 29 11 producing produce VERB ct-9454 29 12 capabilities capability NOUN ct-9454 29 13 of of ADP ct-9454 29 14 stem stem NOUN ct-9454 29 15 cell cell NOUN ct-9454 29 16 derived derive VERB ct-9454 29 17 granulosa granulosa NOUN ct-9454 29 18 cells cell NOUN ct-9454 29 19 , , PUNCT ct-9454 29 20 and and CCONJ ct-9454 29 21 will will AUX ct-9454 29 22 enable enable VERB ct-9454 29 23 in in ADP ct-9454 29 24 vitro vitro X ct-9454 29 25 studies study NOUN ct-9454 29 26 for for ADP ct-9454 29 27 human human ADJ ct-9454 29 28 follicle follicle NOUN ct-9454 29 29 formation formation NOUN ct-9454 29 30 , , PUNCT ct-9454 29 31 for for ADP ct-9454 29 32 which which PRON ct-9454 29 33 there there PRON ct-9454 29 34 is be VERB ct-9454 29 35 currently currently ADV ct-9454 29 36 no no DET ct-9454 29 37 model model NOUN ct-9454 29 38 . . PUNCT ct-9454 30 1 this this DET ct-9454 30 2 strategy strategy NOUN ct-9454 30 3 might might AUX ct-9454 30 4 also also ADV ct-9454 30 5 help help VERB ct-9454 30 6 advise advise VERB ct-9454 30 7 work work NOUN ct-9454 30 8 in in ADP ct-9454 30 9 other other ADJ ct-9454 30 10 species specie NOUN ct-9454 30 11 that that PRON ct-9454 30 12 have have VERB ct-9454 30 13 similar similar ADJ ct-9454 30 14 limitations limitation NOUN ct-9454 30 15 in in ADP ct-9454 30 16 background background NOUN ct-9454 30 17 knowledge knowledge NOUN ct-9454 30 18 regarding regard VERB ct-9454 30 19 organogenesis organogenesis NOUN ct-9454 30 20 of of ADP ct-9454 30 21 the the DET ct-9454 30 22 ovary ovary NOUN ct-9454 30 23 . . PUNCT ct-9454 31 1 materials material NOUN ct-9454 31 2 and and CCONJ ct-9454 31 3 methods method NOUN ct-9454 31 4 cell cell NOUN ct-9454 31 5 culture culture NOUN ct-9454 31 6 and and CCONJ ct-9454 31 7 differentiation differentiation NOUN ct-9454 31 8 human human ADJ ct-9454 31 9 embryonic embryonic ADJ ct-9454 31 10 stem stem NOUN ct-9454 31 11 cells cell NOUN ct-9454 31 12 ( ( PUNCT ct-9454 31 13 hesc hesc NOUN ct-9454 31 14 ) ) PUNCT ct-9454 31 15 lines line NOUN ct-9454 31 16 wa09 wa09 PROPN ct-9454 31 17 ( ( PUNCT ct-9454 31 18 wicell wicell PROPN ct-9454 31 19 ) ) PUNCT ct-9454 31 20 and and CCONJ ct-9454 31 21 esi051 esi051 PROPN ct-9454 31 22 ( ( PUNCT ct-9454 31 23 esibio esibio ADV ct-9454 31 24 ) ) PUNCT ct-9454 31 25 were be AUX ct-9454 31 26 maintained maintain VERB ct-9454 31 27 in in ADP ct-9454 31 28 feeder feeder NOUN ct-9454 31 29 - - PUNCT ct-9454 31 30 free free ADJ ct-9454 31 31 culture culture NOUN ct-9454 31 32 conditions condition NOUN ct-9454 31 33 in in ADP ct-9454 31 34 essential essential ADJ ct-9454 31 35 8 8 NUM ct-9454 31 36 media medium NOUN ct-9454 31 37 ( ( PUNCT ct-9454 31 38 thermofisher thermofisher PRON ct-9454 31 39 scientific scientific PROPN ct-9454 31 40 , , PUNCT ct-9454 31 41 waltham waltham PROPN ct-9454 31 42 , , PUNCT ct-9454 31 43 ma ma PROPN ct-9454 31 44 ) ) PUNCT ct-9454 31 45 on on ADP ct-9454 31 46 tissue tissue NOUN ct-9454 31 47 culture culture NOUN ct-9454 31 48 grade grade NOUN ct-9454 31 49 plates plate NOUN ct-9454 31 50 coated coat VERB ct-9454 31 51 with with ADP ct-9454 31 52 hesc hesc NOUN ct-9454 31 53 - - PUNCT ct-9454 31 54 qualified qualified ADJ ct-9454 31 55 matrigel matrigel NOUN ct-9454 31 56 ( ( PUNCT ct-9454 31 57 corning corning NOUN ct-9454 31 58 , , PUNCT ct-9454 31 59 corning corning NOUN ct-9454 31 60 , , PUNCT ct-9454 31 61 ny ny PROPN ct-9454 31 62 ) ) PUNCT ct-9454 31 63 . . PUNCT ct-9454 32 1 cells cell NOUN ct-9454 32 2 were be AUX ct-9454 32 3 routinely routinely ADV ct-9454 32 4 passaged passage VERB ct-9454 32 5 by by ADP ct-9454 32 6 edta edta NOUN ct-9454 32 7 ( ( PUNCT ct-9454 32 8 0.5 0.5 NUM ct-9454 32 9 mm mm NOUN ct-9454 32 10 ) ) PUNCT ct-9454 32 11 dissociation dissociation NOUN ct-9454 32 12 and and CCONJ ct-9454 32 13 all all DET ct-9454 32 14 cells cell NOUN ct-9454 32 15 were be AUX ct-9454 32 16 used use VERB ct-9454 32 17 prior prior ADV ct-9454 32 18 to to ADP ct-9454 32 19 passage passage NOUN ct-9454 32 20 55 55 NUM ct-9454 32 21 . . PUNCT ct-9454 33 1 prior prior ADV ct-9454 33 2 to to ADP ct-9454 33 3 differentiation differentiation NOUN ct-9454 33 4 , , PUNCT ct-9454 33 5 cells cell NOUN ct-9454 33 6 were be AUX ct-9454 33 7 dispersed disperse VERB ct-9454 33 8 by by ADP ct-9454 33 9 brief brief ADJ ct-9454 33 10 incubation incubation NOUN ct-9454 33 11 in in ADP ct-9454 33 12 0.05 0.05 NUM ct-9454 33 13 % % NOUN ct-9454 33 14 trypsin trypsin NOUN ct-9454 33 15 - - PUNCT ct-9454 33 16 edta edta NOUN ct-9454 33 17 and and CCONJ ct-9454 33 18 were be AUX ct-9454 33 19 washed wash VERB ct-9454 33 20 prior prior ADV ct-9454 33 21 to to ADP ct-9454 33 22 plating plate VERB ct-9454 33 23 at at ADP ct-9454 33 24 45,000 45,000 NUM ct-9454 33 25 cells cell NOUN ct-9454 33 26 / / SYM ct-9454 33 27 well well ADV ct-9454 33 28 in in ADP ct-9454 33 29 12 12 NUM ct-9454 33 30 - - PUNCT ct-9454 33 31 well well NOUN ct-9454 33 32 plates plate NOUN ct-9454 33 33 in in ADP ct-9454 33 34 essential essential ADJ ct-9454 33 35 8 8 NUM ct-9454 33 36 media medium NOUN ct-9454 33 37 supplemented supplement VERB ct-9454 33 38 with with ADP ct-9454 33 39 revitacelltm revitacelltm NOUN ct-9454 33 40 supplement supplement NOUN ct-9454 33 41 ( ( PUNCT ct-9454 33 42 thermofisher thermofisher ADJ ct-9454 33 43 scientific scientific NOUN ct-9454 33 44 ) ) PUNCT ct-9454 33 45 to to PART ct-9454 33 46 aid aid VERB ct-9454 33 47 in in ADP ct-9454 33 48 single single ADJ ct-9454 33 49 cell cell NOUN ct-9454 33 50 seeding seeding NOUN ct-9454 33 51 and and CCONJ ct-9454 33 52 consistent consistent ADJ ct-9454 33 53 plating plating NOUN ct-9454 33 54 density density NOUN ct-9454 33 55 . . PUNCT ct-9454 34 1 when when SCONJ ct-9454 34 2 cells cell NOUN ct-9454 34 3 reached reach VERB ct-9454 34 4 50 50 NUM ct-9454 34 5 % % NOUN ct-9454 34 6 confluent confluent ADJ ct-9454 34 7 , , PUNCT ct-9454 34 8 differentiations differentiation NOUN ct-9454 34 9 were be AUX ct-9454 34 10 begun begin VERB ct-9454 34 11 by by ADP ct-9454 34 12 transition transition NOUN ct-9454 34 13 to to ADP ct-9454 34 14 differentiation differentiation NOUN ct-9454 34 15 media medium NOUN ct-9454 34 16 ( ( PUNCT ct-9454 34 17 dmem dmem ADJ ct-9454 34 18 / / SYM ct-9454 34 19 f12 f12 NOUN ct-9454 34 20 [ [ X ct-9454 34 21 thermofisher thermofisher ADJ ct-9454 34 22 scientific scientific NOUN ct-9454 34 23 ] ] X ct-9454 34 24 , , PUNCT ct-9454 34 25 1x 1x NUM ct-9454 34 26 nonessential nonessential ADJ ct-9454 34 27 amino amino ADJ ct-9454 34 28 acids acid NOUN ct-9454 34 29 [ [ X ct-9454 34 30 thermofisher thermofisher ADJ ct-9454 34 31 scientific scientific NOUN ct-9454 34 32 ] ] PUNCT ct-9454 34 33 , , PUNCT ct-9454 34 34 20 20 NUM ct-9454 34 35 % % NOUN ct-9454 34 36 knockout knockout NOUN ct-9454 34 37 tm tm PROPN ct-9454 34 38 serum serum NOUN ct-9454 34 39 replacement replacement NOUN ct-9454 35 1 [ [ X ct-9454 35 2 thermofisher thermofisher ADJ ct-9454 35 3 scientific scientific NOUN ct-9454 35 4 ] ] PUNCT ct-9454 35 5 , , PUNCT ct-9454 35 6 0.11 0.11 NUM ct-9454 35 7 mm mm NOUN ct-9454 35 8 beta beta NOUN ct-9454 35 9 mercaptoethanol mercaptoethanol NOUN ct-9454 35 10 ) ) PUNCT ct-9454 35 11 supplemented supplement VERB ct-9454 35 12 as as SCONJ ct-9454 35 13 described describe VERB ct-9454 35 14 with with ADP ct-9454 35 15 the the DET ct-9454 35 16 following follow VERB ct-9454 35 17 compounds compound NOUN ct-9454 35 18 : : PUNCT ct-9454 35 19 10 10 NUM ct-9454 35 20 µm µm ADP ct-9454 35 21 chir99021 chir99021 PROPN ct-9454 35 22 ( ( PUNCT ct-9454 35 23 sigma sigma PROPN ct-9454 35 24 , , PUNCT ct-9454 35 25 st st PROPN ct-9454 35 26 . . PROPN ct-9454 35 27 louis louis PROPN ct-9454 35 28 , , PUNCT ct-9454 35 29 mo mo PROPN ct-9454 35 30 ) ) PUNCT ct-9454 35 31 , , PUNCT ct-9454 35 32 1 1 NUM ct-9454 35 33 µm µm ADP ct-9454 35 34 retinoic retinoic NOUN ct-9454 35 35 acid acid PROPN ct-9454 35 36 ( ( PUNCT ct-9454 35 37 sigma sigma PROPN ct-9454 35 38 ) ) PUNCT ct-9454 35 39 , , PUNCT ct-9454 35 40 100 100 NUM ct-9454 35 41 ng ng NOUN ct-9454 35 42 / / SYM ct-9454 35 43 ml ml X ct-9454 35 44 human human ADJ ct-9454 35 45 recombinant recombinant ADJ ct-9454 35 46 bfgf bfgf NOUN ct-9454 35 47 ( ( PUNCT ct-9454 35 48 thermofisher thermofisher ADJ ct-9454 35 49 scientific scientific NOUN ct-9454 35 50 ) ) PUNCT ct-9454 35 51 , , PUNCT ct-9454 35 52 1 1 NUM ct-9454 35 53 µg µg NOUN ct-9454 35 54 / / SYM ct-9454 35 55 ml ml VERB ct-9454 35 56 jagged jagged ADJ ct-9454 35 57 1 1 NUM ct-9454 35 58 ( ( PUNCT ct-9454 35 59 stemrd stemrd X ct-9454 35 60 , , PUNCT ct-9454 35 61 burlingame burlingame PROPN ct-9454 35 62 , , PUNCT ct-9454 35 63 ca ca NOUN ct-9454 35 64 ) ) PUNCT ct-9454 35 65 , , PUNCT ct-9454 35 66 or or CCONJ ct-9454 35 67 50 50 NUM ct-9454 35 68 µm µm NOUN ct-9454 35 69 resveratrol resveratrol NOUN ct-9454 35 70 ( ( PUNCT ct-9454 35 71 mp mp PROPN ct-9454 35 72 biomedical biomedical NOUN ct-9454 35 73 , , PUNCT ct-9454 35 74 santa santa PROPN ct-9454 35 75 ana ana PROPN ct-9454 35 76 , , PUNCT ct-9454 35 77 ca ca NOUN ct-9454 35 78 ) ) PUNCT ct-9454 35 79 . . PUNCT ct-9454 36 1 gene gene NOUN ct-9454 36 2 expression expression NOUN ct-9454 36 3 clinical clinical ADJ ct-9454 36 4 theriogenology theriogenology NOUN ct-9454 36 5 • • NOUN ct-9454 36 6 volume volume NOUN ct-9454 36 7 12 12 NUM ct-9454 36 8 number number NOUN ct-9454 36 9 4 4 NUM ct-9454 36 10 • • NOUN ct-9454 36 11 december december PROPN ct-9454 36 12 2020 2020 NUM ct-9454 36 13 530 530 NUM ct-9454 36 14                     SPACE ct-9454 36 15 rna rna NOUN ct-9454 36 16 was be AUX ct-9454 36 17 isolated isolate VERB ct-9454 36 18 by by ADP ct-9454 36 19 reliaprep reliaprep PROPN ct-9454 36 20 rna rna PROPN ct-9454 36 21 mini mini ADJ ct-9454 36 22 kit kit NOUN ct-9454 36 23 ( ( PUNCT ct-9454 36 24 promega promega PROPN ct-9454 36 25 , , PUNCT ct-9454 36 26 madison madison PROPN ct-9454 36 27 , , PUNCT ct-9454 36 28 wi wi PROPN ct-9454 36 29 ) ) PUNCT ct-9454 36 30 and and CCONJ ct-9454 36 31 reverse reverse ADJ ct-9454 36 32 transcription transcription NOUN ct-9454 36 33 was be AUX ct-9454 36 34 carried carry VERB ct-9454 36 35 out out ADP ct-9454 36 36 using use VERB ct-9454 36 37 the the DET ct-9454 36 38 revertaid revertaid ADJ ct-9454 36 39 first first ADJ ct-9454 36 40 strand strand PROPN ct-9454 36 41 cdna cdna PROPN ct-9454 36 42 synthesis synthesis NOUN ct-9454 36 43 kit kit NOUN ct-9454 36 44 ( ( PUNCT ct-9454 36 45 thermo thermo NOUN ct-9454 36 46 , , PUNCT ct-9454 36 47 thermofisher thermofisher ADJ ct-9454 36 48 scientific scientific NOUN ct-9454 36 49 ) ) PUNCT ct-9454 36 50 . . PUNCT ct-9454 37 1 quantitative quantitative ADJ ct-9454 37 2 rt rt PROPN ct-9454 37 3 - - PUNCT ct-9454 37 4 pcr pcr PROPN ct-9454 37 5 was be AUX ct-9454 37 6 performed perform VERB ct-9454 37 7 with with ADP ct-9454 37 8 fast fast ADJ ct-9454 37 9 sybr sybr NOUN ct-9454 37 10 green green ADJ ct-9454 37 11 ( ( PUNCT ct-9454 37 12 thermo thermo NOUN ct-9454 37 13 , , PUNCT ct-9454 37 14 thermofisher thermofisher ADJ ct-9454 37 15 scientific scientific NOUN ct-9454 37 16 ) ) PUNCT ct-9454 37 17 on on ADP ct-9454 37 18 a a DET ct-9454 37 19 steponeplus steponeplus ADJ ct-9454 37 20 thermocycler thermocycler NOUN ct-9454 37 21 ( ( PUNCT ct-9454 37 22 applied apply VERB ct-9454 37 23 biosystems biosystem NOUN ct-9454 37 24 , , PUNCT ct-9454 37 25 foster foster ADJ ct-9454 37 26 city city NOUN ct-9454 37 27 , , PUNCT ct-9454 37 28 ca ca NOUN ct-9454 37 29 ) ) PUNCT ct-9454 37 30 , , PUNCT ct-9454 37 31 using use VERB ct-9454 37 32 the the DET ct-9454 37 33 following follow VERB ct-9454 37 34 primers primer NOUN ct-9454 37 35 : : PUNCT ct-9454 37 36 b2 b2 NOUN ct-9454 37 37 m m PROPN ct-9454 37 38 f f NOUN ct-9454 37 39 - - PUNCT ct-9454 37 40 ggcattcctgaagctgacag ggcattcctgaagctgacag VERB ct-9454 37 41 , , PUNCT ct-9454 37 42 r r NOUN ct-9454 37 43 - - PUNCT ct-9454 37 44 tggatgacgtgagtaaacctg tggatgacgtgagtaaacctg NOUN ct-9454 37 45 , , PUNCT ct-9454 37 46 foxl2 foxl2 PROPN ct-9454 37 47 facggcctgtactcggtttac facggcctgtactcggtttac NOUN ct-9454 37 48 , , PUNCT ct-9454 37 49 rtccaccgatctttcaaacaa rtccaccgatctttcaaacaa NOUN ct-9454 37 50 , , PUNCT ct-9454 37 51 and and CCONJ ct-9454 37 52 amhr2 amhr2 NOUN ct-9454 37 53 f f X ct-9454 37 54 - - PUNCT ct-9454 37 55 tgtgtttctcccaggtaatccg tgtgtttctcccaggtaatccg NOUN ct-9454 37 56 , , PUNCT ct-9454 37 57 raatgtggtcgtgctgtaggc raatgtggtcgtgctgtaggc NOUN ct-9454 37 58 . . PUNCT ct-9454 38 1 fold fold ADJ ct-9454 38 2 change change NOUN ct-9454 38 3 in in ADP ct-9454 38 4 gene gene NOUN ct-9454 38 5 expression expression NOUN ct-9454 38 6 was be AUX ct-9454 38 7 calculated calculate VERB ct-9454 38 8 using use VERB ct-9454 38 9 the the DET ct-9454 38 10 ∆∆ct ∆∆ct NOUN ct-9454 38 11 method method NOUN ct-9454 38 12 , , PUNCT ct-9454 38 13 with with ADP ct-9454 38 14 b2 b2 NOUN ct-9454 38 15 m m NOUN ct-9454 38 16 as as ADP ct-9454 38 17 the the DET ct-9454 38 18 reference reference NOUN ct-9454 38 19 . . PUNCT ct-9454 39 1 cell cell NOUN ct-9454 39 2 sorting sorting NOUN ct-9454 39 3 and and CCONJ ct-9454 39 4 analysis analysis NOUN ct-9454 39 5 cells cell NOUN ct-9454 39 6 were be AUX ct-9454 39 7 dissociated dissociate VERB ct-9454 39 8 in in ADP ct-9454 39 9 0.25 0.25 NUM ct-9454 39 10 % % NOUN ct-9454 39 11 trypsin trypsin NOUN ct-9454 39 12 - - PUNCT ct-9454 39 13 edta edta NOUN ct-9454 39 14 , , PUNCT ct-9454 39 15 washed wash VERB ct-9454 39 16 in in ADP ct-9454 39 17 media medium NOUN ct-9454 39 18 , , PUNCT ct-9454 39 19 and and CCONJ ct-9454 39 20 blocked block VERB ct-9454 39 21 for for ADP ct-9454 39 22 20 20 NUM ct-9454 39 23 minutes minute NOUN ct-9454 39 24 on on ADP ct-9454 39 25 ice ice NOUN ct-9454 39 26 - - PUNCT ct-9454 39 27 cold cold ADJ ct-9454 39 28 blocking blocking NOUN ct-9454 39 29 buffer buffer NOUN ct-9454 39 30 ( ( PUNCT ct-9454 39 31 2 2 NUM ct-9454 39 32 % % NOUN ct-9454 39 33 bovine bovine NOUN ct-9454 39 34 serum serum NOUN ct-9454 39 35 albumin albumin NOUN ct-9454 39 36 and and CCONJ ct-9454 39 37 2 2 NUM ct-9454 39 38 % % NOUN ct-9454 39 39 normal normal ADJ ct-9454 39 40 goat goat PROPN ct-9454 39 41 serum serum NOUN ct-9454 39 42 in in ADP ct-9454 39 43 pbs pbs PROPN ct-9454 39 44 ) ) PUNCT ct-9454 39 45 . . PUNCT ct-9454 40 1 cells cell NOUN ct-9454 40 2 were be AUX ct-9454 40 3 stained stain VERB ct-9454 40 4 in in ADP ct-9454 40 5 mouse mouse NOUN ct-9454 40 6 antiamhr2 antiamhr2 NOUN ct-9454 40 7 ( ( PUNCT ct-9454 40 8 ab64762 ab64762 PROPN ct-9454 40 9 , , PUNCT ct-9454 40 10 0.1 0.1 NUM ct-9454 40 11 µg µg NOUN ct-9454 40 12 / / SYM ct-9454 40 13 ml ml NOUN ct-9454 40 14 ) ) PUNCT ct-9454 40 15 on on ADP ct-9454 40 16 ice ice NOUN ct-9454 40 17 for for ADP ct-9454 40 18 30 30 NUM ct-9454 40 19 minutes minute NOUN ct-9454 40 20 , , PUNCT ct-9454 40 21 washed wash VERB ct-9454 40 22 , , PUNCT ct-9454 40 23 and and CCONJ ct-9454 40 24 labeled label VERB ct-9454 40 25 with with ADP ct-9454 40 26 goat goat PROPN ct-9454 40 27 antimouse antimouse ADP ct-9454 40 28 alexa alexa NOUN ct-9454 40 29 fluor fluor NOUN ct-9454 40 30 488 488 NUM ct-9454 40 31 ( ( PUNCT ct-9454 40 32 1:500 1:500 NUM ct-9454 40 33 ) ) PUNCT ct-9454 40 34 on on ADP ct-9454 40 35 ice ice NOUN ct-9454 40 36 for for ADP ct-9454 40 37 45 45 NUM ct-9454 40 38 minutes minute NOUN ct-9454 40 39 . . PUNCT ct-9454 41 1 cells cell NOUN ct-9454 41 2 were be AUX ct-9454 41 3 washed wash VERB ct-9454 41 4 and and CCONJ ct-9454 41 5 re re VERB ct-9454 41 6 - - VERB ct-9454 41 7 suspended suspend VERB ct-9454 41 8 in in ADP ct-9454 41 9 cold cold ADJ ct-9454 41 10 facs fac NOUN ct-9454 41 11 buffer buffer NOUN ct-9454 41 12 ( ( PUNCT ct-9454 41 13 1 1 NUM ct-9454 41 14 % % NOUN ct-9454 41 15 fetal fetal ADJ ct-9454 41 16 bovine bovine NOUN ct-9454 41 17 serum serum NOUN ct-9454 41 18 , , PUNCT ct-9454 41 19 25 25 NUM ct-9454 41 20 mm mm PROPN ct-9454 41 21 hepes hepe NOUN ct-9454 41 22 , , PUNCT ct-9454 41 23 1 1 NUM ct-9454 41 24 mm mm NOUN ct-9454 41 25 edta edta NOUN ct-9454 41 26 in in ADP ct-9454 41 27 pbs pbs PROPN ct-9454 41 28 ) ) PUNCT ct-9454 41 29 . . PUNCT ct-9454 42 1 samples sample NOUN ct-9454 42 2 were be AUX ct-9454 42 3 analyzed analyze VERB ct-9454 42 4 on on ADP ct-9454 42 5 a a DET ct-9454 42 6 bd bd PROPN ct-9454 42 7 facs facs PROPN ct-9454 42 8 aria aria PROPN ct-9454 42 9 iii iii NUM ct-9454 42 10 special special ADJ ct-9454 42 11 order order NOUN ct-9454 42 12 flow flow NOUN ct-9454 42 13 cytometer cytometer NOUN ct-9454 42 14 equipped equip VERB ct-9454 42 15 with with ADP ct-9454 42 16 the the DET ct-9454 42 17 following follow VERB ct-9454 42 18 lasers laser NOUN ct-9454 42 19 and and CCONJ ct-9454 42 20 filter filter NOUN ct-9454 42 21 sets set NOUN ct-9454 42 22 : : PUNCT ct-9454 42 23 blue blue ADJ ct-9454 42 24 laser laser NOUN ct-9454 42 25 ( ( PUNCT ct-9454 42 26 488 488 NUM ct-9454 42 27 nm nm NOUN ct-9454 42 28 ) ) PUNCT ct-9454 42 29 equipped equip VERB ct-9454 42 30 with with ADP ct-9454 42 31 fsc fsc PROPN ct-9454 42 32 and and CCONJ ct-9454 42 33 ssc ssc PROPN ct-9454 42 34 detectors detector NOUN ct-9454 42 35 and and CCONJ ct-9454 42 36 a a DET ct-9454 42 37 fitc fitc NOUN ct-9454 42 38 filter filter NOUN ct-9454 42 39 ( ( PUNCT ct-9454 42 40 505lp 505lp NOUN ct-9454 42 41 ; ; PUNCT ct-9454 42 42 530/40 530/40 NUM ct-9454 42 43 nm nm NOUN ct-9454 42 44 ) ) PUNCT ct-9454 42 45 and and CCONJ ct-9454 42 46 a a DET ct-9454 42 47 uv uv NOUN ct-9454 42 48 laser laser NOUN ct-9454 42 49 ( ( PUNCT ct-9454 42 50 355 355 NUM ct-9454 42 51 nm nm NOUN ct-9454 42 52 ) ) PUNCT ct-9454 42 53 equipped equip VERB ct-9454 42 54 with with ADP ct-9454 42 55 a a DET ct-9454 42 56 dapi dapi ADJ ct-9454 42 57 filter filter NOUN ct-9454 42 58 ( ( PUNCT ct-9454 42 59 450/50 450/50 NOUN ct-9454 42 60 nm nm NOUN ct-9454 42 61 ) ) PUNCT ct-9454 42 62 . . PUNCT ct-9454 43 1 dapi dapi PROPN ct-9454 43 2 ( ( PUNCT ct-9454 43 3 sigma sigma PROPN ct-9454 43 4 , , PUNCT ct-9454 43 5 0.2 0.2 NUM ct-9454 43 6 µg µg NOUN ct-9454 43 7 / / SYM ct-9454 43 8 ml ml NOUN ct-9454 43 9 ) ) PUNCT ct-9454 43 10 was be AUX ct-9454 43 11 added add VERB ct-9454 43 12 to to ADP ct-9454 43 13 cells cell NOUN ct-9454 43 14 immediately immediately ADV ct-9454 43 15 prior prior ADV ct-9454 43 16 to to ADP ct-9454 43 17 sorting sort VERB ct-9454 43 18 . . PUNCT ct-9454 44 1 cells cell NOUN ct-9454 44 2 were be AUX ct-9454 44 3 gated gate VERB ct-9454 44 4 from from ADP ct-9454 44 5 debris debris NOUN ct-9454 44 6 by by ADP ct-9454 44 7 fsc fsc PROPN ct-9454 44 8 versus versus ADP ct-9454 44 9 ssc ssc PROPN ct-9454 44 10 plots plot NOUN ct-9454 44 11 , , PUNCT ct-9454 44 12 followed follow VERB ct-9454 44 13 by by ADP ct-9454 44 14 gating gate VERB ct-9454 44 15 for for ADP ct-9454 44 16 singlet singlet ADJ ct-9454 44 17 events event NOUN ct-9454 44 18 and and CCONJ ct-9454 44 19 lastly lastly ADV ct-9454 44 20 , , PUNCT ct-9454 44 21 gating gate VERB ct-9454 44 22 for for ADP ct-9454 44 23 dapi dapi ADJ ct-9454 44 24 negative negative ADJ ct-9454 44 25 events event NOUN ct-9454 44 26 for for ADP ct-9454 44 27 dead dead ADJ ct-9454 44 28 cell cell NOUN ct-9454 44 29 exclusion exclusion NOUN ct-9454 44 30 . . PUNCT ct-9454 45 1 population population NOUN ct-9454 45 2 gating gating NOUN ct-9454 45 3 was be AUX ct-9454 45 4 performed perform VERB ct-9454 45 5 in in ADP ct-9454 45 6 flowjo flowjo PROPN ct-9454 45 7 ( ( PUNCT ct-9454 45 8 ashland ashland NOUN ct-9454 45 9 , , PUNCT ct-9454 45 10 or or CCONJ ct-9454 45 11 ) ) PUNCT ct-9454 45 12 for for ADP ct-9454 45 13 statistical statistical ADJ ct-9454 45 14 analyses analysis NOUN ct-9454 45 15 . . PUNCT ct-9454 46 1 results result NOUN ct-9454 46 2 we we PRON ct-9454 46 3 presented present VERB ct-9454 46 4 a a DET ct-9454 46 5 method method NOUN ct-9454 46 6 to to PART ct-9454 46 7 differentiate differentiate VERB ct-9454 46 8 cells cell NOUN ct-9454 46 9 from from ADP ct-9454 46 10 pscs psc NOUN ct-9454 46 11 with with ADP ct-9454 46 12 molecular molecular ADJ ct-9454 46 13 signatures signature NOUN ct-9454 46 14 of of ADP ct-9454 46 15 human human ADJ ct-9454 46 16 granulosa granulosa NOUN ct-9454 46 17 - - PUNCT ct-9454 46 18 like like ADJ ct-9454 46 19 cells cell NOUN ct-9454 46 20 . . PUNCT ct-9454 47 1 to to PART ct-9454 47 2 differentiate differentiate VERB ct-9454 47 3 granulosa granulosa NOUN ct-9454 47 4 cells cell NOUN ct-9454 47 5 from from ADP ct-9454 47 6 hescs hesc NOUN ct-9454 47 7 , , PUNCT ct-9454 47 8 undifferentiated undifferentiated ADJ ct-9454 47 9 cells cell NOUN ct-9454 47 10 were be AUX ct-9454 47 11 exposed expose VERB ct-9454 47 12 to to ADP ct-9454 47 13 a a DET ct-9454 47 14 stepwise stepwise ADJ ct-9454 47 15 differentiation differentiation NOUN ct-9454 47 16 via via ADP ct-9454 47 17 small small ADJ ct-9454 47 18 molecules molecule NOUN ct-9454 47 19 to to PART ct-9454 47 20 induce induce VERB ct-9454 47 21 signaling signal VERB ct-9454 47 22 cascades cascade NOUN ct-9454 47 23 proposed propose VERB ct-9454 47 24 for for ADP ct-9454 47 25 each each DET ct-9454 47 26 stage stage NOUN ct-9454 47 27 and and CCONJ ct-9454 47 28 rtqpcr rtqpcr ADJ ct-9454 47 29 was be AUX ct-9454 47 30 performed perform VERB ct-9454 47 31 to to PART ct-9454 47 32 detect detect VERB ct-9454 47 33 increases increase NOUN ct-9454 47 34 in in ADP ct-9454 47 35 marker marker NOUN ct-9454 47 36 gene gene NOUN ct-9454 47 37 expression expression NOUN ct-9454 47 38 at at ADP ct-9454 47 39 each each DET ct-9454 47 40 stage stage NOUN ct-9454 47 41 ( ( PUNCT ct-9454 47 42 figure figure NOUN ct-9454 47 43 1 1 NUM ct-9454 47 44 ) ) PUNCT ct-9454 47 45 . . PUNCT ct-9454 48 1 because because SCONJ ct-9454 48 2 human human ADJ ct-9454 48 3 pre pre ADJ ct-9454 48 4 - - ADJ ct-9454 48 5 granulosa granulosa ADJ ct-9454 48 6 cells cell NOUN ct-9454 48 7 are be AUX ct-9454 48 8 not not PART ct-9454 48 9 well well ADV ct-9454 48 10 characterized characterized ADJ ct-9454 48 11 , , PUNCT ct-9454 48 12 we we PRON ct-9454 48 13 analyzed analyze VERB ct-9454 48 14 our our PRON ct-9454 48 15 previously previously ADV ct-9454 48 16 reported report VERB ct-9454 48 17 comprehensive comprehensive ADJ ct-9454 48 18 figure figure NOUN ct-9454 48 19 1 1 NUM ct-9454 48 20 . . PUNCT ct-9454 48 21 differentiation differentiation NOUN ct-9454 48 22 strategy strategy NOUN ct-9454 48 23 for for ADP ct-9454 48 24 the the DET ct-9454 48 25 production production NOUN ct-9454 48 26 of of ADP ct-9454 48 27 human human ADJ ct-9454 48 28 pregranulosa pregranulosa NOUN ct-9454 48 29 cells cell NOUN ct-9454 48 30 from from ADP ct-9454 48 31 pluripotent pluripotent ADJ ct-9454 48 32 stem stem NOUN ct-9454 48 33 cells cell NOUN ct-9454 48 34 . . PUNCT ct-9454 49 1 human human ADJ ct-9454 49 2 embryonic embryonic ADJ ct-9454 49 3 stem stem NOUN ct-9454 49 4 cells cell NOUN ct-9454 49 5 ( ( PUNCT ct-9454 49 6 wa09 wa09 PROPN ct-9454 49 7 , , PUNCT ct-9454 49 8 wicell wicell NOUN ct-9454 49 9 ) ) PUNCT ct-9454 49 10 were be AUX ct-9454 49 11 maintained maintain VERB ct-9454 49 12 in in ADP ct-9454 49 13 feeder feeder NOUN ct-9454 49 14 free free ADJ ct-9454 49 15 conditions condition NOUN ct-9454 49 16 and and CCONJ ct-9454 49 17 subjected subject VERB ct-9454 49 18 to to ADP ct-9454 49 19 2 2 NUM ct-9454 49 20 - - PUNCT ct-9454 49 21 d d ADV ct-9454 49 22 directed direct VERB ct-9454 49 23 differentiation differentiation NOUN ct-9454 49 24 . . PUNCT ct-9454 50 1 cells cell NOUN ct-9454 50 2 were be AUX ct-9454 50 3 plated plate VERB ct-9454 50 4 and and CCONJ ct-9454 50 5 treated treat VERB ct-9454 50 6 with with ADP ct-9454 50 7 gsk3 gsk3 NOUN ct-9454 50 8 inhibitor inhibitor NOUN ct-9454 50 9 ( ( PUNCT ct-9454 50 10 gsk3i gsk3i PROPN ct-9454 50 11 , , PUNCT ct-9454 50 12 chir99021 chir99021 PROPN ct-9454 50 13 , , PUNCT ct-9454 50 14 10 10 NUM ct-9454 50 15 µm µm NOUN ct-9454 50 16 ) ) PUNCT ct-9454 50 17 to to PART ct-9454 50 18 induce induce VERB ct-9454 50 19 mesendodermal mesendodermal ADJ ct-9454 50 20 lineage lineage NOUN ct-9454 50 21 via via ADP ct-9454 50 22 wnt wnt NOUN ct-9454 50 23 signaling signal VERB ct-9454 50 24 . . PUNCT ct-9454 51 1 further further ADJ ct-9454 51 2 treatment treatment NOUN ct-9454 51 3 with with ADP ct-9454 51 4 fetal fetal ADJ ct-9454 51 5 growth growth NOUN ct-9454 51 6 factor factor NOUN ct-9454 51 7 ( ( PUNCT ct-9454 51 8 bfgf bfgf NOUN ct-9454 51 9 , , PUNCT ct-9454 51 10 100 100 NUM ct-9454 51 11 ng ng NOUN ct-9454 51 12 / / SYM ct-9454 51 13 ml ml PROPN ct-9454 51 14 ) ) PUNCT ct-9454 51 15 and and CCONJ ct-9454 51 16 retinoic retinoic PROPN ct-9454 51 17 acid acid NOUN ct-9454 51 18 ( ( PUNCT ct-9454 51 19 1 1 NUM ct-9454 51 20 µm µm NOUN ct-9454 51 21 ) ) PUNCT ct-9454 51 22 was be AUX ct-9454 51 23 utilized utilize VERB ct-9454 51 24 to to PART ct-9454 51 25 induce induce VERB ct-9454 51 26 cells cell NOUN ct-9454 51 27 of of ADP ct-9454 51 28 a a DET ct-9454 51 29 gonadal gonadal ADJ ct-9454 51 30 / / SYM ct-9454 51 31 renal renal ADJ ct-9454 51 32 lineage lineage NOUN ct-9454 51 33 , , PUNCT ct-9454 51 34 and and CCONJ ct-9454 51 35 subsequent subsequent ADJ ct-9454 51 36 treatment treatment NOUN ct-9454 51 37 with with ADP ct-9454 51 38 notch notch ADJ ct-9454 51 39 activators activator NOUN ct-9454 51 40 , , PUNCT ct-9454 51 41 jagged jag VERB ct-9454 51 42 1 1 NUM ct-9454 51 43 ( ( PUNCT ct-9454 51 44 1 1 NUM ct-9454 51 45 µg µg NOUN ct-9454 51 46 / / SYM ct-9454 51 47 ml ml NOUN ct-9454 51 48 ) ) PUNCT ct-9454 51 49 , , PUNCT ct-9454 51 50 a a DET ct-9454 51 51 ligand ligand NOUN ct-9454 51 52 for for ADP ct-9454 51 53 notch notch ADJ ct-9454 51 54 receptors receptor NOUN ct-9454 51 55 , , PUNCT ct-9454 51 56 and and CCONJ ct-9454 51 57 resveratrol resveratrol NOUN ct-9454 51 58 ( ( PUNCT ct-9454 51 59 50 50 NUM ct-9454 51 60 µm µm NOUN ct-9454 51 61 ) ) PUNCT ct-9454 51 62 , , PUNCT ct-9454 51 63 a a DET ct-9454 51 64 compound compound NOUN ct-9454 51 65 that that PRON ct-9454 51 66 induces induce VERB ct-9454 51 67 notch notch ADJ ct-9454 51 68 signaling signal VERB ct-9454 51 69 , , PUNCT ct-9454 51 70 to to PART ct-9454 51 71 increase increase VERB ct-9454 51 72 the the DET ct-9454 51 73 incidence incidence NOUN ct-9454 51 74 of of ADP ct-9454 51 75 potential potential ADJ ct-9454 51 76 granulosa granulosa NOUN ct-9454 51 77 - - PUNCT ct-9454 51 78 like like ADJ ct-9454 51 79 cells cell NOUN ct-9454 51 80 . . PUNCT ct-9454 52 1 cells cell NOUN ct-9454 52 2 were be AUX ct-9454 52 3 subject subject ADJ ct-9454 52 4 to to ADP ct-9454 52 5 quantitative quantitative ADJ ct-9454 52 6 rt rt NOUN ct-9454 52 7 - - PUNCT ct-9454 52 8 pcr pcr NOUN ct-9454 52 9 to to PART ct-9454 52 10 assess assess VERB ct-9454 52 11 gene gene NOUN ct-9454 52 12 expression expression NOUN ct-9454 52 13 throughout throughout ADP ct-9454 52 14 differentiation differentiation NOUN ct-9454 52 15 ( ( PUNCT ct-9454 52 16 genes gene NOUN ct-9454 52 17 chosen choose VERB ct-9454 52 18 for for ADP ct-9454 52 19 analysis analysis NOUN ct-9454 52 20 shown show VERB ct-9454 52 21 in in ADP ct-9454 52 22 gray gray ADJ ct-9454 52 23 ) ) PUNCT ct-9454 52 24 . . PUNCT ct-9454 53 1 quantitative quantitative ADJ ct-9454 53 2 mass mass PROPN ct-9454 53 3 spectrometric spectrometric ADJ ct-9454 53 4 proteomics proteomic NOUN ct-9454 53 5 dataset dataset NOUN ct-9454 53 6 of of ADP ct-9454 53 7 human human ADJ ct-9454 53 8 fetal fetal ADJ ct-9454 53 9 ovarian ovarian ADJ ct-9454 53 10 tissue tissue NOUN ct-9454 53 11 across across ADP ct-9454 53 12 developmental developmental ADJ ct-9454 53 13 time time NOUN ct-9454 53 14 points12 points12 NOUN ct-9454 53 15 to to PART ct-9454 53 16 determine determine VERB ct-9454 53 17 that that DET ct-9454 53 18 forkhead forkhead NOUN ct-9454 53 19 box box NOUN ct-9454 53 20 l2 l2 NOUN ct-9454 53 21 ( ( PUNCT ct-9454 53 22 foxl2 foxl2 PROPN ct-9454 53 23 ) ) PUNCT ct-9454 53 24 , , PUNCT ct-9454 53 25 a a DET ct-9454 53 26 transcriptional transcriptional ADJ ct-9454 53 27 regulator regulator NOUN ct-9454 53 28 required require VERB ct-9454 53 29 for for ADP ct-9454 53 30 granulosa granulosa NOUN ct-9454 53 31 cell cell NOUN ct-9454 53 32 formation formation NOUN ct-9454 53 33 in in ADP ct-9454 53 34 mice mouse NOUN ct-9454 53 35 , , PUNCT ct-9454 53 36 is be AUX ct-9454 53 37 expressed express VERB ct-9454 53 38 just just ADV ct-9454 53 39 prior prior ADV ct-9454 53 40 to to ADP ct-9454 53 41 and and CCONJ ct-9454 53 42 during during ADP ct-9454 53 43 folliculogenesis folliculogenesis NOUN ct-9454 53 44 in in ADP ct-9454 53 45 humans human NOUN ct-9454 53 46 ( ( PUNCT ct-9454 53 47 figure figure NOUN ct-9454 53 48 2a 2a NUM ct-9454 53 49 ) ) PUNCT ct-9454 53 50 . . PUNCT ct-9454 54 1 to to PART ct-9454 54 2 confirm confirm VERB ct-9454 54 3 that that DET ct-9454 54 4 foxl2 foxl2 PROPN ct-9454 54 5 expression expression NOUN ct-9454 54 6 was be AUX ct-9454 54 7 specific specific ADJ ct-9454 54 8 to to ADP ct-9454 54 9 pre pre ADJ ct-9454 54 10 - - ADJ ct-9454 54 11 granulosa granulosa ADJ ct-9454 54 12 cells cell NOUN ct-9454 54 13 , , PUNCT ct-9454 54 14 immunohistochemistry immunohistochemistry NOUN ct-9454 54 15 ( ( PUNCT ct-9454 54 16 ihc ihc PROPN ct-9454 54 17 ) ) PUNCT ct-9454 54 18 verified verify VERB ct-9454 54 19 that that SCONJ ct-9454 54 20 foxl2 foxl2 PROPN ct-9454 54 21 was be AUX ct-9454 54 22 not not PART ct-9454 54 23 detected detect VERB ct-9454 54 24 in in ADP ct-9454 54 25 tissue tissue NOUN ct-9454 54 26 from from ADP ct-9454 54 27 56 56 NUM ct-9454 54 28 days day NOUN ct-9454 54 29 of of ADP ct-9454 54 30 development development NOUN ct-9454 54 31 prior prior ADV ct-9454 54 32 to to ADP ct-9454 54 33 follicle follicle VERB ct-9454 54 34 formation formation NOUN ct-9454 54 35 , , PUNCT ct-9454 54 36 and and CCONJ ct-9454 54 37 as as SCONJ ct-9454 54 38 germ germ NOUN ct-9454 54 39 cell cell NOUN ct-9454 54 40 cyst cyst NOUN ct-9454 54 41 breakdown breakdown NOUN ct-9454 54 42 occurred occur VERB ct-9454 54 43 , , PUNCT ct-9454 54 44 was be AUX ct-9454 54 45 localized localize VERB ct-9454 54 46 specifically specifically ADV ct-9454 54 47 to to ADP ct-9454 54 48 somatic somatic ADJ ct-9454 54 49 cells cell NOUN ct-9454 54 50 surrounding surround VERB ct-9454 54 51 germ germ NOUN ct-9454 54 52 cells cell NOUN ct-9454 54 53 and and CCONJ ct-9454 54 54 was be AUX ct-9454 54 55 primarily primarily ADV ct-9454 54 56 nuclear nuclear ADJ ct-9454 54 57 ( ( PUNCT ct-9454 54 58 figure figure NOUN ct-9454 54 59 2b 2b NOUN ct-9454 54 60 ) ) PUNCT ct-9454 54 61 . . PUNCT ct-9454 55 1 clinical clinical ADJ ct-9454 55 2 theriogenology theriogenology NOUN ct-9454 55 3 • • NOUN ct-9454 55 4 volume volume NOUN ct-9454 55 5 12 12 NUM ct-9454 55 6 number number NOUN ct-9454 55 7 4 4 NUM ct-9454 55 8 • • NOUN ct-9454 55 9 december december PROPN ct-9454 55 10 2020531 2020531 NUM ct-9454 55 11                     SPACE ct-9454 55 12 figure figure NOUN ct-9454 55 13 2 2 NUM ct-9454 55 14 . . PUNCT ct-9454 55 15 foxl2 foxl2 PROPN ct-9454 55 16 as as ADP ct-9454 55 17 a a DET ct-9454 55 18 marker marker NOUN ct-9454 55 19 for for ADP ct-9454 55 20 human human ADJ ct-9454 55 21 pre pre ADJ ct-9454 55 22 - - ADJ ct-9454 55 23 granulosa granulosa ADJ ct-9454 55 24 cells cell NOUN ct-9454 55 25 based base VERB ct-9454 55 26 on on ADP ct-9454 55 27 proteomics proteomic NOUN ct-9454 55 28 and and CCONJ ct-9454 55 29 ihc ihc PROPN ct-9454 55 30 confirmation confirmation NOUN ct-9454 55 31 of of ADP ct-9454 55 32 expression expression NOUN ct-9454 55 33 and and CCONJ ct-9454 55 34 localization localization NOUN ct-9454 55 35 . . PUNCT ct-9454 56 1 ( ( PUNCT ct-9454 56 2 a a X ct-9454 56 3 ) ) PUNCT ct-9454 56 4 quantitative quantitative ADJ ct-9454 56 5 mass mass NOUN ct-9454 56 6 spectrometry spectrometry NOUN ct-9454 56 7 detection detection NOUN ct-9454 56 8 of of ADP ct-9454 56 9 pre pre ADJ ct-9454 56 10 - - ADJ ct-9454 56 11 granulosa granulosa ADJ ct-9454 56 12 cell cell NOUN ct-9454 56 13 protein protein NOUN ct-9454 56 14 foxl2 foxl2 NOUN ct-9454 56 15 at at ADP ct-9454 56 16 four four NUM ct-9454 56 17 stages stage NOUN ct-9454 56 18 of of ADP ct-9454 56 19 fetal fetal ADJ ct-9454 56 20 development development NOUN ct-9454 56 21 ( ( PUNCT ct-9454 56 22 days day NOUN ct-9454 56 23 47 47 NUM ct-9454 56 24 , , PUNCT ct-9454 56 25 108 108 NUM ct-9454 56 26 , , PUNCT ct-9454 56 27 122 122 NUM ct-9454 56 28 , , PUNCT ct-9454 56 29 and and CCONJ ct-9454 56 30 137 137 NUM ct-9454 56 31 ) ) PUNCT ct-9454 56 32 and and CCONJ ct-9454 56 33 in in ADP ct-9454 56 34 a a DET ct-9454 56 35 representative representative ADJ ct-9454 56 36 adult adult NOUN ct-9454 56 37 tissue tissue NOUN ct-9454 56 38 sample sample NOUN ct-9454 56 39 . . PUNCT ct-9454 57 1 ( ( PUNCT ct-9454 57 2 b b X ct-9454 57 3 ) ) PUNCT ct-9454 57 4 representative representative NOUN ct-9454 57 5 ihc ihc PROPN ct-9454 57 6 images image NOUN ct-9454 57 7 of of ADP ct-9454 57 8 foxl2 foxl2 NOUN ct-9454 57 9 immunostaining immunostaine VERB ct-9454 57 10 in in ADP ct-9454 57 11 human human ADJ ct-9454 57 12 ovarian ovarian ADJ ct-9454 57 13 tissue tissue NOUN ct-9454 57 14 from from ADP ct-9454 57 15 56 56 NUM ct-9454 57 16 , , PUNCT ct-9454 57 17 116 116 NUM ct-9454 57 18 , , PUNCT ct-9454 57 19 or or CCONJ ct-9454 57 20 137 137 NUM ct-9454 57 21 days day NOUN ct-9454 57 22 of of ADP ct-9454 57 23 development development NOUN ct-9454 57 24 . . PUNCT ct-9454 58 1 primary primary ADJ ct-9454 58 2 antibodies antibody NOUN ct-9454 58 3 were be AUX ct-9454 58 4 labeled label VERB ct-9454 58 5 and and CCONJ ct-9454 58 6 detected detect VERB ct-9454 58 7 with with ADP ct-9454 58 8 dab dab NOUN ct-9454 58 9 substrate substrate NOUN ct-9454 58 10 ( ( PUNCT ct-9454 58 11 brown brown NOUN ct-9454 58 12 ) ) PUNCT ct-9454 58 13 and and CCONJ ct-9454 58 14 nuclei nucleus NOUN ct-9454 58 15 were be AUX ct-9454 58 16 counterstained counterstaine VERB ct-9454 58 17 with with ADP ct-9454 58 18 hematoxylin hematoxylin PROPN ct-9454 58 19 ( ( PUNCT ct-9454 58 20 blue blue ADJ ct-9454 58 21 ) ) PUNCT ct-9454 58 22 . . PUNCT ct-9454 59 1 scale scale NOUN ct-9454 59 2 bar bar NOUN ct-9454 59 3 = = NOUN ct-9454 59 4 100 100 NUM ct-9454 59 5 µm µm NOUN ct-9454 59 6 . . PUNCT ct-9454 60 1 during during ADP ct-9454 60 2 the the DET ct-9454 60 3 first first ADJ ct-9454 60 4 stage stage NOUN ct-9454 60 5 of of ADP ct-9454 60 6 in in ADP ct-9454 60 7 vitro vitro X ct-9454 60 8 differentiation differentiation NOUN ct-9454 60 9 , , PUNCT ct-9454 60 10 cells cell NOUN ct-9454 60 11 were be AUX ct-9454 60 12 treated treat VERB ct-9454 60 13 with with ADP ct-9454 60 14 chir99021 chir99021 PROPN ct-9454 60 15 , , PUNCT ct-9454 60 16 a a DET ct-9454 60 17 glycogen glycogen NOUN ct-9454 60 18 synthase synthase NOUN ct-9454 60 19 kinase kinase PROPN ct-9454 60 20 3 3 NUM ct-9454 60 21 ( ( PUNCT ct-9454 60 22 gsk3 gsk3 PROPN ct-9454 60 23 ) ) PUNCT ct-9454 60 24 inhibitor inhibitor NOUN ct-9454 60 25 that that PRON ct-9454 60 26 activates activate VERB ct-9454 60 27 wnt wnt NOUN ct-9454 60 28 signaling signal VERB ct-9454 60 29 , , PUNCT ct-9454 60 30 for for ADP ct-9454 60 31 48 48 NUM ct-9454 60 32 hours hour NOUN ct-9454 60 33 to to PART ct-9454 60 34 induce induce VERB ct-9454 60 35 differentiation differentiation NOUN ct-9454 60 36 to to ADP ct-9454 60 37 the the DET ct-9454 60 38 mesendoderm mesendoderm NOUN ct-9454 60 39 . . PUNCT ct-9454 61 1 chir99021 chir99021 PROPN ct-9454 61 2 treatment treatment NOUN ct-9454 61 3 resulted result VERB ct-9454 61 4 in in ADP ct-9454 61 5 a a DET ct-9454 61 6 520 520 NUM ct-9454 61 7 - - ADJ ct-9454 61 8 fold fold ADJ ct-9454 61 9 increase increase NOUN ct-9454 61 10 in in ADP ct-9454 61 11 brachyury brachyury NOUN ct-9454 61 12 ( ( PUNCT ct-9454 61 13 tbxt tbxt ADJ ct-9454 61 14 gene gene NOUN ct-9454 61 15 ) ) PUNCT ct-9454 61 16 expression expression NOUN ct-9454 61 17 at at ADP ct-9454 61 18 48 48 NUM ct-9454 61 19 hours hour NOUN ct-9454 61 20 ( ( PUNCT ct-9454 61 21 p p X ct-9454 61 22 = = NOUN ct-9454 61 23 0.0005 0.0005 NUM ct-9454 61 24 ) ) PUNCT ct-9454 61 25 ( ( PUNCT ct-9454 61 26 figure figure NOUN ct-9454 61 27 3a 3a NUM ct-9454 61 28 ) ) PUNCT ct-9454 61 29 . . PUNCT ct-9454 62 1 following follow VERB ct-9454 62 2 mesendoderm mesendoderm NOUN ct-9454 62 3 induction induction NOUN ct-9454 62 4 , , PUNCT ct-9454 62 5 cells cell NOUN ct-9454 62 6 were be AUX ct-9454 62 7 treated treat VERB ct-9454 62 8 with with ADP ct-9454 62 9 bfgf bfgf NOUN ct-9454 62 10 and and CCONJ ct-9454 62 11 retinoic retinoic PROPN ct-9454 62 12 acid acid NOUN ct-9454 62 13 for for ADP ct-9454 62 14 48 48 NUM ct-9454 62 15 hours hour NOUN ct-9454 62 16 , , PUNCT ct-9454 62 17 followed follow VERB ct-9454 62 18 by by ADP ct-9454 62 19 treatment treatment NOUN ct-9454 62 20 with with ADP ct-9454 62 21 either either CCONJ ct-9454 62 22 jagged jagged ADJ ct-9454 62 23 1 1 NUM ct-9454 62 24 or or CCONJ ct-9454 62 25 resveratrol resveratrol NOUN ct-9454 62 26 to to PART ct-9454 62 27 induce induce VERB ct-9454 62 28 notch notch ADJ ct-9454 62 29 signaling signal VERB ct-9454 62 30 ( ( PUNCT ct-9454 62 31 figure figure NOUN ct-9454 62 32 1 1 NUM ct-9454 62 33 ) ) PUNCT ct-9454 62 34 . . PUNCT ct-9454 63 1 in in ADP ct-9454 63 2 comparison comparison NOUN ct-9454 63 3 to to ADP ct-9454 63 4 vehicle vehicle NOUN ct-9454 63 5 controls control NOUN ct-9454 63 6 , , PUNCT ct-9454 63 7 foxl2 foxl2 NOUN ct-9454 63 8 expression expression NOUN ct-9454 63 9 increased increase VERB ct-9454 63 10 3.1or 3.1or PROPN ct-9454 63 11 4.5 4.5 NUM ct-9454 63 12 - - NOUN ct-9454 63 13 fold fold VERB ct-9454 63 14 in in ADP ct-9454 63 15 response response NOUN ct-9454 63 16 to to ADP ct-9454 63 17 bfgf bfgf NOUN ct-9454 63 18 and and CCONJ ct-9454 63 19 retinoic retinoic PROPN ct-9454 63 20 acid acid NOUN ct-9454 63 21 , , PUNCT ct-9454 63 22 followed follow VERB ct-9454 63 23 by by ADP ct-9454 63 24 jagged jagged ADJ ct-9454 63 25 1 1 NUM ct-9454 63 26 or or CCONJ ct-9454 63 27 resveratrol resveratrol NOUN ct-9454 63 28 , , PUNCT ct-9454 63 29 respectively respectively ADV ct-9454 63 30 ( ( PUNCT ct-9454 63 31 p p X ct-9454 63 32 > > X ct-9454 63 33 0.05 0.05 NUM ct-9454 63 34 ) ) PUNCT ct-9454 63 35 ( ( PUNCT ct-9454 63 36 figure figure NOUN ct-9454 63 37 3b 3b NUM ct-9454 63 38 ) ) PUNCT ct-9454 63 39 . . PUNCT ct-9454 64 1 figure figure VERB ct-9454 64 2 3 3 NUM ct-9454 64 3 . . PUNCT ct-9454 64 4 directed direct VERB ct-9454 64 5 differentiation differentiation NOUN ct-9454 64 6 results result NOUN ct-9454 64 7 in in ADP ct-9454 64 8 an an DET ct-9454 64 9 increase increase NOUN ct-9454 64 10 in in ADP ct-9454 64 11 mesoderm mesoderm NOUN ct-9454 64 12 marker marker NOUN ct-9454 64 13 t t NOUN ct-9454 64 14 at at ADP ct-9454 64 15 48 48 NUM ct-9454 64 16 hours hour NOUN ct-9454 64 17 , , PUNCT ct-9454 64 18 followed follow VERB ct-9454 64 19 by by ADP ct-9454 64 20 an an DET ct-9454 64 21 increase increase NOUN ct-9454 64 22 in in ADP ct-9454 64 23 foxl2 foxl2 PROPN ct-9454 64 24 at at ADP ct-9454 64 25 day day NOUN ct-9454 64 26 6 6 NUM ct-9454 64 27 . . PUNCT ct-9454 65 1 ( ( PUNCT ct-9454 65 2 a a X ct-9454 65 3 ) ) PUNCT ct-9454 65 4 inducing induce VERB ct-9454 65 5 wnt wnt NOUN ct-9454 65 6 signaling signal VERB ct-9454 65 7 from from ADP ct-9454 65 8 0 0 NUM ct-9454 65 9 8 8 NUM ct-9454 65 10 hours hour NOUN ct-9454 65 11 resulted result VERB ct-9454 65 12 in in ADP ct-9454 65 13 a a DET ct-9454 65 14 521 521 NUM ct-9454 65 15 - - ADJ ct-9454 65 16 fold fold ADJ ct-9454 65 17 increase increase NOUN ct-9454 65 18 in in ADP ct-9454 65 19 t t NOUN ct-9454 65 20 expression expression NOUN ct-9454 65 21 at at ADP ct-9454 65 22 48 48 NUM ct-9454 65 23 hours hour NOUN ct-9454 65 24 ( ( PUNCT ct-9454 65 25 p p X ct-9454 65 26 = = NOUN ct-9454 65 27 0.0005 0.0005 NUM ct-9454 65 28 ) ) PUNCT ct-9454 65 29 . . PUNCT ct-9454 66 1 ( ( PUNCT ct-9454 66 2 b b X ct-9454 66 3 ) ) PUNCT ct-9454 66 4 subsequent subsequent ADJ ct-9454 66 5 treatment treatment NOUN ct-9454 66 6 with with ADP ct-9454 66 7 bfgf bfgf NOUN ct-9454 66 8 / / SYM ct-9454 66 9 retinoic retinoic NOUN ct-9454 66 10 acid acid NOUN ct-9454 66 11 followed follow VERB ct-9454 66 12 by by ADP ct-9454 66 13 notch notch ADJ ct-9454 66 14 activators activator NOUN ct-9454 66 15 jagged jag VERB ct-9454 66 16 1 1 NUM ct-9454 66 17 or or CCONJ ct-9454 66 18 resveratrol resveratrol NOUN ct-9454 66 19 resulted result VERB ct-9454 66 20 in in ADP ct-9454 66 21 a a DET ct-9454 66 22 3.1or 3.1or PROPN ct-9454 66 23 4.5 4.5 NUM ct-9454 66 24 - - ADJ ct-9454 66 25 fold fold ADJ ct-9454 66 26 increase increase NOUN ct-9454 66 27 in in ADP ct-9454 66 28 pregranulosa pregranulosa NOUN ct-9454 66 29 cell cell NOUN ct-9454 66 30 marker marker NOUN ct-9454 66 31 foxl2 foxl2 PROPN ct-9454 66 32 . . PUNCT ct-9454 67 1 fold fold ADJ ct-9454 67 2 change change NOUN ct-9454 67 3 calculated calculate VERB ct-9454 67 4 against against ADP ct-9454 67 5 b2 b2 NOUN ct-9454 67 6 m m PROPN ct-9454 67 7 and and CCONJ ct-9454 67 8 compared compare VERB ct-9454 67 9 to to ADP ct-9454 67 10 vehicle vehicle NOUN ct-9454 67 11 controls control NOUN ct-9454 67 12 at at ADP ct-9454 67 13 each each DET ct-9454 67 14 timepoint timepoint NOUN ct-9454 67 15 . . PUNCT ct-9454 68 1 additionally additionally ADV ct-9454 68 2 , , PUNCT ct-9454 68 3 we we PRON ct-9454 68 4 assessed assess VERB ct-9454 68 5 the the DET ct-9454 68 6 expression expression NOUN ct-9454 68 7 of of ADP ct-9454 68 8 amhr2 amhr2 NOUN ct-9454 68 9 gene gene NOUN ct-9454 68 10 expression expression NOUN ct-9454 68 11 to to PART ct-9454 68 12 determine determine VERB ct-9454 68 13 the the DET ct-9454 68 14 eventual eventual ADJ ct-9454 68 15 utility utility NOUN ct-9454 68 16 of of ADP ct-9454 68 17 using use VERB ct-9454 68 18 amhr2 amhr2 NOUN ct-9454 68 19 as as ADP ct-9454 68 20 a a DET ct-9454 68 21 live live ADJ ct-9454 68 22 cell cell NOUN ct-9454 68 23 marker marker NOUN ct-9454 68 24 for for ADP ct-9454 68 25 facs fac NOUN ct-9454 68 26 sorting sorting NOUN ct-9454 68 27 of of ADP ct-9454 68 28 granulosa granulosa NOUN ct-9454 68 29 - - PUNCT ct-9454 68 30 like like ADJ ct-9454 68 31 cells cell NOUN ct-9454 68 32 , , PUNCT ct-9454 68 33 using use VERB ct-9454 68 34 the the DET ct-9454 68 35 stepwise stepwise NOUN ct-9454 68 36 directed direct VERB ct-9454 68 37 differentiation differentiation NOUN ct-9454 68 38 protocol protocol NOUN ct-9454 68 39 . . PUNCT ct-9454 69 1 following follow VERB ct-9454 69 2 the the DET ct-9454 69 3 directed direct VERB ct-9454 69 4 differentiation differentiation NOUN ct-9454 69 5 approach approach NOUN ct-9454 69 6 described describe VERB ct-9454 69 7 and and CCONJ ct-9454 69 8 using use VERB ct-9454 69 9 resveratrol resveratrol NOUN ct-9454 69 10 specifically specifically ADV ct-9454 69 11 for for ADP ct-9454 69 12 the the DET ct-9454 69 13 final final ADJ ct-9454 69 14 treatment treatment NOUN ct-9454 69 15 , , PUNCT ct-9454 69 16 amhr2 amhr2 NOUN ct-9454 69 17 expression expression NOUN ct-9454 69 18 increased increase VERB ct-9454 69 19 at at ADP ct-9454 69 20 day day NOUN ct-9454 69 21 10 10 NUM ct-9454 69 22 of of ADP ct-9454 69 23 differentiation differentiation NOUN ct-9454 69 24 in in ADP ct-9454 69 25 both both DET ct-9454 69 26 wa09 wa09 PROPN ct-9454 69 27 ( ( PUNCT ct-9454 69 28 21.5 21.5 NUM ct-9454 69 29 - - NUM ct-9454 69 30 fold fold ADJ ct-9454 69 31 , , PUNCT ct-9454 69 32 p p NOUN ct-9454 69 33 = = NOUN ct-9454 69 34 0.005 0.005 NUM ct-9454 69 35 ) ) PUNCT ct-9454 69 36 and and CCONJ ct-9454 70 1 esi051 esi051 ADJ ct-9454 70 2 cells cell NOUN ct-9454 70 3 ( ( PUNCT ct-9454 70 4 58.4 58.4 NUM ct-9454 70 5 - - NUM ct-9454 70 6 fold fold ADJ ct-9454 70 7 , , PUNCT ct-9454 70 8 p p NOUN ct-9454 70 9 = = NOUN ct-9454 70 10 0.001 0.001 NUM ct-9454 70 11 ) ) PUNCT ct-9454 70 12 over over ADP ct-9454 70 13 vehicle vehicle NOUN ct-9454 70 14 control control NOUN ct-9454 70 15 clinical clinical ADJ ct-9454 70 16 theriogenology theriogenology NOUN ct-9454 70 17 • • NOUN ct-9454 70 18 volume volume NOUN ct-9454 70 19 12 12 NUM ct-9454 70 20 number number NOUN ct-9454 70 21 4 4 NUM ct-9454 70 22 • • NOUN ct-9454 70 23 december december PROPN ct-9454 70 24 2020 2020 NUM ct-9454 70 25 532 532 NUM ct-9454 70 26                     SPACE ct-9454 70 27 differentiations differentiation NOUN ct-9454 70 28 ( ( PUNCT ct-9454 70 29 figure figure NOUN ct-9454 70 30 4a 4a NUM ct-9454 70 31 ) ) PUNCT ct-9454 70 32 . . PUNCT ct-9454 71 1 when when SCONJ ct-9454 71 2 differentiated differentiated ADJ ct-9454 71 3 cells cell NOUN ct-9454 71 4 were be AUX ct-9454 71 5 labeled label VERB ct-9454 71 6 with with ADP ct-9454 71 7 antiamhr2 antiamhr2 NOUN ct-9454 71 8 and and CCONJ ct-9454 71 9 analyzed analyze VERB ct-9454 71 10 by by ADP ct-9454 71 11 facs fac NOUN ct-9454 71 12 , , PUNCT ct-9454 71 13 there there PRON ct-9454 71 14 was be VERB ct-9454 71 15 an an DET ct-9454 71 16 increase increase NOUN ct-9454 71 17 in in ADP ct-9454 71 18 amhr2 amhr2 NOUN ct-9454 71 19 + + SYM ct-9454 71 20 cells cell NOUN ct-9454 71 21 from from ADP ct-9454 71 22 day day NOUN ct-9454 71 23 0 0 NUM ct-9454 71 24 to to ADP ct-9454 71 25 day day NOUN ct-9454 71 26 10 10 NUM ct-9454 71 27 ( ( PUNCT ct-9454 71 28 p p NOUN ct-9454 71 29 = = NOUN ct-9454 71 30 0.005 0.005 NUM ct-9454 71 31 ) ) PUNCT ct-9454 71 32 , , PUNCT ct-9454 71 33 and and CCONJ ct-9454 71 34 no no DET ct-9454 71 35 difference difference NOUN ct-9454 71 36 in in ADP ct-9454 71 37 percent percent NOUN ct-9454 71 38 of of ADP ct-9454 71 39 amhr2 amhr2 NOUN ct-9454 71 40 + + NUM ct-9454 71 41 cells cell NOUN ct-9454 71 42 at at ADP ct-9454 71 43 day day NOUN ct-9454 71 44 10 10 NUM ct-9454 71 45 between between ADP ct-9454 71 46 vehicle vehicle NOUN ct-9454 71 47 and and CCONJ ct-9454 71 48 directed direct VERB ct-9454 71 49 differentiations differentiation NOUN ct-9454 71 50 for for ADP ct-9454 71 51 wa09 wa09 PROPN ct-9454 71 52 ( ( PUNCT ct-9454 71 53 p p X ct-9454 71 54 > > X ct-9454 71 55 0.05 0.05 NUM ct-9454 71 56 ) ) PUNCT ct-9454 71 57 . . PUNCT ct-9454 72 1 however however ADV ct-9454 72 2 , , PUNCT ct-9454 72 3 there there PRON ct-9454 72 4 was be VERB ct-9454 72 5 an an DET ct-9454 72 6 increase increase NOUN ct-9454 72 7 in in ADP ct-9454 72 8 amhr2 amhr2 NOUN ct-9454 72 9 + + SYM ct-9454 72 10 cells cell NOUN ct-9454 72 11 with with ADP ct-9454 72 12 directed direct VERB ct-9454 72 13 differentiation differentiation NOUN ct-9454 72 14 at at ADP ct-9454 72 15 day day NOUN ct-9454 72 16 10 10 NUM ct-9454 72 17 for for ADP ct-9454 72 18 esi051 esi051 PROPN ct-9454 72 19 ( ( PUNCT ct-9454 72 20 2.6 2.6 NUM ct-9454 72 21 - - ADJ ct-9454 72 22 fold fold ADJ ct-9454 72 23 increase increase NOUN ct-9454 72 24 , , PUNCT ct-9454 72 25 p p NOUN ct-9454 72 26 = = NOUN ct-9454 72 27 0.008 0.008 NUM ct-9454 72 28 ) ) PUNCT ct-9454 72 29 , , PUNCT ct-9454 72 30 indicating indicate VERB ct-9454 72 31 a a DET ct-9454 72 32 difference difference NOUN ct-9454 72 33 between between ADP ct-9454 72 34 the the DET ct-9454 72 35 2 2 NUM ct-9454 72 36 cell cell NOUN ct-9454 72 37 types type NOUN ct-9454 72 38 with with ADP ct-9454 72 39 regards regard NOUN ct-9454 72 40 to to ADP ct-9454 72 41 surface surface NOUN ct-9454 72 42 marker marker NOUN ct-9454 72 43 expression expression NOUN ct-9454 72 44 ( ( PUNCT ct-9454 72 45 figure figure NOUN ct-9454 72 46 4b 4b PROPN ct-9454 72 47 ) ) PUNCT ct-9454 72 48 . . PUNCT ct-9454 73 1 figure figure VERB ct-9454 73 2 4 4 NUM ct-9454 73 3 . . PUNCT ct-9454 73 4 directed direct VERB ct-9454 73 5 differentiation differentiation NOUN ct-9454 73 6 results result NOUN ct-9454 73 7 in in ADP ct-9454 73 8 an an DET ct-9454 73 9 increase increase NOUN ct-9454 73 10 in in ADP ct-9454 73 11 granulosa granulosa NOUN ct-9454 73 12 cell cell NOUN ct-9454 73 13 marker marker NOUN ct-9454 73 14 amhr2 amhr2 NOUN ct-9454 73 15 at at ADP ct-9454 73 16 day day NOUN ct-9454 73 17 10 10 NUM ct-9454 73 18 of of ADP ct-9454 73 19 differentiation differentiation NOUN ct-9454 73 20 and and CCONJ ct-9454 73 21 live live ADJ ct-9454 73 22 cells cell NOUN ct-9454 73 23 can can AUX ct-9454 73 24 be be AUX ct-9454 73 25 sorted sort VERB ct-9454 73 26 by by ADP ct-9454 73 27 facs fac NOUN ct-9454 73 28 labeling labeling NOUN ct-9454 73 29 for for ADP ct-9454 73 30 amhr2 amhr2 NOUN ct-9454 73 31 . . PUNCT ct-9454 74 1 ( ( PUNCT ct-9454 74 2 a a X ct-9454 74 3 ) ) PUNCT ct-9454 74 4 inducing induce VERB ct-9454 74 5 wnt wnt NOUN ct-9454 74 6 signaling signal VERB ct-9454 74 7 from from ADP ct-9454 74 8 0 0 NUM ct-9454 74 9 - - SYM ct-9454 74 10 48 48 NUM ct-9454 74 11 hours hour NOUN ct-9454 74 12 , , PUNCT ct-9454 74 13 followed follow VERB ct-9454 74 14 by by ADP ct-9454 74 15 subsequent subsequent ADJ ct-9454 74 16 treatment treatment NOUN ct-9454 74 17 with with ADP ct-9454 74 18 bfgf bfgf NOUN ct-9454 74 19 / / SYM ct-9454 74 20 retinoic retinoic ADJ ct-9454 74 21 acid acid NOUN ct-9454 74 22 and and CCONJ ct-9454 74 23 resveratrol resveratrol NOUN ct-9454 74 24 , , PUNCT ct-9454 74 25 resulted result VERB ct-9454 74 26 in in ADP ct-9454 74 27 a a DET ct-9454 74 28 21.5or 21.5or NUM ct-9454 74 29 58.4 58.4 NUM ct-9454 74 30 - - NOUN ct-9454 74 31 fold fold NOUN ct-9454 74 32 ( ( PUNCT ct-9454 74 33 wa09 wa09 PROPN ct-9454 74 34 p p NOUN ct-9454 74 35 = = NOUN ct-9454 74 36 0.005 0.005 NUM ct-9454 74 37 and and CCONJ ct-9454 74 38 esi051 esi051 ADJ ct-9454 74 39 p p NOUN ct-9454 74 40 = = NOUN ct-9454 74 41 0.001 0.001 NUM ct-9454 74 42 ) ) PUNCT ct-9454 74 43 increase increase NOUN ct-9454 74 44 in in ADP ct-9454 74 45 granulosa granulosa NOUN ct-9454 74 46 cell cell NOUN ct-9454 74 47 marker marker NOUN ct-9454 74 48 amhr2 amhr2 NOUN ct-9454 74 49 at at ADP ct-9454 74 50 day day NOUN ct-9454 74 51 10 10 NUM ct-9454 74 52 . . PUNCT ct-9454 75 1 fold fold ADJ ct-9454 75 2 change change NOUN ct-9454 75 3 calculated calculate VERB ct-9454 75 4 against against ADP ct-9454 75 5 b2 b2 NOUN ct-9454 75 6 m m PROPN ct-9454 75 7 and and CCONJ ct-9454 75 8 compared compare VERB ct-9454 75 9 to to ADP ct-9454 75 10 vehicle vehicle NOUN ct-9454 75 11 controls control NOUN ct-9454 75 12 at at ADP ct-9454 75 13 each each DET ct-9454 75 14 timepoint timepoint NOUN ct-9454 75 15 , , PUNCT ct-9454 75 16 n n NOUN ct-9454 75 17 = = SYM ct-9454 75 18 3 3 X ct-9454 75 19 . . PUNCT ct-9454 75 20 ( ( PUNCT ct-9454 75 21 b b X ct-9454 75 22 ) ) PUNCT ct-9454 75 23 facs fac NOUN ct-9454 75 24 analysis analysis NOUN ct-9454 75 25 of of ADP ct-9454 75 26 amhr2 amhr2 NOUN ct-9454 75 27 - - PUNCT ct-9454 75 28 labeled label VERB ct-9454 75 29 cells cell NOUN ct-9454 75 30 in in ADP ct-9454 75 31 undifferentiated undifferentiated ADJ ct-9454 75 32 cells cell NOUN ct-9454 75 33 and and CCONJ ct-9454 75 34 at at ADP ct-9454 75 35 day day NOUN ct-9454 75 36 10 10 NUM ct-9454 75 37 of of ADP ct-9454 75 38 a a DET ct-9454 75 39 differentiation differentiation NOUN ct-9454 75 40 under under ADP ct-9454 75 41 vehicle vehicle NOUN ct-9454 75 42 control control NOUN ct-9454 75 43 conditions condition NOUN ct-9454 75 44 or or CCONJ ct-9454 75 45 under under ADP ct-9454 75 46 directed direct VERB ct-9454 75 47 differentiation differentiation NOUN ct-9454 75 48 conditions condition NOUN ct-9454 75 49 . . PUNCT ct-9454 76 1 the the DET ct-9454 76 2 population population NOUN ct-9454 76 3 of of ADP ct-9454 76 4 amhr2 amhr2 NOUN ct-9454 76 5 + + NUM ct-9454 76 6 cells cell NOUN ct-9454 76 7 was be AUX ct-9454 76 8 unchanged unchanged ADJ ct-9454 76 9 for for ADP ct-9454 76 10 wa09 wa09 PROPN ct-9454 76 11 cells cell NOUN ct-9454 76 12 at at ADP ct-9454 76 13 day day NOUN ct-9454 76 14 10 10 NUM ct-9454 76 15 of of ADP ct-9454 76 16 differentiation differentiation NOUN ct-9454 76 17 ( ( PUNCT ct-9454 76 18 p p X ct-9454 76 19 > > X ct-9454 76 20 0.05 0.05 NUM ct-9454 76 21 ) ) PUNCT ct-9454 76 22 and and CCONJ ct-9454 76 23 increased increase VERB ct-9454 76 24 over over ADP ct-9454 76 25 vehicle vehicle NOUN ct-9454 76 26 for for ADP ct-9454 76 27 esi051 esi051 ADJ ct-9454 76 28 cells cell NOUN ct-9454 76 29 ( ( PUNCT ct-9454 76 30 p p NOUN ct-9454 76 31 = = NOUN ct-9454 76 32 0.008 0.008 NUM ct-9454 76 33 ) ) PUNCT ct-9454 76 34 . . PUNCT ct-9454 77 1 discussion discussion NOUN ct-9454 77 2 the the DET ct-9454 77 3 need need NOUN ct-9454 77 4 for for ADP ct-9454 77 5 a a DET ct-9454 77 6 psc psc ADJ ct-9454 77 7 - - PUNCT ct-9454 77 8 derived derive VERB ct-9454 77 9 ovarian ovarian ADJ ct-9454 77 10 microenvironment microenvironment NOUN ct-9454 77 11 containing contain VERB ct-9454 77 12 granulosa granulosa NOUN ct-9454 77 13 cell cell NOUN ct-9454 77 14 precursors precursor NOUN ct-9454 77 15 to to PART ct-9454 77 16 complement complement VERB ct-9454 77 17 strategies strategy NOUN ct-9454 77 18 for for ADP ct-9454 77 19 the the DET ct-9454 77 20 generation generation NOUN ct-9454 77 21 of of ADP ct-9454 77 22 functional functional ADJ ct-9454 77 23 eggs egg NOUN ct-9454 77 24 across across ADP ct-9454 77 25 species specie NOUN ct-9454 77 26 is be AUX ct-9454 77 27 apparent apparent ADJ ct-9454 77 28 , , PUNCT ct-9454 77 29 as as SCONJ ct-9454 77 30 future future ADJ ct-9454 77 31 applications application NOUN ct-9454 77 32 can can AUX ct-9454 77 33 not not PART ct-9454 77 34 rely rely VERB ct-9454 77 35 on on ADP ct-9454 77 36 a a DET ct-9454 77 37 steady steady ADJ ct-9454 77 38 source source NOUN ct-9454 77 39 of of ADP ct-9454 77 40 fetal fetal ADJ ct-9454 77 41 gonads gonad NOUN ct-9454 77 42 to to PART ct-9454 77 43 serve serve VERB ct-9454 77 44 in in ADP ct-9454 77 45 this this DET ct-9454 77 46 capacity capacity NOUN ct-9454 77 47 . . PUNCT ct-9454 78 1 although although SCONJ ct-9454 78 2 mice mouse NOUN ct-9454 78 3 have have AUX ct-9454 78 4 served serve VERB ct-9454 78 5 as as ADP ct-9454 78 6 an an DET ct-9454 78 7 important important ADJ ct-9454 78 8 model model NOUN ct-9454 78 9 for for ADP ct-9454 78 10 understanding understand VERB ct-9454 78 11 mammalian mammalian ADJ ct-9454 78 12 ovarian ovarian ADJ ct-9454 78 13 organogenesis organogenesis NOUN ct-9454 78 14 , , PUNCT ct-9454 78 15 key key ADJ ct-9454 78 16 differences difference NOUN ct-9454 78 17 in in ADP ct-9454 78 18 the the DET ct-9454 78 19 timing timing NOUN ct-9454 78 20 of of ADP ct-9454 78 21 differentiation differentiation NOUN ct-9454 78 22 processes process NOUN ct-9454 78 23 , , PUNCT ct-9454 78 24 including include VERB ct-9454 78 25 folliculogenesis folliculogenesis NOUN ct-9454 78 26 , , PUNCT ct-9454 78 27 across across ADP ct-9454 78 28 species specie NOUN ct-9454 78 29 call call NOUN ct-9454 78 30 for for ADP ct-9454 78 31 an an DET ct-9454 78 32 assessment assessment NOUN ct-9454 78 33 of of ADP ct-9454 78 34 the the DET ct-9454 78 35 developmental developmental ADJ ct-9454 78 36 timeline timeline NOUN ct-9454 78 37 , , PUNCT ct-9454 78 38 when when SCONJ ct-9454 78 39 possible possible ADJ ct-9454 78 40 . . PUNCT ct-9454 79 1 to to ADP ct-9454 79 2 this this DET ct-9454 79 3 end end NOUN ct-9454 79 4 , , PUNCT ct-9454 79 5 we we PRON ct-9454 79 6 previously previously ADV ct-9454 79 7 completed complete VERB ct-9454 79 8 a a DET ct-9454 79 9 comprehensive comprehensive ADJ ct-9454 79 10 proteomic proteomic ADJ ct-9454 79 11 analysis analysis NOUN ct-9454 79 12 of of ADP ct-9454 79 13 human human ADJ ct-9454 79 14 fetal fetal ADJ ct-9454 79 15 ovarian ovarian ADJ ct-9454 79 16 tissue12 tissue12 NOUN ct-9454 79 17 to to PART ct-9454 79 18 inform inform VERB ct-9454 79 19 us we PRON ct-9454 79 20 in in ADP ct-9454 79 21 the the DET ct-9454 79 22 selection selection NOUN ct-9454 79 23 of of ADP ct-9454 79 24 our our PRON ct-9454 79 25 differentiation differentiation NOUN ct-9454 79 26 pathway pathway NOUN ct-9454 79 27 , , PUNCT ct-9454 79 28 including include VERB ct-9454 79 29 the the DET ct-9454 79 30 significance significance NOUN ct-9454 79 31 of of ADP ct-9454 79 32 wnt wnt NOUN ct-9454 79 33 signaling signal VERB ct-9454 79 34 components.13 components.13 NOUN ct-9454 79 35 additionally additionally ADV ct-9454 79 36 , , PUNCT ct-9454 79 37 research research NOUN ct-9454 79 38 has have AUX ct-9454 79 39 shed shed VERB ct-9454 79 40 light light NOUN ct-9454 79 41 on on ADP ct-9454 79 42 the the DET ct-9454 79 43 origin origin NOUN ct-9454 79 44 of of ADP ct-9454 79 45 granulosa granulosa NOUN ct-9454 79 46 cells cell NOUN ct-9454 79 47 , , PUNCT ct-9454 79 48 using use VERB ct-9454 79 49 various various ADJ ct-9454 79 50 animal animal NOUN ct-9454 79 51 model model NOUN ct-9454 79 52 systems system NOUN ct-9454 79 53 to to PART ct-9454 79 54 lineage lineage VERB ct-9454 79 55 trace trace NOUN ct-9454 79 56 cells cell NOUN ct-9454 79 57 and and CCONJ ct-9454 79 58 estimate estimate VERB ct-9454 79 59 the the DET ct-9454 79 60 dynamics dynamic NOUN ct-9454 79 61 of of ADP ct-9454 79 62 follicle follicle NOUN ct-9454 79 63 formation formation NOUN ct-9454 79 64 . . PUNCT ct-9454 80 1 granulosa granulosa NOUN ct-9454 80 2 cells cell NOUN ct-9454 80 3 were be AUX ct-9454 80 4 once once ADV ct-9454 80 5 assumed assume VERB ct-9454 80 6 to to PART ct-9454 80 7 be be AUX ct-9454 80 8 derived derive VERB ct-9454 80 9 from from ADP ct-9454 80 10 either either CCONJ ct-9454 80 11 the the DET ct-9454 80 12 mesonephros mesonephro NOUN ct-9454 80 13 , , PUNCT ct-9454 80 14 from from ADP ct-9454 80 15 which which PRON ct-9454 80 16 ovarian ovarian ADJ ct-9454 80 17 somatic somatic ADJ ct-9454 80 18 tissues tissue NOUN ct-9454 80 19 arise arise VERB ct-9454 80 20 during during ADP ct-9454 80 21 development development NOUN ct-9454 80 22 , , PUNCT ct-9454 80 23 or or CCONJ ct-9454 80 24 the the DET ct-9454 80 25 ovarian ovarian ADJ ct-9454 80 26 surface surface NOUN ct-9454 80 27 epithelium.14 epithelium.14 NOUN ct-9454 80 28 - - PUNCT ct-9454 80 29 16 16 NUM ct-9454 80 30 in in ADP ct-9454 80 31 mice mouse NOUN ct-9454 80 32 , , PUNCT ct-9454 80 33 granulosa granulosa NOUN ct-9454 80 34 cells cell NOUN ct-9454 80 35 originate originate VERB ct-9454 80 36 from from ADP ct-9454 80 37 the the DET ct-9454 80 38 surface surface NOUN ct-9454 80 39 epithelium epithelium NOUN ct-9454 80 40 and and CCONJ ct-9454 80 41 may may AUX ct-9454 80 42 constitute constitute VERB ct-9454 80 43 several several ADJ ct-9454 80 44 waves wave NOUN ct-9454 80 45 of of ADP ct-9454 80 46 differentiation.17 differentiation.17 NOUN ct-9454 80 47 in in ADP ct-9454 80 48 bovine bovine NOUN ct-9454 80 49 models model NOUN ct-9454 80 50 , , PUNCT ct-9454 80 51 precursors precursor NOUN ct-9454 80 52 to to ADP ct-9454 80 53 these these DET ct-9454 80 54 cells cell NOUN ct-9454 80 55 , , PUNCT ct-9454 80 56 termed term VERB ct-9454 80 57 gonadal gonadal NOUN ct-9454 80 58 ridge ridge NOUN ct-9454 80 59 epithelial epithelial ADJ ct-9454 80 60 ( ( PUNCT ct-9454 80 61 grel grel NOUN ct-9454 80 62 ) ) PUNCT ct-9454 80 63 cells cell NOUN ct-9454 80 64 , , PUNCT ct-9454 80 65 express express VERB ct-9454 80 66 lgr5 lgr5 NOUN ct-9454 80 67 and and CCONJ ct-9454 80 68 appear appear VERB ct-9454 80 69 to to PART ct-9454 80 70 act act VERB ct-9454 80 71 similar similar ADJ ct-9454 80 72 to to ADP ct-9454 80 73 other other ADJ ct-9454 80 74 epithelial epithelial ADJ ct-9454 80 75 stem stem NOUN ct-9454 80 76 cell cell NOUN ct-9454 80 77 niches niche NOUN ct-9454 80 78 , , PUNCT ct-9454 80 79 in in ADP ct-9454 80 80 which which PRON ct-9454 80 81 cells cell NOUN ct-9454 80 82 are be AUX ct-9454 80 83 differentiated differentiate VERB ct-9454 80 84 and and CCONJ ct-9454 80 85 migrate migrate VERB ct-9454 80 86 into into ADP ct-9454 80 87 the the DET ct-9454 80 88 ovary ovary NOUN ct-9454 80 89 to to PART ct-9454 80 90 form form VERB ct-9454 80 91 primordial primordial ADJ ct-9454 80 92 follicles.18 follicles.18 NOUN ct-9454 80 93 although although SCONJ ct-9454 80 94 these these DET ct-9454 80 95 experiments experiment NOUN ct-9454 80 96 have have AUX ct-9454 80 97 begun begin VERB ct-9454 80 98 to to PART ct-9454 80 99 elucidate elucidate VERB ct-9454 80 100 the the DET ct-9454 80 101 origin origin NOUN ct-9454 80 102 and and CCONJ ct-9454 80 103 differentiation differentiation NOUN ct-9454 80 104 pathway pathway NOUN ct-9454 80 105 of of ADP ct-9454 80 106 granulosa granulosa NOUN ct-9454 80 107 cells cell NOUN ct-9454 80 108 , , PUNCT ct-9454 80 109 none none NOUN ct-9454 80 110 have have AUX ct-9454 80 111 identified identify VERB ct-9454 80 112 whether whether SCONJ ct-9454 80 113 these these DET ct-9454 80 114 pathways pathway NOUN ct-9454 80 115 are be AUX ct-9454 80 116 directly directly ADV ct-9454 80 117 paralleled parallel VERB ct-9454 80 118 in in ADP ct-9454 80 119 human human ADJ ct-9454 80 120 ovarian ovarian ADJ ct-9454 80 121 organogenesis organogenesis NOUN ct-9454 80 122 , , PUNCT ct-9454 80 123 and and CCONJ ct-9454 80 124 efforts effort NOUN ct-9454 80 125 to to PART ct-9454 80 126 find find VERB ct-9454 80 127 conserved conserved ADJ ct-9454 80 128 pathways pathway NOUN ct-9454 80 129 between between ADP ct-9454 80 130 species specie NOUN ct-9454 80 131 have have AUX ct-9454 80 132 been be AUX ct-9454 80 133 sporadic sporadic ADJ ct-9454 80 134 . . PUNCT ct-9454 81 1 here here ADV ct-9454 81 2 , , PUNCT ct-9454 81 3 building build VERB ct-9454 81 4 upon upon SCONJ ct-9454 81 5 previously previously ADV ct-9454 81 6 established establish VERB ct-9454 81 7 protocols protocol NOUN ct-9454 81 8 we we PRON ct-9454 81 9 demonstrated demonstrate VERB ct-9454 81 10 a a DET ct-9454 81 11 protocol protocol NOUN ct-9454 81 12 for for ADP ct-9454 81 13 the the DET ct-9454 81 14 stepwise stepwise NOUN ct-9454 81 15 directed direct VERB ct-9454 81 16 differentiation differentiation NOUN ct-9454 81 17 of of ADP ct-9454 81 18 granulosa granulosa NOUN ct-9454 81 19 precursor precursor NOUN ct-9454 81 20 cells cell NOUN ct-9454 81 21 from from ADP ct-9454 81 22 human human ADJ ct-9454 81 23 pscs psc NOUN ct-9454 81 24 . . PUNCT ct-9454 82 1 first first ADV ct-9454 82 2 , , PUNCT ct-9454 82 3 mesendoderm mesendoderm NOUN ct-9454 82 4 was be AUX ct-9454 82 5 differentiated differentiate VERB ct-9454 82 6 from from ADP ct-9454 82 7 hescs hesc NOUN ct-9454 82 8 by by ADP ct-9454 82 9 activating activate VERB ct-9454 82 10 wnt wnt NOUN ct-9454 82 11 signaling signal VERB ct-9454 82 12 via via ADP ct-9454 82 13 gsk3 gsk3 NOUN ct-9454 82 14 inhibition inhibition NOUN ct-9454 82 15 with with ADP ct-9454 82 16 the the DET ct-9454 82 17 small small ADJ ct-9454 82 18 molecule molecule NOUN ct-9454 82 19 , , PUNCT ct-9454 82 20 chir99021 chir99021 PROPN ct-9454 82 21 , , PUNCT ct-9454 82 22 which which PRON ct-9454 82 23 dramatically dramatically ADV ct-9454 82 24 increased increase VERB ct-9454 82 25 the the DET ct-9454 82 26 expression expression NOUN ct-9454 82 27 of of ADP ct-9454 82 28 mesendoderm mesendoderm NOUN ct-9454 82 29 marker marker NOUN ct-9454 82 30 t t PROPN ct-9454 82 31 within within ADP ct-9454 82 32 24 24 NUM ct-9454 82 33 48 48 NUM ct-9454 82 34 hours hour NOUN ct-9454 82 35 of of ADP ct-9454 82 36 culture culture NOUN ct-9454 82 37 . . PUNCT ct-9454 83 1 this this PRON ct-9454 83 2 was be AUX ct-9454 83 3 consistent consistent ADJ ct-9454 83 4 with with ADP ct-9454 83 5 previously previously ADV ct-9454 83 6 established establish VERB ct-9454 83 7 protocols protocol NOUN ct-9454 83 8 , , PUNCT ct-9454 83 9 in in ADP ct-9454 83 10 which which PRON ct-9454 83 11 treatment treatment NOUN ct-9454 83 12 with with ADP ct-9454 83 13 chir99021 chir99021 PROPN ct-9454 83 14 significantly significantly ADV ct-9454 83 15 and and CCONJ ct-9454 83 16 reliably reliably ADV ct-9454 83 17 induced induce VERB ct-9454 83 18 t t NOUN ct-9454 83 19 expression expression NOUN ct-9454 83 20 within within ADP ct-9454 83 21 the the DET ct-9454 83 22 first first ADJ ct-9454 83 23 2 2 NUM ct-9454 83 24 days day NOUN ct-9454 83 25 of of ADP ct-9454 83 26 treatment.19 treatment.19 NOUN ct-9454 83 27 subsequently subsequently ADV ct-9454 83 28 , , PUNCT ct-9454 83 29 bfgf bfgf PROPN ct-9454 83 30 clinical clinical ADJ ct-9454 83 31 theriogenology theriogenology NOUN ct-9454 84 1 • • NOUN ct-9454 84 2 volume volume NOUN ct-9454 84 3 12 12 NUM ct-9454 84 4 number number NOUN ct-9454 84 5 4 4 NUM ct-9454 84 6 • • NOUN ct-9454 84 7 december december PROPN ct-9454 84 8 2020533 2020533 NUM ct-9454 84 9                     SPACE ct-9454 84 10 and and CCONJ ct-9454 84 11 retinoic retinoic PROPN ct-9454 84 12 acid acid PROPN ct-9454 84 13 were be AUX ct-9454 84 14 simultaneously simultaneously ADV ct-9454 84 15 applied20 applied20 ADJ ct-9454 84 16 to to PART ct-9454 84 17 induce induce VERB ct-9454 84 18 cells cell NOUN ct-9454 84 19 of of ADP ct-9454 84 20 the the DET ct-9454 84 21 intermediate intermediate ADJ ct-9454 84 22 mesoderm mesoderm NOUN ct-9454 84 23 , , PUNCT ct-9454 84 24 from from ADP ct-9454 84 25 which which PRON ct-9454 84 26 the the DET ct-9454 84 27 gonads gonad NOUN ct-9454 84 28 are be AUX ct-9454 84 29 derived derive VERB ct-9454 84 30 and and CCONJ ct-9454 84 31 prior prior ADV ct-9454 84 32 to to ADP ct-9454 84 33 formation formation NOUN ct-9454 84 34 of of ADP ct-9454 84 35 pregranulosa pregranulosa NOUN ct-9454 84 36 cells cell NOUN ct-9454 84 37 . . PUNCT ct-9454 85 1 following follow VERB ct-9454 85 2 successful successful ADJ ct-9454 85 3 differentiation differentiation NOUN ct-9454 85 4 to to ADP ct-9454 85 5 intermediate intermediate ADJ ct-9454 85 6 mesoderm mesoderm NOUN ct-9454 85 7 , , PUNCT ct-9454 85 8 induction induction NOUN ct-9454 85 9 of of ADP ct-9454 85 10 notch notch ADJ ct-9454 85 11 signaling signal VERB ct-9454 85 12 , , PUNCT ct-9454 85 13 a a DET ct-9454 85 14 requisite requisite NOUN ct-9454 85 15 for for ADP ct-9454 85 16 the the DET ct-9454 85 17 initiation initiation NOUN ct-9454 85 18 of of ADP ct-9454 85 19 granulosa granulosa NOUN ct-9454 85 20 cell cell NOUN ct-9454 85 21 specification specification NOUN ct-9454 85 22 and and CCONJ ct-9454 85 23 the the DET ct-9454 85 24 onset onset NOUN ct-9454 85 25 of of ADP ct-9454 85 26 folliculogenesis folliculogenesis NOUN ct-9454 85 27 , , PUNCT ct-9454 85 28 was be AUX ct-9454 85 29 applied apply VERB ct-9454 85 30 through through ADP ct-9454 85 31 addition addition NOUN ct-9454 85 32 of of ADP ct-9454 85 33 compounds compound NOUN ct-9454 85 34 jagged jag VERB ct-9454 85 35 1 1 NUM ct-9454 85 36 ligand ligand NOUN ct-9454 85 37 , , PUNCT ct-9454 85 38 or or CCONJ ct-9454 85 39 the the DET ct-9454 85 40 compound compound NOUN ct-9454 85 41 resveratrol.21,22 resveratrol.21,22 NOUN ct-9454 85 42 this this DET ct-9454 85 43 stepwise stepwise ADJ ct-9454 85 44 differentiation differentiation NOUN ct-9454 85 45 was be AUX ct-9454 85 46 successful successful ADJ ct-9454 85 47 in in ADP ct-9454 85 48 generating generate VERB ct-9454 85 49 cells cell NOUN ct-9454 85 50 with with ADP ct-9454 85 51 increased increase VERB ct-9454 85 52 expression expression NOUN ct-9454 85 53 of of ADP ct-9454 85 54 foxl2 foxl2 PROPN ct-9454 85 55 and and CCONJ ct-9454 85 56 amhr2 amhr2 NOUN ct-9454 85 57 , , PUNCT ct-9454 85 58 markers marker NOUN ct-9454 85 59 of of ADP ct-9454 85 60 pregranulosa pregranulosa NOUN ct-9454 85 61 and and CCONJ ct-9454 85 62 early early ADJ ct-9454 85 63 granulosa granulosa NOUN ct-9454 85 64 cells cell NOUN ct-9454 85 65 , , PUNCT ct-9454 85 66 respectively respectively ADV ct-9454 85 67 . . PUNCT ct-9454 86 1 additionally additionally ADV ct-9454 86 2 , , PUNCT ct-9454 86 3 amhr2 amhr2 PROPN ct-9454 86 4 is be AUX ct-9454 86 5 a a DET ct-9454 86 6 viable viable ADJ ct-9454 86 7 target target NOUN ct-9454 86 8 for for ADP ct-9454 86 9 live live ADJ ct-9454 86 10 cell cell NOUN ct-9454 86 11 antibody antibody NOUN ct-9454 86 12 tagging tagging NOUN ct-9454 86 13 and and CCONJ ct-9454 86 14 subsequent subsequent ADJ ct-9454 86 15 facs fac NOUN ct-9454 86 16 sorting sort VERB ct-9454 86 17 for for ADP ct-9454 86 18 culture culture NOUN ct-9454 86 19 and and CCONJ ct-9454 86 20 analysis analysis NOUN ct-9454 86 21 . . PUNCT ct-9454 87 1 this this DET ct-9454 87 2 approach approach NOUN ct-9454 87 3 has have VERB ct-9454 87 4 several several ADJ ct-9454 87 5 important important ADJ ct-9454 87 6 benefits benefit NOUN ct-9454 87 7 ; ; PUNCT ct-9454 87 8 primarily primarily ADV ct-9454 87 9 , , PUNCT ct-9454 87 10 the the DET ct-9454 87 11 differentiation differentiation NOUN ct-9454 87 12 time time NOUN ct-9454 87 13 is be AUX ct-9454 87 14 relatively relatively ADV ct-9454 87 15 brief brief ADJ ct-9454 87 16 ( ( PUNCT ct-9454 87 17 days day NOUN ct-9454 87 18 ) ) PUNCT ct-9454 87 19 and and CCONJ ct-9454 87 20 does do AUX ct-9454 87 21 not not PART ct-9454 87 22 require require VERB ct-9454 87 23 embryoid embryoid NUM ct-9454 87 24 body body NOUN ct-9454 87 25 formation formation NOUN ct-9454 87 26 , , PUNCT ct-9454 87 27 reducing reduce VERB ct-9454 87 28 the the DET ct-9454 87 29 labor labor NOUN ct-9454 87 30 associated associate VERB ct-9454 87 31 with with ADP ct-9454 87 32 embryoid embryoid NUM ct-9454 87 33 bodies body NOUN ct-9454 87 34 and and CCONJ ct-9454 87 35 spheroid spheroid NOUN ct-9454 87 36 formation formation NOUN ct-9454 87 37 ; ; PUNCT ct-9454 87 38 second second X ct-9454 87 39 , , PUNCT ct-9454 87 40 the the DET ct-9454 87 41 sorting sorting NOUN ct-9454 87 42 of of ADP ct-9454 87 43 amhr2 amhr2 NOUN ct-9454 87 44 - - PUNCT ct-9454 87 45 labeled label VERB ct-9454 87 46 cells cell NOUN ct-9454 87 47 does do AUX ct-9454 87 48 not not PART ct-9454 87 49 require require VERB ct-9454 87 50 genetic genetic ADJ ct-9454 87 51 manipulation manipulation NOUN ct-9454 87 52 to to PART ct-9454 87 53 generate generate VERB ct-9454 87 54 a a DET ct-9454 87 55 reporter reporter NOUN ct-9454 87 56 line line NOUN ct-9454 87 57 for for ADP ct-9454 87 58 identification identification NOUN ct-9454 87 59 and and CCONJ ct-9454 87 60 isolation isolation NOUN ct-9454 87 61 , , PUNCT ct-9454 87 62 making make VERB ct-9454 87 63 this this DET ct-9454 87 64 strategy strategy NOUN ct-9454 87 65 widely widely ADV ct-9454 87 66 applicable applicable ADJ ct-9454 87 67 . . PUNCT ct-9454 88 1 finally finally ADV ct-9454 88 2 , , PUNCT ct-9454 88 3 whereas whereas SCONJ ct-9454 88 4 the the DET ct-9454 88 5 mammalian mammalian ADJ ct-9454 88 6 ovary ovary ADJ ct-9454 88 7 functions function NOUN ct-9454 88 8 to to PART ct-9454 88 9 develop develop VERB ct-9454 88 10 and and CCONJ ct-9454 88 11 mature mature ADJ ct-9454 88 12 oocytes oocyte NOUN ct-9454 88 13 for for ADP ct-9454 88 14 reproduction reproduction NOUN ct-9454 88 15 , , PUNCT ct-9454 88 16 it it PRON ct-9454 88 17 is be AUX ct-9454 88 18 a a DET ct-9454 88 19 vital vital ADJ ct-9454 88 20 component component NOUN ct-9454 88 21 of of ADP ct-9454 88 22 the the DET ct-9454 88 23 tightly tightly ADV ct-9454 88 24 regulated regulate VERB ct-9454 88 25 hypothalamic hypothalamic ADJ ct-9454 88 26 - - PUNCT ct-9454 88 27 pituitary pituitary ADJ ct-9454 88 28 - - PUNCT ct-9454 88 29 gonadal gonadal NOUN ct-9454 88 30 axis axis NOUN ct-9454 88 31 that that PRON ct-9454 88 32 maintains maintain VERB ct-9454 88 33 hormonal hormonal ADJ ct-9454 88 34 stasis stasis NOUN ct-9454 88 35 throughout throughout ADP ct-9454 88 36 the the DET ct-9454 88 37 female female ADJ ct-9454 88 38 reproductive reproductive ADJ ct-9454 88 39 lifespan lifespan NOUN ct-9454 88 40 in in ADP ct-9454 88 41 mammals mammal NOUN ct-9454 88 42 . . PUNCT ct-9454 89 1 granulosa granulosa NOUN ct-9454 89 2 cells cell NOUN ct-9454 89 3 are be AUX ct-9454 89 4 at at ADP ct-9454 89 5 the the DET ct-9454 89 6 crux crux NOUN ct-9454 89 7 of of ADP ct-9454 89 8 steroid steroid NOUN ct-9454 89 9 production production NOUN ct-9454 89 10 within within ADP ct-9454 89 11 the the DET ct-9454 89 12 ovary ovary NOUN ct-9454 89 13 , , PUNCT ct-9454 89 14 and and CCONJ ct-9454 89 15 , , PUNCT ct-9454 89 16 in in ADP ct-9454 89 17 concert concert NOUN ct-9454 89 18 with with ADP ct-9454 89 19 theca theca NOUN ct-9454 89 20 cells cell NOUN ct-9454 89 21 , , PUNCT ct-9454 89 22 generate generate VERB ct-9454 89 23 estradiol estradiol NOUN ct-9454 89 24 and and CCONJ ct-9454 89 25 progesterone progesterone VERB ct-9454 89 26 in in ADP ct-9454 89 27 response response NOUN ct-9454 89 28 to to ADP ct-9454 89 29 luteinizing luteinize VERB ct-9454 89 30 hormone hormone NOUN ct-9454 89 31 and and CCONJ ct-9454 89 32 follicle follicle VERB ct-9454 89 33 stimulating stimulate VERB ct-9454 89 34 hormone hormone NOUN ct-9454 89 35 surges surge NOUN ct-9454 89 36 during during ADP ct-9454 89 37 reproductive reproductive ADJ ct-9454 89 38 years year NOUN ct-9454 89 39 . . PUNCT ct-9454 90 1 this this PRON ct-9454 90 2 finely finely ADV ct-9454 90 3 tuned tune VERB ct-9454 90 4 steroid steroid NOUN ct-9454 90 5 biosynthesis biosynthesis NOUN ct-9454 90 6 pathway pathway NOUN ct-9454 90 7 is be AUX ct-9454 90 8 disrupted disrupt VERB ct-9454 90 9 due due ADJ ct-9454 90 10 to to PART ct-9454 90 11 follicle follicle VERB ct-9454 90 12 loss loss NOUN ct-9454 90 13 in in ADP ct-9454 90 14 the the DET ct-9454 90 15 case case NOUN ct-9454 90 16 of of ADP ct-9454 90 17 polycystic polycystic ADJ ct-9454 90 18 ovarian ovarian ADJ ct-9454 90 19 syndrome syndrome NOUN ct-9454 90 20 , , PUNCT ct-9454 90 21 in in ADP ct-9454 90 22 response response NOUN ct-9454 90 23 to to ADP ct-9454 90 24 chemotherapeutic chemotherapeutic ADJ ct-9454 90 25 agents agent NOUN ct-9454 90 26 , , PUNCT ct-9454 90 27 exposure exposure NOUN ct-9454 90 28 to to ADP ct-9454 90 29 toxicants toxicant NOUN ct-9454 90 30 , , PUNCT ct-9454 90 31 and and CCONJ ct-9454 90 32 inevitably inevitably ADV ct-9454 90 33 with with ADP ct-9454 90 34 age age NOUN ct-9454 90 35 . . PUNCT ct-9454 91 1 the the DET ct-9454 91 2 development development NOUN ct-9454 91 3 of of ADP ct-9454 91 4 synthetic synthetic ADJ ct-9454 91 5 sources source NOUN ct-9454 91 6 of of ADP ct-9454 91 7 granulosa granulosa NOUN ct-9454 91 8 cells cell NOUN ct-9454 91 9 or or CCONJ ct-9454 91 10 their their PRON ct-9454 91 11 precursors precursor NOUN ct-9454 91 12 from from ADP ct-9454 91 13 pluripotent pluripotent ADJ ct-9454 91 14 stem stem NOUN ct-9454 91 15 cells cell NOUN ct-9454 91 16 is be AUX ct-9454 91 17 not not PART ct-9454 91 18 only only ADV ct-9454 91 19 key key ADJ ct-9454 91 20 to to ADP ct-9454 91 21 the the DET ct-9454 91 22 reproductive reproductive ADJ ct-9454 91 23 success success NOUN ct-9454 91 24 of of ADP ct-9454 91 25 these these DET ct-9454 91 26 artificial artificial ADJ ct-9454 91 27 gametes gamete NOUN ct-9454 91 28 , , PUNCT ct-9454 91 29 but but CCONJ ct-9454 91 30 also also ADV ct-9454 91 31 represents represent VERB ct-9454 91 32 a a DET ct-9454 91 33 putative putative ADJ ct-9454 91 34 way way NOUN ct-9454 91 35 to to PART ct-9454 91 36 address address VERB ct-9454 91 37 the the DET ct-9454 91 38 endocrine endocrine ADJ ct-9454 91 39 disruption disruption NOUN ct-9454 91 40 associated associate VERB ct-9454 91 41 with with ADP ct-9454 91 42 ovarian ovarian ADJ ct-9454 91 43 failure failure NOUN ct-9454 91 44 . . PUNCT ct-9454 92 1 conclusion conclusion NOUN ct-9454 92 2 we we PRON ct-9454 92 3 previously previously ADV ct-9454 92 4 established establish VERB ct-9454 92 5 a a DET ct-9454 92 6 framework framework NOUN ct-9454 92 7 for for ADP ct-9454 92 8 identifying identify VERB ct-9454 92 9 human human ADJ ct-9454 92 10 , , PUNCT ct-9454 92 11 granulosa granulosa NOUN ct-9454 92 12 - - PUNCT ct-9454 92 13 like like ADJ ct-9454 92 14 cells cell NOUN ct-9454 92 15 from from ADP ct-9454 92 16 a a DET ct-9454 92 17 pluripotent pluripotent ADJ ct-9454 92 18 stem stem NOUN ct-9454 92 19 cell cell NOUN ct-9454 92 20 source source NOUN ct-9454 92 21 . . PUNCT ct-9454 93 1 building build VERB ct-9454 93 2 upon upon SCONJ ct-9454 93 3 established establish VERB ct-9454 93 4 protocols protocol NOUN ct-9454 93 5 , , PUNCT ct-9454 93 6 we we PRON ct-9454 93 7 demonstrated demonstrate VERB ct-9454 93 8 a a DET ct-9454 93 9 protocol protocol NOUN ct-9454 93 10 for for ADP ct-9454 93 11 the the DET ct-9454 93 12 stepwise stepwise NOUN ct-9454 93 13 directed direct VERB ct-9454 93 14 differentiation differentiation NOUN ct-9454 93 15 of of ADP ct-9454 93 16 granulosa granulosa NOUN ct-9454 93 17 precursor precursor NOUN ct-9454 93 18 cells cell NOUN ct-9454 93 19 from from ADP ct-9454 93 20 human human ADJ ct-9454 93 21 pscs psc NOUN ct-9454 93 22 . . PUNCT ct-9454 94 1 we we PRON ct-9454 94 2 presented present VERB ct-9454 94 3 a a DET ct-9454 94 4 method method NOUN ct-9454 94 5 to to PART ct-9454 94 6 differentiate differentiate VERB ct-9454 94 7 cells cell NOUN ct-9454 94 8 from from ADP ct-9454 94 9 pluripotent pluripotent ADJ ct-9454 94 10 stem stem NOUN ct-9454 94 11 cells cell NOUN ct-9454 94 12 with with ADP ct-9454 94 13 molecular molecular ADJ ct-9454 94 14 signatures signature NOUN ct-9454 94 15 of of ADP ct-9454 94 16 human human ADJ ct-9454 94 17 granulosa granulosa NOUN ct-9454 94 18 - - PUNCT ct-9454 94 19 like like ADJ ct-9454 94 20 cells cell NOUN ct-9454 94 21 and and CCONJ ct-9454 94 22 we we PRON ct-9454 94 23 have have AUX ct-9454 94 24 provided provide VERB ct-9454 94 25 evidence evidence NOUN ct-9454 94 26 for for ADP ct-9454 94 27 improvements improvement NOUN ct-9454 94 28 , , PUNCT ct-9454 94 29 based base VERB ct-9454 94 30 on on ADP ct-9454 94 31 a a DET ct-9454 94 32 stepwise stepwise NOUN ct-9454 94 33 , , PUNCT ct-9454 94 34 2 2 NUM ct-9454 94 35 - - PUNCT ct-9454 94 36 dimensional dimensional ADJ ct-9454 94 37 protocol protocol NOUN ct-9454 94 38 for for ADP ct-9454 94 39 the the DET ct-9454 94 40 directed direct VERB ct-9454 94 41 differentiation differentiation NOUN ct-9454 94 42 of of ADP ct-9454 94 43 human human ADJ ct-9454 94 44 pscs psc NOUN ct-9454 94 45 . . PUNCT ct-9454 95 1 conflict conflict NOUN ct-9454 95 2 of of ADP ct-9454 95 3 interest interest NOUN ct-9454 95 4 none none NOUN ct-9454 95 5 to to PART ct-9454 95 6 declare declare VERB ct-9454 95 7 . . PUNCT ct-9454 96 1 acknowledgement acknowledgement PROPN ct-9454 96 2 supported support VERB ct-9454 96 3 by by ADP ct-9454 96 4 the the DET ct-9454 96 5 national national PROPN ct-9454 96 6 science science PROPN ct-9454 96 7 foundation foundation PROPN ct-9454 96 8 ( ( PUNCT ct-9454 96 9 nsf nsf NOUN ct-9454 96 10 ) ) PUNCT ct-9454 96 11 career career NOUN ct-9454 96 12 award award NOUN ct-9454 96 13 1750996 1750996 NUM ct-9454 96 14 to to ADP ct-9454 96 15 dw dw PROPN ct-9454 96 16 . . PROPN ct-9454 96 17 references reference NOUN ct-9454 96 18 1 1 NUM ct-9454 96 19 . . PUNCT ct-9454 96 20 hübner hübner NOUN ct-9454 96 21 k k NOUN ct-9454 96 22 , , PUNCT ct-9454 96 23 fuhrmann fuhrmann NOUN ct-9454 96 24 g g PROPN ct-9454 96 25 , , PUNCT ct-9454 96 26 christenson christenson PROPN ct-9454 96 27 lk lk PROPN ct-9454 96 28 , , PUNCT ct-9454 96 29 et et PROPN ct-9454 96 30 al al PROPN ct-9454 96 31 : : PUNCT ct-9454 96 32 derivation derivation NOUN ct-9454 96 33 of of ADP ct-9454 96 34 oocytes oocyte NOUN ct-9454 96 35 from from ADP ct-9454 96 36 mouse mouse NOUN ct-9454 96 37 embryonic embryonic ADJ ct-9454 96 38 stem stem NOUN ct-9454 96 39 cells cell NOUN ct-9454 96 40 . . PUNCT ct-9454 97 1 science science NOUN ct-9454 97 2 2003;300:1251 2003;300:1251 NUM ct-9454 97 3 - - SYM ct-9454 97 4 1256 1256 NUM ct-9454 97 5 . . PUNCT ct-9454 98 1 2 2 X ct-9454 98 2 . . X ct-9454 98 3 nicholas nicholas PROPN ct-9454 98 4 cr cr PROPN ct-9454 98 5 , , PUNCT ct-9454 98 6 haston haston PROPN ct-9454 98 7 km km PROPN ct-9454 98 8 , , PUNCT ct-9454 98 9 grewall grewall PROPN ct-9454 98 10 ak ak PROPN ct-9454 98 11 , , PUNCT ct-9454 98 12 et et PROPN ct-9454 98 13 al al PROPN ct-9454 98 14 : : PUNCT ct-9454 98 15 transplantation transplantation NOUN ct-9454 98 16 directs direct VERB ct-9454 98 17 oocyte oocyte ADJ ct-9454 98 18 maturation maturation NOUN ct-9454 98 19 from from ADP ct-9454 98 20 embryonic embryonic ADJ ct-9454 98 21 stem stem NOUN ct-9454 98 22 cells cell NOUN ct-9454 98 23 and and CCONJ ct-9454 98 24 provides provide VERB ct-9454 98 25 a a DET ct-9454 98 26 therapeutic therapeutic ADJ ct-9454 98 27 strategy strategy NOUN ct-9454 98 28 for for ADP ct-9454 98 29 female female ADJ ct-9454 98 30 infertility infertility NOUN ct-9454 98 31 . . PUNCT ct-9454 99 1 hum hum PROPN ct-9454 99 2 mol mol ADP ct-9454 99 3 genet genet PROPN ct-9454 99 4 2009;18:4376 2009;18:4376 PROPN ct-9454 99 5 - - SYM ct-9454 99 6 4389 4389 NUM ct-9454 99 7 . . PUNCT ct-9454 100 1 3 3 X ct-9454 100 2 . . PUNCT ct-9454 100 3 hayashi hayashi PROPN ct-9454 100 4 k k PROPN ct-9454 100 5 , , PUNCT ct-9454 100 6 ogushi ogushi PROPN ct-9454 100 7 s s PROPN ct-9454 100 8 , , PUNCT ct-9454 100 9 kurimoto kurimoto PROPN ct-9454 100 10 k k PROPN ct-9454 100 11 , , PUNCT ct-9454 100 12 et et PROPN ct-9454 100 13 al al PROPN ct-9454 100 14 : : PUNCT ct-9454 100 15 offspring offspring NOUN ct-9454 100 16 from from ADP ct-9454 100 17 oocytes oocyte NOUN ct-9454 100 18 derived derive VERB ct-9454 100 19 from from ADP ct-9454 100 20 in in ADP ct-9454 100 21 vitro vitro X ct-9454 100 22 primordial primordial ADJ ct-9454 100 23 germ germ NOUN ct-9454 100 24 cell cell NOUN ct-9454 100 25 - - PUNCT ct-9454 100 26 like like ADJ ct-9454 100 27 cells cell NOUN ct-9454 100 28 in in ADP ct-9454 100 29 mice mouse NOUN ct-9454 100 30 . . PUNCT ct-9454 101 1 science science NOUN ct-9454 101 2 2012;338:971 2012;338:971 NUM ct-9454 101 3 - - SYM ct-9454 101 4 975 975 NUM ct-9454 101 5 . . PUNCT ct-9454 101 6 4 4 NUM ct-9454 101 7 . . PUNCT ct-9454 101 8 hayashi hayashi PROPN ct-9454 101 9 k k PROPN ct-9454 101 10 , , PUNCT ct-9454 101 11 hikabe hikabe ADJ ct-9454 101 12 o o NOUN ct-9454 101 13 , , PUNCT ct-9454 101 14 obata obata PROPN ct-9454 101 15 y y PROPN ct-9454 101 16 , , PUNCT ct-9454 101 17 et et PROPN ct-9454 101 18 al al PROPN ct-9454 101 19 : : PUNCT ct-9454 101 20 reconstitution reconstitution NOUN ct-9454 101 21 of of ADP ct-9454 101 22 mouse mouse NOUN ct-9454 101 23 oogenesis oogenesis NOUN ct-9454 101 24 in in ADP ct-9454 101 25 a a DET ct-9454 101 26 dish dish NOUN ct-9454 101 27 from from ADP ct-9454 101 28 pluripotent pluripotent ADJ ct-9454 101 29 stem stem NOUN ct-9454 101 30 cells cell NOUN ct-9454 101 31 . . PUNCT ct-9454 102 1 nat nat PROPN ct-9454 102 2 protoc protoc VERB ct-9454 102 3 2017;12:1733 2017;12:1733 NUM ct-9454 102 4 - - SYM ct-9454 102 5 1744 1744 NUM ct-9454 102 6 . . PUNCT ct-9454 103 1 5 5 X ct-9454 103 2 . . X ct-9454 103 3 hikabe hikabe ADJ ct-9454 103 4 o o NOUN ct-9454 103 5 , , PUNCT ct-9454 103 6 hamazaki hamazaki PROPN ct-9454 103 7 n n NUM ct-9454 103 8 , , PUNCT ct-9454 103 9 nagamatsu nagamatsu NOUN ct-9454 103 10 g g PROPN ct-9454 103 11 , , PUNCT ct-9454 103 12 et et PROPN ct-9454 103 13 al al PROPN ct-9454 103 14 : : PUNCT ct-9454 103 15 reconstitution reconstitution NOUN ct-9454 103 16 in in ADP ct-9454 103 17 vitro vitro X ct-9454 103 18 of of ADP ct-9454 103 19 the the DET ct-9454 103 20 entire entire ADJ ct-9454 103 21 cycle cycle NOUN ct-9454 103 22 of of ADP ct-9454 103 23 the the DET ct-9454 103 24 mouse mouse NOUN ct-9454 103 25 female female ADJ ct-9454 103 26 germ germ NOUN ct-9454 103 27 line line NOUN ct-9454 103 28 . . PUNCT ct-9454 104 1 nature nature NOUN ct-9454 104 2 2016;539:299 2016;539:299 NOUN ct-9454 104 3 - - PUNCT ct-9454 104 4 303 303 NUM ct-9454 104 5 . . PUNCT ct-9454 104 6 6 6 NUM ct-9454 104 7 . . X ct-9454 105 1 tian tian PROPN ct-9454 105 2 c c PROPN ct-9454 105 3 , , PUNCT ct-9454 105 4 liu liu PROPN ct-9454 105 5 l l PROPN ct-9454 105 6 , , PUNCT ct-9454 105 7 ye ye PRON ct-9454 105 8 x x NOUN ct-9454 105 9 , , PUNCT ct-9454 105 10 et et PROPN ct-9454 105 11 al al PROPN ct-9454 105 12 : : PUNCT ct-9454 105 13 functional functional ADJ ct-9454 105 14 oocytes oocyte NOUN ct-9454 105 15 derived derive VERB ct-9454 105 16 from from ADP ct-9454 105 17 granulosa granulosa NOUN ct-9454 105 18 cells cell NOUN ct-9454 105 19 . . PUNCT ct-9454 106 1 cell cell NOUN ct-9454 106 2 rep rep PROPN ct-9454 106 3 2019;29:4256 2019;29:4256 PROPN ct-9454 106 4 - - PUNCT ct-9454 106 5 4267.e9 4267.e9 NOUN ct-9454 106 6 . . PROPN ct-9454 106 7 7 7 X ct-9454 106 8 . . PUNCT ct-9454 106 9 crawford crawford PROPN ct-9454 106 10 pa pa PROPN ct-9454 106 11 , , PUNCT ct-9454 106 12 sadovsky sadovsky PROPN ct-9454 106 13 y y PROPN ct-9454 106 14 , , PUNCT ct-9454 106 15 milbrandt milbrandt PROPN ct-9454 106 16 j j PROPN ct-9454 106 17 : : PUNCT ct-9454 106 18 nuclear nuclear ADJ ct-9454 106 19 receptor receptor NOUN ct-9454 106 20 steroidogenic steroidogenic ADJ ct-9454 106 21 factor factor NOUN ct-9454 106 22 1 1 NUM ct-9454 106 23 directs direct VERB ct-9454 106 24 embryonic embryonic ADJ ct-9454 106 25 stem stem NOUN ct-9454 106 26 cells cell NOUN ct-9454 106 27 toward toward ADP ct-9454 106 28 the the DET ct-9454 106 29 steroidogenic steroidogenic ADJ ct-9454 106 30 lineage lineage NOUN ct-9454 106 31 . . PUNCT ct-9454 107 1 mol mol ADP ct-9454 107 2 cell cell NOUN ct-9454 107 3 biol biol NOUN ct-9454 107 4 1997;17:3997 1997;17:3997 NUM ct-9454 107 5 - - SYM ct-9454 107 6 4006 4006 NUM ct-9454 107 7 . . PUNCT ct-9454 108 1 8 8 NUM ct-9454 108 2 . . NUM ct-9454 108 3 yazawa yazawa PROPN ct-9454 108 4 t t PROPN ct-9454 108 5 , , PUNCT ct-9454 108 6 inanoka inanoka PROPN ct-9454 108 7 y y PROPN ct-9454 108 8 , , PUNCT ct-9454 108 9 mizutani mizutani PROPN ct-9454 108 10 t t PROPN ct-9454 108 11 , , PUNCT ct-9454 108 12 et et PROPN ct-9454 108 13 al al PROPN ct-9454 108 14 : : PUNCT ct-9454 108 15 liver liver NOUN ct-9454 108 16 receptor receptor NOUN ct-9454 108 17 homolog-1 homolog-1 PROPN ct-9454 108 18 regulates regulate VERB ct-9454 108 19 the the DET ct-9454 108 20 transcription transcription NOUN ct-9454 108 21 of of ADP ct-9454 108 22 steroidogenic steroidogenic ADJ ct-9454 108 23 enzymes enzyme NOUN ct-9454 108 24 and and CCONJ ct-9454 108 25 induces induce VERB ct-9454 108 26 the the DET ct-9454 108 27 differentiation differentiation NOUN ct-9454 108 28 of of ADP ct-9454 108 29 mesenchymal mesenchymal ADJ ct-9454 108 30 stem stem NOUN ct-9454 108 31 cells cell NOUN ct-9454 108 32 into into ADP ct-9454 108 33 steroidogenic steroidogenic ADJ ct-9454 108 34 cells cell NOUN ct-9454 108 35 . . PUNCT ct-9454 109 1 endocrinology endocrinology NOUN ct-9454 109 2 2009;150 2009;150 NUM ct-9454 109 3 : : PUNCT ct-9454 109 4 3885 3885 NUM ct-9454 109 5 - - SYM ct-9454 109 6 3893 3893 NUM ct-9454 109 7 . . PUNCT ct-9454 110 1 clinical clinical ADJ ct-9454 110 2 theriogenology theriogenology NOUN ct-9454 110 3 • • NOUN ct-9454 110 4 volume volume NOUN ct-9454 110 5 12 12 NUM ct-9454 110 6 number number NOUN ct-9454 110 7 4 4 NUM ct-9454 110 8 • • NOUN ct-9454 110 9 december december PROPN ct-9454 110 10 2020 2020 NUM ct-9454 110 11 534 534 NUM ct-9454 110 12                     SPACE ct-9454 110 13 9 9 NUM ct-9454 110 14 . . PUNCT ct-9454 110 15 yazawa yazawa PROPN ct-9454 110 16 t t PROPN ct-9454 110 17 , , PUNCT ct-9454 110 18 kawabe kawabe PROPN ct-9454 110 19 s s PROPN ct-9454 110 20 , , PUNCT ct-9454 110 21 inaoka inaoka PROPN ct-9454 110 22 y y PROPN ct-9454 110 23 , , PUNCT ct-9454 110 24 et et PROPN ct-9454 110 25 al al PROPN ct-9454 110 26 : : PUNCT ct-9454 110 27 differentiation differentiation NOUN ct-9454 110 28 of of ADP ct-9454 110 29 mesenchymal mesenchymal ADJ ct-9454 110 30 stem stem NOUN ct-9454 110 31 cells cell NOUN ct-9454 110 32 and and CCONJ ct-9454 110 33 embryonic embryonic ADJ ct-9454 110 34 stem stem NOUN ct-9454 110 35 cells cell NOUN ct-9454 110 36 into into ADP ct-9454 110 37 s s PART ct-9454 110 38 teroidogenic teroidogenic ADJ ct-9454 110 39 cells cell NOUN ct-9454 110 40 using use VERB ct-9454 110 41 steroidogenic steroidogenic ADJ ct-9454 110 42 factor-1 factor-1 NUM ct-9454 110 43 and and CCONJ ct-9454 110 44 liver liver NOUN ct-9454 110 45 receptor receptor NOUN ct-9454 110 46 homolog-1 homolog-1 PROPN ct-9454 110 47 . . PUNCT ct-9454 111 1 mol mol ADP ct-9454 111 2 cell cell NOUN ct-9454 111 3 endocrinol endocrinol NOUN ct-9454 111 4 2011;336:127 2011;336:127 NUM ct-9454 111 5 - - SYM ct-9454 111 6 132 132 NUM ct-9454 111 7 . . NOUN ct-9454 112 1 10 10 NUM ct-9454 112 2 . . PUNCT ct-9454 113 1 anchan anchan PROPN ct-9454 113 2 r r NOUN ct-9454 113 3 , , PUNCT ct-9454 113 4 gerami gerami ADJ ct-9454 113 5 - - PUNCT ct-9454 113 6 naini naini NOUN ct-9454 113 7 b b PROPN ct-9454 113 8 , , PUNCT ct-9454 113 9 lindsey lindsey PROPN ct-9454 113 10 js js PROPN ct-9454 113 11 , , PUNCT ct-9454 113 12 et et PROPN ct-9454 113 13 al al PROPN ct-9454 113 14 : : PUNCT ct-9454 113 15 efficient efficient ADJ ct-9454 113 16 differentiation differentiation NOUN ct-9454 113 17 of of ADP ct-9454 113 18 steroidogenic steroidogenic ADJ ct-9454 113 19 and and CCONJ ct-9454 113 20 germ germ NOUN ct-9454 113 21 - - PUNCT ct-9454 113 22 like like ADJ ct-9454 113 23 cells cell NOUN ct-9454 113 24 from from ADP ct-9454 113 25 epigenetically epigenetically ADV ct-9454 113 26 - - PUNCT ct-9454 113 27 related relate VERB ct-9454 113 28 ipscs ipscs NOUN ct-9454 113 29 derived derive VERB ct-9454 113 30 from from ADP ct-9454 113 31 ovarian ovarian ADJ ct-9454 113 32 granulosa granulosa NOUN ct-9454 113 33 cells cell NOUN ct-9454 113 34 . . PUNCT ct-9454 114 1 plos plos PROPN ct-9454 114 2 one one NUM ct-9454 114 3 2015;10(3):e0119275 2015;10(3):e0119275 NUM ct-9454 114 4 . . PROPN ct-9454 114 5 11 11 NUM ct-9454 114 6 . . PUNCT ct-9454 115 1 woods woods PROPN ct-9454 115 2 dc dc PROPN ct-9454 115 3 , , PUNCT ct-9454 115 4 white white PROPN ct-9454 115 5 ya ya PROPN ct-9454 115 6 , , PUNCT ct-9454 115 7 niikura niikura PROPN ct-9454 115 8 y y PROPN ct-9454 115 9 , , PUNCT ct-9454 115 10 et et PROPN ct-9454 115 11 al al PROPN ct-9454 115 12 : : PUNCT ct-9454 115 13 embryonic embryonic ADJ ct-9454 115 14 stem stem NOUN ct-9454 115 15 cell cell NOUN ct-9454 115 16 - - PUNCT ct-9454 115 17 derived derive VERB ct-9454 115 18 granulosa granulosa NOUN ct-9454 115 19 cells cell NOUN ct-9454 115 20 participate participate VERB ct-9454 115 21 in in ADP ct-9454 115 22 ovarian ovarian ADJ ct-9454 115 23 follicle follicle NOUN ct-9454 115 24 formation formation NOUN ct-9454 115 25 in in ADP ct-9454 115 26 vitro vitro X ct-9454 115 27 and and CCONJ ct-9454 115 28 in in ADP ct-9454 115 29 vivo vivo NOUN ct-9454 115 30 . . PUNCT ct-9454 116 1 reprod reprod PROPN ct-9454 116 2 sci sci PROPN ct-9454 116 3 2013;20:524 2013;20:524 PROPN ct-9454 116 4 - - PUNCT ct-9454 116 5 535 535 NUM ct-9454 116 6 . . PUNCT ct-9454 116 7 12 12 NUM ct-9454 116 8 . . PUNCT ct-9454 117 1 bothun bothun PROPN ct-9454 117 2 am be AUX ct-9454 117 3 , , PUNCT ct-9454 117 4 gao gao PROPN ct-9454 117 5 y y PROPN ct-9454 117 6 , , PUNCT ct-9454 117 7 takai takai PROPN ct-9454 117 8 y y PROPN ct-9454 117 9 , , PUNCT ct-9454 117 10 et et PROPN ct-9454 117 11 al al PROPN ct-9454 117 12 : : PUNCT ct-9454 117 13 quantitative quantitative ADJ ct-9454 117 14 proteomic proteomic ADJ ct-9454 117 15 profiling profiling NOUN ct-9454 117 16 of of ADP ct-9454 117 17 the the DET ct-9454 117 18 human human ADJ ct-9454 117 19 ovary ovary NOUN ct-9454 117 20 from from ADP ct-9454 117 21 early early ADV ct-9454 117 22 to to ADP ct-9454 117 23 mid mid NOUN ct-9454 117 24 - - NOUN ct-9454 117 25 gestation gestation NOUN ct-9454 117 26 reveals reveal VERB ct-9454 117 27 protein protein NOUN ct-9454 117 28 expression expression NOUN ct-9454 117 29 dynamics dynamic NOUN ct-9454 117 30 of of ADP ct-9454 117 31 oogenesis oogenesis NOUN ct-9454 117 32 and and CCONJ ct-9454 117 33 folliculogenesis folliculogenesis NOUN ct-9454 117 34 . . PUNCT ct-9454 118 1 stem stem NOUN ct-9454 118 2 cells cell NOUN ct-9454 118 3 dev dev VERB ct-9454 118 4 2018;27:723 2018;27:723 PROPN ct-9454 118 5 - - SYM ct-9454 118 6 735 735 NUM ct-9454 118 7 . . NOUN ct-9454 118 8 13 13 NUM ct-9454 118 9 . . PUNCT ct-9454 119 1 bothun bothun PROPN ct-9454 119 2 am be AUX ct-9454 119 3 , , PUNCT ct-9454 119 4 woods woods PROPN ct-9454 119 5 dc dc PROPN ct-9454 119 6 : : PUNCT ct-9454 119 7 dynamics dynamic NOUN ct-9454 119 8 of of ADP ct-9454 119 9 wnt wnt NOUN ct-9454 119 10 signaling signal VERB ct-9454 119 11 components component NOUN ct-9454 119 12 in in ADP ct-9454 119 13 the the DET ct-9454 119 14 human human ADJ ct-9454 119 15 ovary ovary NOUN ct-9454 119 16 from from ADP ct-9454 119 17 development development NOUN ct-9454 119 18 to to ADP ct-9454 119 19 adulthood adulthood PROPN ct-9454 119 20 . . PUNCT ct-9454 120 1 histochem histochem PROPN ct-9454 120 2 cell cell NOUN ct-9454 120 3 biol biol NOUN ct-9454 120 4 2019;151:115 2019;151:115 NUM ct-9454 120 5 - - SYM ct-9454 120 6 123 123 NUM ct-9454 120 7 . . PUNCT ct-9454 121 1 14 14 NUM ct-9454 121 2 . . PUNCT ct-9454 122 1 motta motta PROPN ct-9454 122 2 pm pm PROPN ct-9454 122 3 , , PUNCT ct-9454 122 4 makabe makabe PROPN ct-9454 122 5 s s PART ct-9454 122 6 : : PUNCT ct-9454 122 7 development development NOUN ct-9454 122 8 of of ADP ct-9454 122 9 the the DET ct-9454 122 10 ovarian ovarian ADJ ct-9454 122 11 surface surface NOUN ct-9454 122 12 and and CCONJ ct-9454 122 13 associated associate VERB ct-9454 122 14 germ germ NOUN ct-9454 122 15 cells cell NOUN ct-9454 122 16 in in ADP ct-9454 122 17 the the DET ct-9454 122 18 human human ADJ ct-9454 122 19 fetus fetus NOUN ct-9454 122 20 . . PUNCT ct-9454 123 1 a a DET ct-9454 123 2 correlated correlate VERB ct-9454 123 3 study study NOUN ct-9454 123 4 by by ADP ct-9454 123 5 scanning scan VERB ct-9454 123 6 and and CCONJ ct-9454 123 7 transmission transmission NOUN ct-9454 123 8 electron electron NOUN ct-9454 123 9 microscopy microscopy NOUN ct-9454 123 10 . . PUNCT ct-9454 124 1 cell cell NOUN ct-9454 124 2 tissue tissue NOUN ct-9454 124 3 res re NOUN ct-9454 124 4 1982;226:493 1982;226:493 NUM ct-9454 124 5 - - SYM ct-9454 124 6 510 510 NUM ct-9454 124 7 . . PUNCT ct-9454 124 8 15 15 NUM ct-9454 124 9 . . PUNCT ct-9454 125 1 wilhelm wilhelm PROPN ct-9454 125 2 d d PROPN ct-9454 125 3 , , PUNCT ct-9454 125 4 palmer palmer PROPN ct-9454 125 5 s s PROPN ct-9454 125 6 , , PUNCT ct-9454 125 7 koopman koopman NOUN ct-9454 125 8 p p X ct-9454 125 9 : : PUNCT ct-9454 125 10 sex sex NOUN ct-9454 125 11 determination determination NOUN ct-9454 125 12 and and CCONJ ct-9454 125 13 gonadal gonadal NOUN ct-9454 125 14 development development NOUN ct-9454 125 15 in in ADP ct-9454 125 16 mammals mammal NOUN ct-9454 125 17 . . PUNCT ct-9454 126 1 physiol physiol PROPN ct-9454 126 2 rev rev VERB ct-9454 126 3 2007 2007 NUM ct-9454 126 4 ; ; PUNCT ct-9454 126 5 87:1 87:1 NUM ct-9454 126 6 - - NUM ct-9454 126 7 28 28 NUM ct-9454 126 8 . . PUNCT ct-9454 127 1 16 16 NUM ct-9454 127 2 . . PUNCT ct-9454 128 1 maheshwari maheshwari PROPN ct-9454 128 2 a a PROPN ct-9454 128 3 , , PUNCT ct-9454 128 4 fowler fowler PROPN ct-9454 128 5 pa pa PROPN ct-9454 128 6 : : PUNCT ct-9454 128 7 primordial primordial ADJ ct-9454 128 8 follicular follicular ADJ ct-9454 128 9 assembly assembly NOUN ct-9454 128 10 in in ADP ct-9454 128 11 humans human NOUN ct-9454 128 12 -- -- PUNCT ct-9454 128 13 revisited revisit VERB ct-9454 128 14 . . PUNCT ct-9454 129 1 zygote zygote X ct-9454 129 2 2008;16:285 2008;16:285 NOUN ct-9454 129 3 - - SYM ct-9454 129 4 296 296 NUM ct-9454 129 5 . . PUNCT ct-9454 129 6 17 17 NUM ct-9454 129 7 . . PUNCT ct-9454 129 8 mork mork PROPN ct-9454 129 9 l l PROPN ct-9454 129 10 , , PUNCT ct-9454 129 11 maatouk maatouk PROPN ct-9454 129 12 dm dm PROPN ct-9454 129 13 , , PUNCT ct-9454 129 14 mcmahon mcmahon PROPN ct-9454 129 15 ja ja PROPN ct-9454 129 16 , , PUNCT ct-9454 129 17 et et PROPN ct-9454 129 18 al al PROPN ct-9454 129 19 : : PUNCT ct-9454 129 20 temporal temporal ADJ ct-9454 129 21 differences difference NOUN ct-9454 129 22 in in ADP ct-9454 129 23 granulosa granulosa NOUN ct-9454 129 24 cell cell NOUN ct-9454 129 25 specification specification NOUN ct-9454 129 26 in in ADP ct-9454 129 27 the the DET ct-9454 129 28 ovary ovary ADJ ct-9454 129 29 reflect reflect VERB ct-9454 129 30 distinct distinct ADJ ct-9454 129 31 follicle follicle NOUN ct-9454 129 32 fates fate NOUN ct-9454 129 33 in in ADP ct-9454 129 34 mice mouse NOUN ct-9454 129 35 . . PUNCT ct-9454 130 1 biol biol PROPN ct-9454 130 2 reprod reprod PROPN ct-9454 130 3 2012;86:37 2012;86:37 NUM ct-9454 130 4 . . PUNCT ct-9454 131 1 18 18 NUM ct-9454 131 2 . . PUNCT ct-9454 131 3 hummitzsch hummitzsch PROPN ct-9454 131 4 k k NOUN ct-9454 131 5 , , PUNCT ct-9454 131 6 irving irving PROPN ct-9454 131 7 - - PUNCT ct-9454 131 8 rodgers rodgers PROPN ct-9454 131 9 hf hf PROPN ct-9454 131 10 , , PUNCT ct-9454 131 11 hatzirodos hatzirodo NOUN ct-9454 131 12 n n CCONJ ct-9454 131 13 , , PUNCT ct-9454 131 14 et et PROPN ct-9454 131 15 al al PROPN ct-9454 131 16 : : PUNCT ct-9454 131 17 a a DET ct-9454 131 18 new new ADJ ct-9454 131 19 model model NOUN ct-9454 131 20 of of ADP ct-9454 131 21 development development NOUN ct-9454 131 22 of of ADP ct-9454 131 23 the the DET ct-9454 131 24 mammalian mammalian ADJ ct-9454 131 25 ovary ovary NOUN ct-9454 131 26 and and CCONJ ct-9454 131 27 follicles follicle NOUN ct-9454 131 28 . . PUNCT ct-9454 132 1 plos plos PROPN ct-9454 132 2 one one NUM ct-9454 132 3 2013;8 2013;8 NUM ct-9454 132 4 : : PUNCT ct-9454 132 5 e55578 e55578 PROPN ct-9454 132 6 . . NOUN ct-9454 133 1 19 19 NUM ct-9454 133 2 . . PUNCT ct-9454 133 3 araoka araoka PROPN ct-9454 133 4 t t PROPN ct-9454 133 5 , , PUNCT ct-9454 133 6 mae mae PROPN ct-9454 133 7 s s PROPN ct-9454 133 8 , , PUNCT ct-9454 133 9 kurose kurose PROPN ct-9454 133 10 y y PROPN ct-9454 133 11 , , PUNCT ct-9454 133 12 et et PROPN ct-9454 133 13 al al PROPN ct-9454 133 14 : : PUNCT ct-9454 133 15 efficient efficient ADJ ct-9454 133 16 and and CCONJ ct-9454 133 17 rapid rapid ADJ ct-9454 133 18 induction induction NOUN ct-9454 133 19 of of ADP ct-9454 133 20 human human ADJ ct-9454 133 21 ipscs ipsc NOUN ct-9454 133 22 / / SYM ct-9454 133 23 escs esc NOUN ct-9454 133 24 into into ADP ct-9454 133 25 nephrogenic nephrogenic ADJ ct-9454 133 26 intermediate intermediate ADJ ct-9454 133 27 mesoderm mesoderm NOUN ct-9454 133 28 using use VERB ct-9454 133 29 small small ADJ ct-9454 133 30 molecule molecule NOUN ct-9454 133 31 - - PUNCT ct-9454 133 32 based base VERB ct-9454 133 33 differentiation differentiation NOUN ct-9454 133 34 methods method NOUN ct-9454 133 35 . . PUNCT ct-9454 134 1 plos plos PROPN ct-9454 134 2 one one NUM ct-9454 134 3 2014;9(1):e84881 2014;9(1):e84881 NUM ct-9454 134 4 . . PROPN ct-9454 135 1 20 20 NUM ct-9454 135 2 . . PUNCT ct-9454 136 1 lam lam PROPN ct-9454 136 2 aq aq PROPN ct-9454 136 3 , , PUNCT ct-9454 136 4 freedman freedman PROPN ct-9454 136 5 bs bs PROPN ct-9454 136 6 , , PUNCT ct-9454 136 7 morizane morizane ADJ ct-9454 136 8 r r NOUN ct-9454 136 9 , , PUNCT ct-9454 136 10 et et PROPN ct-9454 136 11 al al PROPN ct-9454 136 12 : : PUNCT ct-9454 136 13 rapid rapid ADJ ct-9454 136 14 and and CCONJ ct-9454 136 15 efficient efficient ADJ ct-9454 136 16 differentiation differentiation NOUN ct-9454 136 17 of of ADP ct-9454 136 18 human human ADJ ct-9454 136 19 pluripotent pluripotent NOUN ct-9454 136 20 stem stem NOUN ct-9454 136 21 cells cell NOUN ct-9454 136 22 into into ADP ct-9454 136 23 intermediate intermediate ADJ ct-9454 136 24 mesoderm mesoderm NOUN ct-9454 136 25 that that PRON ct-9454 136 26 forms form VERB ct-9454 136 27 tubules tubule NOUN ct-9454 136 28 expressing express VERB ct-9454 136 29 kidney kidney NOUN ct-9454 136 30 proximal proximal ADJ ct-9454 136 31 tubular tubular ADJ ct-9454 136 32 markers marker NOUN ct-9454 136 33 . . PUNCT ct-9454 137 1 j j PROPN ct-9454 137 2 am be AUX ct-9454 137 3 soc soc NOUN ct-9454 137 4 nephrol nephrol NOUN ct-9454 137 5 2014;25:1211 2014;25:1211 NUM ct-9454 137 6 - - SYM ct-9454 137 7 1225 1225 NUM ct-9454 137 8 . . PUNCT ct-9454 138 1 21 21 NUM ct-9454 138 2 . . PUNCT ct-9454 139 1 edson edson PROPN ct-9454 139 2 ma ma PROPN ct-9454 139 3 , , PUNCT ct-9454 139 4 nagaraja nagaraja PROPN ct-9454 139 5 ak ak PROPN ct-9454 139 6 , , PUNCT ct-9454 139 7 matzuk matzuk PROPN ct-9454 139 8 mm mm PROPN ct-9454 139 9 : : PUNCT ct-9454 139 10 the the DET ct-9454 139 11 mammalian mammalian ADJ ct-9454 139 12 ovary ovary NOUN ct-9454 139 13 from from ADP ct-9454 139 14 genesis genesis NOUN ct-9454 139 15 to to ADP ct-9454 139 16 revelation revelation NOUN ct-9454 139 17 . . PUNCT ct-9454 140 1 endocr endocr PROPN ct-9454 140 2 rev rev PROPN ct-9454 140 3 2009 2009 NUM ct-9454 140 4 ; ; PUNCT ct-9454 140 5 30:624 30:624 NUM ct-9454 140 6 - - SYM ct-9454 140 7 712 712 NUM ct-9454 140 8 . . PUNCT ct-9454 141 1 22 22 NUM ct-9454 141 2 . . PUNCT ct-9454 141 3 yu yu PROPN ct-9454 141 4 xm xm PROPN ct-9454 141 5 , , PUNCT ct-9454 141 6 jaskula jaskula NOUN ct-9454 141 7 - - PUNCT ct-9454 141 8 sztul sztul NOUN ct-9454 141 9 r r NOUN ct-9454 141 10 , , PUNCT ct-9454 141 11 ahmed ahmed PROPN ct-9454 141 12 k k PROPN ct-9454 141 13 , , PUNCT ct-9454 141 14 et et PROPN ct-9454 141 15 al al PROPN ct-9454 141 16 : : PUNCT ct-9454 141 17 resveratrol resveratrol NOUN ct-9454 141 18 induces induce VERB ct-9454 141 19 differentiation differentiation NOUN ct-9454 141 20 markers marker NOUN ct-9454 141 21 expression expression NOUN ct-9454 141 22 in in ADP ct-9454 141 23 anaplastic anaplastic ADJ ct-9454 141 24 thyroid thyroid NOUN ct-9454 141 25 carcinoma carcinoma NOUN ct-9454 141 26 via via ADP ct-9454 141 27 activation activation NOUN ct-9454 141 28 of of ADP ct-9454 141 29 notch1 notch1 NOUN ct-9454 141 30 signaling signal VERB ct-9454 141 31 and and CCONJ ct-9454 141 32 suppresses suppress VERB ct-9454 141 33 cell cell NOUN ct-9454 141 34 growth growth NOUN ct-9454 141 35 . . PUNCT ct-9454 142 1 mol mol ADP ct-9454 142 2 cancer cancer NOUN ct-9454 142 3 ther ther PROPN ct-9454 143 1 2013;12:1276 2013;12:1276 NUM ct-9454 143 2 - - SYM ct-9454 143 3 1287 1287 NUM ct-9454 143 4 . . PUNCT ct-9454 144 1 clinical clinical ADJ ct-9454 144 2 theriogenology theriogenology NOUN ct-9454 144 3 • • NOUN ct-9454 144 4 volume volume NOUN ct-9454 144 5 12 12 NUM ct-9454 144 6 number number NOUN ct-9454 144 7 4 4 NUM ct-9454 144 8 • • NOUN ct-9454 144 9 december december PROPN ct-9454 144 10 2020535 2020535 NUM