id	sid	tid	token	lemma	pos
cusj-10965	1	1	template	template	NOUN
cusj-10965	1	2	for	for	ADP
cusj-10965	1	3	electronic	electronic	ADJ
cusj-10965	1	4	submission	submission	NOUN
cusj-10965	1	5	to	to	ADP
cusj-10965	1	6	acs	acs	PROPN
cusj-10965	1	7	journals	journal	NOUN
cusj-10965	1	8	2023	2023	NUM
cusj-10965	1	9	article	article	NOUN
cusj-10965	1	10	of	of	ADP
cusj-10965	1	11	the	the	DET
cusj-10965	1	12	year	year	NOUN
cusj-10965	1	13	6	6	NUM
cusj-10965	1	14	©	©	PROPN
cusj-10965	1	15	2023	2023	NUM
cusj-10965	1	16	lang	lang	PROPN
cusj-10965	1	17	,	,	PUNCT
cusj-10965	1	18	elvis	elvis	PROPN
cusj-10965	1	19	.	.	PUNCT
cusj-10965	2	1	this	this	PRON
cusj-10965	2	2	is	be	AUX
cusj-10965	2	3	an	an	DET
cusj-10965	2	4	open	open	ADJ
cusj-10965	2	5	access	access	NOUN
cusj-10965	2	6	article	article	NOUN
cusj-10965	2	7	distributed	distribute	VERB
cusj-10965	2	8	under	under	ADP
cusj-10965	2	9	the	the	DET
cusj-10965	2	10	terms	term	NOUN
cusj-10965	2	11	of	of	ADP
cusj-10965	2	12	the	the	DET
cusj-10965	2	13	creative	creative	ADJ
cusj-10965	2	14	commons	common	NOUN
cusj-10965	2	15	attribution	attribution	NOUN
cusj-10965	2	16	license	license	NOUN
cusj-10965	2	17	,	,	PUNCT
cusj-10965	2	18	which	which	PRON
cusj-10965	2	19	permits	permit	VERB
cusj-10965	2	20	the	the	DET
cusj-10965	2	21	user	user	NOUN
cusj-10965	2	22	to	to	PART
cusj-10965	2	23	copy	copy	VERB
cusj-10965	2	24	,	,	PUNCT
cusj-10965	2	25	distribute	distribute	VERB
cusj-10965	2	26	,	,	PUNCT
cusj-10965	2	27	and	and	CCONJ
cusj-10965	2	28	transmit	transmit	VERB
cusj-10965	2	29	the	the	DET
cusj-10965	2	30	work	work	NOUN
cusj-10965	2	31	provided	provide	VERB
cusj-10965	2	32	that	that	SCONJ
cusj-10965	2	33	the	the	DET
cusj-10965	2	34	original	original	ADJ
cusj-10965	2	35	authors	author	NOUN
cusj-10965	2	36	and	and	CCONJ
cusj-10965	2	37	source	source	NOUN
cusj-10965	2	38	are	be	AUX
cusj-10965	2	39	credited	credit	VERB
cusj-10965	2	40	.	.	PUNCT
cusj-10965	3	1	expression	expression	NOUN
cusj-10965	3	2	of	of	ADP
cusj-10965	3	3	single	single	ADJ
cusj-10965	3	4	mrna	mrna	PROPN
cusj-10965	3	5	constructs	construct	NOUN
cusj-10965	3	6	encoding	encode	VERB
cusj-10965	3	7	both	both	DET
cusj-10965	3	8	crispr	crispr	ADJ
cusj-10965	3	9	-	-	PUNCT
cusj-10965	3	10	cas9	cas9	NOUN
cusj-10965	3	11	protein	protein	NOUN
cusj-10965	3	12	and	and	CCONJ
cusj-10965	3	13	guide	guide	VERB
cusj-10965	3	14	rnas	rna	NOUN
cusj-10965	3	15	for	for	ADP
cusj-10965	3	16	future	future	ADJ
cusj-10965	3	17	gene	gene	NOUN
cusj-10965	3	18	therapy	therapy	NOUN
cusj-10965	3	19	applications	application	NOUN
cusj-10965	3	20	elvis	elvis	PROPN
cusj-10965	3	21	lang1	lang1	PROPN
cusj-10965	3	22	,	,	PUNCT
cusj-10965	3	23	john	john	PROPN
cusj-10965	3	24	tilton2	tilton2	PROPN
cusj-10965	3	25	,	,	PUNCT
cusj-10965	3	26	thomas	thomas	PROPN
cusj-10965	3	27	sweet3	sweet3	PROPN
cusj-10965	3	28	1,2,3case	1,2,3case	NUM
cusj-10965	3	29	western	western	PROPN
cusj-10965	3	30	reserve	reserve	PROPN
cusj-10965	3	31	university	university	PROPN
cusj-10965	3	32	school	school	NOUN
cusj-10965	3	33	of	of	ADP
cusj-10965	3	34	medicine	medicine	NOUN
cusj-10965	3	35	,	,	PUNCT
cusj-10965	3	36	cleveland	cleveland	PROPN
cusj-10965	3	37	,	,	PUNCT
cusj-10965	3	38	oh	oh	INTJ
cusj-10965	3	39	,	,	PUNCT
cusj-10965	3	40	usa	usa	PROPN
cusj-10965	3	41	keywords	keyword	NOUN
cusj-10965	3	42	:	:	PUNCT
cusj-10965	3	43	crispr	crispr	ADJ
cusj-10965	3	44	-	-	PUNCT
cusj-10965	3	45	cas9	cas9	NOUN
cusj-10965	3	46	,	,	PUNCT
cusj-10965	3	47	gene	gene	NOUN
cusj-10965	3	48	editing	editing	NOUN
cusj-10965	3	49	,	,	PUNCT
cusj-10965	3	50	mrna	mrna	PROPN
cusj-10965	3	51	abstract	abstract	NOUN
cusj-10965	3	52	:	:	PUNCT
cusj-10965	3	53	the	the	DET
cusj-10965	3	54	basis	basis	NOUN
cusj-10965	3	55	of	of	ADP
cusj-10965	3	56	many	many	ADJ
cusj-10965	3	57	life	life	NOUN
cusj-10965	3	58	-	-	PUNCT
cusj-10965	3	59	threatening	threaten	VERB
cusj-10965	3	60	diseases	disease	NOUN
cusj-10965	3	61	is	be	AUX
cusj-10965	3	62	disruption	disruption	NOUN
cusj-10965	3	63	in	in	ADP
cusj-10965	3	64	key	key	ADJ
cusj-10965	3	65	genes	gene	NOUN
cusj-10965	3	66	.	.	PUNCT
cusj-10965	4	1	in	in	ADP
cusj-10965	4	2	many	many	ADJ
cusj-10965	4	3	cases	case	NOUN
cusj-10965	4	4	,	,	PUNCT
cusj-10965	4	5	repairing	repair	VERB
cusj-10965	4	6	these	these	DET
cusj-10965	4	7	disruptions	disruption	NOUN
cusj-10965	4	8	can	can	AUX
cusj-10965	4	9	prevent	prevent	VERB
cusj-10965	4	10	or	or	CCONJ
cusj-10965	4	11	reverse	reverse	ADJ
cusj-10965	4	12	disease	disease	NOUN
cusj-10965	4	13	.	.	PUNCT
cusj-10965	5	1	the	the	DET
cusj-10965	5	2	development	development	NOUN
cusj-10965	5	3	of	of	ADP
cusj-10965	5	4	crispr	crispr	ADJ
cusj-10965	5	5	-	-	PUNCT
cusj-10965	5	6	cas9	cas9	NOUN
cusj-10965	5	7	technology	technology	NOUN
cusj-10965	5	8	,	,	PUNCT
cusj-10965	5	9	which	which	PRON
cusj-10965	5	10	consists	consist	VERB
cusj-10965	5	11	of	of	ADP
cusj-10965	5	12	cas9	cas9	NOUN
cusj-10965	5	13	nuclease	nuclease	NOUN
cusj-10965	5	14	directed	direct	VERB
cusj-10965	5	15	to	to	ADP
cusj-10965	5	16	specific	specific	ADJ
cusj-10965	5	17	genomic	genomic	NOUN
cusj-10965	5	18	locations	location	NOUN
cusj-10965	5	19	by	by	ADP
cusj-10965	5	20	guide	guide	NOUN
cusj-10965	5	21	rna	rna	PROPN
cusj-10965	5	22	(	(	PUNCT
cusj-10965	5	23	grna	grna	NOUN
cusj-10965	5	24	)	)	PUNCT
cusj-10965	5	25	,	,	PUNCT
cusj-10965	5	26	has	have	AUX
cusj-10965	5	27	significantly	significantly	ADV
cusj-10965	5	28	progressed	progress	VERB
cusj-10965	5	29	in	in	ADP
cusj-10965	5	30	the	the	DET
cusj-10965	5	31	past	past	ADJ
cusj-10965	5	32	decade	decade	NOUN
cusj-10965	5	33	and	and	CCONJ
cusj-10965	5	34	has	have	AUX
cusj-10965	5	35	shown	show	VERB
cusj-10965	5	36	signs	sign	NOUN
cusj-10965	5	37	of	of	ADP
cusj-10965	5	38	promise	promise	NOUN
cusj-10965	5	39	for	for	ADP
cusj-10965	5	40	treating	treat	VERB
cusj-10965	5	41	diseases	disease	NOUN
cusj-10965	5	42	such	such	ADJ
cusj-10965	5	43	as	as	ADP
cusj-10965	5	44	alzheimer	alzheimer	PROPN
cusj-10965	5	45	’s	’s	PART
cusj-10965	5	46	and	and	CCONJ
cusj-10965	5	47	cystic	cystic	ADJ
cusj-10965	5	48	fibrosis	fibrosis	NOUN
cusj-10965	5	49	.	.	PUNCT
cusj-10965	6	1	one	one	NUM
cusj-10965	6	2	integral	integral	ADJ
cusj-10965	6	3	issue	issue	NOUN
cusj-10965	6	4	of	of	ADP
cusj-10965	6	5	gene	gene	NOUN
cusj-10965	6	6	editing	edit	VERB
cusj-10965	6	7	therapy	therapy	NOUN
cusj-10965	6	8	is	be	AUX
cusj-10965	6	9	the	the	DET
cusj-10965	6	10	method	method	NOUN
cusj-10965	6	11	and	and	CCONJ
cusj-10965	6	12	effectiveness	effectiveness	NOUN
cusj-10965	6	13	of	of	ADP
cusj-10965	6	14	delivery	delivery	NOUN
cusj-10965	6	15	.	.	PUNCT
cusj-10965	7	1	current	current	ADJ
cusj-10965	7	2	approaches	approach	NOUN
cusj-10965	7	3	such	such	ADJ
cusj-10965	7	4	as	as	ADP
cusj-10965	7	5	lentiviral	lentiviral	ADJ
cusj-10965	7	6	and	and	CCONJ
cusj-10965	7	7	adeno	adeno	NOUN
cusj-10965	7	8	-	-	PUNCT
cusj-10965	7	9	associated	associate	VERB
cusj-10965	7	10	virus	virus	NOUN
cusj-10965	7	11	vectors	vector	NOUN
cusj-10965	7	12	suffer	suffer	VERB
cusj-10965	7	13	from	from	ADP
cusj-10965	7	14	either	either	CCONJ
cusj-10965	7	15	stable	stable	ADJ
cusj-10965	7	16	,	,	PUNCT
cusj-10965	7	17	constant	constant	ADJ
cusj-10965	7	18	expression	expression	NOUN
cusj-10965	7	19	of	of	ADP
cusj-10965	7	20	crispr	crispr	ADJ
cusj-10965	7	21	components	component	NOUN
cusj-10965	7	22	that	that	PRON
cusj-10965	7	23	causes	cause	VERB
cusj-10965	7	24	unintended	unintended	ADJ
cusj-10965	7	25	gene	gene	NOUN
cusj-10965	7	26	editing	editing	NOUN
cusj-10965	7	27	or	or	CCONJ
cusj-10965	7	28	an	an	DET
cusj-10965	7	29	inability	inability	NOUN
cusj-10965	7	30	to	to	PART
cusj-10965	7	31	efficiently	efficiently	ADV
cusj-10965	7	32	carry	carry	VERB
cusj-10965	7	33	large	large	ADJ
cusj-10965	7	34	cargoes	cargo	NOUN
cusj-10965	7	35	such	such	ADJ
cusj-10965	7	36	as	as	ADP
cusj-10965	7	37	two	two	NUM
cusj-10965	7	38	independent	independent	ADJ
cusj-10965	7	39	genes	gene	NOUN
cusj-10965	7	40	:	:	PUNCT
cusj-10965	7	41	cas9	cas9	NOUN
cusj-10965	7	42	and	and	CCONJ
cusj-10965	7	43	guide	guide	VERB
cusj-10965	7	44	rna	rna	PROPN
cusj-10965	7	45	.	.	PUNCT
cusj-10965	8	1	to	to	PART
cusj-10965	8	2	begin	begin	VERB
cusj-10965	8	3	to	to	PART
cusj-10965	8	4	bypass	bypass	VERB
cusj-10965	8	5	these	these	DET
cusj-10965	8	6	cargo	cargo	NOUN
cusj-10965	8	7	limitations	limitation	NOUN
cusj-10965	8	8	,	,	PUNCT
cusj-10965	8	9	we	we	PRON
cusj-10965	8	10	created	create	VERB
cusj-10965	8	11	a	a	DET
cusj-10965	8	12	crispr	crispr	ADJ
cusj-10965	8	13	-	-	PUNCT
cusj-10965	8	14	cas9	cas9	NOUN
cusj-10965	8	15	mrna	mrna	NOUN
cusj-10965	8	16	structure	structure	NOUN
cusj-10965	8	17	that	that	PRON
cusj-10965	8	18	encompasses	encompass	VERB
cusj-10965	8	19	all	all	PRON
cusj-10965	8	20	of	of	ADP
cusj-10965	8	21	the	the	DET
cusj-10965	8	22	necessary	necessary	ADJ
cusj-10965	8	23	components	component	NOUN
cusj-10965	8	24	for	for	ADP
cusj-10965	8	25	gene	gene	NOUN
cusj-10965	8	26	editing	edit	VERB
cusj-10965	8	27	on	on	ADP
cusj-10965	8	28	a	a	DET
cusj-10965	8	29	single	single	ADJ
cusj-10965	8	30	rna	rna	NOUN
cusj-10965	8	31	.	.	PUNCT
cusj-10965	9	1	these	these	DET
cusj-10965	9	2	constructs	construct	NOUN
cusj-10965	9	3	consist	consist	VERB
cusj-10965	9	4	of	of	ADP
cusj-10965	9	5	a	a	DET
cusj-10965	9	6	promoter	promoter	NOUN
cusj-10965	9	7	,	,	PUNCT
cusj-10965	9	8	followed	follow	VERB
cusj-10965	9	9	by	by	ADP
cusj-10965	9	10	a	a	DET
cusj-10965	9	11	cas9	cas9	NOUN
cusj-10965	9	12	open	open	ADJ
cusj-10965	9	13	reading	reading	NOUN
cusj-10965	9	14	frame	frame	NOUN
cusj-10965	9	15	,	,	PUNCT
cusj-10965	9	16	a	a	DET
cusj-10965	9	17	triplex	triplex	ADJ
cusj-10965	9	18	region	region	NOUN
cusj-10965	9	19	from	from	ADP
cusj-10965	9	20	malat1	malat1	PROPN
cusj-10965	9	21	that	that	PRON
cusj-10965	9	22	protects	protect	VERB
cusj-10965	9	23	the	the	DET
cusj-10965	9	24	cas9	cas9	NOUN
cusj-10965	9	25	open	open	ADJ
cusj-10965	9	26	reading	reading	NOUN
cusj-10965	9	27	frame	frame	NOUN
cusj-10965	9	28	,	,	PUNCT
cusj-10965	9	29	and	and	CCONJ
cusj-10965	9	30	then	then	ADV
cusj-10965	9	31	either	either	DET
cusj-10965	9	32	1	1	NUM
cusj-10965	9	33	,	,	PUNCT
cusj-10965	9	34	2	2	NUM
cusj-10965	9	35	,	,	PUNCT
cusj-10965	9	36	or	or	CCONJ
cusj-10965	9	37	4	4	NUM
cusj-10965	9	38	grnas	grna	NOUN
cusj-10965	9	39	that	that	PRON
cusj-10965	9	40	target	target	VERB
cusj-10965	9	41	specific	specific	ADJ
cusj-10965	9	42	reporters	reporter	NOUN
cusj-10965	9	43	,	,	PUNCT
cusj-10965	9	44	with	with	ADP
cusj-10965	9	45	each	each	DET
cusj-10965	9	46	grna	grna	NOUN
cusj-10965	9	47	between	between	ADP
cusj-10965	9	48	two	two	NUM
cusj-10965	9	49	self	self	NOUN
cusj-10965	9	50	-	-	PUNCT
cusj-10965	9	51	cleaving	cleave	VERB
cusj-10965	9	52	ribozyme	ribozyme	ADJ
cusj-10965	9	53	sequences	sequence	NOUN
cusj-10965	9	54	.	.	PUNCT
cusj-10965	10	1	these	these	DET
cusj-10965	10	2	constructs	construct	NOUN
cusj-10965	10	3	successfully	successfully	ADV
cusj-10965	10	4	drove	drive	VERB
cusj-10965	10	5	cas9	cas9	NOUN
cusj-10965	10	6	editing	editing	NOUN
cusj-10965	10	7	of	of	ADP
cusj-10965	10	8	two	two	NUM
cusj-10965	10	9	distinct	distinct	ADJ
cusj-10965	10	10	reporters	reporter	NOUN
cusj-10965	10	11	in	in	ADP
cusj-10965	10	12	human	human	ADJ
cusj-10965	10	13	cells	cell	NOUN
cusj-10965	10	14	and	and	CCONJ
cusj-10965	10	15	thus	thus	ADV
cusj-10965	10	16	open	open	VERB
cusj-10965	10	17	the	the	DET
cusj-10965	10	18	door	door	NOUN
cusj-10965	10	19	for	for	ADP
cusj-10965	10	20	many	many	ADJ
cusj-10965	10	21	more	more	ADJ
cusj-10965	10	22	experiments	experiment	NOUN
cusj-10965	10	23	such	such	ADJ
cusj-10965	10	24	as	as	ADP
cusj-10965	10	25	incorporation	incorporation	NOUN
cusj-10965	10	26	into	into	ADP
cusj-10965	10	27	various	various	ADJ
cusj-10965	10	28	delivery	delivery	NOUN
cusj-10965	10	29	constructs	construct	NOUN
cusj-10965	10	30	to	to	PART
cusj-10965	10	31	further	far	ADV
cusj-10965	10	32	develop	develop	VERB
cusj-10965	10	33	this	this	DET
cusj-10965	10	34	technology	technology	NOUN
cusj-10965	10	35	for	for	ADP
cusj-10965	10	36	gene	gene	NOUN
cusj-10965	10	37	editing	edit	VERB
cusj-10965	10	38	therapy	therapy	NOUN
cusj-10965	10	39	.	.	PUNCT
cusj-10965	11	1	introduction	introduction	NOUN
cusj-10965	11	2	crispr	crispr	NOUN
cusj-10965	11	3	-	-	PUNCT
cusj-10965	11	4	cas9	cas9	NOUN
cusj-10965	11	5	(	(	PUNCT
cusj-10965	11	6	clustered	cluster	VERB
cusj-10965	11	7	regularly	regularly	ADV
cusj-10965	11	8	interspaced	interspace	VERB
cusj-10965	11	9	short	short	ADJ
cusj-10965	11	10	palindromic	palindromic	ADJ
cusj-10965	11	11	repeatscrispr	repeatscrispr	NOUN
cusj-10965	11	12	associated	associate	VERB
cusj-10965	11	13	protein	protein	NOUN
cusj-10965	11	14	9	9	NUM
cusj-10965	11	15	)	)	PUNCT
cusj-10965	11	16	gene	gene	NOUN
cusj-10965	11	17	editing	edit	VERB
cusj-10965	11	18	technology	technology	NOUN
cusj-10965	11	19	has	have	AUX
cusj-10965	11	20	been	be	AUX
cusj-10965	11	21	shown	show	VERB
cusj-10965	11	22	to	to	PART
cusj-10965	11	23	be	be	AUX
cusj-10965	11	24	a	a	DET
cusj-10965	11	25	promising	promising	ADJ
cusj-10965	11	26	solution	solution	NOUN
cusj-10965	11	27	to	to	ADP
cusj-10965	11	28	genetic	genetic	ADJ
cusj-10965	11	29	diseases	disease	NOUN
cusj-10965	11	30	.	.	PUNCT
cusj-10965	12	1	cas9	cas9	NOUN
cusj-10965	12	2	proteins	protein	NOUN
cusj-10965	12	3	are	be	AUX
cusj-10965	12	4	naturally	naturally	ADV
cusj-10965	12	5	found	find	VERB
cusj-10965	12	6	in	in	ADP
cusj-10965	12	7	streptococcus	streptococcus	NOUN
cusj-10965	12	8	thermophilus	thermophilus	NOUN
cusj-10965	12	9	as	as	ADP
cusj-10965	12	10	a	a	DET
cusj-10965	12	11	defense	defense	NOUN
cusj-10965	12	12	system	system	NOUN
cusj-10965	12	13	against	against	ADP
cusj-10965	12	14	invading	invade	VERB
cusj-10965	12	15	viruses	virus	NOUN
cusj-10965	12	16	,	,	PUNCT
cusj-10965	12	17	but	but	CCONJ
cusj-10965	12	18	now	now	ADV
cusj-10965	12	19	scientists	scientist	NOUN
cusj-10965	12	20	use	use	VERB
cusj-10965	12	21	this	this	DET
cusj-10965	12	22	system	system	NOUN
cusj-10965	12	23	to	to	PART
cusj-10965	12	24	perform	perform	VERB
cusj-10965	12	25	gene	gene	NOUN
cusj-10965	12	26	editing	editing	NOUN
cusj-10965	12	27	in	in	ADP
cusj-10965	12	28	many	many	ADJ
cusj-10965	12	29	organisms.1	organisms.1	NOUN
cusj-10965	12	30	in	in	ADP
cusj-10965	12	31	the	the	DET
cusj-10965	12	32	crispr	crispr	ADJ
cusj-10965	12	33	system	system	NOUN
cusj-10965	12	34	,	,	PUNCT
cusj-10965	12	35	guide	guide	VERB
cusj-10965	12	36	rnas	rna	NOUN
cusj-10965	12	37	bind	bind	VERB
cusj-10965	12	38	to	to	ADP
cusj-10965	12	39	a	a	DET
cusj-10965	12	40	specific	specific	ADJ
cusj-10965	12	41	region	region	NOUN
cusj-10965	12	42	of	of	ADP
cusj-10965	12	43	dna	dna	PROPN
cusj-10965	12	44	as	as	ADV
cusj-10965	12	45	well	well	ADV
cusj-10965	12	46	as	as	ADP
cusj-10965	12	47	cas9	cas9	NOUN
cusj-10965	12	48	nuclease	nuclease	NOUN
cusj-10965	12	49	,	,	PUNCT
cusj-10965	12	50	guiding	guide	VERB
cusj-10965	12	51	cas9	cas9	NOUN
cusj-10965	12	52	to	to	ADP
cusj-10965	12	53	the	the	DET
cusj-10965	12	54	targeted	target	VERB
cusj-10965	12	55	dna	dna	PROPN
cusj-10965	12	56	region	region	NOUN
cusj-10965	12	57	to	to	PART
cusj-10965	12	58	cause	cause	VERB
cusj-10965	12	59	doublestranded	doublestranded	ADJ
cusj-10965	12	60	breaks	break	NOUN
cusj-10965	12	61	in	in	ADP
cusj-10965	12	62	an	an	DET
cusj-10965	12	63	organism	organism	NOUN
cusj-10965	12	64	’s	’s	PART
cusj-10965	12	65	genome	genome	NOUN
cusj-10965	12	66	.	.	PUNCT
cusj-10965	13	1	the	the	DET
cusj-10965	13	2	cell	cell	NOUN
cusj-10965	13	3	’s	’s	PART
cusj-10965	13	4	own	own	ADJ
cusj-10965	13	5	non	non	ADJ
cusj-10965	13	6	-	-	ADJ
cusj-10965	13	7	homologous	homologous	ADJ
cusj-10965	13	8	end	end	NOUN
cusj-10965	13	9	joining	join	VERB
cusj-10965	13	10	dna	dna	PROPN
cusj-10965	13	11	repair	repair	NOUN
cusj-10965	13	12	system	system	NOUN
cusj-10965	13	13	is	be	AUX
cusj-10965	13	14	used	use	VERB
cusj-10965	13	15	to	to	PART
cusj-10965	13	16	repair	repair	VERB
cusj-10965	13	17	the	the	DET
cusj-10965	13	18	break	break	NOUN
cusj-10965	13	19	made	make	VERB
cusj-10965	13	20	by	by	ADP
cusj-10965	13	21	cas9	cas9	NOUN
cusj-10965	13	22	which	which	PRON
cusj-10965	13	23	induces	induce	VERB
cusj-10965	13	24	changes	change	NOUN
cusj-10965	13	25	to	to	ADP
cusj-10965	13	26	targeted	target	VERB
cusj-10965	13	27	sequences	sequence	NOUN
cusj-10965	13	28	in	in	ADP
cusj-10965	13	29	the	the	DET
cusj-10965	13	30	genome	genome	NOUN
cusj-10965	13	31	(	(	PUNCT
cusj-10965	13	32	figure	figure	NOUN
cusj-10965	13	33	1).2	1).2	PROPN
cusj-10965	13	34	this	this	DET
cusj-10965	13	35	system	system	NOUN
cusj-10965	13	36	has	have	AUX
cusj-10965	13	37	been	be	AUX
cusj-10965	13	38	extensively	extensively	ADV
cusj-10965	13	39	researched	research	VERB
cusj-10965	13	40	and	and	CCONJ
cusj-10965	13	41	expanded	expand	VERB
cusj-10965	13	42	upon	upon	SCONJ
cusj-10965	13	43	for	for	ADP
cusj-10965	13	44	the	the	DET
cusj-10965	13	45	past	past	ADJ
cusj-10965	13	46	decade	decade	NOUN
cusj-10965	13	47	,	,	PUNCT
cusj-10965	13	48	and	and	CCONJ
cusj-10965	13	49	more	more	ADJ
cusj-10965	13	50	systems	system	NOUN
cusj-10965	13	51	have	have	AUX
cusj-10965	13	52	been	be	AUX
cusj-10965	13	53	developed	develop	VERB
cusj-10965	13	54	that	that	PRON
cusj-10965	13	55	use	use	VERB
cusj-10965	13	56	cas9	cas9	NOUN
cusj-10965	13	57	as	as	ADV
cusj-10965	13	58	well	well	ADV
cusj-10965	13	59	such	such	ADJ
cusj-10965	13	60	as	as	ADP
cusj-10965	13	61	base	base	NOUN
cusj-10965	13	62	and	and	CCONJ
cusj-10965	13	63	prime	prime	ADJ
cusj-10965	13	64	editors	editor	NOUN
cusj-10965	13	65	.	.	PUNCT
cusj-10965	14	1	in	in	ADP
cusj-10965	14	2	these	these	DET
cusj-10965	14	3	systems	system	NOUN
cusj-10965	14	4	,	,	PUNCT
cusj-10965	14	5	various	various	ADJ
cusj-10965	14	6	proteins	protein	NOUN
cusj-10965	14	7	have	have	AUX
cusj-10965	14	8	been	be	AUX
cusj-10965	14	9	fused	fuse	VERB
cusj-10965	14	10	to	to	ADP
cusj-10965	14	11	nuclease	nuclease	NOUN
cusj-10965	14	12	-	-	PUNCT
cusj-10965	14	13	deficient	deficient	ADJ
cusj-10965	14	14	cas9	cas9	NOUN
cusj-10965	14	15	to	to	PART
cusj-10965	14	16	modify	modify	VERB
cusj-10965	14	17	the	the	DET
cusj-10965	14	18	genome	genome	NOUN
cusj-10965	14	19	in	in	ADP
cusj-10965	14	20	several	several	ADJ
cusj-10965	14	21	different	different	ADJ
cusj-10965	14	22	ways	way	NOUN
cusj-10965	14	23	.	.	PUNCT
cusj-10965	15	1	columbia	columbia	PROPN
cusj-10965	15	2	undergraduate	undergraduate	PROPN
cusj-10965	15	3	science	science	PROPN
cusj-10965	15	4	journal	journal	PROPN
cusj-10965	15	5	vol	vol	NOUN
cusj-10965	15	6	.	.	PROPN
cusj-10965	15	7	17	17	NUM
cusj-10965	15	8	,	,	PUNCT
cusj-10965	15	9	2023	2023	NUM
cusj-10965	15	10	lang	lang	PROPN
cusj-10965	15	11	et	et	PROPN
cusj-10965	15	12	.	.	PUNCT
cusj-10965	16	1	al	al	PROPN
cusj-10965	16	2	.	.	PROPN
cusj-10965	16	3	7	7	NUM
cusj-10965	17	1	the	the	DET
cusj-10965	17	2	advent	advent	NOUN
cusj-10965	17	3	of	of	ADP
cusj-10965	17	4	base	base	NOUN
cusj-10965	17	5	editing	edit	VERB
cusj-10965	17	6	technology	technology	NOUN
cusj-10965	17	7	grants	grant	VERB
cusj-10965	17	8	the	the	DET
cusj-10965	17	9	ability	ability	NOUN
cusj-10965	17	10	to	to	PART
cusj-10965	17	11	perform	perform	VERB
cusj-10965	17	12	specific	specific	ADJ
cusj-10965	17	13	types	type	NOUN
cusj-10965	17	14	of	of	ADP
cusj-10965	17	15	point	point	NOUN
cusj-10965	17	16	mutations	mutation	NOUN
cusj-10965	17	17	to	to	ADP
cusj-10965	17	18	nucleotides	nucleotide	NOUN
cusj-10965	17	19	.	.	PUNCT
cusj-10965	18	1	the	the	DET
cusj-10965	18	2	first	first	ADJ
cusj-10965	18	3	effective	effective	ADJ
cusj-10965	18	4	iteration	iteration	NOUN
cusj-10965	18	5	of	of	ADP
cusj-10965	18	6	this	this	DET
cusj-10965	18	7	technology	technology	NOUN
cusj-10965	18	8	,	,	PUNCT
cusj-10965	18	9	a	a	DET
cusj-10965	18	10	cytosine	cytosine	NOUN
cusj-10965	18	11	base	base	NOUN
cusj-10965	18	12	editor	editor	NOUN
cusj-10965	18	13	,	,	PUNCT
cusj-10965	18	14	arose	arise	VERB
cusj-10965	18	15	in	in	ADP
cusj-10965	18	16	2016	2016	NUM
cusj-10965	18	17	where	where	SCONJ
cusj-10965	18	18	komor	komor	VERB
cusj-10965	18	19	et	et	PROPN
cusj-10965	18	20	al	al	PROPN
cusj-10965	18	21	.	.	PROPN
cusj-10965	18	22	was	be	AUX
cusj-10965	18	23	able	able	ADJ
cusj-10965	18	24	to	to	PART
cusj-10965	18	25	fuse	fuse	VERB
cusj-10965	18	26	rat	rat	NOUN
cusj-10965	18	27	derived	derive	VERB
cusj-10965	18	28	deaminase	deaminase	NOUN
cusj-10965	18	29	protein	protein	NOUN
cusj-10965	18	30	to	to	ADP
cusj-10965	18	31	the	the	DET
cusj-10965	18	32	amino	amino	NOUN
cusj-10965	18	33	terminal	terminal	PROPN
cusj-10965	18	34	end	end	NOUN
cusj-10965	18	35	of	of	ADP
cusj-10965	18	36	an	an	DET
cusj-10965	18	37	inactive	inactive	ADJ
cusj-10965	18	38	cas9	cas9	NOUN
cusj-10965	18	39	protein.3	protein.3	PROPN
cusj-10965	18	40	instead	instead	ADV
cusj-10965	18	41	of	of	ADP
cusj-10965	18	42	causing	cause	VERB
cusj-10965	18	43	double	double	ADJ
cusj-10965	18	44	stranded	strand	VERB
cusj-10965	18	45	breaks	break	NOUN
cusj-10965	18	46	,	,	PUNCT
cusj-10965	18	47	this	this	DET
cusj-10965	18	48	editor	editor	NOUN
cusj-10965	18	49	is	be	AUX
cusj-10965	18	50	able	able	ADJ
cusj-10965	18	51	to	to	PART
cusj-10965	18	52	deaminate	deaminate	VERB
cusj-10965	18	53	cytosine	cytosine	NOUN
cusj-10965	18	54	to	to	ADP
cusj-10965	18	55	uracil	uracil	PROPN
cusj-10965	18	56	.	.	PUNCT
cusj-10965	19	1	since	since	SCONJ
cusj-10965	19	2	dna	dna	PROPN
cusj-10965	19	3	replication	replication	NOUN
cusj-10965	19	4	machinery	machinery	NOUN
cusj-10965	19	5	does	do	AUX
cusj-10965	19	6	not	not	PART
cusj-10965	19	7	recognize	recognize	VERB
cusj-10965	19	8	uracil	uracil	VERB
cusj-10965	19	9	,	,	PUNCT
cusj-10965	19	10	the	the	DET
cusj-10965	19	11	replication	replication	NOUN
cusj-10965	19	12	results	result	VERB
cusj-10965	19	13	in	in	ADP
cusj-10965	19	14	a	a	DET
cusj-10965	19	15	c	c	NOUN
cusj-10965	19	16	-	-	PUNCT
cusj-10965	19	17	g	g	NOUN
cusj-10965	19	18	to	to	ADP
cusj-10965	19	19	t	t	PROPN
cusj-10965	19	20	-	-	PUNCT
cusj-10965	19	21	a	a	DET
cusj-10965	19	22	mutation.4	mutation.4	NOUN
cusj-10965	19	23	through	through	ADP
cusj-10965	19	24	further	further	ADJ
cusj-10965	19	25	research	research	NOUN
cusj-10965	19	26	,	,	PUNCT
cusj-10965	19	27	this	this	DET
cusj-10965	19	28	editing	editing	NOUN
cusj-10965	19	29	system	system	NOUN
cusj-10965	19	30	was	be	AUX
cusj-10965	19	31	able	able	ADJ
cusj-10965	19	32	to	to	PART
cusj-10965	19	33	become	become	VERB
cusj-10965	19	34	more	more	ADV
cusj-10965	19	35	specific	specific	ADJ
cusj-10965	19	36	and	and	CCONJ
cusj-10965	19	37	effective	effective	ADJ
cusj-10965	19	38	.	.	PUNCT
cusj-10965	20	1	an	an	DET
cusj-10965	20	2	adenine	adenine	ADJ
cusj-10965	20	3	base	base	NOUN
cusj-10965	20	4	editor	editor	NOUN
cusj-10965	20	5	was	be	AUX
cusj-10965	20	6	also	also	ADV
cusj-10965	20	7	developed	develop	VERB
cusj-10965	20	8	using	use	VERB
cusj-10965	20	9	a	a	DET
cusj-10965	20	10	similar	similar	ADJ
cusj-10965	20	11	method	method	NOUN
cusj-10965	20	12	to	to	ADP
cusj-10965	20	13	the	the	DET
cusj-10965	20	14	cytosine	cytosine	NOUN
cusj-10965	20	15	base	base	NOUN
cusj-10965	20	16	editor.4	editor.4	VERB
cusj-10965	20	17	like	like	ADP
cusj-10965	20	18	cas9	cas9	NOUN
cusj-10965	20	19	,	,	PUNCT
cusj-10965	20	20	cytosine	cytosine	NOUN
cusj-10965	20	21	and	and	CCONJ
cusj-10965	20	22	adenine	adenine	ADJ
cusj-10965	20	23	base	base	NOUN
cusj-10965	20	24	editors	editor	NOUN
cusj-10965	20	25	can	can	AUX
cusj-10965	20	26	cause	cause	VERB
cusj-10965	20	27	targeted	targeted	ADJ
cusj-10965	20	28	mutations	mutation	NOUN
cusj-10965	20	29	,	,	PUNCT
cusj-10965	20	30	however	however	ADV
cusj-10965	20	31	these	these	DET
cusj-10965	20	32	base	base	NOUN
cusj-10965	20	33	editors	editor	NOUN
cusj-10965	20	34	are	be	AUX
cusj-10965	20	35	more	more	ADV
cusj-10965	20	36	specific	specific	ADJ
cusj-10965	20	37	due	due	ADP
cusj-10965	20	38	to	to	ADP
cusj-10965	20	39	the	the	DET
cusj-10965	20	40	ability	ability	NOUN
cusj-10965	20	41	to	to	PART
cusj-10965	20	42	specify	specify	VERB
cusj-10965	20	43	the	the	DET
cusj-10965	20	44	point	point	NOUN
cusj-10965	20	45	mutation	mutation	NOUN
cusj-10965	20	46	.	.	PUNCT
cusj-10965	21	1	in	in	ADP
cusj-10965	21	2	a	a	DET
cusj-10965	21	3	gene	gene	NOUN
cusj-10965	21	4	therapy	therapy	NOUN
cusj-10965	21	5	context	context	NOUN
cusj-10965	21	6	,	,	PUNCT
cusj-10965	21	7	adenine	adenine	ADJ
cusj-10965	21	8	base	base	NOUN
cusj-10965	21	9	editors	editor	NOUN
cusj-10965	21	10	are	be	AUX
cusj-10965	21	11	being	be	AUX
cusj-10965	21	12	used	use	VERB
cusj-10965	21	13	to	to	PART
cusj-10965	21	14	mutate	mutate	VERB
cusj-10965	21	15	premature	premature	ADJ
cusj-10965	21	16	stop	stop	NOUN
cusj-10965	21	17	codons	codon	NOUN
cusj-10965	21	18	,	,	PUNCT
cusj-10965	21	19	which	which	PRON
cusj-10965	21	20	are	be	AUX
cusj-10965	21	21	thought	think	VERB
cusj-10965	21	22	to	to	PART
cusj-10965	21	23	cause	cause	VERB
cusj-10965	21	24	faulty	faulty	ADJ
cusj-10965	21	25	gene	gene	NOUN
cusj-10965	21	26	expression	expression	NOUN
cusj-10965	21	27	in	in	ADP
cusj-10965	21	28	up	up	ADP
cusj-10965	21	29	to	to	ADP
cusj-10965	21	30	a	a	DET
cusj-10965	21	31	third	third	NOUN
cusj-10965	21	32	of	of	ADP
cusj-10965	21	33	genetic	genetic	ADJ
cusj-10965	21	34	diseases.5	diseases.5	PROPN
cusj-10965	21	35	despite	despite	SCONJ
cusj-10965	21	36	the	the	DET
cusj-10965	21	37	incredible	incredible	ADJ
cusj-10965	21	38	capabilities	capability	NOUN
cusj-10965	21	39	of	of	ADP
cusj-10965	21	40	base	base	NOUN
cusj-10965	21	41	editors	editor	NOUN
cusj-10965	21	42	,	,	PUNCT
cusj-10965	21	43	they	they	PRON
cusj-10965	21	44	are	be	AUX
cusj-10965	21	45	unable	unable	ADJ
cusj-10965	21	46	to	to	PART
cusj-10965	21	47	perform	perform	VERB
cusj-10965	21	48	more	more	ADJ
cusj-10965	21	49	than	than	ADP
cusj-10965	21	50	specific	specific	ADJ
cusj-10965	21	51	point	point	NOUN
cusj-10965	21	52	mutations	mutation	NOUN
cusj-10965	21	53	.	.	PUNCT
cusj-10965	22	1	however	however	ADV
cusj-10965	22	2	,	,	PUNCT
cusj-10965	22	3	another	another	DET
cusj-10965	22	4	cas9	cas9	NOUN
cusj-10965	22	5	related	relate	VERB
cusj-10965	22	6	system	system	NOUN
cusj-10965	22	7	,	,	PUNCT
cusj-10965	22	8	prime	prime	ADJ
cusj-10965	22	9	editors	editor	NOUN
cusj-10965	22	10	,	,	PUNCT
cusj-10965	22	11	can	can	AUX
cusj-10965	22	12	perform	perform	VERB
cusj-10965	22	13	any	any	DET
cusj-10965	22	14	type	type	NOUN
cusj-10965	22	15	of	of	ADP
cusj-10965	22	16	mutations	mutation	NOUN
cusj-10965	22	17	that	that	PRON
cusj-10965	22	18	can	can	AUX
cusj-10965	22	19	be	be	AUX
cusj-10965	22	20	encoded	encode	VERB
cusj-10965	22	21	in	in	ADP
cusj-10965	22	22	a	a	DET
cusj-10965	22	23	grna.4	grna.4	PROPN
cusj-10965	22	24	simply	simply	ADV
cusj-10965	22	25	speaking	speak	VERB
cusj-10965	22	26	,	,	PUNCT
cusj-10965	22	27	these	these	DET
cusj-10965	22	28	systems	system	NOUN
cusj-10965	22	29	are	be	AUX
cusj-10965	22	30	created	create	VERB
cusj-10965	22	31	by	by	ADP
cusj-10965	22	32	fusing	fuse	VERB
cusj-10965	22	33	a	a	DET
cusj-10965	22	34	reverse	reverse	ADJ
cusj-10965	22	35	transcriptase	transcriptase	NOUN
cusj-10965	22	36	to	to	ADP
cusj-10965	22	37	an	an	DET
cusj-10965	22	38	inactive	inactive	ADJ
cusj-10965	22	39	cas9	cas9	NOUN
cusj-10965	22	40	protein	protein	NOUN
cusj-10965	22	41	.	.	PUNCT
cusj-10965	23	1	a	a	DET
cusj-10965	23	2	prime	prime	ADJ
cusj-10965	23	3	editing	edit	VERB
cusj-10965	23	4	guide	guide	NOUN
cusj-10965	23	5	rna	rna	NOUN
cusj-10965	23	6	then	then	ADV
cusj-10965	23	7	directs	direct	VERB
cusj-10965	23	8	targeted	target	VERB
cusj-10965	23	9	transition	transition	NOUN
cusj-10965	23	10	and	and	CCONJ
cusj-10965	23	11	transversion	transversion	NOUN
cusj-10965	23	12	mutations.4	mutations.4	PROPN
cusj-10965	23	13	although	although	SCONJ
cusj-10965	23	14	there	there	PRON
cusj-10965	23	15	is	be	VERB
cusj-10965	23	16	great	great	ADJ
cusj-10965	23	17	potential	potential	NOUN
cusj-10965	23	18	for	for	ADP
cusj-10965	23	19	this	this	DET
cusj-10965	23	20	system	system	NOUN
cusj-10965	23	21	,	,	PUNCT
cusj-10965	23	22	it	it	PRON
cusj-10965	23	23	still	still	ADV
cusj-10965	23	24	requires	require	VERB
cusj-10965	23	25	much	much	ADV
cusj-10965	23	26	more	more	ADJ
cusj-10965	23	27	research	research	NOUN
cusj-10965	23	28	to	to	PART
cusj-10965	23	29	improve	improve	VERB
cusj-10965	23	30	its	its	PRON
cusj-10965	23	31	efficacy	efficacy	NOUN
cusj-10965	23	32	and	and	CCONJ
cusj-10965	23	33	specificity	specificity	NOUN
cusj-10965	23	34	.	.	PUNCT
cusj-10965	24	1	other	other	ADJ
cusj-10965	24	2	applications	application	NOUN
cusj-10965	24	3	include	include	VERB
cusj-10965	24	4	grna	grna	NOUN
cusj-10965	24	5	targeted	target	VERB
cusj-10965	24	6	modulation	modulation	NOUN
cusj-10965	24	7	of	of	ADP
cusj-10965	24	8	transcription	transcription	NOUN
cusj-10965	24	9	or	or	CCONJ
cusj-10965	24	10	epigenetic	epigenetic	ADJ
cusj-10965	24	11	marks	mark	NOUN
cusj-10965	24	12	by	by	ADP
cusj-10965	24	13	fusing	fuse	VERB
cusj-10965	24	14	transcriptional	transcriptional	NOUN
cusj-10965	24	15	or	or	CCONJ
cusj-10965	24	16	epigenetic	epigenetic	ADJ
cusj-10965	24	17	regulators	regulator	NOUN
cusj-10965	24	18	to	to	PART
cusj-10965	24	19	inactive	inactive	ADJ
cusj-10965	24	20	cas9.6	cas9.6	NOUN
cusj-10965	24	21	these	these	DET
cusj-10965	24	22	methods	method	NOUN
cusj-10965	24	23	can	can	AUX
cusj-10965	24	24	be	be	AUX
cusj-10965	24	25	used	use	VERB
cusj-10965	24	26	to	to	PART
cusj-10965	24	27	up	up	ADP
cusj-10965	24	28	or	or	CCONJ
cusj-10965	24	29	downregulate	downregulate	VERB
cusj-10965	24	30	genes	gene	NOUN
cusj-10965	24	31	like	like	ADP
cusj-10965	24	32	those	those	PRON
cusj-10965	24	33	related	relate	VERB
cusj-10965	24	34	to	to	ADP
cusj-10965	24	35	cancer	cancer	NOUN
cusj-10965	24	36	,	,	PUNCT
cusj-10965	24	37	therefore	therefore	ADV
cusj-10965	24	38	showing	show	VERB
cusj-10965	24	39	a	a	DET
cusj-10965	24	40	lot	lot	NOUN
cusj-10965	24	41	of	of	ADP
cusj-10965	24	42	promise	promise	NOUN
cusj-10965	24	43	for	for	ADP
cusj-10965	24	44	therapeutic	therapeutic	ADJ
cusj-10965	24	45	uses.4	uses.4	NOUN
cusj-10965	24	46	in	in	ADP
cusj-10965	24	47	several	several	ADJ
cusj-10965	24	48	mouse	mouse	NOUN
cusj-10965	24	49	models	model	NOUN
cusj-10965	24	50	,	,	PUNCT
cusj-10965	24	51	researchers	researcher	NOUN
cusj-10965	24	52	have	have	AUX
cusj-10965	24	53	been	be	AUX
cusj-10965	24	54	able	able	ADJ
cusj-10965	24	55	to	to	PART
cusj-10965	24	56	reduce	reduce	VERB
cusj-10965	24	57	the	the	DET
cusj-10965	24	58	severity	severity	NOUN
cusj-10965	24	59	of	of	ADP
cusj-10965	24	60	neurodegenerative	neurodegenerative	ADJ
cusj-10965	24	61	diseases	disease	NOUN
cusj-10965	24	62	by	by	ADP
cusj-10965	24	63	editing	edit	VERB
cusj-10965	24	64	genes	gene	NOUN
cusj-10965	24	65	with	with	ADP
cusj-10965	24	66	crispr	crispr	NOUN
cusj-10965	24	67	.	.	PUNCT
cusj-10965	25	1	7	7	NUM
cusj-10965	25	2	recent	recent	ADJ
cusj-10965	25	3	studies	study	NOUN
cusj-10965	25	4	have	have	AUX
cusj-10965	25	5	demonstrated	demonstrate	VERB
cusj-10965	25	6	cas9	cas9	NOUN
cusj-10965	25	7	to	to	PART
cusj-10965	25	8	be	be	AUX
cusj-10965	25	9	promising	promise	VERB
cusj-10965	25	10	in	in	ADP
cusj-10965	25	11	decreasing	decrease	VERB
cusj-10965	25	12	the	the	DET
cusj-10965	25	13	effects	effect	NOUN
cusj-10965	25	14	of	of	ADP
cusj-10965	25	15	alzheimer	alzheimer	PROPN
cusj-10965	25	16	’s	’s	PART
cusj-10965	25	17	and	and	CCONJ
cusj-10965	25	18	parkinson	parkinson	NOUN
cusj-10965	25	19	’s	’s	PART
cusj-10965	25	20	disease	disease	NOUN
cusj-10965	25	21	through	through	ADP
cusj-10965	25	22	the	the	DET
cusj-10965	25	23	mutation	mutation	NOUN
cusj-10965	25	24	of	of	ADP
cusj-10965	25	25	the	the	DET
cusj-10965	25	26	app	app	NOUN
cusj-10965	25	27	and	and	CCONJ
cusj-10965	25	28	lrrk2	lrrk2	NOUN
cusj-10965	25	29	gene	gene	NOUN
cusj-10965	25	30	respectively.7	respectively.7	VERB
cusj-10965	25	31	a	a	DET
cusj-10965	25	32	study	study	NOUN
cusj-10965	25	33	from	from	ADP
cusj-10965	25	34	yang	yang	PROPN
cusj-10965	25	35	et	et	PROPN
cusj-10965	25	36	al	al	PROPN
cusj-10965	25	37	.	.	PROPN
cusj-10965	25	38	has	have	AUX
cusj-10965	25	39	shown	show	VERB
cusj-10965	25	40	that	that	SCONJ
cusj-10965	25	41	crispr	crispr	ADJ
cusj-10965	25	42	technology	technology	NOUN
cusj-10965	25	43	can	can	AUX
cusj-10965	25	44	be	be	AUX
cusj-10965	25	45	used	use	VERB
cusj-10965	25	46	to	to	PART
cusj-10965	25	47	ameliorate	ameliorate	VERB
cusj-10965	25	48	the	the	DET
cusj-10965	25	49	symptoms	symptom	NOUN
cusj-10965	25	50	of	of	ADP
cusj-10965	25	51	huntington	huntington	PROPN
cusj-10965	25	52	's	's	PART
cusj-10965	25	53	disease	disease	NOUN
cusj-10965	25	54	in	in	ADP
cusj-10965	25	55	mouse	mouse	NOUN
cusj-10965	25	56	models	model	NOUN
cusj-10965	25	57	through	through	ADP
cusj-10965	25	58	mutations	mutation	NOUN
cusj-10965	25	59	in	in	ADP
cusj-10965	25	60	the	the	DET
cusj-10965	25	61	htt	htt	NOUN
cusj-10965	25	62	gene.8	gene.8	PROPN
cusj-10965	25	63	in	in	ADP
cusj-10965	25	64	addition	addition	NOUN
cusj-10965	25	65	,	,	PUNCT
cusj-10965	25	66	clinical	clinical	ADJ
cusj-10965	25	67	trials	trial	NOUN
cusj-10965	25	68	for	for	ADP
cusj-10965	25	69	crispr	crispr	ADJ
cusj-10965	25	70	related	related	ADJ
cusj-10965	25	71	therapies	therapy	NOUN
cusj-10965	25	72	have	have	AUX
cusj-10965	25	73	already	already	ADV
cusj-10965	25	74	begun	begin	VERB
cusj-10965	25	75	to	to	PART
cusj-10965	25	76	treat	treat	VERB
cusj-10965	25	77	cystic	cystic	ADJ
cusj-10965	25	78	fibrosis	fibrosis	NOUN
cusj-10965	25	79	by	by	ADP
cusj-10965	25	80	mutating	mutate	VERB
cusj-10965	25	81	the	the	DET
cusj-10965	25	82	cftr	cftr	NOUN
cusj-10965	25	83	gene.9	gene.9	NOUN
cusj-10965	25	84	as	as	ADP
cusj-10965	25	85	a	a	DET
cusj-10965	25	86	result	result	NOUN
cusj-10965	25	87	,	,	PUNCT
cusj-10965	25	88	crispr	crispr	ADJ
cusj-10965	25	89	,	,	PUNCT
cusj-10965	25	90	while	while	SCONJ
cusj-10965	25	91	still	still	ADV
cusj-10965	25	92	being	be	AUX
cusj-10965	25	93	heavily	heavily	ADV
cusj-10965	25	94	researched	research	VERB
cusj-10965	25	95	and	and	CCONJ
cusj-10965	25	96	developed	develop	VERB
cusj-10965	25	97	,	,	PUNCT
cusj-10965	25	98	shows	show	VERB
cusj-10965	25	99	extremely	extremely	ADV
cusj-10965	25	100	promising	promising	ADJ
cusj-10965	25	101	capabilities	capability	NOUN
cusj-10965	25	102	for	for	ADP
cusj-10965	25	103	mitigating	mitigate	VERB
cusj-10965	25	104	genetic	genetic	ADJ
cusj-10965	25	105	diseases	disease	NOUN
cusj-10965	25	106	.	.	PUNCT
cusj-10965	26	1	crispr	crispr	ADJ
cusj-10965	26	2	-	-	PUNCT
cusj-10965	26	3	cas9	cas9	NOUN
cusj-10965	26	4	delivery	delivery	NOUN
cusj-10965	26	5	figure	figure	NOUN
cusj-10965	26	6	1	1	NUM
cusj-10965	26	7	:	:	PUNCT
cusj-10965	26	8	illustration	illustration	NOUN
cusj-10965	26	9	of	of	ADP
cusj-10965	26	10	how	how	SCONJ
cusj-10965	26	11	crispr	crispr	ADJ
cusj-10965	26	12	-	-	PUNCT
cusj-10965	26	13	cas9	cas9	NOUN
cusj-10965	26	14	performs	perform	VERB
cusj-10965	26	15	gene	gene	NOUN
cusj-10965	26	16	editing	editing	NOUN
cusj-10965	26	17	.	.	PUNCT
cusj-10965	27	1	columbia	columbia	PROPN
cusj-10965	27	2	undergraduate	undergraduate	PROPN
cusj-10965	27	3	science	science	PROPN
cusj-10965	27	4	journal	journal	PROPN
cusj-10965	27	5	vol	vol	NOUN
cusj-10965	27	6	.	.	PROPN
cusj-10965	27	7	17	17	NUM
cusj-10965	27	8	,	,	PUNCT
cusj-10965	27	9	2023	2023	NUM
cusj-10965	27	10	lang	lang	PROPN
cusj-10965	27	11	et	et	PROPN
cusj-10965	27	12	.	.	PUNCT
cusj-10965	28	1	al	al	PROPN
cusj-10965	28	2	.	.	PROPN
cusj-10965	28	3	8	8	NUM
cusj-10965	28	4	one	one	NUM
cusj-10965	28	5	major	major	ADJ
cusj-10965	28	6	hurdle	hurdle	NOUN
cusj-10965	28	7	to	to	PART
cusj-10965	28	8	fully	fully	ADV
cusj-10965	28	9	realizing	realize	VERB
cusj-10965	28	10	the	the	DET
cusj-10965	28	11	potential	potential	NOUN
cusj-10965	28	12	of	of	ADP
cusj-10965	28	13	cas9	cas9	NOUN
cusj-10965	28	14	-	-	PUNCT
cusj-10965	28	15	based	base	VERB
cusj-10965	28	16	approaches	approach	NOUN
cusj-10965	28	17	is	be	AUX
cusj-10965	28	18	delivery	delivery	NOUN
cusj-10965	28	19	to	to	ADP
cusj-10965	28	20	tissues	tissue	NOUN
cusj-10965	28	21	and	and	CCONJ
cusj-10965	28	22	cells	cell	NOUN
cusj-10965	28	23	.	.	PUNCT
cusj-10965	29	1	there	there	PRON
cusj-10965	29	2	are	be	VERB
cusj-10965	29	3	two	two	NUM
cusj-10965	29	4	primary	primary	ADJ
cusj-10965	29	5	ways	way	NOUN
cusj-10965	29	6	currently	currently	ADV
cusj-10965	29	7	used	use	VERB
cusj-10965	29	8	to	to	PART
cusj-10965	29	9	deliver	deliver	VERB
cusj-10965	29	10	cas9	cas9	NOUN
cusj-10965	29	11	and	and	CCONJ
cusj-10965	29	12	grna	grna	NOUN
cusj-10965	29	13	:	:	PUNCT
cusj-10965	29	14	viral	viral	ADJ
cusj-10965	29	15	and	and	CCONJ
cusj-10965	29	16	non	non	ADJ
cusj-10965	29	17	-	-	ADJ
cusj-10965	29	18	viral	viral	ADJ
cusj-10965	29	19	delivery	delivery	NOUN
cusj-10965	29	20	.	.	PUNCT
cusj-10965	30	1	with	with	ADP
cusj-10965	30	2	viral	viral	ADJ
cusj-10965	30	3	delivery	delivery	NOUN
cusj-10965	30	4	,	,	PUNCT
cusj-10965	30	5	there	there	PRON
cusj-10965	30	6	are	be	VERB
cusj-10965	30	7	methods	method	NOUN
cusj-10965	30	8	that	that	PRON
cusj-10965	30	9	use	use	VERB
cusj-10965	30	10	adeno	adeno	NOUN
cusj-10965	30	11	-	-	PUNCT
cusj-10965	30	12	associated	associate	VERB
cusj-10965	30	13	viruses	virus	NOUN
cusj-10965	30	14	(	(	PUNCT
cusj-10965	30	15	aavs	aavs	ADV
cusj-10965	30	16	)	)	PUNCT
cusj-10965	30	17	or	or	CCONJ
cusj-10965	30	18	lentiviral	lentiviral	ADJ
cusj-10965	30	19	vectors	vector	NOUN
cusj-10965	30	20	to	to	PART
cusj-10965	30	21	encapsulate	encapsulate	VERB
cusj-10965	30	22	both	both	DET
cusj-10965	30	23	cas9	cas9	NOUN
cusj-10965	30	24	and	and	CCONJ
cusj-10965	30	25	grna	grna	VERB
cusj-10965	30	26	genetic	genetic	ADJ
cusj-10965	30	27	information	information	NOUN
cusj-10965	30	28	and	and	CCONJ
cusj-10965	30	29	deliver	deliver	VERB
cusj-10965	30	30	it	it	PRON
cusj-10965	30	31	to	to	ADP
cusj-10965	30	32	cells	cell	NOUN
cusj-10965	30	33	through	through	ADP
cusj-10965	30	34	a	a	DET
cusj-10965	30	35	mechanism	mechanism	NOUN
cusj-10965	30	36	similar	similar	ADJ
cusj-10965	30	37	to	to	ADP
cusj-10965	30	38	viral	viral	ADJ
cusj-10965	30	39	infection	infection	NOUN
cusj-10965	30	40	.	.	PUNCT
cusj-10965	31	1	on	on	ADP
cusj-10965	31	2	the	the	DET
cusj-10965	31	3	other	other	ADJ
cusj-10965	31	4	hand	hand	NOUN
cusj-10965	31	5	,	,	PUNCT
cusj-10965	31	6	non	non	ADJ
cusj-10965	31	7	-	-	ADJ
cusj-10965	31	8	viral	viral	ADJ
cusj-10965	31	9	methods	method	NOUN
cusj-10965	31	10	utilize	utilize	VERB
cusj-10965	31	11	other	other	ADJ
cusj-10965	31	12	macromolecules	macromolecule	NOUN
cusj-10965	31	13	like	like	ADP
cusj-10965	31	14	lipid	lipid	NOUN
cusj-10965	31	15	nanoparticles	nanoparticle	NOUN
cusj-10965	31	16	(	(	PUNCT
cusj-10965	31	17	lnps	lnps	PROPN
cusj-10965	31	18	)	)	PUNCT
cusj-10965	31	19	,	,	PUNCT
cusj-10965	31	20	protein	protein	NOUN
cusj-10965	31	21	polymers	polymer	NOUN
cusj-10965	31	22	,	,	PUNCT
cusj-10965	31	23	and	and	CCONJ
cusj-10965	31	24	au	au	ADJ
cusj-10965	31	25	nanoparticles	nanoparticle	NOUN
cusj-10965	31	26	to	to	PART
cusj-10965	31	27	deliver	deliver	VERB
cusj-10965	31	28	grna	grna	NOUN
cusj-10965	31	29	and	and	CCONJ
cusj-10965	31	30	cas9	cas9	PROPN
cusj-10965	31	31	mrna	mrna	PROPN
cusj-10965	31	32	,	,	PUNCT
cusj-10965	31	33	protein	protein	NOUN
cusj-10965	31	34	,	,	PUNCT
cusj-10965	31	35	or	or	CCONJ
cusj-10965	31	36	dna.10	dna.10	NOUN
cusj-10965	31	37	delivering	deliver	VERB
cusj-10965	31	38	the	the	DET
cusj-10965	31	39	protein	protein	NOUN
cusj-10965	31	40	form	form	NOUN
cusj-10965	31	41	of	of	ADP
cusj-10965	31	42	crispr	crispr	NOUN
cusj-10965	31	43	-	-	PUNCT
cusj-10965	31	44	cas9	cas9	NOUN
cusj-10965	31	45	along	along	ADP
cusj-10965	31	46	with	with	ADP
cusj-10965	31	47	grna	grna	NOUN
cusj-10965	31	48	is	be	AUX
cusj-10965	31	49	efficient	efficient	ADJ
cusj-10965	31	50	and	and	CCONJ
cusj-10965	31	51	does	do	AUX
cusj-10965	31	52	n’t	not	PART
cusj-10965	31	53	result	result	VERB
cusj-10965	31	54	in	in	ADP
cusj-10965	31	55	much	much	ADJ
cusj-10965	31	56	off	off	ADP
cusj-10965	31	57	-	-	PUNCT
cusj-10965	31	58	target	target	NOUN
cusj-10965	31	59	editing	editing	NOUN
cusj-10965	31	60	,	,	PUNCT
cusj-10965	31	61	however	however	ADV
cusj-10965	31	62	it	it	PRON
cusj-10965	31	63	is	be	AUX
cusj-10965	31	64	very	very	ADV
cusj-10965	31	65	expensive	expensive	ADJ
cusj-10965	31	66	and	and	CCONJ
cusj-10965	31	67	there	there	PRON
cusj-10965	31	68	is	be	VERB
cusj-10965	31	69	risk	risk	NOUN
cusj-10965	31	70	of	of	ADP
cusj-10965	31	71	endotoxin	endotoxin	ADJ
cusj-10965	32	1	contamination.10	contamination.10	PROPN
cusj-10965	32	2	cas9	cas9	PROPN
cusj-10965	32	3	mrna	mrna	PROPN
cusj-10965	32	4	+	+	CCONJ
cusj-10965	32	5	grna	grna	NOUN
cusj-10965	32	6	delivery	delivery	NOUN
cusj-10965	32	7	has	have	VERB
cusj-10965	32	8	similar	similar	ADJ
cusj-10965	32	9	figure	figure	NOUN
cusj-10965	32	10	2	2	NUM
cusj-10965	32	11	:	:	PUNCT
cusj-10965	32	12	sequence	sequence	NOUN
cusj-10965	32	13	of	of	ADP
cusj-10965	32	14	pctg	pctg	NOUN
cusj-10965	32	15	plasmids	plasmid	NOUN
cusj-10965	32	16	involved	involve	VERB
cusj-10965	32	17	with	with	ADP
cusj-10965	32	18	cas9	cas9	PROPN
cusj-10965	32	19	gene	gene	NOUN
cusj-10965	32	20	editing	editing	NOUN
cusj-10965	32	21	.	.	PUNCT
cusj-10965	33	1	1x	1x	PROPN
cusj-10965	33	2	refers	refer	VERB
cusj-10965	33	3	to	to	ADP
cusj-10965	33	4	one	one	NUM
cusj-10965	33	5	copy	copy	NOUN
cusj-10965	33	6	of	of	ADP
cusj-10965	33	7	the	the	DET
cusj-10965	33	8	grna	grna	NOUN
cusj-10965	33	9	between	between	ADP
cusj-10965	33	10	two	two	NUM
cusj-10965	33	11	self	self	NOUN
cusj-10965	33	12	-	-	PUNCT
cusj-10965	33	13	cleaving	cleave	VERB
cusj-10965	33	14	ribozyme	ribozyme	ADJ
cusj-10965	33	15	sequences	sequence	NOUN
cusj-10965	33	16	.	.	PUNCT
cusj-10965	34	1	the	the	DET
cusj-10965	34	2	pctg	pctg	NOUN
cusj-10965	34	3	2x	2x	NUM
cusj-10965	34	4	plasmids	plasmid	NOUN
cusj-10965	34	5	have	have	VERB
cusj-10965	34	6	two	two	NUM
cusj-10965	34	7	ribozyme	ribozyme	ADJ
cusj-10965	34	8	+	+	CCONJ
cusj-10965	34	9	grna	grna	NOUN
cusj-10965	34	10	+	+	CCONJ
cusj-10965	34	11	ribozyme	ribozyme	ADJ
cusj-10965	34	12	sequences	sequence	NOUN
cusj-10965	34	13	subsequently	subsequently	ADV
cusj-10965	34	14	and	and	CCONJ
cusj-10965	34	15	the	the	DET
cusj-10965	34	16	pctg	pctg	NOUN
cusj-10965	34	17	4x	4x	NUM
cusj-10965	34	18	(	(	PUNCT
cusj-10965	34	19	not	not	PART
cusj-10965	34	20	shown	show	VERB
cusj-10965	34	21	)	)	PUNCT
cusj-10965	35	1	plasmid	plasmid	NOUN
cusj-10965	35	2	has	have	VERB
cusj-10965	35	3	four	four	NUM
cusj-10965	35	4	.	.	PUNCT
cusj-10965	36	1	figure	figure	NOUN
cusj-10965	36	2	3	3	NUM
cusj-10965	36	3	:	:	PUNCT
cusj-10965	36	4	schematic	schematic	ADJ
cusj-10965	36	5	of	of	ADP
cusj-10965	36	6	rfp	rfp	PROPN
cusj-10965	36	7	and	and	CCONJ
cusj-10965	36	8	gfp	gfp	PROPN
cusj-10965	36	9	reporters	reporter	NOUN
cusj-10965	36	10	used	use	VERB
cusj-10965	36	11	.	.	PUNCT
cusj-10965	37	1	gene	gene	NOUN
cusj-10965	37	2	editing	editing	NOUN
cusj-10965	37	3	of	of	ADP
cusj-10965	37	4	tlr	tlr	PROPN
cusj-10965	37	5	reporter	reporter	NOUN
cusj-10965	37	6	causes	cause	VERB
cusj-10965	37	7	a	a	DET
cusj-10965	37	8	frameshift	frameshift	NOUN
cusj-10965	37	9	which	which	PRON
cusj-10965	37	10	makes	make	VERB
cusj-10965	37	11	rfp	rfp	PROPN
cusj-10965	37	12	.	.	PROPN
cusj-10965	37	13	gfp	gfp	PROPN
cusj-10965	37	14	reporter	reporter	NOUN
cusj-10965	37	15	is	be	AUX
cusj-10965	37	16	activated	activate	VERB
cusj-10965	37	17	through	through	ADP
cusj-10965	37	18	editing	edit	VERB
cusj-10965	37	19	multiple	multiple	ADJ
cusj-10965	37	20	sites	site	NOUN
cusj-10965	37	21	to	to	PART
cusj-10965	37	22	delete	delete	VERB
cusj-10965	37	23	transcriptional	transcriptional	NOUN
cusj-10965	37	24	stops	stop	NOUN
cusj-10965	37	25	.	.	PUNCT
cusj-10965	38	1	columbia	columbia	PROPN
cusj-10965	38	2	undergraduate	undergraduate	PROPN
cusj-10965	38	3	science	science	PROPN
cusj-10965	38	4	journal	journal	PROPN
cusj-10965	38	5	vol	vol	NOUN
cusj-10965	38	6	.	.	PROPN
cusj-10965	38	7	17	17	NUM
cusj-10965	38	8	,	,	PUNCT
cusj-10965	38	9	2023	2023	NUM
cusj-10965	38	10	lang	lang	PROPN
cusj-10965	38	11	et	et	PROPN
cusj-10965	38	12	.	.	PUNCT
cusj-10965	39	1	al	al	PROPN
cusj-10965	39	2	.	.	PROPN
cusj-10965	39	3	9	9	NUM
cusj-10965	39	4	benefits	benefit	NOUN
cusj-10965	39	5	to	to	ADP
cusj-10965	39	6	the	the	DET
cusj-10965	39	7	protein	protein	NOUN
cusj-10965	39	8	form	form	NOUN
cusj-10965	39	9	;	;	PUNCT
cusj-10965	39	10	however	however	ADV
cusj-10965	39	11	,	,	PUNCT
cusj-10965	39	12	it	it	PRON
cusj-10965	39	13	requires	require	VERB
cusj-10965	39	14	two	two	NUM
cusj-10965	39	15	components	component	NOUN
cusj-10965	39	16	to	to	PART
cusj-10965	39	17	get	get	VERB
cusj-10965	39	18	into	into	ADP
cusj-10965	39	19	particles	particle	NOUN
cusj-10965	39	20	and	and	CCONJ
cusj-10965	39	21	cells.10	cells.10	NOUN
cusj-10965	39	22	alternatively	alternatively	ADV
cusj-10965	39	23	,	,	PUNCT
cusj-10965	39	24	cas9	cas9	NOUN
cusj-10965	39	25	delivery	delivery	NOUN
cusj-10965	39	26	can	can	AUX
cusj-10965	39	27	also	also	ADV
cusj-10965	39	28	be	be	AUX
cusj-10965	39	29	performed	perform	VERB
cusj-10965	39	30	through	through	ADP
cusj-10965	39	31	complexing	complexe	VERB
cusj-10965	39	32	and	and	CCONJ
cusj-10965	39	33	conjugating	conjugate	VERB
cusj-10965	39	34	with	with	ADP
cusj-10965	39	35	proteins	protein	NOUN
cusj-10965	39	36	.	.	PUNCT
cusj-10965	40	1	ramakrishna	ramakrishna	NOUN
cusj-10965	40	2	et	et	PROPN
cusj-10965	40	3	al	al	PROPN
cusj-10965	40	4	.	.	PROPN
cusj-10965	40	5	were	be	AUX
cusj-10965	40	6	able	able	ADJ
cusj-10965	40	7	to	to	PART
cusj-10965	40	8	design	design	VERB
cusj-10965	40	9	a	a	DET
cusj-10965	40	10	cell	cell	NOUN
cusj-10965	40	11	-	-	PUNCT
cusj-10965	40	12	penetrating	penetrate	VERB
cusj-10965	40	13	protein	protein	NOUN
cusj-10965	40	14	(	(	PUNCT
cusj-10965	40	15	cpp	cpp	NOUN
cusj-10965	40	16	)	)	PUNCT
cusj-10965	40	17	that	that	PRON
cusj-10965	40	18	was	be	AUX
cusj-10965	40	19	conjugated	conjugate	VERB
cusj-10965	40	20	to	to	ADP
cusj-10965	40	21	cas9	cas9	NOUN
cusj-10965	40	22	and	and	CCONJ
cusj-10965	40	23	combined	combine	VERB
cusj-10965	40	24	with	with	ADP
cusj-10965	40	25	a	a	DET
cusj-10965	40	26	cpp	cpp	NOUN
cusj-10965	40	27	complexed	complexed	NOUN
cusj-10965	40	28	to	to	ADP
cusj-10965	40	29	a	a	DET
cusj-10965	40	30	grna	grna	NOUN
cusj-10965	40	31	,	,	PUNCT
cusj-10965	40	32	resulting	result	VERB
cusj-10965	40	33	in	in	ADP
cusj-10965	40	34	efficient	efficient	ADJ
cusj-10965	40	35	endogenous	endogenous	ADJ
cusj-10965	40	36	gene	gene	NOUN
cusj-10965	40	37	editing.11	editing.11	NOUN
cusj-10965	40	38	this	this	DET
cusj-10965	40	39	technology	technology	NOUN
cusj-10965	40	40	has	have	AUX
cusj-10965	40	41	been	be	AUX
cusj-10965	40	42	proven	prove	VERB
cusj-10965	40	43	effective	effective	ADJ
cusj-10965	40	44	in	in	ADP
cusj-10965	40	45	hek293	hek293	PROPN
cusj-10965	40	46	t	t	NOUN
cusj-10965	40	47	cells	cell	NOUN
cusj-10965	40	48	,	,	PUNCT
cusj-10965	40	49	embryonic	embryonic	ADJ
cusj-10965	40	50	stem	stem	NOUN
cusj-10965	40	51	cells	cell	NOUN
cusj-10965	40	52	,	,	PUNCT
cusj-10965	40	53	embryonic	embryonic	ADJ
cusj-10965	40	54	carcinoma	carcinoma	NOUN
cusj-10965	40	55	cells	cell	NOUN
cusj-10965	40	56	,	,	PUNCT
cusj-10965	40	57	and	and	CCONJ
cusj-10965	40	58	dermal	dermal	VERB
cusj-10965	40	59	fibroblasts.11	fibroblasts.11	NOUN
cusj-10965	40	60	additionally	additionally	ADV
cusj-10965	40	61	,	,	PUNCT
cusj-10965	40	62	this	this	DET
cusj-10965	40	63	system	system	NOUN
cusj-10965	40	64	was	be	AUX
cusj-10965	40	65	able	able	ADJ
cusj-10965	40	66	to	to	PART
cusj-10965	40	67	produce	produce	VERB
cusj-10965	40	68	less	less	ADJ
cusj-10965	40	69	off	off	ADP
cusj-10965	40	70	-	-	PUNCT
cusj-10965	40	71	target	target	NOUN
cusj-10965	40	72	editing	editing	NOUN
cusj-10965	40	73	events	event	NOUN
cusj-10965	40	74	,	,	PUNCT
cusj-10965	40	75	however	however	ADV
cusj-10965	40	76	it	it	PRON
cusj-10965	40	77	is	be	AUX
cusj-10965	40	78	not	not	PART
cusj-10965	40	79	perfect	perfect	ADJ
cusj-10965	40	80	and	and	CCONJ
cusj-10965	40	81	it	it	PRON
cusj-10965	40	82	is	be	AUX
cusj-10965	40	83	difficult	difficult	ADJ
cusj-10965	40	84	in	in	ADP
cusj-10965	40	85	vivo	vivo	NOUN
cusj-10965	40	86	without	without	ADP
cusj-10965	40	87	a	a	DET
cusj-10965	40	88	protective	protective	ADJ
cusj-10965	40	89	lipid	lipid	NOUN
cusj-10965	40	90	nanoparticle.11	nanoparticle.11	NOUN
cusj-10965	40	91	while	while	SCONJ
cusj-10965	40	92	there	there	PRON
cusj-10965	40	93	have	have	AUX
cusj-10965	40	94	been	be	AUX
cusj-10965	40	95	studies	study	NOUN
cusj-10965	40	96	showing	show	VERB
cusj-10965	40	97	effective	effective	ADJ
cusj-10965	40	98	delivery	delivery	NOUN
cusj-10965	40	99	of	of	ADP
cusj-10965	40	100	crispr	crispr	NOUN
cusj-10965	40	101	-	-	PUNCT
cusj-10965	40	102	cas9	cas9	NOUN
cusj-10965	40	103	into	into	ADP
cusj-10965	40	104	tissues	tissue	NOUN
cusj-10965	40	105	using	use	VERB
cusj-10965	40	106	lentiviral	lentiviral	ADJ
cusj-10965	40	107	and	and	CCONJ
cusj-10965	40	108	adeno	adeno	NOUN
cusj-10965	40	109	-	-	PUNCT
cusj-10965	40	110	associated	associate	VERB
cusj-10965	40	111	virus	virus	NOUN
cusj-10965	40	112	vectors	vector	NOUN
cusj-10965	40	113	,	,	PUNCT
cusj-10965	40	114	these	these	DET
cusj-10965	40	115	methods	method	NOUN
cusj-10965	40	116	of	of	ADP
cusj-10965	40	117	long	long	ADJ
cusj-10965	40	118	-	-	PUNCT
cusj-10965	40	119	term	term	NOUN
cusj-10965	40	120	expression	expression	NOUN
cusj-10965	40	121	can	can	AUX
cusj-10965	40	122	be	be	AUX
cusj-10965	40	123	problematic	problematic	ADJ
cusj-10965	40	124	if	if	SCONJ
cusj-10965	40	125	used	use	VERB
cusj-10965	40	126	as	as	ADP
cusj-10965	40	127	a	a	DET
cusj-10965	40	128	therapeutic12,13	therapeutic12,13	NOUN
cusj-10965	40	129	.	.	PUNCT
cusj-10965	41	1	for	for	ADP
cusj-10965	41	2	example	example	NOUN
cusj-10965	41	3	,	,	PUNCT
cusj-10965	41	4	lentiviruses	lentiviruse	NOUN
cusj-10965	41	5	involve	involve	VERB
cusj-10965	41	6	integration	integration	NOUN
cusj-10965	41	7	into	into	ADP
cusj-10965	41	8	the	the	DET
cusj-10965	41	9	genome	genome	NOUN
cusj-10965	41	10	and	and	CCONJ
cusj-10965	41	11	potentially	potentially	ADV
cusj-10965	41	12	permanent	permanent	ADJ
cusj-10965	41	13	,	,	PUNCT
cusj-10965	41	14	constant	constant	ADJ
cusj-10965	41	15	expression	expression	NOUN
cusj-10965	41	16	of	of	ADP
cusj-10965	41	17	cas9	cas9	NOUN
cusj-10965	41	18	along	along	ADP
cusj-10965	41	19	with	with	ADP
cusj-10965	41	20	a	a	DET
cusj-10965	41	21	grna14	grna14	NOUN
cusj-10965	41	22	.	.	PUNCT
cusj-10965	42	1	despite	despite	SCONJ
cusj-10965	42	2	the	the	DET
cusj-10965	42	3	specificity	specificity	NOUN
cusj-10965	42	4	of	of	ADP
cusj-10965	42	5	cas9	cas9	NOUN
cusj-10965	42	6	,	,	PUNCT
cusj-10965	42	7	the	the	DET
cusj-10965	42	8	technology	technology	NOUN
cusj-10965	42	9	is	be	AUX
cusj-10965	42	10	not	not	PART
cusj-10965	42	11	guaranteed	guarantee	VERB
cusj-10965	42	12	to	to	PART
cusj-10965	42	13	always	always	ADV
cusj-10965	42	14	edit	edit	VERB
cusj-10965	42	15	targeted	target	VERB
cusj-10965	42	16	gene	gene	NOUN
cusj-10965	42	17	sequences	sequence	NOUN
cusj-10965	42	18	,	,	PUNCT
cusj-10965	42	19	and	and	CCONJ
cusj-10965	42	20	this	this	PRON
cusj-10965	42	21	can	can	AUX
cusj-10965	42	22	potentially	potentially	ADV
cusj-10965	42	23	lead	lead	VERB
cusj-10965	42	24	to	to	ADP
cusj-10965	42	25	malignant	malignant	ADJ
cusj-10965	42	26	or	or	CCONJ
cusj-10965	42	27	deleterious	deleterious	ADJ
cusj-10965	42	28	mutations	mutation	NOUN
cusj-10965	42	29	.	.	PUNCT
cusj-10965	43	1	in	in	ADP
cusj-10965	43	2	many	many	ADJ
cusj-10965	43	3	of	of	ADP
cusj-10965	43	4	the	the	DET
cusj-10965	43	5	previous	previous	ADJ
cusj-10965	43	6	methods	method	NOUN
cusj-10965	43	7	,	,	PUNCT
cusj-10965	43	8	the	the	DET
cusj-10965	43	9	size	size	NOUN
cusj-10965	43	10	of	of	ADP
cusj-10965	43	11	cargo	cargo	NOUN
cusj-10965	43	12	is	be	AUX
cusj-10965	43	13	also	also	ADV
cusj-10965	43	14	a	a	DET
cusj-10965	43	15	significant	significant	ADJ
cusj-10965	43	16	barrier	barrier	NOUN
cusj-10965	43	17	for	for	ADP
cusj-10965	43	18	the	the	DET
cusj-10965	43	19	efficient	efficient	ADJ
cusj-10965	43	20	delivery	delivery	NOUN
cusj-10965	43	21	of	of	ADP
cusj-10965	43	22	gene	gene	NOUN
cusj-10965	43	23	editing	edit	VERB
cusj-10965	43	24	technology	technology	NOUN
cusj-10965	43	25	.	.	PUNCT
cusj-10965	44	1	for	for	ADP
cusj-10965	44	2	instance	instance	NOUN
cusj-10965	44	3	,	,	PUNCT
cusj-10965	44	4	aav	aav	NOUN
cusj-10965	44	5	packaging	packaging	NOUN
cusj-10965	44	6	limits	limit	NOUN
cusj-10965	44	7	require	require	VERB
cusj-10965	44	8	separate	separate	ADJ
cusj-10965	44	9	viruses	virus	NOUN
cusj-10965	44	10	to	to	PART
cusj-10965	44	11	be	be	AUX
cusj-10965	44	12	made	make	VERB
cusj-10965	44	13	for	for	ADP
cusj-10965	44	14	cas9	cas9	NOUN
cusj-10965	44	15	and	and	CCONJ
cusj-10965	44	16	grna	grna	NOUN
cusj-10965	44	17	.	.	PUNCT
cusj-10965	45	1	lentiviral	lentiviral	ADJ
cusj-10965	45	2	packaging	packaging	NOUN
cusj-10965	45	3	limitations	limitation	NOUN
cusj-10965	45	4	lead	lead	VERB
cusj-10965	45	5	to	to	ADP
cusj-10965	45	6	reduced	reduce	VERB
cusj-10965	45	7	efficacy	efficacy	NOUN
cusj-10965	45	8	when	when	SCONJ
cusj-10965	45	9	carrying	carry	VERB
cusj-10965	45	10	large	large	ADJ
cusj-10965	45	11	cas9	cas9	NOUN
cusj-10965	45	12	and	and	CCONJ
cusj-10965	45	13	grna	grna	NOUN
cusj-10965	45	14	genes	gene	NOUN
cusj-10965	45	15	together	together	ADV
cusj-10965	45	16	.	.	PUNCT
cusj-10965	46	1	several	several	ADJ
cusj-10965	46	2	non	non	ADJ
cusj-10965	46	3	-	-	ADJ
cusj-10965	46	4	viral	viral	ADJ
cusj-10965	46	5	approaches	approach	NOUN
cusj-10965	46	6	depend	depend	VERB
cusj-10965	46	7	on	on	ADP
cusj-10965	46	8	two	two	NUM
cusj-10965	46	9	different	different	ADJ
cusj-10965	46	10	components	component	NOUN
cusj-10965	46	11	(	(	PUNCT
cusj-10965	46	12	cas9	cas9	NOUN
cusj-10965	46	13	and	and	CCONJ
cusj-10965	46	14	grna	grna	NOUN
cusj-10965	46	15	)	)	PUNCT
cusj-10965	46	16	to	to	PART
cusj-10965	46	17	get	get	VERB
cusj-10965	46	18	into	into	ADP
cusj-10965	46	19	the	the	DET
cusj-10965	46	20	same	same	ADJ
cusj-10965	46	21	particles	particle	NOUN
cusj-10965	46	22	and	and	CCONJ
cusj-10965	46	23	cells	cell	NOUN
cusj-10965	46	24	.	.	PUNCT
cusj-10965	47	1	therefore	therefore	ADV
cusj-10965	47	2	,	,	PUNCT
cusj-10965	47	3	to	to	PART
cusj-10965	47	4	increase	increase	VERB
cusj-10965	47	5	the	the	DET
cusj-10965	47	6	efficiency	efficiency	NOUN
cusj-10965	47	7	of	of	ADP
cusj-10965	47	8	delivery	delivery	NOUN
cusj-10965	47	9	,	,	PUNCT
cusj-10965	47	10	we	we	PRON
cusj-10965	47	11	engineered	engineer	VERB
cusj-10965	47	12	both	both	CCONJ
cusj-10965	47	13	the	the	DET
cusj-10965	47	14	grna	grna	NOUN
cusj-10965	47	15	and	and	CCONJ
cusj-10965	47	16	cas9	cas9	NOUN
cusj-10965	47	17	segments	segment	NOUN
cusj-10965	47	18	to	to	PART
cusj-10965	47	19	be	be	AUX
cusj-10965	47	20	expressed	express	VERB
cusj-10965	47	21	from	from	ADP
cusj-10965	47	22	a	a	DET
cusj-10965	47	23	single	single	ADJ
cusj-10965	47	24	piece	piece	NOUN
cusj-10965	47	25	of	of	ADP
cusj-10965	47	26	rna	rna	PROPN
cusj-10965	47	27	.	.	PUNCT
cusj-10965	48	1	with	with	ADP
cusj-10965	48	2	this	this	DET
cusj-10965	48	3	construct	construct	NOUN
cusj-10965	48	4	design	design	NOUN
cusj-10965	48	5	,	,	PUNCT
cusj-10965	48	6	cargo	cargo	NOUN
cusj-10965	48	7	size	size	NOUN
cusj-10965	48	8	would	would	AUX
cusj-10965	48	9	be	be	AUX
cusj-10965	48	10	significantly	significantly	ADV
cusj-10965	48	11	reduced	reduce	VERB
cusj-10965	48	12	and	and	CCONJ
cusj-10965	48	13	in	in	ADP
cusj-10965	48	14	the	the	DET
cusj-10965	48	15	case	case	NOUN
cusj-10965	48	16	of	of	ADP
cusj-10965	48	17	rna	rna	NOUN
cusj-10965	48	18	delivery	delivery	NOUN
cusj-10965	48	19	methods	method	NOUN
cusj-10965	48	20	,	,	PUNCT
cusj-10965	48	21	two	two	NUM
cusj-10965	48	22	molecules	molecule	NOUN
cusj-10965	48	23	reduced	reduce	VERB
cusj-10965	48	24	to	to	ADP
cusj-10965	48	25	one	one	NUM
cusj-10965	48	26	.	.	PUNCT
cusj-10965	49	1	this	this	DET
cusj-10965	49	2	configuration	configuration	NOUN
cusj-10965	49	3	has	have	VERB
cusj-10965	49	4	the	the	DET
cusj-10965	49	5	potential	potential	NOUN
cusj-10965	49	6	to	to	PART
cusj-10965	49	7	open	open	VERB
cusj-10965	49	8	the	the	DET
cusj-10965	49	9	door	door	NOUN
cusj-10965	49	10	for	for	ADP
cusj-10965	49	11	more	more	ADV
cusj-10965	49	12	efficient	efficient	ADJ
cusj-10965	49	13	and	and	CCONJ
cusj-10965	49	14	a	a	DET
cusj-10965	49	15	greater	great	ADJ
cusj-10965	49	16	variety	variety	NOUN
cusj-10965	49	17	of	of	ADP
cusj-10965	49	18	delivery	delivery	NOUN
cusj-10965	49	19	methods	method	NOUN
cusj-10965	49	20	.	.	PUNCT
cusj-10965	50	1	methods	method	NOUN
cusj-10965	50	2	plasmids	plasmid	NOUN
cusj-10965	50	3	pcmv	pcmv	NOUN
cusj-10965	50	4	-	-	PUNCT
cusj-10965	50	5	vsv	vsv	PROPN
cusj-10965	50	6	-	-	PUNCT
cusj-10965	50	7	g	g	PROPN
cusj-10965	50	8	was	be	AUX
cusj-10965	50	9	a	a	DET
cusj-10965	50	10	gift	gift	NOUN
cusj-10965	50	11	from	from	ADP
cusj-10965	50	12	bob	bob	PROPN
cusj-10965	50	13	weinberg	weinberg	PROPN
cusj-10965	50	14	(	(	PUNCT
cusj-10965	50	15	addgene	addgene	ADJ
cusj-10965	50	16	plasmid	plasmid	ADJ
cusj-10965	50	17	#	#	NOUN
cusj-10965	50	18	8454	8454	NUM
cusj-10965	50	19	;	;	PUNCT
cusj-10965	50	20	http://n2t.net/addgene:8454	http://n2t.net/addgene:8454	X
cusj-10965	50	21	;	;	PUNCT
cusj-10965	50	22	rrid	rrid	VERB
cusj-10965	50	23	:	:	PUNCT
cusj-10965	50	24	addgene_8454).15	addgene_8454).15	PROPN
cusj-10965	50	25	lenticrispr	lenticrispr	PROPN
cusj-10965	50	26	v2	v2	PROPN
cusj-10965	50	27	was	be	AUX
cusj-10965	50	28	a	a	DET
cusj-10965	50	29	gift	gift	NOUN
cusj-10965	50	30	from	from	ADP
cusj-10965	50	31	feng	feng	PROPN
cusj-10965	50	32	zhang	zhang	PROPN
cusj-10965	50	33	(	(	PUNCT
cusj-10965	50	34	addgene	addgene	ADJ
cusj-10965	50	35	plasmid	plasmid	ADJ
cusj-10965	50	36	#	#	NOUN
cusj-10965	50	37	52961	52961	NUM
cusj-10965	50	38	;	;	PUNCT
cusj-10965	50	39	http://n2t.net/addgene:52961	http://n2t.net/addgene:52961	PROPN
cusj-10965	50	40	;	;	PUNCT
cusj-10965	50	41	rrid	rrid	VERB
cusj-10965	50	42	:	:	PUNCT
cusj-10965	50	43	addgene_52961).16	addgene_52961).16	DET
cusj-10965	50	44	paavs1	paavs1	NOUN
cusj-10965	50	45	-	-	PUNCT
cusj-10965	50	46	tlr	tlr	PROPN
cusj-10965	50	47	targeting	target	VERB
cusj-10965	50	48	vector	vector	NOUN
cusj-10965	50	49	was	be	AUX
cusj-10965	50	50	a	a	DET
cusj-10965	50	51	gift	gift	NOUN
cusj-10965	50	52	from	from	ADP
cusj-10965	50	53	ralf	ralf	PROPN
cusj-10965	50	54	kuehn	kuehn	PROPN
cusj-10965	50	55	(	(	PUNCT
cusj-10965	50	56	addgene	addgene	ADJ
cusj-10965	50	57	plasmid	plasmid	ADJ
cusj-10965	50	58	#	#	NOUN
cusj-10965	50	59	64215	64215	NUM
cusj-10965	50	60	;	;	PUNCT
cusj-10965	50	61	http://n2t.net/addgene:64215	http://n2t.net/addgene:64215	X
cusj-10965	50	62	;	;	PUNCT
cusj-10965	50	63	rrid	rrid	VERB
cusj-10965	50	64	:	:	PUNCT
cusj-10965	50	65	addgene_64215).17	addgene_64215).17	PRON
cusj-10965	50	66	pcag	pcag	NOUN
cusj-10965	50	67	-	-	PUNCT
cusj-10965	50	68	loxpstoploxp	loxpstoploxp	NOUN
cusj-10965	50	69	-	-	PUNCT
cusj-10965	50	70	zsgreen	zsgreen	NOUN
cusj-10965	50	71	was	be	AUX
cusj-10965	50	72	a	a	DET
cusj-10965	50	73	gift	gift	NOUN
cusj-10965	50	74	from	from	ADP
cusj-10965	50	75	pawel	pawel	PROPN
cusj-10965	50	76	pelczar	pelczar	PROPN
cusj-10965	50	77	(	(	PUNCT
cusj-10965	50	78	addgene	addgene	ADJ
cusj-10965	50	79	plasmid	plasmid	ADJ
cusj-10965	50	80	#	#	NOUN
cusj-10965	50	81	51269	51269	NUM
cusj-10965	50	82	;	;	PUNCT
cusj-10965	50	83	http://n2t.net/addgene:51269	http://n2t.net/addgene:51269	PROPN
cusj-10965	50	84	;	;	PUNCT
cusj-10965	50	85	rrid	rrid	VERB
cusj-10965	50	86	:	:	PUNCT
cusj-10965	50	87	addgene_51269).18	addgene_51269).18	ADP
cusj-10965	50	88	cloning	cloning	NOUN
cusj-10965	50	89	of	of	ADP
cusj-10965	50	90	constructs	construct	NOUN
cusj-10965	50	91	encoding	encode	VERB
cusj-10965	50	92	cas9	cas9	NOUN
cusj-10965	50	93	and	and	CCONJ
cusj-10965	50	94	grna	grna	NOUN
cusj-10965	50	95	on	on	ADP
cusj-10965	50	96	a	a	DET
cusj-10965	50	97	single	single	ADJ
cusj-10965	50	98	rna	rna	NOUN
cusj-10965	50	99	a	a	DET
cusj-10965	50	100	pcmv	pcmv	NOUN
cusj-10965	50	101	-	-	PUNCT
cusj-10965	50	102	cas9	cas9	NOUN
cusj-10965	50	103	plasmid	plasmid	NOUN
cusj-10965	50	104	was	be	AUX
cusj-10965	50	105	cloned	clone	VERB
cusj-10965	50	106	by	by	ADP
cusj-10965	50	107	replacing	replace	VERB
cusj-10965	50	108	the	the	DET
cusj-10965	50	109	vsv	vsv	PROPN
cusj-10965	50	110	-	-	PUNCT
cusj-10965	50	111	g	g	NOUN
cusj-10965	50	112	open	open	ADJ
cusj-10965	50	113	reading	reading	NOUN
cusj-10965	50	114	frame	frame	NOUN
cusj-10965	50	115	in	in	ADP
cusj-10965	50	116	pcmv	pcmv	NOUN
cusj-10965	50	117	-	-	PUNCT
cusj-10965	50	118	vsv	vsv	NOUN
cusj-10965	50	119	-	-	PUNCT
cusj-10965	50	120	g	g	PROPN
cusj-10965	50	121	with	with	ADP
cusj-10965	50	122	cas9	cas9	NOUN
cusj-10965	50	123	open	open	ADJ
cusj-10965	50	124	reading	reading	NOUN
cusj-10965	50	125	frame	frame	NOUN
cusj-10965	50	126	from	from	ADP
cusj-10965	50	127	lenticrispr	lenticrispr	NOUN
cusj-10965	50	128	v2	v2	PROPN
cusj-10965	50	129	using	use	VERB
cusj-10965	50	130	pcr	pcr	NOUN
cusj-10965	50	131	followed	follow	VERB
cusj-10965	50	132	by	by	ADP
cusj-10965	50	133	hifi	hifi	PROPN
cusj-10965	50	134	assembly	assembly	PROPN
cusj-10965	50	135	(	(	PUNCT
cusj-10965	50	136	new	new	PROPN
cusj-10965	50	137	england	england	PROPN
cusj-10965	50	138	biolabs	biolabs	PROPN
cusj-10965	50	139	)	)	PUNCT
cusj-10965	50	140	.	.	PUNCT
cusj-10965	51	1	to	to	PART
cusj-10965	51	2	clone	clone	VERB
cusj-10965	51	3	in	in	ADP
cusj-10965	51	4	grnas	grna	NOUN
cusj-10965	51	5	,	,	PUNCT
cusj-10965	51	6	pcmv	pcmv	NOUN
cusj-10965	51	7	-	-	PUNCT
cusj-10965	51	8	cas9	cas9	NOUN
cusj-10965	51	9	was	be	AUX
cusj-10965	51	10	linearized	linearize	VERB
cusj-10965	51	11	downstream	downstream	NOUN
cusj-10965	51	12	of	of	ADP
cusj-10965	51	13	the	the	DET
cusj-10965	51	14	cas9	cas9	NOUN
cusj-10965	51	15	stop	stop	VERB
cusj-10965	51	16	codon	codon	NOUN
cusj-10965	51	17	using	use	VERB
cusj-10965	51	18	stui	stui	NOUN
cusj-10965	51	19	,	,	PUNCT
cusj-10965	51	20	then	then	ADV
cusj-10965	51	21	malat1	malat1	NOUN
cusj-10965	51	22	triplex	triplex	NOUN
cusj-10965	51	23	(	(	PUNCT
cusj-10965	51	24	from	from	ADP
cusj-10965	51	25	campa	campa	PROPN
cusj-10965	51	26	et	et	PROPN
cusj-10965	51	27	al.)19	al.)19	PROPN
cusj-10965	52	1	+	+	PROPN
cusj-10965	52	2	hammerhead	hammerhead	PROPN
cusj-10965	52	3	(	(	PUNCT
cusj-10965	52	4	hh	hh	PROPN
cusj-10965	52	5	)	)	PUNCT
cusj-10965	52	6	ribozyme	ribozyme	ADJ
cusj-10965	52	7	dna	dna	NOUN
cusj-10965	52	8	and	and	CCONJ
cusj-10965	52	9	guide	guide	VERB
cusj-10965	52	10	rna	rna	NOUN
cusj-10965	52	11	sequence	sequence	NOUN
cusj-10965	52	12	+	+	CCONJ
cusj-10965	52	13	hepatitis	hepatitis	PROPN
cusj-10965	52	14	delta	delta	NOUN
cusj-10965	52	15	virus	virus	NOUN
cusj-10965	52	16	(	(	PUNCT
cusj-10965	52	17	hdv	hdv	PROPN
cusj-10965	52	18	)	)	PUNCT
cusj-10965	52	19	ribozyme	ribozyme	PROPN
cusj-10965	52	20	dna	dna	PROPN
cusj-10965	52	21	were	be	AUX
cusj-10965	52	22	ordered	order	VERB
cusj-10965	52	23	from	from	ADP
cusj-10965	52	24	integrated	integrate	VERB
cusj-10965	52	25	dna	dna	NOUN
cusj-10965	52	26	technologies	technology	NOUN
cusj-10965	52	27	as	as	ADP
cusj-10965	52	28	gblocks	gblock	NOUN
cusj-10965	52	29	with	with	ADP
cusj-10965	52	30	20	20	NUM
cusj-10965	52	31	bp	bp	NOUN
cusj-10965	52	32	overhangs	overhang	NOUN
cusj-10965	52	33	between	between	ADP
cusj-10965	52	34	all	all	DET
cusj-10965	52	35	three	three	NUM
cusj-10965	52	36	dna	dna	PROPN
cusj-10965	52	37	fragments	fragment	NOUN
cusj-10965	52	38	for	for	ADP
cusj-10965	52	39	hifi	hifi	NOUN
cusj-10965	52	40	assembly	assembly	PROPN
cusj-10965	52	41	.	.	PUNCT
cusj-10965	53	1	xmai	xmai	PROPN
cusj-10965	53	2	,	,	PUNCT
cusj-10965	53	3	nhei	nhei	PROPN
cusj-10965	53	4	,	,	PUNCT
cusj-10965	53	5	and	and	CCONJ
cusj-10965	53	6	hindiii	hindiii	ADJ
cusj-10965	53	7	sites	site	NOUN
cusj-10965	53	8	as	as	ADV
cusj-10965	53	9	well	well	ADV
cusj-10965	53	10	as	as	ADP
cusj-10965	53	11	homologous	homologous	ADJ
cusj-10965	53	12	regions	region	NOUN
cusj-10965	53	13	for	for	ADP
cusj-10965	53	14	hifi	hifi	PROPN
cusj-10965	53	15	assembly	assembly	PROPN
cusj-10965	53	16	were	be	AUX
cusj-10965	53	17	created	create	VERB
cusj-10965	53	18	in	in	ADP
cusj-10965	53	19	these	these	DET
cusj-10965	53	20	dnas	dna	NOUN
cusj-10965	53	21	in	in	ADP
cusj-10965	53	22	order	order	NOUN
cusj-10965	53	23	to	to	PART
cusj-10965	53	24	allow	allow	VERB
cusj-10965	53	25	for	for	ADP
cusj-10965	53	26	expansion	expansion	NOUN
cusj-10965	53	27	of	of	ADP
cusj-10965	53	28	the	the	DET
cusj-10965	53	29	grna	grna	NOUN
cusj-10965	53	30	cassette	cassette	NOUN
cusj-10965	53	31	according	accord	VERB
cusj-10965	53	32	to	to	ADP
cusj-10965	53	33	the	the	DET
cusj-10965	53	34	approach	approach	NOUN
cusj-10965	53	35	of	of	ADP
cusj-10965	53	36	spakman	spakman	NOUN
cusj-10965	53	37	et	et	PROPN
cusj-10965	53	38	al	al	PROPN
cusj-10965	53	39	.	.	PUNCT
cusj-10965	54	1	(	(	PUNCT
cusj-10965	54	2	figure	figure	NOUN
cusj-10965	54	3	2).20	2).20	NUM
cusj-10965	54	4	the	the	DET
cusj-10965	54	5	result	result	NOUN
cusj-10965	54	6	of	of	ADP
cusj-10965	54	7	these	these	DET
cusj-10965	54	8	steps	step	NOUN
cusj-10965	54	9	was	be	AUX
cusj-10965	54	10	pcmvcas9	pcmvcas9	NOUN
cusj-10965	54	11	-	-	PUNCT
cusj-10965	54	12	malat1	malat1	NOUN
cusj-10965	54	13	triplex	triplex	NOUN
cusj-10965	54	14	-	-	PUNCT
cusj-10965	54	15	hh	hh	ADJ
cusj-10965	54	16	ribozyme	ribozyme	NOUN
cusj-10965	54	17	-	-	PUNCT
cusj-10965	54	18	grnahdv	grnahdv	NOUN
cusj-10965	54	19	ribozyme	ribozyme	NOUN
cusj-10965	54	20	,	,	PUNCT
cusj-10965	54	21	or	or	CCONJ
cusj-10965	54	22	pctg-1x	pctg-1x	NOUN
cusj-10965	54	23	,	,	PUNCT
cusj-10965	54	24	where	where	SCONJ
cusj-10965	54	25	the	the	DET
cusj-10965	54	26	1x	1x	PROPN
cusj-10965	54	27	columbia	columbia	PROPN
cusj-10965	54	28	undergraduate	undergraduate	PROPN
cusj-10965	54	29	science	science	PROPN
cusj-10965	54	30	journal	journal	PROPN
cusj-10965	54	31	vol	vol	NOUN
cusj-10965	54	32	.	.	PROPN
cusj-10965	54	33	17	17	NUM
cusj-10965	54	34	,	,	PUNCT
cusj-10965	54	35	2023	2023	NUM
cusj-10965	54	36	lang	lang	PROPN
cusj-10965	54	37	et	et	PROPN
cusj-10965	54	38	.	.	PUNCT
cusj-10965	55	1	al	al	PROPN
cusj-10965	55	2	.	.	PROPN
cusj-10965	56	1	10	10	NUM
cusj-10965	56	2	denotes	denote	VERB
cusj-10965	56	3	a	a	DET
cusj-10965	56	4	single	single	ADJ
cusj-10965	56	5	grna	grna	NOUN
cusj-10965	56	6	.	.	PUNCT
cusj-10965	57	1	in	in	ADP
cusj-10965	57	2	the	the	DET
cusj-10965	57	3	text	text	NOUN
cusj-10965	57	4	,	,	PUNCT
cusj-10965	57	5	grna	grna	NOUN
cusj-10965	57	6	targeting	targeting	NOUN
cusj-10965	57	7	is	be	AUX
cusj-10965	57	8	added	add	VERB
cusj-10965	57	9	to	to	ADP
cusj-10965	57	10	the	the	DET
cusj-10965	57	11	name	name	NOUN
cusj-10965	57	12	:	:	PUNCT
cusj-10965	57	13	pctg	pctg	PROPN
cusj-10965	57	14	-	-	PUNCT
cusj-10965	57	15	tlr1x	tlr1x	PROPN
cusj-10965	57	16	encodes	encode	NOUN
cusj-10965	57	17	grna	grna	NOUN
cusj-10965	57	18	targeting	target	VERB
cusj-10965	57	19	traffic	traffic	NOUN
cusj-10965	57	20	light	light	NOUN
cusj-10965	57	21	reporter	reporter	NOUN
cusj-10965	57	22	(	(	PUNCT
cusj-10965	57	23	ggtagcgggcgaagcactgc	ggtagcgggcgaagcactgc	NOUN
cusj-10965	57	24	)	)	PUNCT
cusj-10965	57	25	and	and	CCONJ
cusj-10965	57	26	pctg	pctg	PROPN
cusj-10965	57	27	-	-	PUNCT
cusj-10965	57	28	gfp-1x	gfp-1x	NOUN
cusj-10965	57	29	encodes	encode	NOUN
cusj-10965	57	30	grna	grna	NOUN
cusj-10965	57	31	targeting	target	VERB
cusj-10965	57	32	gfp	gfp	PROPN
cusj-10965	57	33	reporter	reporter	NOUN
cusj-10965	57	34	(	(	PUNCT
cusj-10965	57	35	sgtom	sgtom	NOUN
cusj-10965	57	36	from	from	ADP
cusj-10965	57	37	wei	wei	PROPN
cusj-10965	57	38	et	et	PROPN
cusj-10965	57	39	al.).20,21	al.).20,21	VERB
cusj-10965	57	40	to	to	PART
cusj-10965	57	41	create	create	VERB
cusj-10965	57	42	2x	2x	NUM
cusj-10965	57	43	and	and	CCONJ
cusj-10965	57	44	4x	4x	NUM
cusj-10965	57	45	grna	grna	NOUN
cusj-10965	57	46	constructs	construct	VERB
cusj-10965	57	47	,	,	PUNCT
cusj-10965	57	48	we	we	PRON
cusj-10965	57	49	used	use	VERB
cusj-10965	57	50	the	the	DET
cusj-10965	57	51	approach	approach	NOUN
cusj-10965	57	52	of	of	ADP
cusj-10965	57	53	spakman	spakman	NOUN
cusj-10965	57	54	et	et	PROPN
cusj-10965	57	55	al	al	PROPN
cusj-10965	57	56	.	.	PROPN
cusj-10965	57	57	2020	2020	NUM
cusj-10965	57	58	but	but	CCONJ
cusj-10965	57	59	with	with	ADP
cusj-10965	57	60	different	different	ADJ
cusj-10965	57	61	restriction	restriction	NOUN
cusj-10965	57	62	enzymes	enzyme	NOUN
cusj-10965	57	63	.	.	PUNCT
cusj-10965	58	1	briefly	briefly	ADV
cusj-10965	58	2	,	,	PUNCT
cusj-10965	58	3	1x	1x	PROPN
cusj-10965	58	4	constructs	construct	NOUN
cusj-10965	58	5	were	be	AUX
cusj-10965	58	6	linearized	linearize	VERB
cusj-10965	58	7	with	with	ADP
cusj-10965	58	8	nhei	nhei	NOUN
cusj-10965	58	9	and	and	CCONJ
cusj-10965	58	10	separately	separately	ADV
cusj-10965	58	11	the	the	DET
cusj-10965	58	12	entire	entire	ADJ
cusj-10965	58	13	hh	hh	ADJ
cusj-10965	58	14	ribozymegrna	ribozymegrna	NOUN
cusj-10965	58	15	-	-	PUNCT
cusj-10965	58	16	hdv	hdv	ADJ
cusj-10965	58	17	ribozyme	ribozyme	NOUN
cusj-10965	58	18	region	region	NOUN
cusj-10965	58	19	was	be	AUX
cusj-10965	58	20	cut	cut	VERB
cusj-10965	58	21	out	out	ADP
cusj-10965	58	22	with	with	ADP
cusj-10965	58	23	xmai	xmai	PROPN
cusj-10965	58	24	and	and	CCONJ
cusj-10965	58	25	hindiii	hindiii	PROPN
cusj-10965	58	26	then	then	ADV
cusj-10965	58	27	gel	gel	PROPN
cusj-10965	58	28	purified	purified	PROPN
cusj-10965	58	29	.	.	PUNCT
cusj-10965	59	1	this	this	PRON
cusj-10965	59	2	creates	create	VERB
cusj-10965	59	3	overhangs	overhang	NOUN
cusj-10965	59	4	that	that	PRON
cusj-10965	59	5	allow	allow	VERB
cusj-10965	59	6	the	the	DET
cusj-10965	59	7	entire	entire	ADJ
cusj-10965	59	8	hh	hh	ADJ
cusj-10965	59	9	ribozyme	ribozyme	NOUN
cusj-10965	59	10	-	-	PUNCT
cusj-10965	59	11	grna	grna	NOUN
cusj-10965	59	12	-	-	PUNCT
cusj-10965	59	13	hdv	hdv	ADJ
cusj-10965	59	14	ribozyme	ribozyme	NOUN
cusj-10965	59	15	region	region	NOUN
cusj-10965	59	16	to	to	PART
cusj-10965	59	17	be	be	AUX
cusj-10965	59	18	cloned	clone	VERB
cusj-10965	59	19	upstream	upstream	NOUN
cusj-10965	59	20	of	of	ADP
cusj-10965	59	21	the	the	DET
cusj-10965	59	22	other	other	ADJ
cusj-10965	59	23	copy	copy	NOUN
cusj-10965	59	24	of	of	ADP
cusj-10965	59	25	the	the	DET
cusj-10965	59	26	grna	grna	NOUN
cusj-10965	59	27	cassette	cassette	NOUN
cusj-10965	59	28	with	with	ADP
cusj-10965	59	29	hifi	hifi	PROPN
cusj-10965	59	30	assembly	assembly	PROPN
cusj-10965	59	31	to	to	PART
cusj-10965	59	32	create	create	VERB
cusj-10965	59	33	2x	2x	NUM
cusj-10965	59	34	grna	grna	NOUN
cusj-10965	59	35	constructs	construct	NOUN
cusj-10965	59	36	.	.	PUNCT
cusj-10965	60	1	the	the	DET
cusj-10965	60	2	same	same	ADJ
cusj-10965	60	3	expansion	expansion	NOUN
cusj-10965	60	4	was	be	AUX
cusj-10965	60	5	repeated	repeat	VERB
cusj-10965	60	6	starting	start	VERB
cusj-10965	60	7	with	with	ADP
cusj-10965	60	8	the	the	DET
cusj-10965	60	9	2x	2x	NUM
cusj-10965	60	10	construct	construct	NOUN
cusj-10965	60	11	to	to	PART
cusj-10965	60	12	get	get	VERB
cusj-10965	60	13	the	the	DET
cusj-10965	60	14	4x	4x	NUM
cusj-10965	60	15	construct	construct	NOUN
cusj-10965	60	16	encoding	encode	VERB
cusj-10965	60	17	4	4	NUM
cusj-10965	60	18	identical	identical	ADJ
cusj-10965	60	19	grnas	grna	NOUN
cusj-10965	60	20	.	.	PUNCT
cusj-10965	61	1	plasmid	plasmid	VERB
cusj-10965	61	2	sequences	sequence	NOUN
cusj-10965	61	3	were	be	AUX
cusj-10965	61	4	confirmed	confirm	VERB
cusj-10965	61	5	by	by	ADP
cusj-10965	61	6	sanger	sanger	PROPN
cusj-10965	61	7	sequencing	sequencing	PROPN
cusj-10965	61	8	.	.	PUNCT
cusj-10965	62	1	transfection	transfection	NOUN
cusj-10965	62	2	of	of	ADP
cusj-10965	62	3	pctg	pctg	PROPN
cusj-10965	62	4	-	-	PUNCT
cusj-10965	62	5	tlr	tlr	PROPN
cusj-10965	62	6	and	and	CCONJ
cusj-10965	62	7	pctggfp	pctggfp	ADJ
cusj-10965	62	8	plasmids	plasmid	NOUN
cusj-10965	62	9	the	the	DET
cusj-10965	62	10	day	day	NOUN
cusj-10965	62	11	before	before	ADP
cusj-10965	62	12	transfection	transfection	NOUN
cusj-10965	62	13	,	,	PUNCT
cusj-10965	62	14	hek293	hek293	PROPN
cusj-10965	62	15	t	t	NOUN
cusj-10965	62	16	cells	cell	NOUN
cusj-10965	62	17	were	be	AUX
cusj-10965	62	18	seeded	seed	VERB
cusj-10965	62	19	in	in	ADP
cusj-10965	62	20	dulbecco	dulbecco	NOUN
cusj-10965	62	21	’s	’s	PART
cusj-10965	62	22	modified	modified	PROPN
cusj-10965	62	23	eagle	eagle	PROPN
cusj-10965	62	24	medium	medium	NOUN
cusj-10965	62	25	supplemented	supplement	VERB
cusj-10965	62	26	with	with	ADP
cusj-10965	62	27	10	10	NUM
cusj-10965	62	28	%	%	NOUN
cusj-10965	62	29	fetal	fetal	ADJ
cusj-10965	62	30	bovine	bovine	NOUN
cusj-10965	62	31	serum	serum	NOUN
cusj-10965	62	32	at	at	ADP
cusj-10965	62	33	roughly	roughly	ADV
cusj-10965	62	34	25	25	NUM
cusj-10965	62	35	%	%	NOUN
cusj-10965	62	36	confluency	confluency	NOUN
cusj-10965	62	37	in	in	ADP
cusj-10965	62	38	6	6	NUM
cusj-10965	62	39	-	-	PUNCT
cusj-10965	62	40	well	well	NOUN
cusj-10965	62	41	plates	plate	NOUN
cusj-10965	62	42	and	and	CCONJ
cusj-10965	62	43	incubated	incubate	VERB
cusj-10965	62	44	overnight	overnight	ADV
cusj-10965	62	45	at	at	ADP
cusj-10965	62	46	37c	37c	NUM
cusj-10965	62	47	and	and	CCONJ
cusj-10965	62	48	5	5	NUM
cusj-10965	62	49	%	%	NOUN
cusj-10965	62	50	co2	co2	NOUN
cusj-10965	62	51	.	.	PUNCT
cusj-10965	63	1	the	the	DET
cusj-10965	63	2	next	next	ADJ
cusj-10965	63	3	day	day	NOUN
cusj-10965	63	4	,	,	PUNCT
cusj-10965	63	5	pctg	pctg	PROPN
cusj-10965	63	6	-	-	PUNCT
cusj-10965	63	7	tlr	tlr	PROPN
cusj-10965	63	8	1x	1x	NUM
cusj-10965	63	9	,	,	PUNCT
cusj-10965	63	10	2x	2x	NUM
cusj-10965	63	11	,	,	PUNCT
cusj-10965	63	12	4x	4x	NUM
cusj-10965	63	13	,	,	PUNCT
cusj-10965	63	14	or	or	CCONJ
cusj-10965	63	15	pctg	pctg	NOUN
cusj-10965	63	16	-	-	PUNCT
cusj-10965	63	17	gfp	gfp	PROPN
cusj-10965	63	18	1x	1x	PROPN
cusj-10965	63	19	and	and	CCONJ
cusj-10965	63	20	2x	2x	NUM
cusj-10965	63	21	were	be	AUX
cusj-10965	63	22	transfected	transfecte	VERB
cusj-10965	63	23	into	into	ADP
cusj-10965	63	24	hek293	hek293	PROPN
cusj-10965	63	25	t	t	NOUN
cusj-10965	63	26	cells	cell	NOUN
cusj-10965	63	27	with	with	ADP
cusj-10965	63	28	either	either	PRON
cusj-10965	63	29	paavs1	paavs1	NOUN
cusj-10965	63	30	-	-	PUNCT
cusj-10965	63	31	tlr	tlr	PROPN
cusj-10965	63	32	or	or	CCONJ
cusj-10965	63	33	pcag	pcag	NOUN
cusj-10965	63	34	-	-	PUNCT
cusj-10965	63	35	loxpstoploxp	loxpstoploxp	NOUN
cusj-10965	63	36	-	-	PUNCT
cusj-10965	63	37	zsgreen	zsgreen	NOUN
cusj-10965	63	38	using	use	VERB
cusj-10965	63	39	jetoptimus	jetoptimus	NOUN
cusj-10965	63	40	transfection	transfection	NOUN
cusj-10965	63	41	reagent	reagent	NOUN
cusj-10965	63	42	.	.	PUNCT
cusj-10965	64	1	plates	plate	NOUN
cusj-10965	64	2	were	be	AUX
cusj-10965	64	3	then	then	ADV
cusj-10965	64	4	left	leave	VERB
cusj-10965	64	5	to	to	PART
cusj-10965	64	6	incubate	incubate	VERB
cusj-10965	64	7	for	for	ADP
cusj-10965	64	8	48	48	NUM
cusj-10965	64	9	hours	hour	NOUN
cusj-10965	64	10	at	at	ADP
cusj-10965	64	11	37c	37c	NUM
cusj-10965	64	12	and	and	CCONJ
cusj-10965	64	13	5	5	NUM
cusj-10965	64	14	%	%	NOUN
cusj-10965	64	15	co2	co2	NOUN
cusj-10965	64	16	.	.	PUNCT
cusj-10965	65	1	imaging	imaging	NOUN
cusj-10965	65	2	of	of	ADP
cusj-10965	65	3	all	all	DET
cusj-10965	65	4	constructed	construct	VERB
cusj-10965	65	5	plasmids	plasmid	NOUN
cusj-10965	65	6	for	for	ADP
cusj-10965	65	7	gene	gene	NOUN
cusj-10965	65	8	editing	edit	VERB
cusj-10965	65	9	activity	activity	NOUN
cusj-10965	65	10	all	all	DET
cusj-10965	65	11	samples	sample	NOUN
cusj-10965	65	12	were	be	AUX
cusj-10965	65	13	imaged	image	VERB
cusj-10965	65	14	after	after	ADP
cusj-10965	65	15	48	48	NUM
cusj-10965	65	16	hours	hour	NOUN
cusj-10965	65	17	incubation	incubation	NOUN
cusj-10965	65	18	using	use	VERB
cusj-10965	65	19	the	the	DET
cusj-10965	65	20	lionheart	lionheart	PROPN
cusj-10965	65	21	fx	fx	PROPN
cusj-10965	65	22	automated	automate	VERB
cusj-10965	65	23	microscope	microscope	NOUN
cusj-10965	65	24	with	with	ADP
cusj-10965	65	25	the	the	DET
cusj-10965	65	26	4x	4x	NOUN
cusj-10965	65	27	objective	objective	NOUN
cusj-10965	65	28	.	.	PUNCT
cusj-10965	66	1	the	the	DET
cusj-10965	66	2	plates	plate	NOUN
cusj-10965	66	3	transfected	transfecte	VERB
cusj-10965	66	4	with	with	ADP
cusj-10965	66	5	paavs1	paavs1	NOUN
cusj-10965	66	6	-	-	PUNCT
cusj-10965	66	7	tlr	tlr	PROPN
cusj-10965	66	8	reporter	reporter	NOUN
cusj-10965	66	9	were	be	AUX
cusj-10965	66	10	imaged	image	VERB
cusj-10965	66	11	for	for	ADP
cusj-10965	66	12	rfp	rfp	PROPN
cusj-10965	66	13	and	and	CCONJ
cusj-10965	66	14	the	the	DET
cusj-10965	66	15	plates	plate	NOUN
cusj-10965	66	16	that	that	PRON
cusj-10965	66	17	received	receive	VERB
cusj-10965	66	18	pcag	pcag	NOUN
cusj-10965	66	19	-	-	PUNCT
cusj-10965	66	20	loxpstoploxp	loxpstoploxp	NOUN
cusj-10965	66	21	-	-	PUNCT
cusj-10965	66	22	zsgreen	zsgreen	VERB
cusj-10965	66	23	reporter	reporter	NOUN
cusj-10965	66	24	were	be	AUX
cusj-10965	66	25	imaged	image	VERB
cusj-10965	66	26	for	for	ADP
cusj-10965	66	27	gfp	gfp	PROPN
cusj-10965	66	28	.	.	PUNCT
cusj-10965	67	1	gen5	gen5	NOUN
cusj-10965	67	2	figure	figure	NOUN
cusj-10965	67	3	4	4	NUM
cusj-10965	67	4	:	:	PUNCT
cusj-10965	67	5	pctg	pctg	NOUN
cusj-10965	67	6	-	-	PUNCT
cusj-10965	67	7	tlr	tlr	PROPN
cusj-10965	67	8	constructs	construct	VERB
cusj-10965	67	9	efficiently	efficiently	ADV
cusj-10965	67	10	edit	edit	VERB
cusj-10965	67	11	tlr	tlr	PROPN
cusj-10965	67	12	reporter	reporter	NOUN
cusj-10965	67	13	.	.	PUNCT
cusj-10965	68	1	hek293	hek293	PROPN
cusj-10965	68	2	t	t	PROPN
cusj-10965	68	3	cells	cell	NOUN
cusj-10965	68	4	were	be	AUX
cusj-10965	68	5	transfected	transfecte	VERB
cusj-10965	68	6	with	with	ADP
cusj-10965	68	7	indicated	indicate	VERB
cusj-10965	68	8	cas9	cas9	NOUN
cusj-10965	68	9	-	-	PUNCT
cusj-10965	68	10	grna	grna	NOUN
cusj-10965	68	11	plasmid	plasmid	NOUN
cusj-10965	68	12	and	and	CCONJ
cusj-10965	68	13	traffic	traffic	NOUN
cusj-10965	68	14	light	light	NOUN
cusj-10965	68	15	reporter	reporter	NOUN
cusj-10965	68	16	plasmid	plasmid	NOUN
cusj-10965	68	17	,	,	PUNCT
cusj-10965	68	18	then	then	ADV
cusj-10965	68	19	imaged	image	VERB
cusj-10965	68	20	for	for	ADP
cusj-10965	68	21	tagrfp	tagrfp	NOUN
cusj-10965	68	22	after	after	ADP
cusj-10965	68	23	48	48	NUM
cusj-10965	68	24	hours	hour	NOUN
cusj-10965	68	25	.	.	PUNCT
cusj-10965	69	1	fluorescence	fluorescence	PROPN
cusj-10965	69	2	imaging	imaging	NOUN
cusj-10965	69	3	was	be	AUX
cusj-10965	69	4	done	do	VERB
cusj-10965	69	5	with	with	ADP
cusj-10965	69	6	the	the	DET
cusj-10965	69	7	lionheart	lionheart	PROPN
cusj-10965	69	8	fx	fx	PROPN
cusj-10965	69	9	automated	automate	VERB
cusj-10965	69	10	microscope	microscope	NOUN
cusj-10965	69	11	using	use	VERB
cusj-10965	69	12	the	the	DET
cusj-10965	69	13	4x	4x	NOUN
cusj-10965	69	14	objective	objective	NOUN
cusj-10965	69	15	.	.	PUNCT
cusj-10965	70	1	each	each	DET
cusj-10965	70	2	red	red	ADJ
cusj-10965	70	3	particle	particle	NOUN
cusj-10965	70	4	shown	show	VERB
cusj-10965	70	5	represents	represent	VERB
cusj-10965	70	6	one	one	NUM
cusj-10965	70	7	cell	cell	NOUN
cusj-10965	70	8	expressing	express	VERB
cusj-10965	70	9	tlr	tlr	PROPN
cusj-10965	70	10	.	.	PUNCT
cusj-10965	71	1	each	each	DET
cusj-10965	71	2	panel	panel	NOUN
cusj-10965	71	3	represents	represent	VERB
cusj-10965	71	4	1	1	NUM
cusj-10965	71	5	of	of	ADP
cusj-10965	71	6	16	16	NUM
cusj-10965	71	7	fields	field	NOUN
cusj-10965	71	8	imaged	image	VERB
cusj-10965	71	9	.	.	PUNCT
cusj-10965	72	1	brightfield	brightfield	NOUN
cusj-10965	72	2	images	image	NOUN
cusj-10965	72	3	were	be	AUX
cusj-10965	72	4	taken	take	VERB
cusj-10965	72	5	of	of	ADP
cusj-10965	72	6	all	all	DET
cusj-10965	72	7	wells	well	NOUN
cusj-10965	72	8	and	and	CCONJ
cusj-10965	72	9	showed	show	VERB
cusj-10965	72	10	similar	similar	ADJ
cusj-10965	72	11	cellular	cellular	ADJ
cusj-10965	72	12	confluency	confluency	NOUN
cusj-10965	72	13	(	(	PUNCT
cusj-10965	72	14	data	datum	NOUN
cusj-10965	72	15	not	not	PART
cusj-10965	72	16	shown	show	VERB
cusj-10965	72	17	)	)	PUNCT
cusj-10965	72	18	.	.	PUNCT
cusj-10965	73	1	columbia	columbia	PROPN
cusj-10965	73	2	undergraduate	undergraduate	PROPN
cusj-10965	73	3	science	science	PROPN
cusj-10965	73	4	journal	journal	PROPN
cusj-10965	73	5	vol	vol	NOUN
cusj-10965	73	6	.	.	PROPN
cusj-10965	73	7	17	17	NUM
cusj-10965	73	8	,	,	PUNCT
cusj-10965	73	9	2023	2023	NUM
cusj-10965	73	10	lang	lang	PROPN
cusj-10965	73	11	et	et	PROPN
cusj-10965	73	12	.	.	PUNCT
cusj-10965	74	1	al	al	PROPN
cusj-10965	74	2	.	.	PROPN
cusj-10965	74	3	11	11	NUM
cusj-10965	74	4	software	software	NOUN
cusj-10965	74	5	was	be	AUX
cusj-10965	74	6	used	use	VERB
cusj-10965	74	7	to	to	PART
cusj-10965	74	8	count	count	VERB
cusj-10965	74	9	rfp+	rfp+	PROPN
cusj-10965	74	10	or	or	CCONJ
cusj-10965	74	11	gfp+	gfp+	PROPN
cusj-10965	74	12	cells	cell	NOUN
cusj-10965	74	13	as	as	ADV
cusj-10965	74	14	well	well	ADV
cusj-10965	74	15	as	as	ADP
cusj-10965	74	16	calculate	calculate	NOUN
cusj-10965	74	17	intensity	intensity	NOUN
cusj-10965	74	18	of	of	ADP
cusj-10965	74	19	expression	expression	NOUN
cusj-10965	74	20	per	per	ADP
cusj-10965	74	21	cell	cell	NOUN
cusj-10965	74	22	.	.	PUNCT
cusj-10965	75	1	after	after	ADP
cusj-10965	75	2	imaging	imaging	NOUN
cusj-10965	75	3	,	,	PUNCT
cusj-10965	75	4	a	a	DET
cusj-10965	75	5	two	two	NUM
cusj-10965	75	6	-	-	PUNCT
cusj-10965	75	7	tailed	tail	VERB
cusj-10965	75	8	,	,	PUNCT
cusj-10965	75	9	two	two	NUM
cusj-10965	75	10	sample	sample	NOUN
cusj-10965	75	11	equal	equal	ADJ
cusj-10965	75	12	variance	variance	NOUN
cusj-10965	75	13	,	,	PUNCT
cusj-10965	75	14	statistical	statistical	ADJ
cusj-10965	75	15	t	t	NOUN
cusj-10965	75	16	-	-	PUNCT
cusj-10965	75	17	test	test	NOUN
cusj-10965	75	18	was	be	AUX
cusj-10965	75	19	performed	perform	VERB
cusj-10965	75	20	to	to	PART
cusj-10965	75	21	determine	determine	VERB
cusj-10965	75	22	significance	significance	NOUN
cusj-10965	75	23	of	of	ADP
cusj-10965	75	24	rfp	rfp	PROPN
cusj-10965	75	25	or	or	CCONJ
cusj-10965	75	26	gfp	gfp	PROPN
cusj-10965	75	27	expression	expression	NOUN
cusj-10965	75	28	(	(	PUNCT
cusj-10965	75	29	n=2	n=2	ADV
cusj-10965	75	30	)	)	PUNCT
cusj-10965	75	31	.	.	PUNCT
cusj-10965	76	1	figures	figure	NOUN
cusj-10965	76	2	1	1	NUM
cusj-10965	76	3	,	,	PUNCT
cusj-10965	76	4	2	2	NUM
cusj-10965	76	5	,	,	PUNCT
cusj-10965	76	6	and	and	CCONJ
cusj-10965	76	7	3	3	NUM
cusj-10965	76	8	were	be	AUX
cusj-10965	76	9	made	make	VERB
cusj-10965	76	10	with	with	ADP
cusj-10965	76	11	biorender	biorend	ADJ
cusj-10965	76	12	software	software	NOUN
cusj-10965	76	13	.	.	PUNCT
cusj-10965	77	1	results	result	NOUN
cusj-10965	77	2	in	in	ADP
cusj-10965	77	3	order	order	NOUN
cusj-10965	77	4	to	to	PART
cusj-10965	77	5	test	test	VERB
cusj-10965	77	6	cas9	cas9	NOUN
cusj-10965	77	7	and	and	CCONJ
cusj-10965	77	8	grna	grna	VERB
cusj-10965	77	9	single	single	ADJ
cusj-10965	77	10	rna	rna	NOUN
cusj-10965	77	11	configurations	configuration	NOUN
cusj-10965	77	12	,	,	PUNCT
cusj-10965	77	13	we	we	PRON
cusj-10965	77	14	created	create	VERB
cusj-10965	77	15	constructs	construct	NOUN
cusj-10965	77	16	that	that	PRON
cusj-10965	77	17	contain	contain	VERB
cusj-10965	77	18	cas9	cas9	NOUN
cusj-10965	77	19	open	open	ADJ
cusj-10965	77	20	reading	reading	NOUN
cusj-10965	77	21	frame	frame	NOUN
cusj-10965	77	22	followed	follow	VERB
cusj-10965	77	23	by	by	ADP
cusj-10965	77	24	an	an	DET
cusj-10965	77	25	rna	rna	NOUN
cusj-10965	77	26	region	region	NOUN
cusj-10965	77	27	that	that	PRON
cusj-10965	77	28	forms	form	VERB
cusj-10965	77	29	a	a	DET
cusj-10965	77	30	protective	protective	ADJ
cusj-10965	77	31	triplex.22	triplex.22	NOUN
cusj-10965	77	32	this	this	DET
cusj-10965	77	33	sequence	sequence	NOUN
cusj-10965	77	34	is	be	AUX
cusj-10965	77	35	then	then	ADV
cusj-10965	77	36	followed	follow	VERB
cusj-10965	77	37	by	by	ADP
cusj-10965	77	38	grna	grna	NOUN
cusj-10965	77	39	sequence	sequence	NOUN
cusj-10965	77	40	sandwiched	sandwich	VERB
cusj-10965	77	41	between	between	ADP
cusj-10965	77	42	self	self	NOUN
cusj-10965	77	43	-	-	PUNCT
cusj-10965	77	44	cleaving	cleave	VERB
cusj-10965	77	45	ribozymes	ribozyme	NOUN
cusj-10965	77	46	(	(	PUNCT
cusj-10965	77	47	figure	figure	NOUN
cusj-10965	77	48	2	2	NUM
cusj-10965	77	49	)	)	PUNCT
cusj-10965	77	50	.	.	PUNCT
cusj-10965	78	1	in	in	ADP
cusj-10965	78	2	the	the	DET
cusj-10965	78	3	cell	cell	NOUN
cusj-10965	78	4	,	,	PUNCT
cusj-10965	78	5	these	these	DET
cusj-10965	78	6	self	self	NOUN
cusj-10965	78	7	-	-	PUNCT
cusj-10965	78	8	cleaving	cleave	VERB
cusj-10965	78	9	ribozymes	ribozyme	NOUN
cusj-10965	78	10	cleave	cleave	VERB
cusj-10965	78	11	out	out	ADP
cusj-10965	78	12	grna	grna	NOUN
cusj-10965	78	13	so	so	SCONJ
cusj-10965	78	14	that	that	SCONJ
cusj-10965	78	15	it	it	PRON
cusj-10965	78	16	can	can	AUX
cusj-10965	78	17	bind	bind	VERB
cusj-10965	78	18	to	to	ADP
cusj-10965	78	19	cas9	cas9	NOUN
cusj-10965	78	20	and	and	CCONJ
cusj-10965	78	21	the	the	DET
cusj-10965	78	22	targeted	targeted	ADJ
cusj-10965	78	23	dna	dna	NOUN
cusj-10965	78	24	.	.	PUNCT
cusj-10965	79	1	the	the	DET
cusj-10965	79	2	triplex	triplex	NOUN
cusj-10965	79	3	is	be	AUX
cusj-10965	79	4	needed	need	VERB
cusj-10965	79	5	because	because	SCONJ
cusj-10965	79	6	these	these	DET
cusj-10965	79	7	ribozyme	ribozyme	ADJ
cusj-10965	79	8	cleavages	cleavage	NOUN
cusj-10965	79	9	would	would	AUX
cusj-10965	79	10	expose	expose	VERB
cusj-10965	79	11	the	the	DET
cusj-10965	79	12	3	3	NUM
cusj-10965	79	13	’	'	PUNCT
cusj-10965	79	14	end	end	NOUN
cusj-10965	79	15	of	of	ADP
cusj-10965	79	16	the	the	DET
cusj-10965	79	17	cas9	cas9	NOUN
cusj-10965	79	18	open	open	ADJ
cusj-10965	79	19	reading	reading	NOUN
cusj-10965	79	20	frame	frame	NOUN
cusj-10965	79	21	to	to	ADP
cusj-10965	79	22	nucleases	nuclease	NOUN
cusj-10965	79	23	in	in	ADP
cusj-10965	79	24	the	the	DET
cusj-10965	79	25	absence	absence	NOUN
cusj-10965	79	26	of	of	ADP
cusj-10965	79	27	the	the	DET
cusj-10965	79	28	triplex.22	triplex.22	NOUN
cusj-10965	79	29	we	we	PRON
cusj-10965	79	30	created	create	VERB
cusj-10965	79	31	versions	version	NOUN
cusj-10965	79	32	expressing	express	VERB
cusj-10965	79	33	1	1	NUM
cusj-10965	79	34	,	,	PUNCT
cusj-10965	79	35	2	2	NUM
cusj-10965	79	36	,	,	PUNCT
cusj-10965	79	37	or	or	CCONJ
cusj-10965	79	38	4	4	NUM
cusj-10965	79	39	grnas	grna	NOUN
cusj-10965	79	40	that	that	PRON
cusj-10965	79	41	target	target	VERB
cusj-10965	79	42	traffic	traffic	NOUN
cusj-10965	79	43	light	light	NOUN
cusj-10965	79	44	reporter	reporter	NOUN
cusj-10965	79	45	(	(	PUNCT
cusj-10965	79	46	tlr	tlr	PROPN
cusj-10965	79	47	)	)	PUNCT
cusj-10965	79	48	,	,	PUNCT
cusj-10965	79	49	or	or	CCONJ
cusj-10965	79	50	1	1	NUM
cusj-10965	79	51	or	or	CCONJ
cusj-10965	79	52	2	2	NUM
cusj-10965	79	53	grnas	grna	NOUN
cusj-10965	79	54	targeting	target	VERB
cusj-10965	79	55	the	the	DET
cusj-10965	79	56	stop	stop	NOUN
cusj-10965	79	57	region	region	NOUN
cusj-10965	79	58	of	of	ADP
cusj-10965	79	59	pcagloxpstoploxp	pcagloxpstoploxp	NOUN
cusj-10965	79	60	-	-	PUNCT
cusj-10965	79	61	zsgreen	zsgreen	NOUN
cusj-10965	79	62	(	(	PUNCT
cusj-10965	79	63	figure	figure	NOUN
cusj-10965	79	64	3	3	NUM
cusj-10965	79	65	)	)	PUNCT
cusj-10965	79	66	.	.	PUNCT
cusj-10965	80	1	these	these	DET
cusj-10965	80	2	reporters	reporter	NOUN
cusj-10965	80	3	were	be	AUX
cusj-10965	80	4	targeted	target	VERB
cusj-10965	80	5	because	because	SCONJ
cusj-10965	80	6	both	both	PRON
cusj-10965	80	7	are	be	AUX
cusj-10965	80	8	well	well	ADV
cusj-10965	80	9	characterized	characterize	VERB
cusj-10965	80	10	and	and	CCONJ
cusj-10965	80	11	are	be	AUX
cusj-10965	80	12	also	also	ADV
cusj-10965	80	13	integrated	integrate	VERB
cusj-10965	80	14	into	into	ADP
cusj-10965	80	15	mouse	mouse	NOUN
cusj-10965	80	16	lines	line	NOUN
cusj-10965	80	17	,	,	PUNCT
cusj-10965	80	18	and	and	CCONJ
cusj-10965	80	19	thus	thus	ADV
cusj-10965	80	20	are	be	AUX
cusj-10965	80	21	useful	useful	ADJ
cusj-10965	80	22	grnas	grna	NOUN
cusj-10965	80	23	for	for	ADP
cusj-10965	80	24	future	future	NOUN
cusj-10965	80	25	in	in	ADP
cusj-10965	80	26	vivo	vivo	ADJ
cusj-10965	80	27	experiments.23	experiments.23	PROPN
cusj-10965	80	28	to	to	PART
cusj-10965	80	29	test	test	VERB
cusj-10965	80	30	targeted	target	VERB
cusj-10965	80	31	editing	editing	NOUN
cusj-10965	80	32	of	of	ADP
cusj-10965	80	33	tlr	tlr	PROPN
cusj-10965	80	34	,	,	PUNCT
cusj-10965	80	35	we	we	PRON
cusj-10965	80	36	transfected	transfecte	VERB
cusj-10965	80	37	each	each	PRON
cusj-10965	80	38	of	of	ADP
cusj-10965	80	39	these	these	DET
cusj-10965	80	40	constructs	construct	NOUN
cusj-10965	80	41	into	into	ADP
cusj-10965	80	42	hek293	hek293	PROPN
cusj-10965	80	43	t	t	NOUN
cusj-10965	80	44	cells	cell	NOUN
cusj-10965	80	45	along	along	ADP
cusj-10965	80	46	with	with	ADP
cusj-10965	80	47	traffic	traffic	NOUN
cusj-10965	80	48	light	light	NOUN
cusj-10965	80	49	reporter	reporter	NOUN
cusj-10965	80	50	(	(	PUNCT
cusj-10965	80	51	tlr	tlr	PROPN
cusj-10965	80	52	)	)	PUNCT
cusj-10965	80	53	.	.	PUNCT
cusj-10965	81	1	traffic	traffic	NOUN
cusj-10965	81	2	light	light	PROPN
cusj-10965	81	3	reporter	reporter	NOUN
cusj-10965	81	4	encodes	encode	VERB
cusj-10965	81	5	an	an	DET
cusj-10965	81	6	upstream	upstream	ADJ
cusj-10965	81	7	stop	stop	NOUN
cusj-10965	81	8	codon	codon	NOUN
cusj-10965	81	9	as	as	ADV
cusj-10965	81	10	well	well	ADV
cusj-10965	81	11	as	as	ADP
cusj-10965	81	12	an	an	DET
cusj-10965	81	13	out	out	ADV
cusj-10965	81	14	-	-	PUNCT
cusj-10965	81	15	of	of	ADP
cusj-10965	81	16	-	-	PUNCT
cusj-10965	81	17	frame	frame	NOUN
cusj-10965	81	18	tagrfp	tagrfp	NOUN
cusj-10965	81	19	.	.	PUNCT
cusj-10965	82	1	upon	upon	SCONJ
cusj-10965	82	2	cas9	cas9	NOUN
cusj-10965	82	3	editing	edit	VERB
cusj-10965	82	4	upstream	upstream	ADV
cusj-10965	82	5	of	of	ADP
cusj-10965	82	6	the	the	DET
cusj-10965	82	7	early	early	ADJ
cusj-10965	82	8	stop	stop	NOUN
cusj-10965	82	9	codon	codon	NOUN
cusj-10965	82	10	,	,	PUNCT
cusj-10965	82	11	a	a	DET
cusj-10965	82	12	portion	portion	NOUN
cusj-10965	82	13	of	of	ADP
cusj-10965	82	14	editing	edit	VERB
cusj-10965	82	15	events	event	NOUN
cusj-10965	82	16	will	will	AUX
cusj-10965	82	17	cause	cause	VERB
cusj-10965	82	18	the	the	DET
cusj-10965	82	19	upstream	upstream	ADJ
cusj-10965	82	20	stop	stop	VERB
cusj-10965	82	21	codon	codon	NOUN
cusj-10965	82	22	to	to	PART
cusj-10965	82	23	go	go	VERB
cusj-10965	82	24	outof	outof	PROPN
cusj-10965	82	25	-	-	PUNCT
cusj-10965	82	26	frame	frame	NOUN
cusj-10965	82	27	and	and	CCONJ
cusj-10965	82	28	bring	bring	VERB
cusj-10965	82	29	tagrfp	tagrfp	NOUN
cusj-10965	82	30	in	in	ADP
cusj-10965	82	31	frame	frame	NOUN
cusj-10965	82	32	,	,	PUNCT
cusj-10965	82	33	resulting	result	VERB
cusj-10965	82	34	in	in	ADP
cusj-10965	82	35	rfp	rfp	NOUN
cusj-10965	82	36	expression	expression	NOUN
cusj-10965	82	37	(	(	PUNCT
cusj-10965	82	38	figure	figure	NOUN
cusj-10965	82	39	3	3	NUM
cusj-10965	82	40	)	)	PUNCT
cusj-10965	82	41	.	.	PUNCT
cusj-10965	83	1	cells	cell	NOUN
cusj-10965	83	2	expressing	express	VERB
cusj-10965	83	3	tlr	tlr	PROPN
cusj-10965	83	4	grnas	grnas	PROPN
cusj-10965	83	5	exhibit	exhibit	PROPN
cusj-10965	83	6	rfp	rfp	NOUN
cusj-10965	83	7	expression	expression	NOUN
cusj-10965	83	8	,	,	PUNCT
cusj-10965	83	9	which	which	PRON
cusj-10965	83	10	indicates	indicate	VERB
cusj-10965	83	11	successful	successful	ADJ
cusj-10965	83	12	gene	gene	NOUN
cusj-10965	83	13	editing	editing	NOUN
cusj-10965	83	14	by	by	ADP
cusj-10965	83	15	cas9	cas9	NOUN
cusj-10965	83	16	that	that	PRON
cusj-10965	83	17	targeted	target	VERB
cusj-10965	83	18	the	the	DET
cusj-10965	83	19	rfp	rfp	PROPN
cusj-10965	83	20	reporter	reporter	NOUN
cusj-10965	83	21	(	(	PUNCT
cusj-10965	83	22	figures	figure	NOUN
cusj-10965	83	23	4a	4a	NUM
cusj-10965	83	24	-	-	PUNCT
cusj-10965	83	25	c	c	NOUN
cusj-10965	83	26	)	)	PUNCT
cusj-10965	83	27	.	.	PUNCT
cusj-10965	84	1	the	the	DET
cusj-10965	84	2	quantification	quantification	NOUN
cusj-10965	84	3	of	of	ADP
cusj-10965	84	4	rfp+	rfp+	PROPN
cusj-10965	84	5	cells	cell	NOUN
cusj-10965	84	6	also	also	ADV
cusj-10965	84	7	demonstrate	demonstrate	VERB
cusj-10965	84	8	a	a	DET
cusj-10965	84	9	significant	significant	ADJ
cusj-10965	84	10	number	number	NOUN
cusj-10965	84	11	of	of	ADP
cusj-10965	84	12	cells	cell	NOUN
cusj-10965	84	13	underwent	underwent	VERB
cusj-10965	84	14	gene	gene	NOUN
cusj-10965	84	15	editing	editing	NOUN
cusj-10965	84	16	(	(	PUNCT
cusj-10965	84	17	figure	figure	NOUN
cusj-10965	84	18	6a	6a	NOUN
cusj-10965	84	19	)	)	PUNCT
cusj-10965	84	20	.	.	PUNCT
cusj-10965	85	1	when	when	SCONJ
cusj-10965	85	2	comparing	compare	VERB
cusj-10965	85	3	the	the	DET
cusj-10965	85	4	difference	difference	NOUN
cusj-10965	85	5	between	between	ADP
cusj-10965	85	6	1x	1x	NUM
cusj-10965	85	7	,	,	PUNCT
cusj-10965	85	8	2x	2x	NUM
cusj-10965	85	9	,	,	PUNCT
cusj-10965	85	10	and	and	CCONJ
cusj-10965	85	11	4x	4x	NUM
cusj-10965	85	12	tlr	tlr	PROPN
cusj-10965	85	13	grnas	grnas	PROPN
cusj-10965	85	14	,	,	PUNCT
cusj-10965	85	15	there	there	PRON
cusj-10965	85	16	is	be	VERB
cusj-10965	85	17	a	a	DET
cusj-10965	85	18	significant	significant	ADJ
cusj-10965	85	19	increase	increase	NOUN
cusj-10965	85	20	in	in	ADP
cusj-10965	85	21	figure	figure	NOUN
cusj-10965	85	22	5	5	NUM
cusj-10965	85	23	:	:	PUNCT
cusj-10965	85	24	pctg	pctg	NOUN
cusj-10965	85	25	-	-	PUNCT
cusj-10965	85	26	gfp-2x	gfp-2x	NOUN
cusj-10965	85	27	construct	construct	NOUN
cusj-10965	85	28	edits	edit	VERB
cusj-10965	85	29	gfp	gfp	PROPN
cusj-10965	85	30	reporter	reporter	NOUN
cusj-10965	85	31	.	.	PUNCT
cusj-10965	86	1	hek293	hek293	PROPN
cusj-10965	86	2	t	t	PROPN
cusj-10965	86	3	cells	cell	NOUN
cusj-10965	86	4	were	be	AUX
cusj-10965	86	5	transfected	transfecte	VERB
cusj-10965	86	6	with	with	ADP
cusj-10965	86	7	indicated	indicate	VERB
cusj-10965	86	8	cas9	cas9	NOUN
cusj-10965	86	9	-	-	PUNCT
cusj-10965	86	10	grna	grna	NOUN
cusj-10965	86	11	plasmid	plasmid	NOUN
cusj-10965	86	12	and	and	CCONJ
cusj-10965	86	13	green	green	ADJ
cusj-10965	86	14	fluorescent	fluorescent	ADJ
cusj-10965	86	15	protein	protein	NOUN
cusj-10965	86	16	reporter	reporter	NOUN
cusj-10965	86	17	plasmid	plasmid	NOUN
cusj-10965	86	18	,	,	PUNCT
cusj-10965	86	19	then	then	ADV
cusj-10965	86	20	imaged	image	VERB
cusj-10965	86	21	for	for	ADP
cusj-10965	86	22	gfp	gfp	PROPN
cusj-10965	86	23	after	after	ADP
cusj-10965	86	24	48	48	NUM
cusj-10965	86	25	hours	hour	NOUN
cusj-10965	86	26	.	.	PUNCT
cusj-10965	87	1	fluorescence	fluorescence	PROPN
cusj-10965	87	2	imaging	imaging	NOUN
cusj-10965	87	3	was	be	AUX
cusj-10965	87	4	done	do	VERB
cusj-10965	87	5	with	with	ADP
cusj-10965	87	6	the	the	DET
cusj-10965	87	7	lionheart	lionheart	PROPN
cusj-10965	87	8	fx	fx	PROPN
cusj-10965	87	9	automated	automate	VERB
cusj-10965	87	10	microscope	microscope	NOUN
cusj-10965	87	11	using	use	VERB
cusj-10965	87	12	the	the	DET
cusj-10965	87	13	4x	4x	NOUN
cusj-10965	87	14	objective	objective	NOUN
cusj-10965	87	15	.	.	PUNCT
cusj-10965	88	1	each	each	DET
cusj-10965	88	2	bright	bright	ADJ
cusj-10965	88	3	green	green	ADJ
cusj-10965	88	4	particle	particle	NOUN
cusj-10965	88	5	shown	show	VERB
cusj-10965	88	6	represents	represent	VERB
cusj-10965	88	7	one	one	NUM
cusj-10965	88	8	cell	cell	NOUN
cusj-10965	88	9	expressing	express	VERB
cusj-10965	88	10	gfp	gfp	PROPN
cusj-10965	88	11	.	.	PUNCT
cusj-10965	89	1	each	each	DET
cusj-10965	89	2	panel	panel	NOUN
cusj-10965	89	3	represents	represent	VERB
cusj-10965	89	4	1	1	NUM
cusj-10965	89	5	of	of	ADP
cusj-10965	89	6	16	16	NUM
cusj-10965	89	7	fields	field	NOUN
cusj-10965	89	8	imaged	image	VERB
cusj-10965	89	9	.	.	PUNCT
cusj-10965	90	1	brightfield	brightfield	NOUN
cusj-10965	90	2	images	image	NOUN
cusj-10965	90	3	were	be	AUX
cusj-10965	90	4	taken	take	VERB
cusj-10965	90	5	of	of	ADP
cusj-10965	90	6	all	all	DET
cusj-10965	90	7	wells	well	NOUN
cusj-10965	90	8	and	and	CCONJ
cusj-10965	90	9	showed	show	VERB
cusj-10965	90	10	similar	similar	ADJ
cusj-10965	90	11	cellular	cellular	ADJ
cusj-10965	90	12	confluency	confluency	NOUN
cusj-10965	90	13	(	(	PUNCT
cusj-10965	90	14	data	datum	NOUN
cusj-10965	90	15	not	not	PART
cusj-10965	90	16	shown	show	VERB
cusj-10965	90	17	)	)	PUNCT
cusj-10965	90	18	.	.	PUNCT
cusj-10965	91	1	columbia	columbia	PROPN
cusj-10965	91	2	undergraduate	undergraduate	PROPN
cusj-10965	91	3	science	science	PROPN
cusj-10965	91	4	journal	journal	PROPN
cusj-10965	91	5	vol	vol	NOUN
cusj-10965	91	6	.	.	PROPN
cusj-10965	91	7	17	17	NUM
cusj-10965	91	8	,	,	PUNCT
cusj-10965	91	9	2023	2023	NUM
cusj-10965	91	10	lang	lang	PROPN
cusj-10965	91	11	et	et	PROPN
cusj-10965	91	12	.	.	PUNCT
cusj-10965	92	1	al	al	PROPN
cusj-10965	92	2	.	.	PROPN
cusj-10965	92	3	12	12	NUM
cusj-10965	92	4	the	the	DET
cusj-10965	92	5	number	number	NOUN
cusj-10965	92	6	of	of	ADP
cusj-10965	92	7	cells	cell	NOUN
cusj-10965	92	8	that	that	PRON
cusj-10965	92	9	displayed	display	VERB
cusj-10965	92	10	gene	gene	NOUN
cusj-10965	92	11	editing	editing	NOUN
cusj-10965	92	12	(	(	PUNCT
cusj-10965	92	13	figure	figure	NOUN
cusj-10965	92	14	6a	6a	NOUN
cusj-10965	92	15	)	)	PUNCT
cusj-10965	92	16	.	.	PUNCT
cusj-10965	93	1	additionally	additionally	ADV
cusj-10965	93	2	,	,	PUNCT
cusj-10965	93	3	the	the	DET
cusj-10965	93	4	magnitude	magnitude	NOUN
cusj-10965	93	5	of	of	ADP
cusj-10965	93	6	rfp	rfp	PROPN
cusj-10965	93	7	expression	expression	NOUN
cusj-10965	93	8	per	per	ADP
cusj-10965	93	9	cell	cell	NOUN
cusj-10965	93	10	increased	increase	VERB
cusj-10965	93	11	corresponding	correspond	VERB
cusj-10965	93	12	to	to	ADP
cusj-10965	93	13	the	the	DET
cusj-10965	93	14	number	number	NOUN
cusj-10965	93	15	of	of	ADP
cusj-10965	93	16	guide	guide	ADJ
cusj-10965	93	17	rna	rna	NOUN
cusj-10965	93	18	sequences	sequence	NOUN
cusj-10965	93	19	,	,	PUNCT
cusj-10965	93	20	meaning	mean	VERB
cusj-10965	93	21	that	that	SCONJ
cusj-10965	93	22	1x	1x	PROPN
cusj-10965	93	23	tlr	tlr	PROPN
cusj-10965	93	24	grna	grna	NOUN
cusj-10965	93	25	showed	show	VERB
cusj-10965	93	26	the	the	DET
cusj-10965	93	27	lowest	low	ADJ
cusj-10965	93	28	magnitude	magnitude	NOUN
cusj-10965	93	29	,	,	PUNCT
cusj-10965	93	30	followed	follow	VERB
cusj-10965	93	31	by	by	ADP
cusj-10965	93	32	2x	2x	NUM
cusj-10965	93	33	,	,	PUNCT
cusj-10965	93	34	and	and	CCONJ
cusj-10965	93	35	finally	finally	ADV
cusj-10965	93	36	4x	4x	NOUN
cusj-10965	93	37	demonstrated	demonstrate	VERB
cusj-10965	93	38	the	the	DET
cusj-10965	93	39	largest	large	ADJ
cusj-10965	93	40	magnitude	magnitude	NOUN
cusj-10965	93	41	of	of	ADP
cusj-10965	93	42	fluorescence	fluorescence	NOUN
cusj-10965	93	43	(	(	PUNCT
cusj-10965	93	44	figures	figure	NOUN
cusj-10965	93	45	4a	4a	NUM
cusj-10965	93	46	-	-	PUNCT
cusj-10965	93	47	c	c	NOUN
cusj-10965	93	48	and	and	CCONJ
cusj-10965	93	49	6b	6b	NUM
cusj-10965	93	50	)	)	PUNCT
cusj-10965	93	51	.	.	PUNCT
cusj-10965	94	1	importantly	importantly	ADV
cusj-10965	94	2	,	,	PUNCT
cusj-10965	94	3	cells	cell	NOUN
cusj-10965	94	4	not	not	PART
cusj-10965	94	5	expressing	express	VERB
cusj-10965	94	6	grna	grna	NOUN
cusj-10965	94	7	(	(	PUNCT
cusj-10965	94	8	figure	figure	NOUN
cusj-10965	94	9	4f	4f	NUM
cusj-10965	94	10	)	)	PUNCT
cusj-10965	94	11	or	or	CCONJ
cusj-10965	94	12	expressing	express	VERB
cusj-10965	94	13	constructs	construct	NOUN
cusj-10965	94	14	encoding	encode	VERB
cusj-10965	94	15	gfp	gfp	NOUN
cusj-10965	94	16	targeting	target	VERB
cusj-10965	94	17	grna	grna	NOUN
cusj-10965	94	18	(	(	PUNCT
cusj-10965	94	19	figure	figure	NOUN
cusj-10965	94	20	4d	4d	NUM
cusj-10965	94	21	-	-	PUNCT
cusj-10965	94	22	e	e	NOUN
cusj-10965	94	23	)	)	PUNCT
cusj-10965	94	24	do	do	AUX
cusj-10965	94	25	not	not	PART
cusj-10965	94	26	result	result	VERB
cusj-10965	94	27	in	in	ADP
cusj-10965	94	28	rfp	rfp	PROPN
cusj-10965	94	29	expression	expression	NOUN
cusj-10965	94	30	,	,	PUNCT
cusj-10965	94	31	indicating	indicate	VERB
cusj-10965	94	32	that	that	SCONJ
cusj-10965	94	33	editing	editing	NOUN
cusj-10965	94	34	of	of	ADP
cusj-10965	94	35	tlr	tlr	PROPN
cusj-10965	94	36	is	be	AUX
cusj-10965	94	37	selective	selective	ADJ
cusj-10965	94	38	.	.	PUNCT
cusj-10965	95	1	similarly	similarly	ADV
cusj-10965	95	2	,	,	PUNCT
cusj-10965	95	3	constructs	construct	VERB
cusj-10965	95	4	expressing	express	VERB
cusj-10965	95	5	cas9	cas9	NOUN
cusj-10965	95	6	and	and	CCONJ
cusj-10965	95	7	grnas	grna	NOUN
cusj-10965	95	8	targeted	target	VERB
cusj-10965	95	9	to	to	ADP
cusj-10965	95	10	the	the	DET
cusj-10965	95	11	stop	stop	NOUN
cusj-10965	95	12	region	region	NOUN
cusj-10965	95	13	of	of	ADP
cusj-10965	95	14	pcag	pcag	NOUN
cusj-10965	95	15	-	-	PUNCT
cusj-10965	95	16	loxpstoploxp	loxpstoploxp	NOUN
cusj-10965	95	17	-	-	PUNCT
cusj-10965	95	18	zsgreen	zsgreen	NOUN
cusj-10965	95	19	were	be	AUX
cusj-10965	95	20	tested	test	VERB
cusj-10965	95	21	and	and	CCONJ
cusj-10965	95	22	demonstrated	demonstrate	VERB
cusj-10965	95	23	selective	selective	ADJ
cusj-10965	95	24	gene	gene	NOUN
cusj-10965	95	25	editing	edit	VERB
cusj-10965	95	26	as	as	ADV
cusj-10965	95	27	well	well	ADV
cusj-10965	95	28	.	.	PUNCT
cusj-10965	96	1	pcag	pcag	NOUN
cusj-10965	96	2	-	-	PUNCT
cusj-10965	96	3	loxpstoploxp	loxpstoploxp	NOUN
cusj-10965	96	4	-	-	PUNCT
cusj-10965	96	5	zsgreen	zsgreen	NOUN
cusj-10965	96	6	encodes	encode	NOUN
cusj-10965	96	7	a	a	DET
cusj-10965	96	8	zsgreen	zsgreen	NOUN
cusj-10965	96	9	reporter	reporter	NOUN
cusj-10965	96	10	downstream	downstream	NOUN
cusj-10965	96	11	of	of	ADP
cusj-10965	96	12	3	3	NUM
cusj-10965	96	13	successive	successive	ADJ
cusj-10965	96	14	transcription	transcription	NOUN
cusj-10965	96	15	termination	termination	NOUN
cusj-10965	96	16	sites	site	NOUN
cusj-10965	96	17	.	.	PUNCT
cusj-10965	97	1	normally	normally	ADV
cusj-10965	97	2	zsgreen	zsgreen	PUNCT
cusj-10965	97	3	expression	expression	NOUN
cusj-10965	97	4	would	would	AUX
cusj-10965	97	5	be	be	AUX
cusj-10965	97	6	low	low	ADJ
cusj-10965	97	7	but	but	CCONJ
cusj-10965	97	8	targeting	target	VERB
cusj-10965	97	9	cas9	cas9	NOUN
cusj-10965	97	10	to	to	ADP
cusj-10965	97	11	regions	region	NOUN
cusj-10965	97	12	between	between	ADP
cusj-10965	97	13	transcription	transcription	NOUN
cusj-10965	97	14	termination	termination	NOUN
cusj-10965	97	15	sites	site	NOUN
cusj-10965	97	16	with	with	ADP
cusj-10965	97	17	grna	grna	NOUN
cusj-10965	97	18	results	result	NOUN
cusj-10965	97	19	in	in	ADP
cusj-10965	97	20	removal	removal	NOUN
cusj-10965	97	21	of	of	ADP
cusj-10965	97	22	termination	termination	NOUN
cusj-10965	97	23	sites	site	NOUN
cusj-10965	97	24	and	and	CCONJ
cusj-10965	97	25	zsgreen	zsgreen	NOUN
cusj-10965	97	26	expression	expression	NOUN
cusj-10965	97	27	(	(	PUNCT
cusj-10965	97	28	figure	figure	NOUN
cusj-10965	97	29	3	3	NUM
cusj-10965	97	30	)	)	PUNCT
cusj-10965	97	31	.	.	PUNCT
cusj-10965	98	1	cells	cell	NOUN
cusj-10965	98	2	expressing	express	VERB
cusj-10965	98	3	cas9	cas9	NOUN
cusj-10965	98	4	and	and	CCONJ
cusj-10965	98	5	tlr	tlr	PROPN
cusj-10965	98	6	grnas	grna	NOUN
cusj-10965	98	7	along	along	ADP
cusj-10965	98	8	with	with	ADP
cusj-10965	98	9	reporter	reporter	NOUN
cusj-10965	98	10	exhibited	exhibit	VERB
cusj-10965	98	11	some	some	DET
cusj-10965	98	12	gfp	gfp	PROPN
cusj-10965	98	13	(	(	PUNCT
cusj-10965	98	14	figures	figure	NOUN
cusj-10965	98	15	5a	5a	NUM
cusj-10965	98	16	–	–	PUNCT
cusj-10965	98	17	c	c	NOUN
cusj-10965	98	18	)	)	PUNCT
cusj-10965	98	19	,	,	PUNCT
cusj-10965	98	20	but	but	CCONJ
cusj-10965	98	21	co	co	NOUN
cusj-10965	98	22	-	-	NOUN
cusj-10965	98	23	expression	expression	NOUN
cusj-10965	98	24	of	of	ADP
cusj-10965	98	25	cas9	cas9	NOUN
cusj-10965	98	26	and	and	CCONJ
cusj-10965	98	27	2	2	NUM
cusj-10965	98	28	gfp	gfp	PROPN
cusj-10965	98	29	grnas	grna	NOUN
cusj-10965	98	30	resulted	result	VERB
cusj-10965	98	31	in	in	ADP
cusj-10965	98	32	increased	increase	VERB
cusj-10965	98	33	gfp	gfp	NOUN
cusj-10965	98	34	expression	expression	NOUN
cusj-10965	98	35	(	(	PUNCT
cusj-10965	98	36	figures	figure	VERB
cusj-10965	98	37	5e	5e	NOUN
cusj-10965	98	38	and	and	CCONJ
cusj-10965	98	39	6c	6c	PROPN
cusj-10965	98	40	-	-	PUNCT
cusj-10965	98	41	d	d	PROPN
cusj-10965	98	42	)	)	PUNCT
cusj-10965	98	43	.	.	PUNCT
cusj-10965	99	1	when	when	SCONJ
cusj-10965	99	2	quantified	quantify	VERB
cusj-10965	99	3	,	,	PUNCT
cusj-10965	99	4	there	there	PRON
cusj-10965	99	5	was	be	VERB
cusj-10965	99	6	no	no	DET
cusj-10965	99	7	statistical	statistical	ADJ
cusj-10965	99	8	significance	significance	NOUN
cusj-10965	99	9	between	between	ADP
cusj-10965	99	10	the	the	DET
cusj-10965	99	11	gfp	gfp	PROPN
cusj-10965	99	12	reporter	reporter	NOUN
cusj-10965	99	13	only	only	ADV
cusj-10965	99	14	negative	negative	ADJ
cusj-10965	99	15	control	control	NOUN
cusj-10965	99	16	(	(	PUNCT
cusj-10965	99	17	figure	figure	NOUN
cusj-10965	99	18	5f	5f	NOUN
cusj-10965	99	19	)	)	PUNCT
cusj-10965	99	20	and	and	CCONJ
cusj-10965	99	21	the	the	DET
cusj-10965	99	22	pctg	pctg	PROPN
cusj-10965	99	23	-	-	PUNCT
cusj-10965	99	24	gfp	gfp	PROPN
cusj-10965	99	25	2x	2x	NUM
cusj-10965	99	26	version	version	NOUN
cusj-10965	99	27	of	of	ADP
cusj-10965	99	28	the	the	DET
cusj-10965	99	29	plasmid	plasmid	NOUN
cusj-10965	99	30	with	with	ADP
cusj-10965	99	31	figure	figure	NOUN
cusj-10965	99	32	6	6	NUM
cusj-10965	99	33	:	:	PUNCT
cusj-10965	99	34	quantitative	quantitative	ADJ
cusj-10965	99	35	analysis	analysis	NOUN
cusj-10965	99	36	of	of	ADP
cusj-10965	99	37	imaging	imaging	NOUN
cusj-10965	99	38	from	from	ADP
cusj-10965	99	39	figures	figure	NOUN
cusj-10965	99	40	4	4	NUM
cusj-10965	99	41	and	and	CCONJ
cusj-10965	99	42	5	5	NUM
cusj-10965	99	43	.	.	NOUN
cusj-10965	99	44	corresponds	correspond	NOUN
cusj-10965	99	45	with	with	ADP
cusj-10965	99	46	figure	figure	NOUN
cusj-10965	99	47	4	4	NUM
cusj-10965	99	48	:	:	PUNCT
cusj-10965	99	49	tagrfp+	tagrfp+	PRON
cusj-10965	99	50	cell	cell	NOUN
cusj-10965	99	51	counts	count	VERB
cusj-10965	99	52	(	(	PUNCT
cusj-10965	99	53	a	a	PRON
cusj-10965	99	54	)	)	PUNCT
cusj-10965	99	55	obtained	obtain	VERB
cusj-10965	99	56	over	over	ADP
cusj-10965	99	57	16	16	NUM
cusj-10965	99	58	images	image	NOUN
cusj-10965	99	59	for	for	ADP
cusj-10965	99	60	each	each	DET
cusj-10965	99	61	sample	sample	NOUN
cusj-10965	99	62	were	be	AUX
cusj-10965	99	63	obtained	obtain	VERB
cusj-10965	99	64	using	use	VERB
cusj-10965	99	65	gen5	gen5	NOUN
cusj-10965	99	66	software	software	NOUN
cusj-10965	99	67	.	.	PUNCT
cusj-10965	100	1	average	average	ADJ
cusj-10965	100	2	rfp	rfp	PROPN
cusj-10965	100	3	intensity	intensity	NOUN
cusj-10965	100	4	per	per	ADP
cusj-10965	100	5	cell	cell	NOUN
cusj-10965	100	6	(	(	PUNCT
cusj-10965	100	7	b	b	NOUN
cusj-10965	100	8	)	)	PUNCT
cusj-10965	100	9	was	be	AUX
cusj-10965	100	10	also	also	ADV
cusj-10965	100	11	obtained	obtain	VERB
cusj-10965	100	12	using	use	VERB
cusj-10965	100	13	gen5	gen5	NOUN
cusj-10965	100	14	software	software	NOUN
cusj-10965	100	15	.	.	PUNCT
cusj-10965	101	1	corresponds	correspond	VERB
cusj-10965	101	2	with	with	ADP
cusj-10965	101	3	figure	figure	NOUN
cusj-10965	101	4	5	5	NUM
cusj-10965	101	5	:	:	PUNCT
cusj-10965	101	6	gfp+	gfp+	PROPN
cusj-10965	101	7	cell	cell	NOUN
cusj-10965	101	8	counts	count	VERB
cusj-10965	101	9	(	(	PUNCT
cusj-10965	101	10	c	c	NOUN
cusj-10965	101	11	)	)	PUNCT
cusj-10965	101	12	obtained	obtain	VERB
cusj-10965	101	13	over	over	ADP
cusj-10965	101	14	16	16	NUM
cusj-10965	101	15	images	image	NOUN
cusj-10965	101	16	for	for	ADP
cusj-10965	101	17	each	each	DET
cusj-10965	101	18	sample	sample	NOUN
cusj-10965	101	19	were	be	AUX
cusj-10965	101	20	obtained	obtain	VERB
cusj-10965	101	21	using	use	VERB
cusj-10965	101	22	gen5	gen5	NOUN
cusj-10965	101	23	software	software	NOUN
cusj-10965	101	24	.	.	PUNCT
cusj-10965	102	1	average	average	ADJ
cusj-10965	102	2	gfp	gfp	PROPN
cusj-10965	102	3	intensity	intensity	NOUN
cusj-10965	102	4	per	per	ADP
cusj-10965	102	5	cell	cell	NOUN
cusj-10965	102	6	(	(	PUNCT
cusj-10965	102	7	d	d	X
cusj-10965	102	8	)	)	PUNCT
cusj-10965	102	9	was	be	AUX
cusj-10965	102	10	also	also	ADV
cusj-10965	102	11	obtained	obtain	VERB
cusj-10965	102	12	using	use	VERB
cusj-10965	102	13	gen5	gen5	NOUN
cusj-10965	102	14	software	software	NOUN
cusj-10965	102	15	.	.	PUNCT
cusj-10965	103	1	these	these	DET
cusj-10965	103	2	data	datum	NOUN
cusj-10965	103	3	are	be	AUX
cusj-10965	103	4	the	the	DET
cusj-10965	103	5	result	result	NOUN
cusj-10965	103	6	of	of	ADP
cusj-10965	103	7	two	two	NUM
cusj-10965	103	8	independent	independent	ADJ
cusj-10965	103	9	experiments	experiment	NOUN
cusj-10965	103	10	(	(	PUNCT
cusj-10965	103	11	n=2	n=2	ADV
cusj-10965	103	12	)	)	PUNCT
cusj-10965	103	13	.	.	PUNCT
cusj-10965	104	1	columbia	columbia	PROPN
cusj-10965	104	2	undergraduate	undergraduate	PROPN
cusj-10965	104	3	science	science	PROPN
cusj-10965	104	4	journal	journal	PROPN
cusj-10965	104	5	vol	vol	NOUN
cusj-10965	104	6	.	.	PROPN
cusj-10965	104	7	17	17	NUM
cusj-10965	104	8	,	,	PUNCT
cusj-10965	104	9	2023	2023	NUM
cusj-10965	104	10	lang	lang	PROPN
cusj-10965	104	11	et	et	PROPN
cusj-10965	104	12	.	.	PUNCT
cusj-10965	105	1	al	al	PROPN
cusj-10965	105	2	.	.	PROPN
cusj-10965	105	3	13	13	NUM
cusj-10965	105	4	regards	regard	NOUN
cusj-10965	105	5	to	to	ADP
cusj-10965	105	6	both	both	DET
cusj-10965	105	7	number	number	NOUN
cusj-10965	105	8	of	of	ADP
cusj-10965	105	9	cells	cell	NOUN
cusj-10965	105	10	that	that	PRON
cusj-10965	105	11	express	express	VERB
cusj-10965	105	12	gfp	gfp	NOUN
cusj-10965	105	13	and	and	CCONJ
cusj-10965	105	14	the	the	DET
cusj-10965	105	15	magnitude	magnitude	NOUN
cusj-10965	105	16	of	of	ADP
cusj-10965	105	17	expression	expression	NOUN
cusj-10965	105	18	/	/	SYM
cusj-10965	105	19	gene	gene	NOUN
cusj-10965	105	20	editing	editing	NOUN
cusj-10965	105	21	(	(	PUNCT
cusj-10965	105	22	figure	figure	NOUN
cusj-10965	105	23	6c	6c	PROPN
cusj-10965	105	24	-	-	PUNCT
cusj-10965	105	25	d	d	PROPN
cusj-10965	105	26	)	)	PUNCT
cusj-10965	105	27	.	.	PUNCT
cusj-10965	106	1	this	this	DET
cusj-10965	106	2	reporter	reporter	NOUN
cusj-10965	106	3	has	have	VERB
cusj-10965	106	4	a	a	DET
cusj-10965	106	5	higher	high	ADJ
cusj-10965	106	6	background	background	NOUN
cusj-10965	106	7	signal	signal	NOUN
cusj-10965	106	8	in	in	ADP
cusj-10965	106	9	the	the	DET
cusj-10965	106	10	absence	absence	NOUN
cusj-10965	106	11	of	of	ADP
cusj-10965	106	12	editing	edit	VERB
cusj-10965	106	13	as	as	ADV
cusj-10965	106	14	well	well	ADV
cusj-10965	106	15	as	as	ADP
cusj-10965	106	16	a	a	DET
cusj-10965	106	17	higher	high	ADJ
cusj-10965	106	18	threshold	threshold	NOUN
cusj-10965	106	19	for	for	ADP
cusj-10965	106	20	signal	signal	NOUN
cusj-10965	106	21	(	(	PUNCT
cusj-10965	106	22	multiple	multiple	ADJ
cusj-10965	106	23	cas9	cas9	NOUN
cusj-10965	106	24	have	have	VERB
cusj-10965	106	25	to	to	PART
cusj-10965	106	26	hit	hit	VERB
cusj-10965	106	27	the	the	DET
cusj-10965	106	28	same	same	ADJ
cusj-10965	106	29	reporter	reporter	NOUN
cusj-10965	106	30	dna	dna	PROPN
cusj-10965	106	31	)	)	PUNCT
cusj-10965	106	32	.	.	PUNCT
cusj-10965	107	1	in	in	ADP
cusj-10965	107	2	addition	addition	NOUN
cusj-10965	107	3	,	,	PUNCT
cusj-10965	107	4	the	the	DET
cusj-10965	107	5	reporter	reporter	NOUN
cusj-10965	107	6	only	only	ADV
cusj-10965	107	7	control	control	NOUN
cusj-10965	107	8	is	be	AUX
cusj-10965	107	9	a	a	DET
cusj-10965	107	10	transfection	transfection	NOUN
cusj-10965	107	11	with	with	ADP
cusj-10965	107	12	only	only	ADV
cusj-10965	107	13	one	one	NUM
cusj-10965	107	14	plasmid	plasmid	NOUN
cusj-10965	107	15	and	and	CCONJ
cusj-10965	107	16	neither	neither	CCONJ
cusj-10965	107	17	cas9	cas9	NOUN
cusj-10965	107	18	nor	nor	CCONJ
cusj-10965	107	19	grna	grna	NOUN
cusj-10965	107	20	,	,	PUNCT
cusj-10965	107	21	meaning	mean	VERB
cusj-10965	107	22	that	that	SCONJ
cusj-10965	107	23	the	the	DET
cusj-10965	107	24	reporter	reporter	NOUN
cusj-10965	107	25	only	only	ADV
cusj-10965	107	26	control	control	NOUN
cusj-10965	107	27	is	be	AUX
cusj-10965	107	28	not	not	PART
cusj-10965	107	29	the	the	DET
cusj-10965	107	30	best	good	ADJ
cusj-10965	107	31	direct	direct	ADJ
cusj-10965	107	32	comparison	comparison	NOUN
cusj-10965	107	33	.	.	PUNCT
cusj-10965	108	1	however	however	ADV
cusj-10965	108	2	,	,	PUNCT
cusj-10965	108	3	there	there	PRON
cusj-10965	108	4	was	be	VERB
cusj-10965	108	5	a	a	DET
cusj-10965	108	6	significant	significant	ADJ
cusj-10965	108	7	increase	increase	NOUN
cusj-10965	108	8	in	in	ADP
cusj-10965	108	9	both	both	DET
cusj-10965	108	10	number	number	NOUN
cusj-10965	108	11	of	of	ADP
cusj-10965	108	12	gfp+	gfp+	PROPN
cusj-10965	108	13	cells	cell	NOUN
cusj-10965	108	14	,	,	PUNCT
cusj-10965	108	15	as	as	ADV
cusj-10965	108	16	well	well	ADV
cusj-10965	108	17	as	as	ADP
cusj-10965	108	18	gfp	gfp	PROPN
cusj-10965	108	19	intensity	intensity	NOUN
cusj-10965	108	20	per	per	ADP
cusj-10965	108	21	cell	cell	NOUN
cusj-10965	108	22	when	when	SCONJ
cusj-10965	108	23	comparing	compare	VERB
cusj-10965	108	24	pctg	pctg	NOUN
cusj-10965	108	25	-	-	PUNCT
cusj-10965	108	26	gfp	gfp	PROPN
cusj-10965	108	27	2x	2x	NUM
cusj-10965	108	28	to	to	ADP
cusj-10965	108	29	pctg	pctg	NOUN
cusj-10965	108	30	-	-	PUNCT
cusj-10965	108	31	gfp	gfp	PROPN
cusj-10965	108	32	1x	1x	NOUN
cusj-10965	108	33	or	or	CCONJ
cusj-10965	108	34	any	any	PRON
cusj-10965	108	35	of	of	ADP
cusj-10965	108	36	the	the	DET
cusj-10965	108	37	pctg	pctg	PROPN
cusj-10965	108	38	-	-	PUNCT
cusj-10965	108	39	tlr	tlr	PROPN
cusj-10965	108	40	constructs	construct	NOUN
cusj-10965	108	41	(	(	PUNCT
cusj-10965	108	42	figure	figure	NOUN
cusj-10965	108	43	6c	6c	PROPN
cusj-10965	108	44	-	-	PUNCT
cusj-10965	108	45	d	d	PROPN
cusj-10965	108	46	)	)	PUNCT
cusj-10965	108	47	indicating	indicate	VERB
cusj-10965	108	48	some	some	DET
cusj-10965	108	49	level	level	NOUN
cusj-10965	108	50	of	of	ADP
cusj-10965	108	51	selective	selective	ADJ
cusj-10965	108	52	gene	gene	NOUN
cusj-10965	108	53	editing	editing	NOUN
cusj-10965	108	54	.	.	PUNCT
cusj-10965	109	1	for	for	ADP
cusj-10965	109	2	future	future	ADJ
cusj-10965	109	3	research	research	NOUN
cusj-10965	109	4	,	,	PUNCT
cusj-10965	109	5	it	it	PRON
cusj-10965	109	6	will	will	AUX
cusj-10965	109	7	be	be	AUX
cusj-10965	109	8	valuable	valuable	ADJ
cusj-10965	109	9	to	to	PART
cusj-10965	109	10	create	create	VERB
cusj-10965	109	11	a	a	DET
cusj-10965	109	12	pctg	pctg	NOUN
cusj-10965	109	13	-	-	PUNCT
cusj-10965	109	14	gfp	gfp	NOUN
cusj-10965	109	15	4x	4x	NOUN
cusj-10965	109	16	plasmid	plasmid	NOUN
cusj-10965	109	17	and	and	CCONJ
cusj-10965	109	18	assess	assess	VERB
cusj-10965	109	19	whether	whether	SCONJ
cusj-10965	109	20	or	or	CCONJ
cusj-10965	109	21	not	not	PART
cusj-10965	109	22	it	it	PRON
cusj-10965	109	23	demonstrates	demonstrate	VERB
cusj-10965	109	24	an	an	DET
cusj-10965	109	25	increase	increase	NOUN
cusj-10965	109	26	in	in	ADP
cusj-10965	109	27	gene	gene	NOUN
cusj-10965	109	28	editing	edit	VERB
cusj-10965	109	29	activity	activity	NOUN
cusj-10965	109	30	similar	similar	ADJ
cusj-10965	109	31	to	to	ADP
cusj-10965	109	32	the	the	DET
cusj-10965	109	33	pctg	pctg	PROPN
cusj-10965	109	34	-	-	PUNCT
cusj-10965	109	35	tlr	tlr	PROPN
cusj-10965	109	36	plasmids	plasmid	NOUN
cusj-10965	109	37	.	.	PUNCT
cusj-10965	110	1	discussion	discussion	NOUN
cusj-10965	110	2	the	the	DET
cusj-10965	110	3	single	single	ADJ
cusj-10965	110	4	rna	rna	NOUN
cusj-10965	110	5	encoding	encoding	NOUN
cusj-10965	110	6	cas9	cas9	NOUN
cusj-10965	110	7	+	+	CCONJ
cusj-10965	110	8	guide	guide	VERB
cusj-10965	110	9	rna	rna	NOUN
cusj-10965	110	10	constructs	construct	NOUN
cusj-10965	110	11	were	be	AUX
cusj-10965	110	12	successful	successful	ADJ
cusj-10965	110	13	in	in	ADP
cusj-10965	110	14	performing	perform	VERB
cusj-10965	110	15	gene	gene	NOUN
cusj-10965	110	16	editing	edit	VERB
cusj-10965	110	17	on	on	ADP
cusj-10965	110	18	two	two	NUM
cusj-10965	110	19	different	different	ADJ
cusj-10965	110	20	reporters	reporter	NOUN
cusj-10965	110	21	.	.	PUNCT
cusj-10965	111	1	the	the	DET
cusj-10965	111	2	plasmids	plasmid	NOUN
cusj-10965	111	3	containing	contain	VERB
cusj-10965	111	4	tlr	tlr	PROPN
cusj-10965	111	5	guide	guide	PROPN
cusj-10965	111	6	rna	rna	PROPN
cusj-10965	111	7	were	be	AUX
cusj-10965	111	8	able	able	ADJ
cusj-10965	111	9	to	to	PART
cusj-10965	111	10	produce	produce	VERB
cusj-10965	111	11	significant	significant	ADJ
cusj-10965	111	12	gene	gene	NOUN
cusj-10965	111	13	editing	edit	VERB
cusj-10965	111	14	only	only	ADV
cusj-10965	111	15	on	on	ADP
cusj-10965	111	16	tlr	tlr	PROPN
cusj-10965	111	17	and	and	CCONJ
cusj-10965	111	18	the	the	DET
cusj-10965	111	19	duplication	duplication	NOUN
cusj-10965	111	20	of	of	ADP
cusj-10965	111	21	guide	guide	ADJ
cusj-10965	111	22	rna	rna	NOUN
cusj-10965	111	23	sequences	sequence	NOUN
cusj-10965	111	24	was	be	AUX
cusj-10965	111	25	shown	show	VERB
cusj-10965	111	26	to	to	PART
cusj-10965	111	27	improve	improve	VERB
cusj-10965	111	28	not	not	PART
cusj-10965	111	29	only	only	ADV
cusj-10965	111	30	the	the	DET
cusj-10965	111	31	number	number	NOUN
cusj-10965	111	32	of	of	ADP
cusj-10965	111	33	cells	cell	NOUN
cusj-10965	111	34	that	that	PRON
cusj-10965	111	35	had	have	VERB
cusj-10965	111	36	gene	gene	NOUN
cusj-10965	111	37	editing	editing	NOUN
cusj-10965	111	38	but	but	CCONJ
cusj-10965	111	39	also	also	ADV
cusj-10965	111	40	increased	increase	VERB
cusj-10965	111	41	the	the	DET
cusj-10965	111	42	magnitude	magnitude	NOUN
cusj-10965	111	43	of	of	ADP
cusj-10965	111	44	gene	gene	NOUN
cusj-10965	111	45	editing	edit	VERB
cusj-10965	111	46	per	per	ADP
cusj-10965	111	47	cell	cell	NOUN
cusj-10965	111	48	as	as	ADV
cusj-10965	111	49	well	well	ADV
cusj-10965	111	50	.	.	PUNCT
cusj-10965	112	1	with	with	ADP
cusj-10965	112	2	regards	regard	NOUN
cusj-10965	112	3	to	to	ADP
cusj-10965	112	4	the	the	DET
cusj-10965	112	5	gfp	gfp	PROPN
cusj-10965	112	6	guide	guide	PROPN
cusj-10965	112	7	rna	rna	NOUN
cusj-10965	112	8	containing	contain	VERB
cusj-10965	112	9	plasmid	plasmid	NOUN
cusj-10965	112	10	,	,	PUNCT
cusj-10965	112	11	there	there	PRON
cusj-10965	112	12	was	be	VERB
cusj-10965	112	13	a	a	DET
cusj-10965	112	14	significant	significant	ADJ
cusj-10965	112	15	increase	increase	NOUN
cusj-10965	112	16	in	in	ADP
cusj-10965	112	17	the	the	DET
cusj-10965	112	18	number	number	NOUN
cusj-10965	112	19	of	of	ADP
cusj-10965	112	20	cells	cell	NOUN
cusj-10965	112	21	with	with	ADP
cusj-10965	112	22	gene	gene	NOUN
cusj-10965	112	23	editing	editing	NOUN
cusj-10965	112	24	between	between	ADP
cusj-10965	112	25	the	the	DET
cusj-10965	112	26	2x	2x	NUM
cusj-10965	112	27	version	version	NOUN
cusj-10965	112	28	of	of	ADP
cusj-10965	112	29	pctg	pctg	PROPN
cusj-10965	112	30	-	-	PUNCT
cusj-10965	112	31	gfp	gfp	PROPN
cusj-10965	112	32	when	when	SCONJ
cusj-10965	112	33	compared	compare	VERB
cusj-10965	112	34	to	to	ADP
cusj-10965	112	35	the	the	DET
cusj-10965	112	36	1x	1x	NUM
cusj-10965	112	37	version	version	NOUN
cusj-10965	112	38	or	or	CCONJ
cusj-10965	112	39	any	any	PRON
cusj-10965	112	40	of	of	ADP
cusj-10965	112	41	the	the	DET
cusj-10965	112	42	pctg	pctg	PROPN
cusj-10965	112	43	-	-	PUNCT
cusj-10965	112	44	tlr	tlr	PROPN
cusj-10965	112	45	versions	version	NOUN
cusj-10965	112	46	,	,	PUNCT
cusj-10965	112	47	demonstrating	demonstrate	VERB
cusj-10965	112	48	the	the	DET
cusj-10965	112	49	increase	increase	NOUN
cusj-10965	112	50	in	in	ADP
cusj-10965	112	51	number	number	NOUN
cusj-10965	112	52	of	of	ADP
cusj-10965	112	53	grnas	grna	NOUN
cusj-10965	112	54	is	be	AUX
cusj-10965	112	55	also	also	ADV
cusj-10965	112	56	able	able	ADJ
cusj-10965	112	57	to	to	PART
cusj-10965	112	58	increase	increase	VERB
cusj-10965	112	59	the	the	DET
cusj-10965	112	60	level	level	NOUN
cusj-10965	112	61	of	of	ADP
cusj-10965	112	62	selective	selective	ADJ
cusj-10965	112	63	gene	gene	NOUN
cusj-10965	112	64	editing	edit	VERB
cusj-10965	112	65	in	in	ADP
cusj-10965	112	66	cells	cell	NOUN
cusj-10965	112	67	.	.	PUNCT
cusj-10965	113	1	while	while	SCONJ
cusj-10965	113	2	this	this	DET
cusj-10965	113	3	result	result	NOUN
cusj-10965	113	4	was	be	AUX
cusj-10965	113	5	clearly	clearly	ADV
cusj-10965	113	6	weaker	weak	ADJ
cusj-10965	113	7	in	in	ADP
cusj-10965	113	8	magnitude	magnitude	NOUN
cusj-10965	113	9	than	than	ADP
cusj-10965	113	10	the	the	DET
cusj-10965	113	11	tlr	tlr	PROPN
cusj-10965	113	12	system	system	NOUN
cusj-10965	113	13	,	,	PUNCT
cusj-10965	113	14	there	there	PRON
cusj-10965	113	15	are	be	VERB
cusj-10965	113	16	some	some	DET
cusj-10965	113	17	limitations	limitation	NOUN
cusj-10965	113	18	to	to	ADP
cusj-10965	113	19	using	use	VERB
cusj-10965	113	20	this	this	DET
cusj-10965	113	21	gfp	gfp	NOUN
cusj-10965	113	22	reporter	reporter	NOUN
cusj-10965	113	23	that	that	PRON
cusj-10965	113	24	likely	likely	ADV
cusj-10965	113	25	account	account	VERB
cusj-10965	113	26	for	for	ADP
cusj-10965	113	27	this	this	PRON
cusj-10965	113	28	.	.	PUNCT
cusj-10965	114	1	first	first	ADV
cusj-10965	114	2	,	,	PUNCT
cusj-10965	114	3	there	there	PRON
cusj-10965	114	4	are	be	VERB
cusj-10965	114	5	nonzero	nonzero	ADJ
cusj-10965	114	6	amounts	amount	NOUN
cusj-10965	114	7	of	of	ADP
cusj-10965	114	8	background	background	NOUN
cusj-10965	114	9	green	green	ADJ
cusj-10965	114	10	fluorescence	fluorescence	NOUN
cusj-10965	114	11	for	for	ADP
cusj-10965	114	12	negative	negative	ADJ
cusj-10965	114	13	controls	control	NOUN
cusj-10965	114	14	(	(	PUNCT
cusj-10965	114	15	figure	figure	NOUN
cusj-10965	114	16	5	5	NUM
cusj-10965	114	17	)	)	PUNCT
cusj-10965	114	18	.	.	PUNCT
cusj-10965	115	1	this	this	DET
cusj-10965	115	2	higher	high	ADJ
cusj-10965	115	3	background	background	NOUN
cusj-10965	115	4	is	be	AUX
cusj-10965	115	5	likely	likely	ADV
cusj-10965	115	6	worse	bad	ADJ
cusj-10965	115	7	in	in	ADP
cusj-10965	115	8	the	the	DET
cusj-10965	115	9	reporter	reporter	NOUN
cusj-10965	115	10	only	only	ADV
cusj-10965	115	11	control	control	NOUN
cusj-10965	115	12	in	in	ADP
cusj-10965	115	13	which	which	PRON
cusj-10965	115	14	only	only	ADV
cusj-10965	115	15	one	one	NUM
cusj-10965	115	16	plasmid	plasmid	NOUN
cusj-10965	115	17	is	be	AUX
cusj-10965	115	18	being	be	AUX
cusj-10965	115	19	transfected	transfecte	VERB
cusj-10965	115	20	as	as	ADP
cusj-10965	115	21	opposed	oppose	VERB
cusj-10965	115	22	to	to	ADP
cusj-10965	115	23	all	all	DET
cusj-10965	115	24	other	other	ADJ
cusj-10965	115	25	samples	sample	NOUN
cusj-10965	115	26	which	which	PRON
cusj-10965	115	27	get	get	VERB
cusj-10965	115	28	two	two	NUM
cusj-10965	115	29	plasmids	plasmid	NOUN
cusj-10965	115	30	.	.	PUNCT
cusj-10965	116	1	in	in	ADP
cusj-10965	116	2	addition	addition	NOUN
cusj-10965	116	3	,	,	PUNCT
cusj-10965	116	4	the	the	DET
cusj-10965	116	5	gfp	gfp	PROPN
cusj-10965	116	6	system	system	NOUN
cusj-10965	116	7	requires	require	VERB
cusj-10965	116	8	multiple	multiple	ADJ
cusj-10965	116	9	editing	edit	VERB
cusj-10965	116	10	events	event	NOUN
cusj-10965	116	11	per	per	ADP
cusj-10965	116	12	cell	cell	NOUN
cusj-10965	116	13	to	to	PART
cusj-10965	116	14	get	get	VERB
cusj-10965	116	15	gfp	gfp	NOUN
cusj-10965	116	16	(	(	PUNCT
cusj-10965	116	17	figure	figure	NOUN
cusj-10965	116	18	3	3	NUM
cusj-10965	116	19	)	)	PUNCT
cusj-10965	116	20	,	,	PUNCT
cusj-10965	116	21	making	make	VERB
cusj-10965	116	22	the	the	DET
cusj-10965	116	23	signal	signal	NOUN
cusj-10965	116	24	weaker	weak	ADJ
cusj-10965	116	25	than	than	ADP
cusj-10965	116	26	the	the	DET
cusj-10965	116	27	single	single	ADJ
cusj-10965	116	28	editing	editing	NOUN
cusj-10965	116	29	event	event	NOUN
cusj-10965	116	30	required	require	VERB
cusj-10965	116	31	for	for	ADP
cusj-10965	116	32	the	the	DET
cusj-10965	116	33	tlr	tlr	PROPN
cusj-10965	116	34	system	system	NOUN
cusj-10965	116	35	.	.	PUNCT
cusj-10965	117	1	an	an	DET
cusj-10965	117	2	article	article	NOUN
cusj-10965	117	3	written	write	VERB
cusj-10965	117	4	by	by	ADP
cusj-10965	117	5	mccarty	mccarty	PROPN
cusj-10965	117	6	et	et	PROPN
cusj-10965	117	7	al	al	PROPN
cusj-10965	117	8	.	.	PROPN
cusj-10965	118	1	reviews	review	NOUN
cusj-10965	118	2	construct	construct	VERB
cusj-10965	118	3	designs	design	NOUN
cusj-10965	118	4	somewhat	somewhat	ADV
cusj-10965	118	5	similar	similar	ADJ
cusj-10965	118	6	to	to	ADP
cusj-10965	118	7	ours	our	NOUN
cusj-10965	118	8	,	,	PUNCT
cusj-10965	118	9	including	include	VERB
cusj-10965	118	10	one	one	NUM
cusj-10965	118	11	encoding	encoding	NOUN
cusj-10965	118	12	cas12a.19,24	cas12a.19,24	INTJ
cusj-10965	118	13	we	we	PRON
cusj-10965	118	14	selected	select	VERB
cusj-10965	118	15	cas9	cas9	NOUN
cusj-10965	118	16	for	for	ADP
cusj-10965	118	17	our	our	PRON
cusj-10965	118	18	configuration	configuration	NOUN
cusj-10965	118	19	due	due	ADP
cusj-10965	118	20	to	to	ADP
cusj-10965	118	21	the	the	DET
cusj-10965	118	22	wealth	wealth	NOUN
cusj-10965	118	23	of	of	ADP
cusj-10965	118	24	knowledge	knowledge	NOUN
cusj-10965	118	25	about	about	ADP
cusj-10965	118	26	this	this	DET
cusj-10965	118	27	system	system	NOUN
cusj-10965	118	28	and	and	CCONJ
cusj-10965	118	29	cas9	cas9	NOUN
cusj-10965	118	30	’s	’s	PART
cusj-10965	118	31	high	high	ADJ
cusj-10965	118	32	activity	activity	NOUN
cusj-10965	118	33	relative	relative	ADJ
cusj-10965	118	34	to	to	ADP
cusj-10965	118	35	other	other	ADJ
cusj-10965	118	36	cas	cas	NOUN
cusj-10965	118	37	proteins	protein	NOUN
cusj-10965	118	38	.	.	PUNCT
cusj-10965	119	1	in	in	ADP
cusj-10965	119	2	addition	addition	NOUN
cusj-10965	119	3	,	,	PUNCT
cusj-10965	119	4	the	the	DET
cusj-10965	119	5	selected	select	VERB
cusj-10965	119	6	self	self	NOUN
cusj-10965	119	7	-	-	PUNCT
cusj-10965	119	8	cleaving	cleave	VERB
cusj-10965	119	9	ribozymes	ribozyme	NOUN
cusj-10965	119	10	that	that	PRON
cusj-10965	119	11	process	process	NOUN
cusj-10965	119	12	grnas	grna	NOUN
cusj-10965	119	13	are	be	AUX
cusj-10965	119	14	wellcharacterized	wellcharacterize	VERB
cusj-10965	119	15	and	and	CCONJ
cusj-10965	119	16	regulated	regulated	ADJ
cusj-10965	119	17	cleavage	cleavage	NOUN
cusj-10965	119	18	can	can	AUX
cusj-10965	119	19	be	be	AUX
cusj-10965	119	20	engineered.25,26	engineered.25,26	ADJ
cusj-10965	119	21	since	since	SCONJ
cusj-10965	119	22	we	we	PRON
cusj-10965	119	23	found	find	VERB
cusj-10965	119	24	that	that	SCONJ
cusj-10965	119	25	this	this	DET
cusj-10965	119	26	kind	kind	NOUN
cusj-10965	119	27	of	of	ADP
cusj-10965	119	28	construct	construct	NOUN
cusj-10965	119	29	design	design	NOUN
cusj-10965	119	30	works	work	NOUN
cusj-10965	119	31	,	,	PUNCT
cusj-10965	119	32	we	we	PRON
cusj-10965	119	33	can	can	AUX
cusj-10965	119	34	potentially	potentially	ADV
cusj-10965	119	35	also	also	ADV
cusj-10965	119	36	test	test	VERB
cusj-10965	119	37	other	other	ADJ
cusj-10965	119	38	designs	design	NOUN
cusj-10965	119	39	,	,	PUNCT
cusj-10965	119	40	such	such	ADJ
cusj-10965	119	41	as	as	ADP
cusj-10965	119	42	one	one	NUM
cusj-10965	119	43	where	where	SCONJ
cusj-10965	119	44	different	different	ADJ
cusj-10965	119	45	grna	grna	NOUN
cusj-10965	119	46	sequences	sequence	NOUN
cusj-10965	119	47	are	be	AUX
cusj-10965	119	48	encoded	encode	VERB
cusj-10965	119	49	on	on	ADP
cusj-10965	119	50	one	one	NUM
cusj-10965	119	51	rna	rna	NOUN
cusj-10965	119	52	strand	strand	NOUN
cusj-10965	119	53	which	which	PRON
cusj-10965	119	54	would	would	AUX
cusj-10965	119	55	allow	allow	VERB
cusj-10965	119	56	for	for	ADP
cusj-10965	119	57	simultaneous	simultaneous	ADJ
cusj-10965	119	58	gene	gene	NOUN
cusj-10965	119	59	editing	editing	NOUN
cusj-10965	119	60	at	at	ADP
cusj-10965	119	61	multiple	multiple	ADJ
cusj-10965	119	62	gene	gene	NOUN
cusj-10965	119	63	loci.24	loci.24	NOUN
cusj-10965	119	64	this	this	DET
cusj-10965	119	65	kind	kind	NOUN
cusj-10965	119	66	of	of	ADP
cusj-10965	119	67	structure	structure	NOUN
cusj-10965	119	68	could	could	AUX
cusj-10965	119	69	be	be	AUX
cusj-10965	119	70	promising	promise	VERB
cusj-10965	119	71	for	for	ADP
cusj-10965	119	72	gene	gene	NOUN
cusj-10965	119	73	therapy	therapy	NOUN
cusj-10965	119	74	in	in	ADP
cusj-10965	119	75	the	the	DET
cusj-10965	119	76	future	future	NOUN
cusj-10965	119	77	and	and	CCONJ
cusj-10965	119	78	is	be	AUX
cusj-10965	119	79	worth	worth	ADJ
cusj-10965	119	80	considering	consider	VERB
cusj-10965	119	81	.	.	PUNCT
cusj-10965	120	1	conclusion	conclusion	NOUN
cusj-10965	120	2	these	these	DET
cusj-10965	120	3	results	result	NOUN
cusj-10965	120	4	are	be	AUX
cusj-10965	120	5	significant	significant	ADJ
cusj-10965	120	6	because	because	SCONJ
cusj-10965	120	7	after	after	ADP
cusj-10965	120	8	demonstrating	demonstrate	VERB
cusj-10965	120	9	that	that	SCONJ
cusj-10965	120	10	these	these	DET
cusj-10965	120	11	cas9	cas9	NOUN
cusj-10965	120	12	/	/	SYM
cusj-10965	120	13	grna	grna	NOUN
cusj-10965	120	14	single	single	ADJ
cusj-10965	120	15	rna	rna	NOUN
cusj-10965	120	16	constructs	construct	VERB
cusj-10965	120	17	function	function	NOUN
cusj-10965	120	18	in	in	ADP
cusj-10965	120	19	hek293	hek293	PROPN
cusj-10965	120	20	t	t	NOUN
cusj-10965	120	21	cells	cell	NOUN
cusj-10965	120	22	,	,	PUNCT
cusj-10965	120	23	future	future	ADJ
cusj-10965	120	24	experiments	experiment	NOUN
cusj-10965	120	25	can	can	AUX
cusj-10965	120	26	now	now	ADV
cusj-10965	120	27	be	be	AUX
cusj-10965	120	28	designed	design	VERB
cusj-10965	120	29	to	to	PART
cusj-10965	120	30	test	test	VERB
cusj-10965	120	31	whether	whether	SCONJ
cusj-10965	120	32	this	this	DET
cusj-10965	120	33	configuration	configuration	NOUN
cusj-10965	120	34	improves	improve	VERB
cusj-10965	120	35	delivery	delivery	NOUN
cusj-10965	120	36	of	of	ADP
cusj-10965	120	37	cas9	cas9	NOUN
cusj-10965	120	38	/	/	SYM
cusj-10965	120	39	grna	grna	NOUN
cusj-10965	120	40	using	use	VERB
cusj-10965	120	41	systems	system	NOUN
cusj-10965	120	42	that	that	PRON
cusj-10965	120	43	have	have	AUX
cusj-10965	120	44	been	be	AUX
cusj-10965	120	45	shown	show	VERB
cusj-10965	120	46	to	to	PART
cusj-10965	120	47	be	be	AUX
cusj-10965	120	48	limited	limit	VERB
cusj-10965	120	49	by	by	ADP
cusj-10965	120	50	cargo	cargo	NOUN
cusj-10965	120	51	size	size	NOUN
cusj-10965	120	52	like	like	ADP
cusj-10965	120	53	aavs	aavs	NOUN
cusj-10965	120	54	,	,	PUNCT
cusj-10965	120	55	lentiviruses	lentiviruse	NOUN
cusj-10965	120	56	,	,	PUNCT
cusj-10965	120	57	and	and	CCONJ
cusj-10965	120	58	mrna	mrna	PROPN
cusj-10965	120	59	delivered	deliver	VERB
cusj-10965	120	60	by	by	ADP
cusj-10965	120	61	nano	nano	NOUN
cusj-10965	120	62	-	-	PUNCT
cusj-10965	120	63	lipid	lipid	NOUN
cusj-10965	120	64	particles	particle	NOUN
cusj-10965	120	65	.	.	PUNCT
cusj-10965	121	1	aavs	aavs	PROPN
cusj-10965	121	2	are	be	AUX
cusj-10965	121	3	known	know	VERB
cusj-10965	121	4	to	to	PART
cusj-10965	121	5	have	have	VERB
cusj-10965	121	6	limited	limit	VERB
cusj-10965	121	7	cargo	cargo	NOUN
cusj-10965	121	8	capacity	capacity	NOUN
cusj-10965	121	9	despite	despite	SCONJ
cusj-10965	121	10	being	be	AUX
cusj-10965	121	11	very	very	ADV
cusj-10965	121	12	effective	effective	ADJ
cusj-10965	121	13	for	for	ADP
cusj-10965	121	14	delivery27	delivery27	ADJ
cusj-10965	121	15	.	.	PUNCT
cusj-10965	122	1	combining	combine	VERB
cusj-10965	122	2	our	our	PRON
cusj-10965	122	3	configuration	configuration	NOUN
cusj-10965	122	4	with	with	ADP
cusj-10965	122	5	smaller	small	ADJ
cusj-10965	122	6	promoters	promoter	NOUN
cusj-10965	122	7	,	,	PUNCT
cusj-10965	122	8	more	more	ADV
cusj-10965	122	9	compact	compact	ADJ
cusj-10965	122	10	cas	cas	NOUN
cusj-10965	122	11	enzymes	enzyme	NOUN
cusj-10965	122	12	,	,	PUNCT
cusj-10965	122	13	and	and	CCONJ
cusj-10965	122	14	regulatable	regulatable	ADJ
cusj-10965	122	15	ribozymes	ribozyme	NOUN
cusj-10965	122	16	may	may	AUX
cusj-10965	122	17	even	even	ADV
cusj-10965	122	18	allow	allow	VERB
cusj-10965	122	19	a	a	DET
cusj-10965	122	20	single	single	ADJ
cusj-10965	122	21	aav	aav	NOUN
cusj-10965	122	22	or	or	CCONJ
cusj-10965	122	23	more	more	ADV
cusj-10965	122	24	efficient	efficient	ADJ
cusj-10965	122	25	lentiviruses	lentiviruse	NOUN
cusj-10965	122	26	to	to	PART
cusj-10965	122	27	be	be	AUX
cusj-10965	122	28	produced.28,29	produced.28,29	NOUN
cusj-10965	122	29	with	with	ADP
cusj-10965	122	30	regards	regard	NOUN
cusj-10965	122	31	to	to	ADP
cusj-10965	122	32	nonviral	nonviral	ADJ
cusj-10965	122	33	delivery	delivery	NOUN
cusj-10965	122	34	,	,	PUNCT
cusj-10965	122	35	lipid	lipid	NOUN
cusj-10965	122	36	nanoparticles	nanoparticle	NOUN
cusj-10965	122	37	are	be	AUX
cusj-10965	122	38	already	already	ADV
cusj-10965	122	39	known	know	VERB
cusj-10965	122	40	to	to	PART
cusj-10965	122	41	produce	produce	VERB
cusj-10965	122	42	efficient	efficient	ADJ
cusj-10965	122	43	delivery	delivery	NOUN
cusj-10965	122	44	of	of	ADP
cusj-10965	122	45	cargo	cargo	NOUN
cusj-10965	122	46	,	,	PUNCT
cusj-10965	122	47	as	as	ADV
cusj-10965	122	48	well	well	ADV
cusj-10965	122	49	as	as	ADP
cusj-10965	122	50	target	target	PROPN
cusj-10965	122	51	columbia	columbia	PROPN
cusj-10965	122	52	undergraduate	undergraduate	PROPN
cusj-10965	122	53	science	science	PROPN
cusj-10965	122	54	journal	journal	PROPN
cusj-10965	122	55	vol	vol	NOUN
cusj-10965	122	56	.	.	PROPN
cusj-10965	123	1	17	17	NUM
cusj-10965	123	2	,	,	PUNCT
cusj-10965	123	3	2023	2023	NUM
cusj-10965	123	4	lang	lang	PROPN
cusj-10965	123	5	et	et	PROPN
cusj-10965	123	6	.	.	PUNCT
cusj-10965	124	1	al	al	PROPN
cusj-10965	124	2	.	.	PROPN
cusj-10965	124	3	14	14	NUM
cusj-10965	124	4	specific	specific	ADJ
cusj-10965	124	5	cells	cell	NOUN
cusj-10965	124	6	.	.	PUNCT
cusj-10965	125	1	while	while	SCONJ
cusj-10965	125	2	nonviral	nonviral	ADJ
cusj-10965	125	3	delivery	delivery	NOUN
cusj-10965	125	4	systems	system	NOUN
cusj-10965	125	5	are	be	AUX
cusj-10965	125	6	generally	generally	ADV
cusj-10965	125	7	able	able	ADJ
cusj-10965	125	8	to	to	PART
cusj-10965	125	9	hold	hold	VERB
cusj-10965	125	10	larger	large	ADJ
cusj-10965	125	11	cargos	cargo	NOUN
cusj-10965	125	12	,	,	PUNCT
cusj-10965	125	13	it	it	PRON
cusj-10965	125	14	is	be	AUX
cusj-10965	125	15	still	still	ADV
cusj-10965	125	16	valuable	valuable	ADJ
cusj-10965	125	17	to	to	PART
cusj-10965	125	18	test	test	VERB
cusj-10965	125	19	this	this	DET
cusj-10965	125	20	single	single	ADJ
cusj-10965	125	21	rna	rna	NOUN
cusj-10965	125	22	construct	construct	NOUN
cusj-10965	125	23	’s	’s	PART
cusj-10965	125	24	effectiveness	effectiveness	NOUN
cusj-10965	125	25	in	in	ADP
cusj-10965	125	26	lipid	lipid	ADJ
cusj-10965	125	27	nanoparticles	nanoparticle	NOUN
cusj-10965	125	28	and	and	CCONJ
cusj-10965	125	29	whether	whether	SCONJ
cusj-10965	125	30	it	it	PRON
cusj-10965	125	31	demonstrates	demonstrate	VERB
cusj-10965	125	32	improvement	improvement	NOUN
cusj-10965	125	33	in	in	ADP
cusj-10965	125	34	gene	gene	NOUN
cusj-10965	125	35	editing	edit	VERB
cusj-10965	125	36	frequency	frequency	NOUN
cusj-10965	125	37	and	and	CCONJ
cusj-10965	125	38	magnitude	magnitude	NOUN
cusj-10965	125	39	since	since	SCONJ
cusj-10965	125	40	current	current	ADJ
cusj-10965	125	41	methods	method	NOUN
cusj-10965	125	42	often	often	ADV
cusj-10965	125	43	rely	rely	VERB
cusj-10965	125	44	on	on	ADP
cusj-10965	125	45	getting	get	VERB
cusj-10965	125	46	two	two	NUM
cusj-10965	125	47	separate	separate	ADJ
cusj-10965	125	48	molecules	molecule	NOUN
cusj-10965	125	49	,	,	PUNCT
cusj-10965	125	50	grna	grna	NOUN
cusj-10965	125	51	and	and	CCONJ
cusj-10965	125	52	cas9	cas9	NOUN
cusj-10965	125	53	,	,	PUNCT
cusj-10965	125	54	into	into	ADP
cusj-10965	125	55	particles	particle	NOUN
cusj-10965	125	56	.	.	PUNCT
cusj-10965	126	1	in	in	ADP
cusj-10965	126	2	the	the	DET
cusj-10965	126	3	future	future	NOUN
cusj-10965	126	4	,	,	PUNCT
cusj-10965	126	5	these	these	DET
cusj-10965	126	6	delivery	delivery	NOUN
cusj-10965	126	7	approaches	approach	NOUN
cusj-10965	126	8	could	could	AUX
cusj-10965	126	9	be	be	AUX
cusj-10965	126	10	directly	directly	ADV
cusj-10965	126	11	used	use	VERB
cusj-10965	126	12	in	in	ADP
cusj-10965	126	13	animal	animal	NOUN
cusj-10965	126	14	models	model	NOUN
cusj-10965	126	15	too	too	ADV
cusj-10965	126	16	as	as	SCONJ
cusj-10965	126	17	the	the	DET
cusj-10965	126	18	guide	guide	NOUN
cusj-10965	126	19	rnas	rna	NOUN
cusj-10965	126	20	we	we	PRON
cusj-10965	126	21	have	have	AUX
cusj-10965	126	22	used	use	VERB
cusj-10965	126	23	in	in	ADP
cusj-10965	126	24	this	this	DET
cusj-10965	126	25	study	study	NOUN
cusj-10965	126	26	target	target	NOUN
cusj-10965	126	27	commercially	commercially	ADV
cusj-10965	126	28	available	available	ADJ
cusj-10965	126	29	tlr	tlr	PROPN
cusj-10965	126	30	and	and	CCONJ
cusj-10965	126	31	ai9	ai9	ADJ
cusj-10965	126	32	mice	mouse	NOUN
cusj-10965	126	33	.	.	PUNCT
cusj-10965	127	1	beyond	beyond	ADP
cusj-10965	127	2	this	this	PRON
cusj-10965	127	3	,	,	PUNCT
cusj-10965	127	4	testing	test	VERB
cusj-10965	127	5	for	for	ADP
cusj-10965	127	6	effective	effective	ADJ
cusj-10965	127	7	modification	modification	NOUN
cusj-10965	127	8	of	of	ADP
cusj-10965	127	9	disease	disease	NOUN
cusj-10965	127	10	associated	associate	VERB
cusj-10965	127	11	genes	gene	NOUN
cusj-10965	127	12	using	use	VERB
cusj-10965	127	13	other	other	ADJ
cusj-10965	127	14	grnas	grna	NOUN
cusj-10965	127	15	would	would	AUX
cusj-10965	127	16	provide	provide	VERB
cusj-10965	127	17	valuable	valuable	ADJ
cusj-10965	127	18	insight	insight	NOUN
cusj-10965	127	19	for	for	ADP
cusj-10965	127	20	the	the	DET
cusj-10965	127	21	prospect	prospect	NOUN
cusj-10965	127	22	of	of	ADP
cusj-10965	127	23	using	use	VERB
cusj-10965	127	24	our	our	PRON
cusj-10965	127	25	single	single	ADJ
cusj-10965	127	26	rna	rna	NOUN
cusj-10965	127	27	structure	structure	NOUN
cusj-10965	127	28	for	for	ADP
cusj-10965	127	29	gene	gene	NOUN
cusj-10965	127	30	therapy	therapy	NOUN
cusj-10965	127	31	applications	application	NOUN
cusj-10965	127	32	.	.	PUNCT
cusj-10965	128	1	in	in	ADP
cusj-10965	128	2	short	short	ADJ
cusj-10965	128	3	,	,	PUNCT
cusj-10965	128	4	this	this	DET
cusj-10965	128	5	technology	technology	NOUN
cusj-10965	128	6	has	have	VERB
cusj-10965	128	7	the	the	DET
cusj-10965	128	8	potential	potential	NOUN
cusj-10965	128	9	to	to	PART
cusj-10965	128	10	improve	improve	VERB
cusj-10965	128	11	both	both	PRON
cusj-10965	128	12	existing	exist	VERB
cusj-10965	128	13	and	and	CCONJ
cusj-10965	128	14	emerging	emerge	VERB
cusj-10965	128	15	cas9	cas9	NOUN
cusj-10965	128	16	/	/	SYM
cusj-10965	128	17	grna	grna	NOUN
cusj-10965	128	18	delivery	delivery	NOUN
cusj-10965	128	19	methods	method	NOUN
cusj-10965	128	20	.	.	PUNCT
cusj-10965	129	1	author	author	NOUN
cusj-10965	129	2	information	information	NOUN
cusj-10965	129	3	corresponding	correspond	VERB
cusj-10965	129	4	author	author	NOUN
cusj-10965	129	5	*	*	PUNCT
cusj-10965	129	6	elvis	elvis	PROPN
cusj-10965	129	7	lang	lang	PROPN
cusj-10965	129	8	–	–	PUNCT
cusj-10965	129	9	ecl67@case.edu	ecl67@case.edu	PROPN
cusj-10965	129	10	author	author	NOUN
cusj-10965	129	11	contributions	contribution	NOUN
cusj-10965	129	12	elvis	elvis	PROPN
cusj-10965	129	13	lang	lang	PROPN
cusj-10965	129	14	conceived	conceive	VERB
cusj-10965	129	15	experiments	experiment	NOUN
cusj-10965	129	16	,	,	PUNCT
cusj-10965	129	17	performed	perform	VERB
cusj-10965	129	18	the	the	DET
cusj-10965	129	19	cloning	cloning	NOUN
cusj-10965	129	20	,	,	PUNCT
cusj-10965	129	21	and	and	CCONJ
cusj-10965	129	22	performed	perform	VERB
cusj-10965	129	23	data	datum	NOUN
cusj-10965	129	24	analysis	analysis	NOUN
cusj-10965	129	25	.	.	PUNCT
cusj-10965	130	1	he	he	PRON
cusj-10965	130	2	also	also	ADV
cusj-10965	130	3	wrote	write	VERB
cusj-10965	130	4	the	the	DET
cusj-10965	130	5	manuscript	manuscript	NOUN
cusj-10965	130	6	and	and	CCONJ
cusj-10965	130	7	generated	generate	VERB
cusj-10965	130	8	all	all	DET
cusj-10965	130	9	the	the	DET
cusj-10965	130	10	figures	figure	NOUN
cusj-10965	130	11	used	use	VERB
cusj-10965	130	12	.	.	PUNCT
cusj-10965	131	1	dr	dr	PROPN
cusj-10965	131	2	.	.	PROPN
cusj-10965	131	3	john	john	PROPN
cusj-10965	131	4	tilton	tilton	PROPN
cusj-10965	131	5	provided	provide	VERB
cusj-10965	131	6	direction	direction	NOUN
cusj-10965	131	7	and	and	CCONJ
cusj-10965	131	8	guidance	guidance	NOUN
cusj-10965	131	9	during	during	ADP
cusj-10965	131	10	this	this	DET
cusj-10965	131	11	project	project	NOUN
cusj-10965	131	12	.	.	PUNCT
cusj-10965	132	1	dr	dr	PROPN
cusj-10965	132	2	.	.	PROPN
cusj-10965	132	3	thomas	thomas	PROPN
cusj-10965	132	4	sweet	sweet	PROPN
cusj-10965	132	5	also	also	ADV
cusj-10965	132	6	provided	provide	VERB
cusj-10965	132	7	direction	direction	NOUN
cusj-10965	132	8	and	and	CCONJ
cusj-10965	132	9	including	include	VERB
cusj-10965	132	10	with	with	ADP
cusj-10965	132	11	the	the	DET
cusj-10965	132	12	manuscript	manuscript	NOUN
cusj-10965	132	13	,	,	PUNCT
cusj-10965	132	14	conceiving	conceive	VERB
cusj-10965	132	15	experiments	experiment	NOUN
cusj-10965	132	16	,	,	PUNCT
cusj-10965	132	17	and	and	CCONJ
cusj-10965	132	18	also	also	ADV
cusj-10965	132	19	did	do	VERB
cusj-10965	132	20	some	some	PRON
cusj-10965	132	21	of	of	ADP
cusj-10965	132	22	the	the	DET
cusj-10965	132	23	plasmid	plasmid	ADJ
cusj-10965	132	24	design	design	NOUN
cusj-10965	132	25	,	,	PUNCT
cusj-10965	132	26	cell	cell	NOUN
cusj-10965	132	27	culture	culture	NOUN
cusj-10965	132	28	work	work	NOUN
cusj-10965	132	29	,	,	PUNCT
cusj-10965	132	30	and	and	CCONJ
cusj-10965	132	31	imaging	imaging	NOUN
cusj-10965	132	32	for	for	ADP
cusj-10965	132	33	this	this	DET
cusj-10965	132	34	project	project	NOUN
cusj-10965	132	35	.	.	PUNCT
cusj-10965	133	1	funding	funding	NOUN
cusj-10965	133	2	sources	source	NOUN
cusj-10965	133	3	experiments	experiment	NOUN
cusj-10965	133	4	presented	present	VERB
cusj-10965	133	5	here	here	ADV
cusj-10965	133	6	were	be	AUX
cusj-10965	133	7	supported	support	VERB
cusj-10965	133	8	by	by	ADP
cusj-10965	133	9	nih	nih	PROPN
cusj-10965	133	10	5ug3hl151544	5ug3hl151544	PROPN
cusj-10965	133	11	-	-	PUNCT
cusj-10965	133	12	03	03	NUM
cusj-10965	133	13	.	.	PUNCT
cusj-10965	134	1	abbreviations	abbreviation	NOUN
cusj-10965	134	2	crispr	crispr	NOUN
cusj-10965	134	3	:	:	PUNCT
cusj-10965	134	4	clustered	cluster	VERB
cusj-10965	134	5	regularly	regularly	ADV
cusj-10965	134	6	interspaced	interspace	VERB
cusj-10965	134	7	short	short	ADJ
cusj-10965	134	8	palindromic	palindromic	ADJ
cusj-10965	134	9	repeats	repeat	NOUN
cusj-10965	134	10	cas9	cas9	NOUN
cusj-10965	134	11	:	:	PUNCT
cusj-10965	134	12	crispr	crispr	ADJ
cusj-10965	134	13	associated	associate	VERB
cusj-10965	134	14	protein	protein	NOUN
cusj-10965	134	15	9	9	NUM
cusj-10965	134	16	grna	grna	NOUN
cusj-10965	134	17	:	:	PUNCT
cusj-10965	134	18	guide	guide	VERB
cusj-10965	134	19	rna	rna	PROPN
cusj-10965	134	20	aav	aav	PROPN
cusj-10965	134	21	:	:	PUNCT
cusj-10965	134	22	adeno	adeno	NOUN
cusj-10965	134	23	associated	associated	PROPN
cusj-10965	134	24	virus	virus	NOUN
cusj-10965	134	25	rnp	rnp	PROPN
cusj-10965	134	26	:	:	PUNCT
cusj-10965	134	27	ribonucleoprotein	ribonucleoprotein	PROPN
cusj-10965	134	28	complex	complex	PROPN
cusj-10965	134	29	lnp	lnp	PROPN
cusj-10965	134	30	:	:	PUNCT
cusj-10965	134	31	lipid	lipid	NOUN
cusj-10965	134	32	nanoparticles	nanoparticle	NOUN
cusj-10965	134	33	cpp	cpp	NOUN
cusj-10965	134	34	:	:	PUNCT
cusj-10965	134	35	cell	cell	NOUN
cusj-10965	134	36	penetrating	penetrate	VERB
cusj-10965	134	37	protein	protein	NOUN
cusj-10965	134	38	hek293	hek293	PROPN
cusj-10965	134	39	t	t	PROPN
cusj-10965	134	40	:	:	PUNCT
cusj-10965	134	41	human	human	ADJ
cusj-10965	134	42	embryonic	embryonic	ADJ
cusj-10965	134	43	kidney	kidney	NOUN
cusj-10965	134	44	293	293	NUM
cusj-10965	134	45	t	t	NOUN
cusj-10965	134	46	tlr	tlr	PROPN
cusj-10965	134	47	:	:	PUNCT
cusj-10965	134	48	traffic	traffic	NOUN
cusj-10965	134	49	light	light	PROPN
cusj-10965	134	50	reporter	reporter	NOUN
cusj-10965	134	51	rfp	rfp	PROPN
cusj-10965	134	52	:	:	PUNCT
cusj-10965	134	53	red	red	ADJ
cusj-10965	134	54	fluoresce	fluoresce	NOUN
cusj-10965	134	55	ent	ent	PROPN
cusj-10965	134	56	protein	protein	NOUN
cusj-10965	134	57	gfp	gfp	PROPN
cusj-10965	134	58	:	:	PUNCT
cusj-10965	134	59	green	green	ADJ
cusj-10965	134	60	fluorescent	fluorescent	ADJ
cusj-10965	134	61	protein	protein	NOUN
cusj-10965	134	62	pctg	pctg	NOUN
cusj-10965	134	63	:	:	PUNCT
cusj-10965	134	64	pcmv	pcmv	NOUN
cusj-10965	134	65	-	-	PUNCT
cusj-10965	134	66	triplex	triplex	NOUN
cusj-10965	134	67	-	-	PUNCT
cusj-10965	134	68	grna	grna	NOUN
cusj-10965	134	69	cmv	cmv	NOUN
cusj-10965	134	70	:	:	PUNCT
cusj-10965	134	71	cytomegalovirus	cytomegalovirus	NOUN
cusj-10965	134	72	references	reference	NOUN
cusj-10965	134	73	1	1	NUM
cusj-10965	134	74	.	.	PUNCT
cusj-10965	135	1	deveau	deveau	PROPN
cusj-10965	135	2	,	,	PUNCT
cusj-10965	135	3	h.	h.	PROPN
cusj-10965	135	4	,	,	PUNCT
cusj-10965	135	5	garneau	garneau	PROPN
cusj-10965	135	6	,	,	PUNCT
cusj-10965	135	7	j.	j.	PROPN
cusj-10965	135	8	e.	e.	PROPN
cusj-10965	135	9	&	&	CCONJ
cusj-10965	135	10	moineau	moineau	PROPN
cusj-10965	135	11	,	,	PUNCT
cusj-10965	135	12	s.	s.	PROPN
cusj-10965	135	13	crispr	crispr	PROPN
cusj-10965	135	14	/	/	SYM
cusj-10965	135	15	cas	cas	NOUN
cusj-10965	135	16	system	system	NOUN
cusj-10965	135	17	and	and	CCONJ
cusj-10965	135	18	its	its	PRON
cusj-10965	135	19	role	role	NOUN
cusj-10965	135	20	in	in	ADP
cusj-10965	135	21	phage	phage	NOUN
cusj-10965	135	22	-	-	PUNCT
cusj-10965	135	23	bacteria	bacteria	NOUN
cusj-10965	135	24	interactions	interaction	NOUN
cusj-10965	135	25	.	.	PUNCT
cusj-10965	136	1	annu	annu	PROPN
cusj-10965	136	2	rev	rev	VERB
cusj-10965	136	3	microbiol	microbiol	PROPN
cusj-10965	136	4	64	64	NUM
cusj-10965	136	5	,	,	PUNCT
cusj-10965	136	6	475–493	475–493	NUM
cusj-10965	136	7	(	(	PUNCT
cusj-10965	136	8	2010	2010	NUM
cusj-10965	136	9	)	)	PUNCT
cusj-10965	136	10	.	.	PUNCT
cusj-10965	137	1	https://doi.org/10.1146/annurev.micro.112408.134123	https://doi.org/10.1146/annurev.micro.112408.134123	NOUN
cusj-10965	137	2	2	2	NUM
cusj-10965	137	3	.	.	NUM
cusj-10965	137	4	ran	run	VERB
cusj-10965	137	5	,	,	PUNCT
cusj-10965	137	6	f.	f.	PROPN
cusj-10965	137	7	,	,	PUNCT
cusj-10965	137	8	hsu	hsu	PROPN
cusj-10965	137	9	,	,	PUNCT
cusj-10965	137	10	p.	p.	PROPN
cusj-10965	137	11	,	,	PUNCT
cusj-10965	137	12	wright	wright	PROPN
cusj-10965	137	13	,	,	PUNCT
cusj-10965	137	14	j.	j.	PROPN
cusj-10965	137	15	et	et	PROPN
cusj-10965	137	16	al	al	PROPN
cusj-10965	137	17	.	.	PROPN
cusj-10965	137	18	genome	genome	NOUN
cusj-10965	137	19	engineering	engineering	NOUN
cusj-10965	137	20	using	use	VERB
cusj-10965	137	21	the	the	DET
cusj-10965	137	22	crisprcas9	crisprcas9	NOUN
cusj-10965	137	23	system	system	NOUN
cusj-10965	137	24	.	.	PUNCT
cusj-10965	138	1	nat	nat	PROPN
cusj-10965	138	2	protoc	protoc	VERB
cusj-10965	138	3	8	8	NUM
cusj-10965	138	4	,	,	PUNCT
cusj-10965	138	5	2281	2281	NUM
cusj-10965	138	6	–	–	PUNCT
cusj-10965	138	7	2308	2308	NUM
cusj-10965	138	8	(	(	PUNCT
cusj-10965	138	9	2013	2013	NUM
cusj-10965	138	10	https://doi.org/10.1038/nprot.2013.143	https://doi.org/10.1038/nprot.2013.143	PROPN
cusj-10965	138	11	3	3	NUM
cusj-10965	138	12	.	.	PUNCT
cusj-10965	138	13	komor	komor	PROPN
cusj-10965	138	14	,	,	PUNCT
cusj-10965	138	15	a.	a.	PROPN
cusj-10965	138	16	c.	c.	PROPN
cusj-10965	138	17	,	,	PUNCT
cusj-10965	138	18	kim	kim	PROPN
cusj-10965	138	19	,	,	PUNCT
cusj-10965	138	20	y.	y.	PROPN
cusj-10965	138	21	b.	b.	PROPN
cusj-10965	138	22	,	,	PUNCT
cusj-10965	138	23	packer	packer	PROPN
cusj-10965	138	24	,	,	PUNCT
cusj-10965	138	25	m.	m.	NOUN
cusj-10965	138	26	s.	s.	PROPN
cusj-10965	138	27	,	,	PUNCT
cusj-10965	138	28	zuris	zuris	PROPN
cusj-10965	138	29	,	,	PUNCT
cusj-10965	138	30	j.	j.	PROPN
cusj-10965	138	31	a.	a.	PROPN
cusj-10965	138	32	&	&	CCONJ
cusj-10965	138	33	liu	liu	PROPN
cusj-10965	138	34	,	,	PUNCT
cusj-10965	138	35	d.	d.	PROPN
cusj-10965	138	36	r.	r.	PROPN
cusj-10965	138	37	programmable	programmable	PROPN
cusj-10965	138	38	editing	editing	NOUN
cusj-10965	138	39	of	of	ADP
cusj-10965	138	40	a	a	DET
cusj-10965	138	41	target	target	NOUN
cusj-10965	138	42	base	base	NOUN
cusj-10965	138	43	in	in	ADP
cusj-10965	138	44	genomic	genomic	ADJ
cusj-10965	138	45	dna	dna	PROPN
cusj-10965	138	46	without	without	ADP
cusj-10965	138	47	double	double	ADJ
cusj-10965	138	48	-	-	PUNCT
cusj-10965	138	49	stranded	strand	VERB
cusj-10965	138	50	dna	dna	PROPN
cusj-10965	138	51	cleavage	cleavage	NOUN
cusj-10965	138	52	.	.	PUNCT
cusj-10965	139	1	nature	nature	NOUN
cusj-10965	139	2	533	533	NUM
cusj-10965	139	3	,	,	PUNCT
cusj-10965	139	4	420–424	420–424	NUM
cusj-10965	139	5	(	(	PUNCT
cusj-10965	139	6	2016	2016	NUM
cusj-10965	139	7	)	)	PUNCT
cusj-10965	139	8	https://doi.org/10.1038/nature17946	https://doi.org/10.1038/nature17946	PROPN
cusj-10965	139	9	4	4	NUM
cusj-10965	139	10	.	.	PUNCT
cusj-10965	140	1	kantor	kantor	PROPN
cusj-10965	140	2	,	,	PUNCT
cusj-10965	140	3	a.	a.	PROPN
cusj-10965	140	4	,	,	PUNCT
cusj-10965	140	5	mcclements	mcclement	NOUN
cusj-10965	140	6	,	,	PUNCT
cusj-10965	140	7	m.	m.	NOUN
cusj-10965	140	8	&	&	CCONJ
cusj-10965	140	9	maclaren	maclaren	PROPN
cusj-10965	140	10	,	,	PUNCT
cusj-10965	140	11	r.	r.	PROPN
cusj-10965	140	12	crispr	crispr	PROPN
cusj-10965	140	13	-	-	PUNCT
cusj-10965	140	14	cas9	cas9	NOUN
cusj-10965	140	15	dna	dna	NOUN
cusj-10965	140	16	base	base	NOUN
cusj-10965	140	17	-	-	PUNCT
cusj-10965	140	18	editing	editing	NOUN
cusj-10965	140	19	and	and	CCONJ
cusj-10965	140	20	prime	prime	NOUN
cusj-10965	140	21	-	-	PUNCT
cusj-10965	140	22	editing	editing	NOUN
cusj-10965	140	23	.	.	PUNCT
cusj-10965	141	1	int	int	PROPN
cusj-10965	141	2	j	j	PROPN
cusj-10965	141	3	mol	mol	ADP
cusj-10965	141	4	sci	sci	PROPN
cusj-10965	141	5	21	21	NUM
cusj-10965	141	6	,	,	PUNCT
cusj-10965	141	7	6240	6240	NUM
cusj-10965	141	8	(	(	PUNCT
cusj-10965	141	9	2020	2020	NUM
cusj-10965	141	10	)	)	PUNCT
cusj-10965	141	11	.	.	PUNCT
cusj-10965	142	1	https://doi.org/10.3390/ijms21176240	https://doi.org/10.3390/ijms21176240	PROPN
cusj-10965	142	2	5	5	NUM
cusj-10965	142	3	.	.	PUNCT
cusj-10965	143	1	karijolich	karijolich	PROPN
cusj-10965	143	2	,	,	PUNCT
cusj-10965	143	3	j.	j.	PROPN
cusj-10965	143	4	&	&	CCONJ
cusj-10965	143	5	yu	yu	PROPN
cusj-10965	143	6	,	,	PUNCT
cusj-10965	143	7	y.-t	y.-t	NOUN
cusj-10965	143	8	.	.	PUNCT
cusj-10965	144	1	therapeutic	therapeutic	ADJ
cusj-10965	144	2	suppression	suppression	NOUN
cusj-10965	144	3	of	of	ADP
cusj-10965	144	4	premature	premature	ADJ
cusj-10965	144	5	termination	termination	NOUN
cusj-10965	144	6	codons	codon	NOUN
cusj-10965	144	7	:	:	PUNCT
cusj-10965	144	8	mechanisms	mechanism	NOUN
cusj-10965	144	9	and	and	CCONJ
cusj-10965	144	10	clinical	clinical	ADJ
cusj-10965	144	11	considerations	consideration	NOUN
cusj-10965	144	12	(	(	PUNCT
cusj-10965	144	13	review	review	NOUN
cusj-10965	144	14	)	)	PUNCT
cusj-10965	144	15	.	.	PUNCT
cusj-10965	145	1	int	int	PROPN
cusj-10965	145	2	j	j	PROPN
cusj-10965	145	3	mol	mol	ADP
cusj-10965	145	4	med	med	PROPN
cusj-10965	145	5	34	34	NUM
cusj-10965	145	6	,	,	PUNCT
cusj-10965	145	7	355–362	355–362	NUM
cusj-10965	145	8	(	(	PUNCT
cusj-10965	145	9	2014	2014	NUM
cusj-10965	145	10	)	)	PUNCT
cusj-10965	145	11	.	.	PUNCT
cusj-10965	146	1	https://doi.org/10.3892/ijmm.2014.180	https://doi.org/10.3892/ijmm.2014.180	NOUN
cusj-10965	146	2	9	9	NUM
cusj-10965	146	3	6	6	NUM
cusj-10965	146	4	.	.	PUNCT
cusj-10965	147	1	zannas	zanna	NOUN
cusj-10965	147	2	,	,	PUNCT
cusj-10965	147	3	a.	a.	PROPN
cusj-10965	147	4	s.	s.	PROPN
cusj-10965	147	5	&	&	CCONJ
cusj-10965	147	6	west	west	PROPN
cusj-10965	147	7	,	,	PUNCT
cusj-10965	147	8	a.	a.	PROPN
cusj-10965	147	9	e.	e.	PROPN
cusj-10965	147	10	epigenetics	epigenetics	PROPN
cusj-10965	147	11	and	and	CCONJ
cusj-10965	147	12	the	the	DET
cusj-10965	147	13	regulation	regulation	NOUN
cusj-10965	147	14	of	of	ADP
cusj-10965	147	15	stress	stress	NOUN
cusj-10965	147	16	vulnerability	vulnerability	NOUN
cusj-10965	147	17	and	and	CCONJ
cusj-10965	147	18	resilience	resilience	NOUN
cusj-10965	147	19	.	.	PUNCT
cusj-10965	148	1	neuroscience	neuroscience	NOUN
cusj-10965	148	2	264	264	NUM
cusj-10965	148	3	,	,	PUNCT
cusj-10965	148	4	157–170	157–170	NUM
cusj-10965	148	5	(	(	PUNCT
cusj-10965	148	6	2014	2014	NUM
cusj-10965	148	7	)	)	PUNCT
cusj-10965	148	8	.	.	PUNCT
cusj-10965	149	1	https://doi.org/10.1146/annurev.micro.112408.134123	https://doi.org/10.1146/annurev.micro.112408.134123	PROPN
cusj-10965	149	2	https://doi.org/10.1146/annurev.micro.112408.134123	https://doi.org/10.1146/annurev.micro.112408.134123	PROPN
cusj-10965	149	3	https://doi.org/10.1038/nprot.2013.143	https://doi.org/10.1038/nprot.2013.143	PROPN
cusj-10965	149	4	https://doi.org/10.1038/nature17946	https://doi.org/10.1038/nature17946	PROPN
cusj-10965	149	5	https://doi.org/10.3390/ijms21176240	https://doi.org/10.3390/ijms21176240	PROPN
cusj-10965	149	6	https://doi.org/10.3892/ijmm.2014.1809	https://doi.org/10.3892/ijmm.2014.1809	PROPN
cusj-10965	149	7	https://doi.org/10.3892/ijmm.2014.1809	https://doi.org/10.3892/ijmm.2014.1809	PROPN
cusj-10965	149	8	columbia	columbia	PROPN
cusj-10965	149	9	undergraduate	undergraduate	PROPN
cusj-10965	149	10	science	science	PROPN
cusj-10965	149	11	journal	journal	PROPN
cusj-10965	149	12	vol	vol	NOUN
cusj-10965	149	13	.	.	PROPN
cusj-10965	149	14	17	17	NUM
cusj-10965	149	15	,	,	PUNCT
cusj-10965	149	16	2023	2023	NUM
cusj-10965	149	17	lang	lang	PROPN
cusj-10965	149	18	et	et	PROPN
cusj-10965	149	19	.	.	PUNCT
cusj-10965	150	1	al	al	PROPN
cusj-10965	150	2	.	.	PROPN
cusj-10965	150	3	15	15	NUM
cusj-10965	151	1	https://doi.org/10.1016/j.neuroscience.2013.12.003	https://doi.org/10.1016/j.neuroscience.2013.12.003	CCONJ
cusj-10965	151	2	7	7	NUM
cusj-10965	151	3	.	.	PUNCT
cusj-10965	151	4	karimian	karimian	NOUN
cusj-10965	151	5	,	,	PUNCT
cusj-10965	151	6	a.	a.	PROPN
cusj-10965	151	7	et	et	PROPN
cusj-10965	151	8	al	al	PROPN
cusj-10965	151	9	.	.	PROPN
cusj-10965	151	10	crispr	crispr	PROPN
cusj-10965	151	11	/	/	SYM
cusj-10965	151	12	cas9	cas9	NOUN
cusj-10965	151	13	novel	novel	NOUN
cusj-10965	151	14	therapeutic	therapeutic	ADJ
cusj-10965	151	15	road	road	NOUN
cusj-10965	151	16	for	for	ADP
cusj-10965	151	17	the	the	DET
cusj-10965	151	18	treatment	treatment	NOUN
cusj-10965	151	19	of	of	ADP
cusj-10965	151	20	neurodegenerative	neurodegenerative	ADJ
cusj-10965	151	21	diseases	disease	NOUN
cusj-10965	151	22	.	.	PUNCT
cusj-10965	152	1	life	life	NOUN
cusj-10965	152	2	sci	sci	PROPN
cusj-10965	152	3	259	259	NUM
cusj-10965	152	4	,	,	PUNCT
cusj-10965	152	5	118165	118165	NUM
cusj-10965	152	6	(	(	PUNCT
cusj-10965	152	7	2020	2020	NUM
cusj-10965	152	8	)	)	PUNCT
cusj-10965	152	9	.	.	PUNCT
cusj-10965	153	1	https://doi.org/10.1016/j.lfs.2020.11816	https://doi.org/10.1016/j.lfs.2020.11816	PROPN
cusj-10965	153	2	5	5	NUM
cusj-10965	153	3	8	8	NUM
cusj-10965	153	4	.	.	PUNCT
cusj-10965	154	1	yang	yang	PROPN
cusj-10965	154	2	,	,	PUNCT
cusj-10965	154	3	s.	s.	PROPN
cusj-10965	154	4	et	et	PROPN
cusj-10965	154	5	al	al	PROPN
cusj-10965	154	6	.	.	PROPN
cusj-10965	154	7	crispr	crispr	PROPN
cusj-10965	154	8	/	/	SYM
cusj-10965	154	9	cas9mediated	cas9mediate	VERB
cusj-10965	154	10	gene	gene	NOUN
cusj-10965	154	11	editing	editing	NOUN
cusj-10965	154	12	ameliorates	ameliorate	VERB
cusj-10965	154	13	neurotoxicity	neurotoxicity	NOUN
cusj-10965	154	14	in	in	ADP
cusj-10965	154	15	mouse	mouse	NOUN
cusj-10965	154	16	model	model	NOUN
cusj-10965	154	17	of	of	ADP
cusj-10965	154	18	huntington	huntington	PROPN
cusj-10965	154	19	’s	’s	PART
cusj-10965	154	20	disease	disease	NOUN
cusj-10965	154	21	.	.	PUNCT
cusj-10965	155	1	journal	journal	PROPN
cusj-10965	155	2	of	of	ADP
cusj-10965	155	3	clinical	clinical	ADJ
cusj-10965	155	4	investigation	investigation	NOUN
cusj-10965	155	5	127	127	NUM
cusj-10965	155	6	,	,	PUNCT
cusj-10965	155	7	2719–2724	2719–2724	NUM
cusj-10965	155	8	(	(	PUNCT
cusj-10965	155	9	2017	2017	NUM
cusj-10965	155	10	)	)	PUNCT
cusj-10965	155	11	.	.	PUNCT
cusj-10965	156	1	https://doi.org/10.1172/jci92087	https://doi.org/10.1172/jci92087	NOUN
cusj-10965	156	2	9	9	NUM
cusj-10965	156	3	.	.	PUNCT
cusj-10965	156	4	da	da	PROPN
cusj-10965	156	5	silva	silva	PROPN
cusj-10965	156	6	sanchez	sanchez	PROPN
cusj-10965	156	7	,	,	PUNCT
cusj-10965	156	8	a.	a.	NOUN
cusj-10965	156	9	,	,	PUNCT
cusj-10965	156	10	paunovska	paunovska	PROPN
cusj-10965	156	11	,	,	PUNCT
cusj-10965	156	12	k.	k.	PROPN
cusj-10965	156	13	,	,	PUNCT
cusj-10965	156	14	cristian	cristian	PROPN
cusj-10965	156	15	,	,	PUNCT
cusj-10965	156	16	a.	a.	PROPN
cusj-10965	156	17	&	&	CCONJ
cusj-10965	156	18	dahlman	dahlman	PROPN
cusj-10965	156	19	,	,	PUNCT
cusj-10965	156	20	j.	j.	PROPN
cusj-10965	156	21	e.	e.	PROPN
cusj-10965	156	22	treating	treat	VERB
cusj-10965	156	23	cystic	cystic	ADJ
cusj-10965	156	24	fibrosis	fibrosis	NOUN
cusj-10965	156	25	with	with	ADP
cusj-10965	156	26	mrna	mrna	PROPN
cusj-10965	156	27	and	and	CCONJ
cusj-10965	156	28	crispr	crispr	ADJ
cusj-10965	156	29	.	.	PUNCT
cusj-10965	157	1	hum	hum	PROPN
cusj-10965	157	2	gene	gene	NOUN
cusj-10965	157	3	ther	ther	ADV
cusj-10965	157	4	31	31	NUM
cusj-10965	157	5	,	,	PUNCT
cusj-10965	157	6	940	940	NUM
cusj-10965	157	7	–	–	PUNCT
cusj-10965	157	8	955	955	NUM
cusj-10965	157	9	(	(	PUNCT
cusj-10965	157	10	2020	2020	NUM
cusj-10965	157	11	)	)	PUNCT
cusj-10965	157	12	.	.	PUNCT
cusj-10965	158	1	https://doi.org/10.1089/hum.2020.137	https://doi.org/10.1089/hum.2020.137	PROPN
cusj-10965	158	2	10	10	NUM
cusj-10965	158	3	.	.	PUNCT
cusj-10965	159	1	li	li	PROPN
cusj-10965	159	2	,	,	PUNCT
cusj-10965	159	3	l.	l.	PROPN
cusj-10965	159	4	,	,	PUNCT
cusj-10965	159	5	hu	hu	PROPN
cusj-10965	159	6	,	,	PUNCT
cusj-10965	159	7	s.	s.	PROPN
cusj-10965	159	8	&	&	CCONJ
cusj-10965	159	9	chen	chen	PROPN
cusj-10965	159	10	,	,	PUNCT
cusj-10965	159	11	x.	x.	PROPN
cusj-10965	159	12	non	non	ADJ
cusj-10965	159	13	-	-	ADJ
cusj-10965	159	14	viral	viral	ADJ
cusj-10965	159	15	delivery	delivery	NOUN
cusj-10965	159	16	systems	system	NOUN
cusj-10965	159	17	for	for	ADP
cusj-10965	159	18	crispr	crispr	NOUN
cusj-10965	159	19	/	/	SYM
cusj-10965	159	20	cas9based	cas9base	VERB
cusj-10965	159	21	genome	genome	NOUN
cusj-10965	159	22	editing	editing	NOUN
cusj-10965	159	23	:	:	PUNCT
cusj-10965	159	24	challenges	challenge	NOUN
cusj-10965	159	25	and	and	CCONJ
cusj-10965	159	26	opportunities	opportunity	NOUN
cusj-10965	159	27	.	.	PUNCT
cusj-10965	160	1	biomaterials	biomaterial	NOUN
cusj-10965	160	2	171	171	NUM
cusj-10965	160	3	,	,	PUNCT
cusj-10965	160	4	207–218	207–218	NUM
cusj-10965	160	5	(	(	PUNCT
cusj-10965	160	6	2018	2018	NUM
cusj-10965	160	7	)	)	PUNCT
cusj-10965	160	8	.	.	PUNCT
cusj-10965	161	1	https://doi.org/10.1016/j.biomaterials.2018.04.031	https://doi.org/10.1016/j.biomaterials.2018.04.031	NOUN
cusj-10965	161	2	11	11	NUM
cusj-10965	161	3	.	.	PUNCT
cusj-10965	162	1	ramakrishna	ramakrishna	PROPN
cusj-10965	162	2	,	,	PUNCT
cusj-10965	162	3	s.	s.	PROPN
cusj-10965	162	4	et	et	PROPN
cusj-10965	162	5	al	al	PROPN
cusj-10965	162	6	.	.	PROPN
cusj-10965	163	1	gene	gene	NOUN
cusj-10965	163	2	disruption	disruption	NOUN
cusj-10965	163	3	by	by	ADP
cusj-10965	163	4	cell	cell	NOUN
cusj-10965	163	5	-	-	PUNCT
cusj-10965	163	6	penetrating	penetrate	VERB
cusj-10965	163	7	peptide	peptide	NOUN
cusj-10965	163	8	-	-	PUNCT
cusj-10965	163	9	mediated	mediate	VERB
cusj-10965	163	10	delivery	delivery	NOUN
cusj-10965	163	11	of	of	ADP
cusj-10965	163	12	cas9	cas9	NOUN
cusj-10965	163	13	protein	protein	NOUN
cusj-10965	163	14	and	and	CCONJ
cusj-10965	163	15	guide	guide	VERB
cusj-10965	163	16	rna	rna	PROPN
cusj-10965	163	17	.	.	PUNCT
cusj-10965	164	1	genome	genome	NOUN
cusj-10965	164	2	res	re	NOUN
cusj-10965	164	3	24	24	NUM
cusj-10965	164	4	,	,	PUNCT
cusj-10965	164	5	1020–1027	1020–1027	NUM
cusj-10965	164	6	(	(	PUNCT
cusj-10965	164	7	2014	2014	NUM
cusj-10965	164	8	)	)	PUNCT
cusj-10965	164	9	.	.	PUNCT
cusj-10965	165	1	https://doi.org/10.1101/gr.171264.113	https://doi.org/10.1101/gr.171264.113	ADJ
cusj-10965	165	2	12	12	NUM
cusj-10965	165	3	.	.	PUNCT
cusj-10965	165	4	escors	escor	NOUN
cusj-10965	165	5	,	,	PUNCT
cusj-10965	165	6	d.	d.	PROPN
cusj-10965	165	7	&	&	CCONJ
cusj-10965	165	8	breckpot	breckpot	PROPN
cusj-10965	165	9	,	,	PUNCT
cusj-10965	165	10	k.	k.	PROPN
cusj-10965	165	11	lentiviral	lentiviral	ADJ
cusj-10965	165	12	vectors	vector	NOUN
cusj-10965	165	13	in	in	ADP
cusj-10965	165	14	gene	gene	NOUN
cusj-10965	165	15	therapy	therapy	NOUN
cusj-10965	165	16	:	:	PUNCT
cusj-10965	165	17	their	their	PRON
cusj-10965	165	18	current	current	ADJ
cusj-10965	165	19	status	status	NOUN
cusj-10965	165	20	and	and	CCONJ
cusj-10965	165	21	future	future	ADJ
cusj-10965	165	22	potential	potential	NOUN
cusj-10965	165	23	.	.	PUNCT
cusj-10965	166	1	arch	arch	ADJ
cusj-10965	166	2	immunol	immunol	NOUN
cusj-10965	166	3	ther	ther	PROPN
cusj-10965	166	4	exp	exp	PROPN
cusj-10965	166	5	(	(	PUNCT
cusj-10965	166	6	warsz	warsz	PROPN
cusj-10965	166	7	)	)	PUNCT
cusj-10965	166	8	58	58	NUM
cusj-10965	166	9	,	,	PUNCT
cusj-10965	166	10	107	107	NUM
cusj-10965	166	11	–	–	PUNCT
cusj-10965	166	12	119	119	NUM
cusj-10965	166	13	(	(	PUNCT
cusj-10965	166	14	2010	2010	NUM
cusj-10965	166	15	)	)	PUNCT
cusj-10965	166	16	.	.	PUNCT
cusj-10965	167	1	https://doi.org/10.1007/s00005-0100063-4	https://doi.org/10.1007/s00005-0100063-4	PROPN
cusj-10965	167	2	13	13	NUM
cusj-10965	167	3	.	.	PUNCT
cusj-10965	168	1	coura	coura	PROPN
cusj-10965	168	2	,	,	PUNCT
cusj-10965	168	3	r.	r.	PROPN
cusj-10965	168	4	dos	dos	PROPN
cusj-10965	168	5	s.	s.	PROPN
cusj-10965	168	6	&	&	CCONJ
cusj-10965	168	7	nardi	nardi	PROPN
cusj-10965	168	8	,	,	PUNCT
cusj-10965	168	9	n.	n.	PROPN
cusj-10965	168	10	b.	b.	PROPN
cusj-10965	169	1	a	a	DET
cusj-10965	169	2	role	role	NOUN
cusj-10965	169	3	for	for	ADP
cusj-10965	169	4	adeno	adeno	NOUN
cusj-10965	169	5	-	-	PUNCT
cusj-10965	169	6	associated	associate	VERB
cusj-10965	169	7	viral	viral	ADJ
cusj-10965	169	8	vectors	vector	NOUN
cusj-10965	169	9	in	in	ADP
cusj-10965	169	10	gene	gene	NOUN
cusj-10965	169	11	therapy	therapy	NOUN
cusj-10965	169	12	.	.	PUNCT
cusj-10965	170	1	genet	genet	PROPN
cusj-10965	170	2	mol	mol	ADP
cusj-10965	170	3	biol	biol	PROPN
cusj-10965	170	4	31	31	NUM
cusj-10965	170	5	,	,	PUNCT
cusj-10965	170	6	1–11	1–11	PROPN
cusj-10965	170	7	(	(	PUNCT
cusj-10965	170	8	2008	2008	NUM
cusj-10965	170	9	)	)	PUNCT
cusj-10965	170	10	.	.	PUNCT
cusj-10965	171	1	https://doi.org/10.1590/s141547572008000100001	https://doi.org/10.1590/s141547572008000100001	VERB
cusj-10965	171	2	14	14	NUM
cusj-10965	171	3	.	.	PUNCT
cusj-10965	172	1	ciuffi	ciuffi	ADV
cusj-10965	172	2	,	,	PUNCT
cusj-10965	172	3	a.	a.	NOUN
cusj-10965	172	4	mechanisms	mechanism	NOUN
cusj-10965	172	5	governing	govern	VERB
cusj-10965	172	6	lentivirus	lentivirus	NOUN
cusj-10965	172	7	integration	integration	NOUN
cusj-10965	172	8	site	site	NOUN
cusj-10965	172	9	selection	selection	NOUN
cusj-10965	172	10	.	.	PUNCT
cusj-10965	173	1	curr	curr	PROPN
cusj-10965	173	2	gene	gene	PROPN
cusj-10965	173	3	ther	ther	ADV
cusj-10965	173	4	8	8	NUM
cusj-10965	173	5	,	,	PUNCT
cusj-10965	173	6	419–429	419–429	NUM
cusj-10965	173	7	(	(	PUNCT
cusj-10965	173	8	2008	2008	NUM
cusj-10965	173	9	)	)	PUNCT
cusj-10965	173	10	.	.	PUNCT
cusj-10965	174	1	https://dx.doi.org/10.2174/1566523087	https://dx.doi.org/10.2174/1566523087	PROPN
cusj-10965	174	2	86848021	86848021	NUM
cusj-10965	174	3	15	15	NUM
cusj-10965	174	4	.	.	PUNCT
cusj-10965	175	1	steward	steward	PROPN
cusj-10965	175	2	,	,	PUNCT
cusj-10965	175	3	s.	s.	PROPN
cusj-10965	175	4	a.	a.	PROPN
cusj-10965	175	5	et	et	PROPN
cusj-10965	175	6	al	al	PROPN
cusj-10965	175	7	.	.	PUNCT
cusj-10965	175	8	lentivirus	lentivirus	PROPN
cusj-10965	175	9	-	-	PUNCT
cusj-10965	175	10	delivered	deliver	VERB
cusj-10965	175	11	stable	stable	ADJ
cusj-10965	175	12	gene	gene	NOUN
cusj-10965	175	13	silencing	silence	VERB
cusj-10965	175	14	by	by	ADP
cusj-10965	175	15	rnai	rnai	PROPN
cusj-10965	175	16	in	in	ADP
cusj-10965	175	17	primary	primary	ADJ
cusj-10965	175	18	cells	cell	NOUN
cusj-10965	175	19	.	.	PUNCT
cusj-10965	176	1	rna	rna	NOUN
cusj-10965	176	2	9	9	NUM
cusj-10965	176	3	,	,	PUNCT
cusj-10965	176	4	493–501	493–501	NUM
cusj-10965	176	5	(	(	PUNCT
cusj-10965	176	6	2003	2003	NUM
cusj-10965	176	7	)	)	PUNCT
cusj-10965	176	8	.	.	PUNCT
cusj-10965	177	1	https://doi.org/10.1261/rna.2192803	https://doi.org/10.1261/rna.2192803	PROPN
cusj-10965	177	2	16	16	NUM
cusj-10965	177	3	.	.	PUNCT
cusj-10965	178	1	sanjana	sanjana	PROPN
cusj-10965	178	2	,	,	PUNCT
cusj-10965	178	3	n.	n.	PROPN
cusj-10965	178	4	e.	e.	PROPN
cusj-10965	178	5	,	,	PUNCT
cusj-10965	178	6	shalem	shalem	PROPN
cusj-10965	178	7	,	,	PUNCT
cusj-10965	178	8	o.	o.	PROPN
cusj-10965	178	9	&	&	CCONJ
cusj-10965	178	10	zhang	zhang	PROPN
cusj-10965	178	11	,	,	PUNCT
cusj-10965	178	12	f.	f.	PROPN
cusj-10965	178	13	improved	improve	VERB
cusj-10965	178	14	vectors	vector	NOUN
cusj-10965	178	15	and	and	CCONJ
cusj-10965	178	16	genome	genome	NOUN
cusj-10965	178	17	-	-	PUNCT
cusj-10965	178	18	wide	wide	ADJ
cusj-10965	178	19	libraries	library	NOUN
cusj-10965	178	20	for	for	ADP
cusj-10965	178	21	crispr	crispr	ADJ
cusj-10965	178	22	screening	screening	NOUN
cusj-10965	178	23	.	.	PUNCT
cusj-10965	179	1	nat	nat	NOUN
cusj-10965	179	2	methods	method	NOUN
cusj-10965	179	3	11	11	NUM
cusj-10965	179	4	,	,	PUNCT
cusj-10965	179	5	783–784	783–784	NUM
cusj-10965	179	6	(	(	PUNCT
cusj-10965	179	7	2014	2014	NUM
cusj-10965	179	8	)	)	PUNCT
cusj-10965	179	9	.	.	PUNCT
cusj-10965	180	1	https://doi.org/10.1038/nmeth.3047	https://doi.org/10.1038/nmeth.3047	NUM
cusj-10965	180	2	17	17	NUM
cusj-10965	180	3	.	.	PUNCT
cusj-10965	181	1	chu	chu	PROPN
cusj-10965	181	2	,	,	PUNCT
cusj-10965	181	3	v.	v.	ADP
cusj-10965	181	4	t.	t.	PROPN
cusj-10965	181	5	et	et	PROPN
cusj-10965	181	6	al	al	PROPN
cusj-10965	181	7	.	.	PUNCT
cusj-10965	181	8	increasing	increase	VERB
cusj-10965	181	9	the	the	DET
cusj-10965	181	10	efficiency	efficiency	NOUN
cusj-10965	181	11	of	of	ADP
cusj-10965	181	12	homology	homology	NOUN
cusj-10965	181	13	-	-	PUNCT
cusj-10965	181	14	directed	direct	VERB
cusj-10965	181	15	repair	repair	NOUN
cusj-10965	181	16	for	for	ADP
cusj-10965	181	17	crispr	crispr	NOUN
cusj-10965	181	18	-	-	PUNCT
cusj-10965	181	19	cas9	cas9	NOUN
cusj-10965	181	20	-	-	PUNCT
cusj-10965	181	21	induced	induce	VERB
cusj-10965	181	22	precise	precise	ADJ
cusj-10965	181	23	gene	gene	NOUN
cusj-10965	181	24	editing	editing	NOUN
cusj-10965	181	25	in	in	ADP
cusj-10965	181	26	mammalian	mammalian	ADJ
cusj-10965	181	27	cells	cell	NOUN
cusj-10965	181	28	.	.	PUNCT
cusj-10965	182	1	nat	nat	PROPN
cusj-10965	182	2	biotechnol	biotechnol	PROPN
cusj-10965	182	3	33	33	NUM
cusj-10965	182	4	,	,	PUNCT
cusj-10965	182	5	543–548	543–548	NUM
cusj-10965	182	6	(	(	PUNCT
cusj-10965	182	7	2015	2015	NUM
cusj-10965	182	8	)	)	PUNCT
cusj-10965	182	9	.	.	PUNCT
cusj-10965	183	1	https://doi.org/10.1038/nbt.3198	https://doi.org/10.1038/nbt.3198	PROPN
cusj-10965	183	2	18	18	NUM
cusj-10965	183	3	.	.	PUNCT
cusj-10965	184	1	hermann	hermann	PROPN
cusj-10965	184	2	,	,	PUNCT
cusj-10965	184	3	m.	m.	PROPN
cusj-10965	184	4	et	et	PROPN
cusj-10965	184	5	al	al	PROPN
cusj-10965	184	6	.	.	PROPN
cusj-10965	184	7	binary	binary	PROPN
cusj-10965	184	8	recombinase	recombinase	NOUN
cusj-10965	184	9	systems	system	NOUN
cusj-10965	184	10	for	for	ADP
cusj-10965	184	11	high	high	ADJ
cusj-10965	184	12	-	-	PUNCT
cusj-10965	184	13	resolution	resolution	NOUN
cusj-10965	184	14	conditional	conditional	ADJ
cusj-10965	184	15	mutagenesis	mutagenesis	NOUN
cusj-10965	184	16	.	.	PUNCT
cusj-10965	185	1	nucleic	nucleic	ADJ
cusj-10965	185	2	acids	acid	NOUN
cusj-10965	185	3	res	re	NOUN
cusj-10965	185	4	42	42	NUM
cusj-10965	185	5	,	,	PUNCT
cusj-10965	185	6	3894–3907	3894–3907	NUM
cusj-10965	185	7	(	(	PUNCT
cusj-10965	185	8	2014	2014	NUM
cusj-10965	185	9	)	)	PUNCT
cusj-10965	185	10	.	.	PUNCT
cusj-10965	186	1	https://doi.org/10.1093/nar/gkt1361	https://doi.org/10.1093/nar/gkt1361	VERB
cusj-10965	186	2	19	19	NUM
cusj-10965	186	3	.	.	PUNCT
cusj-10965	187	1	campa	campa	PROPN
cusj-10965	187	2	,	,	PUNCT
cusj-10965	187	3	c.	c.	PROPN
cusj-10965	187	4	c.	c.	PROPN
cusj-10965	187	5	,	,	PUNCT
cusj-10965	187	6	weisbach	weisbach	NOUN
cusj-10965	187	7	,	,	PUNCT
cusj-10965	187	8	n.	n.	PROPN
cusj-10965	187	9	r.	r.	PROPN
cusj-10965	187	10	,	,	PUNCT
cusj-10965	187	11	santinha	santinha	NOUN
cusj-10965	187	12	,	,	PUNCT
cusj-10965	187	13	a.	a.	PROPN
cusj-10965	187	14	j.	j.	PROPN
cusj-10965	187	15	,	,	PUNCT
cusj-10965	187	16	incarnato	incarnato	PROPN
cusj-10965	187	17	,	,	PUNCT
cusj-10965	187	18	d.	d.	PROPN
cusj-10965	187	19	&	&	CCONJ
cusj-10965	187	20	platt	platt	PROPN
cusj-10965	187	21	,	,	PUNCT
cusj-10965	187	22	r.	r.	PROPN
cusj-10965	187	23	j.	j.	PROPN
cusj-10965	187	24	multiplexed	multiplexed	PROPN
cusj-10965	187	25	genome	genome	NOUN
cusj-10965	187	26	engineering	engineering	NOUN
cusj-10965	187	27	by	by	ADP
cusj-10965	187	28	cas12a	cas12a	NOUN
cusj-10965	187	29	and	and	CCONJ
cusj-10965	187	30	crispr	crispr	ADJ
cusj-10965	187	31	arrays	array	NOUN
cusj-10965	187	32	encoded	encode	VERB
cusj-10965	187	33	on	on	ADP
cusj-10965	187	34	single	single	ADJ
cusj-10965	187	35	transcripts	transcript	NOUN
cusj-10965	187	36	.	.	PUNCT
cusj-10965	188	1	nat	nat	PROPN
cusj-10965	188	2	methods	method	NOUN
cusj-10965	188	3	16	16	NUM
cusj-10965	188	4	,	,	PUNCT
cusj-10965	188	5	887–893	887–893	NUM
cusj-10965	188	6	(	(	PUNCT
cusj-10965	188	7	2019	2019	NUM
cusj-10965	188	8	)	)	PUNCT
cusj-10965	188	9	.	.	PUNCT
cusj-10965	189	1	https://doi.org/10.1038/s41592-0190508-6	https://doi.org/10.1038/s41592-0190508-6	PROPN
cusj-10965	189	2	20	20	NUM
cusj-10965	189	3	.	.	PUNCT
cusj-10965	189	4	spakman	spakman	PROPN
cusj-10965	189	5	,	,	PUNCT
cusj-10965	189	6	d.	d.	PROPN
cusj-10965	189	7	,	,	PUNCT
cusj-10965	189	8	king	king	PROPN
cusj-10965	189	9	,	,	PUNCT
cusj-10965	189	10	g.	g.	PROPN
cusj-10965	189	11	a.	a.	PROPN
cusj-10965	189	12	,	,	PUNCT
cusj-10965	189	13	peterman	peterman	PROPN
cusj-10965	189	14	,	,	PUNCT
cusj-10965	189	15	e.	e.	PROPN
cusj-10965	189	16	j.	j.	PROPN
cusj-10965	189	17	g.	g.	PROPN
cusj-10965	189	18	&	&	CCONJ
cusj-10965	189	19	wuite	wuite	PROPN
cusj-10965	189	20	,	,	PUNCT
cusj-10965	189	21	g.	g.	PROPN
cusj-10965	189	22	j.	j.	PROPN
cusj-10965	189	23	l.	l.	PROPN
cusj-10965	189	24	constructing	constructing	PROPN
cusj-10965	189	25	arrays	array	NOUN
cusj-10965	189	26	of	of	ADP
cusj-10965	189	27	nucleosome	nucleosome	NOUN
cusj-10965	189	28	positioning	positioning	NOUN
cusj-10965	189	29	sequences	sequence	NOUN
cusj-10965	189	30	using	use	VERB
cusj-10965	189	31	gibson	gibson	PROPN
cusj-10965	189	32	assembly	assembly	PROPN
cusj-10965	189	33	for	for	ADP
cusj-10965	189	34	single	single	ADJ
cusj-10965	189	35	-	-	PUNCT
cusj-10965	189	36	molecule	molecule	NOUN
cusj-10965	189	37	studies	study	NOUN
cusj-10965	189	38	.	.	PUNCT
cusj-10965	190	1	sci	sci	PROPN
cusj-10965	190	2	rep	rep	PROPN
cusj-10965	190	3	10	10	NUM
cusj-10965	190	4	,	,	PUNCT
cusj-10965	190	5	9903	9903	NUM
cusj-10965	190	6	(	(	PUNCT
cusj-10965	190	7	2020	2020	NUM
cusj-10965	190	8	)	)	PUNCT
cusj-10965	190	9	.	.	PUNCT
cusj-10965	191	1	https://doi.org/10.1038/s41598-02066259-4	https://doi.org/10.1038/s41598-02066259-4	PROPN
cusj-10965	191	2	21	21	NUM
cusj-10965	191	3	.	.	PUNCT
cusj-10965	192	1	wei	wei	PROPN
cusj-10965	192	2	,	,	PUNCT
cusj-10965	192	3	t.	t.	PROPN
cusj-10965	192	4	,	,	PUNCT
cusj-10965	192	5	cheng	cheng	PROPN
cusj-10965	192	6	,	,	PUNCT
cusj-10965	192	7	q.	q.	PROPN
cusj-10965	192	8	,	,	PUNCT
cusj-10965	192	9	min	min	PROPN
cusj-10965	192	10	,	,	PUNCT
cusj-10965	192	11	y.-l	y.-l	NOUN
cusj-10965	192	12	.	.	PUNCT
cusj-10965	192	13	,	,	PUNCT
cusj-10965	192	14	olson	olson	PROPN
cusj-10965	192	15	,	,	PUNCT
cusj-10965	192	16	e.	e.	PROPN
cusj-10965	192	17	n.	n.	PROPN
cusj-10965	192	18	&	&	CCONJ
cusj-10965	192	19	siegwart	siegwart	PROPN
cusj-10965	192	20	,	,	PUNCT
cusj-10965	192	21	d.	d.	PROPN
cusj-10965	192	22	j.	j.	PROPN
cusj-10965	192	23	systemic	systemic	PROPN
cusj-10965	192	24	nanoparticle	nanoparticle	PROPN
cusj-10965	192	25	delivery	delivery	NOUN
cusj-10965	192	26	of	of	ADP
cusj-10965	192	27	crispr	crispr	ADJ
cusj-10965	192	28	-	-	PUNCT
cusj-10965	192	29	cas9	cas9	NOUN
cusj-10965	192	30	ribonucleoproteins	ribonucleoprotein	NOUN
cusj-10965	192	31	for	for	ADP
cusj-10965	192	32	effective	effective	ADJ
cusj-10965	192	33	tissue	tissue	NOUN
cusj-10965	192	34	specific	specific	ADJ
cusj-10965	192	35	genome	genome	NOUN
cusj-10965	192	36	editing	editing	NOUN
cusj-10965	192	37	.	.	PUNCT
cusj-10965	193	1	nat	nat	PROPN
cusj-10965	193	2	commun	commun	PROPN
cusj-10965	193	3	11	11	NUM
cusj-10965	193	4	,	,	PUNCT
cusj-10965	193	5	3232	3232	NUM
cusj-10965	193	6	(	(	PUNCT
cusj-10965	193	7	2020	2020	NUM
cusj-10965	193	8	)	)	PUNCT
cusj-10965	193	9	.	.	PUNCT
cusj-10965	194	1	https://doi.org/10.1016/j.neuroscience.2013.12.003	https://doi.org/10.1016/j.neuroscience.2013.12.003	CCONJ
cusj-10965	194	2	https://doi.org/10.1016/j.neuroscience.2013.12.003	https://doi.org/10.1016/j.neuroscience.2013.12.003	NOUN
cusj-10965	194	3	https://doi.org/10.1016/j.lfs.2020.118165	https://doi.org/10.1016/j.lfs.2020.118165	X
cusj-10965	194	4	https://doi.org/10.1016/j.lfs.2020.118165	https://doi.org/10.1016/j.lfs.2020.118165	PROPN
cusj-10965	194	5	https://doi.org/10.1172/jci92087	https://doi.org/10.1172/jci92087	NOUN
cusj-10965	194	6	https://doi.org/10.1089/hum.2020.137	https://doi.org/10.1089/hum.2020.137	NOUN
cusj-10965	194	7	https://doi.org/10.1016/j.biomaterials.2018.04.031	https://doi.org/10.1016/j.biomaterials.2018.04.031	NOUN
cusj-10965	194	8	https://doi.org/10.1016/j.biomaterials.2018.04.031	https://doi.org/10.1016/j.biomaterials.2018.04.031	PROPN
cusj-10965	194	9	https://doi.org/10.1101/gr.171264.113	https://doi.org/10.1101/gr.171264.113	ADJ
cusj-10965	194	10	https://doi.org/10.1007/s00005-010-0063-4	https://doi.org/10.1007/s00005-010-0063-4	PROPN
cusj-10965	194	11	https://doi.org/10.1007/s00005-010-0063-4	https://doi.org/10.1007/s00005-010-0063-4	NUM
cusj-10965	194	12	https://doi.org/10.1590/s1415-47572008000100001	https://doi.org/10.1590/s1415-47572008000100001	NOUN
cusj-10965	194	13	https://doi.org/10.1590/s1415-47572008000100001	https://doi.org/10.1590/s1415-47572008000100001	NOUN
cusj-10965	194	14	https://dx.doi.org/10.2174/156652308786848021	https://dx.doi.org/10.2174/156652308786848021	NOUN
cusj-10965	194	15	https://dx.doi.org/10.2174/156652308786848021	https://dx.doi.org/10.2174/156652308786848021	NOUN
cusj-10965	194	16	https://doi.org/10.1261/rna.2192803	https://doi.org/10.1261/rna.2192803	PROPN
cusj-10965	194	17	https://doi.org/10.1038/nmeth.3047	https://doi.org/10.1038/nmeth.3047	NOUN
cusj-10965	194	18	https://doi.org/10.1038/nbt.3198	https://doi.org/10.1038/nbt.3198	PROPN
cusj-10965	194	19	https://doi.org/10.1093/nar/gkt1361	https://doi.org/10.1093/nar/gkt1361	NOUN
cusj-10965	194	20	https://doi.org/10.1038/s41592-019-0508-6	https://doi.org/10.1038/s41592-019-0508-6	NUM
cusj-10965	194	21	https://doi.org/10.1038/s41592-019-0508-6	https://doi.org/10.1038/s41592-019-0508-6	NUM
cusj-10965	194	22	https://doi.org/10.1038/s41598-020-66259-4	https://doi.org/10.1038/s41598-020-66259-4	NUM
cusj-10965	194	23	https://doi.org/10.1038/s41598-020-66259-4	https://doi.org/10.1038/s41598-020-66259-4	NUM
cusj-10965	194	24	columbia	columbia	PROPN
cusj-10965	194	25	undergraduate	undergraduate	PROPN
cusj-10965	194	26	science	science	PROPN
cusj-10965	194	27	journal	journal	PROPN
cusj-10965	194	28	vol	vol	NOUN
cusj-10965	194	29	.	.	PROPN
cusj-10965	194	30	17	17	NUM
cusj-10965	194	31	,	,	PUNCT
cusj-10965	194	32	2023	2023	NUM
cusj-10965	194	33	lang	lang	PROPN
cusj-10965	194	34	et	et	PROPN
cusj-10965	194	35	.	.	PUNCT
cusj-10965	195	1	al	al	PROPN
cusj-10965	195	2	.	.	PROPN
cusj-10965	196	1	16	16	NUM
cusj-10965	196	2	https://doi.org/10.1038/s41467-02017029-3	https://doi.org/10.1038/s41467-02017029-3	VERB
cusj-10965	196	3	22	22	NUM
cusj-10965	196	4	.	.	PUNCT
cusj-10965	197	1	wilusz	wilusz	PROPN
cusj-10965	197	2	,	,	PUNCT
cusj-10965	197	3	j.	j.	PROPN
cusj-10965	197	4	e.	e.	PROPN
cusj-10965	197	5	et	et	PROPN
cusj-10965	197	6	al	al	PROPN
cusj-10965	197	7	.	.	PUNCT
cusj-10965	198	1	a	a	DET
cusj-10965	198	2	triple	triple	ADJ
cusj-10965	198	3	helix	helix	NOUN
cusj-10965	198	4	stabilizes	stabilize	VERB
cusj-10965	198	5	the	the	DET
cusj-10965	198	6	3′	3′	NUM
cusj-10965	198	7	ends	end	NOUN
cusj-10965	198	8	of	of	ADP
cusj-10965	198	9	long	long	ADJ
cusj-10965	198	10	noncoding	noncoding	ADJ
cusj-10965	198	11	rnas	rna	NOUN
cusj-10965	198	12	that	that	PRON
cusj-10965	198	13	lack	lack	VERB
cusj-10965	198	14	poly(a	poly(a	NOUN
cusj-10965	198	15	)	)	PUNCT
cusj-10965	198	16	tails	tail	NOUN
cusj-10965	198	17	.	.	PUNCT
cusj-10965	199	1	genes	gene	NOUN
cusj-10965	199	2	dev	dev	PROPN
cusj-10965	199	3	26	26	NUM
cusj-10965	199	4	,	,	PUNCT
cusj-10965	199	5	2392–2407	2392–2407	NUM
cusj-10965	199	6	(	(	PUNCT
cusj-10965	199	7	2012	2012	NUM
cusj-10965	199	8	)	)	PUNCT
cusj-10965	199	9	.	.	PUNCT
cusj-10965	200	1	https://doi.org/10.1101/gad.204438.11	https://doi.org/10.1101/gad.204438.11	ADP
cusj-10965	200	2	2	2	NUM
cusj-10965	200	3	23	23	NUM
cusj-10965	200	4	.	.	PUNCT
cusj-10965	201	1	bryda	bryda	PROPN
cusj-10965	201	2	,	,	PUNCT
cusj-10965	201	3	e.	e.	PROPN
cusj-10965	201	4	c.	c.	PROPN
cusj-10965	201	5	et	et	PROPN
cusj-10965	201	6	al	al	PROPN
cusj-10965	201	7	.	.	PUNCT
cusj-10965	202	1	a	a	DET
cusj-10965	202	2	novel	novel	ADJ
cusj-10965	202	3	conditional	conditional	ADJ
cusj-10965	202	4	zsgreen	zsgreen	NOUN
cusj-10965	202	5	-	-	PUNCT
cusj-10965	202	6	expressing	express	VERB
cusj-10965	202	7	transgenic	transgenic	NOUN
cusj-10965	202	8	reporter	reporter	NOUN
cusj-10965	202	9	rat	rat	NOUN
cusj-10965	202	10	strain	strain	NOUN
cusj-10965	202	11	for	for	ADP
cusj-10965	202	12	validating	validate	VERB
cusj-10965	202	13	cre	cre	PROPN
cusj-10965	202	14	recombinase	recombinase	NOUN
cusj-10965	202	15	expression	expression	NOUN
cusj-10965	202	16	.	.	PUNCT
cusj-10965	203	1	sci	sci	PROPN
cusj-10965	203	2	rep	rep	PROPN
cusj-10965	203	3	9	9	NUM
cusj-10965	203	4	,	,	PUNCT
cusj-10965	203	5	13330	13330	NUM
cusj-10965	203	6	(	(	PUNCT
cusj-10965	203	7	2019	2019	NUM
cusj-10965	203	8	)	)	PUNCT
cusj-10965	203	9	.	.	PUNCT
cusj-10965	204	1	https://doi.org/10.1038/s41598-01949783-w	https://doi.org/10.1038/s41598-01949783-w	NOUN
cusj-10965	204	2	24	24	NUM
cusj-10965	204	3	.	.	PUNCT
cusj-10965	204	4	mccarty	mccarty	PROPN
cusj-10965	204	5	,	,	PUNCT
cusj-10965	204	6	n.	n.	PROPN
cusj-10965	204	7	s.	s.	PROPN
cusj-10965	204	8	,	,	PUNCT
cusj-10965	204	9	graham	graham	PROPN
cusj-10965	204	10	,	,	PUNCT
cusj-10965	204	11	a.	a.	PROPN
cusj-10965	204	12	e.	e.	PROPN
cusj-10965	204	13	,	,	PUNCT
cusj-10965	204	14	studená	studená	VERB
cusj-10965	204	15	,	,	PUNCT
cusj-10965	204	16	l.	l.	PROPN
cusj-10965	204	17	&	&	CCONJ
cusj-10965	204	18	ledesma	ledesma	PROPN
cusj-10965	204	19	-	-	PUNCT
cusj-10965	204	20	amaro	amaro	PROPN
cusj-10965	204	21	,	,	PUNCT
cusj-10965	204	22	r.	r.	PROPN
cusj-10965	204	23	multiplexed	multiplexed	ADJ
cusj-10965	204	24	crispr	crispr	PROPN
cusj-10965	204	25	technologies	technology	NOUN
cusj-10965	204	26	for	for	ADP
cusj-10965	204	27	gene	gene	NOUN
cusj-10965	204	28	editing	editing	NOUN
cusj-10965	204	29	and	and	CCONJ
cusj-10965	204	30	transcriptional	transcriptional	ADJ
cusj-10965	204	31	regulation	regulation	NOUN
cusj-10965	204	32	.	.	PUNCT
cusj-10965	205	1	nat	nat	PROPN
cusj-10965	205	2	commun	commun	PROPN
cusj-10965	205	3	11	11	NUM
cusj-10965	205	4	,	,	PUNCT
cusj-10965	205	5	1281	1281	NUM
cusj-10965	205	6	(	(	PUNCT
cusj-10965	205	7	2020	2020	NUM
cusj-10965	205	8	)	)	PUNCT
cusj-10965	205	9	.	.	PUNCT
cusj-10965	206	1	https://doi.org/10.1038/s41467-02015053-x	https://doi.org/10.1038/s41467-02015053-x	PROPN
cusj-10965	207	1	25	25	NUM
cusj-10965	207	2	.	.	PUNCT
cusj-10965	208	1	beilstein	beilstein	PROPN
cusj-10965	208	2	,	,	PUNCT
cusj-10965	208	3	k.	k.	PROPN
cusj-10965	208	4	,	,	PUNCT
cusj-10965	208	5	wittmann	wittmann	PROPN
cusj-10965	208	6	,	,	PUNCT
cusj-10965	208	7	a.	a.	NOUN
cusj-10965	208	8	,	,	PUNCT
cusj-10965	208	9	grez	grez	NOUN
cusj-10965	208	10	,	,	PUNCT
cusj-10965	208	11	m.	m.	NOUN
cusj-10965	208	12	&	&	CCONJ
cusj-10965	208	13	suess	suess	PROPN
cusj-10965	208	14	,	,	PUNCT
cusj-10965	208	15	b.	b.	PROPN
cusj-10965	208	16	conditional	conditional	ADJ
cusj-10965	208	17	control	control	NOUN
cusj-10965	208	18	of	of	ADP
cusj-10965	208	19	mammalian	mammalian	ADJ
cusj-10965	208	20	gene	gene	NOUN
cusj-10965	208	21	expression	expression	NOUN
cusj-10965	208	22	by	by	ADP
cusj-10965	208	23	tetracycline	tetracycline	NOUN
cusj-10965	208	24	-	-	PUNCT
cusj-10965	208	25	dependent	dependent	ADJ
cusj-10965	208	26	hammerhead	hammerhead	NOUN
cusj-10965	208	27	ribozymes	ribozyme	NOUN
cusj-10965	208	28	.	.	PUNCT
cusj-10965	209	1	acs	acs	PROPN
cusj-10965	209	2	synth	synth	PROPN
cusj-10965	209	3	biol	biol	PROPN
cusj-10965	209	4	4	4	NUM
cusj-10965	209	5	,	,	PUNCT
cusj-10965	209	6	526	526	NUM
cusj-10965	209	7	–	–	PUNCT
cusj-10965	209	8	534	534	NUM
cusj-10965	209	9	(	(	PUNCT
cusj-10965	209	10	2015	2015	NUM
cusj-10965	209	11	)	)	PUNCT
cusj-10965	209	12	.	.	PUNCT
cusj-10965	210	1	https://doi.org/10.1021/sb500270h	https://doi.org/10.1021/sb500270h	X
cusj-10965	211	1	26	26	NUM
cusj-10965	211	2	.	.	PUNCT
cusj-10965	212	1	komatsu	komatsu	NOUN
cusj-10965	212	2	,	,	PUNCT
cusj-10965	212	3	y.	y.	PROPN
cusj-10965	212	4	regulation	regulation	NOUN
cusj-10965	212	5	of	of	ADP
cusj-10965	212	6	ribozyme	ribozyme	ADJ
cusj-10965	212	7	activity	activity	NOUN
cusj-10965	212	8	with	with	ADP
cusj-10965	212	9	short	short	ADJ
cusj-10965	212	10	oligonucleotides	oligonucleotide	NOUN
cusj-10965	212	11	.	.	PUNCT
cusj-10965	213	1	biol	biol	PROPN
cusj-10965	213	2	pharm	pharm	PROPN
cusj-10965	213	3	bull	bull	PROPN
cusj-10965	213	4	27	27	NUM
cusj-10965	213	5	,	,	PUNCT
cusj-10965	213	6	457–462	457–462	NUM
cusj-10965	213	7	(	(	PUNCT
cusj-10965	213	8	2004	2004	NUM
cusj-10965	213	9	)	)	PUNCT
cusj-10965	213	10	.	.	PUNCT
cusj-10965	214	1	https://doi.org/10.1248/bpb.27.457	https://doi.org/10.1248/bpb.27.457	PROPN
cusj-10965	214	2	27	27	NUM
cusj-10965	214	3	.	.	PUNCT
cusj-10965	215	1	salman	salman	PROPN
cusj-10965	215	2	,	,	PUNCT
cusj-10965	215	3	a.	a.	PROPN
cusj-10965	215	4	et	et	PROPN
cusj-10965	215	5	al	al	PROPN
cusj-10965	215	6	.	.	PUNCT
cusj-10965	216	1	non	non	ADJ
cusj-10965	216	2	-	-	ADJ
cusj-10965	216	3	viral	viral	ADJ
cusj-10965	216	4	delivery	delivery	NOUN
cusj-10965	216	5	of	of	ADP
cusj-10965	216	6	crispr	crispr	ADJ
cusj-10965	216	7	/	/	SYM
cusj-10965	216	8	cas	cas	NOUN
cusj-10965	216	9	cargo	cargo	NOUN
cusj-10965	216	10	to	to	ADP
cusj-10965	216	11	the	the	DET
cusj-10965	216	12	retina	retina	NOUN
cusj-10965	216	13	using	use	VERB
cusj-10965	216	14	nanoparticles	nanoparticle	NOUN
cusj-10965	216	15	:	:	PUNCT
cusj-10965	216	16	current	current	ADJ
cusj-10965	216	17	possibilities	possibility	NOUN
cusj-10965	216	18	,	,	PUNCT
cusj-10965	216	19	challenges	challenge	NOUN
cusj-10965	216	20	,	,	PUNCT
cusj-10965	216	21	and	and	CCONJ
cusj-10965	216	22	limitations	limitation	NOUN
cusj-10965	216	23	.	.	PUNCT
cusj-10965	217	1	pharmaceutics	pharmaceutic	NOUN
cusj-10965	217	2	14	14	NUM
cusj-10965	217	3	,	,	PUNCT
cusj-10965	217	4	1842	1842	NUM
cusj-10965	217	5	(	(	PUNCT
cusj-10965	217	6	2022	2022	NUM
cusj-10965	217	7	)	)	PUNCT
cusj-10965	217	8	.	.	PUNCT
cusj-10965	218	1	https://doi.org/10.3390/pharmaceutics14091842	https://doi.org/10.3390/pharmaceutics14091842	NOUN
cusj-10965	218	2	28	28	NUM
cusj-10965	218	3	.	.	PUNCT
cusj-10965	219	1	frommer	frommer	PROPN
cusj-10965	219	2	,	,	PUNCT
cusj-10965	219	3	j.	j.	PROPN
cusj-10965	219	4	,	,	PUNCT
cusj-10965	219	5	appel	appel	PROPN
cusj-10965	219	6	,	,	PUNCT
cusj-10965	219	7	b.	b.	PROPN
cusj-10965	219	8	&	&	CCONJ
cusj-10965	219	9	müller	müller	PROPN
cusj-10965	219	10	,	,	PUNCT
cusj-10965	219	11	s.	s.	PROPN
cusj-10965	219	12	ribozymes	ribozyme	NOUN
cusj-10965	219	13	that	that	PRON
cusj-10965	219	14	can	can	AUX
cusj-10965	219	15	be	be	AUX
cusj-10965	219	16	regulated	regulate	VERB
cusj-10965	219	17	by	by	ADP
cusj-10965	219	18	external	external	ADJ
cusj-10965	219	19	stimuli	stimulus	NOUN
cusj-10965	219	20	.	.	PUNCT
cusj-10965	220	1	curr	curr	PROPN
cusj-10965	220	2	opin	opin	NOUN
cusj-10965	220	3	biotechnol	biotechnol	NOUN
cusj-10965	220	4	31	31	NUM
cusj-10965	220	5	,	,	PUNCT
cusj-10965	220	6	35–41	35–41	NUM
cusj-10965	220	7	(	(	PUNCT
cusj-10965	220	8	2015	2015	NUM
cusj-10965	220	9	)	)	PUNCT
cusj-10965	220	10	.	.	PUNCT
cusj-10965	221	1	https://doi.org/10.1016/j.copbio.2014.07.009	https://doi.org/10.1016/j.copbio.2014.07.009	PROPN
cusj-10965	221	2	29	29	NUM
cusj-10965	221	3	.	.	PUNCT
cusj-10965	222	1	kuwabara	kuwabara	PROPN
cusj-10965	222	2	,	,	PUNCT
cusj-10965	222	3	t.	t.	ADJ
cusj-10965	222	4	allosterically	allosterically	ADV
cusj-10965	222	5	controllable	controllable	ADJ
cusj-10965	222	6	ribozymes	ribozyme	NOUN
cusj-10965	222	7	with	with	ADP
cusj-10965	222	8	biosensor	biosensor	NOUN
cusj-10965	222	9	functions	function	NOUN
cusj-10965	222	10	.	.	PUNCT
cusj-10965	223	1	curr	curr	PROPN
cusj-10965	223	2	opin	opin	NOUN
cusj-10965	223	3	chem	chem	NOUN
cusj-10965	223	4	biol	biol	NOUN
cusj-10965	223	5	4	4	NUM
cusj-10965	223	6	,	,	PUNCT
cusj-10965	223	7	669–677	669–677	NUM
cusj-10965	223	8	(	(	PUNCT
cusj-10965	223	9	2000	2000	NUM
cusj-10965	223	10	)	)	PUNCT
cusj-10965	223	11	.	.	PUNCT
cusj-10965	224	1	https://doi.org/10.1016/s13675931(00)00150-2	https://doi.org/10.1016/s13675931(00)00150-2	NOUN
cusj-10965	224	2	https://doi.org/10.1038/s41467-020-17029-3	https://doi.org/10.1038/s41467-020-17029-3	PRON
cusj-10965	224	3	https://doi.org/10.1038/s41467-020-17029-3	https://doi.org/10.1038/s41467-020-17029-3	NUM
cusj-10965	224	4	https://doi.org/10.1101/gad.204438.112	https://doi.org/10.1101/gad.204438.112	PROPN
cusj-10965	224	5	https://doi.org/10.1101/gad.204438.112	https://doi.org/10.1101/gad.204438.112	PROPN
cusj-10965	224	6	https://doi.org/10.1038/s41598-019-49783-w	https://doi.org/10.1038/s41598-019-49783-w	NOUN
cusj-10965	224	7	https://doi.org/10.1038/s41598-019-49783-w	https://doi.org/10.1038/s41598-019-49783-w	NOUN
cusj-10965	224	8	https://doi.org/10.1038/s41467-020-15053-x	https://doi.org/10.1038/s41467-020-15053-x	PROPN
cusj-10965	224	9	https://doi.org/10.1038/s41467-020-15053-x	https://doi.org/10.1038/s41467-020-15053-x	PROPN
cusj-10965	224	10	https://doi.org/10.1021/sb500270h	https://doi.org/10.1021/sb500270h	X
cusj-10965	225	1	https://doi.org/10.1248/bpb.27.457	https://doi.org/10.1248/bpb.27.457	PRON
cusj-10965	226	1	https://doi.org/10.3390/pharmaceutics14091842	https://doi.org/10.3390/pharmaceutics14091842	NOUN
cusj-10965	226	2	https://doi.org/10.3390/pharmaceutics14091842	https://doi.org/10.3390/pharmaceutics14091842	NOUN
cusj-10965	226	3	https://doi.org/10.1016/j.copbio.2014.07.009	https://doi.org/10.1016/j.copbio.2014.07.009	NOUN
cusj-10965	226	4	https://doi.org/10.1016/j.copbio.2014.07.009	https://doi.org/10.1016/j.copbio.2014.07.009	PROPN
cusj-10965	226	5	https://doi.org/10.1016/s1367-5931(00)00150-2	https://doi.org/10.1016/s1367-5931(00)00150-2	PROPN
cusj-10965	226	6	https://doi.org/10.1016/s1367-5931(00)00150-2	https://doi.org/10.1016/s1367-5931(00)00150-2	NOUN