77 general anatomical obervations upon the african catfish (clarias gariepinus) gheorghe radu bologan*, phd student abstract in order to acquire better knowledge of the morphophysiological features of the african catfish there have been done dissections on a varios number of fish of different sex, age, weight. keywords: clarias gariepinus, anatomy, african catfish. material and method eleven male fish have been dissected as following: • three male weighing150gr • four male of 800gr • two male of 1200gr • two male of 500gr female – six weighing between 500-800gr • three 800-1200gr • three 1200-2000gr dissection on the ventral abdominal side with observations upon the main features of the organs and apparatus. results and debates the anatomical and physiological features make the african catfish suitable for an intensive artifical breeding on a large scale in artificial aquacultures of small capacity. the anatomy and physiology of the african catfish. general observations on the anatomy of the african catfish on dissecting the abdominal cavity on the ventral – median side we can observe: • about 90% of the cavity is filled with fat tissue situated in parallel longitudinal fascicle, • stomach, liver, duodenum bulb and the area near the intestine are situated towards the cephalic extremity, * s.c. incavet s.r.l., oradea, e-mail: gheorghe_bologan@yahoo.com cluj veterinary journal, 15(1)/2009, pp. 77-79 78 • excepting the liver, there is a disproportion between the weight which is very big and the reduced dimensions of the digestive organs (cavity, lumen, stomach, intestine), • the oral cavity is extremly large compared its role as a digestive organ, as well as a respiratory organ (branchial filter), • the bucal – oesophagus cavity is large, the oesophagian lumen larger and the stomach extremly small (almost having the dimension of the oesophagus; intestinal lumen is reduced), • has a stomach-omnivorous species, • the liver is a soul organ with two lobes (at other fish species there more lobes), • the pancreas has grape-shaped spread acinus, • the intestine has a spiral first part then an even, descendent-short and reduced lumen, • the existence of the gills and of the arborescent oragan-pseudopulmon, • the kidneys are situated in the backhead under the pectoral fin, in a muscular chamber, strongly capsulated, • reduced heart situated under the oral cavity, • the central nervous system includes the brain and the spinal marrow and the external nervous system includes nerves and two rows of ganglions situated on both sides of the backbone, • pneumatic bladder (fins) heads’ end, arboral brain pan, • the existence of a transverse cavity situated after the fin. conclusions the african catfish-clarias gariepinus is a fish species that posseses a lot of anatomical and physiological features from which i will mention the following: • it has a complementary breathing apparatus – pseudolung, which allows this type of fish to make the necessary exchange in order to breath even in high turbidity level of the water with a low oxygen level. if the oxygen level in the water is reduced this fish lifts itself above water and fills its branchial chamber with air, emerging underwater it can keep the air in this chamber for a long time, • outside the water this fish produces a large quantity of mucus at skin level in order to keep it moist and breath through. this process allows it to survive a long period of time on land, • this omnivorous species has a rapid growing system and holds out various life conditions, • it can be bred in tanks, in closed spaces with thermostat and water pomps keeping it under constant supervision and medium parameters, • due to its respiratory features it can be bred in large masses, anatomotopographic aspect of organs in the abdomen after opening the ventral wall 1-liver, 2-bladder gall, 3-stomach, 4-pre-pyloric (gastro piloric) antrum of intestine, 5-intestine (instestinal anse), 6-fat tissue, 7-anus, 8-uro genital papilla 79 reference 1. adriens d., w. verraes, neth j zool, growth of the suspensiorial and opercular muscles in clarias gariepinus (siluroidei, claridae), 1997. 2. adriens d., w. verraes, neth j zool, growth in siluriform chondocrania, a case study of clarias gariepinus ( burchell, 1822), 1997. 3. bănărescu, p.c., fauna r.p.r. pisces osteichthyes, editura academiei române, 1964. 4. brehm alfred, lumea animalelor, traducere, 1965. 5. bud i., diaconescu ş., mudura m, creşterea crapului şi a altor specii de peşti editura ceres, bucureşti, 2004. 6. bud i., piscicultura – caiet de lucrari practice – tipo agronomia cluj-napoca, acvacultura – curs universitar, tipo agronomia cluj–napoca, 1999. 7. cavaco jeb, vilrockx c, trudeau vl., american journal of phisiology – regulatory pubertal development of male african catfish, clarias gariepinus. 8. deceuninck, v., national reviews for aquaculture development in africa. no 15, congo, fao fisheries circular (770.15), in french, 1988. 9. hegy a., az afrikai harcsa, elet es tudomany – budapest, 2000. 10. hogendoorn h., the african catfish a new species for aquaculture – revista aquacultura, 1992. 11. huet m. traite de pisciculture, ed. wyngant bruxelles, 1970. 12. huet, m., textbook of fish culture. fishing books ltd, surrey, england, 1972. 13. popovici i. şi col., tratat de anatomie comparată splanhnologie, ed. academie pres, clujnapoca pag. 26 – 55; 93 – 222., 2002 24 researches regarding estrus induction and synchronization in sows after weaning professor liviu bogdan*, phd professor ioan groza*, phd assistant mihai cenariu*, phd lecturer simona ciupe*, phd emoke pall*, phd student anamaria petrean*, phd student sorana matei*, phd student* sidonia bogdan**, student abstract the purpose of this paper was to improve the reproductive performances of sows after weaning in a private swine farm. the main objective was to implement modern reproductive biotechnologies (estrus synchronization, artificial insemination and early pregnancy diagnosis) in order to increase the economic efficiency of the reproductive sector of this farm. the biologic material used for the research was represented by 300 sows whose estrus was synchronized using three hormonal procedures (regu-mate administered collectively, regu-mate administered individually and pg600) as well as naturally, using stimulating boars. the results showed that the best methods of estrus induction and synchronization in sows use either regu-mate administered individually in fodder or pg600. key words: sows, estrus, synchronization, artificial insemination, pregnancy, weaning introduction swine breeding has developed as a necessity meant to ensure meat for consumption, therefore the main objective of this industry is to maximize production. swine have the ability to produce a large number of offspring during a short period of time [1,4]. thus, pigs may represent one of the most profitable species among the farm animals. profitability of this sector is largely dependent on the reproductive performance [2,3]. therefore, the main purpose is to wean as many good quality piglets from a sow as possible during a year, with as little expenses as possible [5,6]. the implementation of * university of agricultural sciences and veterinary medicine, faculty of veterinary medicine, department of veterinary reproduction, obstetrics and gynecology, 3-5 manastur street, 400372 cluj-napoca, romania, tel. +40 264 596384 ext. 163, e-mail: medivetbogdan@yahoo.com ** university of agricultural sciences and veterinary medicine, faculty of veterinary medicine cluj veterinary journal, 15(1)/2009, pp. 24-28 25 new biotechnological methods for estrus induction and synchronization in reproduction programs allows the improvement of technological and economical parameters [7,8]. the purpose of this paper was to improve the reproductive performances of sows after weaning in a private swine farm. the main objective was to implement modern reproductive biotechnologies (estrus synchronization, artificial insemination and early pregnancy diagnosis) in order to increase the economic efficiency of the reproductive sector of this farm. material and methods the research has been carried out during november 2008 – may 2009 in a private swine farm from mures county, romania. the farm had a total of 8900 pigs out of which 800 were mother sows, 165 awaiting sows and 13 boars, the rest being used for meat production. the boars belonged to the following breeds: white duroc, maxter, pietrain and great white, while the sows were mixed breeds between pic and one of the previously mentioned boars. the average productive life of the sows was of 5-6 parturitions, with an average of 12 piglets/ parturition and 11.5-11.8 weaned piglets/sow. the biologic material used for the research was represented by 300 sows, 1-4 years of age, mixed breed between pic and great white, duroc and pietrain boars. estrus induction and synchronization was performed using three hormonal procedures (regumate administered collectively, regu-mate administered individually and pg600 – figure 1) as well as naturally, using stimulating boars. the sows were divided into four batches as follows: batch 1 made up of 75 sows whose estrus was induced using the collective administration of regumate in the fodder; batch 2 made up of 75 sows whose estrus was induced using the individual administration of regu-mate in the fodder; batch 3 made up of 75 sows whose estrus was induced using pg600; batch 4 made up of 75 control sows. fig. 1. the hormonal products used semen collection was performed using the manual method, which is efficient and does not imply supplementary costs. the dilution of fresh semen was performed using the trixcel dilution media that maintains the viability of spermatozoa for 7 days (figure 2). 26 fig. 2. semen collection and dillution the optimum moment for insemination was chosen 24 hours after the observation of the immobility syndrome. the sows were artificially inseminated (a.i.) twice (in the morning and in the evening) using 50 ml diluted semen/ dose, with a concentration of 3 billions spermatozoa/dose (fig. 3). the pregnancy diagnosis was performed 30 days after artificial insemination in all sows, using a doppler device (fig. 4). results and discussions following estrus synchronization in batch 1, 67 sows (90%) showed heat symptoms after 5-8 days. the remaining 8 sows (10%) did not show estrus signs during this period. from the 75 sows, 52 (69%) were diagnosed pregnant after the first insemination, 15 (20%) after the second insemination while 8 (11%) did not show estrus signs and therefore were eliminated from the batch. the results obtained for batch 1 are shown in table 1: table 1. results obtained for batch 1 no. regu-mate collectively in fodder number of sows percent 1. number of sows/batch 75 100% 2. sows in heat 67 90% 3. sows that did not show heat signs 8 11% 4. pregnant sows after first insemination 52 69% 5. pregnant sows after the second insemination 15 20% following estrus synchronization in batch 2, 73 sows (97%) showed heat symptoms after 2-3 days. the remaining 3 sows (3%) did not show estrus signs during this period. from the 75 sows, 71 (94%) were diagnosed pregnant after the first insemination, 2 (3%) after the second insemination while 2 (3%) did not show estrus signs and therefore were eliminated from the batch. the results obtained for batch 2 are shown in table 2: fig. 3. a.i. of sows fig. 4. pregnancy diagnosis 27 table 2. results obtained for batch 2 no. regu-mate individually in fodder number of sows percent 1. number of sows/batch 75 100% 2. sows in heat 73 97% 3. sows that did not show heat signs 2 3% 4. pregnant sows after first insemination 71 94% 5. pregnant sows after the second insemination 2 3% following estrus synchronization in batch 3, 74 sows (98%) showed heat symptoms after 2-3 days. the remaining sow (2%) did not show estrus signs during this period. from the 75 sows, 71 (81%) were diagnosed pregnant after the first insemination, 13 (17%) after the second insemination while 1 sow (2%) did not show estrus signs and therefore was eliminated from the batch. the results obtained for batch 3 are shown in table 3: table 3. results obtained for batch 3 no. pg 600 i.m. number of sows percent 1. number of sows/batch 75 100% 2. sows in heat 74 98% 3. sows that did not show heat signs 1 2% 4. pregnant sows after first insemination 61 81% 5. pregnant sows after the second insemination 13 17% in batch 4 (control), 67 (90%) sows showed estrus signs 5-10 days after weaning. the remaining 8 sows (10%) did not show estrus signs during this period. from the 75 sows, 52 (69%) were diagnosed pregnant after the first insemination, 15 (20%) after the second insemination while 8 (11%) did not show estrus signs and therefore were eliminated from the batch. the results obtained for batch 4 are shown in table 4: table 4. results obtained for batch 4 no. control number of sows percent 1. number of sows/batch 75 100% 2. sows in heat 67 90% 3. sows that did not show heat signs 8 11% 4. pregnant sows after first insemination 52 69% 5. pregnant sows after the second insemination 15 20% after delivery and weaning of the resulted piglets belonging to the four batches, the following results have been obtained (table 5): table 5. results obtained after delivery and weaning no. delivered piglets average/sow weaned piglets average/sow 1. batch 1 624 12 468 9 2. batch 2 994 14 710 10 3. batch 3 793 13 610 10 4. batch 4 624 12 468 9 28 conclusions after performing the research, the following conclusions were drawn: 1. the best results for estrus induction and synchronization were obtained in batch 2 and 3 where individual administration of regu-mate and pg600 were used. 2. the number of piglets delivered was also bigger in these two batches, as well as the number of weaned piglets. 3. synchronization of estrus cycle leads to a short service-period and therefore to a larger number of deliveries/productive life of a sow. 4. estrus synchronization also allows the decrease of boar number used for semen collection and therefore the number of artificial inseminations. 5. delivery monitoring avoids the inherent accidents during parturition (dystokia, large fetuses, female exhaustion). references 1. bogdan l. m.: biotehnici în reproducţia animalelor domestice, ed. academic press, cluj-napoca, 2000; 2. bogdan l.m.: reproducţie, obstetrică, terapie şi însămânţări artificiale la animale, ed. academicpres cluj-napoca, 2001; 3. cardenas h., herrick j.r., pope w.f. : increased ovulation rate in gilts treated with dihydrotestosterone, reproduction, vol. 123, 2002; 4. groza i., muntean m.: elemente de fiziologia reproducţiei la animale, ed. academic press, cluj-napoca, 2002; 5. groza i., morar i., andrologie veterinară, ed. gryphon, braşov, 2004; 6. michel r. muirhead, thomas jl. alexander: managing pig health and the treatment of disease, the word renound book, 2002; 7. wise t., klindt j., howard h.j., conley a.j., ford j.j.: endocrine relationships of meishan and white composite females after weaning and during the luteal phase of the estrous cycle, vol. 79, 2001; 8. yen h.w., ford j.j., zimmerman d.r., johnson r.k.: follicular development and maturation in gilts selected for an index of high ovulation rate and high prenatal survival, departament of animal science, university of nebraska, u.s. meat animal research center. microsoft word cvj_24_28_coldea_2622021.docx cluj vet j 2021, 26, 2 http://clujveterinaryjournal.ro communication brain auditory evoked response test, the standard method for the diagnosis of the hereditary deafness in dogs nicolae coldea 1,* 1 ”dr coldea nicolea’’ private practice, 1c tudor arghezi st., sibiu, romania: coldeadvm@yahoo.com * correspondence: coldeadvm@yahoo.com; abstract: hearing deficiency is one of the most common hearing impairments that affect humans and other mammalian alike. hearing loss is not painful or a life-threatening change but can endanger the patient by taking into account a large number of breeds predisposed to hereditary deafness, this short communication aims to synthesize the steps and the method for baer test. for the affected breeds, the baer test is recommended starting at the age of two months. keywords: baer, dog, auditory evoked response test 1. introduction dog breeds that are affected by hereditary deafness: akita, dalmatian, nova scotia, duck tolling retriever, alapaha blue blood bulldog/otto bulldog, dappled dachshund, old english sheepdog, american bulldog , doberman pinscher, papillon, american-canadian shepherd, dogo argentino, pekingese, american eskimo, english bulldog, perro de carea leones, american hairless terrier, english cocker spaniel, pit bull terrier, american staffordshire terrier, english setter pointer/english pointer, anatolian shepherd, foxhound, presa canario, australian cattle dog, fox terrier, puli, australian kelpie, french bulldog, rhodesian ridgeback, australian shepherd, german shepherd, rat terrier, australian stumpy-tail cattle dog, german shorthaired pointer, rottweiler, beagle, goldendoodle, saint bernard, belgian sheepdog/groenendael, great dane, saluki, belgian tervuren, great pyrenees, samoyed, bichon frise, greater swiss mountain dog, schnauzer border collie greyhound scottish terrier borzoi havanese sealyham terrier boston terrier, ibizan hound, shetland sheepdog, boxer, icelandic sheepdog, shih tzu, brittney spaniel, italian greyhound, shropshire terrier, bulldog jack/parson russell terrier, siberian husky, bullmastiff, japanese chin, soft coated wheaten terrier, bull terrier, keeshond, springer spaniel, canaan dog, kuvasz, sussex spaniel, cardigan welsh corgi, labrador retriever, tibetan spaniel, catahoula leopard dog, lhasa apso, tibetan terriercatalan shepherd lowchentoy fox terrier cavalier king charles spaniel maltese, toy poodle, chihuahua, manchester terrier, walker american foxhound, chinese crested miniature pinscher, west highland white terrier, chow chow, miniature poodle, whippet, cocker spanielmongrel, yorkshire terrier, collie, newfoundland landseer, coton de tulear, norwegian dunkerhound [1]. for these dogs, the baer test is recommended starting at the age of two months. this paper aims to describe the technique of the test and the interpretation of the results. we will not insist on the etiology of deafness as it is described elsewhere [2,1,3]. however, some elements of classification, anatomy, physiology, and genetics are necessary. received: 08.05.2021 accepted: 03.09.2021 published: 29.092021 doi:10.52331/cvj.v26i2.23 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 2 25 2. deafness deafness can be peripheral or central, congenital / inherited or acquired, unior bilateral, total or partial, conductive or neurosenzorial. the congenital deafness should not be confused with the hereditary one; the congenital form may appear during parturition and is determined by dystocia and oxygen deprivation. hereditary deafness occurs 3 to 4 weeks after birth and is a neurosensorial type. it is the result of the degeneration of a structure called stria vascularis. this structure is responsible for maintaining a very specific composition of the endolymph from scala media, characterized by a high concentration of potassium ions and a low concentration of sodium ions, different from other extracellular fluids inside the body. this process is involved the numerous melanocytes present in stria vascularis[3,4]. when the atrophy of the stria occurs and/or the melanocytes are missing, the composition of the endolymph is altered and leads to the death of the hair cells from the organ of corti. the hair cells are the ones who transformed the sound (mechanic oscillations) transmitted to the cilia by the tectorial membrane in electric impulses. when these structures are damaged, peripheral neurosenzorial deafness appears. a different situation is described in dobermans when the hair cells die, but the melanocytes from stria vascularis are intact, called neuroepithelial deafness [5,6]. the inheritance of deafness is controlled by a gene situated on merle (m) locus, with two alleles: the recessive m and the dominant m. the homozygous mm individuals present blue irises and may be blind and sterile. unfortunately, heterozygous mm x mm parents will give birth to 25% mm puppies. another gene is placed on the s locus, and it is called piebald. it has four alleles: dominant (s) and recessive (si) irish spotting, (sp) piebald, and (sw) extreme white piebald. the inheritance mechanism is considered to best fit by the presence of two autosomal recessive genes or an incompletely penetrant recessive allele. regarding the deafness in dobermans, the inheritance has an autosomal recessive mechanism [3]. 3. baer test according to the ”orthopedic foundation for animals," the only accepted test (at least for the moment) to detect hereditary deafness in dogs is the baer (brain auditory evoked response) test. headphones deliver the test sound and one ear at a time test can be diagnostic for other types of acquired deafness (toxic, traumatic, degenerative, inflammatory, etc.) (fig. 1). it is recommended to perform the test at the age of two months. the test shows a few waves, and the first five ones are of diagnostic importance. the waves are marked with roman numbers (fig. 1). wave i is generated by the distal end of the cranial nerve viii, wave ii by the proximal part of cranial nerve viii, wave iii by the cochlear nucleus, wave iv and v inferior colliculus, and probably by the medial geniculate body. anyway, the disturbances responsible for altering the last two waves will determine other symptoms of diseases of the central nervous system. the test can be done without sedation, but if the patient is restless, it can be sedated because the medication does not affect the test result. currently, we are using four electrodes: one "grounding" electrode at the level of the t1 vertebra, one positive electrode on the median line of the skull at the level of the ears, and two negative electrodes anterior to the tragus of each ear. . cluj vet j 2021, 26, 2 26 fig. 1 positioning of headphones in baer test fig. 2 right ear deafness. i ii cluj vet j 2021, 26, 2 27 fig. 3 bilateral deafness. to avoid motion artifacts, sedation of the patient is recommended. fig. 4 motion artifact fig. 5. same patient after sedation. 4. discussion identification of the dogs (e.g., microchip) is very important because unior bilateral deaf dogs must be excluded from breeding. puppies with unilateral deafness can be excellent pets, but those with bilateral deafness need special attention. these dogs can be good companion animals, but care should be taken to avoid unattended contact with other persons or animals. because they cannot hear, they may have a violent reaction when touched without warning. anytime someone wants to pet the dog, he should be sure that he is within the visual range of the affected dog. it is recommended to provide these patients with collars or harnesses with warnings (e.g., don't touch! deaf dog!) one can find/buy this type of equipment in pet shops or on the internet. it is highly recommended to use them, to avoid accidents. cluj vet j 2021, 26, 2 28 conflicts of interest: none references 1. strain, g.m. canine deafness. veterinary clinics of north america: small animal practice 2012, 42, 1209–1224, doi: https://doi.org/10.1016/j.cvsm.2012.08.010 2. strain, g.m. aetiology, prevalence and diagnosis of deafness in dogs and cats. british veterinary journal 1996, 152, 17–36, doi: https://doi.org/10.1016/s0007-1935(96)80083-2. 3. strain, g.m. the genetics of deafness in domestic animals. front. vet. sci. 2015, 2, doi: https://doi.org/10.3389/fvets.2015.00029. 4. holliday, t.a.; nelson, h.j.; williams, d.c.; willits, n. unilateral and bilateral brainstem auditory-evoked response abnormalities in 900 dalmatian dogs. journal of veterinary internal medicine 1992, 6, 166–174, doi: https://doi.org/10.1111/j.19391676.1992.tb00332.x. 5. wilson, w.j.; mills, p.c. brainstem auditory-evoked response in dogs. american journal of veterinary research 2005, 66, 2177– 2187, doi: https://doi.org/10.2460/ajvr.2005.66.2177. 6. wilson, w.j.; mills, p.c.; bradley, a.p.; petoe, m.a.; smith, a.w.b.; dzulkarnain, a.a. fast assessment of canine hearing using high click-rate baer. the veterinary journal 2011, 187, 136–138, doi: https://doi.org/10.1016/j.tvjl.2009.10.009. 29 rat bone marrow mesenchymal stem cells isolation, cultivation and differentiation emoke pall*, phd student professor ioan groza*, phd olga soriţău**, phd, researcher ciprian tomuleasa**, student, researcher assistant mihai cenariu*, phd daria groza***, phd student teodora vlasiu*, phd student abstract bone marrow stromal cells (mscs) represent a heterogeneous population derived from the non–blood-forming fraction of bone marrow that regulates hematopoietic cell development. in vitro, adult mesenchymal stem cells resident in this bone marrow fraction differentiate into bone, cartilage, and fat. because mscs can be easily obtained using a simple bone marrow aspiration and show extensive capacity for expansion in vitro, these cells have been considered as candidates for cell therapy. the aim of this study was to purify rat mscs from adult bone marrow and to functionally characterise their abilities to differentiate along diverse lineages. our data demonstrate that we successfully isolated, culture-expanded and differentiated a relatively homogeneous population of mpcs from adult rat bone marrow. keywords: mesenchymal stem cells, culture expansion, osteogenic nodules, differentiation, rat bone marrow stem cells stem cell research has become an important field of study for molecular, cellular, and clinical biology as well as pharmaco-toxicology (1,3,4,5,8). this cells have a strong proliferative and unlimited self-renewal potential and are multipotent (4,8). mesenchymal stem cells (mscs) represent a population of the bone marrow microenvironment. msc are non-haematopoietic stromal cells that were first isolated from the bone marrow (bm) but subsequently from other adult connective tissues (6,7) which have been explored as a promising * university of agricultural sciences and veterinary medicine, faculty of veterinary medicine, department of veterinary reproduction, obstetrics and gynecology, 3-5 manastur street, 400372 cluj-napoca, romania, tel. +40 264 596384 ext. 163, email: pallemoke@yahoo.com ** “prof. dr. ioan chiricuţă“ oncological institute, cluj-napoca *** “iuliu haţieganu“ university of medicine and pharmacy, cluj-napoca cluj veterinary journal, 15(1)/2009, pp. 29-32 30 treatment in tissue regeneration. they exhibit multilineage differentiation capacity being capable to give rise to diverse cells like osteoblasts (2,9), chondrocytes, adipocytes, myocytes, tenocytes and possibly neural cells (7). we describe a protocol for isolation of mesenchymal stem cells mononuclear cells from adult rat bone marrow. materials and methods mscs were collected from the long bones of three adult wistar rats (100150 g). the animals were killed by cervical dislocation. their femurs and tibiae were carefully dissected of adherent soft tissue, the epiphyses were removed with a rongeur and bone marrow was flushed out by inserting a syringe needle (21g) into one end of the bone. washing bone marrow were used dmem/f12 (gibco) medium supplemented with fcs 10% and antibiotic-antimicotic (100x) (gibco)1%. the aspirant was filtered through a 70 mm filter (falcon) to remove bone fragments and then centrifuged at 1000 rpm for 10 min. the cell pellet obtained (containing both haematopoietic cells and marrow stromal cells) was then suspended in mscs growth medium (dmem/f12 1x, 10% fetal calf serum, 1% antibiotic-antimicotic). the cells were resuspended in normal culture medium to a final concentration of 5x106 viable cells per ml and were then plated on 75 cm2 flasks and left for 72 h. the culture dishes were washed with pbs + 10% fcs to leave an adherent layer of cells containing marrow stromal cells. confluent primary cultures were passaged, split, and re-plated; this cycle was repeated three times. osteogenic differentiation was induced by culturing mscs for 2 weeks in dmem (gibco) supplimented with 10%fcs, 10-7dexamethasone, 10mm β-glicerophosphate, 1µg/ml insulin, 50µg/ ml ascorbic acid, 10ng/ml bmp2, 2ng/ml tgfβ, with a medium change every 2 days. at the end of the cultivation period, the cells were fixed with 4% paraformaldehide (sigma) for 10 min. the cultures were examinated for identification of osteopontin positive cells and colonies according to the manufacturer´s instructions. they were then incubated separately with the primary antibodies to anti osteopontin (sigma), followed by incubation with secondary fluorochromes fitc (anti-goat, diluted 1:100; sigma). after antibody application, the cells were incubated with a hoechst nuclear marker solution (diluted 1 mg/ml in distilled water; sigma) for 15 min at 37°c. following washing in pbs the preparations were mounted under coverslips, examined at high magnification under a fluorescence microscope (zeiss axioplan 2). results and discussion for the mesenchymal stem cells recovery we used rats from wistar line. the bone marrow was recovered by repeated washing of the medullar channel with dmem/f12 supplemented with fcs. rat mscs obtained from standard purification methods and maintained in adherent culture consist of a morphologically heterogeneous population (fig. 1a). after 72 hours from the recovery was made the first medium change, after which was observed the emergence of two major subpopulations (fig. 1 b,c)); cells with an elongated cells with two processes that extend in opposite directions from the cell body and pronounced bipolarity and other groups of polygonal cells with or without short processes. the first passage was made after 12 days (fig. 1d) from the recovery when it was identified the emergence of some cellular colonies (fig. 1c). 31 fig. 1. photomicrographs of rat mesenchymal stem cells after harvest 24 h (a), at 3 days (b), at 4 days (c), small colonies (d), after 1st passage (e), 3nd passage (f) after passage 3 (fig. 1f) the culture was treated with osteogenic medium, and the medium change was made every other day (fig. 2a). after 4 days from adding the osteogenic medium we observed the emergence of some nodules (fig. 2b) of different sizes irregularly dispersed. after the examination with the inversed microscope was stated the growth in dimension of the nodules, fact also macroscopically visible. the cells around the nodules also suffered pronounced morphological modifications. initially the cells presented a fusiform phenotype with some fine prolongations, followed by their transformation in round cells of different sizes. towards the end of the experiment we observed a cellular juxtaposition: the fist layer of elongated cells over which it was stated the superposition of a layer of round cells. the osteogenic differentiation was identified with the aid of the osteopontin antibody. at the fluorescence microscope we identified the fact that the nodules formed were osteopontin positive that demonstrates that these nodules were formed from osteoblasts. fig. 2. phase contrast images of rat mesenchymal stem cells osteogenic differentiation; cells with morphology changed (a), and nodules of different sizes (b) fig. 3.immunohistochemical highlighting of osteopontin positive cells and nodules 32 concusion in conclusions mscs from rat bone marrow are relatively easily isolated from the bone marrow and can be manipulated in vitro, they could be good candidates for the development of various therapeutic modalities aimed to regenerate mesenchymal tissues. better understanding of the molecular mechanism directing the differentiation of bmcs will eventually allow us to properly manipulate bmcs both in vivo and ex vivo for regeneration of complex tissues and organs. less passaged bmcs cultured with osteoinductor medium proved to possess in vivo osteogenic potential. this can be applicable to use cell therapy in the repair of bone defects. in clinical feasibility, however, large cell numbers with osteogenic potential will be required. further investigations are needed to establish the culture conditions that permit the rapid expansion of mesenchymal stem cells while retaining their potential for differentiation. references 1. bianco p., riminucci m., gronthos s., robey p.g., 2001, bone marrow stromal stem cells: nature, biology and potential applications, stem cells 19/180-192; 2. fumiaki sugiura, hiroshi kitoh, naoki ishiguro, 2004, osteogenic potential of rat mesenchymal stem cells after several passages, biochemical and biophysical research communications 316, 233–239; 3. groza i.s., emoke pall, olga soriţău, d.d. ciupercescu, laura cătană, 2007, isolation, characterization and differentiation pf stem cells from bone marrow of mice cd1 strain, revista română de medicină veterinară, vol.17, 4, pag.71-84; 4. guanbin song, yang ju, hitoshi soyama, 2008, growth and proliferation of bone marrow mesenchymal stem cells affected by type i collagen, fibronectin and bfgf, materials science and engineering c msc-02266; no. of pages 5; 5. jose j.m., alejandro e., paulette conget, 2001, mesenchymal stem cells, minireview, society for experimental biology and medicine; 6. pountos i, giannoudis pv., 2005, biology of mesenchymal stem cells. injury; 36:s8-s12. 7. pountos i, jones e, tzioupis c, 2006, growing bone and cartilage. the role of mesenchymal stem cells. j bone joint surg br.; 88:421-6; 8. tarja a.j., william s., xuan y., michael i.c., chi v.d., saul j.s., 2006, isolation of bone marrow derived stem cells using density gradient separation, experimental mematology, 35/335-341; 9. xiaoli w., hiroko h., shigeru t., yasushi a., qiang l., wenhao c., jianfeng w., changye ws., tomomi m., satoshi o., quing l., tianxue f., hongxue f., zhexiong l., gershwin m.e., sususmu i., 2005, characterization of mesenchymal stem cells isolated from mouse fetal bone marrow, stem cells, 24/482493; 69 determination of pathogen resistance to streptomycin lecturer anca chereji*, phd rareş chereji**, dvm abstract this research was made in order to emphasize the actual incindence of the sensibility of various bacterial pathogens to streptomycin. the pathogens were identified as belonging to staphylococcus, escherichia, citrobacter, enterobacter, klebsiella, salmonella, proteus, pasteurella and pseudomonas genus. antimicrobial agar disk diffusion method was used to test the strains isolated from animals and the results were interpreted as resistant, intermediate and sensitive according to international standards. resistance in 100% percentage was registered for staphylococci and also for the pathogens from citrobacter, enterobacter, proteus, pasteurella, pseudomonas genus. there wasalso resistance for escherichia coli strains 90%, and salmonella 50%. intermediary values of the antibacterial inhibition zones presented salmonella (50%) and also escherichia coli pathogens (10%). the only genus that was sensitive to streptomycin was klebsiella. the frequency of resistance phenomenon to streptomycin was 87,5%, intermediary values for the inhibition zones – 8,33% and only 4,17% of the strains showed sensibility to this antibiotic. keywords: pathogen resistance, streptomycin introduction aminoglycosides represent, next to betalactamines, the group of antibiotics having the larger therapeutical use. the first discovered aminoglycosides were natural molecules, produced by streptomyces (streptomycin, neomycin, kanamycin, tobramycin) or micromonospora (gentamycin, sisomycin). streptomycin and dihydrostreptomycin have a relatively restricted spectrum, the resistance being very spread between these antibiotics. nevertheless, there a few staphylococci, even some streptococci and gram-negative bacilli still sensitive, among these actinomyces bovis strains, pasteurella spp, e. coli, salmonella spp., campylobacter fetus, leptospira spp. and brucella spp.. mycobacterium tuberculosis, also, is still sensitive to streptomycin (vakurenko s.b. and mobashery s., 2003). starting with natural aminoglycosides, there were later conceived, using semisynthesis technique, molecules less sensitive to enzyme inactivation induced by resistant bacteria and having lower toxicity (amikacin, netilmycin etc.) (oniga o. and tiperciuc brânduşa, 2003). * university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, department of pharmacology, 3-5 mănăştur street, 400372 cluj-napoca ** s.c. biovet serv. s.r.l., cluj napoca cluj veterinary journal, 15(1)/2009, pp. 69-72 70 this study was made in order to investigate the present resistance of some pathogens to streptomycin, taking into account the fact that aminoglycosides are used, despite their high nephrotoxicitiy, to control local and systemic infections due to sensitive aerobic bacteria (generally gram-negative) (cristina t. romeo, 2006). the aminoglycosides recommendation is justified by their therapeutical efficiency (mărculescu anca, 2007). material and methods the sensibility of a pathogen to antibiotics can be tested through a relative unsophisticated method – the antibiogram. the materials used in this study were represented by bacterial strains, cuture media and disks with a standard quantity of antibiotic. the bacterial strains were isolated from abscesses, phlegmons, vaginal secretions, secretions mastitis, faeces, intestinal contents, organs with lesions (liver, spleen, heart, lungs, nodules etc.), bones and corpses of animals. the susceptibility to streptomycin was tested on 48 gram-positive and gram-negative bacterial strains. the cultivation was made on usual media (broth and agar) with a plus of serum, glucose, blood when necessary, or special media (răpuntean gh. and boldizsar e., 2001). the interpretation of the antimicrobial agar disk diffusion method had been effected according to international standards (nccls m31-a, m31-t, 1999). results and discussions a number of 48 pathogens from staphylococcus, escherichia, citrobacter, enterobacter, klebsiella, salmonella, proteus, pasteurella, pseudomonas genus was investigated through antibiogram in order to determine the sensitivity to streptomycin. the results were interpreted (table 1) and the pathogens were noted as resistant (r), sensible (s) or with intermediary values (i) to this antibiotic (table 2). table1. disc diffusion test interpretation according to international standards crt. no. antibiotic atb/conc. disc diametrul zonei de inhibiţie antibacteriană (mm) r i s standard values: 1 streptomicină streptomicină 100 µg 10 µg ≤ 22 ≤ 11 23 – 25 12 – 14 ≥ 26 ≥ 15 neo-sensitab veterinary pathogens –nccls bbl sensi-disc – nccls table 2. susceptibility/resistance to streptomycin crt. no. bacterial strains no. sensibility/resistance r % i % s % 1 staphylococcus 6 6 100 2 e. coli 20 18 90 2 10 3 citrobacter 2 2 100 4 enterobacter 2 2 100 5 klebsiella 2 2 100 6 salmonella 4 2 50 2 50 7 proteus 4 4 100 8 pasteurella 2 2 100 9 pseudomonas 6 6 100 total no. of pathogens 48 42 87,50 4 8,33 2 4,17 71 many attainment mechanisms of resistance to streptomycin were described; can be plasmid mediated or owed to mutations. a non-plasmid mediated mechanism is the decrease of the transportation through cellular membrane. the anaerobic (clostridium) and facultative anaerobic (enterobacteriaceae and some staphylococci) bacteria are more resistant to aminoglycosides, in an anaerobic medium, because of the active and oxygen-dependent transportation. a 100% resistance of staphylococci can be observed in the antibiograms of the present study. the resistance due to decreased carriage can be induced by the exposal of bacterial strains to sublethal concentrations of antibiotic. an example is the pseudomonas aeruginosa resistance to streptomycin, as it is obvious also in the tested strains of this research. the decreasing of the binding of antibiotic to ribosomes is also a mechanism of pseudomonas resistance to streptomycin; that type of mechanism is met also in escherichia coli strains. furthermore, the results of the present study show a 100% percentage of resistance in pseudomonas, whilst in the case of escherichia coli – a 90% resistance and 10% intermediary values of the antibacterial inhibition zones; as some authors point out (angelescu m., 1998), that means also 100% resistance, because mostly statistical and epidemiological studies present the existence only of resistant and sensible strains. even if ray a. et al, in 2006, observe in salmonella genus the highest resistance to streptomycin, in this research there are only 50% of resistant strains; all the same, because of the existence of a great number of intermediate strains – 50%, the sensitivity of the pathogens to this antibiotic is 0%. the resistance emerge also through an enzymatic mechanism. these enzymes are found both in gram-negative and gram-positive bacteria. it is possible that this mechanism determined the resistance in all strains from citrobacter, enterobacter, proteus şi pasteurella genus, as it is showed in graphic 1. accordingly, it is observed that for streptomycin the antibiotic resistance phenomenon appear in a rather high percentage – 87,5%, as we marked for 21 of the 24 tested strains, being in existence also a percentage of 8,33% of intermediary values – 2 strains, and only one strain was sensitive – a percentage of 4,17% of the total strains (graphic 2). conclusions bacterial strains from staphylococcus, escherichia, citrobacter, enterobacter, klebsiella, salmonella, proteus, pasteurella, pseudomonas genus were investigated about the susceptibility to streptomycin; the antimicrobial agar disk diffusion method was used for the testing of the pathogens; the results were interpreted according to international standards; staphylococci registered a 100% resistance to streptomycin and also citrobacter, enterobacter, proteus, pasteurella, pseudomonas strains; i % 8,33 s % 4,17 r % 87,5 90 0 50 100 100 100 100 100 100 0 20 40 60 80 100 staf ilococi e. coli citrobacter enterobacter klebsiella salmonella proteus pasteurella pseudomonas % s % i % r % graphic 1. resistance to streptomycin graphic 2. the frequentness of resistance phenomenon to streptomycin 72 escherichia coli strains showed also rather high percentage of resistance to this antibiotic – 90%, the rest of 10% being intermediary values of the inhibition zones resistance of 50% was observed for salmonella pathogens and intermediary values, also in 50% percentage the only genus that was sensitive to streptomycin was klebsiella; the resistance of the investigated pathogens was, generally, 87,5%, being noted intermediary values – 8,33% and only 4,17% of the strains showed sensibility to this antibiotic. references 1. angelescu mircea – terapia cu antibiotice, ed. medicală, bucureşti, 1998; 2. cristina t. romeo – bazele farmacologiei veterinare, ed. brumar, timişoara, 2000; 3. mărculescu anca – phd thesis: „studiu privind evoluţia fenomenului de antibiorezistenţă şi posibilitatea diminuării acestuia prin asocierea de antibiotice, pe baza relaţiilor de sinergism”, universitatea de ştiinţe agricole şi medicină veterinară cluj-napoca, 2007 4. nccls, m31-a – performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals; approved standard, 1999, vol.19, no. 11; 5. nccls, m31-t – performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals; approved standard, 1999, vol.17, no. 11; 6. oniga o., brînduşa tiperciuc – antibiotice antibacteriene, editura medicală universitară „iuliu haţieganu”, cluj-napoca, 2003; 7. ray k.a., l.d. warnick, r.m. michell, j.b. kaneene, p.l. ruegg, s.j. wells, c.p. fossier, l.w. halbert– antimicrobial susceptibility of salmonella from organic and conventional daily farm, j. dairy sci., 2006, 89 (6): 2038-50; 8. răpuntean gh., boldizsar e. – practicum de bacteriologie specială, ed. academicpres, cluj-napoca, 2001; 9. vakurenko s.b., s. mobashery – versatility of aminoglycosides and prospects for their future, clinical microbiol. reviews, 2003, vol. 16, 430-450; type of the paper (article cluj vet j 2022, 27, 1 http://clujveterinaryjournal.ro communication etiopathogenetic mechanism in dogs with syringomyelia caroline maria lacatus 1 student, university of agricultural science and veterinary medicine cluj-napoca, calea manastur, no. 3-5, 400372, cluj, romania ; carolinelacatus@yahoo.com * correspondence: carolinelacatus@yahoo.com; tel.: 0757225229 abstract: syringomyelia (ms) is a condition characterized by the development of cavities in the parenchyma of the spinal cord (sirinx). cavalier king charles spaniel (ckcs) dogs have a high incidence of chiari malformation. the breed was born in 1928, from dogs of the king charles spaniel breed, a favorite dog of royal and noble families, with the aim of recreating a dog similar to the one present in the portraits of king charles ii, during the restoration period. the ckcs breed is native to the united kingdom, being composed of small brachycephalic specimens toy, a distinctive feature of the breed being the flattened and miniaturized appearance of the head (rusbridge & knowler, 2003). syringomyelia is a topical and real interest topic in canine neuropathology, representing the topic of numerous researches, both due to the many unknowns of the evolution of the diseases, and the fact that at present there is no effective treatment. keywords: central nervous system, genetic predisposition, ct exam, behavioral changes, nervous symptoms 1. introduction in dogs, the etiology of syringomyelia is not fully known, but in the case of cavalier king charles spaniel and griffon de bruxelles, syringomyelia may occur as a result of gene modification. bmp 3 (bone morphogenetic protein 3) is the gene responsible for regulating the harmonious development of the skull and spinal cord, so that the extreme brachycephalic conformation of these breeds is associated with chiari malformation and syringomyelia. two chromosomal loci were identified cfa 22 and cfa 26, which are associated with the presence of a reduced volume of the caudal cranial fossa and with the modified orientation of the caudal cranial fossa, characteristic of chiari malformation and syringomyelia 1 (miller & zachary, 2017), 2 (schoenebeck, et al.,2012). 2. receptivity syringomyelia (ms) are commonly diagnosed in cavalier king charles spaniel and griffon de bruxelles breeds, but are also found in other brachycephalic breeds, including: chihuahua, maltese bichon, pomeranian, pug, french bulldog, yorkshire terrier, boston terrier, but and their mestizos (dewey, et al., 2005) (rusbridge, 1997). syringomyelia are rarely diagnosed in cats, however recent studies have indicated the presence of ms in cats, especially in brachycephalic breeds. in the literature, syringomyelia has rarely been described in other animal species, especially in horses and calves, in most cases being a congenital disease, not being correlated with mc (chiari-like malformation). 3. etiopathogenesis one of the most common causes of syringomyelia (ms) is chiari-like malformation (mc), secondary to volume mismatch between the caudal cranial fossa received: 7 december 2021 accepted: 22 february 2022 published: 28 june 2022 doi:10.52331/cvj.v27i1.33 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2022, 27, 1 22 (too small) and brain tissue (too large), altered csf (cerebrospinal fluid) circulation, and subarachnoid space compression (freeman, et al., 2014) (rusbridge, 2014). in addition to mc, syringomyelia can also be associated with many pathologies that cause csf obstruction. however, it is unclear why only some dogs diagnosed with chiari-like malformation (mc) develop ms and others do not. other causes besides mc that can lead to syringomyelia are csf obstruction (neoplasms), trauma, constrictive lesions of the spinal cord or space-occupying processes in the spinal cord. in a study conducted in 2013 3 (by driver et al.) in dogs with and without ms, pulsation cerebellar was assessed during the cardiac cycle using magnetic resonance imaging. these findings support theories of the pathogenesis of syringomyelia secondary to chiari malformation in human medicine, highlighting the similarities between canine and human patients. there can be many factors that influence the pathogenesis, among which we list intracranial hypertension, blood-brain barrier disturbances, imbalance between csf production and absorption, or insufficiency of extracellular fluid absorption or drainage (hemley, et al., 2012). 5. physiopathology of syringomyelia due to the underdeveloped caudal cranial fossa, its small volume cannot fully encompass brain tissue. this abnormality leads to the herniation of the cerebellum, thus obstructing the flow of cerebrospinal fluid (csf) through the foramen magnum (fm), and the csf pressure exerted on the cns (central nervous system) is inconsistent csf flow disturbance as well as pressure variations seem to play an important role in development of syringomyelia. cerebellar herniation appears to be a component of ms. (fig.2). it is common in cases of ms, but the presence or size does not anticipate the formation of ms. an explanation by which herniation cerebellar contributes to the pathogenesis of ms is that obstruction of csf channels occurs in the foramen magnum, but there must be other predisposing factors. (cerda-gonzalez, et al., 2009b) (lu, et al., 2003). another important factor included in the pathogenesis of ms is csf circulation. changes in speed, turbulence and disturbances in csf circulation can lead to the formation of intramedullary cavities. a high rate of csf flow recorded in the foramen magnum along with a lower rate of csf flow in the cervical vertebrae c2-c3 are considered predisposing factors in the formation of ms. intracranial pressure is higher than in the cervical portion of the spinal cord, so when there are rapid increases in pressure, csf converges to the cervical region. inside the spinal cord, the pressure tends to increase faster in the lumbar region than in the cervical area, further favoring csf movement toward the cervical portion of the spinal cord. (rusbridge, et al., 2000) (kirberger, et al., 1997) due to the direct link between ms and csf circulation disturbances, the size of the cerebral ventricles correlates with the size of the medullary cavities.ckcs dogs diagnosed with mc and ms have smaller jugular foramen (jugular hole) compared to ckcs patients diagnosed only with mc. because of this, the venous shaft at the level of the jugular hole is reduced and associated with a small cranial base, leading to increased venous pressure and reduced absorption of csf, predisposing factors in the formation of intramedullary cavities. (rusbridge, et al., 2009a) (schmidt, et al., 2012). cluj vet j 2022, 27, 1 23 another cause of reduced csf absorption is low sinus volume in ckcs patients diagnosed with mc and ms. reduced venous sinus volume leads to increased intracranial pressure and secondary to improper csf reabsorption. 3. discussions the pathophysiology of syringomyelia is still unclear, several theories are exposed in the literature. however, the full mechanism is not fully understood, and has been the subject of intense research in recent years. it is important to note that the tubular formations in the spinal cord parenchyma, which does not involve the central medullary canal, are defined as syringomyelia (sirinx), while hydromyelia is defined as a dilation of the central canal of the spinal cord. these two cavities can communicate with each other, but it is difficult to highlight this communication. in the early stages, the cavities are located dorsally and laterally by the central medullary canal, in the gray matter. the medullary tissue around the cavities is edematous. if syringomyelia is causing signs and symptoms that interfere with the life of animal, it is recommended a treatment based on gabapentin at 10 mg/kg orally every 8 to 12 h as a primary treatment for several symptoms like: neck and back pain on palpation, abnormal scratching, episodes of sudden vocalizing or in advanced stages is necessary surgery. the goal of surgery is to remove the pressure the syrinx places on your spinal cord and to restore the normal flow of cerebrospinal fluid. this can help improve the symptoms and nervous system function (fig. 1). 4. conclusion overall, the prognosis for cm/sm-affected dogs depends on the severity of clinical signs and on the response to medication. chiari-like malformation and syringomyelia is a progressive condition in those dogs that are affected clinically. some dogs will need constant dose adjustments to adequately treat their symptoms. unfortunately, some dogs afflicted with severe and disabling pain do not respond to medical management and are surgical candidates. fig.1 differences between a healthy dog and a dog with syringomyelia (https://www.frontiersin.org/articles/10.3389/fvets.2018.00280/full) fig. 2 chiari malformation and syringomyelia seen on a ct image (https://www.vin.com/apputil/content/defaultadv1.aspx?id=5328340&pid=11349&print=1) https://www.frontiersin.org/articles/10.3389/fvets.2018.00280/full https://www.frontiersin.org/articles/10.3389/fvets.2018.00280/full https://www.frontiersin.org/articles/10.3389/fvets.2018.00280/full https://www.vin.com/apputil/content/defaultadv1.aspx?id=5328340&pid=11349&print=1 https://www.vin.com/apputil/content/defaultadv1.aspx?id=5328340&pid=11349&print=1 cluj vet j 2022, 27, 1 24 references 1. couturier, j., rault, d., & cauzinille, l., 2008. chiari-like malformation and syringomyelia in normal cavalier king charles spaniels: a multiple diagnostic imaging approach. journal of small animal practice, 49, 438–443. 2. teză de doctorat, cucoș c.a., diagnosticul malformației de tip chiari și a siringomieliei la câine, bucurești, 2019. 3. dewey, c., berg, j., barone, g., marino, d., & stefanacci, j., 2005. foramen magnum decompression for treatment of caudal occipital malformation syndrome in dogs. journal of the american veterinary medical association, 227(8), 1270-1275. 4. driver, c., de risio, l., hamilton, s., rusbridge, c., dennis, r., & mcgonnell, i., 2012. changes over time in craniocerebral morphology and syringomyelia in cavalier king charles spaniels with chiari-like malformation. bmc veterinary research, 8(1), 215. 5. freedman, d., 2011. preliminary morphometric evaluation of syringomyelia in american brussels griffon dogs. journal of veterinary internal medicine, 25(3). 6. rusbridge, c., & knowler, s., 2006a. coexistence of occipital dysplasia and occipital hypoplasia/syringomyelia in the cavalier king charles spaniel. the journal of small animal practice, 47(10), 603-606. 7. dewey c, berg j, barone g, et al. foramen magnum decompression for treatment of caudal occipital malformation syndrome in dogs. j am vet med assoc. 2005;227:1270–1275. 15 in vitro maturation of bovine oocytes for in vitro fertilization professor ioan groza*, phd lecturer simona ciupe*, phd assistant mihai cenariu*, phd emoke pall*, phd student anamaria petrean*, phd student abstract the objective of the present study was to asses the quality of various cultivation media used for the maturation of bovine oocytes that are prepared for ivf. upon collection from slaughtered bovine ovaries and after morphological evaluation, a total number of 513 viable oocytes have been selected for cultivation, being divided into 3 batches, 171 oocytes / batch. the oocytes belonging to batch 1 were cultivated in tcm 199 nahco3 + 10% fcs + fsh 20 μl/ml. the oocytes belonging to batch 2 were cultivated in tcm 199 nahco3 + 10% fcs + hcg 2.3 x 10 3 ui/ml + fsh 8 μl/ml + pyruvate 0.25 mm + 17β estradiol 1 μl/ml. the oocytes belonging to batch 3 were cultivated in tcm 199 nahco3 + 10% fcs + 17β estradiol 1 μl/ml + fsh 20 μl/ml. the cultivation conditions, for all three batches, were: 24 hours at 39°c, 5% co2. spermatozoa have been prepared using the percoll method and ivf of the matured oocytes has been performed. embryonic development has been assessed 72 hours and then up to 10 days after ivf. the results showed the superior quality of the oocytes belonging to batch 2 and matured using tcm 199 nahco3 + 10% fcs + hcg 2.3x10 3 ui/ml + fsh 8 μl/ml + pyruvate 0.25 mm + 17β estradiol 1 μl/ml, as their use for ivf yielded the highest number of viable embryos. key words: bovine, oocyte, in vitro fertilization, maturation, tcm 199, cultivation introduction embryo transfer technology has been used commercially over the past 2 decades [1,5]. the available statistics published by iets show that the use of embryo transfer technology has increased rapidly during the 1980’s and the early 1990’s [3,8]. however, embryo production has stabilized over the past 5 years. part of the reason for this plateau in the use of embryo transfer is the difficulty to harmonize this technology with the production goals of every herd [2,4,9]. the in vitro production of embryos (ivf) is an approach that may increase the efficiency of reproduction in a cow without compromising its production life. combined with the technologies developed to control ovarian function, increased production of viable embryos through ivf of oocytes derived from growing follicles may prove a * university of agricultural sciences and veterinary medicine, faculty of veterinary medicine, department of veterinary reproduction, obstetrics and gynecology, 3-5 manastur street, 400372 cluj-napoca, romania, e-mail: isgroza@yahoo.com cluj veterinary journal, 15(1)/2009, pp. 15-18 16 valuable method [6,7]. the objective of the present study was to asses the quality of various cultivation media used for the maturation of bovine oocytes that are prepared for ivf. material and methods the oocytes used in this study have been obtained from 104 slaughtered bovine ovaries, recovered in sterile saline with 100 ui penicillin/ml, at 35°c. the interval of time that passed from the recovery of the ovaries until processing them in the laboratory has not been longer than 2 hours. the ovaries were washed with sterile saline in order to remove any trace of blood and the follicles between 18 mm were punctured using an 18g needle attached to a 10 ml syringe. the follicular fluid was aspired, passed in a plastic corning tube with maintenance medium represented by tcm 199 (gibco) + heparin 2 ui/ml and then filtrated in order to concentrate the oocytes in a smaller amount of liquid. the oocytes have subsequently been passed in a petri dish and evaluated using a stereomicroscope at a 20x magnification for counting and 60x for morphological evaluation. only the adequate oocytes were selected, which presented homogenous cytoplasm and compact cumulus, with at least 3 layers of cells surrounding the oocyte (figure 1). after morphological evaluation, a total number of 513 viable oocytes have been selected for cultivation, being divided into 3 batches, 171 oocytes/batch. the oocytes belonging to batch 1 were cultivated in tcm 199 nahco 3 + 10% fcs + fsh (fshp, shering) 20 µl/ml. the oocytes belonging to batch 2 were cultivated in tcm 199 nahco 3 + 10% fcs + hcg (apl) 2.3 x 103 ui/ml + fsh (folltropin-v) 8 µl/ml + pyruvate 0.25 mm + 17β estradiol 1 µl/ml. the oocytes belonging to batch 3 were cultivated in tcm 199 nahco 3 + 10% fcs + 17β estradiol 1 µl/ml + fsh (fshp, shering) 20 µl/ml. the cultivation conditions, for all three batches, were: 24 hours at 39°c, 5% co 2 . the spermatozoa were thawed (5 s at room temperature and 30 s in water at 37°c) and added to a conical tube, on top of 2 ml of 90% percoll solution and 2 ml of 45% percoll solution. the mixture was centrifuged at 1000xg for 10 minutes, the spermatozoa were resuspended in 10 ml talp and then centrifuged again at 200xg for 5 minutes. the matured oocytes were passed into 4-wells culture dishes, in fertilization medium (ferttalp + 55µg/ml heparin) at a density of maximum 30 oocytes/well. the spermatozoa were added at a concentration of 1.3 x 106 spermatozoa / ml and finally the microdrops were covered with mineral oil (sigma). the dishes were vortexed at 18-20 hours and further incubated for 72 hours at 39°c, in 5% co 2 . after this interval, the embryonic development was assessed recording the number of cells presented by every embryo as well as the presence of non-fertilized oocytes. the non-fertilized oocytes were discarded, the medium was changed and embryonic development was followed until day 10 after in vitro fertilization. fig. 1. adequate oocytes, suitable for in vitro maturation 17 results and discussions after evaluation of the embryonic development at 72 hours after ivf, the results obtained were as follows (table 1, chart 1 and figure 2): table 1. results of the in vitro fertilization after 72 hours of culture batch number total number of oocytes non-fertilized oocytes 2-8 cells embryos batch 1 171 51 (29.82%) 120 (70.18%) batch 2 171 42 (24.56%) 129 (75.44%) batch 3 171 46 (26.90%) 125 (73.10%) the figures presented above show small differences between the three batches. the maturation medium used for batch 2 yielded the best results as it contained fsh, hcg, pyruvate and β -estradiol. all these hormones, together with the pyruvate offered the best conditions for oocyte maturation as well as its preparation for in vitro fertilization. when embryonic development was assessed at 10 days of culture after the in vitro fertilization, the following results have been obtained (table 2, chart 2 and figure 3): table 2. results of the in vitro fertilization after 10 days of culture batch number total number of embryos cultivated over 72 hours expanded blastocysts obtained batch 1 120 16 (13.33%) batch 2 129 21 (16.27%) batch 3 125 19 (15.20%) batch 1 batch 2 batch 3 non-fertilized oocytes 2-8 cells embryos 120 129 125 51 42 46 0 20 40 60 80 100 120 140 160 chart 1. results of the in vitro fertilization after 72 hours of culture fig. 2. embryos obtained at 72 hours after ivf batch 1 batch 2 batch 3 expanded blastocysts embryos cultivated over 72 h 120 129 125 16 21 19 0 20 40 60 80 100 120 140 160 chart 2. results of the in vitro fertilization after 10 days of culture fig. 3. blastocysts obtained at 10 days after ivf 18 the figures shown above also show small differences between the three batches, but again, the highest number of expanded blastocysts has been obtained in batch number 2, proving the better quality of the oocytes matured using this maturation medium and subsequently the better quality of the embryos obtained from them. conclusions after performing the research, the following conclusions have been drawn: 1. the evaluation of the best maturation conditions for oocytes has been performed, comparing various combinations of additives for the maturation medium. 2. at 72 hours after the fertilization, satisfactory results have been obtain for all three batches, even though the maturation medium used in batch number 2 yielded the best results, leading to the highest number of embryos obtained after ivf. 3. the results obtained at 10 days after the in vitro fertilization confirm the superior quality of the oocytes belonging to batch 2 and matured using tcm 199 nahco 3 + 10% fcs + hcg 2.3x103 ui/ml + fsh 8 µl/ml + pyruvate 0.25 mm + 17β estradiol 1 µl/ml. 4. the supplementation of the maturation medium with gonadotropins and estradiol led to the increase of the percentage of fertilized oocytes, favoring the maturation of the cumulus cells and stimulating the metabolism of the oocyte. 5. we recommend the use of the medium containing tcm 199 nahco 3 + 10% fcs + hcg 2.3 x 103 ui/ml + fsh 8 µl/ml + pyruvate 0.25 mm + 17β estradiol 1 µl/ml for the in vitro maturation of bovine oocytes destined for in vitro fertilization. references 1. arlotto t., j.l. schwartz, n.l. first, m.l. leibfried-rutledge, 1996, aspects of follicle and oocyte stage that affect in vitro maturation and development of bovine oocytes. theriogenology 45, 943-956. 2. fabbri, r., e. porcu, t. marsella, 2000, technical aspects of oocytes cryopreservation. molecular cell and endocrinology 169, 39-42. 3. groza i, l. harceaga, d. moise, l. bogdan, i. morar, o. sotoc, s. ciupe,1996, cercetări privind fecundarea “in vitro” a ovulelor de vaca. simpozion – lucrări ştiinţifice de medicină veterinară, timişoara, p. 271. 4. groza i. (coordonator), l. bogdan, r. cătană, m. cenariu, simona ciupe, d. ciupercescu, i. morar, m. muntean, al.r. pop, brînduşa stegeran, ginecologie, andrologie şi obstetrică veterinară – compendiu, ed. academiei române, bucureşti, 2006. 5. holm, p., p.j. booth, m.h. schmidt, t. greve, h. callesen, 1999, high bovine blastocyst development in a static in vitro production system using sofaa medium supplemented with sodium citrate and myo-inositol with or without serum-proteins. theriogenology 52: 683-700. 6. ito, k., m. takahashi, k. kawahata, t. goto, j. takahashi, y. yasuda, 1998, supplementation effect of early pregnancy factor-positive serum into bovine in vitro fertilization culture medium. animal journal of immunology 39(6), 356-361. 7. sirad, m.a., r.d. lambert, p. guay, d.p. menard, m. bedoya, 1985, in vivo and in vitro development of in vitro fertilized bovine follicular oocytes obtained by laparoscopy. theriogenology 23, 230. 8. yang, x., c. kubota, h. suzuki, m. taneja, p.e.j. bols, g.a. presicce, 1998, control of oocyes maturation in cows-biological factors. theriogenology 49, 471-482. 9. younis, a.i., b.g. brakett, r.a. fayrer-hosken, 1998, influence of serum and hormones on bovine oocyte maturation and fertilization in vitro. gamete research 23, 189-209. 73 the philogeny of clarides and the ecomorphology of the african catfish gheorghe radu bologan*, phd student abstract the african catfish was introduced into romanian fish breeding starting with the year 2002. it is artificially breed, intensively, in a monoculture in a private ranch near oradea. keywords: african catfish, philogeny, ecomorphology material and method its bibliography has been studied and existing information has been gathered even from the internet. results and discussions the philogeny of clarides is being still studied and largely debated and discussed on a ontogenetical and philogenetical level of this fish species, due to the numerous expeditions in africa, their natural environment. conclusions the philogeny of the african catfish is keeping on being the focus point nowadays; but the unpredictable risks of the translocation oft the african catfish is of a great importance because of their negative effects upon the biodiversity of invertebrates and the possibility of transmitting parasites, bacteria and viruses. the philogeny of clarides the resemblance found between certain species is mainly based on the complete studies of professor melanie from the natural history museum of new york, the ichtiology departament. these studies conssisted in phylogenetical analisys concerning morphological character related to the shape of the head and trunk, the structure of cranial carcase, biomecanics of the bite, all of which pointed towards mutual features of fish related to clarides. several ideas regardind the evolution of teleosteenian anquiliformed fish, of which also the african catfish makes part, were launched. the * s.c. incavet s.r.l., oradea, e-mail: gheorghe_bologan@yahoo.com cluj veterinary journal, 15(1)/2009, pp. 73-76 74 development theories refering to teleosteenian anquiliformed fish are the folowing: 1. the converging evolution theory of teleosteenian anquiliformed fish with similar mutual aspects of phylogeny, 2. the theory refering to the length of the body, while the head of these fish remains small, 3. the adjustment to the skull type, which leads to the relationship between the length of the body compared to the head dimension, 4. mutual aspects regarding the existence of a developed muscle system along with the extreme length of the body, development of jaw muscles, which is an aspect of the development of teleosteenian anquiliformed fish concerning the extreme length of the body and the hypertrophy of jaw muscles, but there shall be mentioned that this last peculiarity isn’t something found in all studied species. all these studies and their conclusions keep these fish as a point of interest for specialists in roder to conclude the moments of evolution of these species and their correct taxonomy. the ecomorphology of the african catfish the clarides from which the african catfish makes part of, are fish which have a body length and cylindrical shape similar to that of an eel. the dorsal and anal fins contain soft bony beams and the bony beam of the pectoral fin has the shape of a spine, the ventral one has as a component a number of six soft bones. the flatened back ventral head is highly ossified, the skull has the shape of a helmet and the body is covered by a soft scaleless skin. the skin is generally pigmented on the back and side of the body. the color is regular and changes to greyish olive to a dark shade, seizing the color of the environment he lives in. on exposure its skin becomes brighter and acquires a perssistent mucus. he’s got four pairs of barbels, a nazal pair, a jaw pair, which is also the longest. two pairs of mandibular barbels up and down, in the exterior and interior. the inferior and superior jaw is equiped with needlelike rough teeth. above the bronchis we find a respiratory accessory – the arborescent organ consisting of a pair of pear-shaped air chamber, which contain two arborescent structures in general present. these structures have a cauliflower – like shape which are sitauted in the second branchial arch. these are sustained by a gristly support being covererd by a highly vascularized tissue. the air chamber communicates with the pharynx, the complementary breathing apparatus-gill chamber-allows the fish to survive several hours outside the water, or for several weeks in muddy marshes near shores. the hydrostatic function is according to buoyancy controlled by the air in the over branchial chamber. we may say that he posses a bucal-aesophagus, the aesophagus is not a self-suficient cavitar organ. the natural food consists in water insects, terestrial insects, fruits and mollusk, but it feeds with fish, water bird and submerse vegetation. photo 1.general morphological aspect – dorsal side photo 2. general morphological aspect – ventral side 75 this kind of fish is an onmivorous animal, with strong predatory tendency towards other fish-he posseses predatory skills, sole or group hunting . the african catfish is “euritypical” holding on throughout a series of variation and is spread over in a variety of terestrial sweat water, lakes, rivers, swamps, moor. this habitat exerts aspects of the morphology, due to this he’s well fit to life and environment. this species is spread all over and is also to be found in lakes with a high peat range and a low water level, e.g. ngami lake and nyamithi pan and as a contrast clear and deep water e.g. malawi, sibaya, victoria. they are also to be succesfully found in rivers. regarding the water temperature this species may be found in water measuring from 8° to 35°c and the breeding takes place at a temperature of over 18°c . the water temperature at hatching is between the limits of 17° to 32°c, this being the perfect growth of young at 28° to 30°c. the salinity of water 0 to 12 ppt, 0 to 2,55 and optimum is 11g/ liter. the oxygen water contains saturating is from 0 to 100 . clarias gariepinus benefits of arborescent organs and is an efficient fish breathing through the gill filamnets and gill rakers. it breathes through its skin when being on land. it is also lasting to drought, when the branchies stop or are being bloked by mud, it produces a mucus to mentain its skin hydrated or it diggs mudholes to stand out the drought and sun rays. it withstands amoniac concetrations in water from 2,3 mg/liter the larva and young and the adults up to 6,5 mg/ liter and they resist to different water ph-levels. with the breeding of such fish, the perfomances of the artificial breeding is differernt and it is recommended not to expect the optimum of the artificial versus the natural. the african catfish is the kind of fish which is best recomanded to worldwide fish breeding. the african catfish breeding has been studied in different locations in south africa, nambia, zimbabwe, malawi the growth rate being variable in these areas. the breeding of both sexes is the most indicate due to growth variations in the fisrt year from 200-300 mm in length and the following years adding 80 to 150 mm, depending on the areas. it must be said that the natural breeding takes place without external feeding. this fish weighs in natural conditions, in the majority of lakes and small rivers rarely 20 kg. there have been captured specimen weighing 40 kg and the max was 58,9 kg, caught in vaal river in south africa. concerning the growth rate between male anf female there is no difference. sexual maturity of male and female is being reached at 1-4 years, depending on ecological environment opportunities, which determin the growth rate. this characteristic is obvious if we don’t pay attention to the medium mass of the sixth fish population in south africa on 1000 mm tl (medium weight differs comparing to the length of fish). therefor the conclusion that any biological and aquatic work has in its roots the length/mass equation. the ecomorphology of this fish demonstrates its adjustment to different environment conditions. this acclimatisation brings with it some ecological hazards when relocating this fish. the ecological hazards of relocating the african catfish in natural conditions there are some serios risks regarding relocating and breeding clarias gariepinus outside its natural environment. this species has all aggressive qualities of a succesfull predator, which fits rapidly in 76 an new place, due to the following: • it is extrermly fertile, it posses a flexible fenotype, • it has several preferences regardinf its environment and it resists to environment changes, • it is capable to feed on a large variety of prey, • it rapidly develops weight and length. in south africa, clarias gariepinus colonized the great fish river through the orange fish tunnel and same other river systems in the est and vest. the cape doesn’t represent though a threat to the indigenous fish population, sandella bainsii (anabautidae) and barbus palidus (cyprniadae) and neither potomananetes perlatus. studies made in east africa show that after introducing the african catfish aquatic environment was seriosly deisturbed. at least 20 species of parasite are hosted by the african catfish, one of them – arqullus japonicus – an unwanted alien, which can translocate. aquaculturalistst in africa and elsewhere in the world need to be much more sensitive to dangers posed by introducing the african catfish and not damaging their own country through the transfer of parasites that may induce the ecological risk of a native fish decimation. reference 1. d. adriaens, w. verraes, jurnal of morphology,– doi.wiley.com pag 1, journal of morphology 229:225269 (1996) ontogeny of cranial musculature in clarias gariepinus (siluroidei: clariidae): the adductor mandibulae complex, 1998 2. mar hossain, mcm beveridge, gs haylor, aquaculture, ingentaconnet.com. the effects of density, light and shelter on the growth and survival of african catfish (clarias gariepinus burchell, 1822), 1998 3. antalfi a. tolk, novenyevohalak, mezogazdasagi, kiado – budapest, 1972 4. bănărescu p.c., fauna r.p.r. pisces osteichthyes – editura academiei române, 1964 5. brehm a., lumea animalelor – traducere, 1965 6. bud i., piscicultura – caiet de lucrari practice – tipo agronomia cluj – napoca, 1999 7. bud i., acvacultura – curs universitar – tipo agronomia cluj – napoca, 1999 8. hogendoorn h., the african catfish a new species for aquaculture – revista aquacultura, 1992 9. horvath l., halbiologia es haltenyesztes – mezogazda kiado – budapest, 1996 10. manea ghe., aclimatizarea de noi specii şi alte organisme acvatice – editura ceres – bucureşti, 1985 11. morar r, creţa v, culea c-tin., zootehnia generală specială – editura didactică şi pedagogică – bucureşti, 1995 12. popovici i. şi col.– tratat de anatomie comparată. splanhnologie, ed. academie pres cluj napoca pag. 26 – 55; 93 – 222., 2002 44 correlation between plasma cortisol and reactivity in five horses alexandra nicoleta păvăloiu*, phd student professor ionel papuc*, phd abstract a plasma cortisol measurement and behavioral assessment of five horses was performed, to determine whether there was a correlation between plasma cortisol and their reactivity. a subjective emotionality survey for each horse was completed by the horse's owners and an objective novel stimulus reactivity test was performed. the horses reactions were used to calculate reactivity scores on a reactivity assessment sheet we specially designed. concentration of plasma cortisol was also measured and reactions to the blood sampling were quantified. associations were made between those different parameters. all five horses appeared to be hypo reactive and their cortisol levels were also very low. behavioral assessed reactivity seemed to correlate directly with the plasma cortisol, all values showing a marked hypo reactivity in all horses. the data obtained provided evidence that low plasma cortisol is a good marker of reactivity in hypo reactive horses and also that the designed sheets for the assessment of objective and subjective reactivity may be used, in correlation with plasma cortisol as an assessment tool in the current practice. keywords: horse, reactivity, behavioral tests, plasma cortisol, assessment sheet introduction horses are kept for various reasons, having become very popular for sport and recreations in the past decades. even though when buying a horse, appearance and performance is being assessed, temperament is not. therefore, many horses are being sold due to their undesirable temperament and a match between horse and its owners temperaments seems now a logical and necessary factor (visser et al., 2003). romania is now approaching this field of interest in the past years, so an assessment method adapted to its economic and social reality seems appropriate. there are many reasons why horse behavior is important even to the clinician. this applies even more in equine medicine then in small animal medicine, because the size of the patient represents more of a threat. the greatest proportion of horse related injury and death is rather behavioral then performance related. therefore, the first reason to be considered is owner safety, and also self protection as a veterinarian (houpt et al., 2006). temperament in animals has only been of interest in the last half of century, with pavlov as a pioneer and followed by a few scientist in the 70's, followed by more attention from researchers in * university of agricultural sciences and veterinary medicine cluj napoca, faculty of veterinary medicine, discipline of semiology, ethology and diagnostic imaging, 3-5 mănăştur street, 400372 cluj-napoca, romania, e-mail: alexa.nicoleta@gmail.com cluj veterinary journal, 15(1)/2009, pp. 44-49 45 the late 90's. it can be defined as an association of internal factors that assure a constant behavior from one moment to another, behavior that is constant in time and correlated to other behavior (lansade, 2005). reactivity or emotionality, in the horse, is a heightened state of arousal, which may influence the horse's manageability and usefulness for specific tasks. reactivity in horses has both behavioral (emotionality, flight response etc.) and physiological (changes in heart rate, respiration, hormones like adrenaline and cortisol etc.) components, and these components should be used as an assessment tool by correlation (mccall et al., 2006). potential application of horse personality and temperament assessment have been researched in lansade (2005). equine personality assessment currently involves classification and assessment of observed behavior (anderson et al., 1999, visser et al., 2002, mccall et al., 2006). also, completion of subjective questionnaires on the behavior of individuals over a variety of situations was performed (momozawa et al., 2005, visser et al., 2003) as well as comparative research (gosling et al., 2002). there were also studies performed on whether judges can actually agree on the assessment of horse personality characteristics (morris et al., 2002). reactivity was measured either by novel stimulus tests or isolation tests (lansade et al., 2008, mccall et al., 2006). this study was conducted to identify whether there is a correlation between plasma cortisol and horse reactivity, and also to design two assessment sheets, one for an objective assessment and one for the owners, as a subjective assessment. should significant relationships exist, they may prove useful in predicting the suitability of horses for different equestrian sports. material and method the horses a total of 5 horses were used, aged between 2 and 20 years, of different breeds (3 mares of half bred romanian heavy draught, one nonius half bred stallion and one romanian sport horse stallion). two of them were from the faculty of veterinary medicine cluj napoca and three belonged to different private owners in cluj napoca. blood collection because prior studies have shown circadian rhythms in cortisol concentrations (frank, 2006, higgins et al., 2006), blood sampling began at 10 am and ended at 11 am each collection day. to avoid stress, collection was performed in the horse's natural environment, whether it was the stable or a paddock, and the horse was held by a person that was familiar to him. blood collection was done by venipuncture of the left jugular vein and one 2,0 ml blood sample was collected into a sterile vacutainer containing 0,1 ml of 15% edta solution. the behavioral reaction of each horse was scored, by giving a score of '0' for no reaction, a score of '1' for minimal movement and a score of '2' was given for extended movement. blood samples were kept on ice immediately after collection and centrifuged for plasma within an hour after collection. plasma cortisol determination plasma cortisol was assessed by elfa (enzyme linked fluorescent immunoassay) technique. its principle relies on the combination of a traditional elisa (enzyme linked immunosorbent assay) test with a final fluorescent detection. a cors test was used on a vitek immunodiagnostic assay system. cors vidas method is calibrated by the reference method id-gcms (isotope dilutiongas cromatography mass spectrometry). 46 plasma cortisol levels were determined at a local human accredited laboratory, since no special equine kits are commercially available in romania for the moment. subjective scoring each horse was assigned with a subjective emotionality score adapted from mccall et al., 2006, by their owners. the scores were included in a specially designed subjective assessment sheet that contained data on the assessed horse (name, breed, age, sex) and description of a possible scenario. emotionality scores that were to be assigned were as following: 1bold and calm, 2bold, 3-normal, 4-shy, 5-very shy and reactive (mccall et al., 2006). objective reactivity testing the next day after blood collection was used for objective reactivity testing by novel stimuli test, as adapted from anderson et al (1999). the first stimulus used was a vocalizing, dancing toy frog placed in front of the horse for 20 seconds. after the cease of any reaction to this stimulus, a 'popping balloon' test (fig. 1) was used and then an umbrella was opened in front of the horse (fig. 2). the horses were allowed to touch and inspect the stimuli after confronted with them. the tests were performed in an open space, with which the horses were familiar with and they were handled by the same handler. behavior was observed and noted on a assessment sheet we designed, that contained data on the horses (name, age, sex, breed), scores from the reactions to the blood sampling, detailed description of expressions, vocalizations and movement, that were based on a behavioral defined scale as described by anderson et al. (1999), as well as different observations on the clinical appearance of the horses. an average reactivity score was calculated for every horse. the minimum value of the score to the objective testing, after adding the scores from blood collection was 3, while maximum that could be obtained was 17, with an average value between 9 and 11. association between different parameters measured association between objectively assessed reactivity and plasma cortisol due to the purpose of discovering a relationship between these two parameters, a comparison between each horse's reactivity score and plasma cortisol value was made. association between behavioral extremes and plasma cortisol we compared results of horses with the lowest reactivity score to their plasma cortisol value. association between objective and subjective reactivity assessment to analyze whether owners can rank their horses accurately, we compared results from both the objective behavioral tests and the subjective evaluation sheets of each horse (adapted from anderson et al. 2006). fig. 1. preparation for the umbrella test fig. 2. popping balloon test 47 results general all horses were easy to work with, none had big issues with blood collection. reactions to stimuli were diverse, but as an average all horses showed a marked response to the umbrella test, while being practically insensitive to the toy stimulus. association between objectively assessed reactivity and plasma cortisol each horse's reactivity score was compared to its plasma cortisol value. as shown in table 1, 2 and 3, plasma cortisol levels were low in all horses and could be correlated to their corresponding, low objective test scores. table 1. results in plasma cortisol determination, objective and subjective scores case/sex cortisol (ng/ml) objective score subjective score 1-f 28,62 6 2 2-f 34,45 8 1 3-f 30,15 8 2 4-m 22,35 6 2 5-f 32,78 8 1 case 1 case 2 case 3 case 4 case 5 0 5 10 15 20 25 30 35 40 45 50 55 60 n or m al c or tis ol v al ue s case 1 case 2 case 3 case 4 case 5 3 5 7 9 11 13 15 17 objective tes ting s cores o bt ai na bl e sc or es table 2. comparison of obtained basal plasma cortisol value to normal mean value (55 ng/ml) table 3. obtained objective scores (average score 9-11) the surprise of the study consisted in the fact that both stallions had very low plasma cortisol levels, as opposed to common belief that they are more aggressive and reactive then mares or geldings. association between behavioral extremes and plasma cortisol both extremed of score 6 when assessed by objective testing had the lowest two plasma cortisol values (22,35 and 28,62 ng/ml). association between objective and subjective reactivity assessment all owners assessed their horses as under normal reactivity (hypo reactive, scores 1 and 2), therefore the results correlated well with our measurements. discussions basal cortisol levels ranged from 22,35 to 34,45 ng/ml. the values in our cases are in the normal range of plasma cortisol values, but towards the lower limit. it is not to be forgotten that results may vary due to age, sex and breed, as well as other factors (higgins et al., 2006). 48 the surprise of this study was represented by the two stallions with low plasma cortisol levels. although their hypo reactivity was confirmed by the owner and us in this case (emotionality scores 2, objective scores 6), stallion reactivity is usually higher than the one of geldings and mares, which is why they are considered not to be suitable as 'pets', and they should rather be used in other purposes than a recreational one. conclusions a correlation between hormone concentrations, objective scores and subjective scores was found, therefore allowing us to conclude the following: the owners of the five horses tested accurately assessed their horses and low plasma cortisol levels do correlate to low objective test scoring in hypo reactive tested horses. due to the small number of tested horses and the fact that we only detected hypo reactive horses, we cannot be sure if our results apply to a larger, more reactive group of horses. our results partially match the studies of anderson et al. (1996), whose hormone concentration just partly matched objective measurements results and mccall et al. (2006), but a study on a larger group of horses needs to be performed to be sure of the accuracy of this method. in spite of this, we do recommend it as a quick and easy way to assess horse reactivity, since in our case it reflected the horses reactivity status accurately. acknowledgments the warmest of thanks are addressed to dr. c. mureşan, who's patient advice on conceiving an article were of invaluable help. also, many thanks go to dr. a. pîrvulescu, dr. r. drozan and dr. j. ginter for their assistance on testing. references 1. marsha k. anderson, friend, t.h., evans, j.w., diana m. bushong, 1999, behavioral assessment of horses in therapeutic riding programs, applied animal behaviour science, 63, 11-24; 2. frank, n., 2006, insulin resistance in horses, proceedings of the american association of equine practitioners; 3. gosling s.d., vazire, s., 2002, are we barking up the right tree? evaluating a comparative approach to personality, journal of res. personality, 36; 4. higgins, a. j., snyder, j. r., 2006, the equine manual, ed. elsevier saunders, philadelphia; 5. houpt, k.a., mills, d.s., 2007, why horse behavior is important to the clinician, equine veterinary journal, 38, 386-387; 6. lea lansade, 2005, le temperament du cheval: etude theoretique. application a la selection des chevaux destines a l'equitation, universite francois rabelais de tours, ecole doctorale 'sante, sciences et techniques'. 7. lea lansade, marie-france boissou, 2008, reactivity to humans: a temperament trait of horses which is stable across time and situations, applied animal behaviour science, doi: 10.1016/ j.applanim.2008.04.12; 8. lea lansade, marie-france boissou, erhard, h.w., 2008, reactivity to isolation and association with conspecifics: a temperament trait stable across time and situation, applied animal behaviour science 109, 355-373; 9. mccall, c.a., hall, s., mcelhenney, w.h., cummins, k.a., 2006, evaluation and comparison of four methods of ranking horses based on reactivity, applied animal behaviour science 96, 15-127; 10. momozawa, y, kusunose r, kikusui t, takeuchi y, mori y, 2005, assessment of equine temperament questionnaire by comparing factor structure between two separate surveys, applied animal behavioural science, 92, 77-84; 11. morris, p.h., gale a., katherine duffy, 2002, can judges agree on the personality of horses?, personality and individual differences 33, 67-81; 49 12. visser, e.k., van reenen c.g., rundgren, m., zetterqvist, m., morgan, k., blokhuis, h.j., 2003, responses of horses in behavioural tests correlate with temperament assessed by riders, equine veterinary journal, 35. 13. visser, e.k., van reenen, c.g., van der werf, j.t.n., schilder, m.b.h., knaap, j.h., barneveld, a., blokhuis, h.j., 2002, heart rate and heart rate variability during a novel object test and a handling test in young horses, psychology and behavior 76, 289-296. 63 strongyls benzimidazole resistance in equine from zoo lecturer mihai cernea*, phd lecturer cristina cernea**, phd abstract the research in view of establishing the development and the way in which antihelmintical treatment influences epidemiological indexes, was carried out between october 2008 and may 2009 in equine species from zoos. in the zoo located targu mures it was noticed am strongyls intensity of 2300 epg 8700 lpg in horses, and 700 epg 1400 lpg in ponies. in vitro effectiveness of bemzimidazoles (bz) being low in both horses and ponies. in the zoo located in turda the intensity of the strongyl parasitism reached the level of 900 epg 2300 lpg in horses and 2400epg 2800 lpg in ponies, the effectiveness of the benzimidazoles being low. in the zoo located in baia mare the intensity of strongyls infestation was of 900 epg 1600 lpg in horses, 1900 epg – 2600 lpg in ponies, 900 epg -1500 lpg in donkeys benzimidazoles treatment being proven effective. cyathostomum species are considered as having the most significant pathology in equines. worldwide, anthelmintical treatment, especially in strongylatosis, faces an ever-increasing phenomenon of drug resistance, to phenotiazin, thiabendazole as well as other bz and probz, in the strongyls population [moore, 2000]. the lack of success in treatment using drug combinations (piperazin and phenotiazin; triclorfon and phenotiazin; diclorfos and morantel) have spurred the development of new substances to which strongyls have not developed resistance [lyons and drudge, 1999]. tong time treatment with the same substance leads to the development of drug-resistant strongyl population, thus a low effectiveness, below the desired level [bauer, 1983]. keywords: strongyls, equine, zoo, cyathostomum, benzimidazole resistace. materials and methods the research carried out in three zoos between october 2008 and may 2009 showed complex yet specific aspects of strongyls infestation, even if the total number of animals was relatively small (n=12). the tests employed were: egg hatch assay – eha and larval development assay – lda. the tested molecules were: thiabendazol – tbz, mebendazol – mbz, fenbendazol – fbz and albendazol – abz. * university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, department of farmacology, 3-5 mănăştur street, 400372 cluj-napoca, romania, e-mail: mscernea@yahoo.com ** university of agricultural sciences and veterinary medicine. faculty of veterinary medicine, department of phisiology, 3-5 mănăştur street, 400372 cluj-napoca, romania. cluj veterinary journal, 15(1)/2009, pp. 63-68 64 results and discussion târgu-mureş zoo – jud. târgu-mureş in this facility there were 5 individuals, 2 horses and 3 ponies which were separately housed. regarding the level of strongyls infestation it was noticed that in horses was of 2300 epg 700 lpg. the ponies showed a lower level of infestation 700 epg 1400 lpg (table 1). table 1. level of strongyls infestation and the identified species – târgu-mureş zoo species no. intensivity identified species (%) epg lpg cyathostomum a cyathostomum d horses 2 2300 8700 80 20 ponies 3 700 1400 40 60 in the past few years anthelmintic treatment in horses was done twice a year, with albendazole and triclorfon. the egg hatch assay done in the horses proved the lowest effectiveness of mebendazole (y=672.90), followed by albendazole and fenbendazole (tabel2). table 2. the results obtained by using eha and lda tests at horses from târgu-mureş zoo thiabendazol mebendazol fenbendazol albendazol eha the egg hatching% on the control samples = 71,11 ar p pa ra m et er s a b a b a b a b -387,59 41,49 118,06 82,60 54,14 81,90 96,39 89,30 hatching% at 0,15µg/ml -16,64 100,31 90,02 103,76 lc50 -0,0219 -0,2761 -0,5893 -0,4077 y maxim -1896,46 672,90 352,6 571,25 lda the larval development% on the control samples = 50,27 ar p pa ra m et er s mic 0,0269 0,1330 0,0269 0,0682 a b a b a b a b -311,05 8,37 -233,01 31,31 -311,05 8,37 -242,71 21,56 y maxim -1546,88 -1133,74 -1546,88 -1191,99 the larval development assay showed a negative tendency of the regression curve for all tested substances (table 2). these results showed a high effectiveness of bz over the strongyls population, but in case of mebendazole and albendazole high levels of third stage larva were observed at high concentrations (mbz – 0,3125µg/ml; abz – 5µg/ml). global analysis of the tow assays highlights the resistant strongyls forms to the usual anthelmintical medication, this being confirmed by the high levels of infestation (8700 lpg). in this case, a change in the anthelmintical medication is recommended, using substances from the tetrahidropirimidin group, or macrocyclic lactones. a similar situation was noticed in the ponies, egg hatch assays showed a high effectiveness for the tested substances, highest among them was fenbendazol and thiabendazol (y-1546.88) (table 3). for all substances tested the regression curve showed a negative tendency, thus we can consider 65 that strongyls population did not develop resistance to bz. in case of the larval development assay the result showed that the only effective bz were mebendazole (y=-581.19) and fenbendazole (y=-92.66), for which the regression curve being negative (table 3). for these substances mic had lowest values, of 0.2019µg/ml, and 1.5224µg/ml. in case of albendazol and thiabendazol third stage larva that developed at a concentration of 0.3125µg/ml (maximal development percent) and 0.1563µg/ ml, these values determining a positive tendency in the regression curve. statistical interpretation showed negative values for the mic for these tow substances, which reflects e low effectiveness over the strongyls population. global analysis of the four tests of therapeutic effectiveness shows a high susceptibility to bz resistance in the strongyls population. table 3. the results obtained by using eha and lda tests at ponies from târgu-mureş zoo thiabendazol mebendazol fenbendazol albendazol eha the egg hatching% on the control samples = 53,12 ar p pa ra m et er s a b a b a b a b -33,28 52,59 189,37 70,84 31,92 74,90 139,26 67,92 hatching% at 0,15µg/ml 47,68 47,60 79,69 88,81 lc50 0,0780 -0,1100 -0,7803 -0,1287 y maxim -1546,88 -1133,74 -1546,88 -1191,99 lda the larval development% on the control samples = 31,50 ar p pa ra m et er s mic -0,2136 0,2019 1,5224 -0,2620 a b a b a b a b 261,08 55,92 -121,26 25,11 -26,67 40,69 177,57 46,84 y maxim 1361,32 -581,19 -92,66 934,69 turda zoo, jud. cluj in this zoo the equine population was made up of a horse and 3 ponies. infestation reached a level of 900 opg and 2300 lpg in case of the horse. the ponies showed a grater infestation level being 2400opg and 2800lpg (table 4) table 4. level of strongyls infestation and the identified species turda zoo species no. intensivity identified species (%) epg lpg cyathostomum a cyathostomum c cyathostomum d horse 1 900 2300 51,3 10 38,7 ponies 3 2400 2800 71,19 28,81 anthelmintical treatments are done three times a year using albendazole based pharmaceutical products. statistical interpretation of data obtained through the egg hatch assay showed a very low effectiveness of fenbendazole (y = 1273.84) and mebendazole (y = 250.20), the overall aspect of the regression curves being influenced by these positive values (table 5). in the larval development assay, even if the regression curves have a negative tendency, high mic values are noticed, especially in 66 fenbendazole (0,2672µg/ml) and albendazole (0,1511µg/ml) (table 5). global analysis of this data shows that the strongyls population is becoming resistant to benzimidazoles and benzimidazole derivatives. to prevent this phenomenon a change in the anthelmintical medication is recommended, using substances from the tetrahidropirimidine group, or macrocyclic lactones [cernea et al, 2005]. table 5. the results obtained by using eha and lda tests on equines from turda zoo thiabendazol mebendazol fenbendazol albendazol eha the egg hatching% on the control samples = 58,33 ar p p ar am et er s a b a b a b a b -97,05 41 36,43 68,05 236,41 91,79 216,66 87,90 hatching% at 0,15µg/ml 26,44 73,52 127,25 120,40 lc50 -0,0926 -0,4955 -0,1768 -0,1749 y maxim -444,25 250,20 1273,84 1171,20 lda the larval development% on the control samples = 62,50% ar p pa ra m et er s mic 0,0269 0,0269 0,2677 0,1511 a b a b a b a b -386,72 10,41 -386,72 10,41 -175,10 46,91 -243,28 36,79 y maxim -1923,19 -1923,19 -828,59 -1179,61 baia mare zoo, jud. maramureş in this zoo the equine population was made up of 3 equine species (horse, pony and donkey) with ages between 7 and 12 years. the 3 animals are housed together in the same enclosure, feed being supplied from producers. the maximum intensity of the strongyls infestation was in the pony in which opg level reached 1900 and lpg 2600. the horse varied between 900 opg and 1600 lpg, the donkey showed a similar situation (table 6) table 6. level of strongyls infestation and the identified species baia mare zoo intensivity identified species (%) epg lpg cyathosto-mum gyaloce-phalus poterios-tomum oesophagodontus s. vulgarisa d horse 900 1600 33,33 50,00 16,67 pony 1900 2600 36,66 30,00 13,33 20,01 donkey 900 1500 33,30 40,47 14,28 11,92 the equines baia-mare zoo are dewormed annually with abz or fbz based pharmaceutical products, the last treatment was applied using fbz in april 2005. through analysis of eha it was noticed that the percentage of hatching at the concentration of 0.15µg/ml was null in all substances, except abz were it reached 10%, but below the 50% that indicates resistance (table 7). from a statistical point of view the obtained values were -15.3%for fbz, -14.41% for mbz and 4.61% for abz, which determined a direct correlation with the negative values obtained in the lc 50 . 67 table 7. the results obtained by using eha and lda tests on equines from baia mare zoo thiabendazol mebendazol fenbendazol albendazol eha the egg hatching% on the control samples = 38,98 ar p p ar am et er s a b a b a b a b -247,55 14,97 -209,66 17,03 -195,81 14,23 -171,63 30,36 hatching% at 0,15µg/ml -22,15 -14,41 -15,13 4,61 lc50 -0,1414 -0,1572 -0,1826 -0,1144 y maxim -1222,78 -1031,27 -964,82 -827,79 lda the larval development% on the control samples = 53,82 ar p pa ra m et er s mic 0,1980 0,1762 0,6959 0,1497 a b a b a b a b -171,85 34,10 -216,01 38,10 -58,49 40,75 -250,83 37,64 y maxim -825,15 -1041,95 -251,70 -1216,51 analysis of the risk degree regarding the manifestation of resistance to bz in the strongyls population from these equines showed negative tendencies in all tested substances. the lowest risk degree was found for mbz (y=-1031.27, followed by fbz (y=-964.82) and abz (y =-827.79). thou in this facility the risk of infestation is not reduced; it is considered that applying treatment correlating with isolation of this group from the sources of massive contamination determines weak pressure for the adaptation of the strongyls to the usual medication. to further reduce the degree of strongyls infestation in equines requires a therapeutic strategy that includes a minimum of 2 annual treatments and for the prevention of resistance the treatment alternating substances from different pharmacological groups. in case of lda the first third stage larva appeared at a concentration of 0.0781µg/ml for tbz and abz, and 0.0391µg/ml for mbz and fbz (table 7). analysis of the data determined mic values of 0.1980µg/ml for tbz, 0.1762µg/ml for mbz, 0.6959µg/ml for fbz and 0.1497µg/ml for abz. even if mic has rather high values, mapping the regression curve has a negative tendency, which is correlated with good sensitivity of the strongyls population to the tested medication. the regression curve is similar to that obtained in the eha, which confirms the lack of resistance of the strongyls to bz derivatives. conclusions in the equine population from tg mures zoo, it has been noticed the intensity of strongylidosis infestation as being 2300 opg 8700 lpg in horses, and 700 opg 1400 lpg in ponies; in vitro effectiveness of bz being low in both species. in the equine population from turda zoo, it has been noticed the intensity of strongylidosis infestation as being 900 opg 2300 lpg in horses and 2400 opg 2800 lpg in ponies; in vitro effectiveness of bz being low in both species. 68 in the equine population from baia-mare zoo, it has been noticed the intensity of strongylidosis infestation as being 900 opg 160000 lpg in horses and 1900 opg 2600 lpg in ponies and 900 opg 1500 lpg in donkeys; in vitro effectiveness of bz being good in all species references 1. bauer c. [1983]. anthehelmintika resistence problembeschreibung und in vitro unterschungen inaug. diss. tierarylitl., hoschschule, hannover, 422. 2. cernea m., cozma v., cernea c., mărculescu a., [2005]. researches about egg hatch assay for the detection of antihelmintic bezimidazoles resistance, in horse strongyles. 5th international conference of phd students, university of miskolc, hungary 14-20 august 2005. 3. lloyds., soulsby e.j.l., [1998]. is anthelmintic resistance inevitable: back to basics? equine vet. j., 30 (4), 280-283. 4. lyons e.s., drudge t.j., [1999]. historical perspective of cyathostomes: prevalence, tratment and control programs. vet. parasitol., 85 (2/3); 95-225. 5. moore, j.n., [2000]. controlling equine cyathostomes. equine forum, 391-393. type of the paper (article cluj vet j 2022, 27, 2 http://clujveterinaryjournal.ro article hoop structure for horses during winter season: controlling the low critical temperature ioan hutu1,2, bianca lungu2*, gabriel otava1,2 , iuliu torda2, simona marc1,2, oana boldura1,2, calin mircu 1,2 1 university of life science “the king michael i” – faculty of veterinary medicine, timisoara, ro 2 horia cernescu research unit – usv timisoara, ro *correspondence: bianca.lungu@fmvt.ro abstract: hoop barns, the low input housing structures, can be used in housing horses during fall and winter seasons. one of the hoop structures issue is the level of temperature, which is close to environmental temperature. the aim of this study is to show some technological measures which can overcome the weaknesses of hoop structures such as: feeding strategy, water system and body warming of horses using ir film. the control variable was the skin temperature of six horses, repeatedly measured with flir® thermo camera during several levels of environmental temperature. in the study, by using ir heating film at outside temperatures such as 0, -5 and -10°c, the body temperature measured in three body regions (neck, shoulder point and internal angle of eyes) did not differed significant (f=0.167 at p =0.847): without ir heating system, differences were observed (f= 8.905 at p =0.000). moreover, in low bcs’s animals, below -10°c environmental temperature, in absence of ir heating and if less fiber was present in the diet, low critical temperature signs were observed. in conclusion the hoop structure can be used successfully in horses even when outside temperatures are below low critical temperature of horses if certain conditions are assigned such as: water at 10-15°c, additional hay for fiber, with or without infrared heating. keywords: hoop structures, low temperature, horse 1. introduction hoop structures have been used as effective alternative housing for grow-finish swine in the united states, canada and australia for over 30 years [4]. in romania a hoop structure was studied [6,7,9,10,11, 13] and has been operable at banat university – horia cernescu research unit since 2012. hoop structures offer a distinct advantage for animal production due to the substantially smaller capital investment, relative to a conventional confinement building along with substantial reductions in energy operating cost. energy use is reduced because these structures are not heated or mechanically ventilated. in cold seasons, horses utilize the low energy consumption systems ir heat panels to increase the thermal comfort. during warm seasons, structures with a north/south long axis orientation in open areas, will experience substantial natural air flow for ventilation. in addition, the high arch-shape of the structure creates a “chimney effect” that facilitates natural air flow. furthermore, hoop structures are also versatile buildings that are easily converted to facilities for other types of livestock or for feed or equipment storage if a farmer decide to discontinue swine production and focus on other enterprises [9]. finnish researchers investigated the respiratory health effects of loose indoor/outdoor group housing on weanling foals in cold scandinavian winters (below −20°c in finland for several consecutive weeks during the winter season) and they found that, generally, the foals did very well in this environment. the general conclusion was that keeping weanling horses in cold loose housing systems does not seem to increase the occurrence received: 06.10.2022 accepted: 27.10.2022 published: 15.11.2022 doi: 10.52331/cvj.v27i2.39 copyright:© 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). https://doi.org/10.52331/cvj.v27i2.39 cluj vet j 2022, 27, 2 2 of 24 of respiratory diseases, but special attention should be focused on ventilation, air quality and feeding-practices [12]. the specific objective of this report was to establish baseline conditions and expectations for keeping horses in hoop systems in romania during the winter season of the year by using ir heating film panels. 2. materials and methods animals and data collection: six horses (thoroughbreds, romanian sport horse and arabian breeds) weighing 580.83±17.14 kg were obtained from private owners on november 2018 by research contract no. 6944 from 25.09.2013 and placed in the ruminants hoop structure at the horia cernescu research unit, infrastructure of life science university “king michael i” timisoara, ro. the group consisted of 4 females and 2 males which were placed in individual pens inside the hoop structure after deworming based on fecal analysis. the horses were acclimated to their new location for 15 days. no haircuts were performed during the trial, but one physiological change was observed an increase in density and length of the horse's coat. on the fifteenth day, horses were weighed and scored for body condition scoring. subsequently, horses were weighed and scored for bcs every month considering the henneke’s scale [5] for jumping horses. inside and outside temperature and humidity of hoop were continuously monitored using a multi-functional wireless digital device weather station pce-fws 20. the flir (e50 multi-spectral imaging dynamic, msx®, wilsonville, oregon, usa). a thermocamera was used for collecting the external body temperature of horses several times, when environmental temperature was in the limits established by the study. the body temperature was taken in three points (neck, head – internal angle of eyes and point of shoulder – figure 2) during the trial period (december and january) depending on the inside temperature inside the hoop: at 0.0±2.0°c, at -5.0±2.0°c, and -10.0±2.0°c. feed: feed consisted of two intakes of 2.0 kg of washed oats and three intakes of 3.0 kg of grasses hay (less than 2% of their body weight in hay per day), 40 ml of corn oil daily, salt, vitamins a, d, e and 2:1 calcium-phosphorus mixture. for medical reason, during january one horse received just 1.25 kg of grasses hay per intake. composition of the feed was analyzed by foss infraxact® (hillerød 3400, dk), nir equipment. feed was stored in bags in the hoop structure and feeders were filled manually after weighing using ranger mate (american calan, northwood, new hampshire, usa). each pen was equipped with one nipple/cup water fountain and one feeder. in order to prevent freezing of pipes, a heating cable was used – the temperature was set to 10-15°c. housing: the experimental unit – hoop structure used for this trial has a total exterior dimension of 12 x 36 m and has concrete flooring, although it was primary designed for heifers and redesigned for horses’ during the trial (figure 1). the primary design feature of these types of structures consists of uniformly spaced metal arches which are covered with a tightly woven plastic tarpaulin which is stretched out over the arches. the arches are attached to the top of vertical posts. these posts serve as the foundation of the structure. the tarp is stretched by means of small winches attached to the exterior surface of the posts. the interior of the posts is faced with wooden boards or sheet material to create a wall of 1.75 meters in height. the arched ends of the structure are typically covered with similar plastic canvass material with some type of roll-up doorway. the end-walls are often partially or completely opened during warm weather to increase air flow and reduce internal structure temperature and totally closed during the cold season. during winter, the one side inlet (15 cm x 36m) and top outlet 30cm x 36 m) were completely open in order to stimulate the air flow and to avoid the formation of condensation drops. the six horses were housed in the hoop structure, one per pen. each of the six pens in which horses were housed measured 3.6 x 5.50 m. this offered 23.76 m2 per animal which is more than the recommendation on horse housing for research purposes – [4,8]. each of the 6 pens were equipped with one heating panel (handmade two rows of 2 m2 of heating film, power 200w/m2, with long-wave infrared radiation, of 4 µm ÷14 µm anchored in arch ceiling structure, parallel with floor, at 3.5 meters high (figure 1). cluj vet j 2021, 27, 2 3 of 24 (a) (b) figure 1. normal (a) and flir thermocamera (b) imagines of trial place – six pens in hoop structure each with one ir heating panel suspended in arches of ceiling (hutu, 2018). statistical analysis: analysis of external body temperature of horses were performed using one-way analysis of variance (anova) for temperature of three body regions in presence or absence of ir heating panels. all data comparing body temperatures in case of using/not using ir heating was analyzed using two-sample student’s t-tests. for lower number of data, the wilcoxon signed ranks test was used. 3. results and discussion body weight was in average 580.83±17.14 kg at the beginning of the study (november 2018) and 585.83±18.09 kg at the end, on 31th of january 2019. the easy training activities were done during the study. in those conditions, even if the temperature in the hoop was lower, horses became heavier but the difference between the start and finish of the trial cannot be statistically sustained (z=-0.843 at p = 0.339 wilcoxon signed ranks test). body condition scoring was in average adequate for jumping horse (bcs = 5.54±0.12). bsc was assessed three times: during the accommodation period, at the end of december and at the end of january. major differences were not observed during the study period (p=0.317, wilcoxon test): in average bcs was 5.41±0.24 at the beginning of the study (november 2018), 5.58±0.20 in december and 5.62±0.22 at the end of the study period (january 2019). temperature and humidity: the inside temperature was higher (+1.56 оc at p< 0.001) and humidity index was lower (-0.49% at p< 0.001) than outside measurements. there was a strong correlation between inside and outside temperature (r = 0.925 at p < 0.01) and humidity index (r = 0.829 at p< 0.01). there were no clinical signs of low critical temperature among horses even though daily minimum temperatures often exceeded -10.0o c during january, with one exception. one horse that scored 4.5 in bcs had horripilation, muscle contractions, reduced blood flow at the level of the extremities such as ears, muzzle and legs as a sign of cold stress. as a preventive measure, horses that are body clipped or with low bcs will benefit from a blanket. blankets are also beneficial for short term, in extremely cold, wet weather [3]. external body temperature of horses was measured in three body regions, with and without ir heating film, at outside temperatures such as 0, -5 and -10°c. without ir heating panels, at previously mentioned environmental temperature, the body temperature measured was 18.28±0.74оc, 18.90±0.72оc and 22.19±0.65оc – in the study, the differences were significant (f= 8.905 at p =0.000). when measured in each body region (middle of neck, shoulder point and internal angle of eyes) the temperature was well differentiated (f=38.34, p=0.000): 17.79±0.38оc for neck region, 18.09±0.63оc for shoulder point and 23.49±0.50оc for internal angle of eyes. the variability between several body regions is normal and was reported by several authors [1]. cluj vet j 2022, 27, 2 4 of 24 with ir heating panels on, the body temperature measured was 19.99±0.85оc, 19.34±0.76оc and 19.61 ±0.78оc – in the study, the differences did not differ significantly (f=0.167 at p =0.847). it appears clearly that ir body heating panels reduce the variability of body part temperature and the influence of external negative temperature of the environment. measured in each body region (neck, shoulder point and internal angle of eyes) the temperature was well differentiated (f=36.46, p=0.000): 17.79±0.37оc for neck region, 17.92±0.65оc for shoulder point and 23.23±0.46оc for internal angle of eyes). because the aim of using ir heating film is body’s warming and not to heat the air of the stable, ir panel heating film had a lower electricity power consumption for one horse the electrical power consumption is 0.4 kwh (1.44 mj). for all six pens the electricity consumption was 2.4 kwh (8.64 mj) which is similar with a domestic air heater. the flir thermocamera used for collecting the external body temperature worked pretty well in cold climate, like other authors suggested [2]. the low critical temperature's signs were observed at environmental temperature below -10°c in one horse– it was the case of a horse that had a lower bcs’s, in absence of ir heating and with less fiber in the diet – because of colic prevention measure. horses increase body metabolism through various physiological mechanisms. bacterial fermentation of forage in the hind gut of the horse is one of them – by this, horses can generate a tremendous amount of heat. as a result, horses can tolerate much colder weather than humans. practically, the addition of fiber to the diet will increase heat from fermentation. in conclusion of the study, the hoop structure can be used successfully in horses, even when outside temperatures are below the low critical temperature of horses, if certain conditions are fulfilled such as: water at 10-15°c, feed rich in fiber and bsc in optimum ranges. 5. conclusions hoop structures can be used for housing horses during the winter season, if an increased diet of grass hay is provided. increasing the external temperature by using panels with long-wave infrared radiation of 4 µm ÷14 µm does increase thermal comfort and will facilitate the housing of horses in extremely cold environments. because the aim of body warming by ir heating film is not to heat the air of the stable, ir panels had a lower electricity power consumption for one horse the electrical power consumption is 0.4 kw/hour. low body condition score imposes the increase of grass hay intake, use of a blanket, or ir heating systems in order to avoid the clinical signs of low critical temperature in the hoop structure. author contributions: “conceptualization, i.h. and c.m.; methodology, g.o.; validation, o.b investigation, l.b and i.t.; writing—original draft preparation, i.h.; writing—review and editing, s.m.; visualization, c.m.; funding acquisition, i.h. all authors have read and agreed to the published version of the manuscript”. funding: the research was financed by extension unit, ong, in research contract no 6944 from 25.09.2013 analysis and testing of the infrastructure for the maintenance and exploitation of horses. institutional review board statement: the study was conducted according to the guidelines of the low 43 11.04.2014 and approved by the ethics committee of horia cernescu researh unit, protocol code pouex1.1 from 27.05.2016. acknowledgments: the authors acknowledge to the faculty of veterinary medicine students (gabriel terei, bibart alexandru, balint andras, balint szillard and halil fahmawi coordinated by phd irina patras) for their volunteer activities, to the banat’s university horse jumping team (lupu andreea and rusu adelina whith mary, popescu teodora figure 2. flir® ir image with temperature spot on "point of shoulder". cluj vet j 2021, 27, 2 5 of 24 with gordon, marza-rizac laura with f-rock, moaca marius with afrodita, galeancu stefan whith navaro) and to trainers olimpia rusu and bogdan biris for collaboration and giving horse during trial period. conflicts of interest: “the authors declare no conflict of interest.” references 1. autio e, neste r, airaksinen s, heiskanen ml., measuring the heat loss in horses in different seasons by infrared thermography. j appl anim welf sci. 2006; 9(3):211-221, doi: 10.1207/s15327604jaws0903_3 2. autio e.,heiskanen ml, mononen j, thermographic evaluation of the lower critical temperature in weanling horses j appl anim welf sci 2007;10(3):207-16. doi: 10888700701353493 3. deboer m., konop a., fisher b., martinson k., dry matter intake, body weight, and body condition scores of blanketed and nonblanketed horses in the upper midwest, 2020, journal of equine veterinary science, 2020, 94:103239, doi: 10.1016/j.jevs.2020.103239. 4. harmon d.j., honeyman m.s., koening b., hoop barns for horses, sheep, ratites, and multiple utilization, mwps-aed 52, iowa state university, midwest plan service, 2004. 5. henneke d.r., potter g.d., kreider j.l., yeates b.f. 1983, relationship between condition score, physical measurements and body fat percentage in mares. equine veterinary journal, 15 (4):371-372 6. hutu i, hoop structures design for gestating sows: review, lucrări ştiinţifice, 2006, 49, ed. “ion ionescu de la brad”. 7. hutu i, onan w.g., hoop structures for finishing pigs. lucr. şt. med. vet. timişoara, 2008, 37:879-887. 8. hutu i., manual de bune practice în unitățile experimentale (vol 2), ed. agroprint, timisoara, 2018. 9. hutu i., onan gw., alternative swine management systems, academic press – elsevier, 125 london wall, london ec2y 5as, united kingdom 525 b street, suite 1650, san diego, ca 92101, united states. doi: https://doi.org/10.1016/c2018-004639-3 10. hutu i., onan w.g., hoop structure for wean to finish pigs: gender influences on carcass in a summer trial, lucrări științifice medicină veterinară, 2016, 59(4): 381-387, editura “ion ionescu de la brad” iași. 11. huțu i., patraș i., chiș c., mircu c., control of indoor temperature in hoop swine experimental unit, lucrări științifice medicină veterinară – lucrări științifice medicină veterinară, usamv ion ionescu d3e la brad, iași, 2014, 57(1-2):246-251. 12. junkkari r., simojoki h., heiskanen m-l., pelkonen s., sankari s., tulamo r.m., mykkänen a., a comparison of unheated loose housing with stables on the respiratory health of weaned-foals in cold winter conditions: an observational field-study, acta veterinaria scandinavica, 2017; 59: 73., doi: 10.1186/s13028-017-0339-3 13. onan g.w., mircu c., patraș i., hutu i., hoop structure for wean to finish pigs: management and gender influence in a summer trial, lucrări științifice medicină veterinară, 2016, 59(4): 388-394, editura “ion ionescu de la brad” iași. https://doi.org/10.1016/c2018-0-04639-3 https://doi.org/10.1016/c2018-0-04639-3 1. introduction 2. materials and methods 3. results and discussion 5. conclusions references no15 pages 10 15 in utero transplantation of human stem cells using an animal model: a comparison between two techniques daria groza*, phd student emoke pall**, phd student assistant mihai cenariu**, phd assistant raul pop**, phd professor nicolae costin***, phd professor ioan groza**, phd abstract objective: the purpose of this study was to assess the feasibility of in utero stem cell transplantation of human umbilical cord blood stem cells in fetal sheep and to compare two different techniques of in utero transplantation, namely ultrasound-guided in utero transplantation and in utero transplantation after midline celiotomy. study design: umbilical cord blood units were collected from term deliveries, after obtaining written informed consent. human cord blood–derived, cd34+ stem cells were injected into the peritoneal cavity of 60to 65-day-old ovine fetuses by using 2 different techniques: ultrasound-guided transabdominal percutaneous needle puncture and midline celiotomy with the exposure of the pregnant uterus. engraftment was determined after birth by flow cytometry with use of human-specific anti-cd 34/45 antibodies. results: we obtained a total of 3 chimeric lambs. using the midline celiotomy technique the fetal loss rate was 75% and only 33,3% when using ultrasound-guided transabdominal percutaneous needle puncture technique. engraftment of donor cells was found in all fetuses, with a mean level of 1.4% in fetal peripheral blood and 3.3% in fetal bone marrow. conclusion: this preliminary study indicates that in utero stem cell transplantation of human hematopoietic cord blood stem cells in fetal lambs is feasible and effective in terms of hematopoietic engraftment. we also concluded that the ultrasound-guided transabdominal percutaneous needle puncture technique is more effective than performing a midline celiotomy in terms of fetal loss rate. keywords: stem cells, umbilical cord blood, in utero stem cell transplantation, sheep chimeras *“iuliu haţieganu” university of medicine and pharmacy, faculty of general medicine, department of obstetrics and gynecology “dominic stanca”, emergency hospital “prof. dr. o. fodor”, cluj-napoca. 57 blv. 21 decembrie street, 400124 cluj-napoca, romania, e-mail: dariagroza@yahoo.com **university of agricultural sciences and veterinary medicine, faculty of veterinary medicine, department of veterinary reproduction, obstetrics and gynecology, 3-5 mănăştur street, 400372 cluj-napoca, romania ***“iuliu haţieganu” university of medicine and pharmacy, faculty of general medicine, chef of department of obstetrics and gynecology “dominic stanca”, emergency hospital “prof. dr. o. fodor”, cluj-napoca. doi: 10.52331/cvj.v15i1.2 cluj veterinary journal, 15(1)/2009, pp. 9-14 9 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ introduction stem cell transplantation has become a valid treatment option for genetic and malignant diseases of the hematopoietic and immune systems (1). in utero stem cell transplantation is a promising potential therapy for a number of these disorders and has several potential advantages over postnatal treatment (2). its advantages are based on the unique opportunity provided by the normal haematological ontogeny. the early fetus is immunological immature and thus would theoretically accept foreign antigens (3). additionally, once successfully transplanted, the intrauterine environment would protect the fetus during ongoing gestation from surrounding viral and bacterial infections. the major advantage would result from the early transplantation before definitive organ damage has occurred (3,4). the development of an animal model of in utero transplantation of human stem cells has allowed investigators to study hematopoietic differentiation of human progenitor and stem cells (5). in addition, this system provides the opportunity to develop in utero stem cell transplantation as a therapy for genetic disorders of the human fetus (6). the fetal sheep model has the advantages of similarity in development of fetal immunocompetence relative to gestational age compared with the early human fetus. though the development of the immune system is not identical, the fetal lamb is tolerant to xenogeneic (eg human) stem cell transplantations before day 70 of gestation (7,8). furthermore, the relatively long gestation allows the study of different strategies and repetitive transplantations (5). in contrast to the small animal models, sheep have the advantage of body size. this allows studying technical issues, such as the ultrasound-guided collection of stem cells from the early ovine fetus or the injection techniques (9,10). there are several routes and techniques of performing in utero stem cell transplantation: ultrasoundguided transabdominal percutaneous needle puncture of the peritoneal cavity of the fetus; midline celiotomy with the exposure of the pregnant uterus followed by injection through the uterine wall into the peritoneal cavity of the lamb or direct ultrasound-guided injections into the intracelomic cavity of the fetus (11,12,13). the aim of this study was to asses the feasibility of in utero human stem cell transplantation using an animal model and to compare two different techniques of performing in utero transplantation. materials and methods a. human cord blood stem cell collection and isolation human cord blood from term deliveries were obtained after written informed consent in “dominic stanca” clinic of obstetrics and gynecology, cluj napoca. mononuclear cells were isolated from the cord blood by ficoll-hypaque method, washed, and resuspended in pbs (sigma). before transplantation, the cd34+ human cord blood stem cell graft was washed in phosphate-buffered saline solution (pbs from sigma), and resuspended at a concentration of 1 x 106 per 1 ml imdm (sigma). b. fetal sheep recipients 10 merinos sheep were selected for this study, divided into 3 groups. first group containing 4 sheep was subject to in utero stem cell transplantation using the midline celiotomy tecnique; the second group of 3 sheep was exposed to in utero transplantation by ultrasound-guided transabdominal percutaneous needle puncture technique and the last group was used as a control. pregnancy and the gestational age of the fetuses was confirmed by ultrasound examination. 10 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ c. in utero stem cell transplantation animals were placed in dorsal recumbancy, and the lower abdomen and mammary glands shaven and sterilized. for ultrasound and transplantation, the table was adjusted such that the head was lowered relative to the uterus at a 30-degree angle, which significantly reduced the difficulties in obtaining a clear view of the fetuses. 1)the ultrasound-guided transabdominal percutaneous needle puncture technique: transabdominal ultrasound with a 3.5 mhz curved array probe (hitachi) was used to determine the position and viability of the fetuses, and to measure crown-rump length to confirm the gestational age (figure 1). fig. 1. transabdominal ultrasound before in utero transplantation a 20-gauge spinal needle was inserted through the skin and the uterine wall into the amniotic cavity and then into the peritoneal cavity of the fetuses under continuous ultrasound guidance by using the freehand technique. care was taken not to insert the needle into the fetal liver. after confirmation of the appropriate positioning of the needle, the graft containing human stem cells was slowly injected in a total volume of 1 ml (figure 2). during infusion, the distribution of the fluid in the peritoneal cavity could be observed. the fetus was then checked to ensure adequate heartbeat after transplantation, and anesthetic was withdrawn from the ewe. b)the midline celiotomy technique: after pre-surgical care and ultrasound examination, as described above, a midline celiotomy incision was performed using a blade and the pregnant uterus was delivered onto the operating field (figure 3). the fetal position was assesed by palpation and a 20gauge needle was inserted trough the uterine wall into the peritoneal cavity of the fetus. a content of 1ml stem cell graft was slowly injected followed by the retraction of the needle. exposed uteruses were warmed with periodic lavages with warmed normal saline. same as before, the fetus was then checked to ensure adequate heartbeat after transplantation, and anesthetic was withdrawn from the ewe. fig. 2. in utero transplantation using the ultrasound-guided transabdominal percutaneous needle puncture technique fig. 3. in utero transplantation using the midline celiotomy technique 11 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ ewes were monitored for 2 weeks after the procedure for behavior, health, food intake, and signs of spontaneous abortion. d. analysis of human stem cell engraftment 10 to 20 ml of peripheral blood and bone marrow aspirates were harvested from the previously transplanted lambs, and prepared according to standard procedures. cells were stained with an antihuman antibody specific for the human leukocyte common antigen, cd45 (bd biosciences, san jose, ca) and with an antibody specific for hematopoietic stem cells cd 34 (bd biosciences, san jose, ca). data were analyzed on a bd facs canto ii (bd biosciences, san jose, ca). results in utero stem cell transplantation was performed in 7 ewes carrying a total of 7 fetuses (4 ewes from the first group and 3 ewes from the second group). the in utero stem cell transplantation was successfully at a 100% rate. three lambs were born at term, corresponding to a fetal loss rate of 42,85% (3/7). the lost fetuses were either resorbed or aborted, mostly between 7 to 14 days after in utero transplantation. in the first group we had 2 abortions and 1 death, corresponding to a fetal loss rate of 75% (3/4) (ewes in this group were transplanted using the the midline celiotomy technique). the second group of ewes were transplanted using the ultrasound-guided transabdominal percutaneous needle puncture technique and here we had a fetal loss rate of 33.3% (1/3) a total number of 3 lambs were available for engraftment analysis. engraftment levels were between 1.3% and 1.4% of peripheral blood cells and between 3.3% and 3.7% of bone marrow cells (figure 4). fig. 4. the results of the facs analysis for peripheral blood and bone marrow discussion we were able to show for the first time in an romanien university that in utero transplantation of human cd34+ stem cells leads to successful engraftment in fetal sheep peripheral blood and bone marrow. the level of engraftment was low in our study. it was, however, not our main purpose to achieve high-level engraftment. some groups have reported higher engraftment levels using human cells in preimmune fetal sheep (14). the low engraftment levels may be due to the lack of human stromal elements supporting hematopoietic cells in homing, proliferation, and differentiation. cotransplantation of human stromal elements has been shown to increase engraftment levels (15). 12 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ we used two different techniques for in utero stem cell transplantation, both of them prouving to produce engraftment of human stem cells in fetal lamb recipients. comparing the two techniques in terms of fetal loss, we concluded that the ultrasound-guided transabdominal percutaneous needle puncture technique is more effective than the midline celiotomy technique. this technique has a low fetal loss rate (33.3%), marginally above the natural loss rate. although this natural loss varies between breeds, it is estimated to be between 15% to 20%. our data prouved to be similar to the data already published (16). the second technique used in our study had a fetal loss rate of 75%; our data was above the one reported in literature to be as high as 50% (11). the differences in fetal loss rate between the two techniques suggest that the surgical trauma associated with midline celiotomy and exposure of the pregnant uterus is more of a factor in fetal loss than specific effects that are due to the introduction of human cells in the sheep fetus. conclusion in utero transplantation of hematopoietic stem cells has recently been shown to be an effective therapy for human fetuses affected by severe immunodeficiency (17) but not in nonimmunodeficient fetuses (eg, affected by hemoglobinopathy) (18). a valuable animal model is therefore crucial to develop improved strategies for clinical protocols aiming to improve engraftment levels to achieve clinical benefit. as described before, the fetal sheep model has several advantages over other animal models and has therefore become a valuable large animal model for prenatal stem cell transplantation (5,6). in our study we obtained the first sheep chimeras in romania, performing in utero stem cell transplantation of human hematopoietic stem cells from umbilical cord blood. we have demonstrated for the first time in romania that in utero stem cell transplantation into sheep fetuses at an early gestational age is feasible and it is associated with engraftment in hematopoietic tissues, such as bone marrow and peripheral blood. the relevance of the ovine animal model to evaluate human stem cell activity must be careffuly addressed in further studies with longer animal follow-up and secondary stem cell transplants. references 1.muench mo. in utero transplantation: baby step towards an effective therapy. bone marrow transplantation 2005; 35:537–47. 2.flake aw, zanjani ed. in utero hematopoietic stem cell transplantation: ontogenic opportunities and biologic barriers. blood 1999; 94:2179-91. 3.flake aw.,zanjani ed. in utero hematopoietic stem cell transplantation. a status report. jama 1997, vol. 278, no. 11,932937. 4.westgren m. in utero stem cell transplantation. semin. reprod. med 2006; 24:348-357. 5.almeida-porada g, porada c, gupta n, torabi a, thain d, zanjani ed. the human-sheep chimeras as a model for human stem cell mobilization and evaluation of hematopoietic graft’s potential. exp hematol. 2007 oct;35(10):1594-600 6.porada ga, porada c, zanjani ed. the fetal sheep: a unique model system for assesing the full differentiative potential of human stem cells. yonsei med j. 2004 jun 30; 45 suppl: 7-14. 7.porada cd, park p, almeida-porada g, et al. the sheep model of in utero gene therapy. fetal diagn ther 2004;19:23–30. 8.miyasaka m, morris b. the ontogeny of the lymphoid system and immune responsiveness in sheep. prog vet micorbiol immunol 1988; 4:21–55. 13 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ 9.almeida-porada g, porada cd, tran n, zanjani ed. cotransplantation of human stromal cell progenitors into preimmune fetal sheep results in early appearance of human donor cells in circulation and boosts cell levels in bone marrow at later time points after transplantation. blood 2000;95:3620–7. 10.surbek dv, young a, danzer e, et al. ultrasound-guided stem cell sampling from the early ovine fetus for prenatal ex vivo gene therapy. am j obstet gynecol 2002; 187:960–3. 11.schoeberlein a, holzgreve w, dudler l, et al. in utero transplantation of autologous and allogeneic fetal liver stem cells in ovine fetuses. am j obstet gynecol 2004;191:1030–6. 12.bernstein j, boyle dw, srour ef, et al. variation in long-term engraftment of a large consecutive series of lambs transplanted in utero with human hematopoietic cells. biol blood marrow transplant 1997; 3:247–54. 13.dahm-kähler p, wranning c, lundmark c, enskog a, mölne j, marcickiewicz j, el-akouri rr, mccracken j, brännström m. transplantation of the uterus in sheep: methodology and early reperfusion events. j obstet gynaecol res. 2008 oct;34(5):784-93. 14.schoeberlein a, holzgreve w, dudler l, hahn s, surbek dv. tissue-specific engraftment after in utero transplantation of allogenic mesenchymal stem cells into sheep fetuses. am j obstet gynecol. 2005 apr; 192(4):1044-52. 15.airey ja, almeida-porada g, colletti ej, porada cd, chamberlain j, movsesian m, sutko jl, zanjani ed. human mesenchymal stem cells form purkinje fibers in fetal sheep heart. circulation. 2004 mar 23; 109(11):1401-7. epub 2004 mar 15. 16.oppenheim sm, muench mo, gutiérrez-adán a, moyer al, bondurant rh, rowe jd, anderson gb. hematopoietic stem cell transplantation in utero produces sheep-goat chimeras. blood cells mol dis. 2001 jan-feb; 27(1):296-308. 17.flake aw, roncarolo mg, puck jm, almeida-porada g, evans mi,johnson mp, et al. treatment of xlinked severe combined immunodeficiency by in utero transplantation of paternal bone marrow. n engl j med 1996; 335:1806-10. 18.westgren m, ringden o, eik-nes s, ek s, anvret m, brubakk am, et al. lack of evidence of permanent engraftment after in utero fetal stem cell transplantation in congenital hemoglobinopathies. transplantation 1996; 61:1176-9. 14 this html is created from pdf at https://www.pdfonline.com/convert-pdf-to-html/ 19 polymerase chain reaction and fluorescent in situ hybridization used for bovine embryo sexing assistant mihai cenariu*, phd professor ioan groza*, phd professor liviu bogdan*, phd emoke pall*, phd student lecturer simona ciupe*, phd abstract the purpose of this paper was to evaluate the results obtained for bovine embryo sexing using the polymerase chain reaction (pcr) and fluorescent in situ hybridization (fish) and to compare them in order to decide which of the two methods is more accurate and yields better results while necessitating less effort. we took into consideration the pregnancy rate obtained after the transfer of biopsied embryos, the percentage of correctly sexed embryos evaluated at birth (when the predicted sex was compared with the actual sex of the newborn) as well as other characteristics related to the difficulty of the method, expenses and suitability to a minimally equipped laboratory. we concluded that the polymerase chain reaction is the most accurate and suitable method for sexing preimplantation bovine embryos, being in the same time easier to perform than the fluorescence in situ hybridization. key words: bovine embryo, biopsy, polymerase chain reaction, fluorescent in situ hybridization introduction preselection of the sex of offspring of agriculturally important species has long been an objective of animal breeders (bredbacka, 2001, groza et al., 2006, cenariu et al., 2008). however, not until the advent of technologies such as artificial insemination and embryo transfer has such an approach been considered commercially feasible (cenariu et al. 2008, groza et al., 2005). preliminary studies suggest that methods for sexing embryos do show potential for commercial use (groza et al., 2006, lee et al., 2004, taketo et al., 2005). embryo sexing will be used in conjunction with embryo transfer and most of the research has been geared to sexing bovine and equine embryos, which can be transferred non-surgically up to the blastocyst stage (jin and lloyd, 1997). sexing methods are classified as either invasive or noninvasive, depending on whether or not a biopsy of embryonic tissue is required (shea, 1999, cenariu et al., 2008). criteria that must be considered in embryo sexing techniques are * university of agricultural sciences and veterinary medicine, faculty of veterinary medicine, department of veterinary reproduction, obstetrics and gynecology, 3-5 manastur street, 400372 cluj-napoca, e-mail: mcenariu@yahoo.es cluj veterinary journal, 15(1)/2009, pp. 19-23 20 the percentage of embryos that can be accurately sexed and the effect that the sexing procedure may have on embryo viability (taketo et al., 2005, cenariu et al., 2008). the purpose of this paper was to evaluate the results obtained for bovine embryo sexing using the polymerase chain reaction (pcr) and fluorescent in situ hybridization (fish) and to compare them in order to decide which of the two methods is more accurate and yields better results while necessitating less effort. material and methods a total number of 152 bovine embryos have been used for sexing, and were divided into 2 batches: batch 1, made up of 76 bovine embryos that were sexed using the polymerase chain reaction (pcr); batch 2, made up of 76 bovine embryos that were sexed using the fluorescent in situ hybridization (fish). the embryos have been non-surgically collected from a batch of 16 simmental donor cows, following superovulation and artificial insemination. the embryos have been morphologically evaluated using a stereomicroscope and biopsy has been performed in order to collect a small number of blastomeres from the inner cell mass (fig.1). after biopsy, the embryos have immediately been transferred to recipient cows, whose estrous cycle had previously been synchronized with the donor cows. the blastomeres obtained from batch 1 were submitted to dna isolation and identification of certain nucleotide sequences found only on the y chromosome, using specific primers. in short, the technique consisted of the following: a. dna extraction from the blastomeres using proteinase k; b. biosynthesis of the specific primers: • one set of primers used for pcr were obtained using a bovine specific dna sequence (1715 bovine satellite dna) in order to show the presence of dna in all the samples. thus, the sequence of the two primers was: upstream 5’ – tgg aag caa aga acc ccg ct – 3’ downstream: 5’ – tcg tga gaa acc gca cac tg – 3’ • the second set of primers was obtained using the bry4a repetitive sequence from the bovine genome that is highly specific for the y chromosome and is present only in males. the sequence of the primers was upstream: 5’ – ctc agc aaa gca cac cag ac – 3’ and downstream: 5’ – gaa ctt tca agc agc tga ggc – 3’ c. setting up of the pcr mixture that consisted of 10 ng dna, 40 pmol of each primer and 45 µl of platinum high fidelity pcr supermix (invitrogen). d. amplification of the dna sequences, using a thermocycler and the following amplification scheme: sample heating at 960c for 3 min., 33 cycles of denaturation at 950c for 1 min., primer annealing at 580c for 1 min. and primer extension at 720c for 1 min. and the final extension at 720c for 5 min.; e. electrophoresis of the amplified samples in a 1.5% agarose gel stained with gelstar nucleic acid gel stain; fig. 1 aspiration of the blastomeres during embryo biopsy 21 f. gel examination using a uv transilluminator: • the presence of a single band corresponding to the bovine specific primers suggested the absence of y-specific dna sequences and thus made us classify the embryo as female; • the presence of two bands one for the bovine specific primers and another for the y-chromosome specific primers confirmed the presence of a y-specific dna sequence and thus made us classify the embryo as male. the blastomeres obtained from batch 2 were treated with 1 µg/ml vinblastine sulphate for 6 hours in order to induce the chromosomal metaphases, fixed on a slide using methanol and acetic acid and then kept in the freezer until use. the dna probe was synthesized using the y-chromosome specific bty2 gene from which the following primers have been obtained: upstream 5’ tgt tgt gaa gaa ggt gcc ca 3’ and downstream 5’ agt ttg agg gtg gtt ggt cg 3’ the primers were used to amplify the male specific dna sequence obtained after collecting blood from a bull and isolating the dna from it. the amplification mixture consisted of 5 ng dna, 1.5mm of each primer and 45 µl platinum high fidelity pcr supermix (invitrogen). the amplification conditions were: heating the mixture at 950c for 3 minutes followed by 33 cycles of denaturation at 950c for 30 seconds, primer annealing at 550c for 30 seconds and primer extension at 720c for 30 seconds. the final extension consisted of keeping the samples at 720c for 7 minutes. after the amplification, the samples were run on a 1% agarose gel stained with gelstar nucleic acid gel stain. following electrophoresis, the gels were examined using a uv trans-illuminator, the bands were cut and the dna was extracted from the gel in order to obtain the dna probes used for fluorescent in situ hybridization. the dna probes were biotinylated by nick translation. the fluorescence in situ hybridization consisted of the following steps: rehydration of the blastomeres using decreasing concentrations of ethanol, target retrieval using heat and sodium citrate buffer, blastomere digestion using triton x and proteinase k, fixation of the blastomeres using paraformaldehyde, application of the in situ frames, application of the hybridization buffer containing 1% dna probe, hybridization reaction using a thermocycler (fig. 4) and the following hybridization scheme: 940c for 6 minute and 370c for 16 hours, washing the slides in 3 baths of pbs. the amplification of the fluorescent signal has been achieved using the tyramide signal amplification kit (perkin-elmer), which contains streptavidin-hrp, fitc conjugated tyramide and hydrogen peroxide. the slides were subsequently examined under a fluorescence microscope, in order to observe the green fluorescence in male embryos. the pregnancy rates obtained after the transfer of biopsied and sexed embryos were evaluated by rectal palpation, 60 days after the insemination, while the accuracy of embryo sexing was evaluated at birth, when the predicted sex was compared with the morphological sex of the newborn. results and discussion the embryo biopsy was successful for all of the embryos and the blastomeres were collected in good conditions. after performing the experiences in the blastomeres belonging to batch 1, the following results have been obtained: from the 76 embryos obtained, 70 (92.1%) had reached the morula stage, while 6 (7.9%) were in the early blastocyst stage. in what the quality of embryos was concerned, 73 embryos (96%) were transferable and were used for embryo biopsy while 3 (4%) could not be used for this purpose. 22 after the amplification and gel electrophoresis of the 73 samples, the following results have been obtained: – 34 samples presented a single 216 bp dna band when the bovine specific primers were used and no band when the y-chromosome specific primers were used and thus they were considered to come from female embryos, – 39 samples presented a 216 bp dna band when bovine specific primers were used and a 301 bp dna band when y-chromosome specific primers were used, thus being considered to come from male embryos. when evaluating the pregnancy rate in recipient cows in which sexed embryos had been transferred, the following results have been obtained: 28 of 73 females have been diagnosed as pregnant, which represents a percentage of 38% (chart 1). at birth, one of the calves obtained presented a different sex than the predicted one (female instead of male) which leads to an accuracy of 96.4% of the polymerase chain reaction sexing method. after performing the experiences in the blastomeres belonging to batch 2, the following results have been obtained: from the 76 embryos obtained, 72 (94.7%) had reached the morula stage, while 5 (5.3%) were in the early blastocyst stage. in what the quality of embryos was concerned, 74 embryos (97.4%) were transferable and were used for embryo biopsy while 2 (2.6%) could not be used for this purpose. the fluorescent in situ hybridization and the amplification of the fluorescent signal using the tyramide kit yielded the following results: – 41 samples presented the characteristic fluorescence and thus we considered the blastomeres to come from male embryos – 33 samples did not present any fluorescence and thus we considered the blastomeres to come from female embryos. when evaluating the pregnancy rate in recipient cows in which sexed embryos had been transferred, the following results have been obtained: 30 of 74 females have been diagnosed pregnant, which represents a percentage of 40.54% (chart 3). at birth, 4 of the calves obtained presented a different sex from the predicted one (females instead of males) which leads to an accuracy of 86.66% for the sexing of bovine embryos using the fluorescence in situ hybridization (chart 4). 73 28 45 0 10 20 30 40 50 60 70 80 recipient cows pregnant cows non-pregnant cows chart 1. pregnancy rate in batch 1 chart 2. accuracy of the pcr method of bovine embryo sexing 28 27 1 0 5 10 15 20 25 30 total number of calves obtained correctly sexed embryos incorrectly sexed embryos 74 30 44 0 10 20 30 40 50 60 70 80 recipient cows pregnant cows non-pregnant cows chart 3. pregnancy rate obtained in batch 2 23 comparing the results obtained for the two methods of bovine embryo sexing, several observations can be made. first of all, the pregnancy rates obtained after transferring the biopsied embryos is almost similar for the two batches (around 40%), which is explainable as the biopsy technique did not differ between the two sexing methods. improvements of the biopsy technique have to be made in the future in order to reduce the damage of the embryos and to be able to obtain higher pregnancy rates. in what the accuracy of the two methods is concerned, the pcr sexing yielded better results than the fish method, being at the same time easier to perform and requesting lower expenses for materials and equipments. conclusions 1. the pregnancy rates obtained after transferring the biopsied embryos were of 38% in batch 1 and 40.54% in batch 2, being almost similar as the biopsy technique did not differ between the two sexing methods. 2. the accuracy of the pcr method of bovine embryo sexing was of 96.4%, one of the embryos having a different sex than the predicted one. 3. the accuracy of the fish method of bovine embryo sexing was of 86.66%, four of the embryos having a different sex than the predicted one. 4. the pcr sexing of bovine embryos yielded better results than the fish method, being at the same time easier to perform and requesting lower expenses for materials and equipments. 5. improvements of the biopsy technique have to be made in the future in order to reduce the damage of the embryos and to be able to obtain higher pregnancy rates. 6. we recommend the commercial use of pcr sexing kits for bovine embryo sexing, the fish method being appropriate only for research purposes. references 1. bredbacka p. – progress on methods of gene detection in preimplantation embryos. theriogenology 55 pp 23-34, 2001. 2. cenariu m., i. groza, r. al. pop, brînduşa stegeran, emoke pall, laura cătană, a. bartoş bovine embryo sexing using the fluorescence in situ hybridization (fish), bulletin of the university of agricultural sciences and veterinary medicine cluj-napoca, veterinary medicine, 65 (2)/2008, issn 1843-5270, pp 109-113, 2008. 3. cenariu m., i. groza, simona ciupe, brânduşa stegeran, emoke pall, cătană laura, a. bartoş bovine embryo sexing using the polymerase chain reaction (pcr), scientific papers usamv iaşi, veterinary medicine, vol. 51/2008, issn 1454-7406, pp 252-256, 2008 4. groza i., l. bogdan, i. morar, simona ciupe, r. pop, m. cenariu, c. peştean cercetari privind variantele de inovulare a embrionilor la bovine, clujul medical veterinar, nr.8, pp 8-12, 2005. 5. groza i. şi col. – ginecologie, andrologie şi obstetrică veterinară, ed. academiei române, bucureşti, 2006 6. lee j.h., j. h. park s.h. lee, c.s. park, d. i. jin sexing using single blastomere derived from ivf bovine embryos by fluorescence in situ hybridization (fish), theriogenology 62, pp 1452-1458, 2004 7. jin l., r.v. lloyd in situ hybridization: methods and applications. j.clin. lab. anal. 11(1), pp 2-9, 1997 8. shea b.e. determining the sex of bovine embryos using polymerase chain reaction results: a six-year retrospective study. theriogenology 51, pp785-797, 1999. 9. taketo, t., lee, c.h., zhang, j., li, y., lee, c.y., lau, y.f. expression of sry proteins in both normal and sex-reversed xy fetal mouse gonads. dev. dyn. 233, pp 612–622, 2005. 30 26 4 0 5 10 15 20 25 30 total number of calves obtained correctly sexed embryos incorrectly sexed embryos chart 4. accuracy of the fish bovine embryo sexing method 50 high resolution imagistic methods for detection of tegumentar perforators that can be used in reconstruction surgery of tissue defects. pig experimental model. bogdan chiroiu*, md professor alexandru georgescu**, phd assistant ileana matei**, phd professor stelian petcu***, phd professor ionel papuc****, phd lecturer radu lăcătuş****, phd abstract tissue defects still determine a high surgical interest in finding new and more efficient methods of covering. perforator flaps are considered one of the most important methods of reconstruction, for defects all over the body. anatomists, surgeons, radiologists are fervently searching ways to improve their reliability and also strategies to ensure that the chosen flap to be used is the best for that case. it has been proven that tissue defects’ reconstruction involves knowing the exact anatomy and physiology of various vascular sources, but there are still unknown factors that sometimes induce perforator flaps failure. objective: the aim of this study is to identify and evaluate by two imagistic methods the perforator vessels in an experimental model of perforator flaps in pig. methods: the imagistic method employed was the x-ray angiography and color doppler vascular ultrasonography with high performance equipment. the explored perforators were located on the body of the experimental model, that was divided in 9 regions and the comparison was made between the perforators identified by imagistic methods and by microsurgical careful dissection. results: this study revealed that the average sensibility of ultrasound per region was 52.66% and the average sensibility of angiography per region was 35.30% on the entire lot. conclusion: the color doppler ultrasonography is a very reliable method for detection of the perforator vessels, with better results compared with x-ray angiography, detecting even the smaller perforators. so, the surgeon can rely the operative planning on this preoperative vascular exploration. keywords: perforator flap, perforator vessel, ultrasound, experimental, pig * clinic hospital of recuperation cluj-napoca, deparment of medical imaging radiology, chiroiubogdan@yahoo.com ** university of medicine and pharmacy “iuliu haţieganu” cluj-napoca, department of plastic surgery *** university of medicine and pharmacy “iuliu haţieganu” cluj-napoca, department of medical imaging radiology **** university of agricultural sciences and veterinary medicine cluj napoca faculty of veterinary medicine cluj napoca, discipline of semiology, ethology and diagnostic imaging cluj veterinary journal, 15(1)/2009, pp. 50-56 51 introduction latest appearance in simple and complex tissue defect’s reconstructive surgery, perforator flaps proved to be one of the most performant in the field. that is because of the great advantage they offer: the posibility to harvest only the cutaneous island, completely excluding the muscle component from the flap. it is still necesary to identify posible vascular sources for this type of flaps and also to map them comprehensively. nowadays, the most recent imagistic methods allow the visualization of the skin micro-circulation and their mapping. the study of this experimental model in pig will allow a comparison with the already performed rat experimental model, and the results of this study will offer the basis for other experimental models in fresh human cadavers, aimed to improve the techniques and tactics of tissue defects reconstructive surgery. material and methods the study was performed during the angiocart research grant, that included as partners umf iuliu hatieganu cluj napoca, usamv cluj napoca, icia cluj napoca and isp cluj napoca. in the experimental study was created a lot of 10 pic – f ii – 337 pigs, with comparable characteritics: age (15-16 weeks), wheight (50-55kg), dimensions (length 70-80 cm, thoracal circonference: 70-75 cm, abdominal circonference: 85-90 cm). the preoperative investigations included the detection of perforator vessels using color and power doppler ultrasonography and contrast angiography of different skin areas, the same in all the experimental subjects. after the perforator mapping followed their microsurgical detection through dissection. the results from the ultrasonography and the angiography were noted in the individual subject’s charts, and then were corelated with the surgical disection ones. in order to carefully establish the number of perforators in a designated anatomical area and their precise location, it was necessary to divide the pig’s body surface in some virtual interesting topographic regions. the head, tail, ears and distal anterior and posterior extremities were excluded from the study. the remaining body surface was divided in 9 topographic regions, delimitated by specific anatomical points. these regions are: • cervical region • thoracic paravertebral region • thoracic region • anterior limb proximal region • anterior limb distal region • lumbar paravertebral region • abdominal region • posterior limb proximal region • posterior limb distal region. in turn, these topographic regions were divided in equal square quadrants of 10/10 cm in the cervical, thoracic paravertebral, thoracic, anterior limb proximal, lumbar paravertebral, abdominal, posterior limb proximal regions, and in 5/5 cm equal square quadrants in the anterior and posterior limb distal regions. every region comprised a specific number of quadrants, numbered longitudinally with letters, starting with a (from the pubic bone) to k (at the menton), and transversally with arabic numbers, starting with 1 (at the median ventral line) to 5 (near the dorsal median line). in this manner, every identified perforator was carefully placed in one of these quadrants. 52 a b fig. 1. color doppler ultrasonography investigation (a) and angiography (b) for the preoperative vascular investigations the pigs received intramuscular neurolept-analgesy with hydrocloric xilazine 20mg/ml, azaperona 40mg/ml and hidrocloric ketamin 100 mg/ml of veterinary use. these drugs offer rapid anesthesia and analgesia, effective in about 10 minutes. the analgesic drug was administered 5-10 minutes after the neuroleptic drug. the amounts administered were 0.1-0.2 ml/kgc (2-4 mg/kgc) hydrocloric xilazine or 0.05ml/kgc (2mg/kgc) azaperona and 0.1ml/ kgc (10 mg/kgc) hidrocloric ketamin. the administration of anesthetic was repeated every 15 minutes for about 3 hours (the average time for the vascular examination of the entire subject’s body surface). during the anesthesia the subject’s body temperature was monitored and kept constant. the heart and respiratory rate were monitored every 10 minutes. the pigs were identified by the registration number on the ear tag, were washed with warm water and soap, were sedated, then shaved and positioned in decubitus, without immobilization. the ultrasonic evaluation was performed with the help of a performing, last generation device 2008 ge logiq 9, with linear high resolution transductors with variable frequency 9-14 mhz. the angiography was performed using a siemens coroskop top model c-arm angiograph, with digital acquisition of images (das – digital acquisition system), image enhancement possibilities, digital video acquisition of images (dcm digital cine mode) and serigraphy and a philips duodiagnostic x-ray device with digital acquisition of images on phosforiq plates pcr eleva s. the cutaneous projection of the perforator was noted on the skin with a permanent marker and then charted on the individual subject’s map. results and discussions after the imagistic vascular examination of the 10 subjects, the data regarding the perforator location and their cutaneous projection were centralized, taking into consideration the 9 topographic regions and the maping quadrants. a b fig. 2. perforator vessel identified using color doppler ultrasonography (a) and the determination of arterial or venous nature of the vessel using pulse doppler technique (b) 53 a b fig. 3. digital angiography: (a) anterior limb, (b) posterior limb (enhanced) these data were correlated with the ones obtained through minute surgical disection. fig. 4. perforators identified by micro-dissection all the data were included in tables containing the number of perforator vessels identified by imagistic explorations per topographic quadrant, in tables comparing the imagistic versus surgical detection etc. table 1. example of data centralization table showing the number of perforator vessels identified by vascular preoperative imaging and the topographic quadrant (in the lumbar paravertebral region) 54 table 2. example of data centralization table showing the comparison between the preoperative imagistic investigations and the surgical dissection results and the sensibility determination in the thoracic paravertebral region also, were performed comprehensive maps showing the imagistic versus surgical averages. a b fig. 5. perforator detection averages in the cervical (a) and abdominal (b) regions fig. 6. perforator detection averages in the thoracic region 55 the high resolution color and power doppler ultrasonography and angiography were used in the study of all the subjects. the ultrasonography and angiography detection averages for every region, quadrant and subject were calculated. also, the sensibility of the methods was calculated for every topographic quadrant and subject, and then the general average was calculated per region for the entire lot of experimental animals: „detection sensibility per topographic quadrant” (se/quadrant), „individual detection sensibility per pig” (se/pig), “detection sensibility per region” (se/region). the centralized results showed the fact that rezultatele centralizate au pus în evidenţă faptul că se/region obtained using the ultrasonography investigation has an average of 52.66%, with values between 15.64% (in the distal region of the anterior limb, area difficult to explore) and 76.76% (in the proximal region of the posterior limb – internal aspect), and the se/region obtained through the angiography study has an average value of 35.30%, with values between 13.40% and 58.41%. it was considered that the significantly different results provided by these two methods were due to the fact that the angiography could detect only the large caliber perforators, and in some cases their location was not very accurate due to method’s limitations (the maximum amount of contrast substance did not allow the examination of every topographic area in more than 2-3 planes). conclusions in pig there are a large number of perforator vessels that can represent a very good asset in experimental studies, both involving imagistic vascular studies and micro-surgical training. these cutaneous perforators offer still the possibility to create new experimental models, and perfecting the methods of preoperative detection can be a very important corollary of this type of surgery. the ultrasonography, a non-invasive, universally spread method, is one of the first choice investigations in the preoperative detection of perforator vessels. the color doppler ultrasonography is a more fiable method in the detection of perforators, but also in the post-surgical surveilance of the flap’s evolution. the doppler ultrasonography proved to have an average sensibility rate of 53.66%, superior to the angiography’s sensibility average, of 35.30%, thus being a trust worthy method in detecting a perforator signal, keeping in mind that it can miss some perforators that can be identified by surgical dissection. due to its high level sensibility and specificity, it has become the major investigation in the preoperative detection of perforators. nevertheless, the color doppler ultrasonography has the disadvantage that is dependent to the anatomical particularities of the region, thus some quadrants were difficult or impossible to explore (distal region of the anterior limb). the arteriography was found to be useful in the preoperative determination of perforator vessels, but with some limitations: the vascular canulation was only possible distant to the actual site to be investigated, to preclude the perforator’s damage. it is an invasive method and rather inaccurate in perforator location and qualities determination. also, it has some other disadvantages: can detect only the large caliber perforators, and the patients find it difficult to bear it. it is possible that the intra-arterial injection of the contrast substance can influence the post-operative evolution of the harvested flaps. the number of injections and the maximum amount of contrast substance allowed to be administered in one session limited the examination for each area to 2-3 planes, every angle change needing a new injection. the fact that the imagistic methods didn’t detect the smaller perforator vessels did not impede the creation of the experimental model. 56 the higher values of the ultrasonography exploration averages and its distinct advantages confirmed that it is the method of choice for the next stages of our study. in conclusion, it can be stated that the pig is a very good experimental model, adequate for the study of perforator flaps, the pig presenting a skin perforator system with a relatively constant architecture. references 1. blondeel pn, morris sf, hallock gg, neligan p. perforator flaps: anatomy, technique and clinical applications. vol. 2. 1st ed. st. louis,mo: quality medical publishing; 2006:1042 2. chiroiu b., georgescu al., petcu s., papuc i., lacatus r., matei i.explorări imagistice de înaltă rezoluţie a vaselor perforante tegumentare folosite în chirurgia reconstructiva a defectelor de substanţă. model experimental pe sobolan –lucrari stiintifice seria medicina veterinara. 2009;52(11):451-458 3. el-mrakby hh, milner rh. the vascular anatomy of the lower anterior abdominal wall: a microdissection study on the deep inferior epigastric vessels and the perforator branches. plast reconstr surg. 2002;109:539–543. 4. falca c., ciorba gh.: tehnici de examinare clinică si paraclinică la animale, editia a ii-a, editura mirton, timisoara, 2005 5. forbes pd.vascular supply of the skin and hair in swine, in montagna w. and dobson rl., advances in biology of the skin. pergamon, new york. 1969. 6. kerrigan cl., zelt rg., thompson jg., diano e.:the pig as an experimental animal in plastic surgery research for the study of skin flaps, myocutaneous flaps and fasciocutaneous flaps. lab.anim.sci. pag.408-412, 1986 7. knight kr., collopy pa., o’brien bmcc. correlation of viability and laser doppler flowmetry in ischemic flaps. journal of reconstructive surgery, (43), pag.444. 1987. 8. kohn dh., wixson sk., white wj.: anesthesia and analgesia in laboratory animals. academic press, new york. 1997. 9. matei i., georgescu al, chiroiu b., et al harvesting of forearm perforator flaps based on intraoperative vascular exploration: clinical experiences and literature review –. microsurg 2008;28(5):321-330. 10. national research council. subcommittee on swine nutrition.nutrient requirements of swine. national academy press, washington dc. 1998. 11. papuc i., lăcătus r.: semiologie si imagistică medicală veterinară, editura accent, cluj-napoca, 2004. 12. papuc i.: anatomie comparată. vascularizatia membrelor la unele mamifere pentadactile, ed. gedo, cluj-napoca, 2000. 13. sack w.o. essentials of pig anatomy and horwitz/kramer atlas of musculoskeletal anatomy of the pig. veterinary textbooks, ithaca, new york. pag. 192, 1982. 14. sasaki gh, pang cy. pathophysiology of skin flaps raised on expanded pig skin, plast. recontr. surg., 74(1), pag.59-67. 1984. 15. schaller o. illustrated veterinary anatomical nomenclature, enke, stuttgart, 1992. type of the paper (article cluj vet j 2022, 27, 3 http://clujveterinaryjournal.ro short communication study on aggression in dogs in a public shelter sorin marian mârza1*; orsolya kasa1; mariana tătaru1; radu lăcătuş1; felix daniel lucaci1 and ionel papuc1 1 faculty of veterinary medicine, university of agricultural sciences and veterinary medicine cluj-napoca; e-mail: sorinmarza@yahoo.com; orsolya_kasa@yahoo.com; mariana.tataru@usamvcluj.ro; radu.lacatus@usamvcluj.ro; lucacifelix@yahoo.com; ionel.papuc@usamvcluj.ro; * correspondence: m.s.m. sorinmarza@yahoo.com; abstract: assessing the behavior of a dog in a shelter is extremely important because the type of behavior can tell us if the animal can be given up for adoption, to whom it can be given up for adoption, if it cannot be given up for adoption and in which direction improvements in behavior need to be made to get it safely given up for adoption. this study aimed to assess the behavior of dogs in a public dog shelter by how a dog behaves towards a person (examiner) in a sequence of situations and to determine the number of individuals who responded with aggression. the behavior test was developed by the rottweiler rescue society (ontario, canada) and john rogerson, blue cross, britain. following minor modifications, has been used to examine dogs in public shelters. the test contains two additional assessment items from the article "an evaluation of a behavior assessment to determine the suitability of shelter dogs for rehoming" [1]. a total of 187 adult dogs were examined, of which 24 were identified with aggressive behavior and the types of aggression identified were dominance, interspecific, or territorial aggression. no behavioral test can show specifically how a dog will behave in a new environment, but the information obtained from the examination can indicate extreme manifestations of canine behavior, such as dominance aggression, possessive aggression, territorial aggression, and separation anxiety. keywords: dogs; aggression; behavior 1. introduction evaluating behavior in dogs is an important part of responsible pet ownership and training. it involves observing and analyzing a dog's actions and reactions to various stimuli to understand their behavior and determine any potential problems or areas for improvement [2, 3]. many different methods and approaches can be used to evaluate behavior in dogs, including observation, assessment tools, and training techniques. common behaviors that may be evaluated include aggression, separation anxiety, fearfulness, and general obedience [4, 5]. understanding and addressing any problematic behaviors makes it possible to create a positive and harmonious relationship with your dog and ensure their well-being [5]. it is also important to consult with a qualified professional, such as a veterinarian or a certified dog trainer if you have any concerns about your dog's behavior [6,7]. aggression in dogs is a complex behavior that can manifest in various forms, such as barking, growling, snapping, and biting. it is often a response to fear, anxiety, or perceived threats, and can be directed toward people, other animals, or objects [8, 9, 10]. aggressive behavior in dogs can be a serious problem, as it can lead to injury or damage to property, and can also cause strain on the relationship between the dog and its owner [2]. identifying the underlying cause of aggressive behavior and addressing it promptly is important, as it can escalate if left unchecked. this may involve seeking the help of a qualified professional, such as a veterinarian or a certified dog trainer, and implementing a behavior modification plan to modify the dog's aggressive behaviors [11]. it is also important to use positive reinforcement training techniques and avoid punishment or physical force, as these approaches can often make the problem worse. received: 25.12.2022 accepted: 30.12.2022 published: 30.12.2022 doi:10.52331/cvj.v27i3.42 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). mailto:sorinmarza@yahoo.com mailto:orsolya_kasa@yahoo.com mailto:mariana.tataru@usamvcluj.ro mailto:radu.lacatus@usamvcluj.ro mailto:lucacifelix@yahoo.com mailto:ionel.papuc@usamvcluj.ro mailto:sorinmarza@yahoo.com cluj vet j 2021, 27, 3 2 of 5 2. materials and methods the biological material was represented by a number of 187 dogs from a public shelter in the municipality of satu mare aged between 1 and 14 years, of which 114 were females and 73 were males. out of the total number of 114 females, 4 were unspayed and out of the 73 males, 7 individuals were not neutered. of the 187 animals, 68 were large, 91 medium, and 28 small. of the 68 large dogs, 36 were female and 32 were male; of the 91 medium-sized individuals, 58 were female and 33 were male; of the 28 small dogs, 20 were female and 8 male. of the total 187 dogs, 6 were purebred and the remaining 181 were mixed. depending on size, the dogs were housed in pens of 2, 3, 4, and 5 individuals and individual pens for females with puppies. the pens were made of metal wire and the soil was either cloddy earth or grass, sometimes with the presence of gravel. the shelters with the resting place were built of wood, one for each pen. the dogs were fed twice a day, in the morning and evening, with commercial dry food and cooked food served in communal trays in each pen. other materials used: dry grain-type food, a rubber bone-type toy with a rope of approx. 10 cm at each end. the behavior assessment test used consists of two parts, the first part of the test is for observation purposes, the examiner is separated from the tested dog by the fences of the pen in which it is sheltered. this part includes approaching the animal, first contact by placing the examiner's palm on the pen wall while speaking in a friendly tone to the animal, followed by casual then insistent eye contact. maintaining eye contact, the examiner will observe the dog's reaction to a threatening situation, after which he will decide whether to continue with the second part of the test. the last subpoint of the first part is separated from the animal after playtime, which can be used to deduce whether the animal might suffer from separation anxiety after adoption. between the two parts of the test, the examiner will leave the dog for a few minutes so that he can be perceived as a neutral person again. if the dog has shown repeated aggression on two or more tests, the testing should be discontinued, or proceed with caution. the second part of the test involves direct contact between the examiner and the animal. for this part we have added two additional test items from the article "an evaluation of a behavior assessment to determine the suitability of shelter dogs for rehoming" [1] these being the first sub-point which consists of performing 3 head-to-tail and 5 head strokes, assessing the dog's response during the stimuli, during the pause between stimuli and after the end of stimuli and the last subpoint of the test, which involves assessing the response to noise and movement. these two subpoints replaced the predator testing and intraspecific aggression testing in the original test, which could not be performed in the shelter. the second part of the test also includes a simulated routine physical examination by the veterinarian, two obedience tests, the dog's reaction to handling the collar, and two assessments of resource guarding, namely food and a toy. . 3. results and discussion out of a total of 187 dogs examined, 20 individuals were discontinued for safety reasons. in the second part of the test, sub-point 7, which tests resource guarding (the dog will be offered a toy which will then be removed), no dog showed interest in the toy offered. in the first part of the test, in the first subpoint consisting of approaching the animal, 7 dogs, of which 4 females and 3 males, 4 large and 3 small, showed an aggressive reaction, manifested by growling, showing fangs, and offensive posture. of these, 3 females and 2 males, 4 large and 1 medium-sized, were known to exhibit aggressive behavior at the shelter. of the five dogs, one female and one male were not neutered. these 5 dogs fall into the category of intraand interspecific aggression, dominance aggression, or perhaps territorial aggression. of the 7 dogs we did not continue examining, we observed one female dog with 10-day-old puppies. the medium-sized female metis, about 2 years old, showed aggression towards the examiner, with growling and intent to bite. this behavior is normal and is related to the post-parturition hormonal status and the presence of pups. the last dog with an aggressive reaction to this sub-point was a medium-sized metis male, about 5 years old, which showed aggression towards humans. for the following sub-point of the first part of the test, i.e. first contact, touch i, touch ii, occasional eye contact, and insistent eye contact, in addition to the 7 where we did not continue the second part of the behavioral test, in the sub-point touch ii a small female showed aggressive reaction by growling and leaving the examination cluj vet j 2021, 27, 3 3 of 5 environment. on casual eye contact, 20 dogs, 13 females and 7 males, 7 large, 7 medium, and 6 small dogs showed a fear reaction; fear is a major factor that can trigger aggressive behavior. when confronted with insistent eye contact, 33 dogs reacted defensively (moved away from the examiner). in the next sub-point, threat, where the examiner strikes the pen wall while adopting an offensive posture and maintaining insistent eye contact with the animal, 13 dogs reacted aggressively, including the 7 that did not continue with the second part of the test. of the 13 dogs, 9 were female and 4 male, 6 large and 7 medium-sized. on the same sub-point of the test, 66 dogs, 45 females, and 21 males, 21 large, 28 medium, and 17 small showed a defensive attitude (moving away from the examiner). these two reactions represent responses to a potentially dangerous stimulus that may show resource defense behavior (in this case bodily integrity), which up to a certain limit is a normal reaction on the part of the animal (normally a dog that feels threatened only attacks when it has no alternative escape from the dangerous situation and only enough to allow it to escape). in the last sub-point of the first part of the test, 92 individuals fell into the "bark/yapping/jump on the fence" reaction, of which 47 were females and 45 males, 35 were large, 48 were medium and 9 were small. these dogs may have separation anxiety after adoption. in the second part of the test, in the first sub-point consisting of three head-to-tail and five head strokes, 10 individuals exhibited an aggressive reaction by attempting to avoid contact with the examiner, growling, and displaying the intention to bite. of the 10 dogs, 9 were female and 1 male, 3 large, 5 medium, and 2 small. on this sub-item, in 9 of the dogs we did not continue the examination for safety reasons (6 females and 3 males, 5 large and 4 medium). 13 dogs, of which 8 females and 5 males, 3 large, 4 medium and 6 small showed fear reaction, immobility or leaving the environment. we proceeded with caution when examining them because fear is a major factor that can trigger aggressive behavior. in the physical examination, 12 individuals we did not continue the examination: 9 females and 3 males, 6 large, 5 medium, and 1 small, including the 9 individuals we did not continue the testing in the previous subpoint. 19 dogs had a bad reaction to the physical examination, characterized by avoiding contact with the examiner or leaving the examination environment. none of the 19 dogs externalized an intention to bite. in sub-point submission i, in 18 dogs we did not continue the test 14 females, and 4 males; 9 large, 8 medium, and 1 small. only one dog, a medium-sized male, showed an aggressive reaction, manifested by growling and the intention to bite. a total of 22 individuals, of which 16 were females and 6 males, 8 large, 5 medium, and 9 small, reacted defensively by leaving the examination environment and avoiding contact with the examiner. in the next sub-point, submission ii, in 19 dogs we did not continue the examinations for safety reasons 14 females, 5 males; 9 large, 9 medium, and 1 small. only one large male dog showed an aggressive reaction, growling and baring its teeth. a total of 25 individuals did not allow themselves to be positioned but did not show aggression. a total of 14 dogs, 9 females and 5 males, 5 large, 3 medium, and 6 small, showed fear/avoidance reactions. fear is a major factor that can trigger aggressive behavior. in the sub-item "handling of slag", 19 dogs were not examined further. 12 individuals externalized aggressive behavior, 8 females and 4 males; 6 large, 3 medium, and 3 small, by avoiding contact with the examiner, growling and having the intent to bite. in the sub-item "handling of slag", 19 dogs were not examined further. 12 individuals externalized aggressive behavior, 8 females and 4 males; 6 large, 3 medium, and 3 small, by avoiding contact with the examiner, growling and having the intent to bite. of the dogs examined, 29 animals, 18 females, 11 males, 2 large, 11 medium, and 6 small, refused to be led but did not exhibit aggressive behavior. these dogs are dominant, upon a forceful intention of handling from the examiner they might show aggression. when guarding resources, a total of 24 individuals, including 14 females and 10 males, 6 large, 14 medium, and 4 small, reacted aggressively by threatening, growling, and displaying the intention to bite. these dogs exhibit possessive/defensive resource aggression. on a total of 20 individuals, we did not perform this test for safety reasons. no individual showed aggressive behavior on the last subitem of the test, reaction to noise and movement. instead, 18 dogs, 11 females and 7 males, 6 large and 3 small, showed fear, immobility, or leaving the examination environment. cluj vet j 2021, 27, 3 4 of 5 4. conclusions and recommendations: of the 187 dogs examined, in a total of 27 individuals we discontinued further behavioral testing for safety reasons. these dogs showed either dominant aggression, interspecific aggression, or territorial aggression. age was not a major factor influencing aggressive reactions from dogs, with the majority of dogs falling into the 5-8 and 9-14 age categories. of the dogs that showed aggression, the majority were large and medium-sized, with smaller individuals most often showing fear. the sex of the animal did not play a significant role in the manifestation of aggressive behavior; of those that expressed aggression, the number of females was approximately as high as the number of males. the types of aggression encountered in the two shelters were: dominance aggression, possessive/resource defense aggression, territorial aggression, interspecific aggression, and maternal aggression. of the categories of aggression observed in the tests, the most common were possessive/defensive aggression for resources (represented by food) and dominance aggression. by housing dogs according to size, temperament, and age, we have not encountered cases of intraspecific aggression; we did not observe fear-induced aggression because dogs that exhibited fear or defensive behavior were able to move away from the examiner and did not have to attack; for the behavioral health of the dogs but also to increase the chances of adoption of the shelter dog, it is recommended to engage in socialization with the animals through play programs and other activities with the dogs at least once a week. the test used is a quality tool for assessing aggression in dogs. author contributions: conceptualization, i.p. and o.k.; methodology, s.m.m.; validation, r.l., f.d.l.; investigation, m.t.; data curation, s.m.m.; writing—original draft preparation, i.p.; writing—review and editing, l.r.; supervision, i.p.; project administration, o.k.; all authors have read and agreed to the published version of the manuscript”. funding: this research received no external funding. institutional review board statement: not applicable. data availability statement: the data supporting the results can be requested from the corresponding author. acknowledgments: we thank the free life satu mare association for the collaboration at the shelter level. conflicts of interest: the authors declare no conflict of interest. references 1. poulsen ,a.h., lisle, a.t., phillips, c.j.c. (2010) an evaluation of a behavior assessment to determine the suitability of shelter dogs for rehoming. sage-hindawi access to researchveterinary, medicine international,volume 2010, article id 523781, 9 pages, doi:10.4061/2010/523781. 2. kleszcz, a.; cholewi ́nska, p.; front, g.; paco ́n, j.; bodkowski, r.; janczak, m.; dorobisz, t. review on selected aggression causes and the role of neurocognitive science in the diagnosis. animals 2022, 12, 281.https://doi.org/10.3390/ani12030281. 3. john c. wright, marc s. nesselrote, classification of behavior problems in dogs: distributions of age, breed, sex and reproductive status, applied animal behaviour science, volume 19, issues 1–2, 1987, pages 169-178, issn 0168-1591,https://doi.org/10.1016/0168-1591(87)90213-9. 4. anastasia c. stellato, hannah e. flint, cate e. dewey, tina m. widowski, lee niel, risk-factors associated with veterinary-related fear and aggression in owned domestic dogs, applied animal behaviour science, volume 241, 2021, 105374, issn 0168-1591, https://doi.org/10.1016/j.applanim.2021.105374. 5. yuying hsu, liching sun, factors associated with aggressive responses in pet dogs, applied animal behaviour science, volume 123, issues 3–4, 2010, pages 108-123, issn 0168-1591,https://doi.org/10.1016/j.applanim.2010.01.013. 6. willem j. netto, doreen j.u. planta, behavioural testing for aggression in the domestic dog, applied animal behaviour science, volume 52, issues 3–4, 1997, pages 243-263, issn 0168-1591,https://doi.org/10.1016/s0168-1591(96)01126-4. 7. overall, k. (1997). clinical behavioral medicine for small animals. st. louis: mosby-year book. 8. jacquelyn a. jacobs, jason b. coe, david l. pearl, tina m. widowski, lee niel, factors associated with canine resource guarding behaviour in the presence of dogs: a cross-sectional survey of dog owners, preventive veterinary medicine, volume 161, 2018, pages 134-142, issn 0167-5877, https://doi.org/10.1016/j.prevetmed.2017.02.004. cluj vet j 2021, 27, 3 5 of 5 9. hannah e. flint, jason b. coe, james a. serpell, david l. pearl, lee niel, risk factors associated with stranger-directed aggression in domestic dogs, applied animal behaviour science, volume 197, 2017, pages 45-54,issn 0168-1591, https://doi.org/10.1016/j.applanim.2017.08.007. 10. aloff, b. aggression in dogs: practical management, prevention and behaviour modification; funderaft publishing: collierville, tn, usa, 2002; pp. 1–418. 11. newbury, sandra și colab.(2010) guidelines for standards of care in animal sheltersthe association of shelter veterinarians. 1. introduction 2. materials and methods 3. results and discussion 4. conclusions and recommendations: references type of the paper (article cluj vet j 2022, 27, 1 http://clujveterinaryjournal.ro case report the use of complementary medicine and pneumo-acupuncture to treat muscle atrophy and chronic respiratory disorders in a dog: a case report madalina florina dragomir*1, alina ardelean1, lorena lloret nadal2, ciprian ober1 1 department of surgery and anesthesiology and intensive care, university of agricultural science and veterinary medicine cluj-napoca, calea mănăștur no. 3-5, 400372, cluj, românia.; madalina.dragomir@usamvcluj.ro, alina.ardelean@usamvcluj.ro, ciprian.ober@usamvcluj.ro. 2 director of chi university europe, veterinary specialists ireland, summerhill, county meath, ireland; lorenalloretnadal@gmail.com * correspondence: m.f.d., madalina.dragomir@usamvcluj.ro. abstract: a 5-year-old female malinois dog was referred to the faculty of veterinary medicine of cluj-napoca for complementary medicine treatment. the patient was diagnosed with severe muscular atrophy in the temporal region but also with ab-ingestis pneumonia due to improper use of the masticatory muscles. after 2 months of symptomatic therapy, partial cure of pneumonia was achieved, but the patient was left with an acute cough during the night. we decided to start a therapeutic protocol combining various chinese therapies including acupuncture, electroacupuncture, pneumo-acupuncture and herbal therapy. the patient’s condition improved considerably even after the first sessions, coughing episodes were reduced and breathing became normal. as for muscle atrophy, the results were partially improved. at the end of the treatment scheme, although the patient was not completely cured, the quality of life was significantly improved. keywords: canine, acupuncture, pneumo-acupuncture, muscle atrophy. 1. introduction in dogs, lung lesions are very similar to those seen in humans mostly characterized as interstitial pneumonia(1). a common clinical diagnosis is represented by the bacterial pneumonia and the underlying causes may include viral infections, aspiration injury and inhalation of foreign body(1). from a traditional chinese medicine point of view, forms of pneumonia are known as “acute febrile disease caused by pathogenic wind” or “invasion of the lung by pathogenic heat”(2). the atrophy of the frontal temporal muscles can have different causes which might include a low level of body fat with pronounced or rapid weight loss, exaggerated skeletal contours, progressive idiopathic atrophy, deformities due to impaired nerve function or even post-operative, also depending on the patient’s age and health (3). pneumo-acupuncture is a traditional chinese veterinary medicine (tcvm) treatment that involves injecting subcutaneous air into specific acupuncture points. large animals, such as horses, are more commonly treated with this procedure, although large dogs can also benefit. this technique is frequently used to treat deficiency conditions like wei syndrome, paresthetic conditions such as suprascapular nerve paresis, facial nerve paresis, or any other local muscular atrophy(4). although the exact mechanism by which acupuncture improves breathing is not fully understand, evidence suggest that it may assist the relax of the muscles involved in breathing. acupuncture has been shown to release chemicals that dilate the airways, making breathing easier(4). received: 7 december 2021 accepted: 22 february 2022 published: 28 june 2022 doi:10.52331/cvj.v27i1.38 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). mailto:madalina.dragomir@usamvcluj.ro mailto:madalina.dragomir@usamvcluj.ro mailto:alina.ardelean@usamvcluj.ro mailto:ciprian.ober@usamvcluj.ro mailto:lorenalloretnadal@gmail.com mailto:lorenalloretnadal@gmail.com mailto:madalina.dragomir@usamvcluj.ro cluj vet j 2022, 27, 1 4 the aim of this study was to present and analyze the benefit of complementary medicine. from the author’s knowledge, there are few information in the literature about this type of treatment for dogs with respiratory disorders. 2. materials and methods case description a five-years-old, malinois breed female dog, was presented because of respiratory disorders and progressive muscle atrophy in the temporalis region. the dog jumped on a fence and felt on her back two-months prior consult. according to the owner, the dog suffered hindlimb ataxia for the following three days after the accident, but the symptoms improved significantly after getting one dose of nsaids. the dog began to eat less after two weeks and experienced anorexia and muscular atrophy in the temporalis area (figure 1). the neurological examination showed the following: the menace and palpebral reflex response were present, so were the vibrissae, oculocephalic and gag reflexes. for the auricular reflex, when we twitched the ear, the dog responded, but when we stimulated the skin on the temporalis region, the dog did not respond. we decided to pursue with the imagistic investigations. imagistic investigations suggested, such as radiographs and computed tomography (ct) scan revealed lesion that correspond with late episode of pneumonia, possible aspiration (figure 2), and on the head revealed a skull chronic fracture with thickening of the calvarium on the medial surface due to healing process. there is also a severe muscle of the temporal and zygomatic muscles (figure 3a, b). a muscle biopsy was performed; however, it came negative for masticatory muscle myositis. the blood samples for serum chemistry profile were in normal range, except for the alt which might have been increased because of the muscular dystrophy (table 1), while the cbc showed a slight leukocytosis (wbc: 21.5 10ˆ9/1, n: 5.519.5). as a conventional therapy, the dog received antibiotics, bronchodilators, nsaid’s as well as steroids, vitamins, essential amino acids, and l-carnitine for almost 3 months. after no major improvements, we decided to try also traditional chinese medicine to improve the breathing and the temporalis muscle. cluj vet j 2022, 27, 1 5 fig. 2. ct image of a dog with diffuse pneumonia; 3a, b. ct scan of the head showing fracture of the skull and local hemorrhage. (original archive) from a tcvm examination, the dog was an earth constitution. she was friendly with people and other dogs; she used to be active and laid-back type. according to the owner, the dog has become increasingly sleepy in recent weeks and more sedentary. the tongue was pale, wet, with cackles (figure 4), the nose was dry, the ears and feet were cold. the cough is more sever during the night. the dog prefers cold instead of heat. the pulse was weaker on the left side. at palpation, it was sensitive to paravertebral muscle, for bladder meridian – bl-20/21/23. the tcvm diagnosis was kidney jing deficiency and spleen qi sinking with lung qi deficiency. fig. 1. muscle atrophy in the temporalis area (before treatment); fig. 4. tongue is wet, thin with crackles. (original archive) a combination of dry-needle, electroacupuncture, pneumo-acupuncture and herbal chinese medicine was performed and at least 10 weekly treatment sessions were planned (figure 5). the treatments aimed to tonify kidney qi and the spleen meridian. the treatments were performed using sterile disposable stainlesssteel ac needles with cooper coil handle, size 0.25x0.25mm, guide tubes (acimut) and stainless-steel ac needles with plastic handle, size 0.16x20mm, without guide tubes (cloud and dragon). dry needling (insertion at 1-1.5 cm with an intermittent manipulation of the point by twirling clockwise) and ea (40-100 hz, 1-3v, increasing progressively for 15-20 minutes/session). pneumo-acupuncture involved air injection, up to 5 ml into subcutaneous tissue in the temporalis region. in order to prevent air embolism, each time before injecting air, we aspirated. for the first days after the treatment, we recommended the owner to keep the dog rested for the air to diffuse without causing undue pressure on surrounding nerves and vessels. table 1. blood sample – biochemistry alb 3.7 2.5-4.4 g/dl alp 41 20-150 u/l alt 184* 10-118 u/l amy 348 200-1200 u/l tbil 0.4 0.1-0.6 mg/dl bun 18 7-25 mg/dl ca 10.2 8.6-11.8 mg/dl phos 5.1 2.9-6.6 mg/dl cre 0.8 0.3-1.4 mg/dl cluj vet j 2022, 27, 1 6 glu 104 60-110 mg/dl na+ 145 138-160 mmol/l k+ 4.3 3.7-5.8 mmol/l tp 7.3 5.4-8.2 g/dl glob 3.6 2.3-5.2 g/dl hct 51% 30-45 % lac 1.8 1-3 mmol/l 3. results the principle of treatment was to restore smooth flow of vital energy of spleen and invigorating the function of the kidney qi. the acupoints used are presented in table 2. during each treatment, a maximum of 10 points were used, depending on the dog’s reaction and status health. the acupoints were selected according to tcvm principles, by a trained acupuncturist. for the first two weeks, the treatment sessions were twice per week, and after that one time per week for the following two months. after the first 3 sessions, the dog began to breath more easily, her cough subsided, and she was becoming more comfortable especially during the night. during each treatment we performed pneumo-acupuncture in the st-5, st-7, si-19, th-21, gb-20. we maintained the treatments for over two months, with significant improvement in breathing (only occasionally cough) but a mild response in muscle atrophy (figure 6). the dog had a good appetite and began to be more active and playful, that she’d been previously. fig. 5. aspects during electroacupuncture treatment. fig. 6. after 4 treatments. (original archive) we’ve added herbal formula qi performance 0.5g/10 kg twice daily for two months. we started with half a dose for the first three days to make sure there are no adverse reactions. from a tcvm point of view, the commonly applied principles of treatments are based on the relationship between yin (vital essence) and yang (vital function), and between the meridians (zang-fu organs). when it comes to pathology, there is an imbalance between the two systems mentioned above, so the relationship is replaced with an abnormal, unbalanced condition, either an excess or a deficiency between them. in our case, we discuss about a deficiency due to a chronic, long course disease with specific symptoms. the longer the course of the disease, the greater the deficiency in the body is and more treatments or combination of techniques are needed to achieve a satisfactory result. tonifying and warming the body, from a tcvm point of view, involves treating the deficiency complexes to get the qi energy, blood, vital essence, and functions moving(2). cluj vet j 2022, 27, 1 7 table 2. acupoints used local points gb3, st5/6/7 distal points gv6, liv3, li4/11, sp3/9, st36/37, lu5/9 association points gv20, bl20/21/22/23/24, bai-hui 4. discussion reinforcement of the organism consists in using different tonics, for example electroacupuncture or pneumo-acupuncture, to correct the deficiency of vital energy in the spleen and lung meridians. the most common symptoms of spleen deficiency are restlessness, anorexia, muscle atrophy, diarrhea, lack of energy, while the symptoms of lung deficiency are shortness of breath, weakness, mucous pallor(4). all chinese herbs have specific properties that are important signs of their actions. knowing these properties and flavors helps to guide medical practice. in our case, we used the formula qi performance which is the modified ba zhen tang (eight-treasure decoction) and is a tonifying formula, commonly used to treat qi and blood deficiency(5). according to pharmaceutical research when this formula is used in conjunction with enteral nutrition in gastric cancer patients post-operatively, it can further promote elevation of growth hormone levels and improve both nutritional state and immune function(6). in anemic mice with bone marrow depression induced by cyclophosphamide, it promotes proliferation of bone marrow cells. huang qi (astragalus membranaceus) is the main herb in the formula and the tonifying effects of this herbs may be due to an increase in muscle glycogen storage and oxygen carrying capacity together with a reduction in creatine phosphate and protein metabolism, which help combat fatigue(7). the most common signs of chronic lung condition include daily coughing, shortness of breath or wheezing for more than 2 months. often the cough can be more pronounced during the night, when the animal is quiet, and can reduce in frequency while is awake and active. in such situations, the differential diagnosis may even be heart failure, pneumonia, allergic lung disease and lung cancer(8). routine blood test results cannot be considered specific for aspiration pneumonia; however, certain abnormalities may be considered compatible with this condition. leukocytosis or leukopenia, often with toxic changes present in neutrophils, may be seen on a cbc, but nevertheless a normal result cannot exclude aspiration pneumonia. a serum chemical profile may have normal values or specific results with a comorbidity. an interesting fact is that in kogan et all’s study(9), an increase liver enzymes and a decrease in albumin levels were demonstrated in more than half of the 58 dogs diagnosed with aspiration pneumonia(10). the imagistic findings showed a chronic fracture of the skull which could be responsible for the muscle atrophy in the temporal region but cannot explain all the symptoms. even if the ct scan did not show any tumors in the brain, we still decided to pursue for a muscle biopsy in order to exclude other disorders. the result came negative for masticatory myositis, so we did not check for muscle enzymes or inflammatory markers such as creatin kinase or canine c reactive protein. as a differential diagnosis we could have had tumors, autoimmune diseases, or inflammation of one or more components of the central nervous system. the dog also received first nsaid’s and then corticosteroids, but still did not improve. unfortunately, due to financial issue we could not pursue with any other clinical or paraclinical investigations. pneumo-acupuncture is a traditional chinese veterinary method through which air is introduced under the skin, in the subcutaneous space, to produce a pressure that might stimulate specific acupoints, as well as the muscles and nerves from the affected region(11). unfortunately, there are few information regarding the efficacy of this procedure, mostly it is mentioned in the literature its use for muscle atrophy, but we could not find relevant study to prove it. furthermore, the fact that in our case it gave only slight improvement, we still question its efficacy. we can recommend its use for muscles with a lower degree of atrophy, as well in the acute phase of the disease. cluj vet j 2022, 27, 1 8 while it is not fully understood how the mechanism of acupuncture is working to improve breathing, some researchers suggest that dry needling and electroacupuncture treatments may help to relax muscles involved in breathing(12). it has also been shown that this type of treatment can release vascular and immunomodulatory factors that distend the airways, making it easier to breath(12). in our case the results were visible during each treatment we performed. also, we cannot forget about the herbs we mentioned earlier which might also had their role in improving the breathing. in human medicine, a quite common scale used for dyspnea is the modified borg dyspnea scale, which is a 0 to 10 rated numerical score reported by the patient during submaximal exercise after a period of exercise(13). for animals you can see the degree of honking, coughing, inspiratory effort, or the activity status, which can be subjective, and we cannot exclude the owner’s assessment of willingness to treat his dog. the study’s limitations include the lack of even more detailed investigations to establish a concrete diagnosis from the classical medicine point of view. these limitations were also due to financial reasons. furthermore, specific blood samples (for e.g., blood gas analysis before and after each treatment session), mri, oxygen saturation could be considered important for a good diagnosis. we suggest further studies to be done using tcvm for each pathology on a larger number of patients in order to find the optimum technique for a better outcome. 5. conclusions for the respiratory disorder, the patient had a good outcome, while for the muscular atrophy had a modest response. despite the fact we were unable to cure completely the dog, we were successful in improving quality of life and dyspnea. acupuncture and herbal medicine are effective for the treatment of chronic respiratory disorders and may be considered a complementary viable treatment. author contributions: conceptualization, m.f.d, writing-review and editing, m.f.d and a.a, supervision, l.l.n and c.o. funding: this research received no external funding. institutional review board statement: this study was made with the written consent of dog’s owner. data availability statement: the data used to support the findings of this study are included in the article. acknowledgments: this research received no specific grant from any funding agency in the public, commercial, or nofor-profit sectors. conflicts of interest: the authors declare no conflict of interest. references 1. dear jd. bacterial pneumonia in dogs and cats. vet clin north am small anim pract. 2014 jan;44(1):143–59. 2. liu yanchi. the essential book of traditional chinese medicine. in new york: columbia university press.; 1988. p. 1–14; 43–4; 254. 3. gordon cr, yaremchuk mj. temporal augmentation with methyl methacrylate. aesthet surg j. 2011 sep 1;31(7):827–33. 4. huisheng xi, vanessa preast. traditional chinese veterinary medicine. in: traditional chinese veterinary medicine. 2nd ed. reddick, florida: chi institute press; 2016. p. 119–21. 5. aituan ma. clinical manual of chinese veterinary herbal medicine. in gainesville, florida; ancient art press; 2016. p. 52. 6. wang h. effects of modified ba zhen decoction in assistant with enteral nutrition on the growth hormone, the nutritional state, and the immune function in patients with gastric cancer after operation. zhongguo zhong xi yi jie he za zhi. 2011;31(10):727–31. 7. li c et al. some mechanism of huang qi extract on the resistance of exercise-induced fatigue. china j mod med. 2012;22(23):58– 61. 8. blue pearls specialists. chronic bronchitis: symptoms, diagnosis and treatment. blue pearl vet [internet]. available from: https://bluepearlvet.com/medical-articles-for-pet-owners/canine-chronic-bronchitis/ 9. kogan da, johnson lr, jandrey ke, pollard re. clinical, clinicopathologic, and radiographic findings in dogs with aspiration pneumonia: 88 cases (2004–2006). j am vet med assoc. 2008 dec;233(11):1742–7. cluj vet j 2022, 27, 1 9 10. heidi m schulze l j r. aspiration pneumonia in dogs: pathophysiology, prevention, and diagnosis. in: compendium [internet]. vetlearn.com; 2012. p. 5. available from: https://s3.amazonaws.com/assets.prod.vetlearn.com/5a/6680503b2211e2a929005056ad4736/file/pv1212_shulze1_ce.pdf 11. justin shmalberg hx. acupuncture. uf health [internet]. integrative medicine. available from: https://largeanimal.vethospitals.ufl.edu/hospital-services/equine-integrative-medicine/acupuncture-rehabilitation/ 12. feng j, wang x, li x, zhao d, xu j. acupuncture for chronic obstructive pulmonary disease (copd): a multicenter, randomized, sham-controlled trial. medicine (baltimore). 2016 oct;95(40):e4879. 13. kendrick kr, baxi sc, smith rm. usefulness of the modified 0-10 borg scale in assessing the degree of dyspnea in patients with copd and asthma. j emerg nurs. 2000 jun;26(3):216–22. 1. introduction 2. materials and methods case description a five-years-old, malinois breed female dog, was presented because of respiratory disorders and progressive muscle atrophy in the temporalis region. the dog jumped on a fence and felt on her back two-months prior consult. according to the owner, the ... imagistic investigations suggested, such as radiographs and computed tomography (ct) scan revealed lesion that correspond with late episode of pneumonia, possible aspiration (figure 2), and on the head revealed a skull chronic fracture with thickening... fig. 2. ct image of a dog with diffuse pneumonia; 3a, b. ct scan of the head showing fracture of the skull and local hemorrhage. (original archive) from a tcvm examination, the dog was an earth constitution. she was friendly with people and other dogs; she used to be active and laid-back type. according to the owner, the dog has become increasingly sleepy in recent weeks and more sedentary. the... the tcvm diagnosis was kidney jing deficiency and spleen qi sinking with lung qi deficiency. fig. 1. muscle atrophy in the temporalis area (before treatment); fig. 4. tongue is wet, thin with crackles. (original archive) a combination of dry-needle, electroacupuncture, pneumo-acupuncture and herbal chinese medicine was performed and at least 10 weekly treatment sessions were planned (figure 5). the treatments aimed to tonify kidney qi and the spleen meridian. the trea... table 1. blood sample – biochemistry 3. results 4. discussion reinforcement of the organism consists in using different tonics, for example electroacupuncture or pneumo-acupuncture, to correct the deficiency of vital energy in the spleen and lung meridians. the most common symptoms of spleen deficiency are restl... the most common signs of chronic lung condition include daily coughing, shortness of breath or wheezing for more than 2 months. often the cough can be more pronounced during the night, when the animal is quiet, and can reduce in frequency while is awa... the imagistic findings showed a chronic fracture of the skull which could be responsible for the muscle atrophy in the temporal region but cannot explain all the symptoms. even if the ct scan did not show any tumors in the brain, we still decided to p... pneumo-acupuncture is a traditional chinese veterinary method through which air is introduced under the skin, in the subcutaneous space, to produce a pressure that might stimulate specific acupoints, as well as the muscles and nerves from the affected... while it is not fully understood how the mechanism of acupuncture is working to improve breathing, some researchers suggest that dry needling and electroacupuncture treatments may help to relax muscles involved in breathing(12). it has also been shown... the study’s limitations include the lack of even more detailed investigations to establish a concrete diagnosis from the classical medicine point of view. these limitations were also due to financial reasons. furthermore, specific blood samples (for e... 5. conclusions references 57 perforator flap in pig experimental study with applications in reconstructive surgery filip ardelean*, md bogdan chiroiu*, md professor alexandru georgescu**, phd professor stelian petcu***, phd professor ionel papuc****, phd lecturer radu lacătuş****, phd abstract the emergence of relatively recent date (1982) in the arsenal of methods to cover soft tissue defects, perforator flap quickly reached top choices surgeons from almost all surgical specialties1,2,3. unfortunately not as fast it could move in the direction of understanding and knowledge of physiology and dynamics of such flaps, especially in the venous drainage4. those who practice it are still seeking ways of becoming more efficient preoperative detection of perforator vessels, for finding ways to mitigate the suffering of the vein which, unfortunately, is still quite a few case’s. that’s why the creation of experimental models to answer all these requirements was a major concern of specialists. but since there is no perfect animal model similar to human anatomy and physiology generally requires developing more experimental models5-9. we aimed to develop an experimental model in pig, the animal relatively less demanding in terms of accommodation and feeding10-13, but is an easy omnivorous compared with a real “eating machine” which, because it grows and gain weight very quickly; this is important in terms of experimental and especially in terms of research in the area of flaps, so that they may not be suitable for longer periods of 4-6 weeks. pig is one of the best experimental animal models, especially for research in the area of flap. although pigs and humans among numerous differences exist in terms of vascular, reflected especially in the microcirculation, the rest of anatomical characteristics have many similarities to those in the body uman14-16. first, the pig has a skin covered with relatively little hair, pink so easy to see changes in vascular territory; skin is largely fixed and intimate attachment to the subcutaneous cellular tissue, like the human body. although the skin is thicker and on average less vascularized and shows some differences in terms of the microcirculation, its vasculature, as the sequence of wound healing processes is also similara117,18. among the most obvious differences are: this paniculata carnosus in some regions, namely the trunk; present in the skin and subcutaneous tissue of the more numerous small perforator vessels, except for anterolateral trunk, such that the number of perforator vessels is similar in humans and pigs; the scapular-humeral articulation joints, as in areas adjacent to the anterior and posterior midlines the skin is very mobile and is vascularized by large vessels with a special distribution; contrary to the situation in man, pig superior deep epigastric artery territory is much larger than the inferior deep epigastric artery19-21. * clinic hospital of recuperation cluj-napoca, deparment of medical imaging radiology ** university of medicine and pharmacy “iuliu hatieganu” cluj-napoca, department of plastic surgery *** university of medicine and pharmacy “iuliu hatieganu” cluj-napoca, department of medical imaging radiology **** university of agricultural sciences and veterinary medicine cluj napoca, faculty of veterinary medicine, discipline of semiology, ethology and diagnostic imaging cluj veterinary journal, 15(1)/2009, pp. 57-62 58 considering the above mentioned and the experience of other authors who have developed a number of models of axial flaps (based on internal thoracic penetrating the system, the deep iliac circumflex artery etc.), muscles, musculo-cutaneous flaps, our research team has directed attention to the study of cutaneous and fascio-cutaneous perforator flaps, deepening the results of previous studies and trying to develop new models applicable to humans22-26. keywords: perforator flap, perforator vessel, skin viability, pig material and methods for this study were chosen breed pigs of pic-be, sex both male and female, aged 15-16 weeks, weighing 50-55 kg, with a length of 70-80 cm, chest circumference of 70-75 cm and the abdominal of 85-90 cm and having 14 thoracic vertebrae. to carry out the study, these experimental groups were created: • group i, consisting of 10 animals, which were used to identify the main perforator vessels existing wide body surface and which have been mapped. • group ii, consisting of 10 animals, which were practiced: • an anterolateral chest skin flap vascularized by a single perforator vessel from intercostal artery; • a lumbar skin flap vascularized by a single perforator vessel; • an external face of the forearm flap vascularized by a single perforator from the radial artery; • a lateral calf flap vascularized by a single perforator vessel from the anterior tibial artery22-24. all these flaps were based on one perforator artery, harvested and reinserted in the original area. choosing perforator vessel which was based flap was dictated by 2 considerations: choosing a central artery in the area and diameter greater choice perforator vessel. • in the group iii were placed in 10 pigs which were applied 2 types of flaps based on perforator artery. the role of this group was to determine the maximum range associated with a perforator artery as the only viable basis of vascularization of skin areas. to achieve these goal two flaps were chosen much larger size than those in group ii, namely the external face of the thigh flap and anterolateral chest flap extended. as group ii, the flaps were taken to keep the only source of vascularization of a single perforator by the same considerations as in the lot ii. after taking list, these flaps have been reinserted in the donor area and sutured. also, like group ii, pigs entered in the study had similar size which resulted from the collection of relatively similar flaps with areas such easing obtains statistically valid results. the animals in group i was performed doppler and arteriography examination in before surgery3 using an ultrasound next-generation performance in 2008 ge logiq 9, with high-resolution linear transducers with variable frequency 9 to 14 mhz and with a ge voluson ultrasound expert 7306 pro with linear transducer with variable frequency 10 to 14 mhz. perforator vessels detected were mapped, the maps obtained were compared with maps obtained by dissection. the animals in groups ii and iii, preoperative doppler examination was practiced then, starting from the first day after surgery, daily for 14 zile3,27. furthermore, arteriography was performed by injecting the contrast substance in each perforator vessel after one month. after euthanasia, flaps were detached and examined by trans lighting. the main clinical parameters seen in the study were: • flap color • flap temperature • the occurrence and progression of areas of necrosis. for each individual animal were made maps of the detected perforator artery surgery and imaging. these were compared among themselves and determine their correspondence. twodimensional planimetry was determined by the percentage of necrosis appeared in some flaps, and by direct measurement, its distance towards the headquarters artery. 59 parameters followed group i parameters seen in the statistical analysis in group i were as follows:  surfaces anatomical regions divided into quadrants of the same size (based on the standard scale), number of perforator vessels in each quadrant (determined by dissection on live anesthetized pigs), number of perforator vessels and distribution on the face of each anatomical region (determined by dissection on live anesthetized pigs). group ii and group iii were measured for statistical analysis and tracking both groups of study the following parameters: perforator artery location imaging detected (based on division into quadrants according to the standard scale); perforator artery location intraoperatively detected (based on division into quadrants according to the standard scale); minimum distance from the artery to the area of necrosis (if it occurred), local complications of surgery (hematoma, infection, dehiscence) total surface area of necrosis (determined by digital planimetry dicomworks 1.5.3 program). also were determined by calculating the following parameters: total flap area (the weighted sum of the quadrants of the standard scale) viable flap area (total area – area of necrosis) flap viability percentage, minimum viable area in the perforator artery marked (defined as the circle area with the radius of the minimal distance from the area of necrosis to perforator artery). intervals and time tracking tracking post operatively flap was made daily for a period of 7 days postoperatively. it was later made tracking every 2-3 days to one month postoperatively, when the animal was slaughtered experience. flap area was divided into areas of interest represented by concentric circles with center and radius artery kept increasing by 5 cm from the artery and to the distal edge of the flap. flap color and temperature within these areas of interest to do direct observation: flap color (normal, pale, hyperemia and cyanotic) capillary pulse (present, absent, accelerated, slowed down) and identify and track progression of necrosis areas, all these are noted in the tables on the clinical course areas. at the same time and the same areas of interest were made and measurements of skin temperature (determined daily at the same time). this was measured during surgery and 4 times: before flap incision, immediately after incision, after take-off flap and immediately after its reapplication. necrosis – appearance, location, extension to quantify the final outcomes of groups ii and iii flap was directly measured area of necrosis occurred on the flap at 1 month after surgery (using the dicomworks 1.5.3). entering data photographic technique for photographic support of the research was carried out pictures in these standard conditions: fixed anaesthetized pig on the table operator position lie flat lateral side or lie flat dorsal side of limbs in neutral, the camera set at 150 cm perpendicular and at 45° to sagittal plane so that its image and only fully capture the pig and the mass controller, plus use of a field located in the soles disease if the photos 45 degrees; was used multifocus way with 9 points pointing device, to use forced flash (forced on) to equalize the brightness of the exposure. also, if the need for images, especially in the dissection group and study group to document the uses are summarized below were used non-standard 60 exposures accompanied but mandatory inclusion of an item in the camera field of measurement (ruler, surgical marker sized). enter data into computer data measurements were integrated into the tracking files pigs, summarized the directory structure and then supplemented with measurements made electronically using the program dicomworks 1.5.3. data collected from both the mapping study group and from lots of flaps based on perforator vessels were introduced in the microsoft excel tables for further statistical processing. results in the group i, mapping group, have been dissected a total of 4185 of perforator vessels. number of arteries varied between 408 and 431 vessels / pig examined. media arteries on the surface of pig 1/2body was 418.5 vessels, a total area of 4647.5 cm2 is 1/2body. on average a perforator vascularized 11.1 cm2. the regions with the constant distribution of the perforator arteries are in order: abdominal area (standard deviation 1.58), distal region of the anterior limb (standard deviation 1.66) and paravertebral lumbar region (standard deviation 1.69). regions with the greatest variability in the perforator arteries distribution are: thoracic region (standard deviation 5.45) and distal region of the posterior limb (standard deviation 4.72). regions with the highest frequency of the perforator artery were: posterior limb proximal region (one perforator/7.81 cm2) and thoracic region (1 perforator/ 8.16 cm2). the regions with the lowest frequency of perforator arteries were: distal region of the posterior limb (one perforator/17.32 cm2), cervical region (16.41 cm2/perforator vessel) and proximal region of the anterior limb (16.11 cm2/perforator vessel). all the 20 pigs in group ii – lot of qualitative analysis of the perforator flap and group iii – group of quantitative analysis of the perforator flap survived the minimum time necessary to further postoperative flap. in the group ii, lumbar paravertebral flap presented an average area of 210.45 cm2, an average viability of 93.13% and a minimum distance perforator vessel – necrosis of 8.25 cm. external face of the anterior limb distal region flap presented an average area of 150.92 cm2, an average viability of 96.25% and a minimum distance perforator vessel – necrosis of 7.03 cm. external face of the posterior limb distal region flap (leg) presented an average area of 223.50 cm2, an average viability of 92.94% and a minimum distance perforator vessels – necrosis of 7.19 cm. small anterolateral chest flap presented an average area of 161.11 cm2, an average viability of 90.16% and a minimum distance perforator vesselnecrosis of 8.08 cm. all group ii flaps had viable areas for over 90%, demonstrating the viability of the flap harvested exclusively on perforator arteries in experimental pig model. in the group iii, external face of the posterior limb proximal region (thigh) presented an average area of 583.90 cm2, a viability percentage of 69.16% and an average minimum distance perforator vessel – necrosis of 10.9 cm. extended anterolateral chest flap presented an average area of 448.81 cm2, a viability percentage of 83.09% and an average minimum distance perforator vessel – necrosis of 9.59 cm. group iii flaps had a average area of 516.35 cm2 compared to 186.50 cm2 in group ii, statistically significant differences. also, flap viability in group iii (76.13% on average) was significantly lower than the viability of the flap in group ii (93.12% on average). thus it can be concluded that group iii was chosen as a suitable model of quantitative analysis of the perforator flaps. flaps in group ii had an average viable area of 186.50 cm2. regions that have been harvested the flaps had an average total of 41.65 perforator vessels / region from which results an average of 12.18 61 cm2 area of a perforated vascular integrity in the skin. the results of our study on group ii demonstrates that harvesting a flap based only on a perforator package leads to considerable increase the area of perforator vasculature. dynamic territory of perforator vasculature is significantly greater than within anatomically demonstrating that the perforator flaps are a reliable experimental model in pigs. the flaps 4 models used to group ii: paravertebral lumbar flap, external face of the anterior limb distal region flap, external face of the posterior limb distal region flap, anterolateral chest flap are new experimental models we appropriate qualitative study of the perforator flaps. group iii flaps were a suitable model for quantitative study of the perforator flaps, because they significantly exceeded the dynamic range of vascularization of a perforator artery, observation demonstrated by the appearance of constant and significant area of skin necrosis (area of necrosis averaged 179, 75.85 cm2 to 97 cm2 that the 2 flaps). calculations applied flap in group iii shows a minimum distance perforator vessels – necrosis 10, 90 cm and 9.59 cm and a minimum viable area for a perforator artery 331.36 cm2. flaps also had an average viable area of 388.42 cm2. anatomical area of the vasculature of a perforator artery in regions where the flaps were harvested in group iii is an average of 7.98 cm2. lot iii study demonstrates that, in pigs, an area of 331.36 cm2 can be in a predictable vascularized by a single perforator artery. by harvesting a perforator flap, one perforator vessel vascularization area (dynamic range) exceeds the anatomical area of vasculature, one perforator can vascularized territory of over 30 neighboring perforator arteries. external face of the posterior limb proximal region flap and anterolateral extended chest flap represent two new experimental models appropriate quantitative statistical study of the flap. perforator flaps in the pig are a valuable experimental model for preclinical studies of the recent methods of coating defects substances. our study has made, after our knowledge, the first mapping of the anatomy dissection perforator vessels from the entire surface of pig. the study also created 6 new and appropriate experimental models to study perforator flap in pigs. conclusions it can be said that the perforator flaps made in the study represents a good experimental model for both training and for the degree of survival of a flap based on a single perforator artery, the size of such flaps. in addition, description and practice of new models of perforator flaps increase the scope of such flaps in the experimental field and training. basically, there are pig skins at a large number of perforator vessels you can behind the creation in future of new experimental models. references 1. georgescu av, matei i, ardelean f, capota i.: microsurgical non microvascular flaps in forearm and hand reconstruction. microsurgery, 207;27:384-394 2. georgescu av, ivan o, lambeau radial antebrachial en ilot base sur des perforantes distales. a propos d’ un cas clinique. ann.chir.plast. esthet. 2000; 45:58-61 3. blondeel pn, beyens g, verhaeghe r, et al. doppler flowmetry in the planning of perforator flaps. br j. plast. surg. 1998; 51:2002-2009 4. kerrigan c., wizman p., hjortdal v., sampalis i.: global flap ischemia: a comparison of arterial versus venous etiology, plast. reconstr.surg(93), pag.1485.1994. 5. chvapil m. and chvapil ta.: wound healing models in miniature yucatan pig. ia:iowa state university press. pag.265-288, 1992. 6. swindle mm. basic surgical exercises using swine. praeger press, philadelphia. 1983. 62 7. swindle mm. surgery, anesthesia and experimental techniques in swine. iowa state university press, ames. 1998. 8. swindle mm. swine as models in biomedical research. iowa state university press, ames. 1992. 9. wang jf, olson me., reno cr., wright jb. and hart da.: the pig as a model for excisional skin wound healing: characterization of the molecular and cellular biology and bacteriology of the healing process, comp.med., 51(4), pag. 341-348.2001. 10. national research council. guide for the care and use of laboratory animals. national academiy press, washington. 1996. 11. national research council. subcommittee on swine nutrition.nutrient requirements of swine. national academy press, washington dc. 1998. 12. tărăboaţă gh., hălmăgean p., farkas n., oprescu s.: tehnologia cresterii suinelor, editura didactică si pedagogică, bucuresti,1983. 13. thulin aj., brumm mc.: water: the forgotten nutrient.swine nutrition. butteworth-heineman, boston. 1991. 14. bollen pja, hansen ak., rasmussen hj.: the laboratory swine. fl: crc press, boca raton. 1999. 15. bolton ll. pines e. and rovee dt.:wound healing and integumentary system. md:williams and wilkins, baltimore. pag. 1-9, 1988. 16. holstad, g.e.: the fetal pig: an introduction to the anatomy of the fetal pig. burgess publishing company, minneapolis, mn. 1959. 17. field h.e.: the fetal pig: an introduction to mammalian anatomy. stanford university press ca. 1944. 18. forbes pd.:vascular supply of the skin and hair in swine, in montagna w. and dobson rl., advances in biology of the skin. pergamon, new york. 1969. 19. barone r.: anatomie comparée des mammifères domestiques, angiologie. vigot, paris. 1996. 20. papuc i.: anatomie comparată. vascularizaţia membrelor la unele mamifere pentadactile, ed. gedo, cluj-napoca, 2000. 21. daniel rk., kerrigan cl.:the omnipotential pig buttock flap, plast reconstr surg (70), pag.11. 1982. 22. davies as., henning m.: use of swine as a model of musculoskeletal grows in animals. plenum press, new york. pag.839-848, 1986. 23. kerrigan cl., zelt rg. thompson jg. and diano e.:the pig as an experimental animal in plastic surgery research for the study of skin flaps, myocutaneous flaps and fasciocutaneous flaps. lab.anim.sci. pag.408-412, 1986 24. sasaki gh. and pang cy.:pathophysiology of skin flaps raised on expanded pig skin, plast. recontr. surg. 74(1), pag.59-67. 1984. 25. mehran rj. ricci ma., graham am., carter k. and smyes jk.: porcine model for vascular graft studies, j.invest.surg. vol. 4, pag. 37-44. 26. knight kr., collopy pa., o’brien bmcc.: correlation of viability and laser doppler flowmetry in ischemic flaps. journal of reconstructive surgery, (43), pag.444. 1987. type of the paper (article doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro article production of viable bovine embryos by intracytoplasmic sperm injection of oocytes harvested from slaughtered old cows mihai cenariu 1*, mihai borzan 1, sorin dan 1, remus chiorean 2 and emoke pall 1 1 university of agricultural sciences and veterinary medicine cluj-napoca, calea mănăștur 3-5, clujnapoca, romania; mihai.cenariu@usamvcluj.ro 2 stațiunea de cercetare și dezvoltare pentru creșterea bubalinelor șercaia, str. câmpului nr.2, șercaia, brașov, romania; scdcb.sercaia@yahoo.com * correspondence: mihai.cenariu@usamvcluj.ro; abstract: (1) background: intracytoplasmic sperm injection (icsi) is currently used to increase fertilization success by avoiding several oocyte or sperm deficiencies that would normally prevent conception after in vivo fertilization or classical in vitro fertilization. this paper aimed at improving the in vitro fertilization protocol of bovine oocytes, harvested from old cows after slaughtering, using intracytoplasmic sperm injection; (2) methods: oocytes were harvested by puncture of follicles from ovaries obtained from slaughtered old cows, followed by aspiration. out of the 127 cumulus-oocyte complexes that were harvested, 84 (66.14%) were declared suitable for cultivation, after morphological evaluation. following oocyte maturation for 22 hours, 77 cumulus-oocyte complexes were morphologically intact and could undergo the steps required for intracytoplasmic injection of spermatozoa. frozen-thawed bull semen was used for icsi and the 77 fertilized oocytes were kept for 24 hours in an atmosphere enriched with 5% co2.; (3) results: fertilized oocytes transformed into 46 zygotes (fertilization rate of 59.74%), while after 168 h of cultivation 38 transferable compact morulae or early blastocysts were obtained; (4) conclusions: intracytoplasmic sperm injection can represent a viable alternative to classical ivf, when oocytes or sperm with lower fertility are used. keywords: bovine oocytes; icsi; embryo; slaughtered cows. 1. introduction intracytoplasmic sperm injection (icsi) is currently used especially in assisted human reproduction as it was shown to be capable of increasing fertilization success by avoiding several oocyte or sperm deficiencies that would normally prevent conception after in vivo fertilization or classical in vitro fertilization (ivf) [1]. in cattle, the first successful icsi was reported by goto et al. in 1990 [2]. they used in vitro-matured (ivm) oocytes that were injected with immobilized bovine spermatozoa, and obtained embryos that developed in vitro up to the blastocyst stage and were further transferred to recipient cows that finally calved viable offspring. following this first successful attempt, several other researchers used this technique in order to enhance assisted reproductive performance of cattle with low quality gametes. an interesting study by magata et al, 2019 [3], proved the beneficial effects of icsi on the production of chromosomally normal embryos using oocytes harvested from aged cows. they showed that aging of females negatively influences the distribution of cortical granules during oocyte maturation, which could lead to abnormal fertilization, low developmental competence of oocytes, or/and increased aneuploidy. such inconveniences could be surpassed by icsi, thus allowing the prolongation of productive life and number of offspring obtained from valuable cows. received: 02.04.2021 accepted: 16.04.2021 published: 21.04.2021 doi: 10.52331/cvj.v26i1.8 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 1 8 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro regarding male gametes, it is well known that classical ivf requires spermatozoa with normal morphology and intact function in order to obtain decent cleavage rates. nevertheless, it was proven that icsi can successfully represent a viable alternative when immature or suboptimal quality sperm was used in several species [4–7]. therefore, icsi could allow the use of lower quality semen, collected from younger bulls, as well as sexed semen for successful fertilization of oocytes [8]. moreover, various reproductive disorders often lead to chronic complications, that permanently disrupt fertility and require culling of high yielding cows. in such females, not only the productive capacity is not fully capitalized, but also their potential to produce valuable offspring is hindered. thus, the use of assisted reproductive technologies can aid in recuperating part of the losses, by harvesting the ovaries immediately after slaughtering and collecting the oocytes, followed by ivm and ivf/icsi. obviously, such expensive technologies are sustainable only in cows with high genetic merit, since their offspring will return all investments that were made. therefore, the present study aimed at harvesting ovaries from slaughtered old cows, followed oocyte isolation and maturation as well as fertilization by icsi using frozen/thawed bull semen and cultivation of resulted embryos until the morula or blastocyst stage. 2. materials and methods the ovaries were harvested from 20 holstein cows, aged 7-10 years, after slaughtering, and transported to the laboratory within 1 hour, in sterile saline, at 38°c. aspiration of the cumulus-oocyte complexes was performed using a 10 ml syringe and a 22g needle (figure 1). figure 1. needle aspiration of cumulus-oocyte complexes. the follicular fluid was subsequently transferred to petri dishes, which were examined using a stereomicroscope, in order to identify the cumulus-oocyte complexes and for morphological evaluation (to establish suitability for in vitro culture and fertilization) (figure 2). only oocytes that were surrounded by a large number of cumulus cells, arranged compactly around the zona pellucida, with a compact inner cell mass, without vacuolation and with a homogeneous appearance, were selected. denuded oocytes, without a homogenous appearance, or with cytoplasmic vacuolation were discarded. oocyte maturation was performed in tcm199 (sigma-aldrich) supplemented with 4 mg/ml bovine serum albumin (bsa, sigma-aldrich), 0.1 iu / ml fsh (sigma-aldrich) and 50 ng/ml epidermal growth factor (egf, sigmaaldrich), at 38.5°c, in an atmosphere with 5% co2 and 80-90% relative humidity, for 22 hours (figure 3). oocyte denudation was done using a 0.1% solution of bovine testicular hyaluronidase (sigma-aldrich) for detachment and dispersion of cumulus cells, which were removed by careful pipetting (figure 4). cluj vet j 2021, 26, 1 9 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro semen straws were thawed at 37°c for 30 seconds and mtalp medium without bovine serum albumin (sigmaaldrich) supplemented with 5 mm caffeine (sigma-aldrich) was added. next, 10 µl of the sperm suspension was mixed with 30 µl of polyvinyl pyrrolidone solution pvp k90 (sigma-aldrich) at a concentration of 12%. a narishige ono-131 micromanipulator coupled to a nikon eclipse ts2r microscope was used for intracytoplasmic sperm injection (figure 5). figure 2. morphological evaluation of cumulus-oocyte complexes (bar = 200µm). figure 3. bovine oocytes after maturation (bar=100µm left, 50µm right). figure 4. bovine oocytes after denudation (bar=30µm left, 50µm right). cluj vet j 2021, 26, 1 10 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro figure 5. intracytoplasmic sperm injection (arrow: spermatozoon, bar=30µm). cultivation of presumptive embryos was done in tcm199 supplemented with 5% fetal bovine serum, at 38,5°c, in 5% co2 and saturated relative humidity, for 24h. after 24 h developing embryos were moved in modified synthetic oviductal fluid, supplemented with 20 µl / ml essential amino acid solution, 10 µl / ml non-essential amino acid solution, 1 mm glycine, 2mm taurine, 6 mg / ml bovine serum albumin and insulin-transferrin-selenium supplement for 7 days in a trigas incubator: 5% co2, 5% o2 and 90% n2. 3. results out of the 40 ovaries, 127 cumulus-oocyte complexes were obtained (an average of 3.17 complexes/ovary) of which only 84 met the quality criteria required for cultivation (figure 6). following the in vitro maturation process, 79 of the 84 cumulus-oocyte complexes showed morphological changes characteristic of maturation. cluj vet j 2021, 26, 1 11 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro figure 6. morphologic evaluation of cumulus-oocyte complexes. after denudation and careful microscopic examination, 2 oocytes were removed, as they showed morphological changes in the inner cell mass 77 oocytes were subjected to the icsi protocol. after 24 hours culture, 46 of the 77 oocytes (59.74%) were successfully fertilized (figure 7). figure 7. viable embryos after 24h of cultivation (bar=50µm). after 168 hours, another 3 embryos degenerated, while the remaining 38 reached an age-appropriate developmental stage (compact morula or early blastocyst) and a normal morphology. figure 8. viable embryos after 168h of cultivation (left: compact morula, right: early blastocist, bar=30µm). therefore, the results of our research can be summarized as follows (figure 9): cluj vet j 2021, 26, 1 12 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro figure 9. results obtained after icsi in bovine oocytes obtained from slaughtered old cows. 4. discussion the results obtained in this study bring more information on the development of the icsi technique in cattle, as the literature is quite limited and often contradictory. thus, since the early 1980s there have been attempts to perform in vitro fertilization by icsi technique in cattle, but the development of the zygote has stopped at the stage of pronucleus formation. a few years later, a group of japanese researchers reported for the first time the success of fertilizing bovine oocytes with intracytoplasmic injected immobilized sperm and the birth of several normal and healthy calves [2]. in terms of embryo fertilization and production rates, the results obtained by icsi were much poorer compared to conventional in vitro fertilization. this contrasted sharply with the experiences of those involved in human icsi, in which sperm injection triggers seemingly normal fertilization and embryonic development. however, in cattle there have been many researchers who have believed that icsi must necessarily be accompanied by an artificial method of activating oocytes to obtain a normal fertilization rate [9]. for this purpose, several methods of oocyte activation (using, for example, 7% ethanol, calcium ionophores, etc.) were tested in combination with icsi [10,11]. thus, bovine oocytes were activated by treatment with ionomycin (15 mm) for 5 minutes and dimethylaminopurine (dmap) for 4 hours. the same study was the first to report the production of blastocysts with normal karyotype following the injection of lyophilized bull sperm stored at 4 ° c until use. chung et al., in 2000 [12] tested an oocyte activation method that mimics the calcium oscillations observed in the normal fertilization process in cattle; oocytes were activated by three 5 min incubations with ionomycin at 30 min intervals. the study seems to confirm the findings that the icsi technique itself is not sufficient to activate bovine oocytes, providing evidence in support of a partial activation called metaphase iii (an abnormal stage in which chromosomes remain condensed after telophase ii due to activation ooplasmic insufficiency). it has been speculated that such partial activation may occasionally provide sufficient cytoplasmic factors to initiate the formation of a female pronucleus, but insufficient for the processing of highly stable bovine sperm (containing type 1 protamine); it has also been speculated that partial activation may have occurred due to the fact that the sperm membrane remained intact or that, during the injection procedure, the ooplasmic membrane was not actually penetrated, but only surrounded the sperm, protecting its nucleus of the ooplasm-reducing medium. horiuchi et al., 2002 [13] reported that the use of immobilized bull sperm by breaking the tail and the use of a piezo-micromanipulator improved the icsi result, with almost normal cleavage rates recorded after inoculation of oocytes that were activated by long ethanol exposure. for 5 minutes. although japanese researchers concluded that no activation procedure was required to perform fertilization, additional stimulation was required for blastocyst embryo development. the same researchers showed in another paper [14] that exposure of fertilized oocytes, which had two polar globules, to 7% ethanol for 5 minutes after icsi, determined cleavage rates and blastocyst formation cluj vet j 2021, 26, 1 13 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro yields comparable to those obtained. in the case of conventional in vitro fertilization; they were also able to report the birth of five normal calves after the transfer of ten blastocysts to ten recipient cows. in korea, hwang et al., 2000 [15] applied an electric shock to bovine oocytes before and after sperm injection; although the exact mechanism involved was not understood, electrical stimulation before and after icsi has been shown to be effective in inducing oocyte activation and supporting embryonic development to the blastocyst stage. our study showed that the activation of fertilized oocytes is not mandatory, when obtaining blastocysts is not needed. if embryo culture stops on the 7th day after icsi, most of them will be in the compact morula stage, which is perfectly suited for transfer or other manipulations (cryopreservation, sexing, etc.). sex sorting of bull semen by flow cytometry is currently a well-established technique, already applied in commercial practice in the us and europe. in vitro fertilization requires a much smaller number of sperm than the artificial insemination technique, which is an advantage for this category of semen. however, there are studies that provide evidence of the viability and reduced motility of sorted sperm. it is known that proteins in the sperm membrane undergo changes that can affect its function and interactions with the oocyte after staining and sorting by flow cytometry [16]. it is also known that some bulls tolerate sperm sorting better than oth ers [17]. medvedev et al., 1997 [18] found some evidence that bull semen sorted by flow cytometry and cryopreserved was as effective as unsorted semen after intracytoplasmic injection. skrzyszowska et al., 2000 [19] similarly reported that the yield of embryo formation does not differ between sorted and unsorted sperm following the application of the icsi technique. such results could suggest that sorting influences motility (which is not important for icsi) rather than sperm fertilization capacity. as mentioned above, icsi in cattle could be very useful in the production of calves using expensive semen; there are bulls from which a single straw of frozen semen can cost up to 800eur. hundreds of oocytes could be injected from such a straw, and if the valuable semen was sexed as well, the efficiency would increase even more. 5. conclusions the oocyte collection technique from slaughtered cows’ ovaries by puncture and aspiration, allowed the collection of a large number of cumulus-oocyte complexes (127 cumulus-oocyte complexes from 40 ovaries). of the 127 cumulus-oocyte complexes collected, 84 (66.14%) were declared cultivable, meeting the specific morphological assessment criteria. following the maturation of the cumulus-oocyte complexes, a number of 77 morphologically suitable oocytes were obtained. after icsi and culture for 24 hours, 46 zygotes were obtained, of which 38 continued their development for up to 7 days, reaching the morula or blastocyst stage. thus, intracytoplasmic sperm injection can represent a viable alternative to classical ivf, when oocytes or sperm with lower fertility are used. author contributions: conceptualization and methodology, m.c. and e.p.; validation, m.b., r.c. and m.c.; formal analysis, m.c.; investigation, m.c., m.b., r.c., s.d. and e.p.; resources, s.d. and r.c.; writing—original draft preparation, m.c.; writing—review and editing, e.p. all authors have read and agreed to the published version of the manuscript”. funding: please add: this research received no external funding. conflicts of interest: the authors declare no conflict of interest. references 1. fishel, s.; aslam, i.; lisi, f.; rinaldi, l.; timson, j.; jacobson, m.; gobetz, l.; green, s.; campbell, a.; lisi, r. should icsi be the treatment of choice for all cases of in-vitro conception? hum. reprod. 2000, 15, 1278–1283. doi: 10.1093/humrep/15.6.1278 2. goto, k.; kinoshita, a.; takuma, y.; ogawa, k. fertilisation of bovine oocytes by the injection of immobilised, killed spermatozoa. vet. rec. 1990, 127, 517–520. 3. magata, f.; tsuchiya, k.; okubo, h.; ideta, a. application of intracytoplasmic sperm injection to the embryo production in aged cows. j. vet. med. sci. 2019, 81(1), 84–90. doi: 10.1292/jvms.18-0284 4. wang, b.; baldassarre, h.; pierson, j.; cote, f.; rao, k.m.; karatzas, c.n. the in vitro and in vivo development of goat embryos produced by intracytoplasmic sperm injection using tail-cut spermatozoa. zygote 2003, 11, 219–227. doi: 10.1017/s0967199403002260 5. stein, p.; schultz, r.m. icsi in the mouse. method enzymol. 2010, 476, 251–262. doi: 10.1016/s0076-6879(10)76014-6 6. uehara, t.; yanagimachi, r. microsurgical injection of spermatozoa into hamster eggs with subsequent transformation of sperm nuclei into male pronuclei. biol. reprod. 1976, 15, 467–470. cluj vet j 2021, 26, 1 14 doi: 10.52331/cvj.v26i1.8 http://clujveterinaryjournal.ro 7. lanzendorf, s.e.; maloney, m.k.; veeck, l.l.; slusser, j.; hodgen, g.d.; rosenwaks, z. a preclinical evaluation of pronuclear formation by microinjection of human spermatozoa into human oocytes. fertil. steril. 1988, 49, 835–842. doi: 10.1016/s00150282(16)59893-8 8. unnikrishnan, v.; kastelic, j.; thundathil, j. intracytoplasmic sperm injection in cattle. genes 2021, 12, 198. doi: 10.3390/ genes12020198 9. oikawa, t.; itahashi, t.; numabe, t. improved embryo development in japanese black cattle by in vitro fertilization using ovum pick-up plus intracytoplasmic sperm injection with dithiothreitol. j. reprod. dev. 2016, 62(1), 11-16. doi: 10.1262/jrd.2015-067 10. keskintepe, l.; pacholczyk, g.; machnicka, a.; norris, k.; curuk, m.a.; khan, i.; brackett, b.g. bovine blastocyst development from oocytes injected with freeze-dried spermatozoa. biol. reprod. 2002, 67, 409–415. doi: 10.1095/biolreprod67.2.409 11. meo, s.c.; leal, c.l.v.; yamazaki, w.; garcia, j.m. influence of simple and combined ionomycin, strontium and 6-dmap treatments on activation and parthenogenetic development. theriogenology 2002, 57, 706. 12. chung, j.t.; keefer, c.l.; downey, b.r. activation of bovine oocytes following intracytoplasmic sperm injection (icsi). theriogenology 2000 53, 1273–1284. doi: 10.1016/s0093-691x(00)00271-5 13. horiuchi, t.; emuta, c.; yamauchi, y.; oikawa, t.; numabe, t.; yanagimachi, r. birth of normal calves after intracytoplasmic sperm injection of bovine oocytes: a methodological approach. theriogenology 2002, 57, 1013–1024. doi: 10.1016/s0093691x(01)00701-4 14. horiuchi, t.; emuta, c.; oikawa, t.; numabe, t. comparison of bovine embryo yield following intracytoplasmic sperm injection and in vitro fertilization in individual bulls. theriogenology 2000, 53, 393. 15. hwang, s.; lee, e.; yoon, j.; yoon, b. k.; lee, j. h.; choi, d. effects of electric stimulation on bovine oocyte activation and embryo development in intracytoplasmic sperm injection procedure. j. assist. reprod. genet. 2000, 17(6), 310–314. doi: 10.1023/a:1009496726343 16. mcnutt, t.l.; johnson, l.a. flow cytometric sorting of sperm: influence on fertilization and embryo/fetal development in the rabbit. mol. reprod. dev. 1996, 43, 261–267. doi: 10.1002/(sici)1098-2795(199602)43:2<261::aid-mrd16>3.0.co;2-6 17. doyle, s.p.; seidel, g.e, jr; schenk, j.l.; herickhoff, l.a.; cran, d.g.; green, r.d. artificial insemination of lactating angus cows with sexed semen. j. anim. sci. 1999, 77(suppl.1), 99. 18. medvedev, s.; bossak, n.; eckert, j.; lucas-hahn, a.; niemann, h.; johnson, l.a. intra-cytoplasmic sperm injection (icsi) with flowcytometrically sorted y-chromosome bearingbovine sperm. theriogenology 1997, 47, 270. 19. skrzyszowska, m.; shioya, y.; nagai, t.; geshi, m.; takenouchi, n. development of cloned bovine embryos from nuclei of cumulus and muscle cell origin. theriogenology 2000, 53, 244. 1. introduction 2. materials and methods 3. results 4. discussion 5. conclusions references microsoft word cvj_purdoiu.edited.docx doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro communication doxazosin effect on neurogenic bladder with urine retention in female dogs robert cristian purdoiu 1*, cristian paul popovici 1, răzvan codea 1, mădălina dragomir 1, caroline lăcătuș 1, laura condor 1, mihai musteață 2, sorin marian mârza 1, nicolae coldea 3, radu lăcătuș 1 1 university of agricultural sciences and veterinary medicine cluj napoca, faculty of veterinary medicine, department of clinical sciences, 3-5 manaștur, cluj napoca, romania; robert.purdoiu@usamvcluj.ro, cristian.popovici@usamvcluj.ro, razvan.codea@usamvcluj.ro, madalina.dragomir@usamvcluj.ro, carolinelacatus@yahoo.com, condor.laura-ab@ansvsa.ro, sorin.marza@usamvcluj.ro, rlacatus2003@yahoo.com 2 university of agricultural sciences and veterinary medicine “ion ionescu de la brad” iași, faculty of veterinary medicine, ; mihai.musteata@yahoo.com 3 ”dr coldea nicolea’’ private practice, 1c tudor arghezi st., sibiu, romania: coldeadvm@yahoo.com * correspondence: robert.purdoiu@usamvcluj.ro abstract: this short communication describes the effect of doxazosin in the case of urinary retention in female dogs due to motor neuron lesions produced by spinal trauma or spinal compression consecutively to intervertebral disk degeneration and extrusion. the study aims to determine whether the treatment of urinary retention in the case of neurogenic bladder in female dogs, using a1 adrenergic blocker, effectively promotes spontaneous recovery of the examined patients. ten female dogs presenting with urinary retention were examined in the laboratory of radiology, faculty of veterinary medicine cluj napoca. the patients were examined using ct, radiography, and ultrasonography to identify the spinal cord injury responsible for the neurogenic bladder. the dose of doxazosin used in treating the voiding problem in the neurogenic bladder was 1mg/kg, a single dose per day. depending on the spinal cord compression cause, the urine retention symptom was resolved. keywords: α1-adrenergic blocking agent, α adrenoreceptor, neurogenic bladder, upper motor neuron, dogs 1. introduction spinal trauma and spinal compression are relatively frequent in dogs. vertebral fractures and subluxation represent 7% of all neurological affection in dogs. studies show that spinal trauma's most commonly affected location is t3-l3 representing 58% [1]. the lumbosacral region is second-most affected by trauma representing 24% for the l4-l7 region and 7% for s1-s3 region, more affected by the trauma of the sacral area are the small breed 13% [1,2]. the degenerative spinal compression is more prevalent in the chondrodystrophic breed, frequently affecting the t3-l3 spinal region [3]. from our experiences, the more frequent degenerative processes are encountered in the l7-s1 area in the larger breed. the symptoms are related to the compression degree and may vary from mild manifestation to paralysis. besides the locomotor system also the elimination of feces and urine is affected. the micturition process is regulated by circuits that involve parts of the autonomic and somatic nervous systems. urine storage involves lumbosacral reflexes, and the spinal and encephalic centers control voiding of the urinary bladder. received: 23.04.2021 accepted: 27.04.2021 published: 04.05.2021 doi: 10.52331/cvj.v26i1.19 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licens es/by/4.0/). cluj vet j 2021, 26, 1 16 doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro spinal lesions located cranially of the sacral segment will determine an impairment of micturition and reorganization of the micturition reflex pathways. if the upper motor neuron is involved, an increase in urethral muscle tone will appear, determining the incapacity of voluntary emptying of the urinary bladder. partial emptying of the urinary bladder can occur in a few days and is because of the presence of reflex pathways that involve the general visceral afferent, the general visceral efferent component of the pelvic nerve, and the general somatic efferent branch of the pudendal nerve, and activate the motor parasympathetic sacral neuron that inhibits the somatic neurons of the urethral muscle [4]. if the lower motor neuron is involved, the lesion is located at the level of the sacral plexus. then the pelvic and pudendal nerves can neither hold nor evacuate urine, urine leaks, and the bladder is never distended [4,5]. electrophysiologic and histologic studies show that chronic injury of the spinal cord could induce phenotypic changes in bladder afferent neurons. those changes include somal hypertrophy and increased expression of neurofilament protein, and increased excitability due to na+ and k+ ion channels [5–7]. other sympathetic mechanisms of the smooth muscle of bladder and urethra contraction involve the a1 and a2 adrenoreceptors that mediate the norepinephrine release by the postganglionic sympathetic terminals [5]. a1 adrenoreceptors suppress the effect based on a peripheral mechanism, while the a2 adrenoreceptors do so via a central mechanism [8–10]. studies show that a1 adrenoreceptors exercise influence on the lower urinary tract function not only through the direct effect on the smooth muscle but also at the level of the spinal cord, ganglia, and nerve terminals and influence the outflow to the bladder, bladder, neck, prostate, and external urethral sphincter [11,12]. the influence of a adrenoreceptors vary depending on different condition. studies show that the detrusor tissue from a patient with nonneurogenic bladder hyperactivity presents an increase in a adrenoreceptors compared to normal [12,13]. multiples studies prove that a adrenoreceptors blocker plays an important role in treating acute urinary retention in case of benign prostatic hyperplasia (bph) [12–16]. management of neurogenic bladder in dogs that present spinal cord injury is a long-term problem. actual management procedures consist of manual bladder voiding, periodic urinalysis, antibiotic treatment, and dietary/prophylactic antiseptic treatment [17,18]. those procedures aim to address inappropriate urine reflex voiding that can result in urinary tract infection, increasing the risk of developing ascending pyelonephritis [19]. the use of doxazosin could prove a valuable addition in the early management of neurogenic urinary retention. 2. patients evaluation the effect of doxazosin was tested in ten female dogs that were presented for imaging evaluation of the spinal cord and present as one of the main symptom’s urinary retention and bladder voiding problem. the patients were clinically examined and were referred for imaging evaluation of the spine and spinal cord integrity. the clinical examination also follows the respiratory system and heart function without being identified any cardio-pulmonary pathologies. the respiratory, cardiac frequency and hematological and biochemical parameters were within normal limits. four of the patients were diagnosed with spinal trauma located proximal to the sacral segment. three of the patients presents fracture of the vertebral body, and one patient presented subluxation at the level of l5-l6. three patients show degenerative pathology that produces mild to moderate compression of the spinal cord proximally to the sacral segment, and three patients were diagnosed with lumbosacral instability (lsi). cluj vet j 2021, 26, 1 17 doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro the female group was heterogeneous, consisting of individuals of different breeds and ages. the common symptom was urine retention and bladder voiding problem. the other symptomatology related to the spinal cord injuries vary from mild to severe: lumbar pain manifested in palpation (n=4); proprioception deficiency on the hind limbs, minor walking deficit (n=3), paralysis of the rear limbs (n=3). other nonneurogenic causes that could produce urinary retention and dysuria, such as infections or urinary lithiasis, were ruled out using the medical imaging method. ultrasonographic examination of the urinary bladder and urethra show moderate to severe bladder distension in all patients, and contraction of the bladder neck or urethra was observed in four patients (n=4). in the other patients, the evaluation of the urethra through ultrasonography did not show abnormalities. probing of the urethra was performed without any difficulties in the patients. the aspect of the urine was normal. when the bladder reaches full distention, the dogs can empty it, helped by abdominal massage. the radiographic evaluation of the spine was relevant in the patients that presented spine trauma (n=4) and in the patients diagnosed with lsi (n=3). the degenerative changes (n=3) and compression degree in case of trauma (n=4) were highlighted using computed tomography (ct). the ct scan shows the calcification of the intervertebral disks and narrowing of the intervertebral space (n=3). in the case of trauma patients, the spinal cord was evaluated, showing only compression without rupture of the soft tissue of the spinal cord. doxazosin is a postsynaptic α1-adrenergic blocking agent derivate from quinazoline used in managing hypertension, being useful in managing resistant hypertension as a component of combination therapy [20,21]. doxazosin reduces the urinary symptom score and improves urinary flow in men with bph [11,12,22]. alpha blocking agents were used in case of other pathology of the urogenital tract in humans to rebalance the cardiovascular system and restore blood volume and obtain peripheral circulation [23]. the dose of doxazosin used in treating urinary retention in the evaluated patient was 1 mg/kg administered in a single dose per day without using any other combination of alpha-blocker and promuscarinic medication. 3. discussion and conclusions the micturition process is mediated by sympathetic, parasympathetic, and somatic innervation. the mechanoreceptors give information concerning the urinary bladder distension in dogs in the urinary bladder wall [24]. sensory information from the urethra, bladder wall, and bladder neck are transmitted via the lumbosacral dorsal root ganglia of the pelvic, hypogastric, and pudendal nerve to the spinal cord, in dogs the primary way for the impulse to travel is represented by the pelvic nerve [24,25]. in dog, the bladder filling and voiding process are regulated by the preganglionic nuclei of the sympathetic hypogastric nerves (facilitate filling of the bladder by relaxation and constriction of the urethra and bladder neck) and parasympathetic pelvic nerve (excite the detrusor muscle and void the bladder) located in the intermediate gray matter of l1-l3 and s1-s3 [19]. the parasympathetic micturition process relies on detrusor contraction due to postganglionic acetylcholine release binds with the muscarinic receptors in the urinary bladder wall. on the other cluj vet j 2021, 26, 1 18 doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro hand, the sympathetic function is mediated by noradrenaline released from postganglionic neuron axon terminals that bind with b-adrenergic receptors within the bladder wall smooth muscle, producing detrusor relaxation, while binding with a1-adrenergic receptor within the urethral smooth muscle will result in urethral contraction [19,24]. "spinal shock" that takes place in case of suprasacral spinal cord injury will produce bladder atony and urine retention due to post-injury impairment of the sympathetic and supraspinal micturition mechanism. the parasympathetic and somatic sacral innervation will remain involved in the voiding of the bladder, producing involuntary detrusor contraction during filling and uncoordinated sphincter contraction during voiding determines the high residual volume and high intravesical pressure [19,26,27]. depending on the administration route, doxazosin has high bioavailability in dogs. oral administration bioavailability is 60%. absorbed doxazosin is subjected to complex biotransformation, and the metabolites are eliminated mainly in the feces. if administered orally, the percent of unchanged substance excreted in the urine in the dog is 3% compared with 44% in feces. intravenous administration determines a 12% entire substance be passed in the urine, and only 4% is excreted unchanged in the feces. the main metabolites result in the metabolism of doxazosin are common in human, mice, and dogs. the doxazosin presents moderate plasma clearance in dogs and a plasma elimination half-life value of 4.7h [28]. in human medicine, a-adrenoreceptors antagonist has become the main medication in patients with bph and lower urinary tract symptoms (luts). besides the sympathetic response that produces the smooth prostatic muscle relaxation, a blocker presents other mechanisms that can be involved in treating non-related bph urine retention [12]. different means of action include upregulation of a receptors in the bladder, a1d receptors in the spinal cord, and dysfunction of the bladder neck and urethra [11]. each of these could be influenced by pharmacological manipulation of a receptors [12]. studies in males dogs suffering from vesicourethral reflex dysuria using a-blocker show comparable results with those obtained in men. treatment with a-blocker shows an efficiency of 60% improvement of the urinary flow in dogs with vesicourethral reflex dysuria [29]. a study conducted on "prostate-like" symptoms in aging women shows no differences in women with luts. compared the effect of doxazosin to hyoscyamine and anticholinergic, they show that 68% of the patients show improvement on monotherapy, and 77% had improvement on combined therapy. also, 50% of the patients that didn't respond to hyoscyamine show improvement to doxazosin [30]. the response being higher for doxazosin than for hyoscyamine [12,30]. even if the effect of an a-blocker is proven in women, there are few studies in the veterinary field that evaluate the impact of a-blocker in female dogs [15]. in our cases, doxazosin administration in solitary dose shows improvement in urethral pressure and help to void the urinary bladder in all the patient. the rapid relief of the urine was present in l7-s1 compression when the symptoms improved after the first dose of doxazosin. in patients with degenerative disease and traumatic compression of the spinal cord, the symptoms improved after 2-3 administration of doxazosin. no side effect was registered after doxazosin administration. cluj vet j 2021, 26, 1 19 doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro doxazosin influences the adrenoreceptors of the urinary tract and produces relaxation of the smooth muscle in the detrusor and increases the bladder compliance, and affects the smooth muscle in the bladder and urethra neck by the use of a1-adrenoreceptors. doxazosin represents an effective medication for improving the symptoms in urinary retention due to neurologic bladder in female dogs. in the case of trauma-induced neurogenic bladder, the use of doxazosin help relieves urinary bladder pressure until surgical therapy is instituted. taking into consideration the complex pathology and low case number, the subject presents opportunities for further investigations. author contributions: all authors have read and agreed to the published version of the manuscript”. funding: please add: "this research received no external funding." conflicts of interest: “the authors declare no conflict of interest.” references 1. bali, m.s.; lang, j.; jaggy, a.; spreng, d.; doherr, m.g.; forterre, f. comparative study of vertebral fractures and luxations in dogs and cats. vet comp orthop traumatol 2009, 1, 47–53, doi:10.3415/vcot-08. 2. bagley, r. spinal fracture or luxation. veterinary clinics of north america: small animal practice 2000, 30, 133–153. 3. forterre, f.; gorgas, d.; m, d.; jaggy, a.; lang, j.; spreng, d. incidence of spinal compressive lesions in chondrodystrophic dogs with abnormal recovery after hemilaminectomy for treatment of thoracolumbar disc disease: a prospective magnetic resonance imaging study. veterinary surgery 2010, 39, 165–172, doi:10.1111/j.1532-950x.2009.00633.x. 4. nishizawa, o.; sugaya, k. cat and dog: higher center of micturition. neurourol urodyn 1994, 13, 169–79. 5. yoshimura, n. bladder afferent pathway and spinal cord injury : possible mechanisms inducing hyperreflexia of the urinary bladder. progress in neurobiology 1999, 57, 583–606. 6. bennett, b.c.; roppolo, j.r.; kruse, m.n.; de groat, w.c. neural control of urethral smooth and striated muscle activity in vivo: role of nitric oxide. j. urol. 1995, 153, 2004–2009. 7. black, j.a.; langworthy, k.; hinson, a.w.; dib-haji, s.d.; waxman, s.g. ngf has opposing effects on na+ channel iii and sns gene expression in spinal sensory neurons. neuroreport 1997, 8, 2331–2335. 8. ramage, a.g.; wyllie, m.g. a comparison of the effects of doxazosin and terazosin on the spontaneous sympathetic drive to the bladder and related organs in anaesthetized cats. eur.j. pharmacol. 1995, 294, 645–650. 9. sugaya, k.; nishijima, s.; miyazato, m.; ashitomi, k.; hatano, t.; ogawa, y. effects of intrathecal injection of tamsulosin and naftopidil, alpha-1a and -1d adrenergic receptor antagonists, on bladder activity in rats. neurosci.lett. 2002, 328, 74–76. 10. michel, m.c.; vrydag, w. α 1-, α 2and β-adrenoceptors in the urinary bladder, urethra and prostate. british journal of pharmacology 2006, 147, 88–119, doi:10.1038/sj.bjp.0706619. 11. andersson, k.; lepor, h.; wyllie, m. prostatic α1-adenoreceptors and uroselectivity. prostate. 1997, 30, 205–215. 12. nitti, v.w. is there a role for alpha-blockers for the treatment of voiding dysfunction unrelated to benign prostatic hyperplasia? reviews in urology 2005, 7 suppl 4, s49-55. 13. restorick, j.; mundy, a. the density of cholinergic and alpha and beta-adrenergic receptors in the normal and hyperreflexic human detrusor. br j urol. 1989, 63, 32–5. 14. jeong, m.s.; lee, j.g. the role of spinal and peripheral a1and a2-adrenoceptors on bladder activity induced by bladder distension and anaesthetized rat. bju int. 2000, 85, 925–931. cluj vet j 2021, 26, 1 20 doi: 10.52331/cvj.v26i1.19 http://clujveterinaryjournal.ro 15. fischer, j.r.; cribb, a.e. urethral pressure profile and hemodynamic effects of phenoxybenzamine and prazosin in nonsedated male beagle dogs résumé. 1. fischer jr, cribb ae. urethral pressure profile and hemodynamic effects of phenoxybenzamine and prazosin in non-sedated male beagle dogs résumé. 2003;(858):30–8. 2003, 67, 30–38. 16. karadeni̇z, a.; pi̇şki̇n, i̇.; eşsi̇z, d.; altintaş, l. relaxation responses of trigonal smooth muscle from rabbit by alpha 1 adrenoceptor antagonists alfuzosin, doxazosin and tamsulosin urinary bladder dysfunction secondary to benign prostate hyperplasia ( bph ) in humans and animals is a major health prob. acta veterinaria brno 2008, 77, 81–88, doi:10.2754/avb200877010081. 17. bubenik, l.j.; hosgood, g.l.; waldron, d.r.; snow, l.a. frequency of urinary tract infection in catheterized dogs and comparison of bacterial culture and susceptibility testing results for catheterized and noncatheterized dogs with urinary tract infections. journal of the american veterinary medical association 2007, 231, 893–899, doi:10.2460/javma.231.6.893. 18. olby, n.j.; mackillop, e.; moore, s.; mun, k.r.; grafinger, m.; osborne, j.a.; vaden, s.l. prevalence of urinary tract infection in dogs a fter surgery for thoracol umbar i ntervertebral di sc extrusi on. journal of veterinary internal medicine / american college of veterinary internal medicine 2010, 1106–1111. 19. hu, h.z.; granger, n.; jeffery, n.d. pathophysiology, clinical importance, and management of neurogenic lower urinary tract dysfunction caused by suprasacral spinal cord injury. journal of veterinary internal medicine 2016, 30, 1575–1588, doi:10.1111/jvim.14557. 20. young, r.; brogden, r. doxazosin: a review of its pharmacodynamic and pharmacokinetic properties, and therapeutic efficacy in mild or moderate hypertension. drugs. 1988, 35, 525–41. 21. khoury, a.; kaplan, n. α-blocker therapy of hypertension. jama. 1991, 266, 394–8. 22. yuan, j.; liu, y.; yang, z.; qin, x.; yang, k.; mao, c. the efficacy and safety of alpha-1 blockers for benign prostatic hyperplasia: an overview of 15 systematic reviews. current medical research and opinion 2013, 29, 279–87. 23. calin, a.m.; grigore, a.c.; voicu, d.c.; schaas, m.c. toxic-septic abortion and its severe complications, frequently lethal. revista de chimie 2016, 67, 2618–2622. 24. uemura, ee. chapter 22. autonomic nervous system. in fundamentals of canine neuroanatomy and neurophysiology; wileyblackwell, 2015; pp. 383–410. 25. samson, m.; reddy, vk. localization of the sacral parasympathetic nucleus in the dog. am j vet res 1982, 43, 1833–1836. 26. smith, p.m.; jeffery, n.d. spinal shock-comparative aspects and clinical relevance. journal of veterinary internal medicine 2005, 19, 788–793, doi:10.1111/j.1939-1676.2005.tb02766.x. 27. taweel, w. al; seyam, r. neurogenic bladder in spinal cord injury patients. research and reports in urology 2015, 7, 85–99, doi:10.2147/rru.s29644. 28. kaye, b.; cussans, n.j.; stopher, d.a.; hospital, s.g. the metabolism and kinetics of doxazosin in man, mouse, rat and dog. br. j. clin. pharmac. 1986, 21. 29. haagsman, a.n.; kummeling, a.; moes, m.e.; mesu, s.j.; kirpensteijn, j. comparison of terazosin and prazosin for treatment of vesico-urethral reflex dyssynergia in dogs. veterinary record 2013, 173, 41–41, doi:10.1136/vr.101326. 30. serels, s.; stein, m. prospective study comparing hyoscyamine, doxazosin, and combination therapy for the treatment of urgency and frequency in women. neurourol urodyn 1998, 17, 31–6. microsoft word cvj_9_16_ilea_2622021.docx cluj vet j 2021, 26, 2 http://clujveterinaryjournal.ro article epidemiological aspects, haematological and biochemical alterations in some gastrointestinal parasitic diseases of carnivores marius stelian ilie 1*, roxana gabriela oanea 2, mirela imre 1, iasmina luca 1, tiana florea 1, simona giubega 1, gabriel orghici 3, sorin morariu 1 1 department of parasitology and dermatology, banat`s university of agricultural sciences and veterinary medicine "king michael i of romania", faculty of veterinary medicine, no. 119, calea aradului, 300645, timisoara, romania, marius.ilie@fmvt.ro; mirela.imre@gmail.com; iasminaluca0@gmail.com; sujic.tijana@gmail.com; simonagiubega@gmail.com; sorin.morariu@fmvt.ro; 2 banat`s university of agricultural sciences and veterinary medicine "king michael i of romania", faculty of veterinary medicine; oanea.roxana3@gmail.com; 3 department of veterinary emergency, banat`s university of agricultural sciences and veterinary medicine "king michael i of romania", faculty of veterinary medicine, no. 119, calea aradului, 300645, timisoara, romania gabrielorghici@gmail.com; * correspondence: marius.ilie@fmvt.ro abstract: gastrointestinal parasites are widespread pathogenic agents and one of the main causes for mortality in young dogs and cats. many of these zoonotic parasites are relevant in terms of public health. the presence of parasites in the animal organism causes local and general modifications in the various organs they parasitize or transit throughout their life cycle. the present study aimed to identify the most frequent gastrointestinal parasites of dogs and cats and to monitor the alterations that occur in terms of haematological and biochemical parameters. the studied animals, 25 dogs and three cats from timiș and caraș severin counties, were brought to the on-call room of the university clinics of the faculty of veterinary medicine timișoara. the laboratory methods that were used were the willis flotation method, the baerman larvoscopic method and the lugol method. the haematological methods, namely flow cytometry, cytochemistry and spectrophotometry, were performed at bioclinica laboratories, on whole blood samples that were collected in edta or simple tubes. the studied animals were positive for giardia, cystoisospora, dipylidium, ancylostoma, toxocara and trichocephalus. the positivity rate was 57.14%, with prevalence rates according to the parasitic species ranging from 3.57% to 21.42%, with multiparasitism in 32.14%, and monoparasitism in 17.85%. the values recorded for red blood cells, haemoglobin and hematocrit followed the same trendmost of the animals being situated within physiological values, except for three dogs, that recorded values below the minimal level. in the case of mch (mean corpuscular haemoglobin) and mchc (mean corpuscular haemoglobin concentration) the values recorded for most dogs were within physiological limits, except for three dogs which overpassed the maximum level. eosinophils were high in all dogs, which is a characteristic feature of parasitism. the serum urea concentrations revealed the fact that all for dogs that were taken into study had values above the maximum limit. keywords: dog; cat; gastrointestinal parasites; haematological and biochemical parameters. 1. introduction both dogs (canis lupus familiaris), and cats (felis catus) are domestic animals that have maintained tight bonds with humans and were bred and kept out of various reasons: as pets, as hunting dogs, police and utilitary animals, laboratory animals and in the case of cats, for rodent-control. intestinal parasites, including protozoa and helminths, are among the most widespread pathogenic agents encountered by veterinarians, being one of the main causes for mortality in young dogs and cats. dogs can serve as definitive host for a variety of macroparasites, microorganisms and viruses. they are associated with tens of zoonotic diseases which bear a negative received: 14.08.2021 accepted: 01.09.2021 published: 09.09.2021 doi: 10.52331/cvj.v26i2.25 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 2 10 impact on human and animal health [1, 2]. the most important ones are rabies, echinococosis, toxacariasis, ancylostomiasis, giardiasis, etc. many of these zoonotic parasites are relevant in terms of public health. their transmission occurs by means of parasitic elements such as eggs or larvae. the resistance of eggs in the environment is quite high. in temperate areas, eggs can survive from 6 to 12 months and the most commonly used disinfectants are not effective against them [3]. gastrointestinal parasites have undergone a successful evolutionary process and have managed to survive and move with the use of various organ systems of hosts. the result of such infections can vary from subclinical to severe, life-threatening ones. they can cause serious health issues translated through delayed growth, precarious health conditions, low resistance to other concurrent diseases and decreased productivity [4]. the presence of parasites in the animal organism causes local and general modifications in the various organs they parasitize or transit throughout their life cycle. the present study aimed to identify the most frequent gastrointestinal parasites of dogs and cats and to monitor the alterations that occur in terms of haematological and biochemical parameters. 2. materials and methods the studied animals were brought to the on-call room of the university clinics of the faculty of veterinary medicine “king michael the ist of romania” from timișoara, between april 2018 and april 2019. the representative species were 25 dogs and three cats from timiș and caraș severin counties. there were both pure bred and mixed breed animals, such as: german shepherd, bucovina shepherd, doberman, pincher, alaskan malamute, viszla, caucasian shepherd, siberian husky, teckel, bichon, pug, poodle, romanian mioritic shepherd, golden retriver, shar pei, swiss shepherd, siberian cats, european cats. the age of the animals ranged between: 2 months and 9 years and they were brought in for coproparasitic exams, with owners accusing to have noticed clinical signs specific for parasitic diseases, namely soft stools. the laboratory methods that were used were the willis flotation method, the baerman larvoscopic method and the lugol method [5 ,6]. the haematological methods, namely flow cytometry, cytochemistry and spectrophotometry, were performed at bioclinica laboratories, on whole blood samples that were collected in edta or simple tubes. 3. results the results of the parasitological exams highlighted pathogens that are sysmetically classified as part of the protozoa, cestoda and nematoda classes. thus, we have identified the following genera giardia, cystoisospora, dipylidium, ancylostoma, toxocara and trichocephalus. out of 25 dogs, four mixed breed and 21 purebred dogs, 11 were negative from a parasitololgical point of view and 14 were positive. as for the cats, two were positive for parasites (european) and one was negative (pure breed). the concurrent infection with more than one species of parasites was observed in nine animals out of 28 taken into study (32.14%), while monoparasitism was noticed in five animals (17.85%) (fig. 1). in relation to the total number of animals taken into study, positive results were noticed in 16 animals, representing 57.14%. the prevalence according to the identified parasite species varied between 3.57% and 21.42%, as seen in figure 2. cluj vet j 2021, 26, 2 11 figure. 1. synthetic presentation of parasitism seen in the studied animals a parazitismului la animalele luate în studiu figure. 2. prevalence of the identified parasites in the studied animals the haematological test values recorded for the 14 parasitized dogs are shown in figures 3-9. the values recorded for red blood cells disclose the fact that the values from most dogs were within the minimal and maximal reference values, except for three of them that showed values below the minimal reference value. the values for red blood cells from one dog reached the maximal reference value. fig. 3. values recorded in the case of erythrocytes and haemoglobin fig. 4. values recorded for the haematocrit and mcv fig. 5. values recorded in the case of mch and mchc fig. 6. values recorded in the case of rdw and platelets fig. 7. values recorded in the case of leukocytes and neutrophils fig. 8. values recorded in the case of lymphocytes and monocytes fig. 9. values recorded in the case of eosinophils and basophils fig. 10. values recorded in the case of amilase and serum lipase cluj vet j 2021, 26, 2 12 fig. 11. values recorded in the case of alkaline phosphatase and serum urea fig. 12. values recorded in the case of serum creatinin and asat fig. 13. values recorded in the case of alat in the case of haemoglobin, similar to the evolution of the red blood cells values, most dogs overpassed the minimal value, except for two of them that showed values below minimum. one of the dogs had values surpassing the maximal threshold. the study of the haematocrit revealed that the recorded data followed a similar trend as that seen in erythrocytes and haemoglobin. in the case of mcv (mean corpuscular volume), all dogs presented values that were within the physiological limits, however two of them reached maximal values. in what regards the mch (mean corpuscular haemoglobin), all dogs showed values above minimum, three of them showed maximum values and three showed values that were above maximum. all dogs had mchc (mean corpuscular haemoglobin concentration) values higher than minimum, five dogs reached the maximum level and four of them overpassed it. the study of the rdw (red cell distribution width) revealed the fact that most dogs from the study have surpassed the maximum value, except for one which showed values below the minimal threshold. three of them reached the maximum value and one of them overpassed it. in the case of platelets, the noticed values were above the minimal threshold for most cases. two cases exhibited values below minimum and other two cases had values above the maximum threshold. the leukocyte values did not go below average values for none of the cases, three of them reached the maximum limit, other four overpassed it with one of them overpassing the limit by far. this fact can be explained by the presence of a chronic infection or of an overlapping bacterial infection which happen at the same time with the migration of parasites throughout the host’s body, in case of leukemia or in case of severe stress. as for the neutrophils, all dogs showed values within normal ranges, with a single case showing values above maximum. the lymphocyte values for most dogs were above the minimal limit, except for one which showed values below limit. none of them showed values above maximum level. the monocyte values of the studied dogs were above the minimal limit, except for five of them. none of the cases showed values below minimum. the eosinophils were above minimum for all dogs, except for three of them and one of them had very high values. the basophil values did not overpass minimal values except for one of the dogs. cluj vet j 2021, 26, 2 13 biochemical analyses, in three, respectively four of the parasitized dogs, showed values that are presented in detail in figures 10-13. serum amylase values for the three studied dogs were all above minimum but below maximum. similarly, serum lipase was also below maximum levels. alkaline phosphatase in the case of the four studied dogs showed values above minimum, with three of them showing values above maximum. following serum urea evaluation, it was revealed that all four studied dogs had values above the maximum reference level. serum creatinin for the four studied dogs revealed that all of the canine patients had values above minimum but below maximum. ast varied similarly, with values above minimum but below maximum in all four dogs and alt was evaluated in three dogs, all of them showing values above minimum, with two showing values above maximum as well. 4. discussion mircean et al., 2012, identified the following parasites in dogs: toxocara canis 26.9%, isospora ohioensis 23.1%, ancylostoma caninum 17.3%, uncinaria stenocephala 13.5%, trichocephalus vulpis 11.5%, hammondia heydorni/neospora caninum 9.6%, sarcocystis spp. 9.6%, isospora canis 7.7%, capillaria aerophila 5.8%, strongyloides stercoralis 93.8%, dipylidium caninum 1.9% and toxascaris leonina 1.9% [7]. in a study by dărăbuș et al., 2018, eggs of toxocara canis, ancylostoma caninum and trichocephalus spp. have been identified in varying proportions (0.57%, 5.78% and 1.73 – 2.22%, respectively) in dog faeces samples from parks. qadir et al., 2011 revealed a prevalence of 10.25% for mixed infections with ancylostoma caninum, toxascaris spp. and dipylidium caninum and a 19.5% overall prevalence of different species of the helminths [8]. in argentina, faecal samples from 85 dogs were examined for intestinal parasites. seventeen parasite species were seen, of which 77% are zoonotic. the most prevalent parasites were ancylostoma caninum (68.2%), giardia spp. (25.9%), cryptosporidium spp. (20.0%) and toxocara canis (14.1%) [9]. bishop and debess, 2020, in portland, oregon, united states of america, determined the following prevalences: toxocara canis 8.7%, strongyloides spp. 2.3%, trichuris spp. 2.1%, hookworms (ancylostoma caninum, uncinaria sp., unspecified) 2.1%, cystoisospora spp. 1.4%, taenia spp. 1.2%, ancylostoma caninum 0.9%, uncinaria spp. 0.7%, baylisascaris procyonis 0.2%, and dipylidium spp. 0.2%, in canine fecal samples [10]. a study conducted by regidor-cerrillo et al., 2020, in spain, highlighted that microscopic, gastrointestinal parasite forms found in dog faeces were identified as nematodes (ancylostomatidae, toxocara canis, trichuris spp. and toxascaris leonina), cestodes (taeniidae) and protozoa (cystoisospora spp. and giardia). from the 233 analysed dogs, 63.5% were positive for at least one intestinal parasite, indicating a high degree of intestinal parasitism in these animals [2]. significant decrease in the values of haemoglobin, total erythrocytic count, lymphocyte and marked leucocytosis, eosinophilia and neutrophilia were noted in pups that were naturally infected with toxocariosis. post-treatment haematogical observations noted on day 7, 14 and 21 revealed that toxocara infected dogs gradually returned to normal level but rapid and significant change towards normality were seen in plozin (a combined tablet containing 500 mg fenbendazole, 144 mg pyrantel pamoate, 50 mg praziquantel @ 1/2 tablet per 5 kg body weight) treated animals [11]. cluj vet j 2021, 26, 2 14 voßmann (1985) examined the haemtaological alterations in pups, following prenatal infections as well as the numeric changes of red blood cells [12]. the number of red blood cells in the blood stream is low from a physiological point of view in newborn pups, rising in approximately 6-8 weeks post partum to reach the values seen in adult dogs. in contrast with this fact are pups which are heavily infected with t. canis. they showed decreasing values of erythrocytes, mainly caused by severe internal bleedings. the reason behind these internal bleedings were the preadult larvae, that migrated through the liver and perforated the intestine, all aspects caused by the massive parasitic load. pups with moderate infections showed an increase in the number of erythrocytes starting with the 5th week of life, but without reaching the values seen in non-infected animals. no changes in the numbers of red blood cells were noticed in adult bitches following infection with t. canis larvae [13]. eosinophilia is characteristic in t. canis infections, starting from day 7 post infection and reaching maximum values within 14 days p.i. a similar evolution of eosinophilia is seen in pups infected in the prenatal period, starting with day 7 post partum [12]. voßmann (1985) has also shown that the degree of eosinophilia in pups that were infected in the pre-natal period is almost proportional with the intensity of the infection [12]. once the eggs start being shed in the faecal matters, the number of eosinophils slowly dropped, returning to physiological levels in 42 days p.i. these data have shown that the evolution of eosinophils in pre-natally infected pups is comparable to that of experimentally infected adult dogs [13]. haematological changes are not the sole observations during infections with t. canis. enzymatic alterations are also present thus, during the liver-migration period, the glutamate-dehydrogenase (gldh) and alanintransaminase (alt) rise, reaching maximum levels within 14 days p.i. [13]. after this peak, alt stays at high levels for a certain period of time, while gldh came back to normal values after 14 days [14]. following reinfestation, hepatic enzymes show a new increase, although smaller in magnitude than during primary infection [13]. voßmann (1985) noticed that these two enzymes, in pre-natally infected pups, were already high upon birth: 67 u / l for gldh (reference values are up to 6,0 u / l) and 365 u / l for alt (reference values are up to 55 u / l) in heavily infected pups [12]. values came back to normal within 1-2 weeks post partum. a second increase in values caused by adult ascarids migrating through the liver and peritoneal cavity was detected shortly before the death of heavily infected pups. the somatic migration in the lungs leads to multiple haemorrhagic petechia, forming a “tinted” pattern on the lungs [15]. the findings of manhardt (1980) have confirmed that somatic migration is performed by larvae that are captured in the capillaries, larvae which penetrate their walls and migrate through the tissue in order to re-eneter the vascular system. this capacity to perform somatic migrations leads to the presence of larvae in organs founds in the vicinity of lungs and in the pleural cavity. additionally, manhardt (1980) has closely examined the kidney, an organ that is frequently affected by t. canis, noticing that severe organ failure is a rare sight in these situations. the larvae leave the blood vessels, namely the cortex, leaving small haemorrhages below the renal capsule, and begin a somatic migration. some larvae go into the urinary canalicules, becoming detectable even in urine while others stay under the capsule after a short somatic migration and encapsulate in granulomas. shortly after beginning the hematogenous journey, larvae were also discovered in muscle fibers of the heart [15]. cluj vet j 2021, 26, 2 15 5. conclusions the carnivores that were taken into study were positive for pathogens from the protozoa, cestoda and nematoda classes. the following genera were identified: giardia, cystoisospora, dipylidium, ancylostoma, toxocara andtrichocephalus. compared to the toal number of examined animals, the positivity rate was 57.14%, with prevalence rates according to the parasitic species ranging from 3.57% to 21.42%, with multiparasitism in 32.14%, and monoparasitism in 17.85%. the values recorded for red blood cells, haemoglobin and hematocrit followed the same trendmost of the animals being situated within physiological values, except for three dogs, that recorded values below the minimal level. in the case of mch (mean corpuscular haemoglobin) and mchc (mean corpuscular haemoglobin concentration) the values recorded for most dogs were within physiological limits, except for three dogs which overpassed the maximum level. eosinophils were high in all dogs, which is a characteristic feature of parasitism. the serum urea concentrations revealed the fact that all for dogs that were taken into study had values above the maximum limit. author contributions: for research articles with several authors, a short paragraph specifying their individual contributions must be provided. the following statements should be used “conceptualization, m.s.i. and r.g.o.; methodology, r.g.o; software, m.s.i.; validation, m.s.i. and r.g.o.; formal analysis, m.i, and i.l.; investigation, r.g.o, i.l. and s.g.; resources, t.s. and g.o; data curation, r.g.o. and g.o; writing—original draft preparation, m.s.i and t.s.; writing—review and editing, m.s.i and s.m.; visualization, t.s.; supervision, s.m.; all authors have read and agreed to the published version of the manuscript”. acknowledgments: this study was performed using the support and infrastructure project „dezvoltarea infrastructurii de cercetare, educaţie şi servicii în domeniile medicinei veterinare şi tehnologiilor inovative pentru ro 05”, cod smiscsnr 2669. conflicts of interest: the authors declare no conflict of interest. references 1. nguyen t, clark n, jones mk, herndon a, mallyon j, soares magalhaes rj, abdullah s. perceptions of dog owners towards canine gastrointestinal parasitism and associated human health risk in southeast queensland. one health. 2021, 12:100226. doi: 10.1016/j.onehlt.2021.100226. pmid: 33665329; pmcid: pmc7903457. 2. regidor-cerrillo j, arranz-solís d, moreno-gonzalo j, pedraza-díaz s, gomez-bautista m, ortega-mora lm, collantesfernandez e. prevalence of intestinal parasite infections in stray and farm dogs from spain. rev bras parasitol vet. 2020, 29(3):e014920. doi: 10.1590/s1984-29612020063. pmid: 32935772. 3. luca i, oprescu i, morariu s, mederle n, ilie m s, darabus g. effects of some disinfectants on toxocara spp.eggs viability of dogs and cats. turk j vet anim sci 2020 44: 734-739 4. qadir, s., dixit, a. k., dixit, p., & sharma, r. l. intestinal helminths induce haematological changes in dogs from jabalpur, india. journal of helminthology, 2010, 85(04), 401–403. doi:10.1017/s0022149x10000726 5. dărăbuş, gh., oprescu, i., morariu, s., mederle, n., ilie, m., ghid practic în bolile parazitare, vol. i, agroprint, timișoara, 2013, isbn 978-606-8037-25-7 6. dărăbuş, gh., oprescu, i., morariu, s., mederle, n., ilie, m., ghid practic în bolile parazitare, vol. ii, agroprint, timișoara, 2013, isbn 978-606-8037-25-7 cluj vet j 2021, 26, 2 16 7. mircean v, györke a, cozma v. prevalence and risk factors of giardia duodenalis in dogs from romania. vet parasitol. 2012, 184(2-4):325-9. doi: 10.1016/j.vetpar.2011.08.022. pmid: 21899952. 8. dărăbuș gheorghe, luca iasmina, oprescu ion, morariu sorin, mederle narcisa, ilie marius, sachter yacov, pollution with parasitic elements of green areas in timișoara, sci parasitol 2018, 19(1-2):62-65, 9. enriquez gf, macchiaverna np, argibay hd, lópez arias l, farber m, gürtler re, cardinal mv, garbossa g. polyparasitism and zoonotic parasites in dogs from a rural area of the argentine chaco. vet parasitol reg stud reports. 2019, 100287. doi: 10.1016/j.vprsr.2019.100287. epub 2019 apr 8. pmid: 31027600. 10. bishop gt, debess e. detection of parasites in canine feces at three off-leash dog parks in portland, oregon 2014. vet parasitol reg stud reports. 2020, 100494. doi: 10.1016/j.vprsr.2020.100494. epub 2020 nov 7. pmid: 33308738. 11. sharma sanjeev kumar, sinha s.r.p., sinha sucheta, jayachandran c., kumar mukesh post-treatment haematological studies on toxocariosis in dogs, journal of veterinary parasitology, 2010, 24, 1, 63-65. 12. voßmann, m.t., klinische, hämatologische und serologische befunde bei welpennachpränataler infektion mit toxocara canis werner 1789 (anisakidae). doctoral thesis. university of veterinary medicine hannover, hannover, 1985, germany, pp. 1–58. 13. zimmermann, u., quantitative untersuchungen über die wanderungund streuung der larven von toxocara canis werner 1782 (anisakidae) imdefinitiven wirt (beagle) nach fraktionierter erstund reinfektion. doctoral thesis. university of veterinary medicine hannover, hannover, germany, 1983, pp. 1–77. 14. schnieder t., laabs e.m., welz c., larval development of toxocara canis in dogs, vet. par. 2011, 175, 193–206. 15. manhardt, j., das verhalten von larven von toxocara canis werner 1782 (anisakidae) während und nach der lungenwandering imdefinitiven wirt (beagle). doctoral thesis, university of veterinary medicine hannover, hannover, germany, 1980, pp. 1–76. type of the paper (article research article comparative evaluation of florfenicol and polymeric nanoparticles loaded with florfenicol against bacterial strains isolated from chickens emilia trif, constantin cerbu, marina spînu, diana ioana olah, adrian valentin potârniche, sergiu dan zăblău, florina marian, george herțanu, emoke pall, gheorghe florinel brudașcă university of agricultural sciences and veterinary medicine cluj napoca, faculty of veterinary medicine, 3-5 calea mănăștur, 400372, cluj-napoca, romania * correspondence: constantin.cerbu@usamvcluj.ro abstract: antimicrobial resistance (amr) poses a significant threat to both human and animal health, necessitating the search for alternative antimicrobial agents and strategies. in this study, we aimed to identify and isolate clinical bacterial strains from chickens and evaluate their sensitivity to florfenicol, a common antimicrobial agent that is used exclusively in veterinary medicine, along with polymeric nanoparticles loaded with florfenicol at various concentrations. three clinical bacterial strains (escherichia coli, enterococcus faecalis and enterobacter cloacae) were successfully isolated and identified from chicken presenting clinical signs. in order to assess their susceptibility, the isolated strains were subjected to a standard disc diffusion assay using florfenicol. subsequently, polymeric nanoparticles loaded with florfenicol were tested at six different concentrations and compared their efficacy against the bacterial strains. our results demonstrated that all three clinical bacterial strains exhibited varying degrees of resistance to florfenicol. interestingly, the use of polymeric nanoparticles loaded with florfenicol did not displayed enhanced antimicrobial activity compared to the free drug. notably, the efficacy of the loaded nanoparticles did not significantly vary with different concentrations of active substance. this study highlights the importance of exploring novel therapeutic approaches to combat antimicrobial resistance. the use of polymeric nanoparticles loaded with florfenicol presents a promising avenue for overcoming resistance mechanisms and improving the efficacy of antimicrobial treatments both in human and veterinary medicine. further investigations are needed to elucidate the underlying mechanisms and optimize the formulation of polymer nanoparticles for enhanced therapeutic outcomes in combating amr. keywords: florfenicol; antibiotic-loaded nanoparticles; antimicrobial resistance; 1. introduction the discovery and integration of antimicrobial substances in the twentieth century stands as a remarkable achievement in modern medicine. this category of active substances has revolutionized the treatment of infectious diseases, ranging from minor to life-threatening complex surgical procedures, feasible organ transplantation to more effective chemotherapy treatment protocols [1]. however, the alarming rise of antimicrobial resistance (amr) on a global scale poses a significant threat, potentially reversing the progress made and returning us to a time similar to the pre-antibiotic era. furthermore, the economic impact of amr is staggering, with a significant loss of $3 trillion in gross domestic product [2]. amr is an inevitable consequence of the evolutionary process, as organisms develop genetic mutations to evade the lethal selective pressures imposed by antibiotics [3]. as long as antimicrobial substances continue to be utilized against human, veterinary or agriculture pathogens, bacteria will persistently develop and employ resistance mechanisms. currently, more that 70% of pathogenic bacteria display resistance to at least one antibiotic [4]. being ubiquitous, microorganisms serve as a reservoir of amr in various ecological niches. the intrinsic network of interactions among microbial communities in diverse environments facilitates the transfer of genetic material, thereby expanding the spread of amr, leading to a global concern [5]. received: 31.05.2023 accepted: 05.06.2023 published: 17.06.2023 doi: 10.52331/cvj.v28i1.43 copyright: © 2023 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses/ by/4.0/). cluj vet j 2023, vol. 28, issue 1 15 of 27 many classes of antibiotics used in human infections are shared with the veterinary sectors and vice versa, exerting cumulative selective pressure on microorganisms and leading to reduced efficacy on antimicrobial based treatments [7]. traditionally, antibiotics have been used in animal husbandry for the treatment of infectious diseases, as well as for preventive measures and as growth-promoting factors. the latter application is based on observations linking the administration of subtherapeutic doses of antibiotics to significant weight gain in treated animals [4]. although the precise mechanism behind this phenomenon is not yet fully understood, is has been observed that prolonged administration of antibiotics at subtherapeutic doses affects multiple organs and physiological processes [4]. the later mentioned processes represent a reduced diversity of the intestinal microbiota and diminished competition for nutrients, a decrease in harmful bacteria, reduced immune stimulation or increased vitamin biosynthesis in the intestines. collectively, these effects improve the net energy balance and enhance animal performance from a zootechnical standpoint [8]. furthermore, sublethal doses of antibiotics act as selective pressure, stimulating bacterial evolutionary mechanisms to adapt to environmental stressors and allowing the survival and propagation of more resistant strains carrying amr traits. similar effects can be observed with the use of antibiotics for prophylactic purposes. in this context, antimicrobial compounds are commonly administered via drinking water or feed, ensuring prolonged exposure of animals to low antibiotic doses over an extended period. however, the protective effects are reversed once antibiotic administration is suspended, leaving the animals susceptible to infections [9], [10]. in the context of poultry farming, the use of antibiotics has been a common practice with far-reaching consequences, particularly concerning amr. antibiotics have been employed in poultry production for therapeutic purposes, and they are typically administered through drinking water [11]. penicillins, aminoglycosides, tetracyclines, macrolides, and a combination of sulfonamide/trimethoprim are among the commonly used classes of antibiotics in this sector [12]. however, the extensive use of antibiotics in poultry farming raises concerns about the development and spread of antimicrobial resistance. the repetitive and widespread use of antibiotics in poultry production contributes to the selection and proliferation of resistant bacteria [13]. as a result, various resistance genes emerge, compromising the effectiveness of antibiotics not only in poultry sector but also in human medicine [14]. florfenicol, a broad-spectrum antibiotic, is frequently employed in poultry to combat respiratory, enteric or septicemic infectios. in addition, it has beed utilized for prophylaxis and growth promotion, due to its lower risk of promoting resistance development when compared to other amphenicols. [15]. however, studies have identified resistance genes associated with florfenicol in poultry populations, that poses a significant challenge for public health. these genes, when transferred to human pathogens, can diminish the effectiveness of antibiotics used for treating human infections [16]. therefore, the emergence and dissemination of resistance genes in poultry population warrant careful monitoring and intervention strategies to mitigate the spread of antimicrobial resistance. understanding the impact of antibiotic usage in poultry and the prevalence of resistance genes, such as those linked to florfenicol, is crucial for implementing effective control measures [17]. is is essential to develop alternative strategies that promote responsible antibiotic use in poultry farming, prioritize animal welfare, and minimize the risk of antimicrobial resistance transmission between animals and humans. by addressing these issues, we can safeguard the efficacy of antibiotics and ensure the continued protection of both animal and human health [18]. in order to determine the antimicrobial resistance of clinical bacterial strains, we employed a technique involving a previous isolation and identification of three strains using chemical identification. our focus was on evaluating the sensitivity of these bacterial strains for florfenicol, as well as for six different concentrations of florfenicol-loaded nanoparticles. the antibiotic was chosen based on the interest in poultry farming, since florfenicol is an antibiotic commonly employed to combat bacterial infections in this species [19]. the methodology consisted in testing the susceptibility of the bacterial strains by using a diffusimetric method, hence the inhibitory effect of the antimicrobial agents was assessed by measuring the diameter of the inhibition zones around the wells. the obtained results were then interpreted by comparing the inhibiting diameters of the different concentrations of florfenicol and florfenicol-loaded nanoparticles. this analysis provided insights into the effectiveness of these agents against the tested bacterial strains and allowed for the determination of the minimum inhibitory concentration (mic) required to inhibit bacterial growth. by employing the diffusimetric method and measuring the inhibiting diameter, we could evaluate the antimicrobial resistance of the clinical bacterial strains to florfenicol and assess the potential enhancement of its efficacy through the use of florfenicol-loaded nanoparticles. these findings contribute to our cluj vet j 2023, vol. 28, issue 1 16 of 27 understanding of the susceptibility patterns of bacterial strains and aid in the development of more effective antimicrobial strategies to combat antimicrobial resistance. 2. materials and methods 2.1. sample collection: swab sampleswere collected from 10-day-old chickens exhibiting non-specific clinical signs such as weight loss and decreased appetite. a total of 10 chickens were selected for this study. the birds were carefully examined, and samples were collected using aseptic techniques to avoid contamination. 2.2 isolation and identification of bacterial strains: upon sample collection, the specimens were inoculated onto nutrient agar plates using the streaking method. the plates were then incubated at 37°c for 24 hours to allow bacterial growth. following incubation, individual bacterial colonies were isolated based on their morphological characteristics. the isolated bacterial strains were subjected to identification using the api 20 e biochemical rapid test (biomérieux sa). this test utilizes a panel of biochemical reactions to identify the bacterial species. each bacterial strain was inoculated into the api 20 e strip and incubated according to the manufacturer's instructions. the results obtained from the test were recorded and used for further analysis. 2.3. preparation of bacterial cultures: to prepare 24-hour cultures of the identified bacterial strains, a loopful of each isolate was streaked onto nutrient agar plates. the plates were then incubated at 37°c for 24 hours. after incubation, a single colony from each plate was selected and inoculated into mueller-hinton broth at a reference scale of 0.5 mcfarland. the broth cultures were incubated under optimal conditions for the respective bacterial strains. 2.4. sensitivity testing: a plate containing 12 ml of mueller-hinton agar was used to perform the sensitivity testing for the three isolated bacterial strains. the tests aimed to evaluate the ability of florfenicol to inhibit bacterial growth using the diffusion method recommended by the clinical and laboratory standards institute (clsi). commercial susceptibility disks loaded with 30 µg of florfenicol were employed in the testing. additionally, polymeric nanoparticles loaded with florfenicol were used as an alternative formulation. the nanoparticles were reconstituted at a concentration of 30 µg/ml and subjected to successive dilutions to obtain concentrations of 15 µg/ml, 7.5 µg/ml, 3.75 µg/ml, 1.875 µg/ml, and 0.937 µg/ml. the reconstituted nanoparticles were prepared in 38 ml of sterile saline solution in wheaton scintillation vials made of borosilicate glass. table 1. inhibition zone diameters of florfenicol and nanoparticle-loaded formulations against isolated bacterial strains bacterial strain florfenicol disk (30 µg) florfenicol-loaded nanoparticles (µg/ml) e.coli 15 mm 30 µg/ml: 8 mm (± 1) 15 µg/ml:7.5 mm (±0.5) 7.5 µg/ml: 8 mm (±1) 3.75 µg/ml: 6.8 mm (±0.2) 1.875 µg/ml: 7 mm (±0.5) 0.937 µg/ml: 8 mm (±1.5) enterococcus faecalis 18 mm 30 µg/ml: 6 mm 15 µg/ml: 6 mm 7.5 µg/ml: 6 mm 3.75 µg/ml: 6 mm 1.875 µg/ml: 6 mm 0.937 µg/ml: 6 mm enterobacter cloacae 17 mm 30 µg/ml: 7 mm (± 1.5) 15 µg/ml: 6.5 mm (± 1) 7.5 µg/ml: 6 mm (±1.8) 3.75 µg/ml: 7.5 mm (±1.8) 1.875 µg/ml: 6.8 mm (±1.2) 0.937 µg/ml: 6 mm (±1.5) cluj vet j 2023, vol. 28, issue 1 17 of 27 2.5 interpretation of results: the interpretation of the sensitivity testing results was performed by measuring the diameter of inhibition zones formed around the susceptibility disks and nanoparticle-loaded wells. the diameter measurements were recorded for each concentration of florfenicol tested. statistical analysis was carried out using graphpad prism 9.3.0 to determine the significance of the differences observed between the susceptibility of the bacterial strains to florfenicol and the nanoparticle-loaded formulation. the results were analyzed, and relevant statistical parameters such as mean, standard deviation, and p-values were calculated. 3. results 3.1. isolation and identification of bacterial strains: from the examined chickens, three bacterial strains were isolated and identified as follows: escherichia coli, enterococcus faecalis, and enterobacter cloacae. it is important to note that these bacteria can also be part of the normal gut bacterial flora. however, further investigation is required to determine whether these isolated strains have any pathogenic effects. 3.7. sensitivity testing results: the susceptibility testing was performed to evaluate the effectiveness of florfenicol and nanoparticle-loaded formulations against the isolated bacterial strains. the inhibition zone diameters were measured and are summarized in table 1. 3.2 data analysis: statistical analysis (one-way anova test) was performed to assess the significance of the differences observed between the susceptibility of the bacterial strains tested at six different concentrations of florfenicol-loaded nanostructures. the analysis revealed no statistical significance between them (p>0.05), as shown also in figures 1, 2 and 3. it is worth noting that the bacterial strains exhibited a significantly higher susceptibility to the florfenicol disk compared to the nanoparticles loaded with florfenicol. 30 15 7.5 3.7 5 1.8 75 0.9 37 0 2 4 6 8 10 e.coli tested concentration (µg/ml) in hi bi tio n di am et er (m m ) 30 15 7.5 3.7 5 1.8 75 0.9 37 0 2 4 6 8 tested concentration (µg/ml) in hi bi tio n di am et er (m m ) enterococcus figure 1 and 2: graphical representation of the e.coli (1) and enterococcus (2) susceptibility to different concentrations of florfenicol-loaded nanoparticles 30 15 7.5 3.7 5 1.8 75 0.9 37 0 2 4 6 8 enterobacter tested concentration (µg/ml) in hi bi tio n di am et er (m m ) figure 3: graphical representation of the enterobacter susceptibility to different concentrations of florfenicol-loaded nanoparticles cluj vet j 2023, vol. 28, issue 1 18 of 27 4. conclusions the main objective of this study was to investigate the susceptibility of bacterial strains (escherichia coli, enterococcus faecalis, and enterobacter cloacae) isolated from chickens exhibiting non-specific clinical signs to florfenicol and nanoparticle-loaded formulations. the identified bacterial strains represent bacteria commonly found in poultry and fresh chicken meat and their presence suggest that they may have a significant effect on human colonization and the dissemination of antibiotic resistance in the environment. the results of the susceptibility testing revealed a higher susceptibility to he florfenicol disk compared to the nanoparticle-loaded formulation. however, it is important to consider that the aqueous solution used for the nanoparticles preparation and the potential influence of variables like the release rate of florfenicol from the nanostructures, temperature variations, and other nanostructure-related properties might have influenced these results . statistical analysis indicated no significant differences between the six different concentrations tested, suggesting that the susceptibility of the bacterial strains to the nanoparticle-loaded formulations remained consistent across the concentration range. the findings from this study highlight the potential limitations of the nanostructures in terms of antimicrobial efficacy compared to the conventional florfenicol disk. further investigations are warranted in order to characterize the nanostructures, including their release kinetics, as well as the loading with the active substance, and the impact of various other parameters on their antimicrobial activity. this additional research will aid in optimizing the nanoparticle formulation and overcoming the observed limitations. moreover, considering that the isolated bacterial strains (e. coli, enterococcus faecalis, and enterobacter cloacae) can be part of the normal gut bacterial flora, it is crucial to conduct further studies to determine whether these strains possess pathogenic properties or are associated with the observed non-specific clinical signs in the examined chickens. in conclusion, this study provides valuable insights into the susceptibility of bacterial strains isolated from chickens to florfenicol and nanoparticle-loaded formulations. the results suggest a higher susceptibility to the conventional florfenicol disk compared to the nanoparticle formulation, highlighting the need for further investigation and optimization of the nanoparticle system. the findings also emphasize the importance of assessing the pathogenic potential of these isolated bacterial strains to elucidate their role in the observed clinical signs. overall, this study sets the foundation for future research aiming to enhance antimicrobial strategies and promote animal health and welfare. author contributions: conceptualization, m.s and c.c; methodology, c.c and g.b; resources: d.o, e.p; data curation, a.p.; writing—original draft preparation, e.t; writing—review and editing s.z, f.m., g.h; visualization, e.t; supervision, c.c., m.s, g.b; all authors have read and agreed to the published version of the manuscript. funding: not applicable institutional review board statement: not applicable data availability statement: all the relevant data is available in the manuscript. acknowledgments: this work was supported by a grant of the ministry of research, innovation and digitization, cncs -uefiscdi, project number pn-iii-p1-1.1-pd-2021-0033, within pncd iii, as well as by grant eranet core organic co-fund roam free #249 ⁄ 2021. conflicts of interest: the authors declare no conflict of interest. references 1. l. garcia-migura, r. s. hendriksen, l. fraile, and f. m. aarestrup, “antimicrobial resistance of zoonotic and commensal bacteria in europe: the missing link between consumption and resistance in veterinary medicine,” veterinary microbiology, vol. 170, no. 1–2. elsevier, pp. 1–9, 2014. doi: 10.1016/j.vetmic.2014.01.013. 2. j. l. watts, m. t. sweeney, and b. v. lubbers, “current and future perspectives on the categorization of antimicrobials used in veterinary medicine,” j vet pharmacol ther, vol. 44, no. 2, pp. 207–214, mar. 2021, doi: 10.1111/jvp.12846. 3. r. r. watkins and r. a. bonomo, “overview: the ongoing threat of antimicrobial resistance,” infectious disease clinics of north america, vol. 34, no. 4. w.b. saunders, pp. 649–658, dec. 01, 2020. doi: 10.1016/j.idc.2020.04.002. cluj vet j 2023, vol. 28, issue 1 19 of 27 4. e. palma, b. tilocca, and p. roncada, “antimicrobial resistance in veterinary medicine: an overview,” international journal of molecular sciences, vol. 21, no. 6. mdpi ag, mar. 02, 2020. doi: 10.3390/ijms21061914. 5. l. cantas et al., “a brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota,” front microbiol, vol. 4, no. may, 2013, doi: 10.3389/fmicb.2013.00096. 6. a. mateus, d. brodbelt, and k. stärk, “evidence-based use of antimicrobials in veterinary practice,” in pract, vol. 33, no. 5, pp. 194–202, may 2011, doi: 10.1136/inp.d2873. 7. l. tollefson and w. t. flynn, “impact of antimicrobial resistance on regulatory policies in veterinary medicine: status report,” 2002. [online]. available: http://www.aapspharmsci.org 8. p. l. toutain, a. a. ferran, a. bousquet-melou, l. pelligand, and p. lees, “veterinary medicine needs new green antimicrobial drugs,” frontiers in microbiology, vol. 7, no. aug. frontiers research foundation, aug. 03, 2016. doi: 10.3389/fmicb.2016.01196. 9. j. espinasse, “responsible use of antimicrobials in veterinary medicine: perspectives in france,” 1993. 10. n. r. naylor et al., “estimating the burden of antimicrobial resistance: a systematic literature review,” antimicrob resist infect control, vol. 7, p. 58, 2018, doi: 10.1186/s13756-018-0336-y. 11. m. ismail and y. a. el-kattan, “comparative pharmacokinetics of florfenicol in the chicken, pigeon and quail,” br poult sci, vol. 50, no. 1, pp. 144–149, jan. 2009, doi: 10.1080/00071660802613286. 12. o. hassanin, f. abdallah, and a. awad, “effects of florfenicol on the immune responses and the interferon-inducible genes in broiler chickens under the impact of e. coli infection,” vet res commun, vol. 38, no. 1, pp. 51–58, mar. 2014, doi: 10.1007/s11259-013-9585-7. 13. s. al-shahrani and v. naidoo, “florfenicol induces early embryonic death in eggs collected from treated hens,” bmc vet res, vol. 11, no. 1, aug. 2015, doi: 10.1186/s12917-015-0536-0. 14. x. li, g. wang, x. du, b. cui, s. zhang, and j. shen, “antimicrobial susceptibility and molecular detection of chloramphenicol and florfenicol resistance among isolates from diseased chickens,” vol. 8, pp. 243–247, 2007. 15. a. bello, b. poźniak, a. smutkiewicz, and m. świtała, “the influence of the site of drug administration on florfenicol pharmacokinetics in turkeys,” poult sci, vol. 101, no. 1, jan. 2022, doi: 10.1016/j.psj.2021.101536. 16. x. mei et al., “florfenicol enhances colonization of a salmonella enterica serovar enteritidis flor mutant with major alterations to the intestinal microbiota and metabolome in neonatal chickens public and environmental health microbiology,” 2021. [online]. available: https://www.cdc.gov/ 17. e. a. h. abu-basha, r. gehring, a. f. al-shunnaq, and s. m. gharaibeh, “pharmacokinetics and bioequivalence of florfenicol oral solution formulations (flonicol® and veterin®10%) in broiler chickens,” j bioequivalence bioavailab, vol. 4, no. 1, pp. 0001–0005, 2012, doi: 10.4172/jbb.1000101. 18. a. brauner, o. fridman, o. gefen, and n. q. balaban, “distinguishing between resistance, tolerance and persistence to antibiotic treatment,” nat rev microbiol, vol. 14, no. 5, pp. 320–330, 2016, doi: 10.1038/nrmicro.2016.34. 19. a. anadón et al., “plasma and tissue depletion of florfenicol and florfenicol-amine in chickens,” j agric food chem, vol. 56, no. 22, pp. 11049–11056, nov. 2008, doi: 10.1021/jf802138y. microsoft word munteanu_dec_2021.docx cluj vet j 2021, 26, 3 http://clujveterinaryjournal.ro review the link between mammary cancer, excessive adipose tissue and cholesterol camelia munteanu1 and bianca pop 2,* 1university of agricultural sciences and veterinary medicine, department of plant culture clujnapoca, romania; camelia.munteanu@usamvcluj.ro 2university of agricultural sciences and veterinary medicine, department of plant culture clujnapoca, romania; bianca-alexandra.pop@student.usamvcluj.ro *correspondence: bianca pop, camelia.munteanu@usamvcluj.ro; tel.: 0728513284 abstract: mammary cancer remains the most frequent worldwide type of cancer in females. from a health point of view, it is a huge challenge. as a definition, we can say that a group of biologically and molecularly heterogeneous diseases is represented by mammary cancer. an important causal factor for this disease is genetic predisposition, especially mutations in the brca1 or brca2 gene. the mammary gland is stimulated by hormones both morphologically and physiologically. the most significant of these are estrogens. estrogen is the main female hormone, but it is present in both females and males. elevated levels of this hormone may increase the risk of developing mammary cancer. in post-climacteric excessive adipose tissue, estrogens biosynthesis is catalyzed by aromatase, converting adrenal androgens into estrogen. risk factors for developing mammary cancer, such as excessive adipose tissue, age at menarche and the use of exogenous hormones may increase the risk of developing it. the aim of this paper is to show the link between cholesterol, excessive adipose tissue and the increased risk of developing mammary cancer. keywords: cancer, estrogen, hormones, cholesterol, obesity introduction obesity is a risk factor for both mammary cancer as well as a strong prognosis, which predicts side effects of the disease. clinical evidence shows that obese patients with mammary cancer who are being treated with chemotherapy or aromatase inhibitors are more likely to have a recurrence of the disease compare to females with normal body mass index [1]. information about adipose tissue has increased significantly in recent years. although adipose tissue has always been described for lipid storage, it is now identified as a true organ that possesses both metabolic and endocrine functions. it releases a variety of substances into the bloodstream to communicate with other organs and tissues [2]. adipokines, adipose tissue-specific substances, are essential in determining a group of physiological responses, namely glucose and lipid metabolism, homeostasis, angiogenesis, inflammation and satiety [3]. on one hand, disorder of the hormonal role and uncontrolled expression of adipokines in adipose tissue, causes overweight or obese, eventually connecting obesity with mammary cancer risk [4]. on the other hand, there are studies that show that increased adiposity induces the growth and advancement of mammary cancer in post-climacteric females through the secretion of estrogen [4]. received: 20.12.2021 accepted: 30.12.2021 published: 31.12.2021 doi: 10.52331/cvj.v26i3.35 copyright:© 2021by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 3 22 2. the role and effects of estrogens the main roles of estrogen are to induce cell proliferation and the development of genitals and other tissues involved in reproduction [5]. estrogens help with: 1. development of the stromal tissue of the breasts; 2. formation of a well-represented pipeline system; 3. deposition of adipose tissue in the breasts. the mammary lobes and alveoli develop only to a small extent under the influence of estrogen. progesterone and prolactin are the hormones that have a decisive effect on the growth and functioning of these structures [6]. 2.1 effects of estrogen on metabolism and adipose tissue deposition estrogen synthesis in obese adipose tissue. estrogen biosynthesis occurs primarily in the adipose tissue in post-climacteric females, through the conversion of adrenal androgens to estrogen by aromatase [7]. several cellular and molecular changes in obese adipose tissue alter the biosynthesis and metabolism of estrogen. activation of the nf-κb pathway leads to an increase in aromatase expression in breast adipocytes and, therefore, to a higher estrogen synthesis (figure 1) (simpson et al., 2013). similarly, several cytokines that are regulated in obese adipose tissue, such as tnf-α and il-6, stimulate aromatase activity [8]. excess breast fat, microscopic outbreaks of adipocytes surrounded by macrophages, present increased aromatase activity [9]. moreover, in post-climacteric females, bmi is directly proportional to serial concentrations of estrone and estradiol and inversely proportional to hormone-binding globulin levels, leading to an increase in total bioavailable estrogen [7]. compared to females with a bmi <22.5 kg / m2, obese females have an 86% increase in circulating estradiol, a 60% increase in estrone, and a 20% increase in testosterone [10]. 3. mammary cancer and excessive adipose tissue-mechanism chronic activation of nf-κb in adipose tissue not only causes obesity-mediated inflammation, but also stimulates anti-apoptotic genes and the proliferation of mammary cancer, invasion, angiogenesis and metastasis [11]. concentrations of il-6 in peritumoral fat are higher than in all other regions and grow with increasing tumor size and lymph node involvement. some studies have shown that the interaction between cancer cells and adipocytes induces both cell types to increase the secretion of cytokines il-6, il-8, ccl2 and ccl5. in addition, this phenomenon promotes tumor invasion and metastasis [11, 12]. adipose tissue normally helps stimulate up to 35% of circulating il-6. it is also responsible for the increase in serum il-6 after climacterium. in this way it can help increase the risk of mammary cancer and the progression of the tumor. il-8 resulting from cancer cells, surrounding adipocytes, endothelial cells, infiltrating neutrophils, and tumor-associated macrophages (tam) develops angiogenesis, tumor growth, metastasis, and resistance to chemotherapy [13]. 4. the link between overweight and tumorigenesis along with obesity, the secreted cytokines go from an anti-inflammatory profile to a pro-inflammatory and proangiogenic profile. the secretion of pro-inflammatory and proangiogenic cytokines also increases in adipocytes, and ultimately results in the multiplication of cancer cells. in this way, the stimulation of angiogenesis, the expansion of cancer stem cells, invasion and metastasis takes place [14]. cluj vet j 2021, 26, 3 23 excessive adipose tissue accumulates mediators of antitumor immunity, such as cd8-positive (cd8 +) t cells, natural killer (nk) cells, and dendritic cells, myeloid-derived suppressor cells (mdsc), and tumorassociated macrophages (tam) which suppresses antitumor immunity (fig.1). in addition, stimulation of adipocyte aromatase results in higher estrogen synthesis and thus potentiates the development of estrogen receptor-positive (er +) mammary cancer [13]. adipocyte hypertrophy induces the secretion of inflammatory cytokines, chemokines, and leptin as a result of an increase in the number and size of adipocytes. these adipokines then induce macrophage recruitment and polarization. macrophages secrete inflammatory cytokines, which can act directly to stimulate mammary cancer. in the end, all this leads to an increase in the production of aromatase and estrogen. in addition, they induce the expression of pro-angiogenic factors [13]. inflammation of adipose tissue also promotes the development of insulin resistance, leading to the release of insulin and insulin-like growth factor (igf). insulin resistance and igf can directly promote mammary cancer. similarly, adipocyte leptin acts directly on cancer cells. moreover, the decrease in adiponectin caused by excess adipose tissue has the same effect [13]. 5. cholesterol and the risk of mammary cancer a number of measures have been implemented to detect and treat elevated cholesterol, largely through the use of statins (figure 2) and more recently by pcsk-9 inhibitors [15]. pcsk9 inhibitors are monoclonal antibodies that inhibit proprotein convertase subtilisin/kexin type 9 (pcsk9). pcsk9 is a protein that binds to ldl receptors for degradation and thus reduces the liver's ability to remove ldl-cholesterol from the blood, also called "bad" cholesterol [16]. the pcsk9 inhibitor is synthesized to bind to pcsk9 and prevent pcsk9 from binding to ldl (low density lipoprotein) receptors on the surface of liver cells. in the absence of pcsk9, there will be more ldl receptors on the surface of liver cells to remove ldl-cholesterol from the blood, resulting in a lower concentration of ldl cholesterol in the blood. in the last decade, there have been more and more results associating cholesterol with other modifiable risk factors, such as obesity and diabetes [17, 18]. unfortunately, the combined action of these factors is reflected in a number of cancers, including mammary cancer [19]. high blood cholesterol is often associated with obesity [20]. its impact as a risk factor in the occurrence of mammary cancer is not very clear and it has not been established which of the 3 parameters: total cholesterol, ldl or hdl contributes to the appearance of the disease [21]. the systematic analysis and meta-analysis of prospective studies that investigated the association between total cholesterol (ct), hdl-c, ldl-c, apoa1 and apob and the risk of mammary cancer suggested an inversely proportional, statistically significant link [22]. at the end of the twentieth century, some epidemiological research (small sample size) studied the impact of serum cholesterol on the incidence of malignancy, but the results were inconclusive [23]. others have suggested that red and processed meat, which contain a higher amount of ldl cholesterol, are risk factors for colorectal, mammary and endometrial cancer [24]. a larger study published in science shows the role of cholesterol in the development of mammary cancer in mice. moreover, the authors also showed that knockout mice in which cholesterol levels increased and were treated with statins had a lower predisposition to developing mammary cancer [25]. at the cellular level, it has been shown that there are many physiological mechanisms. low serum cholesterol can increase the fluidity of the cell membrane which may result in the spread of cancer cells [26]. conversely, the loss of membrane cholesterol can decrease the antigenicity of tumor cells, which results in the avoidance of the action of the immune system [27]. cluj vet j 2021, 26, 3 24 5.1 cholesterol, hfd (high-fat diet), 27hc and cancer biology cholesterol represents a major factor mammary cancer risk. unfortunately, the mechanism by which it takes place is not fully known. most likely the increase in cholesterol content in cell membranes and after the affecting of the membrane fluidity caused by dyslipidemia may represent a possible explanation. also, there are researches that show the functionality of the metabolite, 27-hydroxycholesterol (27hc) as an estrogen [21, 28]. the intensive proliferation of estrogen receptor (er)-positive mammary cancer cells is a result of its action. in this way, the treatments used in mammary cancer in order to lower the concentration of cholesterol are justified [21]. in animals, the specific contribution of cholesterol, a comorbidity of obesity, in the pathogenesis of cancer was underestimated. this may be due to the fact that no increase in cholesterol was observed after a hyperlipidemic diet (hfd high-fat diet). to address this, a high-fat diet was used in humanized apoe3 mice. circulating cholesterol levels were subsequently determined [25]. the observed increase in circulating cholesterol in hfd-fed mice is the result of intensified of novo synthesis. however, the effect of hfd on tumor growth was attenuated by statin treatment or inhibition of cyp27a1 [25]. these findings confirm the importance of cholesterol and dyslipidemia in mammary cancer and highlight the importance of 27hc and er as mediators of these effects. on the other hand, there are studies showing that the effect of statins in mammary cancer is not beneficial [29]. 6. conclusions the effects of excessive adipose tissue on the risk of mammary cancer differ depending on the status of the er. obesity is associated with a significantly higher risk of er-positive mammary cancer. the effect is insignificant for er-negative mammary cancer after climacterium [30]. high concentrations of cytokines and leptins secreted by adipose tissue increase the number of preadipocytes, that release free fatty acids (ffa) and activate the nf-κb pathway. this pathway controls dna transcription, cytokine production, and apoptosis in both adipocytes and immune cells in order to produce chronic inflammation [31]. the high number of preadipocytes causes high concentrations of il-6, il-8, ccl2, ccl5 and vegf with a positive effect on the production of nf-κb and cytokines [32]. in addition, contact between adipocytes and invasive cancer cells synergistically regulates cytokine secretion. 9 tnf-α also called tumor necrosis factor alpha and il-6 affects insulin receptor activation [33]. finally, there is insulin resistance that has a positive impact on the development and growth of mammary cancer. the nf-κb, tnf-α and il-6 pathway also stimulates the expression of aromatase in stromal and adipocyte fibroblasts [8] breast. the effect is an increased estrogen production in both cancer and stromal cells. in addition to increasing insulin resistance, igfs, adipokines, and local estrogen production, there is clear evidence to support the independent role of cholesterol as a mediator of the effects of dyslipidemia and/or obesity on the pathogenesis of mammary cancer [21]. a major mechanism by which cholesterol triggers mammary cancer includes its metabolite, 27hc, a molecule with serm activity (which is a selective modulator of estrogen receptors). studies highlight the immediate therapeutic potential for modulating cholesterol levels, either through diet or medication, such as statins, pcsk9 inhibitors, or niacin [34]. author contributions: for research articles with several authors, a short paragraph specifying their individual contributions must be provided. the following statements should be used “conceptualization, m.c. and p.b.; methodology, cluj vet j 2021, 26, 3 25 p.b.; software, m.c.; validation, m.c., and p.b.; formal analysis, p.b.; investigation, p.b.; resources, p.b.; data curation, p.b.; writing—original draft preparation, p.b.; writing—review and editing, c.m.; visualization, c.m.; supervision, c.m. all authors have read and agreed to the published version of the manuscript”. funding: “this research received no external funding”. conflicts of interest: “the authors declare no conflict of interest.” references 1. lee, k., kruper, l., dieli-conwright, c. m., mortimer, j. e. the impact of obesity on breast cancer diagnosis and treatment. current oncology report 2019, 21(5), 41. https://doi.org/10.1007/s11912-019-0787-1 2. coelho m, oliveira t, fernandes r. biochemistry of adipose tissue: an endocrine organ. arch med sci. 2013;9(2):191-200. doi:10.5114/aoms.2013.33181 3. balistreri, c. r., caruso, c., candore, g. the role of adipose tissue and adipokines in obesity-related inflammatory diseases. mediators of inflammation 2010, 802078. https://doi.org/10.1155/2010/802078 4. mohanty, s. s., mohanty, p. k. obesity as potential breast cancer risk factor for postmenopausal women. genes & disease 2021, 8(2), 117-123. 5. hamilton, k. j., hewitt, s. c., arao, y., korach, k. s. estrogen hormone biology. current topics in developmental biology 2017 125, 109–146. https://doi.org/10.1016/bs.ctdb.2016.12.005 6. brisken, c., o'malley, b. hormone action in the mammary gland. cold spring harbor perspectives in biology 2010, 2(12), a003178. https://doi.org/10.1101/cshperspect.a003178 7. liedtke, s., schmidt, m. e., vrieling, a., lukanova, a., becker, s., kaaks, r., zainedin, a.k., buck, k., benner, a., chang-claude, j., steindorf, k. postmenopausal sex hormones in relation to body fat distribution. obesity 2012, 20(5), 1088-1095. 8. purohit, a., reed, m. j. regulation of estrogen synthesis in postmenopausal women. steroids 2002, 67(12), 979983. 9. mullooly, m., yang, h. p., falk, r. t., nyante, s. j., cora, r., pfeiffer, r. m., radisky, d.c., visscher, d.w., hartmann, l.c., carter, j.m., degnim, a.c., stanczyk, f.z., figueroa, j.d., garcia-closas, m., lissowska, j., troester, m.a., hewitt, s.m., brinton l.a., sherman m.e., gierach, g. l. relationship between crown-like structures and sex-steroid hormones in breast adipose tissue and serum among postmenopausal breast cancer patients. breast cancer research 2017, 19(1), 1-10. 10. key, t. j., appleby, p. n., reeves, g. k., travis, r. c., brinton, l. a., helzlsouer, k. j., dorgan, j.f., gapstur, s.m., gaudet, m.m., kaaks, r., riboli, e., rinaldi, s., manjer, j., hallmans, g., giles, g.g., marchand, l.le, kolonel, l.n., henderson, b.e., tworoger, s.s., hankinson, s.e., zeleniuch-jacquotte a., koenig, k., krogh, v., sieri, s., muti, p., ziegler, r.g., schairer, c., furhman, b.j., barrett-conner, e., laughlin, g.a., grant, e.j., cologne, j., ohishi, w., hida, a., cauley, j.a., fourkala, e.o., menon, u., rohan, t.e., strickler, h.d., gunter, m. j. endogenous hormones and breast cancer collaborative group. steroid hormone measurements from different types of assays in relation to body mass index and breast cancer risk in postmenopausal women: reanalysis of eighteen prospective studies. steroids 2015, 99(pt a), 49-55. 11. dirat, b., bochet, l., dabek, m., daviaud, d., dauvillier, s., majed, b., wang, y.y., meulle, a., salles, b., gonidec, l.s., garrido, i., escourrou, g., valet, p., muller, c. cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. cancer research 2011, 71(7), 2455-2465. 12. mueller mm, fusenig ne. friends or foes—bipolar effects of the tumour stroma in cancer. nat rev cancer 2004; 4:839–49. cluj vet j 2021, 26, 3 26 13. kim, j. h., bachmann, r. a., chen, j. interleukin-6 and insulin resistance. vitamins & hormones 2009, 80, 613633. 14. makki, k., froguel, p., wolowczuk, i. adipose tissue in obesity-related inflammation and insulin resistance: cells, cytokines, and chemokines. isrn inflammation 2013, 139239. https://doi.org/10.1155/2013/139239 15. chaudhary, r., garg, j., shah, n., sumner, a. pcsk9 inhibitors: a new era of lipid lowering therapy. world journal of cardiology 2017, 9(2), 76–91. https://doi.org/10.4330/wjc.v9.i2.76 16. fattori, e., cappelletti, m., lo surdo, p., calzetta, a., bendtsen, c., ni, y. g., pandit, s., sitlani, a., mesiti, g., carfí, a., monaci, p. immunization against proprotein convertase subtilisin-like/kexin type 9 lowers plasma ldl-cholesterol levels in mice. journal of lipid research 2012, 53(8), 1654–1661. https://doi.org/10.1194/jlr.m028340 17. klop, b., elte, j. w., cabezas, m. c. dyslipidemia in obesity: mechanisms and potential targets. nutrients 2013, 5(4), 1218–1240. https://doi.org/10.3390/nu5041218 18. onat, s., ates, g., avcı, a., yıldız, t., birak, a., ozmen, c. a., ulku, r. the role of mediastinoscopy in the diagnosis of non-lung cancer diseases. therapeutics and clinical risk management 2017, 13, 939. 19. la vecchia c, giordano sh, hortobagyi gn, chabner b. overweight, obesity, diabetes, and risk of breast cancer: interlocking pieces of the puzzle. oncologist. 2011;16(6):726-729. doi:10.1634/theoncologist.2011-0050 20. must, a., spadano, j., coakley, e. h., field, a. e., colditz, g., dietz, w. h. the disease burden associated with overweight and obesity. jama 1999, 282(16), 1523-1529. 21. nelson, e. r., chang, c. y., mcdonnell, d. p. cholesterol and breast cancer pathophysiology. trends in endocrinology & metabolism 2014, 25(12), 649-655. 22. touvier m, fassier p, his m, norat t, chan ds, blacher j, hercberg s, galan p, druesne-pecollo n, latinomartel p. cholesterol and breast cancer risk: a systematic review and meta-analysis of prospective studies. br j nutr. 2015, 14;114(3):347-57. doi: 10.1017/s000711451500183x. epub 2015 jul 15. pmid: 26173770. 23. salonen, j. t. risk of cancer and death in relation to serum cholesterol: a longitudinal study in an eastern finnish population with high overall cholesterol level. american journal of epidemiology 1982, 116(4), 622-630. 24. guo, h., callaway, j. b., ting, j. p. inflammasomes: mechanism of action, role in disease, and therapeutics. nature medicine 2015, 21(7), 677-687. 25. nelson, e. r., wardell, s. e., jasper, j. s., park, s., suchindran, s., howe, m. k., carver, n.j., pillai, r.v., sullivan, p.m., sondhi, v., umetani, m., geradts, j., mcdonnell, d. p. 27-hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. science 2013, 342(6162), 1094-1098. 26. oliver, m. f. (1981). serum cholesterol-the knave of hearts and the joker. the lancet, 318(8255), 1090-1095. 27. shinitzky, m. membrane fluidity and receptor function. in membrane fluidity. springer 1984, pp. 585-601. boston, ma. 28. nelson, e. r. the significance of cholesterol and its metabolite, 27-hydroxycholesterol in breast cancer. molecular and cellular endocrinology 2018, 466, 73-80. 29. wu, q., ishikawa, t., sirianni, r., tang, h., mcdonald, j. g., yuhanna, i. s., thompson, b., girard, l., mineo, c., brekken, r.a., umetani, m., euhus, d.m., xie, y., shaul, p. w. 27-hydroxycholesterol promotes cell-autonomous, er-positive breast cancer growth. cell reports 2013, 5(3), 637-645. 30. picon-ruiz, m., morata-tarifa, c., valle-goffin, j. j., friedman, e. r., slingerland, j. m. obesity and adverse breast cancer risk and outcome: mechanistic insights and strategies for intervention. ca: a cancer journal for clinicians 2017 67(5), 378–397. https://doi.org/10.3322/caac.21405 cluj vet j 2021, 26, 3 27 31. zatterale, f., longo, m., naderi, j., raciti, g. a., desiderio, a., miele, c., beguinot, f. chronic adipose tissue inflammation linking obesity to insulin resistance and type 2 diabetes. frontiers in physiology 2020, 10, 1607. https://doi.org/10.3389/fphys.2019.01607 32. simons, p. j., van den pangaart, p. s., van roomen, c. p., aerts, j. m., boon, l. cytokine-mediated modulation of leptin and adiponectin secretion during in vitro adipogenesis: evidence that tumor necrosis factor-αand interleukin-1β-treated human preadipocytes are potent leptin producers. cytokine 2005, 32(2), 94-103. 33. kern, p. a., ranganathan, s., li, c., wood, l., ranganathan, g. adipose tissue tumor necrosis factor and interleukin-6 expression in human obesity and insulin resistance. american journal of physiology-endocrinology and metabolism 2001, 280(5), e745-e751. 34. thelen, k. m., lütjohann, d., vesalainen, r., janatuinen, t., knuuti, j., von bergmann, k., lehtimäki, t., laaksonen, r. effect of pravastatin on plasma sterols and oxysterols in men. european journal of clinical pharmacology 2006, 62(1), 9-14. microsoft word perez_paz_et_al_dec_2021.docx cluj vet j 2021, 26, 3 http://clujveterinaryjournal.ro communication assessing two strategies for production of murine ascites with anti-sars-cov-2 monoclonal antibodies joel javier pérez-paz1, reinaldo blanco1, dayamí dorta1, andy domínguez1, maylin pérez-bernal1,*, celia tamayo1, carlos hernández1, ricardo pina1, javier díaz1, shaylí pérez1, ivis pasarón1 and enrique pérez1 1 center for genetic engineering and biotechnology of sancti spiritus, circunvalante norte, olivos 3, sancti spiritus, cuba * correspondence: maylin.perez@cigb.edu.cu abstract: studies were conducted to improve the production of murine ascites with monoclonal antibodies that recognize sars-cov-2 proteins. balb/c mice were primed with 0.5 ml of mineral oil into the abdominal cavity. seven days after priming, mice were divided in two groups: the group 1 was inoculated intraperitoneally with 2x106 cells/ml of mab-secreting hybridomas against the nucleocapsid and spike proteins of sars-cov-2; the group 2 was injected simultaneously with the same inoculum of hybridoma cells and mineral oil, 18 days after priming. no disturbances or suffering signals were observed in mice from both groups, suggesting that double administration of mineral oil did not produce significant distress with respect to the single dose used for priming, and that none of the hybridoma cell lines were particularly aggressive for the inoculated mice. ascites was collected in 90.48% and 97.68% of mice from groups 1 and 2, respectively. ascites was not collected in 7.42% of all mice. the main cause was they never developed ascites tumors but no solid tumors were observed either. the volume of ascitic fluid per mouse was increased significantly in mice from group 2, and there were no significant differences between groups in terms of the concentration of igg in clarified ascites. according to these results, to obtain higher amounts of mab the strategy applied in group 2 should be used, since it showed the best results in the development of ascites tumors and it significantly increased the volume of ascites fluid per mouse. this could allow the use of fewer animals for ascites production, which is an ethical and economic benefit. keywords: ascites; hybridoma; mice; mineral oil 1. introduction at the end of 2019, a new coronavirus began to spread in china to become the pandemic that has cost the most human lives: the sars-cov-2. all efforts of healthcare personnel and scientists have had to focus on its rapid diagnosis and treatment. in the strategies to reduce the viral transmission, monoclonal antibodies (mabs) have become reliable tools, especially for immunoassay techniques used for diagnosis, which are cost-effective, sensitive, rapid and selective [1]. there are basically two main phases in the production of mabs: the selection of mab-producing hybridoma cells, generated by the fusion of antibody-producing lymphoid cells from an immunized mouse and murine myeloma cells, and the propagation of selected hybridoma clones, in vivo or in vitro. the in vivo production of mabs has been carried out by injecting the hybridoma cells into the mice abdominal cavity. the propagation of these cells in the ascitic fluid offers a rapid and economical route to the production of mabs [2]. in vitro production techniques have been developed over the years as alternatives to in vivo production of mabs, but many of these techniques have not been practical due to their high cost, requirements for specialized equipment or their propensity to become contaminated [3]. mab production in transgenic plants is also a promising technology, since they are considered inexpensive and facile production platforms for recombinant mabs [4], but it still not solves the great demand of these molecules. consequently, the total replacement of the ascites method is not yet possible, much less in the current pandemic context, when the rapid and effective production of mabs is needed for the diagnosis and control of viral transmission. received: 20.10.2021 accepted: 26.11.2021 published: 31.12.2021 doi: 10.52331/cvj.v26i3.31 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 3 3 under these circumstances, medium or large-scale productions of mabs are required. medium-scale production is demanded to make 0.1-1.0 g quantities for diagnostic or developing assays [3]. large-scale production requires an extensive inoculation program with a large number of mice, mostly when a single mouse is inoculated with a single antigen. hence, from an ethical and economic perception, it would be necessary to acquire efficient and high throughput strategies to maximize the mab production and to reduce the number of animals used [5]. the center for genetic engineering and biotechnology of sancti spiritus (cigbss), cuba, has been in charge of generating several mab-secreting hybridomas against the nucleocapsid and spike proteins of sars-cov-2 virus. these antibodies must be produced to satisfy the increasing demands of the enzyme-linked immunosorbent assay (elisa) applied currently for detecting sars-cov-2 antigen. the present work aimed to improve the production of murine ascites containing anti-sars-cov-2 mabs, by assessing two strategies for the administration of mineral oil for balb/c mice: a single injection, as priming agent, 7 days before the inoculation of hybridoma cells and the simultaneous injection of mineral oil and hybridoma cells to mice previously primed with mineral oil. the capability of mice to develop ascitic tumors, the volume of ascites per mouse and the igg concentration in clarified ascites were monitored to select the best strategy for production of ascites with anti-sars-cov-2 mabs. 2. materials and methods 2.1 hybridoma cell lines for the production of anti-sars-cov-2 mabs in murine ascites, there were used six hybridoma cell lines generated by cigbss, cuba. three of them secrete mabs that recognize the sars-cov-2 nucleocapsid protein (cbssncov.2, cbssncov.3 and cbssncov.10) and the others recognize the receptor binding domain (rbd) of the sars-cov-2 spike protein (cbssrbd-s.1, cbssrbd-s.2 and cbssrbd-s.3). 2.2 mouse priming and inoculation balb/c male and female mice of 22 ± 1 and 24 ± 1 g of weight, respectively, were used for ascitic fluid production. they were maintained in eurostandard type ii cages (268 mm x 215 mm x 141 mm) at (22-25) °c and 50-65% relative humidity. all animals were primed with 0.5 ml of mineral oil (zahori, mexico) in the abdominal cavity. each hybridoma inoculum was prepared at a dilution of 2 x 106 cells per milliliter of rpmi-1640 medium (sigma, hybri-max). before the inoculation of cells, the mice were divided into two groups: the group 1 was inoculated intraperitoneally with 1 ml of cell suspension seven days after priming, and the group 2 was inoculated analogously to group 1 but 18 days after priming and simultaneously with 0.5 ml of mineral oil. the mice were observed at least twice daily, including weekends, by personnel familiar with the clinical signs related to the production of ascites, to assess the degree of abdominal distention and to monitor health and well-being. all the experimental procedures were approved by the ethical committee on animal experimentation of the center for genetic engineering and biotechnology (cigb, havana, cuba). 2.3 ascites harvest the extraction of ascites was carried out in two times: 10 and 12 days after the inoculation of the hybridoma cells. before the ascites extraction, the abdomen of each mouse was cleaned with 70% ethanol. the abdominal paracentesis was performed in the right side of the inguinal-abdominal region with an 18-gauge needle, inserted at a 35-45° angle. the ascites fluid was harvested in 50 ml corning tubes with 150 µl of 8% edta. the ascites was clarified by centrifugation at 1125 x g for 30 min at (22-25) °c and filtered through 0.45 µm glass wool. 2.4 quantification of igg in clarified ascites the quantification of murine igg in clarified ascites was performed by a sandwich elisa. polystyrene 96-well microtiter plates (costar 3590 high binding) were coated with 10 µg/ml goat anti-mouse igg polyclonal antibody in 100µl/well coating buffer (10mm carbonate-bicarbonate buffer, ph 9.6) and incubated 2 h at 37°c. wells were washed twice with 380µl/well washing buffer (0.05% tween-20) and blocked with 200µl/well blocking buffer (phosphate-buffered saline, ph 7.2, and 1% nonfat milk). this and the two subsequent steps were carried out 1 h at 37°c. the plate was washed once and 100 µl of ascites diluted 1:20 0000 with blocking buffer were added to wells. the calibration curve was prepared in the range of 150 ng/ml to 2.34 ng/ml using the cbsspsa.4, supplied by cigbss as standard mab. plates were washed three times and 100µl of peroxidase cluj vet j 2021, 26, 3 4 (hrp)-conjugated goat anti-mouse igg diluted 1:8 000 with blocking buffer were added per well and incubated. after four washes, 100µl/well 5.5mg/ml o-phenylenediamine dihydrochloride with 0.015% hydrogen peroxide in 0.1m citrate-phosphate buffer, ph 5.0, were added and incubated 20 min at (22-25) °c in the dark. the reaction was stopped with 100µl/well of 2m sulfuric acid, and the absorbance was measured at 492 nm in a microplate reader (labsystems multiskan® plus, finland). 2.5 statistical analysis the data of ascites volume per mouse and igg concentration in clarified ascites, obtained from each group of mice, were analyzed by means of independent samples t-test (ɑ=0.05) using the statistical package for social science, version 15.0. 3. results mice developed the gradual swelling of the abdomen that accompanies the accumulation of ascites fluid over a period of 7 days after the injection of hybridoma cells. the daily observation did not detect evidence of distress in the animals of both groups under study: their coats were clean and smooth, they maintained food and water consumption and the activity into the cages was normal in all of them. the first extraction of ascites was performed 10 days after the inoculation of the cells. at that time, the abdominal distention was moderate since ascites fluid volumes did not exceed 20% of the baseline body weight of mice. each mouse was tapped two times. after the second and last tap, the following clinical irregularities were perceived in some animals of both groups: hunched posture, piloerection and decreased activity. table 1 shows the number of mice used in both ascites producing groups and the number of mice from which it was possible to collect ascites in two taps. there were included 889 mice in the study, 29.13% of them received the simultaneous injection of mineral oil and hybridoma cells after being primed with mineral oil. in this group, 97.68% of the mice developed ascitic tumors and it was possible to collect ascites from them, while from the group that received a single dose of mineral oil the ascites was collected in a smaller number of mice (90.47%). ascites was not collected in 7.42% of all mice; the main cause was they never developed ascites tumors but no solid tumors were observed either. within this percentage, the minority fraction, 9.09%, corresponded to the group 2. the observations performed by personnel familiar with the clinical signs associated with the production of ascites, did not report differences in the behavior and appearance of the mice, related to the hybridoma cell lines that were inoculated, which means that none of these lines was particularly aggressive to the well-being of mice. table 1. distribution of the mice inoculated with hybridoma cell lines and the mice that produced ascites in both groups under study. hybridoma cell lines no. mice injected no. mice collected group 1 group 2 group 1 group 2 cbssncov.2 130 10 124 10 cbssncov.3 100 130 93 126 cbssncov.10 120 50 117 50 cbssrbd-s.1 150 25 120 23 cbssrbd-s.2 50 24 39 24 cbssrbd-s.3 80 20 77 20 group 1: mice were inoculated intraperitoneally with 2x106 cells of each hybridoma suspended in 1 ml of rpmi-1640 medium, 7 days after priming with 0.5 ml of mineral oil. group 2: mice were inoculated simultaneously with the same inoculum of hybridoma cells and 0.5 ml of mineral oil, 18 days after priming with 0.5 ml of mineral oil. the volume of ascites per mouse was calculated by dividing the total volume of ascites harvested by the number of mice collected in each group. the values ranged from 1.38 to 4.90 ml per animal. the independent samples t-test demonstrated that both groups under study were significant different in terms of the volume of ascluj vet j 2021, 26, 3 5 cites per mouse. simultaneous injection of mice with mineral oil and hybridoma cells increased these volumes in all cases with respect to the mice injected with a single dose of mineral oil (figure 1). the mean ascites volume per mouse in this group was 1.75-fold higher than the estimated mean for group 1. fluctuations in the igg concentration quantified in clarified ascites, both within and between groups, were observed (table 2). nevertheless, the analysis of the data from both groups following an independent samples t-test, showed no significant differences in the mean igg concentration in clarified ascites between both groups (t=1.115; p=0.291). in addition, an approximation of the mab mass yield per mouse was also similar, 17.64 mg for group 1 and 16.48 mg for group 2. figure 1. volume of ascites produced per mouse in both groups under study. all mice were primed with 0.5 ml of mineral oil into the abdominal cavity. group 1: seven days after priming, mice were inoculated intraperitoneally with 2x106 cells of each hybridoma suspended in 1 ml of rpmi-1640 medium. group 2: eighteen days after priming, mice were inoculated simultaneously with the same inoculum of hybridoma cells and 0.5 ml of mineral oil. the independent samples t-test showed that the volume of ascites per mouse was significant different between the groups (t= -3.747; p= 0.004). table 2. volume of clarified ascites and resultant quantity of igg from each hybridoma cell line inoculated in both groups of mice. hybridoma cell lines clarified ascites volume (ml) igg in ascites (mg/ml) group 1 group 2 group 1 group 2 cbssncov.2 215 25 9.06 8.56 cbssncov.3 187 280 7.19 9.05 cbssncov.10 300 82 9.95 6.28 cbssrbd-s.1 300 72 2.49 5.81 cbssrbd-s.2 103 72 13.04 3.64 cbssrbd-s.3 265 98 6.83 3.67 group 1: mice were inoculated intraperitoneally with 2x106 cells of each hybridoma suspended in 1 ml of rpmi-1640 medium, 7 days after priming with 0.5 ml of mineral oil. group 2: mice were inoculated simultaneously with the same inoculum of hybridoma cells and 0.5 ml of mineral oil, 18 days after priming with 0.5 ml of mineral oil. 0 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 cbssncov.2 cbssncov.3 cbssncov.10 cbssrbds-1 cbssrbds-2 cbssrbds-3 a sc it es p er m ou se (m l /m ou se ) hybridoma cell lines group 1 group 2 cluj vet j 2021, 26, 3 6 4. discussion in this work we assayed two strategies for production of murine ascites containing anti-sars-cov-2 mabs using balb/c mice. since sensitive techniques have not been developed to measure signs that might indicate the presence of pain or distress [6], one of the most important tasks in the present study was the daily observation of the mice involved, including the examination and palpation of the injection site, the evaluation of abdominal distention and the detection of all possible side effects of the injected mixture. some hybridoma cell lines can produce clinical signs in mice indicating distress, such as anorexia, hunched posture, hypothermia, rapid breathing and decreased activity [6]. but none of the six hybridoma cell lines used in this work caused worrisome adverse effects as a sign of an aggressive cell line, and this was an important ethical advantage. regarding the timing of priming agent administration in relation to the inoculation of the hybridoma cells, it is common practice to perform priming and several days later to inject the hybridoma cell-suspension into the peritoneal cavity of the mouse. this leads to the development of a tumor, the accumulation of ascitic fluid and the abdominal distention [2, 6]. however, it is not usual the simultaneous administration of the hybridoma cells with an additional dose of the priming agent. in the present study, the objective of the second administration of the mineral oil was to increase the throughput in the production of ascites. mineral oil is thought to act by inducing granulomatous inflammation and interfering with peritoneal lymphatic drainage, thus increasing the volume of ascites produced [7]. we consider that the purpose was achieved because it was possible almost to double the volume of ascites per mouse in the group that received the second injection of mineral oil. this procedure could cause animal distress, but it did not occur in the mice included in this work. some authors have evaluated the effects of priming agent injection on mouse well-being and ascites production, using parameters related with the mouse activity and food and water consumption [8]. in our study, the observation of mice at least twice a day by qualified personnel, did not inform significant evidences of distress or pain in the animals, since they maintained their normal activities and external appearance until the second tap. the volume of ascitic fluid did not cause gross abdominal distention even when a double volume of the priming agent was administered; moreover, the abdominal tap was done before fluid accumulation became excessive and distressful, following the recommendations that it not exceed 20% of the baseline body weight of the mouse [6]. ascites yields can be improved also by performing several harvests; nevertheless, the well-being of mice must be strictly observed. the number of taps should be restricted according to animal welfare and characteristics of the hybridoma being used. some hybridomas seem to cause little distress and various taps could be permissible [9], but the prolongation of tapping time increases the pathological abnormalities in the mice due to solid tumor growth within the peritoneal cavity and the accumulation of ascites [10]. various guidelines and reports have required that the abdomen may be tapped no more than twice before the mouse is euthanized for final harvest of ascites [2, 8, 11]. the present study was careful with this aspect, since ascites pressure was relieved before abdominal distention was great enough to cause discomfort or disturb the normal activity of the animals, and only two taps were performed to obtain ascites, despite the fact that the hybridomas inoculated did not cause adverse effects in mice. a crucial finding was that there were no significant differences in the concentration of igg in ascites and in the mass yield of mab per mouse between the groups analyzed. according to these results, in order to obtain a greater mass of mab, the strategy applied in the group of mice that significantly increased the volume of ascites fluid per mouse must be taken into account: the simultaneous injection of hybridoma cells and mineral oil eighteen days after priming. furthermore, the lowest percentage of mice that never developed ascites tumors was found in this group. consequently, this strategy could allow the usage of fewer animals for the production of ascites. it is clear that the number of mice to be used will be determined by the total amount of mabs needed [10]; but, certainly, the reduction of the amount of animals required for the mabs production offers important ethical and economic advantages. medium-scale production of mabs is demanded to make 0.1-1.0 g quantities for diagnostic or developing assays [3]. applying the strategy used in group 2 it was possible to produce more quantities than 1.0 g of each mab. for example, mice included in this group produced approximately 4.0 g of cbssncov.3 and more than 1.0 g of cbssncov.10. both mabs are being used in the elisa developed in our country for the diagnosis of sars-cov-2 by detecting viral antigen, and they are constantly demanded for immediate diagnosis as urgent necessity of current epidemiological scenario. therefore, with the simultaneous injection of hybridoma cells and mineral oil in previously primed mice, it is possible to guarantee the production of required quantities of both mabs with a minimum number of animals involved. cluj vet j 2021, 26, 3 7 the mabs against the rbd of the sars-cov-2 spike protein (cbssrbd-s.1, cbssrbd-s.2 and cbssrbd-s.3) could play an important role in subunit vaccines development. for this reason, it is necessary to optimize all the productive stages to ensure the availability of these mabs for future assays, and this work also contributes to this. 5. conclusions the double administration of mineral oil, for priming and for the inoculation of hybridoma cells, does not produce additional stress in the mice. none of the six anti-sars-cov-2 mab-secreting hybridoma cell lines, which were injected to mice, are harmful to the animal well-being. the simultaneous inoculation of the hybridoma cells with the mineral oil to the primed mice improves the efficiency of ascites tumor formation and significantly increases the volume of ascites per mouse. this inoculation strategy will optimize the production of ascites with anti-sars-cov-2 mabs, involving fewer animals, which translates into ethical and economic benefits. author contributions: conceptualization, j.j.p.p. and m.p.b; methodology, j.j.p.p., r.b., d.d., a.d., c.t., r.p., j.d. and i.p.; validation, s.p.; formal analysis, c.h.; writing—original draft preparation, m.p.b. and j.j.p.p.; writing—review and editing, r.b., a.d., d.d. and m.p.b.; supervision, r.b. and e.p. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding. conflicts of interest: the authors declare no conflict of interest. references 1. mattioli, i.a.; hassan, a.; oliveira, o.n.; crespilho, f.n. on the challenges for the diagnosis of sars-cov-2 based on a review of current methodologies. acs sens. 2020, 5(12), 3655–3677, doi.org/10.1021/acssensors.0c01382. 2. clark, a.; befus, d.; o'hashi, p.; hart, f.; schunk, m.; fletch, a.; griffin, g. guidelines on: antibody production. canadian council on animal care, 2002. 3. bonistalli, k.n. monoclonal antibody production: a comparison of in vitro and in vivo methods and their use in clostridial vaccine manufacture. master of science thesis in veterinary medicine, institute of veterinary, animal and biomedical sciences, massey university, new zealand, 2013. 4. nessa, m.u.; rahman, m.a.; kabir, y. plant-produced monoclonal antibody as immunotherapy for cancer. biomed res. int. 2020, 3038564, doi.org/10.1155/2020/3038564. 5. chiarella, p.; fazio, v.m. mouse monoclonal antibodies in biological research: strategies for high-throughput production. biotechnol. lett. 2008, 30(8), 1303-1310, doi.org/10.1007/s10529-008-9706-5. 6. ward, p.; adams, j.; faustman, d.; gebhart, g.; geistfeld, j.; imbaratto, j.; peterson, n.; quimby, f.; marshak-rothstein, a.; rowan, a.; scharff, m. monoclonal antibody production. institute for laboratory animal research. national research council. national academy press washington, usa, 1999. 7. amyx, h.l. control of animal pain and distress in antibody production and infectious disease studies. j. am. vet. med. assoc. 1987, 191, 1287-1289. 8. jackson, l.r.; trudel, l.j.; fox, j.g.; lipman, n.s. monoclonal antibody production in murine ascites: i. clinical and pathological features. lab. anim. sci. 1999, 49, 70-80. 9. mendoza, o.; valdés, r.; gonzález, m.; alemán, r.; álvarez, t.; padilla, s.; tamayo, a.; reyes, b.; geada, d.; fernández, e.; fuentes, d.; hernández, o.; zuasnabar, l. influence of the number of animals on the production of monoclonal antibody cb.hep-1 by the ascites method. biotecnol. apl. 2009, 26(2), 133-137. 10. peterson, n.c. behavioral, clinical, and physiological analysis of mice used for ascites monoclonal antibody production. comp. med. 2000, 50(5), 516-526. 11. institutional animal care and use committee (iacuc), uta monoclonal antibodies/mouse ascites sop (v1.0) university of texas at arlington, usa, 2016. microsoft word cvj_1_8_melega_2612021.docx cluj vet j 2021, vol, issue http://clujveterinaryjournal.ro article evaluation of blood electrolyte alterations in cats during elective laparoscopic ovariectomy iulia melega1*, lucia victoria bel1, cosmina andreea dejescu1, mădălina florina dragomir1, bogdan sevastre1, liviu ioan oana1, cosmin petru peștean1† 1 university of agricultural sciences and veterinary medicine of cluj-napoca, romania * correspondence: iulia.melega@usamvcluj.ro † same contribution as the first author abstract: in a clinical setting, we tested the hypothesis of whether hypercapnia developed during carbon dioxide pneumoperitoneum is associated with changes in blood electrolytes. this prospective study involved ten female cats that underwent elective laparoscopic ovariectomy. venous blood samples for assessment of electrolytes were collected in the following sequence: t1before anaesthesia induction, t2 10 minutes after anaesthesia induction, t3 30 minutes of pneumoperitoneum and t4 at the end of pneumoperitoneum. statistical analysis revealed ab disturbances associated with general anaesthesia and pneumoperitoneum, manifested with decreased blood ph, whereas blood pvco2, po2 and be were increased. a constant increase of k+ concentration was recorded in all animals during pneumoperitoneum (p<0.05), whereas img registered a significant increase only at t3 (p<0.05). correlations were recorded between blood ph and na+, ica, img, as well as between na+ and cl¯ at different time points during anaesthesia. no correlations were noted between ph and k+ or pvco2 and k+. in conclusion, electrolyte imbalance represents a possible complication associated with laparoscopic surgery in healthy cats. however, further studies should investigate the causes involved in k+ concentration elevation. keywords: hyperkalemia, pneumoperitoneum, laparoscopy, feline 1. introduction ovariectomy is the most common abdominal laparoscopic surgical procedure performed in small animals, which has gained popularity during the last decade [3]. the essential characteristic of laparoscopic surgery is represented by carbon dioxide (co2) insufflation inside the peritoneal cavity, to achieve surgical view and working space [8]. it has been postulated that these procedures are associated with lower morbidity, expedited recovery time and reduced postoperative pain. however, the pneumoperitoneum leads to increased abdominal pressure, which can further develop significant cardiovascular and respiratory changes, which represent a potential life-threatening condition [27][15]. acid, base and electrolyte alterations are typically observed in the perioperative period, and are related to underlying conditions but may be also iatrogenic. general anaesthetics, intraoperative excessive tissue handling, the nature of fluids infused and metabolic derangements, have all been demonstrated to possess risks of inducing severe electrolyte imbalance [20]. in animal studies, laparoscopic surgery has been associated with alterations of acid-base (ab) metabolism as a manifestation of respiratory acidosis. gas insufflation into the abdominal cavity highly affects respiratory mechanics through a reduced lung volume due to diaphragmatic limited excursions, diminished functional residual capacity and respiratory compliance [15]. altogether, these factors can affect received: 17.08.2021 accepted: 30.08.2021 published: 09.09.2021 doi: 10.52331/cvj.v26i2.26 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses/by/4.0/). cluj vet j 2021, 26, 2 2 the lung compensatory mechanism of ab balance regulation, resulting in hypercapnia [22]. moreover, the diffusion of peritoneal co2 into the bloodstream increases further the concentration of co2 (paco2). this increase will ultimately lead to blood ph changes toward acidosis [28]. for optimal functioning of the cells, relative constancy of the body’s ph is essential because metabolism requires enzymes that operate at fairly narrow limits of ph. electrolytes represent cofactors in enzymatically maintained metabolic reactions, playing vital roles in cellular function, tissue perfusion and ab balance [22]. any changes of ph could disrupt cell metabolism and consequently body function. several studies showing the cardiopulmonary changes due to co2 induced pneumoperitoneum have been reported previously in domestic cats, but such data regarding electrolytes homeostasis is lacking from the literature. therefore, the objective of this study was to analyse selected electrolyte alterations in healthy feline patients undergoing laparoscopic ovariectomy, using an in-house blood gas analyser. based on our current understandings, it was hypothesized that ab imbalance developed during laparoscopic surgery, even for a short period, can affect electrolyte balance. 2. materials and methods in this prospective study, cats were enrolled for elective laparoscopic ovariectomy. exclusion criteria included evidence of pregnancy and other abnormalities found on the physical examination. surgical procedures were realized with the owner consent and the study was approved by the comity for bioethics and research ethics of university of agricultural sciences and veterinary medicine cluj-napoca (aut. no 211 from 27.05.2020). all video-assisted ovariectomies were performed by the same surgeon. food was withheld one night before surgery. the anaesthesia protocol for each feline patient consisted of premedication with 20 mcg/kg of buprenorphine (buprecare 0.3 mg/ml, recipharm monts, uk) and 10 mcg/kg of medetomidine (domitor 1 mg/kg, orion corporation, finland) by intramuscular administration. general anaesthesia was achieved by intravenous administration of 0.25 mg/kg diazepam (diazepam 5 mg/ml, sun pharma company, romania) and 3 mg/kg ketamine (narkamon bio 100 mg/ml, bioveta, czech republic), and maintained with 1.5% isoflurane (isoflutek 1000mg/g, laboratorios karizoo, spain) in 100% oxygen (1 l/min), using a rebreathing anaesthesia circuit (dräger medical, germany). all animals received mechanical ventilation with a dräger fabius plus xl anaesthetic machine (dräger, germany). ventilator parameters were adjusted to deliver a tidal volume of 8-10 ml/kg at a respiratory rate to maintain an endtidal carbon dioxide tension (etco2) below 60 mmhg. fluid therapy with nacl 0.9 % solution (nacl 0.9% b braun, germany) was administered at a rate of 5 ml/kg/hour. a bolus of 6% hydroxyethylstarch (6% hemohes 200/0.5, b braun, germany) of 2 ml/kg was administered over 2 min for patients with mean arterial pressure (map)<60 mmhg. upon completion of the procedure, the animals were placed in a recovery box. meloxicam (melovem 5mg/ml, dopharma, romania) 0.2 mg/kg subcutaneously was administered for complete analgesia. monitoring of anaesthesia during the study was performed by use of a multiparameter monitor (vista 120, dräger, germany) and included electrocardiography (ecg) using a lead ii configuration, puls-oxymetry (spo2), body temperature and non-invasive blood pressure. a small volume of approximately 1 ml of the venous blood sample was collected using a 2 ml pre-heparinized syringe (luer slip blood gas sampling system, numbrecht germany) from the jugular vein and analysed using a point-of-care blood gas analyser (stat profile prime plus® vet critical care analyzer, nova biomedical). the blood was evaluated for ph, pvco2 (partial pressure of carbon dioxide), po2 (partial pressure of oxygen), blood concentrations of sodium (na+), potassium (k+), ionized calcium (ica), ionized magnesium (img), chloride (cl-), glucose (glu), base excess (be), haematocrit (ht) and haemoglobin (hb), all parameters being integrated into the analyser panel. the measurements were performed after premedication (t1, baseline values), 10 minutes after induction of anaesthesia (t2, control), 30 minutes after the start of pneumoperitoneum (t3) and at the end of pneumoperitoneum (t4). a standard surgical procedure using a two-port approach was performed by the same surgeon. insufflation pressure of co2 was limited to 6mmhg, consistent with previous clinical reports [25] cluj vet j 2021, 26, 2 3 3. statistical analysis all data are reported as the mean ± sd. to assume gaussian distribution normality distribution was checked by shapiro-wilk normally test. one-way analysis of variance anova, followed by post hoc tukey’s range test procedure was done for pair-wise comparisons and pearson test analyzed the correlation between normally distributed values. pearson’s correlation was used to assess the correlation between normally distributed variables; the interpretation was done according to colton scale. statistical significance was at p<0.05 (95% confidence interval). statistical values and figures were obtained using graphpad prism version 5.0 for windows, graphpad software, san diego california usa.3.1. subsection 4. results measurement of electrolytes was successfully performed in ten healthy cats, american society of anaesthesiologists status 1, with a mean age of 14.4 months (range 6-48 months, standard deviation (sd) ±12.92) and body weight 2.64 kg (2.2-3.3 kg ±0.35). all animals recovered uneventfully. temporal changes were examined by comparing data with baseline and control values. total mean anaesthesia time was 116.17 ± 43.72 min (range 80-210 min) of which pneumoperitoneum was 67.89 ±18.89 min (56-119 min). premedication induced emesis in one cat. rescue analgesia was necessary for 6 animals. four animals required one bolus of 6% hes for hypotension correction (map <60 mmhg). the hemodynamic variables and body temperature (bt) are listed in table 1. there was no difference in map over the study. the heart rate (hr) showed an increase after the beginning of pneumoperitoneum (p<0.05; table 1), and the bt was lower at t2, t3 and t4 compared with baseline values. table 1. values of physiologic parameters in cats during laparoscopy surgery parameter t1 mean ± sd (range) t2 mean ± sd (range) t3 mean ± sd (range) t4 mean ± sd (range) hr (bpm) 126 ± 10.96 (105-40) 119.89 ± 10.77 (107-138) 137.22 ±18.4 (98-167) 133 ±19.55 (107-162) rr (breaths) 22.78 ±10.96 (13-34) 15.89 ±3 (12-22) 17.4 ± 2.22 (14-20) 17.56 ± 4.81 (12-27) map (mmhg) 75.11 ± 19.06 (55-112) 82.33 ± 12.65 (65-110) 74.78 ± 11.96 (65-105) bt (0c) 38.56 ± 0.54 (37.6-39.3) 37.46 ± 0.85 (35.9-39) 36.96 ± 0.24 (36.5-37.2) 37.66 ± 0.65 (36.9-38.6) spo2 (%) 98.5 ± 1.81 (94-100) 98 ± 1.06 (97-100) 98.7 ± 1.21 (96-100) hr indicates heart rate; bpm, beats per minute; rr, respiratory rate; map, mean arterial pressure; bt, body temperature; spo2, oxygen saturation; sd, standard deviation. the results of mean k+ concentration indicated a significant time effect, suggesting k+ levels change in time. during the anaesthesia, k+ increased from 3.75±0.56 mmol/l at t1 to 5.86±0.98 mmol/l at t4. ionized magnesium concentration did not have a significant alteration, except at t3, which was considered higher than the value of t1. there were no significant changes in other electrolytes. electrolyte trends with time are presented graphically in fig.1. cluj vet j 2021, 26, 2 4 the ab values showed variations in pneumoperitoneum patients as regard to blood ph which was significantly lower at t3 (p<0.05) compared with t1 and t2, increasing again by the end of surgery (fig.2). pvco2 and po2 were almost two-fold increased at t2 and t3 as compared to t1 (p<0.05), while in t4 their level exhibited a decreasing trend. mean be level registered a significant elevation after induction of anaesthesia (p <0.05), this trend persisting throughout the surgery. negative correlations were registered between ph and na (p<0.05; pearson’s coefficient -0.74), ica (p<0.001, pearson’s coefficient -0.95) and img (p<0.01, pearson’s coefficient -0.86) at t3. there was no significant correlation between pvco2 and k+ or ph and k+ in any time point during pneumoperitoneum. no correlation was identified between surgical time and k+ level either. as regard the blood glucose level, a significant increase occurred at t2 (p<0.05), persisting beyond baseline values until the end of surgery (fig.2). figure 1. effect of laparoscopic ovariectomy on blood electrolytes and glucose level. a – potassium evolution, b – sodium evolution, c – ionised magnesium evolution, d – ionised calcium evolution, e – chloride evolution, f – glucose evolution. (mean ± sd) (n = 9) (a = p<0.05 as compared to t1) (t1= pre-induction, t2= control, t3= 30 min of pneumoperitoneum, t4= the end of pneumoperitoneum) cluj vet j 2021, 26, 2 5 figure 2. effects of laparoscopic ovariectomy on blood ab values. a – ph evolution, b – pvco2 evolution, c – po2 evolution, d – be evolution. (mean ± sd) (n = 9) (a = p<0.05 as compared to t1) (t1 = pre-induction, t2 = control, t3= 30 min of pneumoperitoneum, t4= the end of pneumoperitoneum) 4. discussion pressure insufflation of co2 inside the peritoneal cavity for laparoscopic surgery leads to undesirable conditions by causing modifications in respiratory, hemodynamic and ab balance [15]. in this study, changes in electrolytes in cats undergoing elective laparoscopic ovariectomy were evaluated. our data suggests that some significant changes, although mostly transient, are evident. however, none of the changes of these parameters was of a magnitude likely to have clinical importance, at least not in healthy cats. blood analysis was performed from jugular blood collected by through venipuncture. studies on feline ab values reported significant differences between venous and arterial samples [28], showing that arterial blood is indispensable for evaluating ab status, oxygenations and ventilation, but not for electrolyte imbalances. the purpose of the present report was to analyse the evolution of selected electrolytes in anesthetized cats; therefore, venous blood was preferred over arterial. the most important electrolyte modification observed was the progressive increase in k+ concentration. these findings corroborate with those of previous studies evaluating the effect of co2 peritoneal insufflation effect on k+ homeostasis. pearson et al. showed that following prolong insufflation of co2 into the peritoneal cavity in pigs, the k+ concentration increased over time [16]. similar findings were registered by demiroluk et al. and singh et al. in human patients undergoing laparoscopic abdominal interventions [5] [24]. likewise, al-badrany et al, in the experimental induced pneumoperitoneum study on dogs, showed a positive correlation between k+ and abdominal pressure [1]. reilly et al. while assessing biochemical and electrolyte alterations in captive tigers during laparoscopic ovariectomy, observed a similar increase over time in all animals, one tiger developing hyperkalaemia associated with ecg modifications [21]. the changes in potassium concentration in the current study were without clinical expression; nonetheless, these alterations might be relevant in critically ill feline patients at risk for hyperkalaemia. concerning ica concentration, the modifications partially corroborate findings from one previous study in dogs [1]. ionized calcium concentration showed a tendency to increase in time, without a significant difference from baseline values. these results were contradictory with the study conducted by reilly et al. on anaesthetized tigers in which the plasma calcium showed a significant decrease over the course of anaesthesia [21]. likewise, garg et al. related hypocalcaemia in a human patient during laparoscopic repair of a diaphragmatic hernia [10]. cluj vet j 2021, 26, 2 6 however, in their report, the ica imbalance was attributed to fat tissue handling and necrosis, due to calcium binding to adipose tissue. there were no changes registered in cl¯ and na+ concentrations in the present study. one study reported a change towards hyponatremia in dogs, but without significance, in response to hemodynamic instability [1]. as regard to img level, the findings were compatible with the study carried out by kohler et al. in which was demonstrated that mobilization of magnesium from body tissues takes place if body ph is altered [14]. in our current investigation, the factors influencing the electrolyte balance varied during the anaesthesia. in the literature, modifications of blood ph and pvco2 have been suggested as causes to induce electrolyte imbalances [7], [22]. after induction of anaesthesia, there was an increase in the mean pvco2 concentration compared with baseline with significant value, attributable to anaesthesia drugs’ specific respiratory depressive effects [11]. once pneumoperitoneum started, there was a non-significant increase in the pvco2. during laparoscopy, hypercarbia results from co2 absorption through the peritoneal cavity into bloodstream and decreased alveolar ventilation [29]. as already demonstrated in previous studies, the increase in pvco2 was negatively correlated with a decrease in blood ph. acidosis was a consistent finding during abdominal insufflation with co2. if we compare the means of venous blood ph at pre-induction and during the surgery, there were significant differences during pneumoperitoneum. in response to the acute respiratory acidosis developed, there was a significant difference at be levels relative to that at the pre-induction time, suggesting a respiratory factor as the cause of the decrease of ph during the surgical intervention. clinical studies sustain a linear relationship between hypercapnia and hyperkalaemia [12]. during acidosis, the movement of k+ from intracellular space outwards occurs as a result of reduced na+, k+-atpase activity, with hydrogen entering in exchange of k+ [7]. contrary to the aforementioned papers, the authors of this study could not identify any correlation between ph or pvco2 evolution and hyperkalaemia. these findings coincided with the report of weinberg et al. on human patients with experimental induced hypercapnia [31]. in this context, it could be suggested that the significant hyperkalaemia in this trial reflects a combination of the effects of extracellular k+ shift due to acidosis and insulin deficiency and an assumptive decrease in renal perfusion. administration of medetomidine in the present study caused a significant increase in glucose level in all patients, as a consequence of its mechanism of action by insulin inhibition [13]. insulin deficiency plays an important role in the net efflux of k+ from the cell, as frequently seen in diabetic patients [7]. in the study by rilley et al. on electrolyte alterations in non-domestic felids, hypoinsulinemia coincided with hyperglycaemia and induced clinically important hyperkalaemia in one anesthetised tiger. this finding was in accordance with our results; however, hyperkalaemia has been shown to be a complication frequently associated with administration of alpha 2 adrenergic agonists in large felids [26]. kidneys play an esential role in ab and electrolyte balance. temporary reversible oliguria during pneumoperitoneum has been observed in clinical and experimental studies as a consequence of low renal perfusion [19]. this side effect could have been associated to a diminished k+ excretion; however, in our study, urine output was not monitored. pearson and sander, in their experimental study performed in pigs, concluded that long duration pneumoperitoneum can lead to clinically important hyperkalemia [16]. in our study, the average time of pneumoperitoneum was 68 min, with a wide range of 56 and 119 min. there was a significant increase in k+ value at a peritoneal pressure maintained stable at 8 mmhg, although no relationship between the time of pneumoperitoneum and potassium concentration was found. on the other hand, the ica and img evolution were negatively correlated with ph evolution. both calcium and magnesium can be found in circulation in different fractions, from which the ionized form usually reflects the true status in case of ab disturbances [2] [23]. clinical and laboratory researches have already demonstrated the ph influence on ica concentration, suggesting a magnitude of 0.05 mmol/l for every 0.1 ph change [17]. similarly, in the study by wang et al. (2002), ph proved to have a direct effect on magnesium measurement, as a result of a weak binding to plasma protein in a more acidic environment [30]. in the current study, this relationship was highlighted by the patient with severe respiratory acidosis seen at min 30 of pneumoperitoneum, in which ica reached the highest value (1.72 mmol/l), at a level considered in cluj vet j 2021, 26, 2 7 veterinary medicine as severe hypercalcemia [4], associated with a concomitant increment of img (0.98 mmol/l). the authors attributed this imbalance to improper ventilation, bg and electrolyte analysis improving after ventilator settings were modified. a negative correlation was recognized at t2 between cl¯ and na+ concentration. the correlation was changed during pneumoperitoneum, the variables moving together in a positive direction. these findings could be attributable to a renal and gastrointestinal response to acute respiratory acidosis. ramadoss et al. demonstrated the renal response manifested through cl¯ excretion with respect to na+ within 30 minutes of acute respiratory acidosis [18]. as a further compensation mechanism, as suggested by feldman and charney, gastrointestinal reabsorption of both electrolytes is initiated [9]. nevertheless, additional research is needed to support this supposition. there are limitations in our study. first, there were no assessments performed after recovery from anesthesia. in addition, a small number of animals was involved in the study and the absence of a control group. the use of control group undergoing open laparotomy procedure would have been of interest in comparatively monitoring electrolyte disturbances. moreover, it would be recommended to further evaluate these findings with different anaesthesia protocols. in summary, the present study demonstrates a significant rise in k+ and img concentrations, not sufficient enough to cause clinical expression, in healthy cats undergoing elective laparoscopic ovariectomy. these changes occurred partially as a consequence of decreased blood ph and hypercarbia, and were associated with general anaesthesia, co2 gas diffusion and increased intraperitoneal pressure. however, further studies should investigate other possible causes of k+ concentration increase, as this parameter had the most significant alterations. the possibility of hyperkalemia has to be considered in all patients undergoing laparoscopic surgery, possessing a real challenge to anaesthetists. therefore, monitoring of electrolytes may be important for increased safety during laparoscopic surgeries, particularly in patients with risk factors. author contributions: im, cp, lb and cad initiated the study and designed the experiments. im and md contributed with data collection. data management was done by im, cp and sb. data analyses and preparation of was done primarily by sb, with contributions from im. im, cp and lb drafted the manuscript. lo critically revised the manuscript. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding. conflicts of interest: the authors declare no conflict of interest. references 1. al-badrany, m.s., kalo, m.s., al-anaaz m.t. hematological and gas analyzer with acid base balance of pneumoperitoneum in dogs exposed to laparoscopy. ijerste 2014, 3, 90-96. 2. bateman s.: disorders of magnesium: magnesium deficit and excess. in: fluid, electrolyte and acid-base disorders in small animal practice, 4th ed.; dibartola s.p. eds; saunders, philadelphia, usa, 2006, pp. 212. 3. buote n.j.: laparoscopic ovariectomy and ovariohysterectomy. in: small animal laparoscopy and thoracoscopy, 1st ed.; fransson, b.a., mayhwe, p.a., wiley blackwell, iowa 2015, pp. 207. 4. coady, m., fletcher, d.j., goggs, r. severity of ionized hypercalcemia and hypocalcemia is associated with etiology in dogs and cats, front vet sci, 2019, 6, pp. 276. 5. demiroluk, s., salihoglu, z., bozkurt, p., hayirlioglu, m., mose, m.: effect of pneumoperitoneum on the level of plasma potassium. middle east j anaesthesiol 2007, 19, 61-70. 6. dibartola, s.p.: introduction to acid-base disorders. in: fluid, electrolyte and acid-base disorders in small animal practice, 4th ed.; dibartola s.p. eds, saunders, missouri, usa, 2012, pp. 231-252. 7. dibartola s.p., de morais h.a.: disorders of potassium: hypokalemia and hyperkalemia. in: fluid, electrolyte, and acid-base disorders in small animal practice, 4th ed.; dibartola s.p. eds., saunders, missouri, usa, 2012, pp. 92-119. 8. dupre g.: laparoscopic access techniques. in: small animal laparoscopy and thoracoscopy, 1st ed.; fransson b.a., mayhew p.a. eds., wiley blackwell, iowa, usa, 2015, pp. 81-86. cluj vet j 2021, 26, 2 8 9. feldman g.m. and charney a.n.: effect of acute respiratory alkalosis and acidosis on intestinal ion transport in vivo. amer j of physiol 1982, 242, pp. 486-489. 10. garg, r., punj, j., pandey, j., darlong, v. delayed recovery due to exaggerated acid, base and electrolyte imbalance in prolonged laparoscopic repair of diaphragmatic hernia. saudi j anaesth. 2011, 5, pp. 79–81. 11. golden, a.l., bright, j.m., daniel, g.b. cardiovascular effects of the α2-adrenergic receptor agonist medetomidine in clinically normal cats anesthetized with isoflurane. ajvr; 1998, 59, pp. 509–513. 12. hassan h., gjessing j., tomlin j.: hypercapnia and hyperkalaemia; anaesthesia, 1979, 34, pp. 897-889. 13. kanda t., hikasa, y.: neurohormonal and metabolic effects of medetomidine compared with xylazine in healthy cats; can j vet res 2008, 72, pp. 278–286. 14. kohler, e., noack, e., strobach, h., wirth k. effect of respiratory acidosis on heart and circulation in cats, pigs, dogs and rabbits; res exp med (berlin) 1972, 158, pp. 308-320. 15. mama k., de rezende l.m.: anesthesia management of dogs and cats for laparoscopy. in: small animal laparoscopy and thoracoscopy, 1st ed.; fransson b.a., mayhew p.a. eds., wiley blackwell, iowa, usa, 2015, pp. 75-79. 16. pearson m.r., sander m.l.: hyperkalaemia associated with prolonged insufflation of carbon dioxide into the peritoneal cavity. br j anaesth 1994, 72, pp. 602-4. 17. rajini, t.s., prudhvi, k., kumar, p.n., sravani, n.s., tejaswi, n., alekya, b., govardhini, b., rajagopalan, b.: assessment of ionized calcium levels in various acid base disorders in icu patients. int j pharm sci rev res 2018, 49, pp. 60-64. 18. ramadoss j., stewart r.h., cudd t.a.: acute renal response to rapid onset respiratory acidosis. can j physiol pharmacol 2012, 89, pp. 227–231. 19. razvi, h.a., fields, d., vargas, j.c., vaughan jr. e.d., vukasin a., sosa r.e. oliguria during laparoscopic surgery: evidence for direct renal parenchymal compression as an etiologic factor. j endourol 1996, 10, pp. 1-4. 20. reddi, a.s.: respiratory acidosis. in: fluid, electrolyte and acid-base disorders, clinical evaluation and management, 1st ed.; reddi a.s., springer, new york usa, 2014, pp. 410-412. 21. reilly s., seddighi m.r., steeil j.c., sura p., whittemore j.c., gompf r.e., ramsay e.c.: selected clinical, biochemical, and electrolyte alterations in anesthetized captive tigers (panthera tigris) and lions (panthera leo). j zoo wildl med 2014, 45, pp. 328–334. 22. robinson, n.e. acid-base homeostasis. in: cunningham’s textbook of veterinary physiology, 5th ed.; klein b.g., saunders, virginia, usa, 2013, pp. 549. 23. schenck, p.a., chew, d.j., nagode, l.a., rosol, t.j.: disorders of calcium: hypercalcemia and hypocalcemia in: fluid, electrolyte and acid-base disorders in small animal practice, 4th ed.; dibartola s.p., saunders, missouri, usa, 2006, pp. 121. 24. singh, j., singha, d., verma, r.k., sodhi, s.s., bhandari, s., thakur, a.: estimation of serum potassium in patients undergoing laparoscopic cholecystectomy. aimdr 2016, 2, pp. 15-20. 25. shih, a.c., case j.c., coisman, j.g., isaza, n.m., amora-junior, d., maisenbacher, h.b.: cardiopulmonary effects of laparoscopic ovariectomy of variable duration in cats. vet surg 2015, 44, pp. 2-6. 26. steeil j., ramsay e.c., schumacher j., marin m., mosley c., reilly s., seddighi m.r.: hyperkalemia in exotic felids anesthetized with an alpha 2 adrenoceptor agonist, ketamine, and isoflurane. proceedings annual conference aaz 2013. 27. sümpelmann, r., schuerholz, t., marx, g., härtel, d., hecker, h., ure, bm., jesch, m.k.: haemodynamic, acid–base and blood volume changes during prolonged low pressure pneumoperitoneum in rabbits. br j anaesth., 2006, 96, pp. 563–568. 28. tamura, j., itami, t., ishizuka, t., fukui, s., miyoshi, k., sano, t., yamashita, k. central venous blood gas and acid-base status in conscious dogs and cats. j vet med sci, 2015, 77, pp. 865–869. 29. veekash, g., wei, l.x., su, m. carbon dioxide pneumoperitoneum, physiologic changes and anesthetic concerns, ambulatory surgery 2010, 16, pp. 41-46. 30. wang, s., mcdonnell, e., sedor, f.a., toffaletti, j.g.: ph effects on measurements of ionized calcium and ionized magnesium in blood. arch pathol lab med 2002, 126, pp. 947-950. 31. weinberg, l., russell, a., mackley, l., dunnachie, c., meyerov, j., tan, c., li m., hu, r., karalapillai, d. relationship between acute hypercarbia and hyperkalaemia during surgery. world j clin cases 2019, 7, pp. 3711-3717. type of the paper (article cluj vet j 2022, 27, 2 http://clujveterinaryjournal.ro article histopathological and macroscopical considerations of induced experimental periodontitis in rats mureșan ștefana1 , dreancă alexandra1*, andras nagy1, repciuc călin1, purdoiu robert cristian1 , alexandru raul pop1, pantea stelian2 and oana liviu1, 1 university of agricultural sciences and veterinary medicine, calea mănăștur no 3-5, 400372, cluj-napoca, românia stefanamuresan@gmail.com; alexandra.dreanca@usamvcluj.ro; andras.nagy@usamvcluj.ro; calincosmin.repciuc@usamvcluj.ro; robert.purdoiu@usamvcluj.ro; alexandru.pop@usamvcluj.ro; oanaliviu2008@yahoo.com 2 university of oradea, universității street, no 1, 410087 oradea, românia * correspondence: alexandra.dreanca@usamvcluj.ro abstract: ten wistar male rats were used to induce experimental periodontitis by placing a 5-0 cotton thread ligature at the base of the first superior molar on the left side. before this phase, the molar went through the process of scaling, rooting and planning. soft movements of the molar were realized for creating an accumulation of plaque by flattening and resulting in the displacement of the gingival tissue, thus provoking an inflammatory response. after seven days, the ligatures were removed in all ten rats. after 14 days, results obtained showed gross aspects of periodontitis and microscopical lesions as well, installed in the periodontium. in addition, an inflammatory response with bone necrosis and alveolar bone loss was observed microscopically. this study aims to test an experimental protocol of periodontitis confirming the presence of this pathology by gross aspects and histopathological aspects. in conclusion, the tested procedure can provide all the critical biological elements in periodontal disease, representing good features for the biomaterial testing domain. keywords: chronic inflammation; dental ligature; bone necrosis. 1. introduction many investigations have been done in the last years trying to search for an appropriate and efficient treatment for periodontal disease, and all the ways of therapy were very developed. periodontitis is spread worldwide and can affect a significant majority of both human and animal populations, so pathology needed to be experimentally induced in some species in order to assess all the factors involved in its development accurately and also to be able to test the effectiveness of different methods of therapy, some being experimental or ongoing implementation. therefore, this experimental study was implemented to test a novel therapy represented by a hydrogel enriched with a photosensitizer and natural essential oils extract (i.e., oregano, frankincense and thieves blend) that could potentially treat and reverse the associated clinical and pathological symptoms. as a general definition, periodontitis is an inflammatory chronic infectious oral disease caused by specific pathogen agents which lead to the destruction of supporting tissue that supports the teeth; respectively, it causes the loss of the periodontal ligament and, in the end, the loss of the alveolar bone. clinically this pathology causes symptoms such as gum bleeding, dental laxity and plaque on teeth and could also develop a local inflammation as gingivitis [1,2] all these symptoms are considered to result from the response of a capable host to exist as a microbial biofilm represented by bacterial pathogens [3]. serum levels of inflammatory cytokines, such as interleukin-1beta (il-1β), interleukin-6 (il-6), and tumor necrosis factor (tnf), are increased in patients with severe chronic periodontitis [1,4]. there is a great variety of pathogens in the composition of the oral bacterial flora from one subject to another, depending on the species, the age and the cleaning possibilities, as well as the received: 18.10.2022 accepted: 07.11.2022 published: 15.11.2022 doi: 10.52331/cvj.v27i2.41 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses/by/4.0/). mailto:stefanamuresan@gmail.com mailto:alexandra.dreanca@usamvcluj.ro mailto:andras.nagy@usamvcluj.ro mailto:calin-cosmin.repciuc@usamvcluj.ro mailto:calin-cosmin.repciuc@usamvcluj.ro mailto:robert.purdoiu@usamvcluj.ro mailto:alexandru.pop@usamvcluj.ro mailto:oanaliviu2008@yahoo.com mailto:oanaliviu2008@yahoo.com https://doi.org/10.52331/cvj.v27i2.41 cluj vet j 2022, 27, 2 7 of 24 fluctuation of the host response to the interaction of bacterial species, are some of the main reasons why the particular etiology of periodontal disease could not be acknowledged [5– 7]. bacteria are known to be the first etiological agent of periodontal disease, and it has been considered that more than 500 different bacterial species are involved, like streptococcus mutans, porphyromonas gingivalis, aggregatibacter actinomycetemcomitans, etc. [8,9]. a big part of the data published on periodontal disease etiology comes from human medicine research[10]. periodontitis in domestic animals is almost identical to that found in humans in terms of progression and clinical presentation [11]. the accelerated rate of evolution of this affection reported in pets compared to humans may be caused by poor oral hygiene and the absence of routine dental care [12]. this pathology can suffer some changes depending on the animal's habitat and the genetic predisposition of each organism [13,14]. the aim of this study is: 1) to test the experimental induction of local inflammatory response in males rats by placing a braided ligature on the first superior molar in order to induce periodontitis lesions; 2) to prove the success of inducing the periodontal disease by histopathological aspects, by the presence of neutrophils, demineralization, necrosis and alveolar bone loss [15]; 3) to test the specific effects of biomaterials as hydrogels, also combined with natural extracts and laser therapy, implementing new ways of alternative therapy in the management of periodontal disease in animals in the following studies; 4) creating the possibility of avoidance of the analgesic medications because of their side effects defined by gastrointestinal affections and the emergence of antibiotic resistance when using an antibacterial medication because all these represent ways of conventional methods of treating periodontitis [2,16,17]. 2. materials and methods ten medium weighted males, wistar rats were used for this experiment. after the clinical exam, consisting of a short evaluation of their general status (i.e., checking the grimace, checking their degree of hydration, checking their appetite, and inspecting their skin), the rats were weighed in order to determine the weight loss that rats may suffer after the step of placing the ligature. the body weight variation was evaluated and monitored every day after the ligature placement for ten consecutive days. this evaluation was realized in order to establish whether there is necessary the implementation of a supportive therapy or adjust this therapy. optimal accommodation habitat was ensured throughout the experiment; the rats were housed in the establishment for breeding and use of laboratory animals of usamv (cluj-napoca, românia) in standard conditions, at a temperature of 22–23 c, humidity 55%, and 12-h light/dark cycle. the rats were kept in plastic cages with free access to standard rodent granular food (cantacuzino institute, bucharest, romania) and freshwater ad libitum. in addition, an extra hyper lipidic diet (cantacuzino institute, bucharest, romania) with a smooth consistency for the first days after the surgery procedure was provided. the rats were allowed to acclimate to the laboratory environment for two weeks. all procedures involving laboratory animals' use followed the european guidelines and rules 337, as established by the eu directive 2010/63/eu and the romanian law 43/2014 and were performed by an experienced practitioner. the study protocol was approved by the research ethics committee of the university of agricultural sciences and veterinary medicine cluj-napoca, romania, and they were authorized by the state veterinary authority (aut. no. 306/24.03.2022). the surgical procedures were performed under the effect of general injectable anesthesia; this was an injectable type for the application of the ligature and was performed by administering the following anesthetic substances: xylazine (xilazin bio 2%; bioveta, czech republic), injectable solution 7,5 mg/kg im and ketamine injectable solution (narkoman bio 10%; bioveta, czech republic), 75 mg/kg im. the experimental protocol for inducing periodontitis consisted of the application of a surgical technique in order to position the 5-0 cotton thread ligature (biosintex; ilfov, romania) at the base of the molar. to extract the ligature, seven days later, the following were administered: midazolam (dormicum 0.1%; f. hoffmann-la roche ltd., switzerland), injectable solution 0.02 mg/kg sc and ketamine, injectable solution 70 mg/kg im. the animals were euthanized three weeks post-induction, according to the procedures recommended by law no. 43/2014, through profound narcosis with isoflurane (isoflutek 1000 mg/g; laboratorios karizoo cluj vet j 2022, 27, 2 8 of 24 s.a., spain). the animal was considered dead at the moment of absence of cardiac and respiratory activity. then the axo-atloid dislocation was performed to ensure the phenomenon's irreversibility if the inducing protocol's side effects significantly weakened the animals; according to the bioethical protocol, they were euthanized before the end of the study period. as we already mentioned, all rats were weighed to have an effective body condition scoring tool for laboratory animal welfare in the first step. the second step involved the application of a 5-0 cotton thread ligature (biosintex; ilfov, romania) at the base of the first left superior molar (fig. 1), previously performing a slight looseness of the gum in the submarginal position and secondary performing a dislocation of the periodontal ligaments (fig. 2). after the ligature placement (fig. 3), the rats were evaluated daily, and a pre-determined quantity of specific food consisting of softer consistency hyper lipidic diet (cantacuzino institute; bucharest, romania) was offered in order to check their post-surgery appetite. figure 3. aspect after the placement of the ligature figure 2. creating the detachment of the gingiva by performing a slight looseness of the gum. figure 1. placing the ligature at the base of the first left upper molar. cluj vet j 2022, 27, 2 9 of 24 in the first two days post-op, a 10% solution of glucose (b braun pharmaceuticals; melsungen;, germania) injection was administered if they did not eat any food. the analgesia was also managed with an injectable solution of tramadol (tramadolum; 50 mg/1 ml krka d.d., slovenia). finally, the third stage took place one week after the ligature was placed, when the rats were anesthetized again with the same anesthetic protocol, and the ligature was removed (fig. 4). figure 4. the aspect of the molar after the ligature was removed this stage was followed by scaling, rooting and planning the affected molar. next, easy and slight movements of the molar were applied to create an accumulation of bacteria by flattening, resulting in the detachment of the gingival tissue with the help of the dental curettes. the movements were repeated ten times by tractioning the molar in all the lateral planes, thus provoking an inflammatory response. one week after removing the ligature, the rats were anesthetized again because the computed tomography analysis was performed with a siemens somatom scope machine (somatom scope, siemens, germany) before euthanasia. the anatomical region of interest contained the maxilla of the rats; the targeted region is represented by the soft tissues around the upper left molar, the attachment tissues of the molar and its corresponding dental alveolus. the molars were scanned axially with a thickness of 1 mm, and the recorded images were saved in dicom (digital imaging and communications in medicine) format on the siemens workstation in the pacs server. the analysis of bone density in order to confirm the successful induction of periodontitis at the level of the upper left molar was carried out with the help of the syngo somaris 5 ct vc 28 program (syngo vc 28; siemens health care sector, forchheim, germany). so the rats were euthanized one week after the ligature was removed, after which the left maxilla was sampled for histopathological analysis to confirm the onset of periodontitis. in addition, gum and bone sampled from the injured site have been submitted for histological examination. after fixation in 10% buffered neutral formalin, the mandibular samples were decalcified using a mix of 1:1 (formic acid and clorhidric acid) for 24 hours and embedded in paraffin. five-micron thickness sections were stained by the hematoxylin-eosin method (he). the slides were examined under a bx51 olympus microscope (olympus life science europa; hamburg, germany), and images were taken with an olympus uc 30 digital camera (olympus life science europa; hamburg, germany) and processed using olympus essential stream software. sections were examined by an independent observer blinded to the experimental protocol. cluj vet j 2022, 27, 2 10 of 24 figure 5. gross aspects of installed periodontitis accumulation of the plaque is present, and also discoloration of the molar is visible after seven days 3. results ten rats were subjected to this procedure after the presentation of the protocol described above. seven days after the experimental protocol, we could see the onset of periodontitis. gingivitis was observed in five subjects, more moderate, in four others more acute, and in one subject, gingivitis was reduced, so dental laxity was recorded in only nine out of ten rats. this evaluation was performed with the help of the clinical scoring of periodontitis, which implies the mobility scoring and the gingival bleeding performed for each individual [19,20]. six of ten rats lost weight, with variations ranging from 25 to 60 g, considered a moderate amount. when the rats lose more than 10% of their body weight, euthanasia is considered because this parameter is considered a pain assessment recommendation. after the euthanasia of all ten rats, a necropsy was performed. grossly, yellowish discoloration of the molar, mobility within the alveolus and gum reactivity have been observed in nine rats (fig. 6). figure 6. gross features of periodontitis after euthanasia, represented by yellowish discoloration, gum retraction and reactivity, mobility within the alveolus cluj vet j 2022, 27, 2 11 of 24 following the histological aspects after the microscopical analysis, the tooth and the periodontal ligament (the periodontium), respectively, the dental alveolar bone, showed a normal appearance for one rat. however, microscopically, lesions such as inflammation, demineralization, thinning, and bone resorption could be seen in nine rats at different stages.a moderate gingival retraction was observed in the cervix of the teeth and the interdental space, and chronic and superficial local gingivitis were completed in eight rats (fig. 7). figure 7. hyperplasia and severe hyperkeratosis of the gingival epithelium, the subepithelial lamina propria is infiltrated with rare mononuclear cells; he staining x20 the superficial part of the inflammatory process is covered by a layer represented by bacterially infected tissue and fodder debris. furthermore, some segmental osteoclastic resorption of the alveolar bone was seen as also suppurative process represented by focal periodontitis extending from the previously described gingival defect (fig. 8). figure 8. chronic suppurative gingivitis, moderate-segmental osteoclastic resorption of the alveolar bone; he staining x10 cluj vet j 2022, 27, 2 12 of 24 on the site of the subgingival region, abundant granulation tissue was seen, which could split the septic point and replace the dental ligament. in addition, hyperplasia and hyperkeratosis of the gingival layer with the organization of the anatomic epithelial papillae, divided by a fibro-vascular inflammatory stroma, moderate-segmental osteoclastic resorption of the alveolar bone tissue and periodontitis were observed. the inflammatory process was expressed by multiple bands and degenerated neutrophils combined with mononuclear cells and reactive fibroblasts (fig. 9). figure 9. granulation tissue, inflammatory infiltrate consisting primarily of neutrophils, rare mononuclear cells and reactive fibroblasts; he staining x20 also, the presence of hyperplasia and hyperkeratosis in the gingival epithelium layer was observed. thus, the production of irregular epithelial papillae, divided by abundant inflammatory granulation tissue with neutrophils first and then macrophages, was observed. furthermore, the superficial gingival area presented a minimal ulcer covered by a cellular layer mixed with cellular debris and nutrients. fig. 9 also represented aspects of inflammatory granulation tissue with invasive degenerated neutrophils mixed with mononuclear cells and reactive fibroblasts. gingival epithelial hyperplasia was also noted with hyperkeratosis and a partial replacement of the dental ligament with fibro-vascular connective tissue. the ct scan showed changes in bone and periodontal tissue (fig. 10) observed in 8 rats. figure 10. ct images consistent with changes in bone and periodontal tissue, bone necrosis, rarefaction and alveolar bone loss cluj vet j 2022, 27, 2 13 of 24 4. discussion the tested procedure can provide all the critical biological factors in periodontal disease, representing good features for the biomaterial testing domain. currently, ligature-induced periodontitis in rats is the primary model used in periodontal research, and alveolar bone loss is the main parameter evaluated by radiographic, morphometric, and histological techniques [22]. because of the positioning of the ligature on the superior molar, as an advantage, there was a better resistance of the ligature during the induction of the periodontitis, also because the saliva is accumulated by the gravity reason on the mandibular sides, not on the maxillary ones. the main problem with the experimental techniques of inducing periodontitis consists in the resistance of the ligature on the molar, which may require another intervention of replacing the ligature or adding an extra ligature placed tight. nevertheless, we succeeded in inducing periodontitis lesions after seven days, demonstrated by gross aspects and microscopical investigations, even if some authors reported that the ligature should be kept in position from 15 to 60 days to induce periodontal destruction [23]. although we did not investigate the specific parameters of inflammation and necrosis by paraclinical investigations, the macroscopical aspects and the clinical signs were enough to prove and confirm the presence of periodontitis. comparative to other techniques described for inducing experimental periodontitis, such as placing a ligature on one of the incisors or on a group of incisors with a ligature on eight, the technique we chose was more stable, more resistant and much safer. also, compared with another method of inducing experimental periodontitis by creating a lesion on the gum and inoculating an extract of specific periodontitis pathogens [24] [25] on the lesion created, the technique we used did not affect the general health and condition of the rats [26]. the body mass is considered a clinical endpoint, especially in periodontal experimental protocols where the prehension capacity of the animal is intensely affected, and the appetite could be poor. other clinical endpoints for laboratory animals are their behavior, reluctance to move, dehydration and pain [18]. alongside food consumption, monitoring these parameters is usually realized once a week and is considered a good practice as part of standard husbandry care [21]. we chose to evaluate and monitor these parameters every day after the ligature placement for ten consecutive days precisely so that we can closely observe the changes that occur during the installation of this pathology. another main aim of this research is to demonstrate in the following studies the effectiveness of regenerative therapy with biomaterials, photosensitizing agents and photodynamic therapy, reversing all the effects of periodontitis induced by the initially placed ligature. 5. conclusions this study showed that placing a cotton or silk thread around the cervical region of the upper left molar causes gingival inflammation, and the first symptoms of periodontitis developed from the seventh day of the experiment onwards. in the present study, it has been demonstrated that experimental periodontitis has general systemic biological implications; poor body conditions, weight loss secondary to loss of prehension and increased oral pain, and the correlation between periodontal disease and general health. this experimental protocol followed the exact surgical steps by performing ligatures, rooting and scaling and demonstrated gross and microscopic lesions. this article has been created to prove all steps necessary to achieve successful experimental periodontitis explicitly. author contributions: conceptualization, s.m, a.d. and r.c.; methodology, a.d and s.m.; software, r.p..; validation, a.d., a.n. and a.r.p.; formal analysis, a.n.; investigation, a.r.p. and s.p.; resources, s.m., a.r.p. and s.p.; data curation, r.p.; writing—original draft preparation, s.m. and a.d.; writing—review and editing, s.m and a.d..; visualization, a.n.; supervision, l.o.; project administration, l.o. all authors have read and agreed to the published version of the manuscript". acknowledgments: this work was supported by the project "the development of advanced and applicative research competencies in the logic of steam + health"/pocu/993/6/13/153310, a project co-financed by the european social fund through the romanian operational programme human capital 2014-2020. conflicts of interest: all procedures involving laboratory animals' use followed the european guidelines and rules 337, as established by the eu directive 2010/63/eu and the romanian law 43/2014 and were performed by an experienced cluj vet j 2022, 27, 2 14 of 24 practitioner. the study protocol was approved by the research ethics committee of the university of agricultural sciences and veterinary medicine cluj-napoca, romania, and they were authorized by the state veterinary authority (aut. no. 306/24.03.2022). references 1. lorencini, m.; silva, j.a.f.; almeida, c.a.; bruni-cardoso, a.; carvalho, h.f.; stach-machado, d.r. a new paradigm in the periodontal disease progression: gingival connective tissue remodeling with simultaneous collagen degradation and fibers thickening. tissue cell 2009, 41, 43–50, doi:10.1016/j.tice.2008.07.001. 2. goyal, g.; garg, t.; rath, g.; goyal, a.k. current nanotechnological strategies for an effective delivery of drugs in treatment of periodontal disease. critical reviews&trade; in therapeutic drug carrier systems 2014, 31, 89–119, doi:10.1615/critrevtherdrugcarriersyst.2014008117. 3. prates, r.a.; yamada, a.m.; suzuki, l.c.; frança, c.m.; cai, s.; mayer, m.p.a.; ribeiro, a.c.; ribeiro, m.s. histomorphometric and microbiological assessment of photodynamic therapy as an adjuvant treatment for periodontitis: a short-term evaluation of inflammatory periodontal conditions and bacterial reduction in a rat model. photomed laser surg 2011, 29, 835, doi:10.1089/pho.2010.2984. 4. struillou, x.; boutigny, h.; soueidan, a.; layrolle, p. experimental animal models in periodontology: a review. open dent j 2010, 4, 37–47, doi:10.2174/1874210601004010037. 5. chen, x.; wu, g.; feng, z.; dong, y.; zhou, w.; li, b.; bai, s.; zhao, y. advanced biomaterials and their potential applications in the treatment of periodontal disease. crit rev biotechnol 2016, 36, 760–775, doi:10.3109/07388551.2015.1035693. 6. dobson, j.; wilson, m. sensitization of oral bacteria in biofilms to killing by light from a low-power laser. arch oral biol 1992, 37, 883–887, doi:10.1016/0003-9969(92)90058-g. 7. graves, d.t.; fine, d.; teng, y.t.a.; van dyke, t.e.; hajishengallis, g. the use of rodent models to investigate host-bacteria interactions related to periodontal diseases. j clin periodontol 2008, 35, 89–105, doi:10.1111/j.1600051x.2007.01172.x. 8. booij-vrieling, h.e.; van der reijden, w.a.; houwers, d.j.; de wit, w.e.a.j.; bosch-tijhof, c.j.; penning, l.c.; van winkelhoff, a.j.; hazewinkel, h.a.w. comparison of periodontal pathogens between cats and their owners. vet microbiol 2010, 144, 147–152, doi:10.1016/j.vetmic.2009.12.046. 9. graves, d.t.; fine, d.; teng, y.t.a.; van dyke, t.e.; hajishengallis, g. the use of rodent models to investigate host–bacteria interactions related to periodontal diseases. j clin periodontol 2008, 35, 89–105, doi:10.1111/j.1600051x.2007.01172.x. 10. maeda, h.; fujii, s.; tomokiyo, a.; wada, n.; akamine, a. periodontal tissue engineering: defining the triad. int j oral maxillofac implants 2013, 28, e461–e471, doi:10.11607/jomi.te26. 11. oz, h.s.; puleo, d.a. animal models for periodontal disease. j biomed biotechnol 2011, 2011, doi:10.1155/2011/754857. 12. garcía-salinas, s.; elizondo-castillo, h.; arruebo, m.; mendoza, g.; irusta, s. evaluation of the antimicrobial activity and cytotoxicity of different components of natural origin present in essential oils. molecules 2018, 23, doi:10.3390/molecules23061399. 13. ripamonti, u.; renton, l. bone morphogenetic proteins and the induction of periodontal tissue regeneration. periodontol 2000 2006, 41, 73–87, doi:10.1111/j.1600-0757.2006.00155.x. 14. andersen, m.l.; winter, l.m.f. animal models in biological and biomedical research experimental and ethical concerns. an acad bras cienc 2019, 91, doi:10.1590/0001-3765201720170238. 15. partata zuza, e.; gouveia garcia, v.; helena theodoro, l.; ervolino, e.; fernando veloso favero, l.; longo, m.; salimon ribeiro, f.; tadeu martins, a.; carlos spolidorio, l.; antônio sampaio zuanon, j.; et al. influence of cluj vet j 2022, 27, 2 15 of 24 obesity on experimental periodontitis in rats: histopathological, histometric and immunohistochemical study., doi:10.1007/s00784-017-2207-y. 16. ausenda, f.; rasperini, g.; acunzo, r.; gorbunkova, a.; pagni, g. new perspectives in the use of biomaterials for periodontal regeneration. materials (basel) 2019, 12, doi:10.3390/ma12132197. 17. charles, c.h.; mostler, k.m.; bartels, l.l.; mankodi, s.m. comparative antiplaque and antigingivitis effectiveness of a chlorhexidine and an essential oil mouthrinse: 6-month clinical trial. j clin periodontol 2004, 31, 878– 884, doi:10.1111/j.1600-051x.2004.00578.x. 18. hickman, d.l.; swan, m. use of a body condition score technique to assess health status in a rat model of polycystic kidney disease available online: https://pubmed.ncbi.nlm.nih.gov/20353688/. 19. dhingra, k.; vandana, k.l. indices for measuring periodontitis: a literature review. int dent j 2011, 61, 76–84, doi:10.1111/j.1875-595x.2011.00018.x. 20. deng, n.; xie, l.; li, y.; lin, h.; luo, r. oxymatrine alleviates periodontitis in rats by inhibiting inflammatory factor secretion and regulating mmps/timp protein expression. acta cir bras 2018, 33, 945–953, doi:10.1590/s0102-865020180110000001. 21. turner, p. v.; pang, d.s.j.; lofgren, j.l.s. a review of pain assessment methods in laboratory rodents. comp med 2019, 69, 451–467, doi:10.30802/aalas-cm-19-000042. 22. katherine vargas-sanchez, p.; goetz moro, m.; andré dos santos, f.; lia anbinder, a.; kreich, e.; mendonça moraes, r.; padilha, l.; kusiak, c.; xavier scomparin, d.; cesar nobre franco, g.; et al. (no title). j appl oral sci 2017, 25, 490–497, doi:10.1590/1678-7757-2016-0517. 23. duarte, p.m.; tezolin, k.r.; figueiredo, l.c.; feres, m.; bastos, m.f. microbial profile of ligature-induced periodontitis in rats. arch oral biol 2010, 55, 142–147, doi:10.1016/j.archoralbio.2009.10.006. 24. aguirre, j.i.; akhter, m.p.; kimmel, d.b.; pingel, j.; xia, x.; williams, a.; jorgensen, m.; edmonds, k.; lee, j.y.; reinhard, m.k.; et al. enhanced alveolar bone loss in a model of non-invasive periodontitis in rice rats. oral dis 2012, 18, 459–468, doi:10.1111/j.1601-0825.2011.01893.x. 25. zhang, w.; ju, j.; rigney, t.; tribble, g. porphyromonas gingivalis infection increases osteoclastic bone resorption and osteoblastic bone formation in a periodontitis mouse model. bmc oral health 2014, 14, 89, doi:10.1186/1472-6831-14-89. 26. oktay, s.; chukkapalli, s.s.; rivera-kweh, m.f.; velsko, i.m.; holliday, l.s.; kesavalu, l. periodontitis in rats induces systemic oxidative stress that is controlled by bone-targeted antiresorptives. j periodontol 2015, 86, 137, doi:10.1902/jop.2014.140302. 1. introduction 2. materials and methods 3. results ten rats were subjected to this procedure after the presentation of the protocol described above. seven days after the experimental protocol, we could see the onset of periodontitis. gingivitis was observed in five subjects, more moderate, in four oth... six of ten rats lost weight, with variations ranging from 25 to 60 g, considered a moderate amount. when the rats lose more than 10% of their body weight, euthanasia is considered because this parameter is considered a pain assessment recommendation. after the euthanasia of all ten rats, a necropsy was performed. grossly, yellowish discoloration of the molar, mobility within the alveolus and gum reactivity have been observed in nine rats (fig. 6). figure 6. gross features of periodontitis after euthanasia, represented by yellowish discoloration, gum retraction and reactivity, mobility within the alveolus following the histological aspects after the microscopical analysis, the tooth and the periodontal ligament (the periodontium), respectively, the dental alveolar bone, showed a normal appearance for one rat. however, microscopically, lesions such as i... figure 7. hyperplasia and severe hyperkeratosis of the gingival epithelium, the subepithelial lamina propria is infiltrated with rare mononuclear cells; he staining x20 the superficial part of the inflammatory process is covered by a layer represented by bacterially infected tissue and fodder debris. furthermore, some segmental osteoclastic resorption of the alveolar bone was seen as also suppurative process represen... figure 8. chronic suppurative gingivitis, moderate-segmental osteoclastic resorption of the alveolar bone; he staining x10 on the site of the subgingival region, abundant granulation tissue was seen, which could split the septic point and replace the dental ligament. in addition, hyperplasia and hyperkeratosis of the gingival layer with the organization of the anatomic ep... figure 9. granulation tissue, inflammatory infiltrate consisting primarily of neutrophils, rare mononuclear cells and reactive fibroblasts; he staining x20 also, the presence of hyperplasia and hyperkeratosis in the gingival epithelium layer was observed. thus, the production of irregular epithelial papillae, divided by abundant inflammatory granulation tissue with neutrophils first and then macrophages,... the ct scan showed changes in bone and periodontal tissue (fig. 10) observed in 8 rats. figure 10. ct images consistent with changes in bone and periodontal tissue, bone necrosis, rarefaction and alveolar bone loss 4. discussion 5. conclusions this study showed that placing a cotton or silk thread around the cervical region of the upper left molar causes gingival inflammation, and the first symptoms of periodontitis developed from the seventh day of the experiment onwards. in the present st... references microsoft word c-alina zglaucoma in dogs cvjae corrections.docx cluj vet j 2021, 26, 3 http://clujveterinaryjournal.ro communication the glaucomas in dogs andreea alina zăvoi 1*, andra elena enache 2 1 university of agricultural sciences and veterinary medicine cluj napoca, faculty of veterinary medicine; andreea-alina.zavoi@usamvcluj.ro 2 north downs specialist referrals, bletchingley, uk; andra.enache@ndsr.co.uk * correspondence: andreea-alina.zavoi@usamvcluj.ro abstract: the glaucomas (the plural term is used intentionally) represent a group of diseases commonly defined by an increased intraocular pressure which interferes with normal function of the optic nerve and retina. characteristic changes of glaucomas include reduced axoplasmic flow in the optic nerve head, retinal ganglion cells death, cupping of the optic disc and visual damage or blindness due to retinal and optic nerve atrophy. this communication describes the clinical signs, diagnosis and medical treatment of glaucomas in dogs. keywords: glaucoma, blindness, ocular hypertension, gonioscopy, dogs 1. introduction according to the european college of veterinary ophthalmologists (www.ecvo.org) manual ‘glaucoma is characterized by an elevation of intraocular pressure (iop) which, when sustained, results in destruction of the intraocular structures and function, resulting in blindness. the elevated iop occurs mainly with developmental abnormalities or disease processes affecting the intraocular circulation and especially the drainage of aqueous humour from the eye through the irido-corneal angle (ica). dna-tests for open angle glaucoma (poag) in specific breeds are available.’ glaucoma typically occurs as a result of impaired aqueous humor drainage whereby the obstruction of the drainage pathway may lie at the level of either the pupil (pupil block glaucoma), the ica (trabecular meshwork, the conventional pathway), the uveo-scleral outflow (unconventional pathway), the lens, the ciliary body or the vitreous [1, 2]. the main function of the aqueous humor is to provide nutrients to the cornea and lens. the aqueous humor is constantly produced at the level of the non-pigmented epithelium of the ciliary processes (fig. 1). it flows through the posterior chamber, the pupil and into the anterior chamber (in a dorsal to ventral direction due to thermal convection currents) to be drained into the ica (the filtration angle, the anterior most portion of the ciliary body, fig 2.). the ica is formed by the junction of the inner cornea (the corneoscleral tunic), base of the iris and cilioscleral cleft (which contains the pectinate ligaments). the aqueous humor is then drained through the trabecular meshwork and associated aqueous collecting channels (the conventional and main pathway) and less through the ciliary body and anterior uvea (the uveoscleral pathway, also called the unconventional/alternative pathway). received: 14.12.2021 accepted: 30.12.2021 published: 31.12.2021 doi: 10.52331/cvj.v26i3.34 copyright: © 2021 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2021, 26, 3 9 the entire anterior chamber volume (0.4 ml in the dog) is replaced within an hour in most species (46-80 minutes in the dog) [1,2]. therefore, the iop is the result of the balance between production and outflow of aqueous humor. the production of aqueous humor is a dynamic process, the inflow of aqueous humor equals the outflow [1,2]. in glaucoma, both the aqueous humor production and outflow are altered. in understanding the pathogenesis of glaucoma it is important to understand the anatomy and physiology of the aqueous humor outflow pathways in normal and glaucomatous eyes. figure 1. aqueous humor drainage routes in canine eye. after being produced at the level of the ciliary processes, the aqueous humor flows through the posterior chamber into the anterior chamber (dorso-ventral direction, via convection currents). here, it is drained via the trabecular meshwork of the ciliary cleft and into the angular aqueous plexus then directed anteriorly into the episcleral venules (1) or posteriorly into the scleral venous plexus and the vortex venous system (2). an alternative aqueous humor drainage pathway (3) is the diffusion through the ciliary muscle interstitium to the suprachoroidal space and through the sclera (ie, uveoscleral outflow). source: original az adapted after [3] figure 2. the pectinate ligament visualized by gonioscopy (accolade ‘{‘) (ae enache) 2. causes and clinical signs of glaucoma glaucomas have been classified according to their cause into congenital, primary or breed-related (open angle and closed angle glaucoma) and secondary to other intra-ocular diseases (eg. chronic uveitis, primary lens 3 2 1 cluj vet j 2021, 26, 3 10 luxation and intraocular neoplasia, table 1). the canine glaucomas can also be classified according to the stage of progression into acute or chronic. table 1. causes of glaucoma adapted after [3] congenital glaucoma goniodysgenesis associated with multiple ocular defects primary glaucoma goniodysgenesis/narrow/closed irido-corneal angle: breeds affected www.ecvo.org: • japanese shiba inu • dandie dinmont terrier • leonberger • retriever (flat coated) • siberian husky • spaniel (american cocker) • spaniel (cocker) • spaniel (english springer) • spaniel (welsh springer) • spanish water dog and others primary open angle glaucoma beagle, norwegian elkhound, petit basset griffon vendéen, basset hound, shar pei secondary glaucoma formation of pre-iridal fibrovascular membranes (pifm) over the ciliary cleft opening secondary to retinal detachment, neoplasia or uveitis intraocular haemorrhage (due to systemic hypertension, coagulopathies, thrombocytopaenia) intumescence of a cataractous lens (phacomorphic glaucoma in diabetic cataracts) golden retrievers pigmentary uveitis intraocular neoplasia postoperative following cataract surgery ocular melanosis and pigmentary glaucoma in cairn terriers primary lens luxation terrier breeds, border collie and other breeds uveitis, including lens induced uveitis (phacolytic, phacoclastic uveitis) vitreous prolapse after surgical lens extraction (obstruction of the drainage angle by the vitreous) clinical signs of glaucoma vary with the duration, intensity and cause of the iop elevation from simple ocular surface redness (conjunctival hyperaemia and episcleral congestion that can be misdiagnosed as cluj vet j 2021, 26, 3 11 conjunctivitis or retrobulbar disease), third eyelid protrusion and ocular discharge (commonly mistaken for conjunctivitis) to diffuse corneal oedema (cloudiness) that comes and goes (due to intermittent pressure spikes) and enlarged globe. visual impairment may not be obvious to the owner as the dog will likely rely on vision from the contralateral eye, however the owner may report that the dog had been bumping into things on a particular side, missing things or being startled when approached from a particular side. as the dog is presented with a red eye, other ocular diseases should be included on the differential list such as uveitis (fig. 3), episcleritis, conjunctivitis, retrobulbar disease. it is not uncommon to misdiagnose glaucoma as conjunctivitis which leads to irreversible blindness due to the delay in the appropriate treatment. distinguishing between various diseases that can cause ocular redness should be based on the result of the clinical examination (the presence of menace response, pupillary light and dazzle reflexes) and tonometry (when available). figure 3. uveitis, border terrier, 7yo, mnnote the diffuse conjunctival hyperaemia, mid-dilated pupil, hyphaema, hypermature cataract (north downs specialist referrals) primary sudden onset congestive glaucoma is easier to recognize as the dog will be typically middle age, female and will have absent menace response, fixed dilated pupil +/absent dazzle reflexes, diffuse corneal oedema, episcleral congestion and conjunctival hyperaemia (fig. 4). cases of secondary glaucoma are more difficult to recognize solely based on the clinical signs but one should carefully look for signs of uveitis, retinal detachment or intraocular neoplasia, mid-dilated pupil with absent plr and reduced or absent menace response. figure 4. english cocker spaniel, 8yo fnprimary closed angle acute congestive glaucoma left eye, note the anisocoria with dilated left pupil, diffuse corneal oedema, third eyelid protrusion (north downs specialist referrals) clinical signs of acute onset glaucoma (more common in primary glaucoma cases) cluj vet j 2021, 26, 3 12 severe ocular and head pain; lethargy, reduced appetite; diffuse corneal oedema (fig. 5); blepharospasm; epiphora; marked conjunctival hyperaemia which can be misdiagnosed as conjunctivitis; third eyelid protrusion; marked episcleral vascular congestion; mid to large dilated and unresponsive pupil; deep perilimbal corneal vascularisation; mild aqueous flare or pigment dispersion in the anterior chamber changes in the appearance of the optic nerve appearance: pale or dark optic nerve head (atrophy), attenuation of the retinal vasculature, cupped optic nerve head (retinal vessels stop at the rim of the optic nerve, no vessels are seen crossing the optic nerve), hyperreflectivity of the tapetal fundus. figure 5. 8y6mo cocker spaniel, fn with primary angle closed glaucoma – note the mucoid discharge at the medial canthus, third eyelid protrusion, moderate conjunctival hyperaemia, episcleral congestion, diffuse corneal oedema and dilated pupil (north downs specialist referrals) clinical signs of chronic glaucoma (more common in secondary glaucoma): development of haab’ striae (fig. 6): these are breaks in the descemet membranes (allowing aqueous humor to enter the posterior stroma) secondary to stretching of the eye globe. buphthalmos: physical enlargement of the globe, resulting from severe and chronic elevations in iop. it may be especially pronounced in young animals and shar pei dogs (with poag), who have a more easily distended cornea and sclera than most adult dogs; buphthalmic eyes are almost always blind [1,2]. scleral thinning and visualization of the underlying choroid owing to globe enlargement. cluj vet j 2021, 26, 3 13 phthisis bulbi: this develops with advanced cases of glaucoma when the ciliary body stops producing aqueous humor. figure 6. 6yo fn whippetanterior uveitis and secondary chronic glaucomanote the haab’s striae (curvilinear grey/white lines across the cornea), the pupil was miotic owing to the recent application of latanoprost (north downs specialist referrals) congenital glaucoma congenital glaucoma is a rare condition which develops owing to the presence of severe ocular malformation and extensive goniodysgenesis associated with multiple ocular defects. affected animals display severe, bilateral, ocular pathology, very early in life (generally within weeks to months) [1]. primary glaucoma primary glaucoma is a bilateral disease which is not associated with any pre-existing intraocular disease, but has been associated with dysgenesis of the mesenchymal structures of the ica (pectinate ligament dysplasia/goniodysgenesis) and/or narrowing or closure of the iridocorneal angle and/or the ciliary cleft (cc) in some breeds [1]. clinical signs usually do not become evident until relatively late in life and this could be the consequence of age-related changes in the ica. primary glaucoma is a bilateral disease, however the onset of disease varies between the eyes [4]. based on the appearance of the drainage angle at gonioscopy, primary glaucoma may be classified as openangle glaucoma (beagle, petit basset griffon vendeen, basset hound, shar pei, norwegian elkhound) and closed angle glaucoma more common in the majority of breeds (cocker spaniel, welsh springer spaniel etc). when the ica appears abnormal on gonioscopy then goniodysgenesis has been diagnosed. a defect in the development of the ica leads to a decreased width or malformation of the pectinate ligament. it is advised against breeding of dogs diagnosed with pcag. typical presentation of a dog with pcag is a sudden onset of unilateral acute congestive glaucoma (sudden blindness, dilated pupil, third eyelid protrusion, diffuse corneal oedema, marked episcleral congestion) in a middle aged dog (6-8 years of age) more common in female dogs belonging to one of the following breeds: american/english cocker spaniel, springer spaniel, beagle, boston terrier, norwegian elkhound (full list of affected breeds available at https://www.bva.co.uk/canine-health-schemes/eye-scheme/ or cluj vet j 2021, 26, 3 14 https://www.ecvo.org/hereditary-eye-diseases/ecvo-manual.html to check if a specific breed can be affected by primary glaucoma). the second eye typically follows the same outcome within 6-12 months after diagnosis. bilateral presentation of pcag is rare and other intraocular conditions should be considered particularly uveitis/panuveitis, uveo-dermatologic syndrome, chorioretinitis and retinal detachment when a dog is presented with bilateral high iops. secondary glaucoma (post-inflammatory) describes elevated iop that occurs secondary to underlying ocular disease. common causes of secondary glaucoma include cataract (fig. 7), post-cataract surgery, lens (sub)luxation, intraocular neoplasia, severe or chronic uveitis, retinal detachment, lens-induced uveitis, uveo-dermatologic syndrome. secondary glaucoma can develop acutely, subacutely, or chronically and may affect one or both eyes. clinical signs include ocular discomfort, blepharospasm, corneal oedema, episcleral congestion (fig 8), third eyelid protrusion, miosis or mydriasis, uveitis, buphthalmos and/or blindness [1-3]. cases of glaucoma may be mistaken for conjunctivitis or retrobulbar disease due to the conjunctival hyperaemia, third eyelid protrusion and ocular discharge. figure 7. 13yo fn miniature schnauzerchronic lens-induced uveitis and secondary pupil block glaucoma, under treatment pigment dispersion on the surface of the iris and anterior lens capsule, posterior synechiae, fixed pupil (north downs specialist referrals) cluj vet j 2021, 26, 3 15 figure 8. 8yo fn miniature poodle posterior lens luxation and secondary glaucoma. note the conjunctival hyperaemia, engorged episcleral vessels and the aphakic crescent dorsally indicating a posteriorly luxated lens. (north downs specialist referrals) pigmentary glaucoma pigmentary glaucoma (ocular melanosis) is a form of glaucoma which occurs as a result of the proliferation and accumulation of cells containing melanin in the aqueous outflow [1]. studies support a hereditary aetiology. ocular signs are generally bilateral, although not always symmetrical. commonly affected breeds include the cairn terrier, boxer and labrador retriever. 3. diagnosis of glaucoma in the dog vision loss can happen gradually over a few weeks or months or acutely in dogs with glaucoma. ophthalmic examination, including funduscopy, should be performed to rule out other ocular causes such as retinal disease or uveitis. the history, clinical presentation and full ophthalmic examination findings support the diagnosis of glaucoma. iop values greater than 25 mmhg are consistent with ocular hypertension and should raise the suspicion of glaucoma. for the evaluation of visual function, the most important part is the assessment of the plrs (pupillary light reflexes). it is important to evaluate the size of both pupils, and note any difference in pupil size (anisocoria). with raised intraocular pressure the plr function is affected, the pupil will be fixed and dilated. evaluating the menace response (fig. 9) is another important step of the ophthalmic examination. this response is elicited by a threatening hand gesture heading towards the eye. a blinking response and globe retraction are expected to occur. this response involves cerebral cortical integration and interpretation, therefore it is not a reflex. it requires the entire peripheral (retina, optic nerve) and central visual pathways, as well as the visual cortex and the facial nucleus of cranial nerve vii, to be intact [1,4]. cluj vet j 2021, 26, 3 16 figure 9. evaluation of the menace responsenote the contralateral eye should be covered during the assessment (north downs specialist referrals) to avoid false positive response from the visual, contralateral eye, the menace response should be evaluated in one eye, while the other eye is covered. it is important to avoid touching the eyelashes/hairs of the patient, or causing air movement, as this may also elicit false positive response. a facial nerve paralysis may cause a false negative response. therefore, in the absence of a menace response the blinking reflex should be assessed by tapping the skin at the canthus. the menace response is absent in very young (<10–12 weeks) animals, and may also be affected by the patient’s mental status [1, 5]. in glaucoma, the menace response will be either reduced/inconsistent or absent, due to the retinal ganglion cells damage and reduced axoplasmic flow. if the high iop persists, the damage can be irreversible leading to blindness. the dazzle reflex (fig. 10) is a subcortical reflex (mediated by reflex centers in the midbrain with fibers to the facial nucleus) whereby a strong light shone into the eye leads to blinking, globe retraction, third eyelid protrusion, and/or head movement [1]. this is helpful when the ocular media are opaque (hyphaema, cataract) and when the menace response and/or plrs can’t be evaluated. however, it doesn’t indicate that the eye is visual, as this reflex can still be present even after retinal detachment due to the presence of a subspecialized population of retinal ganglion cells that are involved in the control of the plr. though, when the dazzle reflex is absent in a dog with high iop it most likely indicates retinal damage and unless immediate action is taken (medical treatment/aqueous centesis), blindness is likely to be permanent. figure 10. assessment of dazzle and pupillary light reflexes (north downs specialist referrals) 1. tonometry: there are three methods of estimating the intraocular pressure in animals: the indentation tonometer (schiøtz) which is not routinely available in clinical practice, applanation tonometer (tonopen) cluj vet j 2021, 26, 3 17 and the rebound tonometer (tonovet, fig. 11). tonometry is also useful for identifying low iop, which is common with anterior uveitis; normal values vary between individuals and time of the day (diurnal variation). normal reported range for the iop in dogs is 10-20 mmhg. diurnal variation has been reported in the dog with higher iops in the early morning, therefore iop curves (iop checks every 3 hours over 24 hours in hospital regime) may be recommended in order to detect iop spikes in dogs predisposed to or diagnosed with glaucoma [6]. figure 11. estimation of the intraocular pressure using the tonovet (rebound tonometer) in a dog (north downs specialist referrals) 2. ophthalmoscopy: direct and indirect ophthalmoscopy (fig. 12) may be used to examine the retina (look for hyperreflective striations or generalized hyperreflectivity) and the health of the optic nerve (fig. 13, normally the optic nerve head should be well vascularised, the blood vessels should be seen crossing its border). optic disc cupping (the blood vessels stop at the rim of the optic disc due to increased pressure) is the hallmark of glaucoma [1]; however, this may be difficult to notice in cases of acute congestive glaucoma due to the marked corneal oedema. figure 12. indirect ophthalmoscopy using a 30 d volk lensnote the optic disc at the top with the retinal vessels, tapetal fundus at the bottom (the image is inverted in indirect ophthalmoscopy) north downs specialist referrals cluj vet j 2021, 26, 3 18 figure 13. normal appearance of the optic disc pink with a physiologic pit centrally, retinal vessels are seen crossing the border of the optic disc (north downs specialist referrals) 3. gonioscopy: facilitates visualization of the pectinate ligament using a goniolens (eg. koeppe lens) which refracts the incoming light in such a way that the posterior cornea, ica and anterior iris can be assessed [1,2]. this test is performed on the conscious dog under local anaesthetic and is used to diagnose goniodysgenesis (predisposition factor for primary glaucoma in a few breeds of dogs); it also provides information regarding the anatomy of the pectinate ligament which makes up the ica. there are three categories of ica appearance (ecvo scheme): open, narrow or closed angle; with this test you can also visualise the base of the iris, pectinate ligaments and the base of the cornea. abnormalities of the pectinate ligament may be classified into: fibre latae and laminae. depending on the % of the affected area within the pectinate ligament, the dog may be classed as unaffected or affected (mild, moderate or severe). 4. ocular ultrasonography: can be used to rule out intraocular neoplasia, haemorrhage, vitriitis/vitreous membranes and retinal detachement. 5. ultrasound biomicroscopy: high frequency (50-100 mhz) ultrasound, useful to assess the width of the ciliary cleft/ the opening of the iridocorneal angle [1]. other tests are available and are not discussed here: chromatic plr testing, electroretinography (pattern erg to assess the retinal ganglion cell function), optical coherence tomography (oct, used to measure the retinal layer and optic nerve head thickness [7]), scanning laser polarimetry (evaluates the retinal nerve fibre layer, may be of use for early detection of glaucoma patients). 4. discussion there are two options of dealing with glaucoma in dogs: medical and surgical treatment either alone or in combination. very early diagnosis and aggressive therapy are generally required to preserve vision and delay the onset of blindness due to retinal and optic nerve degeneration. in primary glaucoma, despite normalization of the iop following medical management, the glaucoma continues to progress, thereby supporting the evidence that changes occur at a molecular level and the condition can only be delayed but not cured. despite aggressive medical or surgical treatment, the outcome is always the same which is blindness and loss of the eye and this needs to be explained to the owner. sadly, by the time the owner notices changes in the eye, often the iop exceeds 40 mmhg therefore glaucoma is a leading cause of irreversible vision loss in dogs. the patient is lethargic and reluctant to exercise and the affected eye becomes blind and appears red, painful and sore with a bluish tinge (corneal oedema) over the cornea. often the eyes are enucleated because of the painfully high and uncontrolled iop. glaucomas can easily mask cluj vet j 2021, 26, 3 19 underlying systemic diseases, such as infectious uveitis and neoplasia (lymphoma). submission of the enucleated eyes for histopathological examination is always recommended [1,2]. treatment of primary glaucoma (table 2): acute glaucoma should be considered an emergency and the iop must be reduced to the normal range in order to save the patient’s vision; hospitalization is required and treatment is generally commenced with topical prostaglandin analogues. if the iop doesn’t returns to normal within the first 30–60 min then the use of osmotic diuretics or aqueous centesis should be considered. in current clinical practice, ophthalmologists rarely use osmotic diuretics due to the availability of prostaglandin analogues which are as or even more efficient without the risk of inducing side effects. furthermore, osmotic diuretics should be cautiously used as they are contraindicated in patients with kidney disease, owing to the risk of causing dehydration and electrolytes imbalance. the use of osmotic diuretics has been generally replaced by prostaglandin analogues (eg latanoprost) combined with topical carbonic anhydrase inhibitors (brinzolamide, dorzolamide) and beta-blockers (eg timolol). treatment of glaucoma should be aimed at two directions: decreasing the aqueous humor production: carbonic anhydrase inhibitors, beta-blockers. alternatively, surgery aimed at destroying the ciliary processes thereby reducing the aqueous humor production may be considered: endocyclophotocoagulation, transscleral laser with its potential risks and complications [7,8]. because newly developed glaucoma medications are emerging at a very slow rate and may not be effective, working toward improving surgical options may be the most rewarding approach in the near term [8]. increasing the aqueous humor outflow: eg. prostaglandin analogues (eg. latanoprost). one effect of this class of hypotensive drugs is the secondary miosis as well as conjunctival hyperaemia, due to the increased vasodilation (fig. 14). surgery to create alternate pathways of drainage within or outside of the eye (anterior chamber bypass surgery) may be considered with its potential risks and complications [8, 9]. others less commonly used hypotensive drugs include osmotics, adrenergics (non-selective alfa, beta-agonists epinephrine, dipivalyl epinephrine, alfa-2 agonists such as apraclonidine, brimonidine) and adrenergic blockers, parasympathomimetics (pilocarpine, carbachol, demecarium bromide, ectothiopate iodide) and are not discussed here [1,2]. typically, a primary glaucoma patient will receive combinations of carbonic anhydrase inhibitors, beta-blockers and prostaglandin analogues (eg. dorzolamide, timolol and latanoprost) as ongoing medical treatment with frequency which depends on the iop readings. figure 14. the effect of latanoprost application, leading to extreme pupil (north downs specialist referrals) cluj vet j 2021, 26, 3 20 although there is no clear-cut evidence, long-term anti-glaucoma medication (e.g. with topical carbonic anhydrase inhibitors and beta-blockers such as dorzolamide and timolol q8 hours) for the second, predisposed, but normotensive eye should be considered [2]. analgesia should be considered in dogs with glaucoma. an iop over 35 mmhg causes migraines in people. dogs with glaucoma are typically less active, lethargic, they sleep more, eat less and are less willing to go for walks. analgesia should be provided in the form of systemic non-steroidal medication, paracetamol and/or opioids if there are no contraindications. treatment of secondary glaucoma depends on the etiology; therapy may consist in the removal of the lens in cases of primary lens luxation to enucleation for those secondary to an intraocular tumor, but in all cases referral to a veterinary ophthalmologist should always be considered and discussed with the owner. in blind eyes, the treatment options include: transscleral laser, intravitreal injection of gentamicin [10, 11] with a reported iop control of 65%85%, intravitreal injection of cidofovir [12] with a reported iop control of 97% and enucleation. table 2. most commonly used hypotensive drugs for glaucoma in dogs and cats source: adapted after [8] drug available preparations dose or timing contraindications osmotic diuretics mannitol 20% solution only in acute congestive glaucoma 1-1.5 g/kg i.v. slowly over 20 min cardiac or renal disease, dehydration, chronic glaucoma prostaglandin analogues latanoprost 0.005% solution q12-24 h, can be increased to q6-8 hours until a response is seen severe uveitis, anterior lens luxation travoprost 0.004% solution bimatoprost 0.03% solution carbonic anhydrase inhibitors brinzolamide 1% solution q8-12h none in dogs, but may cause local irritation shortly after instillation; keratitis, corneal oedema, blepharitis (especially dorzolamide) systemic absorption can lead to acute kidney injury in cats (check electrolytes before starting treatment) [13, 14] dorzolamide 2% solution cluj vet j 2021, 26, 3 21 β -adrenergic blockers timolol maleate 0.25% and 0.5% solution q8-12h cardiac or respiratory disease use cautiously in cats and small dogs due to systemic absorption, cautious in dogs with asthma and chronic bronchitis 5. conclusions despite medical therapy, a significant proportion of cases may require surgery in an attempt to keep the iop within the normal range and delay the progression of glaucoma and blindness or to reduce the ocular discomfort. the prognosis depends on the underlying cause of glaucoma. long-term therapy is necessary and regular intraocular pressure checks are required in order to ensure a normotensive and comfortable eye. eyes that have lost vision but still have an increased pressure are a source of chronic pain. in such cases, enucleation must be considered to guarantee the well-being and comfort of the patient. due to the aggressive and progressive nature of the disease, most animals lose their vision despite treatment, therefore their owners should be carefully advised regarding the prognosis of this disease. author contributions: all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding. conflicts of interest: the authors declare no conflict of interest. references 1. gelatt, k.n.: veterinary ophthalmology, fifth edition, wiley-blackwell, 2013:1050-1146. 2. maggs, d.j.; miller, p.e.; ofri, r.;. slatter’s fundamentals of veterinary ophthalmology, fourth edition, elsevier inc., philadelphia, 2008:81-106, pp. 230-249. 3. peiffer, r.l.; petersen-jones, s.m.; small animal ophthalmology: a problem-oriented approach, fourth edition, elsevier inc., philadelphia, 2008:120-123, pp. 227-234. 4. reinstein, s.; rankin, a.; allbaugh, r.: canine glaucoma: pathophysiology and diagnosis, 2009:450–452. 5. gelatt, k.n.; ophthalmic examination and diagnostic procedures, ed. essentials of veterinary ophthalmology. philadelphia: lippincott williams & wilkins, 2000:1–26. 6. sanchez rf, vieira da silva mj, dawson c. design of an intraocular pressure curve protocol for use in dogs. j small anim pract. 2017 jan;58(1):42-48. 7. graham, kl, mccowan, ci, caruso, k, et al.:. optical coherence tomography of the retina, nerve fiber layer, and optic nerve head in dogs with glaucoma. vet ophthalmol. 2020; 23: 97– 112. 8. komáromy, a.m.; dineli, b.; douglas, w.e. et al..; the future of canine glaucoma therapy. vet ophthalmol. 2019:726-728. 9. willis, a.m.; ocular hypotensive drugs. vet clinics of north america: small animal practice 2004:755. cluj vet j 2021, 26, 3 22 10. julien, m.e., schechtmann, s.a., michau, t.m. et al.: pharmacologic ciliary body ablation for chronic glaucoma in dogs: a retrospective review of 108 eyes from 2013 to 2018; vet ophthalmol. 2021; 24(suppl. 1): 125– 130. 11. rankin, a.j., lanuza, r., kukanich, b., et al.: measurement of plasma gentamicin concentrations postchemical ciliary body ablation in dogs with chronic glaucoma. vet ophthalmol, 2016; 19: 57-62. 12. low mc, landis ml, peiffer rl.: intravitreal cidofovir injection for the management of chronic glaucoma in dogs. vet ophthalmol. 2014 may;17(3):201-6. 13. thiessen, e.c.; tofflemire, k.l.; makielski, k.m. et al.: hypokalemia and suspected renal tubular acidosis associated with topical carbonic anhydrase inhibitor therapy in a cat. journal of veterinary emergency and critical care 2015:1–5. 14. czepiel, t.m.; wasserman, n.t.: hypokalemia associated with topical administration of dorzolamide 2% ophthalmic solution in cats. vet ophthalmol. 2021;24:12-19. type of the paper (article cluj vet j 2023, vol. 28, issue 1 http://clujveterinaryjournal.ro review unravelling the antioxidant potential of resveratrol and quercetin in animal models: a comprehensive review ioana craciun1,* and florinel gheorghe brudașcă1, 1 department of infectious diseases, faculty of veterinary medicine, university of agricultural sciences and veterinary medicine cluj-napoca, calea mănăştur nr. 3-5, 400372 cluj-napoca, romania. ioana.craciun@usamvcluj.ro, florinbrudasca@yahoo.com abstract: resveratrol and quercetin are naturally occurring polyphenolic compounds widely studied for their potential health benefits, particularly their antioxidant properties. this abstract provides an overview of the extensive research conducted on resveratrol and quercetin as antioxidants in animal models, highlighting their mechanisms of action and therapeutic potential. animal models, such as rodents, have been instrumental in elucidating the oxidative stress pathway and evaluating the efficacy of various antioxidants. resveratrol and quercetin have demonstrated significant antioxidant effects in animal models through multiple mechanisms. these include direct scavenging of reactive oxygen species (ros), upregulation of endogenous antioxidant enzymes, inhibition of lipid peroxidation, and modulation of oxidative stress-related signaling pathways. keywords: polyphenols; therapeutic implications; animal models 1. introduction resveratrol and quercetin supplementation has been found to reduce oxidative stress in a wide range of systems, including the liver [1], heart [2], brain [3], and kidneys [4] in animal models. it has been discovered that these antioxidants can reduce oxidative damage caused by disorders like ageing, inflammation, diabetes, neurological diseases, and cardiovascular conditions [1]. the adaptation of resveratrol and quercetin research to human applications faces several difficulties despite the encouraging results in animal studies [5]. to achieve efficient and secure therapeutic interventions, factors like bioavailability, metabolism, and dosage optimization need to be meticulously taken into consideration. oxidative stress, resulting from an imbalance between reactive oxygen species (ros) production and antioxidant defense mechanisms, has been implicated in the pathogenesis of numerous diseases, including ageing, cardiovascular disorders, neurodegenerative diseases, and cancer [1]. consequently, there is a growing interest in identifying natural compounds that possess potent antioxidant properties to counteract oxidative damage and promote overall health. resveratrol and quercetin, two polyphenolic compounds abundantly found in various fruits, vegetables, and plant extracts, have garnered considerable attention for their potential as antioxidants in animal models [6]. received: 11.06.2023 accepted: 15.06.2023 published: 17.06.2023 doi: 10.52331/cvj.v28i1.44 copyright: © 2023 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2023, vol. 28, issue 1 21 of 27 the authors reported that quercetin treatment suppressed oxidative stress markers, including malondialdehyde (mda) and protein carbonyl levels, while upregulating the expression of antioxidant enzymes, such as heme oxygenase-1 (ho-1). moreover, several mechanistic studies have shed light on the underlying antioxidant mechanisms of resveratrol and quercetin in animal models. for instance, in their comprehensive review, han et al. (2007) summarized the multiple pathways through which resveratrol exerts its antioxidative effects, including ros scavenging, activation of nuclear factor erythroid 2-related factor 2 (nrf2)-mediated antioxidant response, and modulation of signalling pathways like mitogen-activated protein kinases (mapks) and nuclear factor-kappa b (nf-κb)[11]. in a similar vein, xu et al. (2019) elucidated the antioxidant mechanisms of quercetin, highlighting its ability to inhibit ros generation, restore cellular redox balance, and activate antioxidant enzymes through nrf2 signalling pathways in animal models. the evidence that resveratrol and quercetin have antioxidant functions in animal models is carefully increasing, and it includes the outcomes of this study in addition to a large number of additional studies. understanding the processes by which these chemical compounds exert their effects is crucial for the development of effective medical therapies for oxidative disorders in individuals linked to stress. additional research is required to bridge the gap between animal models and clinical trials. this will facilitate the development of safe and effective therapies for human health based on these findings. 2. mechanism of action of resveratrol due to its extraordinary pharmacological potential, resveratrol, also known as 3,4′,5-trihydroxystilbene, is a nutraceutical that has attracted a lot of academic interest. it is a naturally occurring phytoalexin that is frequently found on numerous plants, notably berries, grapes, and peanuts. resveratrol was initially extracted from the veratrum grandiflorum plant, frequently referred to as white hellebore, in the 1940s, which is when it was first discovered [12, 13]. red wine represents a processed plant product that is known to have a high resveratrol content. due to its potential involvement in the "french paradox," which refers to the unusually low rate of heart disease among southern french people despite their consumption of diets high in saturated fat, this substance has garnered interest. red wine contains resveratrol, which has been proposed as a potential explanation for this phenomenon. resveratrol concentrations in red wine can range from 0.1 to 14.3 mg/l [12, 14-16]. numerous studies have elucidated the mechanisms through which resveratrol exerts its antioxidative effects [17, 18]. 2.1. activation of nrf2 pathway resveratrol has been shown to activate the nuclear factor erythroid 2-related factor 2 (nrf2) pathway, a crucial regulator of antioxidant defence systems. nrf2 translocate into the nucleus upon activation, leading to the upregulation of antioxidant enzymes such as superoxide dismutase (sod), catalase (cat), and glutathione peroxidase (gpx). for instance, jia et al. (2019) demonstrated that resveratrol treatment increased the expression of nrf2 and its target genes, resulting in reduced oxidative stress and liver injury in a rat model [9]. 2.2. ros scavenging resveratrol exhibits direct scavenging properties against reactive oxygen species (ros). by neutralizing ros through electron transfer, resveratrol mitigates their damaging effects on cellular components. aminjan et al. (2019) reported that resveratrol administration led to a decrease in ros levels, contributing to the preservation of cellular redox balance and protection against oxidative stress-induced liver injury [19]. cluj vet j 2023, vol. 28, issue 1 22 of 27 2.3.modulation of intracellular signalling pathways resveratrol modulates several intracellular signalling pathways associated with oxidative stress, such as mitogen-activated protein kinases (mapks) and nuclear factor-kappa b (nf-κb). du et al. (2021) highlighted that resveratrol inhibits the activation of mapks, including erk, jnk, and p38, thereby reducing oxidative stress-mediated cellular damage. by interfering with nf-κb signalling, resveratrol can suppress inflammation and oxidative stress-induced damage [20]. 2.4. activation of sirtuins resveratrol activates sirtuins, a family of nad+-dependent deacetylases, particularly the sirt1 enzyme. sirt1 activation has been associated with enhanced antioxidant defences and improved mitochondrial function [21]. kaeberlein et al. (2021) emphasized that resveratrol-mediated sirt1 activation contributes to cellular resilience against oxidative stress and overall cellular homeostasis [22]. 3. therapeutic potential of resveratrol the mechanisms of action of resveratrol in animal models transfer into its potential medicinal applications for a variety of conditions linked to oxidative stress. resveratrol, for instance, has been demonstrated to reduce renal oxidative stress, inflammation, and fibrosis in a mouse model of diabetic nephropathy[23]. resveratrol appears to protect against myocardial ischemia/reperfusion injury in a rat model by reducing oxidative stress while improving cardiac function, according to yu et al. (2021) [24]. furthermore, ibrahim et al. (2020) demonstrated that resveratrol reduced renal oxidative stress and inflammation, which attenuated cisplatin-induced nephrotoxicity[25]. reservatrol was given to rats with chronic cerebral hypoperfusion in a study by wang et al. (2014) [26]. according to the study's findings, resveratrol administration enhanced mental performance while lowering oxidative stress markers in the brain. in a study conducted by wang et al. (2019), resveratrol was administered to rats with experimentally induced colitis [26]. resveratrol treatment reduced oxidative stress preserved colonic tissue integrity, and ameliorated inflammation in the colon[27]. wang et al. (2018) investigated the neuroprotective effects of resveratrol in a mouse model of alzheimer's disease. they found that resveratrol supplementation improved cognitive function, reduced amyloid-beta plaque deposition, and alleviated oxidative stress in the brain [28]. in a study by hu et al. (2020), resveratrol was administered to rats with acute lung injury induced by lipopolysaccharide (lps)[29]. resveratrol treatment attenuated lung injury, reduced oxidative stress markers, and inhibited inflammatory responses in the lung tissues. aged mouse treatment with resveratrol was studied by barger et al. (2008). according to their findings, resveratrol increased lifespan, lowered oxidative stress, and enhanced metabolic health in the treated mice compared to the control group [30]. resveratrol's preventive properties were examined by lan et al. (2022) in a rat model of renal ischemia-reperfusion injury. administration of resveratrol reduced oxidative stress and inflammation in the renal tissues, improved renal function, and minimized kidney damage [31]. resveratrol has been studied in a rat model of liver fibrosis induced on by carbon tetrachloride in a study by abdu et al. (2017). by lowering oxidative stress, inflammation, and hepatic collagen deposition, resveratrol therapy improved liver fibrosis [32, 33]. these investigations collaboratively provide a spotlight on resveratrol's various medicinal benefits. collectively, these studies have provide insight on the numerous therapeutic effects of resveratrol in animal models. they back up the idea that resveratrol has the potential to be an effective natural substance for both the prevention and treatment of many different oxidative illnesses associated with stress. cluj vet j 2023, vol. 28, issue 1 23 of 27 4. mechanism of action of quercetin the chemical compound 3,5,7-trihydroxy-2-(3,4-dihydroxy phenyl)-4hchromen-4-one, typically known as quercetin, is a dietary flavonoid that exists in a variety of plant sources, including capers, black chokeberries, onions, tomatoes, and lettuce [34]. quercetin can be identified in plants in a conjugated state, paired with phenolic acids, sugars, ethers, and other substances. the precise forms of quercetin derivatives can affect how quickly they are absorbed in the stomach and small intestine [35]. the mechanism of action of quercetin involves its interactions with multiple cellular targets, leading to its diverse pharmacological effects. quercetin is an excellent free radical scavenging antioxidant [36]. consuming foods that contain flavonoids lowers the chance of developing long-term illnesses including diabetes, coronary heart disease, and stroke that are brought on by oxidative stress [36–38]. the flavonoid quercetin, which can be discovered in fruits and vegetables, has unique biological properties that could enhance cognition and physical performance while reducing the risk of illness [8]. the foundation for possible benefits to general health and disease resistance is established by these characteristics, which include the ability to suppress lipid peroxidation, platelet aggregation, and capillary permeability as well as the capacity to induce mitochondrial biogenesis [39]. it additionally possesses anti-inflammatory, antiviral, anti-inflammatory, antioxidant, and stimulant effects. 4.1 antioxidant activity one of the primary mechanisms through which quercetin exerts its effects is its potent antioxidant activity. quercetin acts as a free radical scavenger, effectively neutralizing reactive oxygen species (ros) and inhibiting lipid peroxidation. it also enhances the activities of endogenous antioxidant enzymes, such as superoxide dismutase (sod) and catalase (cat), thereby augmenting the cellular defence against oxidative stress [40, 41]. 4.2 anti-inflammatory effects quercetin demonstrates notable anti-inflammatory properties by modulating various inflammatory signalling pathways. it inhibits the production and release of pro-inflammatory mediators, including cytokines (such as tumour necrosis factor-alpha and interleukins) and inflammatory enzymes (such as cyclooxygenase-2 and inducible nitric oxide synthase). quercetin achieves this by suppressing the activation of nuclear factor-kappa b (nf-κb), a key transcription factor involved in the inflammation [41, 42]. 4.3 modulation of cellular signalling pathways quercetin influences several cellular signalling pathways involved in cellular homeostasis and disease processes. it activates the adenosine monophosphate-activated protein kinase (ampk) pathway, which plays a critical role in cellular energy metabolism and oxidative stress response. quercetin-mediated activation of ampk promotes cellular antioxidant defences and inhibits oxidative stress-induced damage [43, 44]. 4.4 epigenetic modifications quercetin has been shown to exert epigenetic modifications, particularly through its influence on dna methylation and histone acetylation. it can alter the expression of genes involved in various physiological processes, including antioxidant defence, inflammation, and cell cycle regulation [45]. by modulating epigenetic mechanisms, quercetin may exert long-term effects on cellular function and disease development [46]. these mechanisms collectively contribute to the pharmacological effects of quercetin, including its antioxidant, anti-inflammatory, and cytoprotective properties. cluj vet j 2023, vol. 28, issue 1 24 of 27 5. therapeutic potential of quercetin the diverse mechanisms of action of quercetin in animal models translate into its potential therapeutic applications for various conditions. neuroprotection: quercetin has shown neuroprotective effects in animal models of diabetic neuropathy, alzheimer's disease, and ischemic brain injury. its antioxidant and anti-inflammatory properties contribute to the preservation of neuronal function and protection against neurodegeneration [47, 48]. hepatoprotection, animal studies have demonstrated that quercetin can attenuate liver injury, fibrosis, and inflammation in models of liver fibrosis and hepatotoxicity. its antioxidant and anti-inflammatory actions contribute to the preservation of liver function and the reduction of liver damage [49-51]. cardiovascular health: quercetin supplementation has shown cardioprotective effects in animal models of myocardial ischemia-reperfusion injury. it reduces oxidative stress, suppresses inflammation, and improves cardiac function, suggesting its potential in preventing cardiovascular diseases [52-54]. anti-inflammatory effects: quercetin exhibits anti-inflammatory effects in animal models of colitis and other inflammatory conditions. it mitigates inflammation, preserves tissue integrity, and reduces oxidative stress, highlighting its potential as an adjunct therapy for inflammatory bowel diseases [54, 55]. 6. discussions in the field of both human and veterinary medicine, various studies using animal models have provided important light on the mechanisms of action and therapeutic potential of quercetin and resveratrol. the results of these investigations are all featured in this review. the review of quercetin and resveratrol's mechanisms of action and therapeutic potential in both veterinary and human medicine delivers important insights into the potential applications of these organic compounds as therapeutic agents. although preliminary evidence is provided through animal research, it is crucial to take into account the parallels and discrepancies between animal models and human patients to ensure the reliability and practicality of the results. the variation in species and their physiological peculiarities are an important factor that must be taken into consideration. the pharmacokinetics and therapeutic response to quercetin and resveratrol can vary amongst individuals and animals based on individual metabolism, organ structure, and genetics. in light of this, extreme caution should be taken when extrapolating findings from animal studies to human patients, and their findings should be confirmed more thoroughly in meticulously planned clinical trials. the effectiveness and safety of quercetin and resveratrol in both veterinary and human medicine are significantly affected by factors other than the biodiversity of species, particularly dosage, formulation, and method of administration. understanding the optimal dosages and delivery methods for each species is essential to achieve desired therapeutic outcomes. furthermore, the bioavailability and metabolism of these compounds may differ between animals and humans, emphasizing the need for further research to establish appropriate dosing regimens in clinical practice. long-term safety and potential drug interactions are important considerations in both veterinary and human medicine. while animal studies provide insights into short-term effects, long-term studies are necessary to evaluate any potential adverse effects or interactions with other medications commonly used in clinical practice. rigorous monitoring and assessment of safety profiles are required to ensure the well-being of patients. in both veterinary and human medicine, quercetin and resveratrol have the potential for alleviating an extensive spectrum of diseases. these chemicals have demonstrated promise in animal models for the treatment of neurological conditions, liver diseases, cardiovascular problems, and metabolic disorders. similar to animal research, there is growing evidence that indicates cluj vet j 2023, vol. 28, issue 1 25 of 27 antioxidants could have a role in the management and prevention of chronic illnesses like cancer, cardiovascular disease, and neurodegenerative disorders. however, more clinical studies are required to confirm these results and determine accurate characteristics of patients, optimal dosages, and lengths of treatment. research on the application of quercetin and resveratrol for veterinary and human medicine should be expanded by cooperation between scientists, doctors, and pharmaceutical companies. for researchers to provide accurate information regarding safety, efficacy, and optimal methods of treatment, well-designed clinical trials taking into consideration species-specific features and involving a variety of patients must be conducted. these investigations may additionally look at potential interactions with currently administered pharmaceuticals, establish early warning signs or contraindications, and contribute to developing clinical practice guidelines. 7. conclusion the research conducted with animal models provides significant insights into the therapeutic potential of resveratrol and quercetin in both human and veterinary medicine. while the findings from animal studies are promising, caution should be exercised when translating these results to human applications, considering species differences and variations in pharmacokinetics. further research, including well-designed clinical trials, is necessary to establish the optimal dosages, safety profiles, and efficacy of these compounds in both veterinary and human patients. collaboration among researchers, clinicians, and pharmaceutical companies will play a crucial role in advancing the research and application of quercetin and resveratrol, ultimately improving the health outcomes of both animals and humans. author contributions: conceptualization, ic.; writing—original draft preparation, i.c.; writing—review and editing, i.c.; visualization, i.c.; supervision, i.c and f.g.b. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding institutional review board statement: not applicable conflicts of interest: the authors declare no conflict of interest. references 1. park, e.-j.; pezzuto, j. m. the pharmacology of resveratrol in animals and humans. biochimica et biophysica acta (bba) molecular basis of disease 2015, 1852 (6), 1071-1113. doi: https://doi.org/10.1016/j.bbadis.2015.01.014. 2. elmadhun, n. y.; sabe, a. a.; robich, m. p.; chu, l. m.; lassaletta, a. d.; sellke, f. w. the pig as a valuable model for testing the effect of resveratrol to prevent cardiovascular disease. annals of the new york academy of sciences 2013, 1290 (1), 130-135. 3. wang, g. j.; judelson, d. r.; goodney, p. p.; bertges, d. j. loss to follow-up 1 year after lower extremity peripheral vascular intervention is associated with worse survival. vascular medicine (united kingdom) 2019, 24 (4), 332-338. doi: 10.1177/1358863x19853622. 4. den hartogh, d. j.; tsiani, e. health benefits of resveratrol in kidney disease: evidence from in vitro and in vivo studies. nutrients 2019, 11 (7), 1624. 5. smoliga, j. m.; vang, o.; baur, j. a. challenges of translating basic research into therapeutics: resveratrol as an example. journals of gerontology series a: biomedical sciences and medical sciences 2012, 67 (2), 158-167. 6. mrkus, l.; batinić, j.; bjeliš, n.; jakas, a. synthesis and biological evaluation of quercetin and resveratrol peptidyl derivatives as potential anticancer and antioxidant agents. amino acids 2019, 51, 319-329. 7. urquiaga, i.; leighton, f. plant polyphenol antioxidants and oxidative stress. biological research 2000, 33 (2), 55-64. cluj vet j 2023, vol. 28, issue 1 26 of 27 8. davis, j. m.; murphy, e. a.; carmichael, m. d. effects of the dietary flavonoid quercetin upon performance and health. curr sports med rep 2009, 8 (4), 206-213. doi: 10.1249/jsr.0b013e3181ae8959 from nlm. 9. jia, r.; li, y.; cao, l.; du, j.; zheng, t.; qian, h.; gu, z.; jeney, g.; xu, p.; yin, g. antioxidative, anti-inflammatory and hepatoprotective effects of resveratrol on oxidative stress-induced liver damage in tilapia (oreochromis niloticus). comparative biochemistry and physiology part c: toxicology & pharmacology 2019, 215, 56-66. 10. zhang, d.; qi, b.-y.; zhu, w.-w.; huang, x.; wang, x.-z. crocin alleviates lipopolysaccharide-induced acute respiratory distress syndrome by protecting against glycocalyx damage and suppressing inflammatory signaling pathways. inflammation research 2020, 69, 267-278. 11. han, x.; shen, t.; lou, h. dietary polyphenols and their biological significance. international journal of molecular sciences 2007, 8 (9), 950-988. 12. berman, a. y.; motechin, r. a.; wiesenfeld, m. y.; holz, m. k. the therapeutic potential of resveratrol: a review of clinical trials. npj precision oncology 2017, 1 (1), 35. doi: 10.1038/s41698-017-0038-6. 13. aggarwal, b. b.; bhardwaj, a.; aggarwal, r. s.; seeram, n. p.; shishodia, s.; takada, y. role of resveratrol in prevention and therapy of cancer: preclinical and clinical studies. anticancer res 2004, 24 (5a), 2783-2840. from nlm. 14. shukla, y.; singh, r. resveratrol and cellular mechanisms of cancer prevention. annals of the new york academy of sciences 2011, 1215 (1), 1-8. renaud, s. d.; de lorgeril, m. wine, alcohol, platelets, and the french paradox for coronary heart disease. the lancet 1992, 339 (8808), 1523-1526. kopp, p. resveratrol, a phytoestrogen found in red wine. a possible explanation for the conundrum of the ‘french paradox’? european journal of endocrinology 1998, 138 (6), 619-620. 15. de la lastra, c. a.; villegas, i. resveratrol as an antioxidant and pro-oxidant agent: mechanisms and clinical implications. biochemical society transactions 2007, 35 (5), 1156-1160. lee, m.; lin, w.; yu, b.; lee, t. antioxidant capacity of phytochemicals and their potential effects on oxidative status in animals—a review. asian-australasian journal of animal sciences 2017, 30 (3), 299. 16. aminjan, h. h.; abtahi, s. r.; hazrati, e.; chamanara, m.; jalili, m.; paknejad, b. targeting of oxidative stress and inflammation through ros/nf-kappab pathway in phosphine-induced hepatotoxicity mitigation. life sciences 2019, 232, 116607. 17. du, p.; song, j.; qiu, h.; liu, h.; zhang, l.; zhou, j.; jiang, s.; liu, j.; zheng, y.; wang, m. polyphenols extracted from shanxi-aged vinegar inhibit inflammation in lps-induced raw264. 7 macrophages and icr mice via the suppression of mapk/nf-κb pathway activation. molecules 2021, 26 (9), 2745. 18. gertz, m.; nguyen, g. t. t.; fischer, f.; suenkel, b.; schlicker, c.; fränzel, b.; tomaschewski, j.; aladini, f.; becker, c.; wolters, d. a molecular mechanism for direct sirtuin activation by resveratrol. plos one 2012, 7 (11), e49761. 19. kaeberlein, m.; mcdonagh, t.; heltweg, b.; hixon, j.; westman, e. a.; caldwell, s. d.; napper, a.; curtis, r.; distefano, p. s.; fields, s. substrate-specific activation of sirtuins by resveratrol. journal of biological chemistry 2005, 280 (17), 17038-17045. 20. cheng, k.; song, z.; chen, y.; li, s.; zhang, y.; zhang, h.; zhang, l.; wang, c.; wang, t. resveratrol protects against renal damage via attenuation of inflammation and oxidative stress in high-fat-diet-induced obese mice. inflammation 2019, 42, 937-945. 21. yu, d.; xiong, j.; gao, y.; li, j.; zhu, d.; shen, x.; sun, l.; wang, x. resveratrol activates pi3k/akt to reduce myocardial cell apoptosis and mitochondrial oxidative damage caused by myocardial ischemia/reperfusion injury. acta histochemica 2021, 123 (5), 151739. 22. ibrahim, a.; al-hizab, f. a.; abushouk, a. i.; abdel-daim, m. m. nephroprotective effects of benzyl isothiocyanate and resveratrol against cisplatin-induced oxidative stress and inflammation. frontiers in pharmacology 2018, 9, 1268. 23. wang, n.; he, j.; pan, c.; wang, j.; ma, m.; shi, x.; xu, z. resveratrol activates autophagy via the akt/mtor signaling pathway to improve cognitive dysfunction in rats with chronic cerebral hypoperfusion. frontiers in neuroscience 2019, 13, 859. 24. li, f.; han, y.; cai, x.; gu, m.; sun, j.; qi, c.; goulette, t.; song, m.; li, z.; xiao, h. dietary resveratrol attenuated colitis and modulated gut microbiota in dextran sulfate sodium-treated mice. food & function 2020, 11 (1), 1063-1073. 25. wang, h.; jiang, t.; li, w.; gao, n.; zhang, t. resveratrol attenuates oxidative damage through activating mitophagy in an in vitro model of alzheimer’s disease. toxicology letters 2018, 282, 100-108. 26. hu, q.; yang, c.; zheng, f.; duan, h.; fu, y.; cheng, z. acute lung injury inhibition by juglone in lps induced sepsis mouse model involves sirt1 activation. tropical journal of pharmaceutical research 2020, 19 (5), 1001-1007. 27. barger, j. l.; kayo, t.; vann, j. m.; arias, e. b.; wang, j.; hacker, t. a.; wang, y.; raederstorff, d.; morrow, j. d.; leeuwenburgh, c. a low dose of dietary resveratrol partially mimics caloric restriction and retards aging parameters in mice. plos one 2008, 3 (6), e2264. 28. lan, t.-y.; dun, r.-l.; yao, d.-s.; wu, f.; qian, y.-l.; zhou, y.; zhan, t.-t.; shao, m.-h.; gao, j.-d.; wang, c. effects of resveratrol on renal ischemia-reperfusion injury: a systematic review and meta-analysis. frontiers in nutrition 2022, 9. cluj vet j 2023, vol. 28, issue 1 27 of 27 29. latief, u.; ahmad, r. herbal remedies for liver fibrosis: a review on the mode of action of fifty herbs. journal of traditional and complementary medicine 2018, 8 (3), 352-360. abdu, s. b.; al-bogami, f. m. influence of resveratrol on liver fibrosis induced by dimethylnitrosamine in male rats. saudi journal of biological sciences 2019, 26 (1), 201-209. 30. wang, w.; sun, c.; mao, l.; ma, p.; liu, f.; yang, j.; gao, y. the biological activities, chemical stability, metabolism and delivery systems of quercetin: a review. trends in food science & technology 2016, 56, 21-38. doi: https://doi.org/10.1016/j.tifs.2016.07.004. 31. materska, m. quercetin and its derivatives: chemical structure and bioactivity-a review. polish journal of food and nutrition sciences 2008, 58 (4). 32. boots, a. w.; li, h.; schins, r. p. f.; duffin, r.; heemskerk, j. w. m.; bast, a.; haenen, g. r. m. m. the quercetin paradox. toxicology and applied pharmacology 2007, 222 (1), 89-96. doi: https://doi.org/10.1016/j.taap.2007.04.004. 33. perez-vizcaino, f.; duarte, j.; andriantsitohaina, r. endothelial function and cardiovascular disease: effects of quercetin and wine polyphenols. free radical research 2006, 40 (10), 1054-1065. doi: 10.1080/10715760600823128. arias, n.; macarulla, m. t.; aguirre, l.; martínez-castaño, m. g.; portillo, m. p. quercetin can reduce insulin resistance without decreasing adipose tissue and skeletal muscle fat accumulation. genes nutr 2014, 9 (1), 361. doi: 10.1007/s12263-013-0361-7 from nlm. 34. li, y.; yao, j.; han, c.; yang, j.; chaudhry, m. t.; wang, s.; liu, h.; yin, y. quercetin, inflammation and immunity. nutrients 2016, 8 (3), 167. 35. chen, x.; yu, j.; zheng, l.; deng, z.; li, h. quercetin and lycopene co-administration prevents oxidative damage induced by d-galactose in mice. food bioscience 2022, 50, 102042. doi: https://doi.org/10.1016/j.fbio.2022.102042. 36. gugliandolo, e.; peritore, a. f.; d’amico, r.; licata, p.; crupi, r. evaluation of neuroprotective effects of quercetin against aflatoxin b1-intoxicated mice. animals 2020, 10 (5), 898. 37. min, y. d.; choi, c. h.; bark, h.; son, h. y.; park, h. h.; lee, s.; park, j. w.; park, e. k.; shin, h. i.; kim, s. h. quercetin inhibits expression of inflammatory cytokines through attenuation of nf-κb and p38 mapk in hmc-1 human mast cell line. inflammation research 2007, 56 (5), 210-215. doi: 10.1007/s00011-007-6172-9. 38. zhang, q.-y.; pan, y.; wang, r.; kang, l.-l.; xue, q.-c.; wang, x.-n.; kong, l.-d. quercetin inhibits ampk/txnip activation and reduces inflammatory lesions to improve insulin signaling defect in the hypothalamus of high fructose-fed rats. the journal of nutritional biochemistry 2014, 25 (4), 420-428. doi: https://doi.org/10.1016/j.jnutbio.2013.11.014. jin, t.; zhang, y.; botchway, b. o. a.; huang, m.; lu, q.; liu, x. quercetin activates the sestrin2/ampk/sirt1 axis to improve amyotrophic lateral sclerosis. biomedicine & pharmacotherapy 2023, 161, 114515. doi: https://doi.org/10.1016/j.biopha.2023.114515. 39. bhatiya, m.; pathak, s.; jothimani, g.; duttaroy, a. k.; banerjee, a. a comprehensive study on the anti-cancer effects of quercetin and its epigenetic modifications in arresting progression of colon cancer cell proliferation. archivum immunologiae et therapiae experimentalis 2023, 71 (1), 6. doi: 10.1007/s00005-023-00669-w. 40. sato, s.; mukai, y. modulation of chronic inflammation by quercetin: the beneficial effects on obesity. journal of inflammation research 2020, 13, 421-431. doi: 10.2147/jir.s228361. 41. benameur, t.; soleti, r.; porro, c. the potential neuroprotective role of free and encapsulated quercetin mediated by mirna against neurological diseases. nutrients 2021, 13 (4), 1318. khan, h.; ullah, h.; aschner, m.; cheang, w. s.; akkol, e. k. neuroprotective effects of quercetin in alzheimer’s disease. biomolecules 2020, 10 (1), 59. 42. afifi, n. a.; ibrahim, m. a.; galal, m. k. hepatoprotective influence of quercetin and ellagic acid on thioacetamide-induced hepatotoxicity in rats. canadian journal of physiology and pharmacology 2018, 96 (6), 624-629. doi: 10.1139/cjpp-2017-0651 (acccessed 2023/06/09). miltonprabu, s.; tomczyk, m.; skalicka-woźniak, k.; rastrelli, l.; daglia, m.; nabavi, s. f.; alavian, s. m.; nabavi, s. m. hepatoprotective effect of quercetin: from chemistry to medicine. food and chemical toxicology 2017, 108, 365-374. doi: https://doi.org/10.1016/j.fct.2016.08.034. peng, z.; gong, x.; yang, y.; huang, l.; zhang, q.; zhang, p.; wan, r.; zhang, b. hepatoprotective effect of quercetin against lps/d-galn induced acute liver injury in mice by inhibiting the ikk/nf-κb and mapk signal pathways. international immunopharmacology 2017, 52, 281-289. doi: https://doi.org/10.1016/j.intimp.2017.09.022. 43. bondonno, n. p.; bondonno, c. p.; hodgson, j. m.; ward, n. c.; croft, k. d. the efficacy of quercetin in cardiovascular health. current nutrition reports 2015, 4 (4), 290-303. doi: 10.1007/s13668-015-0137-3. patel, r. v.; mistry, b. m.; shinde, s. k.; syed, r.; singh, v.; shin, h.-s. therapeutic potential of quercetin as a cardiovascular agent. european journal of medicinal chemistry 2018, 155, 889-904. doi: https://doi.org/10.1016/j.ejmech.2018.06.053. 44. kleemann, r.; verschuren, l.; morrison, m.; zadelaar, s.; van erk, m. j.; wielinga, p. y.; kooistra, t. anti-inflammatory, anti-proliferative and anti-atherosclerotic effects of quercetin in human in vitro and in vivo models. atherosclerosis 2011, 218 (1), 44-52. doi: https://doi.org/10.1016/j.atherosclerosis.2011.04.023. 45. rogerio, a. p.; dora, c. l.; andrade, e. l.; chaves, j. s.; silva, l. f. c.; lemos-senna, e.; calixto, j. b. anti-inflammatory effect of quercetin-loaded microemulsion in the airways allergic inflammatory model in mice. pharmacological research 2010, 61 (4), 288-297. doi: https://doi.org/10.1016/j.phrs.2009.10.005. type of the paper (article cluj vet j 2022, 27, 2 http://clujveterinaryjournal.ro review diagnostic methods used for the detection of theileria equi: review of the last decade simona giubega 1, cristian dreghiciu1, marius stelian ilie 1* and gheorghe dărăbuș1 1 banat’s university of agricultural sciences and veterinary medicine” king michael i of romania” from timisoara, faculty of veterinary medicine, 300645, 119 calea aradului, timisoara, romania * correspondence: marius.ilie@fmvt.ro abstract: theileria equi is one of the aetiological agents responsible for ep and is transmitted by ticks to horses, mules, donkeys and zebras. clinical signs are often nonspecific and can easily be confused with other pathologies. although acute, sub-acute and chronic forms have been described, the most common situation in equines is that of asymptomatic carrier, characterized by undetectable or extremely low parasitaemia and lack of clinical signs. identification of the parasitic agent, as well as the immunity acquired as a result of infection can be done by direct and indirect methods such as molecular and serological methods. this study aims to identify the most commonly used diagnostic methods of ep with the highest specificity and sensitivity and the fewest limitations. in order to achieve the aim of this study, a systematic database search was carried out, resulting, after a preliminary selection, in a total of 97 publications considered eligible. it was concluded that molecular diagnostic methods can overcome many of the limitations of traditional methods and are essential to identify and distinguish genotypes of t. equi. nonmolecular diagnostic methods may lack sensitivity and specificity, but they are still widely used and useful to support clinical and epidemiological research. keywords: theileria equi, equine piroplasmosis, pcr, celisa, blood smear. 1. introduction equine piroplasmosis (ep) is a disease of equidae caused by theileria equi, theileria haneyi and babesia caballi [1,2] transmitted by ticks to horses, mules, donkeys and zebras. infected animals can remain carriers for long periods of time and act as sources of infection for tick vectors. introducing carrier animals into an area where tick vectors exist can lead to an epizootic spread of the disease. transplacental transmission of t. equi from carrier mares to their foetuses has also been shown [3]. although acute, sub-acute and chronic forms have been described, the most common situation in equines is that of asymptomatic carriers. in the chronic form, animals show a dry symptomatology such as decreased exercise tolerance, while the carrier stage is characterized by undetectable or extremely low parasitaemia and lack of clinical signs [4]. identification of the parasitic agent can be done by direct methods, blood or stained organ smears during the acute phase of the disease and by molecular and serological methods in carrier animals, low parasite burden makes detection extremely difficult [5]. the sensitivity of microscopic examination of blood smears and smears of lymph node needle aspirates is low, so that false negative results are regularly observed [6]. the most important feature is that this method is only useful in detecting infected erythrocytes in the acute phase of the disease. several serological tests have been developed to increase the sensitivity of the diagnosis, especially in those carrier horses that show no clinical signs. these tests include the complement fixation test (cft), indirect immunofluorescence assay (ifa), western blot (wb) and competitive enzyme-linked immunosorbent assay (celisa) [5]. the cft test depends on complement activation during the specific antibody-antigen interaction. infected horses seroconvert on cft approximately 8 to 11 days after infection, and titters begin to decline at 2 to 3 months [7,8]. cft is a very specific test, but is received: 18.04.2022 accepted: 12.06.2022 published: 15.11.2022 doi:10.52331/cvj.v27i2.37 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). https://doi.org/10.52331/cvj.v27i2.37 cluj vet j 2022, 27, 2 17 of 24 not sensitive in chronic or inapparent phases of infection, mainly because some antibodies produced during these phases of infection do not bind complement [9]. ifat is thought to be more sensitive than cft during chronic infection. however, the need to dilute serum to improve specificity in ifat performance reduces sensitivity. ifat is often used as an adjuvant test to help analyse cft results [5]. sensitivity and specificity of cft and ifat for t. equi were reported differently, thus a sensitivity between 47% and 63% was reported for cft and 89-96.6% for ifat, and specificity was between 94-96% for both [10]. a method recommended and approved by the oie for international testing for equine piroplasmosis is celisa, which is considered the most sensitive test for the detection of chronic or inapparent t. equi [11,12]. the celisa technique described by commercial kit manufacturers involves binding of primary monoclonal antibodies to antigen-coated plate, binding detected using horseradish secondary peroxidase (hrp). the presence of the hrp marker of the secondary antibody is quantified by the addition of an enzyme substrate and subsequent development of the color product. a poorly developed colour is due to inhibition of binding of the primary monoclonal antibody to the solid phase antigen and indicates the presence of t. equi antibody in the serum sample. [12]. polymerase chain reaction (pcr) is a widely used method to rapidly make millions or billions of copies (full or partial copies) of a given dna sample. in conventional pcr, after amplification, pcr products or amplicons are run on agarose or page gels to detect the presence or absence of dna amplification. but in real time pcr, amplification is monitored after each pcr cycle. nested pcr is a modification of pcr that was designed to improve sensitivity and specificity and involves the use of two primer sets and two successive pcr reactions [13,14]. the basic principle of multiplex pcr is the same as that of conventional pcr, except that multiple primer pairs are required in the same reaction. primers can be specifically combined with the corresponding dna template, and more than one dna fragment will be amplified simultaneously in a single reaction [15]. the pcr technique is one of the oie recommended methods for the diagnosis ofep, suitable for: infection-free equine population, infection-free individual animal, contribution to eradication measures, confirmation of clinical cases, prevalence of infection-surveillance. several pcr diagnostic protocols are currently available, some of which are recommended by the world organisation for animal health [5]. unlike molecular diagnostic methods, serological tests have limited sensitivity and specificity. pcr help to identify asymptomatic carriers and can identify a low parasitaemia of up to 0.017 % for t. equi [16,17]. application of pcr assays, targeting ema-1 gene, bc-48 gene and 18s ribosomal rna (rrna) gene, demonstrated a higher level of analytical sensitivity and specificity than serological and microscopic detection. 2. materials and methods to achieve the aim of this study, a systematic multi-stage search of pubmed and science direct databases was conducted to identify all eligible studies. the keywords "equine piroplasmosis", "pcr", "molecular diagnosis", "theileria equi", "blood smear", "celisa" were entered. articles were selected from the period 2012 to 2022 and had as subjects the diagnosis by molecular methods and description of new protocols for molecular diagnosis of t. equi, identification of parasites by direct microscopy and serological methods. the key terms "equine" and "equine piroplasmosis" allowed the identification of studies in both horses and donkeys. after selecting papers based on titles and abstracts, studies were further analysed by detailed examination of the full text. articles that were included in the study had to meet all of the following criteria: (i) original research articles based on molecular diagnostic techniques, direct microscopy and serological methods; (ii) study conducted between 2012 and 2022; (iii) the diagnostic method must be clearly specified. cluj vet j 2022, 27, 2 18 of 24 the research resulted in 478 articles, which were subsequently checked to determine whether they met all the proposed criteria as well as to eliminate duplicates. after a preliminary screening of the studies performed a total of 97 publications were considered eligible. from 266 articles results following the introduction of the keywords molecular diagnostic and pcr, 32 were aimed at the determination of ep by molecular methods and 4 articles presenting the development and validation of a new molecular diagnostic protocol for ep (fig. 1). regarding the identification of parasite species by direct microscopy, a total of 7 articles were identified. serological diagnostic methods are frequently used in ep diagnosis, thus following the primary search in the two databases a total of 202 published articles were identified and based on the selection criteria 54 articles were considered eligible (fig. 2). 3. results one of the main objectives of this analysis was to identify the most commonly used diagnostic method with the highest specificity and sensitivity and the fewest limitations. figure 1. selection process of studies using molecular diagnostic methods of the 36 articles studied, 14 authors used nested pcr, 11 conventional pcr, 6 real time pcr and 5 multiplex pcr as molecular diagnostic methods. following the analysis of the 4 articles based on the development and validation of a new molecular di-agnostic protocol, it was concluded that 2 articles aimed to develop a new real time pcr protocol, one conventional pcr and one nested pcr. the primers and probes, in the case of real time pcr, used were selected by the authors according to the targeted genes, namely 18s rrna as well as bc48 (b. caballi) and ema-1 (t. equi) genes. table 1. primers and probe used in the articles studied no primers probe refer-ence 1 gtaattccagctccaatag aaagtccctctaagaagc ttcgttgactgcgcttggcg ctaagaagcggaaatgaaa [18] 2 tcgaagacgatcagataccgtcg tgccttaaacttccttgcgat [19] 3 gaaaytgcgaatggctcattam caccggatcactcgatcggtagg ggataaccgtgstaattstagggc gtgtgtacaaagggcagggacg [19] 4 5′tcgaagacgatcagataccgtcg-3′ 5′tgccttaaacttccttgcgat-3′ [20] cluj vet j 2022, 27, 2 19 of 24 5 gcatccattgccatttcgag tgcgccatagacggagaagc aatgttgagcaagtccttcg ttagtagaacaaagcaacggc [21] 6 5' ggt tga tcc tgc cag tag t-3’ 5' ttg cga cca tac tcc ccc ca-3’ [22] 7 5′gtcttgtaattggaatgatgg-3′ 5′-tagtttatggttaggactacg-3′ [23] 8 5′-tcgacttccagttggagtcc-3′ 5′-agctcgacccacttat cacc-3′ 5′attgaccacgtcaccat cga-3′ 5′-gtccttcttgagaacgaggt-3′ [24] 9 5’ctgactacaaggtygtatac-3’ 5’-tgtcgtcacttagtaaaataga -3’ teema1-p 6-famttctccgtctatggcgcamgbnfq [25] 10 5'aagccatgcatgtctaagtataagctttt-3' 5'gaataattcaccggatcactcg-3' [26] 11 5‟ttcgttgactgcgcttggcg-3‟ 5‟-ctaagaagcggaaatgaaa-3‟ [27] 12 5´tcgaagacgatcagataccgtcg-3´, 5´-ctcgtt catgatttagaattgct-3´ 5´-tgccttaaac ttccttgcgat-3´ [28] 13 5’ -cga tcc cct atc agc c-3’ 5’ -tcc tta gat aga tgg tgt tgg-3’ 5’ -ttc tgg tgt tga caa cat gac tac tg-3’ [29] 14 5’ -gcg gtg ttt cgg tga ttc ata-3’ 5’ -tga tag gtc aga aac ttg aat gat aca tc-3’ 5’ -aaa tta gcg aat cgc atg gct t-3’ [29] 15 tcg act tcc agt tgg agt cc agc tcg acc cac tta tca c att gac cac gtc acc atc ga gtc ctt ctt gag aac gag gt [30] 16 5′ − ccg tgc taa ttg tag ggc taa tac a-3′ 5′ -gct tga aac act cta rtt ttc tca aag -3′ [31] 17 5′ cca tacaacccactagag 3′, 5′ ctgtcatttgggtttgatag 3′, 5′ gacaacagagaggtgatt 3′, 5′ cgttgaatgta atgggaac 3′ [32] cluj vet j 2022, 27, 2 20 of 24 figure 2. selection process of studies using serological diagnostic methods. of the 54 articles identified based on serological diagnostic methods, 18 used celisa as the diagnostic method and 36 achieved the aim of the study by at least two diagnostic methods, one of which was celisa. identification of parasite species by direct microscopy was identified as one of the diagnostic methods used in 7 articles. in one study it was used as the only method, while in 6 articles it was used together with elisa or pcr. 4. discussion t. equi, one of the main pathogens causing ephas previously been subclassified into a number of clades based on sequence diversity of the 18s ssu rrna gene. current methods for clade-level genotyping of t. equi are laborious, pcr products must be generated, purified and sent for sanger sequencing, and the presence of multiple allelic types in samples requires an additional molecular cloning step [22]. the 18s rrna gene is a widespread target because nucleotide substitution rates are low and there is no evidence of lateral gene transfer between genetic lines [31]. despite these facts, it can be observed that variable regions of this gene are often used for phylogenetic studies, in particular the 18s rrna gene of t. equi, which has shown a high degree of sequence heterogeneity in different regions of the world [34]. after a primary infection with t. equi animals remain infected and become asymptomatic carriers with fluctuating levels of parasitaemia, a lifelong stage. because parasitaemia levels fluctuate throughout the lifetime of the animal, the sensitivity of the duplex qpcr assay could be further improved by serial testing of initial celisa positive/ qpcr negative tests [25]. in romania, the first study using pcr on ep prevalence was conducted by gallusová et al. in 20102012, which resulted in a prevalence of 25.4% for both piroplasma species from 18 localities inside and outside the danube delta [35]. it is important to note that different genotypes of t. equi (referred to as a-e) circulate in europe, which may ultimately explain some differences in prevalence between countries, even though no link between genotype and virulence has been established so far [36]. in a study by ribeiro et al. (2013), a 52% prevalence for t. equi infection was detected following pcr examination of 25 blood samples collected by jugular vein puncture and splenic puncture, respectively. the results of the study showed that 20% of the animals examined were positive in splenic puncture but negative in venous blood, while 28% were positive in jugular vein blood but negative in splenic puncture. asymptomatic horses did not show parasitaemia but had infected erythrocytes in the spleen [37]. development and validation of a new qpcr diagnostic protocol targeting the ema-1 gene for t. equi and18s rna for b. caballi was performed by lobanov et al. (2018) demonstrating 100% specificity. in comparison, the samples under study were examined by both duplex qpcr and elisa. different results were cluj vet j 2022, 27, 2 21 of 24 obtained for b. caballi by the two methods respectively 7.9% by qpcr and 58.6% by elisa, which can be explained by the fact that b. caballi is eliminated after a period of time [25]. a study by vieira et al. (2017) showed that 13.33% of seronegative tested animals were positive by pcr and 7.8% with negative pcr result were positive by elisa. in this study, 7 horses were positive for t. equi by elisa and negative for t. equi by npcr. these are likely to be chronically infected carrier animals in which parasitaemia is below the detection threshold of molecular diagnostic techniques. a low and longlasting parasitaemia could stimulate the immune system in animals that maintain serum antibodies at detectable levels [26]. camino et al. (2019) performed a comparison between results obtained by several diagnostic methods namely celisa, real time pcr, microscopic examination and haematological and biochemical screening. the study was carried out on 140 equines with specific clinical signs of ep and reported a prevalence of 9% by microscopic examination, while by celisa and pcr the prevalence was 50.7% and 42.9% respectively [38]. another study conducted in iran by abedi et al. (2019) on 106 apparently healthy horses resulted in a prevalence of 3.77% by direct microscopy and 50.94% by pcr. salinas-estrella et al. (2022) compared in a study the results obtained by npcr and duplex qpcr concluding that there was a relatively low concordance between npcr and duplex qpcr for both piroplasma species and that it is also important to repeat the tests in serologically positive and molecularly negative animals and vice versa [39]. ybañez et al. (2018) used blood smear, immunochromatographic test (ict) and pcr as diagnostic methods for 105 philippine horses, resulting in 23 animals positive for t. equi by ict, 26 by pcr and no positive animals after examination of blood smears [24]. the celisa technique is one of the most commonly used diagnostic methods in the diagnosis of ep being able to identify both carrier stage and acute infections, it is also simpler and less expensive than molecular techniques, but can still give false negative or false positive reactions, having a sensitivity of 95% and specificity of 99.5% [10]. because seropositive animals in an asymptomatic population are not an indicator of recent or active infection, several authors have also tested seropositive samples by molecular methods to confirm or refute the presence of the piroplasm genome [40-46]. the use of direct microscopy as one of the diagnostic methods was identified in 7 of the articles reviewed. positive results were presented in 4 studies [47,48,49] while for 3 articles the authors reported that no parasites were identified by this method [50,51,52]. the smear, from blood or lymph node, is a traditional method of agent identification in infected animals, but it is increasingly less used due to low specificity. the percentage of erythrocytes and leukocytes infected, in the clinical phase of the disease, with clinically expressed t. equi is between 1 and 5%, making identification on smear difficult [47]. microscopic examination of smears is classified by the oie as not suitable for testing the infection-free equine population and for use in contributing to eradication measures. this method is suitable in very limited circumstances for testing an individual infection-free animal, but is recommended with limitations for clinical confirmation of cases of ep [5]. 5. conclusions identification of the parasitic agent or infection can be done by direct methods, blood or lymph node smears during the acute phase of the disease, and by molecular and serological methods when in carrier animals the low parasite load makes detection extremely difficult. although some diagnostic methods may lack sensitivity and specificity, they are still widely used and useful to support clinical and epidemiological research. of all available serological methods, elisa is the technique with the highest sensitivity and specificity, suitable for studying the prevalence of t. equi infections in equine populations. serological methods are more sensitive compared to other diagnostic methods (clinical examination and direct microscopy) used, but even these techniques have limitations, e.g. they are not able to differentiate between current and previous infections. molecular diagnostic methods can overcome many of the limitations of other techniques and are essential to identify and distinguish genotypes of t. equi. cluj vet j 2022, 27, 2 22 of 24 author contributions: conceptualization, s.g. and m.s.i.; methodology, s.g. and m.s.i.; validation, m.s.i., s.g. and c.d.; investigation, s.g. and c.d.; resources, s.g. and c.d data curation, s.g. and m.s.i.; writing—original draft preparation, s.g. and m.s.i.; writing—review and editing, g.d. and m.s.i.; visualization, m.s.i. and g.d.; supervision, g.d. all authors have read and agreed to the published version of the manuscript”. funding: this research received no external funding. conflicts of interest: the authors declare no conflict of interest. references 1. knowles, d.p.; kappmeyer, l.s.; haney, d.; herndon, d.r.; fry, l.m.; munro, j.b.; sears, k.; ueti, m.v.; wise, l.n; silva, m.; schneider, d.a.; grause, j.; white, s.n.; tretina, k.; bishop, r.p.; odongo, d.o.; pelzel-mccluskey, a.m.; scoles, g.a.; mealey, r.h.; silva, j.c. discovery of a novel species, theileria haneyi n. sp., infective to equids, highlights exceptional genomic diversity within the genus theileria: implications for apicomplexan parasite surveillance. int j parasitol., 2018, 48(9-10):679-690. 2. elsawy, b.s.m.; nassar, a.m.; alzan, h.f.; bhoora, r.v.; ozubek, s.; mahmoud, m.s.; kandil, o.m.; mahdy, o.a. rapid detection of equine piroplasms using multiplex pcr and first genetic characterization of theileria haneyi in egypt. pathogens 2021, 10, 1414. 3. phipps, l.p.; otter, a. transplacental transmission of theileria equi in two foals born and reared in the united kingdom. vet rec., 2004, 154:406–8. 4. torres, r.; hurtado, c.; pérez-macchi, s.; bittencourt, p.; freschi, c.; de mello, v.v.c.; machado, r.z.; andré, m.r.; müller, a. occurrence and genetic diversity of babesia caballi and theileria equi in chilean thoroughbred racing horses. pathogens, 2021, 10(6):714. 5. oie, terrestrial manual, chapter 3.6.8, equine piroplasmosis, available online: https://www.oie.int/fileadmin/home/eng/health_standards/tahm/3.06.08_equine_piroplasmosis.pdf (accessed on 03.03.2022). 6. wagner, g.; cruz, d.; holman, p.; waghela, s.; perrone, j.; shompole, s.; rurangirwa, f. non-imunologic methods of diagnosis of babesiosis, mem. inst. oswaldo cruz, rio de janeiro, 1992, vol. 87, suppl iii, 193-199 7. oladosu, l. a.; olufemi, b. e. haematology of experimental babesiosis and ehrlichiosis in steroid immunosuppressed horses. zentralblatt fur veterinarmedizin. reihe b. journal of veterinary medicine, 1992, series b, 39(5), 345–352. 8. de waal, d. t.; van heerden, j.; van den berg, s. s.; stegmann, g. f.; potgieter, f. t. isolation of pure babesia equi and babesia caballi organisms in splenectomized horses from endemic areas in south africa. the onderstepoort journal of veterinary research, 1988, 55(1), 33–35. 9. lewis, m. j.; wagner, b.; woof, j. m. the different effector function capabilities of the seven equine igg subclasses have implications for vaccine strategies. molecular immunology, 2008, 45(3), 818–827. 10. alanazi, a. d.; alyousif, m. s.; hassieb, m. m. (2012). seroprevalence study on theileria equi and babesia caballi antibodies in horses from central province of saudi arabia. journal of parasitology, 98(5), 1015–1017 11. deepak, s.; moudgil, a.d.; singla, l.d. equine piroplasmosis: current status. veterinaria, 2014; 2(1): 9-14. 12. https://vmrd.com/test-kits/detail/theileria-equi-antibody-test-kit-celisa/ (accessed on 23.02.2022). 13. nardini, r.; bartolomé del pino, l. e.; cersini, a.; manna, g.; viola, m. r.; antognetti, v.; autorino, g. l.; scicluna, m. t. comparison of pcr-based methods for the detection of babesia caballi and theileria equi in field samples collected in central italy. parasitology research, 2021, 120(6), 2157–2164. 14. mcpherson, r.a.; pincus, m. r. henry's clinical diagnosis and management by laboratory methods polymerase chain reaction and other nucleic acid amplification technology, state university of new york downstate medical center, brooklyn, new york, 2022, (69) 1271-1281. 15. chifiriuc, m. c.; gheorghe, i.; czobor, i.; florea, d.a.; mateescu, l.; caplan, m.e.; caplan, d. m; lazar, v. advances in molecular biology based assays for the rapid detection of food microbial contaminants, , food preservation, 2017. 16. ferreira, e.p.; vidotto, o.; almeida, j.c.; ribeiro, l.p.s.; borges, m.v.; pequeno, w.h.c.; stipp, d.t.; de oliveira, c.j.b.; biondo, a.w.; vieira, t.s.w.j.; et al. serological and molecular detection of theileria equi in sport horses of northeastern brazil. comp. immunol. microbiol. infect. dis. 2016, 47, 72–76 17. butler, c. can theileria equi be eliminated from carrier horses? vet. j. 2013, 196, 279. 18. torres, r.; hurtado, c.; pérez-macchi, s.; bittencourt, p.; freschi, c.; de mello, v.v.c.; machado, r.z.; andré, m.r.; müller, a. occurrence and genetic diversity of babesia caballi and theileria equi in chilean thoroughbred racing horses. pathogens, 2021, 10(6):714. 19. zhao, s.; wang, h.; zhang, s.; xie, s.; li, h.; zhang, x.; jia, l. first report of genetic diversity and risk factor analysis of equine piroplasm infection in equids in jilin, china. parasit vectors. 2020, 13(1):459. 20. onyiche, t.e.; taioe, m.o.; ogo, n.; sivakumar, t.; biu, a.a.; mbaya, a.w.; xuan, x.; yokoyama, n.; thekisoe, o. molecular evidence of babesia caballi and theileria equi in equines and ticks in nigeria: prevalence and risk factors analysis. parasitology, 2020,147(11):1238-1248. 21. sunday idoko i.; tirosh-levy s.; leszkowicz m. m.; mohammed a. b.; sikiti g. b.; wesley nafarnda d.; steinman a. genetic characterization of piroplasms in donkeys and horses from nigeria. animals (basel). 2020 feb 18;10(2):324 cluj vet j 2022, 27, 2 23 of 24 22. coultous, r.m.; mcdonald, m.; raftery, a.g.; shiels, b.r.; sutton, d.g.m.; weir, w. analysis of theileria equi diversity in the gambia using a novel genotyping method. transbound emerg dis. 2020, 67(3):1213-1221. 23. chisu, v.; alberti, a.; zobba, r.; foxi, c.; masala, g. molecular characterization and phylogenetic analysis of babesia and theileria spp. in ticks from domestic and wild hosts in sardinia. acta trop. 2019, 196:60-65. 24. ybañez, a.p.; ybañez, r.h.d.; talle, m.g.; arreglo, r.m.t.; geens, m.j.c.; villas, j.g.i. 3rd.; villar, s.r.; laruga, c.l.; cao, s.; moumouni, f.p.a.; liu, m.; igarashi, i.; xuan, x. serological and molecular detection of theileria equi and babesia caballi in philippine horses. ticks tick borne dis. 2018, 9(5):1125-1128. 25. lobanov, v.a.; peckle, m.; massard, c.l.; brad scandrett, w.; gajadhar, a.a. development and validation of a duplex realtime pcr assay for the diagnosis of equine piroplasmosis. parasit vectors. 2018, 11(1):125. 26. vieira, m.; costa, m. m.; de oliveira, m. t.; gonçalves, l. r.; andré, m. r.; machado, r. z. serological detection and molecular characterization of piroplasmids in equids in brazil. acta tropica, 2018, 179, 81–87. 27. sumbria, d.; singla, l.d.; sharma, a.; bal, m.s.; randhawa, c.s. molecular survey in relation to risk factors and haematobiochemical alteration in theileria equi infection of equines in punjab province, india. vet parasitol reg stud reports. 2017, 8:43-50. 28. malekifard, f.; tavassoli, m.; yakhchali, m.; darvishzadeh, r. detection of theileria equi and babesia caballi using microscopic and molecular methods in horses in suburb of urmia, iran. vet res forum. 2014, 5(2):129-33. 29. alanazi, a.d.; said, a.e.; morin-adeline, v.; alyousif, m.s.; slapeta, j. quantitative pcr detection of theileria equi using laboratory workflows to detect asymptomatic persistently infected horses. vet parasitol. 2014, 206(3-4):138-45. 30. sebastian, p.s.; benitez-ibalo, a.p.; flores, f.s.; debárbora, v.n.; martinez, e.i.; thompson, c.s.; mangold, a.j. molecular detection and phylogenetic characterization of theileria equi in horses (equus caballus) from a peri-urban area of argentina. ticks tick borne dis. 2021, 12(6):101810. 31. romero-salas, d.; solis-cortés. m.; zazueta-islas, h.m.; flores-vásquez, f.; cruz-romero, a.; aguilar-domínguez, m.; salguero-romero, j.l.; de león, a.p.; fernández-figueroa, e.a.; lammoglia-villagómez, m.á.; becker, i.; sánchez-montes, s. molecular detection of theileria equi in horses from veracruz, mexico. ticks tick borne dis. 2021, 12(3):101671. 32. sears, k.p.; kappmeyer, l.s.; wise, l.n.; silva, m.; ueti, m.w.; white, s.; reif, k.e.; knowles, d.p. infection dynamics of theileria equi and theileria haneyi, a newly discovered apicomplexan of the horse. vet parasitol. 2019, 271:68-75. 33. allsopp, m.t.e.p.; allsopp, b.a. molecular sequence evidence for the reclassification of some babesia species. ann. n.y. acad. sci. 2006, 1081, 509–517. 34. peckle, m.; pires, m.s.; silva, c.b.d.; costa, r.l.d.; vitari, g.l.v.; senra, m.v.x.; dias, r.j.p.; santos, h.a.; massard, c.l. molecular characterization of theileria equi in horses from the state of rio de janeiro, brazil. ticks tick borne dis. 2018, 9(2):349-353. 35. gallusova, m.; qablan, m. a.; d'amico, g.; obornik, m.; petrzelkova, k. j.; mihalca, a. d.; modry, d. piroplasms in feral and domestic equines in rural areas of the danube delta, romania, with survey of dogs as a possible reservoir. veterinary parasitology, 2014, 206(3-4), 287-292. 36. tirosh-levy, s.; gottlieb, y.; fry, l.m.; knowles, d.p.; steinman, a., twenty years of equine piroplasmosis research: global distribution, molecular diagnosis, and phylogeny. pathogens 2020,9, 926. 37. ribeiro, i.b.; câmara, a.c.; bittencourt, m.v.; marçola, t.g.; paludo, g.r.; soto-blanco, b. detection of theileria equi in spleen and blood of asymptomatic piroplasm carrier horses. acta parasitol. 2013, 58(2):218-22. 38. camino, e.; cruz-lopez, f.; de juan, l.; dominguez, l.; shiels, b.; coultous, r.m. phylogenetic analysis and geographical distribution of theileria equi and babesia caballi sequences from horses residing in spain. ticks tick borne dis. 2020, 11(6):101521. 39. salinas-estrella, e.; ueti, m. w.; lobanov, v. a.; castillo-payró, e.; lizcano-mata, a.; badilla, c.; martínez-ibáñez, f.; mosqueda, j. (serological and molecular detection of babesia caballi and theileria equi in mexico: a prospective study. plos one, 2022, 17(3), e0264998. 40. bělková, t.; bártová, e.; řičařová, d.; jahn, p.; jandová, v.; modrý, d.; hrazdilová, k.; sedlák, k. theileria equi and babesia caballi in horses in the czech republic. acta trop. 2021, 221:105993. 41. coultous, r.m.; leadon, d.p.; shiels, b.r.; sutton, d.; weir w. investigating the presence of equine piroplasmosis in ireland. veterinary record. 2020, 187(11): e97. 42. bartolomé del pino, l.e.; nardini, r.; veneziano, v.; iacoponi, f.; cersini, a.; autorino, g.l.; buono, f.; scicluna, m. babesia caballi and theileria equi infections in horses in central-southern italy: sero-molecular survey and associated risk factors. ticks tick borne dis. 2016, 7(3):462-9. 43. laus, f.; spaterna, a.; faillace, v.; veronesi, f.; ravagnan, s.; beribé, f.; cerquetella, m.; meligrana, m.; tesei, b. clinical investigation on theileria equi and babesia caballi infections in italian donkeys. bmc veterinary research, 2015, 11:100 44. moretti, a.; mangili, v.; salvatori, r.; maresca, c.; scoccia, e.; torina, a.; moretta, i.; gabrielli, s.; tampieri, m.p.’ pietrobelli, m., prevalence and diagnosis of babesia and theileria infections in horses in italy: a preliminary study. veterinary journal. 2010, 184(3):346-50. 45. grandi, g.; molinari, g.; tittarelli, m.; sassera, d.; kramer, l.h. prevalence of theileria equi and babesia caballi infection in horses from northern italy, vector borne zoonotic dis. 2011, 11(7):955-6. 46. butler, c. m.; sloet van oldruitenborgh-oosterbaan, m. m.; stout, t. a.; van der kolk, j. h.; wollenberg, l. v.; nielen, m.; jongejan, f.; werners, a. h.; houwers, d. j. prevalence of the causative agents of equine piroplasmosis in the south west cluj vet j 2022, 27, 2 24 of 24 of the netherlands and the identification of two autochthonous clinical theileria equi infections. veterinary journal, 2012, 193(2), 381–385. 47. padalino, b.; rosanowski, s. m.; di bella, c.; lacinio, r.; rubino, g. piroplasmosis in italian standardbred horses: 15 years of surveillance data. journal of equine veterinary science, 2019, 83, 102813. 48. díaz-sánchez, a. a.; pires, m. s.; estrada, c. y.; cañizares, e. v.; del castillo domínguez, s. l.; cabezas-cruz, a.; rivero, e. l.; da fonseca, a. h.; massard, c. l.; corona-gonzález, b. first molecular evidence of babesia caballi and theileria equi infections in horses in cuba. parasitology research, 2018, 117(10), 3109–3118. 49. abedi, v.; razmi, g.; seifi, h.; naghibi, a. molecular detection of equine piroplasms in donkeys (equus asinus) in north khorasan province, iran. iranian journal of veterinary research, 2015, 16(2), 202–204. 50. campos, j.; andré, m. r.; gonçalves, l. r.; freschi, c. r.; santos, f. m.; de oliveira, c. e.; piranda, e. m.; de andrade, g. b.; macedo, g. c.; machado, r. z.; herrera, h. m. assessment of equine piroplasmids in the nhecolândia sub-region of brazilian pantanal wetland using serological, parasitological, molecular, and hematological approaches. ticks and tickborne diseases, 2019, 10(3), 714–721. 51. nugraha, a. b.; cahyaningsih, u.; amrozi, a.; ridwan, y.; agungpriyono, s.; taher, d. m.; guswanto, a.; gantuya, s.; tayebwa, d. s.; tuvshintulga, b.; sivakumar, t.; yokoyama, n.; igarashi, i. serological and molecular prevalence of equine piroplasmosis in western java, indonesia. veterinary parasitology, regional studies and reports, 2018, 14, 1–6. 52. souza, e.; araujo, a. c.; pires, l.; freschi, c. r.; azevedo, s. s.; machado, r. z.; horta, m. c. serological detection and risk factors for equine piroplasmosis in the semiarid region of pernambuco, northeastern brazil, brazilian journal of veterinary parasitology, 2019, 28(4), 685–691. 1. introduction 2. materials and methods 3. results reference probe primers no 1 [18] 2 3 [19] 4 5 6 7 8 teema1-p 6-fam-ttctccgtctatggcgca-mgbnfq 9 10 11 12 4. discussion 5. conclusions references 33 the social context of contact calls by rooks (corvus frugilegus) alexandru munteanu*, dvm professor ionel papuc*, phd ira g. federspiel**, phd professor nicola s. clayton***, phd nathan j. emery**, md abstract communication is the link between individuals of one species and represents the essence of social life. vocal communication is one of the most studied forms of information exchange, although it also comes with interspecific barriers that are still tricky to overcome. while we are able to understand the meaning of another human’s words, we fail to understand an animal’s utterances. among these, bird song has become a field of particular interest. however, little is known yet about many species’ vocalizations, and even less about their significance or how different factors influence them. the presented study establishes the vocal repertoire of a group of rooks and further investigates the importance of contact calls between partners in an experiment. we found that test subjects and other group members produced more contact calls after than before partners had been separated from each other, indicating stress induced by physical isolation and/or the lack of visual contact as an important factor influencing the call frequency. separating certain individuals seemed to affect the group differently, which indicates that the ‘importance’ of the animal to the group influences the group call rate. in this study, we have shown how social and environmental factors play a role in vocal communication in birds. key words: rooks, corvus frugilegus, contact calls, birds, communications introduction communication is all around us, we are all familiar with how to ‘do it’, and it is something that could not occur without social contact with others (mcgregor 2005). but communication is not restricted to humans, all other animals also engage in various forms of communication, from vocal to tactile communication to using chemical cues. over the last few decades the field of animal vocal communication has experienced a revolution in terms of methods and feasibility (catchpole & slater 2008). whereas before that, people had to draw spectrograms by hand, nowadays computers with * university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine cluj-napoca, discipline of semiology, ethology and diagnostic imaging ** sub-department of animal behaviour, department of zoology, university of cambridge *** department of experimental psychology, university of cambridge cluj veterinary journal, 15(1)/2009, pp. 33-43 34 intricate software do all the hard work, enabling researchers to focus on more important aspects of communication rather than trying to improve the methods for studying it. with the programs available to us nowadays, we are certainly getting closer and closer to disentangling the various small pieces that make up a bout of communication, i.e. ‘conversations’ between two or more beings, and in a few cases even understand ‘referential’ communication, e.g. alarm calls in a situation of arousal when a predator is close by or begging calls produced by an animal that sees another carrying food and wants to gain some of it. even so, we may never really know for sure what goes on in the mind of another animal, how other animals perceive the outside world (nagel 1974), or even what they mean when they produce vocalizations, because of the fundamental differences between our minds’ mechanisms (quine 1973). one of the various smaller fields in animal communication that people have started working on extensively is bird song (e.g. black-capped chickadees, poecile atricapillus: avey 2008; tyrant flycatchers, tyrannidae: hughes 2008; eurasian jays, garrulus glandarius: goodwin 1949), although the vocal repertoire has also been explored in mammals like degus, octodon degus (long 2007). generally, bird vocalizations are divided into songs – long, complex and spontaneous vocalizations that are commonly produced by males mainly during the breeding season – and calls – much shorter vocalizations that are produced by both sexes, throughout the year (catchpole & slater 2008). the latter ones are given in certain contexts like danger, aggressive display or food desire and thus can be alarm calls, threat calls or begging calls. the smallest structural units of bird songs and calls, named elements or notes, are in fact sounds that, combined in a certain way, form syllables, and syllables in turn are combined to make up phrases (catchpole & slater 2008). a song may consist of a varying amount of the same or different phrases. a big advantage of vocal over non-vocal communication is that it uses sound as a means of communicating in situations where visibility is low or the distances are long (catchpole & slater 2008). sound is also a fast carrier of large amounts of information. perhaps the energetic cost of sound production could be considered a disadvantage, but recent studies have shown that it is less expensive than other activities, such as flying (oberweger & goller 2001, ward et al. 2004). having advantages that outweigh the cost, vocal communication thus seems to be the most suitable way of communicating for birds. to pinpoint the meaning of vocalizations, one usually starts by combining observations of the bird’s social relationship, interactions with its environment and recording calls and songs (struhsaker 1967). this enables a better understanding of the context and thus of the meaning of a certain vocalization. however, grasping the whole range of utterances of one species is difficult to achieve, since there is a lot of variation, even between populations of the same species, stemming from different selective pressures and constraints working on their development, production, transmission and de tection (ryan & brenowitz 1985). a study with ravens (corvus corax) suggests that vocalizations may very well vary even within populations, with new calls emerging and others being lost over time (enggistduebelin & pfister 2002). therefore, one can only attempt to categorize as many different song or call types as possible, either by collecting observational data and sound recordings or by conducting experiments tailored to look at a certain vocalization and how it changes in different contexts. rooks are members of the corvus genus, the biggest and most widespread of the corvidae family. consisting of 48 species, this genus also includes ravens, crows, jays, magpies, and jackdaws (grzimek b. 2002). observations show that the typical crows of the corvus genus are characterized by a spectacular black plumage with metallic iridescence, food caching abilities, complex social 35 interactions and hoarse voices, although still little remains known about their vocalizations. hardy (1979) in a study on black and blue jays (cissilopha) hypothesized that social species produce a wider range of vocalizations than solitary-living species, a theory launched after studying and establishing the vocal repertoire of four closely related species of the cyanocorax genus, in relation to their social habits. we would therefore expect to find a rich vocal repertoire in rooks (corvus frugilegus), since it is a very social species, breeding and foraging close together in colonies and gathering at communal roosting sites (røskaft & espmark 1982). using the approach described above and combining observations with recordings, in the present study we tried to determine the different call types making up our rooks’ vocal repertoire. further investigating the importance of one of the vocalizations, the contact call, we then conducted an experiment that looked at how the context can influence a vocalization. materials and methods subjects and housing in this study we used a group of eight rooks aged 6 years. the group consisted of five females and three males. for individual identification, they had been banded with coloured rings. all individuals were taken from the wild at a young age and hand-reared in captivity. the rooks were kept in a large outdoor aviary at the sub-department of animal behaviour in madingley, uk, measuring 10 x 8 x 4 meters (length, width, height). the aviary consisted of two main compartments, similar in dimensions, separated from each other by a central small compartment. procedure the present study consisted of two parts, each being designed to answer a different question: observations and an experiment. with the observations we wanted to establish the repertoire of rook vocalizations and determine the sex and individual differences in the calls; the experiment looked at the call frequency and call morphology differences between the test subject, its partner, and all other individuals. for both parts, a canon md 101 digital video camrecorder and a dell laptop with integrated sigmatel stereo microphone array (sigmatel high definition audio codec) were used to make video and audio recordings. observations we recorded vocalizations of all eight rooks over a period of 7 weeks (july-august 2008) for an average time of 1 to 2½ hours at different times of the day in order to avoid a possible bias caused by the time of day (e.g. influences of motivation or the nutritional status of the birds). the recordings’ sample rate was of 44100 samples per second, with a resolution of 16 bits per sample and a stereo channel format. the recorded frequency ranged from 0 to 22000 hz. the audio files were stored in uncompressed wave format. after each vocalization notes regarding individual id, time of vocalization, context of the vocalization, parallel behaviour accompanying the vocalization, distance to and visual contact with the partner and other members of the group and the subsequent vocalizations and parallel behaviour of the partner and other group members were taken. the vocalizations were classified into: neutral, agonistic (negative) and affiliative (positive). experiment the experiment was conducted in july and august 2008. each pair was only tested once a day, but in total received four test sessions: two sessions in two different conditions (see fig. 1 and fig. 2). the order in which the pairs were tested and the order in which the partners were isolated from the group on the other side of the aviary was pseudo randomized. 36 before each session, the birds were familiarized with the experimenter’s presence. in both conditions, each session consisted of three phases, each of 10 minutes length: a pre-separation phase ((1) in fig. 1 and 2), a separation phase ((2) in fig. 1 and 2) and a post-separation phase, i.e. reunion of the partners in the group ((3) in fig. 1 and 2). during the pre-separation phase, both partners were in the group and could move around freely; at the beginning of the separation phase, experimenter 2 separated one or both partners from the group and at the end of the phase, the partners were reunited in the group for phase 3, a control phase. in condition 1, one of the individuals was physically, but not visually isolated from its partner and the rest of the group during phase 2 (fig. 1). fig. 1. condition 1. arrows show the three phases of the experiment: (1) pre-separation, (2) separation of the test subject (partner stays with group), (3) post-separation. the recording device is indicated by a square, experimenters are represented by figures. dashed lines indicate wire mesh. fig. 2. condition 2. the set up is the same as in condition 1, with an exception during the separation phase (2), where both partners were separated from the group. solid lines represent visually isolated compartments, dashed lines indicate wire mesh. in condition 2, both partners were physically isolated from the group and each other. in addition, one was also visually isolated in the small compartment, while the other one could still see the group (fig. 2). 37 the latter condition was conducted to control for the influence of the group on the partner that stayed with the group in condition 1. in both conditions, observations of the group (including one of the partners in condition 1) were taken by experimenter 1, whereas observations of the separated subject(s) during phase 2 were taken by experimenter 2 from outside the aviary. data analysis the dominance hierarchy was calculated with matman on the basis of observed displacements (i.e. a bird retreats after having been approached by another). we used 10,000 randomizations and calculated the landau's linearity index (h) and the directional consistency index to determine linearity of the hierarchy and the consistency of the result of the calculation (both indices lie between 1 and 0). an h of 1 indicates a linear hierarchy, whereas 0 point towards an ever-changing hierarchy. for the analysis of the different call types, the vocalizations were extracted from the main recorded sound file, saved as wave files with the same format and added into a library, with the different call types categorized for each bird. video data was then transferred onto the computer and analyzed together with data from the observation sheets. in order to save disk space and for easier storage the raw videos were then compressed using microsoft windows movie maker in windows media video file format with a 3 mb/s bit rate quality, preserving the original display size (720 x 480 pixels), aspect ratio (4:3), frames per second (30) and audio quality (16 bits per sample). for recording, editing and analysis we used the following programs: acoustica premium (version 4.1.0, acon digital media gmbh, 1994-2008), avisoft-saslab pro (version 4.40, avisoft bioacoustics, 1990-2008), windows movie maker (version 6.0, microsoft corporation); for statistical analysis we used spss 16.0 (spss inc., 1989-2006). using a spectrogram generated in avisoft, we analyzed the following parameters: temporal parameters (duration of element, interval between elements, distance from start to maximum), sub-elements (number of elements), spectrum-based parameters (peak frequency, peak amplitude, fundamental frequency, minimum frequency, maximum frequency, frequencies of peaks, amplitude of peaks), locations of measurements (start of element, end of element, centre of element, maximum amplitude of element, mean spectrum of entire element, minimum parameter of entire element, maximum parameter of entire element). for classifying the vocalizations into different call types and looking at individual and sex differences, we used cluster analyses, mann-whitney u tests and kruskal-wallis tests. for analysing the number of contact calls given in the experiment, we calculated the average call number per individual across the two test sessions (separately for each condition) to rule out influences of the weather, the ‘mood’ of the birds, nutritional status etc. for analyses involving the ‘other’ six group members we did the same but also divided the number obtained by 6 (the total number of the birds excluding the test subject and the partner). we used friedman anovas and wilcoxon matched pairs tests. all tests were nonparametric, twotailed, and alpha was set at 0.05. results dominance hierarchy the dominance hierarchy in the group was as follows: plato (white ring) > linnaeus (purple ring) > mackintosh (red ring) > einstein (yellow ring) > darwin (green ring) > aristotle (red and blue rings) > da vinci (blue ring) > huxley (orange ring) (h=0.65, directional consistency index=0.98). 38 vocal repertoire we have established that the rook vocal repertoire consisted of nine structurally different calls, and several more variants. we have determined the function of three calls and have named them accordingly: contact and alarm calls, begging call, and submission calls. the remaining 6 calls and variants were named according to their acoustic similarity with other sounds: ‘rattle’, ‘purr’, ‘click’, ‘hick-up’, ‘scream’, and ‘monkey’ calls. contact and alarm calls were the most common call vocalized by the group and were in fact the same call but used in different situations. examples of some of the calls can be seen in figures 3, 4, 5, 6, 7, 8. do the test subjects, their partners or the other birds vocalize more before, during or after the separation? in both conditions, we found a significant difference between the average number of calls test subjects gave before, during and after the separation (friedman anova: condition 1: n=6, χ2=6.09, p=0.048; condition 2: n=6, χ2=8.34, p=0.016; fig.9). to determine the origin of the significant result, we conducted post-hoc wilcoxon matched pairs tests. these revealed more calls of the test subject after than before the separation in both conditions (condition 1: n=6, z=2.20, p=0.028; condition 2: n=6, z=2.02, p=0.043) and more calls after than during the separation in condition 2 (n=6, z=2.02, p=0.043). furthermore, a significant difference was found for the other group members in both conditions (friedman anova: condition 1: n=6, χ2=7.60, p=0.022; condition 2: n=6, χ2=6.34, p=0.042; fig.10). in both conditions, they produced more calls during the separation of an individual than before (wilcoxon matched pairs tests: condition 1: n=6, z=2.20, p=0.028; condition 2: n=6, z=1.99, p=0.046) and also more after than before the 5 10 15 20 khz 0.2 s 5 10 15 20 khz 0.2 0.4 0.6 s fig. 3. female contact calls 5 10 15 20 khz 0.2 0.4 s 5 10 15 20 khz 0.2 s fig. 4. male contact calls 5 5 10 10 15 15 20 20 khz 0.2 0.4 0.6 0.8 1.0 1.2 1.4 s 5 10 15 20 khz 0.2 0.4 s fig. 5. female begging call fig. 6. female ‘rattle’ call fig. 7. female ‘hick-up’ call 5 10 15 20 khz s 5 10 15 20 khz 0.2 0.4 0.6s fig. 8. male ‘click’ call fig. 9. box and whisker plots for the calls given by the test subjects in the three phases in condition 1. boxes show the interquartile range; the box for the observers is divided by the median value. whiskers indicate the largest and smallest value. 39 separation (condition 1: n=6, z=1.99, p=0.046; condition 2: n=6, z=2.20, p=0.028). there was no difference in the average number of calls the partner of the separated bird produced in any of the three phases in either of the two conditions. do the birds vocalize more before, during or after the separation of a certain individual? depending on which animal was separated, the birds called more or less before, during or after the separation in condition 1. we found a significant difference between the average number of calls the birds produced before, during and after the separation when da vinci (friedman anova: n=8, χ2=8.96, p=0.011), darwin (n=8, χ2=11.08, p=0.004), mackintosh (n=8, χ2=9.34, p=0.009) and plato (n=8, χ2=6.34, p=0.042) were separated (e.g. da vinci, fig.11). results for the post-hoc wilcoxon matched pairs tests can be found in tab.1. similarly, we found significant differences in the number of calls in condition 2 when the following birds were separated: da vinci (friedman anova: n=8, χ2=9.34, p=0.009), linnaeus (n=8, χ2=9.34, p=0.009), mackintosh (n=8, χ2=9.36, p=0.009), aristotle (n=8, χ2=7.36, p=0.025), plato (n=8, χ2=9.36, p=0.009) (e.g. linnaeus, fig. 12; for wilcoxon matched pairs tests see tab. 1). who vocalizes more: the subject, the partner, or the others? we compared the average number of calls the test subjects, their partners and the other birds produced overall for each of the three phases (friedman anovas) and found no significant differences. is there a difference between the two conditions? we looked at the three different phases separately and compared the average number of calls the test subjects, their partners and the other birds gave in condition 1 and 2. except for the number of calls fig. 11. box and whisker plots for the calls given during the separation of one bird in condition 1. boxes show the interquartile range; the box for the observers is divided by the median value. whiskers indicate the largest and smallest value. fig. 10. box and whisker plots for the calls given by the test subjects in the three phases in condition 2. boxes show the interquartile range; the box for the observers is divided by the median value. whiskers indicate the largest and smallest value. fig. 12. box and whisker plots for the calls given during the separation of one bird in condition 2. boxes show the interquartile range; the box for the observers is divided by the median value. whiskers indicate the largest and smallest value. 40 the subjects produced during the separation we found no significant differences. when separated, the subjects called more in condition 2 (in the small compartment) than in condition 1 (at the other side of the aviary) (wilcoxon matched pairs test: n=6, z=2.02, p=0.043; fig. 13). tab. 1. results for the comparison of the average number of calls all birds produced before, during and after the separation of certain individuals for (a) condition 1 and (b) condition 2. (a) phases compared z p da vinci during-after 2.02 0.04 more after after-before 2.37 0.02 more after darwin before-during 2.20 0.03 more during during-after 2.20 0.03 more during mackintosh before-during 2.20 0.03 more during after-before 2.20 0.03 more after plato before-during 1.99 0.05 more during after-before 2.20 0.03 more after (b) phases compared z p da vinci before-during 2.20 0.03 more during after-before 2.20 0.03 more after linnaeus before-during 2.20 0.03 more during after-before 2.20 0.03 more after mackintosh before-during 2.02 0.04 more before during-after 2.20 0.03 more after aristotle after-before 2.20 0.03 more after plato during-after 2.02 0.04 more after after-before 2.20 0.03 more after discussion the present work revealed a large vocal repertoire in the studied group of rooks similar to the one røskaft & espmark (1982) found in their group. we found that the test subjects produced more contact calls after the separation from their partners than before it, irrespective of the condition, i.e. whether the separated partner was in the small compartment or in the other side of the aviary. when an individual was isolated from its partner in the small compartment, it gave more contact calls after than during the separation. similar to postconflict affiliation, when rooks affiliate with each other after a fight in the group (seed et al. 2007), rooks seem to call more after a stressful situation than before it. this points in the direction of stress as an important influence of calling for the subjects. thus, due spending energy on increasing their heart fig. 13. box and whisker plots for the calls given by the test subjects in the two conditions. boxes show the interquartile range; the box for the observers is divided by the median value. whiskers indicate the largest and smallest value. 41 and breathing rate, they might lack the energy for calling during separation. also, the restricted dark space may be an unnatural situation they want to get out of by any means, and for them, the best way for doing that may seem to be through the cracks, where they can see light coming in. continuously trying every possible way of escaping, calling becomes less of a priority, and as stated above, they could at the same time save energy for the flight. the separated bird produced fewer calls in the small compartment in condition 2, in which he could not see the partner, than afterwards, when he was reunited with his partner. nevertheless, compared to condition 1, the subjects produced more contact calls during separation in condition 2, indicating an overall higher level of arousal in condition 2, which may be due to the additional stress of lack of visual contact with the separated bird. this has also been a noted result in a study on marmosets, where the subjects produced a “separation phee” call during short periods of absence from the group (norcross et al. 1999). a study that is currently being conducted with chimpanzees looks at the influence of visibility in the forest on call rate and may reveal similar results (slocombe et al. in prep.). also, the other group members gave more contact calls during the separation of a bird than before, and more after than during the separation, further supporting the idea of stress as a factor. interestingly, the partner of the isolated bird did not change the rate of contact calls in any of the phases in either of the conditions. in both conditions the partner was not physically constricted, it could see the group members and could freely communicate with them. only in the second phase of the second condition the partner was physically isolated but in a familiar enclosure comparable in size and visibility with the one it was separated from. so, one explanation can be that the partner could better assess the situation than the test subject and thus would communicate at a regular frequency. another explanation could be that the distance and physical isolation from the group make the bird instinctively try to conceal its location to an eventual predator, and so minimize the chances of being in imminent danger. instead of using compromising vocalizations it spends its energy on finding a way to get to its partner or the group members. this is because for a social species, rooks are safer when gathered in large groups, while one bird is more vulnerable on its own. separating certain individuals seemed to affect the other group members differently, indicating an influence of the ‘importance’ of the animal to the group on the call rate, potentially arising from the dominance status or the sex of the given bird. social dominance hierarchy has been shown to play an important role in determining the long-distance call frequency and structure in male chimpanzees (pan troglodytes), in the way that high-ranking males produce more calls than low-ranking ones (mitani and nishida 1993). other studies have shown that not necessarily the rate, but for example the structure of vocalizations changes when animals are separated from their group or partner. the oldest example in this direction is the ‘sympathetic song’ of two australian magpies (gymnorhina tibicen). the two birds had succeeded in learning a flute song that both had been exposed to and managed to reproduce it as a duet, in which each one uttered a half while the other one would finish the song (waite 1903). gwinner and kneutgen have shown that because both the common raven (corvus corax) and the common shama (copsychus malabaricus) bond for life and have individually different vocalizations they have a much stronger vocal relationship. when an individual had not been in the presence of its mate for some time, the latter one would produce the missing partner’s vocalizations. upon hearing its own vocalizations, the mate would then return to the caller (gwinner and kneutgen 1962). the same phenomenon has also been reported for the eastern bluebird (sialia sialis) (morton et al. 1978) and the black-headed grosbeak (pheucticus melanocephalus) (ritchison 1983). 42 similar findings have been reported in nonhuman primates that show fine differences in their call structure as a result of social changes. when paired with a new mate, pigmy marmosets (cebuella pygmaea) modify their trill vocalizations structure (snowdown and elowson 1999). periods of social instability determine the emergence of novel variants and transformations in frequency structure of the ‘combined harmonic’ calls in female campbell’s monkeys (cercopithecus campbelli) (lemasson and hausberger 2004). an acoustic variability has been demonstrated to occur in the male chimpanzee (pan troglodytes) typical long-distance calls, the pant hoot, in relation to pre and post-traveling situations of temporary associated parties (mitani and brandt 1994). future studies could take into account the stress of the act of separating a bird on the group and include control experiments to rule out the actual separating as an influence on the call rate, e.g. by catching a bird, letting it go again and measuring the contact call rate immediately afterwards. furthermore, to increase the sample size of just three rook pairs, more data should be taken from different rook groups. in addition, field observations could prove helpful in determining the actual relevance of our study, by noting the different stressful factors that can naturally occur (e.g. predator chasing one of the partners, or partner dies). recording quality could be improved by installing microphones within the aviary or the rook territory to reduce the stress factor created by the presence of an experimenter. this would generate more accurate data, as the recordings could continue over a longer period of time. miniature microphones could also be installed directly on the individuals’ bodies to reduce the possibility of confounding certain birds’ vocalizations. in order to better determine the context in which one vocalization is being produced, cctv cameras could be installed in different angles within the aviary, thus reducing the necessity of human presence and in this way eliminating the additional stress created otherwise. overall, we have shown that vocal communication in rooks, as a highly social species, is a very flexible process influenced by different social and environmental factors. references 1. avey m. t., quince a. f. & sturdy c. b. 2008. seasonal and diurnal patterns of black-capped chickadee (poecile atricapillus) vocal production. behavioural processes, 77, 149-155. 2. catchpole, c. k. & slater p. j. b. 2008. bird song. biological themes and variations. cambridge: cambridge university press. 3. enggist-duebelin, p. & pfister, u. 2002. cultural transmission of vocalizations in ravens, corvus corax. animal behaviour, 64, 831-841. 4. goodwin d. 1949. notes on voice and display of the jay. british birds, 42, 278-287 5. grzimek b. 2002. crows and jays. in: grzimek’s animal life encyclopedia, 2nd edition, vol. 11, birds iv, pp. 503-511. (ed by m. hutchins, j. a. jackson, w. j. bock & d. olendorf) farmington hills, mi: gale group. 6. gwinner, e. & kneutgen, j., 1962. über die biologische bedeutung der "zweckdienlichen" anwendung erlernter laute bei vögeln. zeitschrift fur tierpsychologie, 19, 692-696 7. hardy, j. w. 1979. vocal repertoire and its possible evolution in the black and blue jays (cissilopha). the wilson bulletin, 91, 187-201. 8. hughes a. l. 2008. temporal pattern of vocalization type usage in singing sessions of male tyrant flycatchers (tyrannidae). journal of avian biology, 39, 24-29. 9. lemasson, a. & hausberger, m., 2004. patterns of vocal sharing and social dynamics in a captive group of campbell's monkeys (cercopithecus campbelli). journal of comparative psychology, 118, 347-359. 10. long, c. v. 2007. vocalisations of the degu octodon degus, a social caviomorph rodent. bioacoustics, 16, 223-244. 11. mitani, j.c. and j. gros-louis., 1998. chorusing and call convergence in chimpanzees: tests of three hypotheses. behaviour 135. 1041-1064. 43 12. mitani, j. c. & brandt, k. l. 1994. social factors influence the acoustic variability in the long-distance calls of male chimpanzees. ethology, 96, 233-252. 13. mitani, j.c. and t. nishida. 1993. contexts and social correlates of long distance calling by male chimpanzees. animal behaviour 45, 735-746. 14. mcgregor, p. k. 2005. introduction. in: animal communication networks. pp. ix-xi. (ed. by p. mcgregor) cambridge: cambridge university press. 15. morton, e.s., geitgey, m. s. & mcgrath, s., 1978. responses to apparent female adultery. american naturalist 112, 968-971 16. nagel, t. 1974. what is it like to be a bat? the philosophical review, 83, 435-450. 17. norcross j.l., newman j.d., cofrancesco l.m. 1999. context and sex differences exist in the acoustic structure of phee calls by newly-paired common marmosets (callithrix jacchus). american journal of primatology, 49, 165-181. 18. oberweger, k. & goller, f. 2001. the metabolic cost of birdsong production. journal of experimental biology, 204, 3379-3388. 19. quine, w. v. 1973. on the reasons for the indeterminacy of translation. journal of philosophy, 12, 178183. 20. ritchison, g., 1983: possible "deceptive" use of song by female black-headed grosbeaks. condor 85, 250-251 21. ryan, m.j. & brenowitz, a.e. 1985. the role of body size, phylogeny, and ambient noise in the evolution of bird song. the american naturalist, 126, 87. 22. seed, a., clayton, n. s. & emery, n. j. 2007. postconflict third-party affiliation in rooks, corvus frugilegus. current biology, 17, 157-158. 23. snowdon, c. t. & elowson, a. m., 1999. pygmy marmosets modify call structure when paired. ethology, 105, 893-908. 24. struhsaker t. t. 1967. behavior of vervet monkeys and other cercopithecines, science, 156, 1197. 25. ward s., lampe h. m. & slater p. j. b. 2004. singing is not energetically demanding for pied flycatchers, ficedula hypoleuca. behavioural ecology, 15, 477–484. 26. waite, e.r., 1903. sympathetic song in birds. nature 68, 322 type of the paper (article cluj vet j 2022, 27, 1 http://clujveterinaryjournal.ro case report splenic hematoma and pelvic bladder in a spayed german shepherd mongrel bitch (canis lupus familiaris). a case report. iosif vasiu1,*, †, valentin nicuşor oros1, †, andreea niculina aştilean1, iulia melega1, andreea rusu2, robert purdoiu3, flaviu tăbăran4, mariana vasiu5, emanuel mihai mocanu6, and ciprian andrei ober1 1department of anaesthesiology and surgery, university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, 3-5 mănăştur street, cluj-napoca, 400372, romania iosif.vasiu@usamvcluj.ro; nicusor-valentin.oros@usamvcluj.ro; andreea-niculina.astilean@usamvcluj.ro; iulia.melega@usamvcluj.ro; ciprian.ober@usamvcluj.ro 2small animals emergency hospital, university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, 3-5 mănăştur street, cluj-napoca, 400372; andreearusu@yahoo.com 3 department of imagistics and internal diseases, university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, 3-5 mănăştur street, cluj-napoca, 400372 robert.purdoiu@usamvcluj.ro 4department of pathology, university of agricultural sciences and veterinary medicine cluj-napoca, faculty of veterinary medicine, 3-5 mănăştur street, cluj-napoca, 400372, romania flaviutabaran@gmail.com; 5bioclinica, 10 ştrandului street, sibiu, 550068, romania mariannavasiu@yahoo.com 6fia vet, 1 fragilor street sibiu, 550246, romania mihai_vetmocanu@yahoo.com * correspondence: iosif.vasiu@usamvcluj.ro † these authors contributed equally to the article. abstract: splenic hematomas represent the most encountered splenic benign masses in dogs (canis lupus familiaris), and they are usually secondary to splenic nodular hyperplasia. in most spayed bitches with urinary incontinence (ui), pelvic bladders are a common finding. in addition, ovariohysterectomy (ohe), hormonal imbalances, and various anatomical anomalies are responsible for the onset of urethral sphincter mechanism incompetence (usmi). this case report highlights the aggravating aspect caused by a splenic hematoma to develop a pelvic bladder in a mongrel bitch, that was sterilized seven years ago. a 14-years-old spayed german shepherd was presented to the emergency veterinary hospital in cluj-napoca, with a history of apathy, incontinence, and foul kennel smell, for several months. the diagnostic was based on anamnesis, medical history, imagistic, and routine laboratory assays. the main findings were the presence of a pelvic bladder, splenic hematoma, and chronic cholecystitis. the bitch was admitted for 14 days. surgical intervention was required, so a splenectomy was performed. besides the surgical management and the supportive care, the bitch also received treatment for ui with phenylpropanolamine (ppa; propalin 5%; 1.2 mg/kg 12h po prn). three days after surgery and treatment, the bitch recovered the urinary tonus, and ui was absent. the bitch was discharged two weeks after the surgical intervention. splenic hematomas can precipitate the development of ui by partially translocating the urinary bladder into the pelvic cavity (i.e., pelvic bladder), especially in old spayed bitches. keywords: canis lupus familiaris; splenic hematoma; pelvic bladder; ohe; ui; usmi. 1. introduction urinary incontinence represents an uncontrolled or involuntary urine leakage during the storage phase of micturition [1,2]. it is a common pathology in both intact (i.e., 02-0.3%) and spayed bitches (i.e., 20%) [2]. usually, females with acquired ui suffer from usmi [3,4]. however, the pathophysiology is multifactorial but incompletely elucidated, with ohe, weight, breed, age, and anatomical anomalies as primary contributing factors [5,6]. nevertheless, the condition comprises hormonal, structural, and functional derangements [2]. neurogenic factors comprise low and upper motor neuron disorders; detrusor urethral dyssynergia, dysautonomia, and primary bladder atony. non-neurogenic urinary incontinence (i.e., usmi) includes congenital disorders, detrusor hyperreflexia, anatomreceived: 21 february 2022 accepted: 22 march 2022 published: 28 june 2022 doi:10.52331/cvj.v27i1.36 copyright: © 2022 by the authors. submitted for possible open access publication under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses /by/4.0/). cluj vet j 2022, 27, 1 11 ical or functional urethral obstruction leading to secondary bladder atony, and bladder atony due to muscle weakness or medications [2]. usually, all females suffer from acquired usmi. in addition, usmi and anatomical anomalies may coexist [7]. nodular lymphoid hyperplasia (nlh) and hematomas are benign, non-neoplastic focal masses [8,9] commonly encountered as splenic or hepatic lesions in older dogs, with a reported incidence between 38-59% and account for most focal canine splenic masses [10,11]. they can also be associated with other splenic or hepatic nodules [12]. nodular lymphoid hyperplasia is cytologically characterized as a mixed lymphoid population with medium to small lymphocytes, lymphoblasts, few plasma cells, and other cells with no signs of malignancy on smears [8]. splenic hematomas are blood collections within the tissue, mainly in lymphoid follicular hyperplasia areas with lymphoid aggregates. the coexistence of splenic hematomas and hyperplasia is common in dogs. usually, splenic hematomas result from nlh since it disrupts local blood flow, causing blood pooling, hypoxia, bleeding, and necrosis. usually, dogs with splenic hematomas survive the postoperative period and have an excellent outcome [10,12–14]. in the present case, we highlight the potential of splenic masses to increase abdominal pressure on urinary bladders, causing usmi-derived ui by partially translocating the bladder into the pelvic cavity in a sterilized 14-years-old mixed german shepherd bitch. 2. materials and methods 2.1. case description a 22 kg, nulliparous 14-year-old spayed german shepherd mixed breed female was presented to the small animal emergency hospital in cluj-napoca with a history of apathy, weakness, polyuria (pu), and foul urinary smell kennel for several months. in addition, the owner noticed the dog urinating while sitting or sleeping on the kennel floor, and the hindlimbs were always soaked in urine. the bitch was presented to the same hospital seven years ago for sterilization. at the same time, the bitch was diagnosed with recurrent bilateral otitis (i.e., pseudomonas aeruginosa) due to a food allergy. besides the treatment received for the food allergy (posatex, vet pharma friesoythe, germany; enrofloxacin; baytril, usa; and hypoallergenic food, royal canin, france) and the vets' regular visits for deworming and vaccination, the bitch had no other medical history. during the check-up, the bitch was panting (r=100), presented bilateral senile cataract, enlarged mandibular and popliteal lymph nodes, a distended and sensitive abdomen, and vulval scalding. the bitch showed normal lung and heart sounds, pink mucosae membranes, and other vital signs within the physiological limits (p=100; t=39.20c; trc=1 "). from the cephalic vena, blood was collected for total solids (ts) (element rc, scil, germany), a complete blood count (cbc) (vetscan, abaxis, uk), and blood gases (prime vet, nova biomedical, usa) assays. an abdominal splenic space-occupying lesion was discovered on ultrasound (mylabdeltavet, esaote, italy); a computed tomography (ct) was recommended. in addition, an echo-guided urine sample was obtained aseptically from the urinary bladder, and a stool sample was collected for coproparasitological evaluation. the specimens were sent to the microbiology, pathology, and parasitology departments (university of agricultural sciences and veterinary medicine, cluj-napoca) for culture, sensitivity, sediment, cytology, and stool interpretation, respectively. 2.2. anesthetic and ct protocol a 20g safety iv catheter (b. braun melsungen, germany) was placed on the anterior right limb, and a lactated ringer's solution (ringer-lactat, b. braun melsungen, germany; 10 ml/kg/h iv) was administered. the bitch was premedicated with midazolam cluj vet j 2022, 27, 1 12 (dormicum 0.1%, f. hoffmann-la roche ltd., switzerland; 0.2 mg/kg iv) and ketamine (narkamon bio 10%, bioveta, czech republic; 1.5 mg/kg iv). next, the dog was induced with propofol (propofol-lipuro 1%, b. braun melsungen, germany; 3 mg/kg iv) and maintained with isoflurane/oxygen (isoflutek 1000 mg/g, laboratorios karizoo s.a., spain) after endotracheal intubation using a 9.0 mm endotracheal tube (well lead medical co. ltd., china). finally, an abdominal and thoracic contrast ct scan (somatom scope, siemens, germany) with iohexol (omnipaque 35%, ge healthcare as, norway; 2 ml/kg iv) was performed under general anesthesia. 2.3. anesthetic and surgery protocol after the imagistic evaluation, it was decided to perform an exploratory laparotomy on the same day. the bitch was premedicated with pethidine (mialgin 5%, zentiva, romania; 4 mg/kg im in one dose) and midazolam (0.3 mg/ kg iv). anesthesia was induced with ketamine (2 mg/kg iv) and propofol (2-4mg/kg iv) and was maintained with isoflurane and oxygen mixture (mac=0.9%-1%). the dog received during the surgery a constant rate infusion (cri) of lidocaine (xilină 2%, zentiva s.a., romania; 2.4 mg/kg/h, 24h iv) and ketamine (0.6 mg/kg/h, 24h iv), in ringer's perfusion. next, the bitch was placed in dorsal recumbency and was aseptically prepped on the ventral aspect of the abdomen with chlorhexidine 2% (lifo-scrub 2%, b. braun melsungen, germany) and isopropyl alcohol (alcool sanitar 70%, dual prod, romania). in addition, a midline abdominal anesthetic blocage was also performed with bupivacaine on the linea alba (bupivacaină 0.5%, infomed fluids srl, romania; 1 mg/kg sc). during the surgical intervention, all the vital signs, including pulse oximetry, ecg, and capnography, were evaluated with a noninvasive multi-parameter monitor (life vet 8c, eickemeyer, germany). a ventral midline abdominal incision was performed from xiphoid to pubis for complete abdominal exploration. the edges of the incision were protected with abdominal pads. approximately 100 ml of hemorrhagic fluid was present in the abdominal cavity. the spleen was exteriorized and appeared larger in volume, with macroscopic structures in the parenchyma (figure s1). the capsule was not intact. the liver also presented small reddish nodules on the surface. after the abdominal cavity was explored, the spleen was removed, and a hepatic biopsy was collected. both specimens were rushed to the pathology department for further histopathological evaluation. the blood vessels were double ligated and transected with 3-0 polidioxanone monofilament absorbable (pdo; biosintex, ilfov, romania) suture material at the splenic hilus. next, the abdominal wall was closed in three layers. first, the aponeurosis of the rectus abdominis muscle was sutured with a simple interrupted pattern with 2-0 pdo (biosintex, ilfov, romania) suture material; the subcutaneous connective tissue was sutured in a continuous surjet and tied with an aberdeen knot with 2-0 pdo (biosintex, ilfov, romania) suture material. finally, the skin suture was performed with a simple “x" pattern with a 2-0 nylon (biosintex, ilfov, romania) suture material. the surgical procedure lasted 45 minutes, and no complications occurred. 2.4. treatment plan the lidocaine and ketamine cri was continued for 24h, and the post-op protocol consisted of administration of ceftriaxone (cefort 100%, antibiotice, romania; 22 mg/kg 12h iv for 10 days), metamizole (novasul 50%, richter pharma, austria; 25 mg/kg 12h iv for 3 days), gabapentin (grimodin 300 mg/tb, egis pharmaceuticals plc, hungary; 300 mg/ administration 24h po for 10 days), pantoprazole (controloc 40 mg/tb, takeda gmbh, germany; 1 mg/kg 24h po for 14 days), and ppa (propalin 5%, vetquinol, france; 1.2 mg/kg 12h po for 14 days). after 3 days of treatment, metamizole was changed with meloxicam (meloxidolor 2%, le vet pharma, holland; 0.2 mg/kg 24h sc for 7 more days). cluj vet j 2022, 27, 1 13 3. results 3.1. imagistic results computed tomographic findings were consistent with a large, cavitated hypoattenuating splenic space-occupying mass with a heterogenic structure with multiple fluid attenuating areas (figure 1a,d). the liver also had multiple hypoattenuating areas with a cyst-like structure. the gall bladder was mildly distended with hypoattenuating content (figure 1b,e). the urinary bladder was in semi plentitude and presented with normal contrast uptake due to urine filtration and displaced caudally into the pelvic region (figure 1c,f). the gastrointestinal tract, alongside both kidneys, presented no pathological alterations. (a) (b) (c) (d) (e) (f) figure 1. ct evaluation of the abdomen a, b, c: sagittal view of the thorax and abdomen; d,e,f: axial view of the abdomen and pelvis. the reconstruction is made at different levels. cluj vet j 2022, 27, 1 14 3.2. laboratory results hematological assays showed the presence of hypochromic and microcytic anemia with anisocytosis and thrombocytosis. folded levels of alkaline phosphatase (alp), , and gamma-glutamyl transferase (ggt) confirmed the presence of cholecystitis. cholesterol (chol) and lactate levels (lac) were also folded (supplementary tables s1 and s2). the microbiological assays were negative; the urine sample was sterile, with no sediment or urinary cytology alterations, and the stool sample was negative. after surgery, the anemia was accentuated, but the platelets (plt) returned to the physiological levels, and except for alp, alanine aminotransferase (alt), and the globulins, all the other biochemical parameters returned within the physiological limits, including the lac level (supplementary tables s1 and s2). the histopathological evaluation confirmed the presence of splenic nodular hyperplasia (lymphoid), associated with extensive, acute splenic hematoma. the splenic mass was nodular, poorly demarcated, unencapsulated, elevating the capsule, and consisting of large blood-filled spaces (without an endothelial demarcation). the blood-filled spaces were separated by the preexistent splenic parenchyma and were focally admixed with discrete aggregates of lymphocytes organized in distinct follicular-like structures separated by a few stromal cells (occasionally demarcated by hyalinized collagen). the follicular-like structures showed typical germinal centers and consisted of a regular, stratified mixture of small and large lymphocytes with mantle and marginal zone morphologic features. mitoses were not observed. within the liver, hepatic nodular hyperplasia was diagnosed. the nodular mass was well-demarcated unencapsulated, replacing the preexistent hepatic parenchyma focally and consisting of compact sheets and cords (uniform-cell hepatic plates, ≤ 4 hepatocytes thick) of hepatocytes separated by a delicate, fibrous stroma. few foci of necrosis and extramedullary hematopoiesis (multilineage) were present. portal spaces and mitotic figures were not observed. 3.3. post-op results at 12 h after surgery, the bitch was bright and alert and presented a good appetite. it received small amounts of commercially canned food. water was provided ad libitum. the bitch was leashed and walked 4/5 times daily with no discomfort during the walkovers. after three days of treatment with ppa, the ui ceased, and the bitch was no longer wet on her hindlimbs. the sutures were removed 14 days after the surgical intervention, and the bitch was discharged from the hospital. the owner was instructed to continue the oral administration of ppa, following the same posological protocol, for life. the owner was also asked to give monthly feedback for the rest of the treatment, sooner if needed. a prescription for ursodeoxycholic acid (ursofalk, dr. falk pharma gmbh, germany; 250 mg/tb, 10 mg/kg, 24h po for 14 days) was released to treat the cholecystitis, and a hepatic diet was also recommended. 4. discussion in this case, we postulate that the presence of a splenic mass in a nulliparous sterilized 14-year-old german shepherd bitch led to an increase in abdominal pressure, partially causing the urinary bladder to move from its abdominal topography into the pelvic cavity, facilitating the onset of usmi derived ui similar to the mechanism acknowledge in women where the increasing pressure of the enlarged uterus and fetal weight on the pelvic floor muscle (pfm) and the bladder throughout pregnancy [15], together with pregnancy-related hormonal changes, may lead to reduced pfm strength and their supportive and sphincteric function. in addition, these changes cause bladder, neck, and urethra mobility, leading to urethral sphincter incompetence [16–18]. cluj vet j 2022, 27, 1 15 in dogs, usmi is the most common cause of acquired ui (i.e., 3-5%). the frequency is influenced by gender, breed, body size, weight, docking, gonadectomy, urethral length, urethral tone, and bladder neck positioning, without any known breed predisposition [2,4,19]. ovariectomy or ohe does not result in different continence rates; however, the risk of usmi developing increases with large breed dogs; although mixed young to middle-aged spayed females weighing more than 15 kg are typically affected, the risk decreasing every month the sterilization is postponed in the first year. however, spaying females before the onset of the first heat cycle is less likely to develop ui than those sterilized later in life. in contrast, dogs weighing less than 15 kg are less prone to develop this condition [3,5,20–22]. in adult females, usmi is the leading cause of ui [3], while in young bitches, the leading causes are various congenital abnormalities, especially ureteral ectopia [3,23]. in some breeds, including german shepherds, usmi is encountered in juveniles and adult females [3]. in the present case, the bitch was a german shepherd crossbreed and presented with ui about seven years after spaying intervention. to date, there is no clear correlation between the presence of usmi and the spaying age of the bitches; however, it is reported equally in both males and females [5,6,20,21]. some reports suggest that about 89-90%% of the spayed bitches may develop usmi [3,22]; moreover, ui can occur immediately after sterilization, with the majority of the females developing usmi in the first year after ohe; however, usmi can develop even after ten years after ohe. about 75% of bitches develop usmi within three years of gonadectomy [3,6,7,20,21,24]. urinary incontinence may be permanent or intermittent [3,7]. the exact pathophysiology of usmi is mainly unknown; however, it is multifactorial [21]. the impact of ohe on urinary tract receptor expression is controversial. there is a decrease in urethral closure pressure within one year of ohe, even in continent individuals. if the urethral closure pressure drops below a certain threshold, the sphincter becomes incompetent, and ui develops [21,25]. moreover, about 75% of the spayed bitches that acquired subsequent usmi had at least one oestrus, and 78% presented pelvic bladders [3,26]. interestingly, one report showed that ui was present in a bitch when oestrus would have been expected, even though the bitch was spayed [3]. moreover, compared with continent bitches, which usually show an intraabdominal bladder neck, incontinent bitches have a shorter and dilated urethra [3,22,26]. in the current case, a pelvic bladder was also identified on the ct. in bitches with intrapelvic bladder neck, an increase in the intrabdominal pressure will be transmitted only to the bladder. furthermore, the intravesical pressure will rise. if the urethral resistance is poor, urine leakage can occur, as in bitches with usmi, which tend to be more incontinent whenever the intra-abdominal pressure increases [26]. generally, ui worsens in sleeping dogs or during increased abdominal pressure episodes while barking, coughing, jumping in the owner's car, or recumbency [3,21,24]. in the present case, the owner reported that the bitch was leaking urine, especially while sleeping or laying in the kennel. hormonal abnormalities, mainly estrogen deficiency, may also impact sphincter incompetence; however, since not all incontinent dogs improve with estrogen supplementation, it is unlikely that estrogens alone are solely responsible for the development of usmi [21]. urethral sphincter mechanism incompetence may also predispose to urinary tract infections [1]; however, treatment and presence of concurrent urinary pathologies, including urinary tract infections, do not influence the degree of incontinence [3,22]. there are no specific physical findings to usmi, but clinicians should pay attention to the bladder size, tone, and location. the cbc and ts are usually unaltered; however, they should be performed to rule out other concurrent pathologies. in animals with inappropriate urination, urinalysis and uroculture via cystocentesis for occult infections cluj vet j 2022, 27, 1 16 like cystitis or endocrinology problems like diabetes, liver failure, or other metabolic disorders, especially when dogs present pu and polydipsia (pd), are recommended. the differential diagnostic should also assess the behavior causes of inappropriate urination. imagistics are usually normal in dogs with usmi; however, abdominal imagistic is very important to rule out neoplastic or urinary tract calculi. if all the investigations are negative, a trial of medical therapy is acceptable for diagnostic and therapeutic. cystometrograms and urethral pressure profiles measuring pressure along the length of the urethra are required to document decreased urethral tone [1,6,21,24,26]. imagistics revealed the presence of cholecystitis, a splenic mass, and a pelvic bladder in the present case. the elevated pal and ggt levels are consistent with cholecystitis. besides the anemia and thrombocytosis, biochemistry, hematology, and urinalysis showed no other signs of occulted infections before the splenectomy. moreover, after the surgery, the folded hepatic enzymes were caused by the hepatic biopsy. the long-term well-being of owners and pets is affected by usmi as its etiology is multifactorial and complicated. therefore, treatment comprises a conservative approach followed by surgical management if needed. however, irrespective of the treatment protocol, life-long management of usmi is required [21]. sympathomimetic alpha-adrenergic agents (i.e., ppa, ephedrine, or pseudoephedrine) and hormonal-based drugs (i.e., estrogens, testosterone, or gonadotropin-releasing hormone; gnrh) are used to treat usmi. the first category of medical substances direct stimulates the smooth muscles of the internal urethral sphincter and bladder neck, leading to an increased sphincter tone and a subsequent alleviation of ui. as urethral sphincter tone increases, ui and vulvar scalding decrease over time [1,2,4,21,25]. usually, before surgery, most females are conservatively treated, mainly with ppa [22]. this choice is the frontline treatment of usmi and is intended for the life-long management of usmi-derived ui. therapeutic dosages are effective between 1.5-2 mg/kg sid or bid, reaching long-term continence in bitches suffering from usmi; however, the treatment with ppa is also effective at a 1 mg/kg tid dose [1]. the clinical effect is observed in the first month of treatment. furthermore, ppa effectively maintains continence between 90-97% of the treated bitches [1,2,21,24]. in the present case, the condition was alleviated after the first three days of ppa administration. concurrently, the splenectomy might have also played an essential part in the liquidation of the usmi since the extra pressure exercised by the splenic mass on the urinary bladder was suppressed. the main side effects of ppa are diarrhea and vomiting; however, cardiovascular, neurologic, and behavioral changes like anxiety, excitement, and aggressiveness may also be present secondary to an increased sympathetic tone [1,4,21]. in the present case, no such side effects were reported; however, one month after the beginning of the ppa treatment, the owner reported that the bitch presented a healthy appetite, a shiny coat, and a substantial improvement in mentation and alertness. these positive effects could be partially explained by the increased sympathetic tone and the liquidation of the anemia. ephedrine or pseudoephedrine can also be of aid. however, these medical substances have an efficacy of only 25-75% and may show adverse effects such as panting, hyporexia, and lethargy [1,21]. oestrogens (i.e., estriol) alone or combined with alpha-adrenergic drugs may be necessary to reach continence in some affected females. however, estrogens are not side-effect-free since vulvar hyperplasia, vaginal discharge, and even pyometra are reported [1,21,25]. a combination of gnrh analogs and ppa are also used; however, the treatment is effective for no more than six months [1]. in male dogs, testosterone may be considered if they do not respond favorably to the ppa treatment; however, side effects are also reported in this category of drugs [1,21,25]. moreover, the use of methyltestosterone (0.32-1.27 mg/kg po sid twice a week or eod) in spayed bitches, may be more effective than in castrated male dogs, with excelcluj vet j 2022, 27, 1 17 lent responses between 2 to 4 weeks; however, it seems that the tapper off the testosterone dose has a negative impact on incontinence [27]. the main reasons owners decide to start surgical treatment are represented by poor response to medication (i.e., 17%), progressive unresponsiveness to ppa administration (i.e., 48%), presence of side effects associated with ppa therapy, and owner preference for surgical treatment rather than medical approach (i.e., 29%) [22]. in refractory patients, the following treatment options are mainly surgical and include minimally invasive urethral occluders, urethral bulking, urethropexy, cystourethropexy, and colposuspension, or surgically inserting a hydraulic artificial urethral sphincter (haus) [2,7,21,28]. the haus placement represents a relatively novel approach. it is implemented in animals where medical management or other surgical approaches are ineffective. to date, the haus system is believed to provide the best long-term results for the surgical treatment of bitches with refractory ui, with most dogs achieving complete continence with few reported complications and no other medical treatments needed [5,6,28]. nevertheless, the overall prognosis for usmi is typically good with long-term therapy [21]. the nonmalignant splenic masses are usually identified in 7-14 years dogs; however, nonmalignant and malignant splenic masses can coexist in the same individual [10]. in affected dogs, 17-50% of splenic masses are hematomas and account for the majority (i.e., 46%) of the benign splenic masses [9,29–31]. in comparison, splenic and hepatic nodular hyperplasia is accounted for with a prevalence of about 44% and 38%, respectively [9]. usually, in dogs, splenic hematomas are secondary to underlying splenic disorders, such as nlh, and are less commonly a consequence of trauma [10,12,13]. for example, in a case series, a fall on the stairs is the only trauma-related splenic hematoma event reported in dogs; however, whether a splenic mass existed prior to the traumatic event or not is unknown [14]. in the current case, the hematoma was identified in a 14-year-old spayed bitch, and the owner reported no trauma. grossly splenic hemangiosarcomas and hematomas are indistinguishable during clinical examination, during surgery [10,14,32], and to some extent, even imagistic evaluation poses limitations [10,12,13]; moreover, it is possible that what initially is thought to be a splenic hematoma may be cancer. thus histologic diagnosis is mandatory since the risk of misdiagnosis is high (i.e., 11%) [14]. the histological evaluation of the specimens sent to the pathology department confirmed the presence of nlh. the most affected dogs are the german shepherds (i.e., 11.3%) and labrador retrievers (i.e., 6%), with splenic nlh, with or without hematomas, as the most diagnosed benign splenic mass (i.e., 86%); moreover, 46% of the animals being spayed bitches, with a mean age at the time of splenic removal of ten years [14,33]. interestingly, about 7.6% of dogs with splenic masses die in the perioperative window. however, only 1% of these dogs die during hospitalization [31]. the leading underlying causes of death are uncontrolled hemorrhage (i.e., 24.4%), portal system thrombosis (pst; i.e., 22%), pulmonary thromboembolism (pte; i.e., 9.8%), pneumonia (i.e., 9.8%, each) or, disseminated intravascular coagulation (dic; i.e., 7.3%) [31]. gender, splenic mass volume, elevated alp levels, hemorrhagic peritoneal effusion, anemia, body weight, transfusion coagulopathy, palpable masse, and metastasis are the main parameters evaluated for the survival of dogs diagnosed with splenic hematomas [14]. in addition, marked preoperative thrombocytopenia, anemia, and the development of intraoperative ventricular arrhythmias are risk factors for perioperative death in dogs with splenic masses [31]. however, besides the presence of a distended and sensitive abdomen, increased alp levels, and anemia, no other risk factors had been identified in the perioperative window in the current case. prompt surgical interventions increase life expectancy after splenectomy in dogs with benign splenic masses [29,30]. in cases with splenic hematomas, the overall median survival is 647 days after surgery, up to 3287 days (i.e., 2-9 years) [14]. to date, at 219 days after splenectomy, the owner reports positive feedback. in addition, the health status of the bitch had much improved, with no reported side effects whatsoever. cluj vet j 2022, 27, 1 18 to the author's knowledge, this is the first case report where a pelvic bladder, and consecutive usmi, are associated with a splenic hematoma in a nulliparous sterilized mixed german shepherd bitch. therefore, splenic masses should be considered predisposing factors for ui development, consecutive to usmi, especially in old, spayed bitches. supplementary materials: figure s1: the gross aspect of the splenic hematoma in a 14-years old spayed mixed german shepherd bitch, after splenectomy, table s1: pre-operatory and post-operatory biochemical and hematological values, table s2: pre-operatory and post-operatory blood gases values (i.e., venous blood). author contributions: conceptualization, data curation, writing, review, and editing iv; patient monitoring, anesthesia, surgery, cao, ana, vno, and im; imagistics rp, ar; post-op treatment ar, mv, emm, and iv; histopathologic examination and interpretation ft. all authors have read and agreed to the published version of the manuscript. funding: the publication was supported by funds from the national research development projects to finance excellence (pfe)-14 (id 546) granted by the romanian ministry of research, innovation, and digitalization. institutional review board statement: this research was conducted according to the national (legea 43 din 2014) and european (directiva eu 63/2010) legislation regulations regarding animal protection and welfare for scientific purposes. the owner was informed that the outcomes of this case report would be published and gave its verbal consent for publication. accordingly, ethical review and approval were waived for this study, as standard procedures were implied. acknowledgments: we would like to acknowledge the entire academic veterinary hospital staff for their unconditional involvement in the treatment and well-being of all patients treated in our faculty of veterinary medicine. conflicts of interest: the authors declare no conflict of interest. references 1. scott, l.; leddy, m.; bernay, f.; davot, j.. evaluation of phenylpropanolamine in the treatment of urethral sphincter mechanism incompetence in the bitch. j. small anim. pract. 2002, 43, 493–496. 2. timmermans, j.; van goethem, b.; de rooster, h.; paepe, d. medical treatment of urinary incontinence in the bitch. vlaams diergeneeskd. tijdschr. 2019, 88, 3–8, doi:10.21825/vdt.v88i1.11399. 3. holt, p.e. urinary incontinence in the bitch due to sphincter mechanism incompetence: prevalence in referred dogs and retrospective analysis of sixty cases. j. small anim. pract. 1985, 26, 181–190, doi:10.1111/j.1748-5827.1985.tb02099.x. 4. noël, s.; claeys, s.; hamaide, a. acquired urinary incontinence in the bitch: update and perspectives from human medicine. part 2: the urethral component, pathophysiology and medical treatment. vet. j. 2010, 186, 18–24, doi:10.1016/j.tvjl.2010.06.011. 5. morgan, k.r.s.; milner, h.r.; tikekar, a.; smith, h.l.; coomer, a.r. long term use of hydraulic artificial urethral sphincters in nine dogs from new zealand with urethral sphincter mechanism incompetence. n. z. vet. j. 2018, 66, 205–209, doi:10.1080/00480169.2018.1464975. 6. gomes, c.; doran, i.; friend, e.; tivers, m.; chanoit, g. long-term outcome of female dogs treated with static hydraulic urethral sphincter for urethral sphincter mechanism incompetence. j. am. anim. hosp. assoc. 2018, 54, 276–284, doi:10.5326/jaaha-ms-6709. 7. holt, p.e. urinary incontinence in the bitch due to sphincter mechanism incompetence: surgical treatment. j. small anim. pract. 1985, 26, 237–246, doi:10.1111/j.1748-5827.1985.tb02108.x. 8. mangano, c.; macrì, f.; di pietro, s.; pugliese, m.; santoro, s.; iannelli, n.m.; mazzullo, g.; crupi, r.; de majo, m. use of contrast-enhanced ultrasound for assessment of nodular lymphoid hyperplasia (nlh) in canine spleen. bmc vet. res. 2019, 15, 1–9, doi:10.1186/s12917-019-1942-5. 9. leyva, f.j.; loughin, c.a.; dewey, c.w.; marino, d.j.; akerman, m.; lesser, m.l. histopathologic characteristics of cluj vet j 2022, 27, 1 19 biopsies from dogs undergoing surgery with concurrent gross splenic and hepatic masses: 125 cases (2012-2016). bmc res. notes 2018, 11, 14–18, doi:10.1186/s13104-018-3220-1. 10. fife, w.d.; samii, v.f.; drost, t.; mattoon, j.s.; hoshaw-woodard, s. comparison between malignant and nonmalignant splenic masses in dogs using contrast-enhanced computed tomography. vet. radiol. ultrasound 2004, 45, 289–297, doi:10.1111/j.1740-8261.2004.04054.x. 11. mallinckrodt, m.j.; gottfried, s.d. mass-to-splenic volume ratio and splenic weight as a percentage of body weight in dogs with malignant and benign splenic masses: 65 cases (2007–2008). j. am. vet. med. assoc. 2011, 239, 1325–1327, doi:10.2460/javma.239.10.1325. 12. ivančić, m.; long, f.; seiler, g.s. contrast harmonic ultrasonography of splenic masses and associated liver nodules in dogs. j. am. vet. med. assoc. 2009, 234, 88–94. 13. kutara, k.; seki, m.; ishigaki, k.; teshima, k.; ishikawa, c.; kagawa, y.; edamura, k.; nakayama, t.; asano, k. triple-phase helical computed tomography in dogs with solid splenic masses. j. vet. med. sci. 2017, 79, 1870–1877, doi:10.1292/jvms.17-0253. 14. patten, s.g.; boston, s.e.; monteith, g.j. outcome and prognostic factors for dogs with a histological diagnosis of splenic hematoma following splenectomy: 35 cases (2001-2013). can. vet. j. 2016, 57, 842–846. 15. sangsawang, b. risk factors for the development of stress urinary incontinence during pregnancy in primigravidae: a review of the literature. eur. j. obstet. gynecol. reprod. biol. 2014, 178, 27–34, doi:10.1016/j.ejogrb.2014.04.010. 16. sangsawang, b.; sangsawang, n. stress urinary incontinence in pregnant women: a review of prevalence, pathophysiology, and treatment. int. urogynecol. j. 2013, 24, 901–912, doi:10.1007/s00192-013-2061-7. 17. frederice, c.p.; amaral, e.; de oliveira ferreira, n. urinary symptoms and pelvic floor muscle function during the third trimester of pregnancy in nulliparous women. j. obstet. gynaecol. res. 2013, 39, 188–194, doi:10.1111/j.1447-0756.2012.01962.x. 18. chaliha, c.; bland, j.m.; monga, a.; stanton, s.l.; sultan, a.h. pregnancy and delivery: a urodynamic viewpoint. br. j. obstet. gynaecol. 2000, 107, 1354–1359, doi:10.1111/j.1471-0528.2000.tb11647.x. 19. gregory, s.p. developments in the understanding of the pathophysiology of urethral sphincter mechanism incompetence in the bitch. br. vet. j. 1994, 150, 135–150, doi:10.1016/s0007-1935(05)80222-2. 20. byron, j.k.; taylor, k.h.; phillips, g.s.; stahl, m.s. urethral sphincter mechanism incompetence in 163 neutered female dogs: diagnosis, treatment, and relationship of weight and age at neuter to development of disease. j. vet. intern. med. 2017, doi:10.1111/jvim.14678. 21. applegate, r.; olin, s.; sabatino, b. urethral sphincter mechanism incompetence in dogs: an update. j. am. anim. hosp. assoc. 2018, 54, 22–29, doi:10.5326/jaaha-ms-6524. 22. white, r.n. urethropexy for the management of urethral sphincter mechanism incompetence in the bitch. j. small anim. pract. 2001, 42, 481–486, doi:10.1111/j.1748-5827.2001.tb02452.x. 23. callard, j.; mcloughlin, m.a.; byron, j.k.; chew, d.j. urinary incontinence in juvenile female softcoated wheaten terriers : hospital prevalence and anatomic urogenital anomalies. j. am. anim. hosp. assoc. 2016, 52, 27–35, doi:10.5326/jaaha-ms-6220. 24. claeys, s.; rustichelli, f.; noël, s.; hamaide, a. clinical evaluation of a single daily dose of phenylpropanolamine in the treatment of urethral sphincter mechanism incompetence in the bitch. can. vet. j. 2011, 52, 501–505. 25. reichler, i.m.; hubler, m. urinary incontinence in the bitch: an update. reprod. domest. anim. 2014, 49, 75–80, doi:10.1111/rda.12298. 26. holt, p.e. importance of urethral length, bladder neck position and vestibulovaginal stenosis in sphincter mechanism incompetence in the incontinent bitch. res. vet. sci. 1985, 39, 364–372. 27. nishi, r.; motegi, t.; maeda, s.; tamahara, s.; momoi, y.; matsuki, n.; yonezawa, t. clinical assessment of testosterone cluj vet j 2022, 27, 1 20 analogues for urethral sphincter mechanism incompetence in ten spayed female dogs. j. vet. med. sci. 2021, 83, 274–279, doi:10.1292/jvms.20-0515. 28. timmermans, j.; van goethem, b.; de rooster, h. surgical treatment of refractory incontinence in the bitch. vlaams diergeneeskd. tijdschr. 2020, 89, 177–183, doi:10.21825/vdt.v89i3.16540. 29. burgess, k.e.; price, l.l.; king, r.; kwong, m.; grant, e.; olson, k.a.; lyons, j.a.; robinson, n.a.; wendelburg, k.m.; berg, j. development and validation of a multivariable model and online decision-support calculator to aid in preoperative discrimination of benign from malignant splenic masses in dogs. j. am. vet. med. assoc. 2021, 258, 1362–1371, doi:10.2460/javma.258.12.1362. 30. cleveland, m.j.; casale, s. incidence of malignancy and outcome incidentally detected nonruptured splenic nodules 105 cases (2009-2013). j. am. vet. med. assoc. 2016, 248, 1267–1273. 31. wendelburg, k.m.; o’toole, t.e.; mccobb, e.; price, l.l.; lyons, j.a.; berg, j. risk factors for perioperative death in dogs undergoing splenectomy for splenic masses: 539 cases (2001–2012). j. am. vet. med. assoc. 2014, 245, 1382–1390, doi:10.2460/javma.245.12.1382. 32. hammond, t.n.; pesillo-crosby, s.a. prevalence of hemangiosarcoma in anemic dogs with a splenic mass and hemoperitoneum requiring a transfusion: 71 cases (2003-2005). j. am. vet. med. assoc. 2008, 232, 553–558, doi:10.2460/javma.232.4.553. 33. o’byrne, k.; hosgood, g. splenic mass diagnosis in dogs undergoing splenectomy according to breed size: 234 dogs (2008-2017). vet. rec. 2019, 184, 1–5, doi:10.1136/vr.104983.