id	sid	tid	token	lemma	pos
crias-79	1	1	81	81	NUM
crias-79	1	2	†	†	X
crias-79	1	3	corresponding	corresponding	ADJ
crias-79	1	4	author	author	NOUN
crias-79	1	5	©	©	PROPN
crias-79	1	6	2015	2015	NUM
crias-79	1	7	conscientia	conscientia	PROPN
crias-79	1	8	beam	beam	PROPN
crias-79	1	9	.	.	PUNCT
crias-79	2	1	all	all	DET
crias-79	2	2	rights	right	NOUN
crias-79	2	3	reserved	reserve	VERB
crias-79	2	4	.	.	PUNCT
crias-79	3	1	evaluation	evaluation	NOUN
crias-79	3	2	of	of	ADP
crias-79	3	3	in	in	ADP
crias-79	3	4	vitro	vitro	X
crias-79	3	5	protocols	protocol	NOUN
crias-79	3	6	for	for	ADP
crias-79	3	7	elimination	elimination	NOUN
crias-79	3	8	of	of	ADP
crias-79	3	9	banana	banana	NOUN
crias-79	3	10	streak	streak	PROPN
crias-79	3	11	virus	virus	NOUN
crias-79	3	12	from	from	ADP
crias-79	3	13	tissue	tissue	NOUN
crias-79	3	14	cultured	cultured	ADJ
crias-79	3	15	explants	explant	NOUN
crias-79	3	16	in	in	ADP
crias-79	3	17	banana	banana	NOUN
crias-79	3	18	seedling	seedling	NOUN
crias-79	3	19	production	production	NOUN
crias-79	3	20	g.	g.	PROPN
crias-79	3	21	mungai1†	mungai1†	PROPN
crias-79	3	22	--e	--e	PROPN
crias-79	3	23	.	.	PUNCT
crias-79	4	1	ateka2	ateka2	PROPN
crias-79	4	2	--a	--a	PROPN
crias-79	4	3	.	.	PUNCT
crias-79	5	1	nyende3	nyende3	NOUN
crias-79	5	2	--d	--d	NOUN
crias-79	5	3	.	.	PUNCT
crias-79	6	1	miano4	miano4	NOUN
crias-79	7	1	1,2,3	1,2,3	NUM
crias-79	7	2	jomo	jomo	PROPN
crias-79	7	3	kenyatta	kenyatta	PROPN
crias-79	7	4	university	university	PROPN
crias-79	7	5	of	of	ADP
crias-79	7	6	agriculture	agriculture	NOUN
crias-79	7	7	and	and	CCONJ
crias-79	7	8	technology	technology	NOUN
crias-79	7	9	(	(	PUNCT
crias-79	7	10	jkuat	jkuat	PROPN
crias-79	7	11	)	)	PUNCT
crias-79	7	12	nairobi	nairobi	PROPN
crias-79	7	13	kenya	kenya	PROPN
crias-79	7	14	,	,	PUNCT
crias-79	7	15	kenya	kenya	PROPN
crias-79	7	16	4kenya	4kenya	NUM
crias-79	7	17	agricultural	agricultural	ADJ
crias-79	7	18	research	research	PROPN
crias-79	7	19	institute	institute	PROPN
crias-79	7	20	(	(	PUNCT
crias-79	7	21	kari	kari	PROPN
crias-79	7	22	)	)	PUNCT
crias-79	7	23	,	,	PUNCT
crias-79	7	24	national	national	ADJ
crias-79	7	25	agricultural	agricultural	ADJ
crias-79	7	26	research	research	NOUN
crias-79	7	27	laboratories	laboratory	NOUN
crias-79	7	28	(	(	PUNCT
crias-79	7	29	narl	narl	NOUN
crias-79	7	30	)	)	PUNCT
crias-79	7	31	,	,	PUNCT
crias-79	7	32	kenya	kenya	PROPN
crias-79	7	33	abstract	abstract	VERB
crias-79	7	34	the	the	DET
crias-79	7	35	banana	banana	NOUN
crias-79	7	36	industry	industry	NOUN
crias-79	7	37	in	in	ADP
crias-79	7	38	kenya	kenya	PROPN
crias-79	7	39	is	be	AUX
crias-79	7	40	threatened	threaten	VERB
crias-79	7	41	by	by	ADP
crias-79	7	42	the	the	DET
crias-79	7	43	presence	presence	NOUN
crias-79	7	44	of	of	ADP
crias-79	7	45	banana	banana	PROPN
crias-79	7	46	streak	streak	PROPN
crias-79	7	47	virus	virus	NOUN
crias-79	7	48	(	(	PUNCT
crias-79	7	49	bsv	bsv	NOUN
crias-79	7	50	)	)	PUNCT
crias-79	7	51	.	.	PUNCT
crias-79	8	1	the	the	DET
crias-79	8	2	jomo	jomo	PROPN
crias-79	8	3	kenyatta	kenyatta	PROPN
crias-79	8	4	university	university	PROPN
crias-79	8	5	of	of	ADP
crias-79	8	6	agriculture	agriculture	NOUN
crias-79	8	7	and	and	CCONJ
crias-79	8	8	technology	technology	NOUN
crias-79	8	9	(	(	PUNCT
crias-79	8	10	jkuat	jkuat	ADJ
crias-79	8	11	)	)	PUNCT
crias-79	8	12	commercial	commercial	ADJ
crias-79	8	13	banana	banana	NOUN
crias-79	8	14	laboratory	laboratory	PROPN
crias-79	8	15	uses	use	VERB
crias-79	8	16	tissue	tissue	NOUN
crias-79	8	17	culture	culture	NOUN
crias-79	8	18	(	(	PUNCT
crias-79	8	19	tc	tc	NOUN
crias-79	8	20	)	)	PUNCT
crias-79	8	21	technique	technique	NOUN
crias-79	8	22	for	for	ADP
crias-79	8	23	mass	mass	ADJ
crias-79	8	24	propagation	propagation	NOUN
crias-79	8	25	of	of	ADP
crias-79	8	26	plantlets	plantlet	NOUN
crias-79	8	27	which	which	PRON
crias-79	8	28	are	be	AUX
crias-79	8	29	free	free	ADJ
crias-79	8	30	from	from	ADP
crias-79	8	31	most	most	ADJ
crias-79	8	32	disease	disease	NOUN
crias-79	8	33	causing	cause	VERB
crias-79	8	34	organisms	organism	NOUN
crias-79	8	35	for	for	ADP
crias-79	8	36	commercial	commercial	ADJ
crias-79	8	37	purposes	purpose	NOUN
crias-79	8	38	.	.	PUNCT
crias-79	9	1	to	to	PART
crias-79	9	2	evaluate	evaluate	VERB
crias-79	9	3	in	in	ADP
crias-79	9	4	vitro	vitro	X
crias-79	9	5	protocols	protocol	NOUN
crias-79	9	6	for	for	ADP
crias-79	9	7	production	production	NOUN
crias-79	9	8	of	of	ADP
crias-79	9	9	banana	banana	NOUN
crias-79	9	10	streak	streak	NOUN
crias-79	9	11	virusfree	virusfree	ADJ
crias-79	9	12	tc	tc	NUM
crias-79	9	13	banana	banana	NOUN
crias-79	9	14	planting	planting	NOUN
crias-79	9	15	materials	material	NOUN
crias-79	9	16	for	for	ADP
crias-79	9	17	farmers	farmer	NOUN
crias-79	9	18	,	,	PUNCT
crias-79	9	19	leaf	leaf	NOUN
crias-79	9	20	samples	sample	NOUN
crias-79	9	21	were	be	AUX
crias-79	9	22	collected	collect	VERB
crias-79	9	23	from	from	ADP
crias-79	9	24	thika	thika	NOUN
crias-79	9	25	,	,	PUNCT
crias-79	9	26	kisii	kisii	ADJ
crias-79	9	27	,	,	PUNCT
crias-79	9	28	and	and	CCONJ
crias-79	9	29	jkuat	jkuat	ADJ
crias-79	9	30	orchards	orchard	NOUN
crias-79	9	31	for	for	ADP
crias-79	9	32	indexing	indexing	NOUN
crias-79	9	33	.	.	PUNCT
crias-79	10	1	the	the	DET
crias-79	10	2	corms	corm	NOUN
crias-79	10	3	were	be	AUX
crias-79	10	4	taken	take	VERB
crias-79	10	5	through	through	ADP
crias-79	10	6	the	the	DET
crias-79	10	7	tc	tc	NOUN
crias-79	10	8	procedure	procedure	NOUN
crias-79	10	9	up	up	ADP
crias-79	10	10	to	to	ADP
crias-79	10	11	the	the	DET
crias-79	10	12	2nd	2nd	ADJ
crias-79	10	13	subculture	subculture	NOUN
crias-79	10	14	stage	stage	NOUN
crias-79	10	15	after	after	ADP
crias-79	10	16	which	which	PRON
crias-79	10	17	they	they	PRON
crias-79	10	18	were	be	AUX
crias-79	10	19	subjected	subject	VERB
crias-79	10	20	to	to	ADP
crias-79	10	21	three	three	NUM
crias-79	10	22	virus	virus	NOUN
crias-79	10	23	elimination	elimination	NOUN
crias-79	10	24	techniques	technique	NOUN
crias-79	10	25	;	;	PUNCT
crias-79	10	26	chemotherapy	chemotherapy	NOUN
crias-79	10	27	,	,	PUNCT
crias-79	10	28	meristem	meristem	NOUN
crias-79	10	29	tip	tip	NOUN
crias-79	10	30	culture	culture	NOUN
crias-79	10	31	and	and	CCONJ
crias-79	10	32	thermotherapy	thermotherapy	NOUN
crias-79	10	33	for	for	ADP
crias-79	10	34	evaluation	evaluation	NOUN
crias-79	10	35	.	.	PUNCT
crias-79	11	1	indexing	indexing	NOUN
crias-79	11	2	for	for	ADP
crias-79	11	3	bsv	bsv	NOUN
crias-79	11	4	using	use	VERB
crias-79	11	5	pcr	pcr	PROPN
crias-79	11	6	bsv	bsv	NOUN
crias-79	11	7	indicated	indicate	VERB
crias-79	11	8	90	90	NUM
crias-79	11	9	,	,	PUNCT
crias-79	11	10	80	80	NUM
crias-79	11	11	and	and	CCONJ
crias-79	11	12	40	40	NUM
crias-79	11	13	%	%	NOUN
crias-79	11	14	infection	infection	NOUN
crias-79	11	15	levels	level	NOUN
crias-79	11	16	for	for	ADP
crias-79	11	17	kisii	kisii	PROPN
crias-79	11	18	,	,	PUNCT
crias-79	11	19	jkuat	jkuat	PROPN
crias-79	11	20	and	and	CCONJ
crias-79	11	21	thika	thika	NOUN
crias-79	11	22	orchards	orchard	NOUN
crias-79	11	23	,	,	PUNCT
crias-79	11	24	respectively	respectively	ADV
crias-79	11	25	.	.	PUNCT
crias-79	12	1	for	for	ADP
crias-79	12	2	chemotherapy	chemotherapy	NOUN
crias-79	12	3	evaluation	evaluation	NOUN
crias-79	12	4	,	,	PUNCT
crias-79	12	5	concentrations	concentration	NOUN
crias-79	12	6	of	of	ADP
crias-79	12	7	between	between	ADP
crias-79	12	8	10	10	NUM
crias-79	12	9	and	and	CCONJ
crias-79	12	10	40	40	NUM
crias-79	12	11	mg	mg	NUM
crias-79	12	12	/	/	SYM
crias-79	12	13	l	l	NOUN
crias-79	12	14	were	be	AUX
crias-79	12	15	used	use	VERB
crias-79	12	16	resulting	result	VERB
crias-79	12	17	in	in	ADP
crias-79	12	18	0	0	NUM
crias-79	12	19	to	to	PART
crias-79	12	20	90	90	NUM
crias-79	12	21	%	%	NOUN
crias-79	12	22	virus	virus	NOUN
crias-79	12	23	elimination	elimination	NOUN
crias-79	12	24	.	.	PUNCT
crias-79	13	1	for	for	ADP
crias-79	13	2	thermotherapy	thermotherapy	NOUN
crias-79	13	3	,	,	PUNCT
crias-79	13	4	27	27	NUM
crias-79	13	5	°	°	ADP
crias-79	13	6	c	c	NOUN
crias-79	13	7	(	(	PUNCT
crias-79	13	8	control	control	NOUN
crias-79	13	9	)	)	PUNCT
crias-79	13	10	,	,	PUNCT
crias-79	13	11	32	32	NUM
crias-79	13	12	°	°	SYM
crias-79	13	13	c	c	NOUN
crias-79	13	14	,	,	PUNCT
crias-79	13	15	34	34	NUM
crias-79	13	16	°	°	NOUN
crias-79	13	17	c	c	NOUN
crias-79	13	18	,	,	PUNCT
crias-79	13	19	36	36	NUM
crias-79	13	20	°	°	NOUN
crias-79	13	21	c	c	NOUN
crias-79	13	22	and	and	CCONJ
crias-79	13	23	38	38	NUM
crias-79	13	24	°	°	NOUN
crias-79	13	25	c	c	NOUN
crias-79	13	26	for	for	ADP
crias-79	13	27	10	10	NUM
crias-79	13	28	days	day	NOUN
crias-79	13	29	,	,	PUNCT
crias-79	13	30	resulted	result	VERB
crias-79	13	31	in	in	ADP
crias-79	13	32	0	0	NUM
crias-79	13	33	and	and	CCONJ
crias-79	13	34	90	90	NUM
crias-79	13	35	%	%	NOUN
crias-79	13	36	virus	virus	NOUN
crias-79	13	37	elimination	elimination	NOUN
crias-79	13	38	.	.	PUNCT
crias-79	14	1	meristem	meristem	NOUN
crias-79	14	2	tip	tip	NOUN
crias-79	14	3	culture	culture	NOUN
crias-79	14	4	at	at	ADP
crias-79	14	5	1	1	NUM
crias-79	14	6	,	,	PUNCT
crias-79	14	7	2	2	NUM
crias-79	14	8	,	,	PUNCT
crias-79	14	9	3	3	NUM
crias-79	14	10	,	,	PUNCT
crias-79	14	11	4	4	NUM
crias-79	14	12	and	and	CCONJ
crias-79	14	13	5	5	NUM
crias-79	14	14	mm	mm	NOUN
crias-79	14	15	(	(	PUNCT
crias-79	14	16	control	control	NOUN
crias-79	14	17	)	)	PUNCT
crias-79	14	18	gave	give	VERB
crias-79	14	19	between	between	ADP
crias-79	14	20	0	0	NUM
crias-79	14	21	and	and	CCONJ
crias-79	14	22	90	90	NUM
crias-79	14	23	%	%	NOUN
crias-79	14	24	virus	virus	NOUN
crias-79	14	25	elimination	elimination	NOUN
crias-79	14	26	,	,	PUNCT
crias-79	14	27	respectively	respectively	ADV
crias-79	14	28	.	.	PUNCT
crias-79	15	1	the	the	DET
crias-79	15	2	study	study	NOUN
crias-79	15	3	indicates	indicate	VERB
crias-79	15	4	that	that	SCONJ
crias-79	15	5	bsv	bsv	PROPN
crias-79	15	6	can	can	AUX
crias-79	15	7	be	be	AUX
crias-79	15	8	eliminated	eliminate	VERB
crias-79	15	9	using	use	VERB
crias-79	15	10	chemotherapy	chemotherapy	NOUN
crias-79	15	11	,	,	PUNCT
crias-79	15	12	thermotherapy	thermotherapy	NOUN
crias-79	15	13	and	and	CCONJ
crias-79	15	14	meristem	meristem	NOUN
crias-79	15	15	tip	tip	NOUN
crias-79	15	16	culture	culture	NOUN
crias-79	15	17	.	.	PUNCT
crias-79	16	1	chemotherapy	chemotherapy	NOUN
crias-79	16	2	using	use	VERB
crias-79	16	3	salicylic	salicylic	ADJ
crias-79	16	4	acid	acid	NOUN
crias-79	16	5	at	at	ADP
crias-79	16	6	20mg	20mg	NUM
crias-79	16	7	/	/	SYM
crias-79	16	8	l	l	NOUN
crias-79	16	9	can	can	AUX
crias-79	16	10	be	be	AUX
crias-79	16	11	used	use	VERB
crias-79	16	12	to	to	PART
crias-79	16	13	eliminate	eliminate	VERB
crias-79	16	14	bsv	bsv	PROPN
crias-79	16	15	up	up	ADV
crias-79	16	16	90	90	NUM
crias-79	16	17	%	%	NOUN
crias-79	16	18	.	.	PUNCT
crias-79	17	1	it	it	PRON
crias-79	17	2	is	be	AUX
crias-79	17	3	also	also	ADV
crias-79	17	4	easy	easy	ADJ
crias-79	17	5	to	to	PART
crias-79	17	6	implement	implement	VERB
crias-79	17	7	since	since	SCONJ
crias-79	17	8	it	it	PRON
crias-79	17	9	is	be	AUX
crias-79	17	10	incorporated	incorporate	VERB
crias-79	17	11	into	into	ADP
crias-79	17	12	the	the	DET
crias-79	17	13	medium	medium	NOUN
crias-79	17	14	.	.	PUNCT
crias-79	18	1	keywords	keyword	NOUN
crias-79	18	2	:	:	PUNCT
crias-79	18	3	banana	banana	PROPN
crias-79	18	4	streak	streak	PROPN
crias-79	18	5	virus	virus	PROPN
crias-79	18	6	,	,	PUNCT
crias-79	18	7	chemotherapy	chemotherapy	NOUN
crias-79	18	8	,	,	PUNCT
crias-79	18	9	thermotherapy	thermotherapy	NOUN
crias-79	18	10	,	,	PUNCT
crias-79	18	11	meristem	meristem	NOUN
crias-79	18	12	tip	tip	NOUN
crias-79	18	13	contribution/	contribution/	NUM
crias-79	18	14	originality	originality	NOUN
crias-79	18	15	this	this	DET
crias-79	18	16	study	study	NOUN
crias-79	18	17	contributes	contribute	VERB
crias-79	18	18	to	to	ADP
crias-79	18	19	the	the	DET
crias-79	18	20	existing	exist	VERB
crias-79	18	21	literature	literature	NOUN
crias-79	18	22	on	on	ADP
crias-79	18	23	virus	virus	NOUN
crias-79	18	24	elimination	elimination	NOUN
crias-79	18	25	from	from	ADP
crias-79	18	26	banana	banana	NOUN
crias-79	18	27	planting	planting	NOUN
crias-79	18	28	materials	material	NOUN
crias-79	18	29	globally	globally	ADV
crias-79	18	30	and	and	CCONJ
crias-79	18	31	the	the	DET
crias-79	18	32	first	first	ADJ
crias-79	18	33	logical	logical	ADJ
crias-79	18	34	analysis	analysis	NOUN
crias-79	18	35	in	in	ADP
crias-79	18	36	the	the	DET
crias-79	18	37	fight	fight	NOUN
crias-79	18	38	against	against	ADP
crias-79	18	39	banana	banana	NOUN
crias-79	18	40	streak	streak	PROPN
crias-79	18	41	virus	virus	NOUN
crias-79	18	42	in	in	ADP
crias-79	18	43	kenya	kenya	PROPN
crias-79	18	44	.	.	PUNCT
crias-79	19	1	if	if	SCONJ
crias-79	19	2	adopted	adopt	VERB
crias-79	19	3	,	,	PUNCT
crias-79	19	4	the	the	DET
crias-79	19	5	findings	finding	NOUN
crias-79	19	6	of	of	ADP
crias-79	19	7	the	the	DET
crias-79	19	8	study	study	NOUN
crias-79	19	9	can	can	AUX
crias-79	19	10	help	help	VERB
crias-79	19	11	banana	banana	NOUN
crias-79	19	12	farmers	farmer	NOUN
crias-79	19	13	increase	increase	VERB
crias-79	19	14	the	the	DET
crias-79	19	15	yield	yield	NOUN
crias-79	19	16	translating	translate	VERB
crias-79	19	17	to	to	ADP
crias-79	19	18	higher	high	ADJ
crias-79	19	19	income	income	NOUN
crias-79	19	20	and	and	CCONJ
crias-79	19	21	poverty	poverty	NOUN
crias-79	19	22	eradication	eradication	NOUN
crias-79	19	23	.	.	PUNCT
crias-79	20	1	current	current	ADJ
crias-79	20	2	research	research	NOUN
crias-79	20	3	in	in	ADP
crias-79	20	4	agricultural	agricultural	ADJ
crias-79	20	5	sciences	science	NOUN
crias-79	20	6	2015	2015	NUM
crias-79	20	7	vol	vol	NOUN
crias-79	20	8	.	.	PROPN
crias-79	21	1	2	2	NUM
crias-79	21	2	,	,	PUNCT
crias-79	21	3	no	no	INTJ
crias-79	21	4	.	.	NOUN
crias-79	21	5	3	3	NUM
crias-79	21	6	,	,	PUNCT
crias-79	21	7	pp	pp	ADJ
crias-79	21	8	.	.	PUNCT
crias-79	22	1	81	81	NUM
crias-79	22	2	-	-	SYM
crias-79	22	3	89	89	NUM
crias-79	22	4	issn(e	issn(e	NOUN
crias-79	22	5	):	):	PUNCT
crias-79	22	6	2312	2312	NUM
crias-79	22	7	-	-	SYM
crias-79	22	8	6418	6418	NUM
crias-79	22	9	issn(p	issn(p	NUM
crias-79	22	10	):	):	PUNCT
crias-79	22	11	2313	2313	NUM
crias-79	22	12	-	-	SYM
crias-79	22	13	3716	3716	NUM
crias-79	22	14	doi	doi	NOUN
crias-79	22	15	:	:	PUNCT
crias-79	22	16	10.18488	10.18488	NUM
crias-79	22	17	/	/	SYM
crias-79	22	18	journal.68/2015.2.3/68.3.81.89	journal.68/2015.2.3/68.3.81.89	NOUN
crias-79	22	19	©	©	PROPN
crias-79	22	20	2015	2015	NUM
crias-79	22	21	conscientia	conscientia	PROPN
crias-79	22	22	beam	beam	PROPN
crias-79	22	23	.	.	PUNCT
crias-79	23	1	all	all	DET
crias-79	23	2	rights	right	NOUN
crias-79	23	3	reserved	reserve	VERB
crias-79	23	4	.	.	PUNCT
crias-79	24	1	http://crossmark.crossref.org/dialog/?doi=10.18488/journal.68/2015.2.3/68.3.81.89	http://crossmark.crossref.org/dialog/?doi=10.18488/journal.68/2015.2.3/68.3.81.89	NOUN
crias-79	24	2	current	current	ADJ
crias-79	24	3	research	research	NOUN
crias-79	24	4	in	in	ADP
crias-79	24	5	agricultural	agricultural	ADJ
crias-79	24	6	sciences	science	NOUN
crias-79	24	7	,	,	PUNCT
crias-79	24	8	2015	2015	NUM
crias-79	24	9	,	,	PUNCT
crias-79	24	10	2(3	2(3	NUM
crias-79	24	11	):	):	PUNCT
crias-79	24	12	81	81	NUM
crias-79	24	13	-	-	SYM
crias-79	24	14	89	89	NUM
crias-79	24	15	82	82	NUM
crias-79	24	16	©	©	PROPN
crias-79	24	17	2015	2015	NUM
crias-79	24	18	conscientia	conscientia	PROPN
crias-79	24	19	beam	beam	PROPN
crias-79	24	20	.	.	PUNCT
crias-79	25	1	all	all	DET
crias-79	25	2	rights	right	NOUN
crias-79	25	3	reserved	reserve	VERB
crias-79	25	4	.	.	PUNCT
crias-79	26	1	1	1	X
crias-79	26	2	.	.	X
crias-79	26	3	introduction	introduction	NOUN
crias-79	26	4	in	in	ADP
crias-79	26	5	kenya	kenya	PROPN
crias-79	26	6	,	,	PUNCT
crias-79	26	7	banana	banana	PROPN
crias-79	26	8	is	be	AUX
crias-79	26	9	grown	grow	VERB
crias-79	26	10	for	for	ADP
crias-79	26	11	home	home	NOUN
crias-79	26	12	consumption	consumption	NOUN
crias-79	26	13	and	and	CCONJ
crias-79	26	14	for	for	ADP
crias-79	26	15	the	the	DET
crias-79	26	16	national	national	ADJ
crias-79	26	17	market	market	NOUN
crias-79	26	18	[	[	X
crias-79	26	19	1	1	NUM
crias-79	26	20	]	]	PUNCT
crias-79	26	21	.	.	PUNCT
crias-79	27	1	it	it	PRON
crias-79	27	2	is	be	AUX
crias-79	27	3	also	also	ADV
crias-79	27	4	perceived	perceive	VERB
crias-79	27	5	as	as	ADP
crias-79	27	6	a	a	DET
crias-79	27	7	major	major	ADJ
crias-79	27	8	avenue	avenue	NOUN
crias-79	27	9	to	to	PART
crias-79	27	10	alleviate	alleviate	VERB
crias-79	27	11	food	food	NOUN
crias-79	27	12	insecurity	insecurity	NOUN
crias-79	27	13	in	in	ADP
crias-79	27	14	the	the	DET
crias-79	27	15	region	region	NOUN
crias-79	28	1	[	[	X
crias-79	28	2	2	2	NUM
crias-79	28	3	]	]	PUNCT
crias-79	28	4	.	.	PUNCT
crias-79	29	1	despite	despite	SCONJ
crias-79	29	2	this	this	PRON
crias-79	29	3	,	,	PUNCT
crias-79	29	4	optimum	optimum	ADJ
crias-79	29	5	banana	banana	NOUN
crias-79	29	6	yields	yield	NOUN
crias-79	29	7	are	be	AUX
crias-79	29	8	lowered	lower	VERB
crias-79	29	9	by	by	ADP
crias-79	29	10	banana	banana	NOUN
crias-79	29	11	streak	streak	NOUN
crias-79	29	12	disease	disease	NOUN
crias-79	29	13	(	(	PUNCT
crias-79	29	14	bsd	bsd	NOUN
crias-79	29	15	)	)	PUNCT
crias-79	29	16	caused	cause	VERB
crias-79	29	17	by	by	ADP
crias-79	29	18	banana	banana	NOUN
crias-79	29	19	streak	streak	PROPN
crias-79	29	20	virus	virus	NOUN
crias-79	29	21	(	(	PUNCT
crias-79	29	22	bsv	bsv	NOUN
crias-79	29	23	)	)	PUNCT
crias-79	29	24	.	.	PUNCT
crias-79	30	1	bsv	bsv	PROPN
crias-79	30	2	is	be	AUX
crias-79	30	3	prevalent	prevalent	ADJ
crias-79	30	4	in	in	ADP
crias-79	30	5	all	all	DET
crias-79	30	6	banana	banana	NOUN
crias-79	30	7	growing	grow	VERB
crias-79	30	8	regions	region	NOUN
crias-79	30	9	in	in	ADP
crias-79	30	10	kenya	kenya	PROPN
crias-79	30	11	and	and	CCONJ
crias-79	30	12	all	all	DET
crias-79	30	13	popular	popular	ADJ
crias-79	30	14	cultivars	cultivar	NOUN
crias-79	30	15	grown	grow	VERB
crias-79	30	16	by	by	ADP
crias-79	30	17	farmers	farmer	NOUN
crias-79	30	18	are	be	AUX
crias-79	30	19	susceptible	susceptible	ADJ
crias-79	30	20	[	[	X
crias-79	30	21	3	3	NUM
crias-79	30	22	]	]	PUNCT
crias-79	30	23	.	.	PUNCT
crias-79	31	1	the	the	DET
crias-79	31	2	jkuat	jkuat	PROPN
crias-79	31	3	banana	banana	PROPN
crias-79	31	4	tissue	tissue	NOUN
crias-79	31	5	culture	culture	NOUN
crias-79	31	6	(	(	PUNCT
crias-79	31	7	tc	tc	NOUN
crias-79	31	8	)	)	PUNCT
crias-79	31	9	laboratory	laboratory	NOUN
crias-79	31	10	is	be	AUX
crias-79	31	11	one	one	NUM
crias-79	31	12	of	of	ADP
crias-79	31	13	the	the	DET
crias-79	31	14	biggest	big	ADJ
crias-79	31	15	in	in	ADP
crias-79	31	16	kenya	kenya	PROPN
crias-79	31	17	among	among	ADP
crias-79	31	18	others	other	NOUN
crias-79	31	19	like	like	ADP
crias-79	31	20	mimea	mimea	NUM
crias-79	31	21	limited	limit	VERB
crias-79	31	22	and	and	CCONJ
crias-79	31	23	kari	kari	X
crias-79	31	24	thika	thika	X
crias-79	31	25	,	,	PUNCT
crias-79	31	26	producing	produce	VERB
crias-79	31	27	over	over	ADP
crias-79	31	28	two	two	NUM
crias-79	31	29	million	million	NUM
crias-79	31	30	plantlets	plantlet	NOUN
crias-79	31	31	per	per	ADP
crias-79	31	32	year	year	NOUN
crias-79	31	33	[	[	X
crias-79	31	34	4	4	NUM
crias-79	31	35	]	]	PUNCT
crias-79	31	36	.	.	PUNCT
crias-79	32	1	the	the	DET
crias-79	32	2	propagation	propagation	NOUN
crias-79	32	3	method	method	NOUN
crias-79	32	4	in	in	ADP
crias-79	32	5	use	use	NOUN
crias-79	32	6	at	at	ADP
crias-79	32	7	the	the	DET
crias-79	32	8	jkuat	jkuat	PROPN
crias-79	32	9	commercial	commercial	ADJ
crias-79	32	10	laboratory	laboratory	NOUN
crias-79	32	11	is	be	AUX
crias-79	32	12	micro	micro	ADJ
crias-79	32	13	propagation	propagation	NOUN
crias-79	32	14	of	of	ADP
crias-79	32	15	banana	banana	NOUN
crias-79	32	16	corms	corm	NOUN
crias-79	32	17	through	through	ADP
crias-79	32	18	tissue	tissue	NOUN
crias-79	32	19	culture	culture	NOUN
crias-79	32	20	.	.	PUNCT
crias-79	33	1	this	this	DET
crias-79	33	2	method	method	NOUN
crias-79	33	3	ensures	ensure	VERB
crias-79	33	4	production	production	NOUN
crias-79	33	5	of	of	ADP
crias-79	33	6	sufficient	sufficient	ADJ
crias-79	33	7	planting	planting	NOUN
crias-79	33	8	materials	material	NOUN
crias-79	33	9	which	which	PRON
crias-79	33	10	are	be	AUX
crias-79	33	11	free	free	ADJ
crias-79	33	12	from	from	ADP
crias-79	33	13	most	most	ADJ
crias-79	33	14	disease	disease	NOUN
crias-79	33	15	causing	cause	VERB
crias-79	33	16	organisms	organism	NOUN
crias-79	33	17	but	but	CCONJ
crias-79	33	18	are	be	AUX
crias-79	33	19	not	not	PART
crias-79	33	20	free	free	ADJ
crias-79	33	21	from	from	ADP
crias-79	33	22	banana	banana	NOUN
crias-79	33	23	viruses	virus	NOUN
crias-79	33	24	.	.	PUNCT
crias-79	34	1	the	the	DET
crias-79	34	2	jkuat	jkuat	PROPN
crias-79	34	3	tc	tc	PROPN
crias-79	34	4	laboratory	laboratory	NOUN
crias-79	34	5	supplies	supply	NOUN
crias-79	34	6	planting	planting	NOUN
crias-79	34	7	materials	material	NOUN
crias-79	34	8	all	all	ADV
crias-79	34	9	over	over	ADP
crias-79	34	10	the	the	DET
crias-79	34	11	country	country	NOUN
crias-79	34	12	and	and	CCONJ
crias-79	34	13	the	the	DET
crias-79	34	14	east	east	ADJ
crias-79	34	15	african	african	ADJ
crias-79	34	16	region	region	NOUN
crias-79	34	17	including	include	VERB
crias-79	34	18	ethiopia	ethiopia	PROPN
crias-79	34	19	,	,	PUNCT
crias-79	34	20	southern	southern	ADJ
crias-79	34	21	sudan	sudan	PROPN
crias-79	34	22	and	and	CCONJ
crias-79	34	23	somalia	somalia	PROPN
crias-79	35	1	[	[	X
crias-79	35	2	4	4	NUM
crias-79	35	3	]	]	PUNCT
crias-79	35	4	.	.	PUNCT
crias-79	36	1	initiation	initiation	NOUN
crias-79	36	2	of	of	ADP
crias-79	36	3	up	up	ADP
crias-79	36	4	to	to	PART
crias-79	36	5	400	400	NUM
crias-79	36	6	,	,	PUNCT
crias-79	36	7	100	100	NUM
crias-79	36	8	,	,	PUNCT
crias-79	36	9	and	and	CCONJ
crias-79	36	10	100	100	NUM
crias-79	36	11	pieces	piece	NOUN
crias-79	36	12	from	from	ADP
crias-79	36	13	jkuat	jkuat	PROPN
crias-79	36	14	,	,	PUNCT
crias-79	36	15	kisii	kisii	ADJ
crias-79	36	16	and	and	CCONJ
crias-79	36	17	thika	thika	NOUN
crias-79	36	18	orchards	orchard	NOUN
crias-79	36	19	,	,	PUNCT
crias-79	36	20	respectively	respectively	ADV
crias-79	36	21	are	be	AUX
crias-79	36	22	used	use	VERB
crias-79	36	23	in	in	ADP
crias-79	36	24	the	the	DET
crias-79	36	25	tc	tc	NOUN
crias-79	36	26	laboratory	laboratory	NOUN
crias-79	36	27	every	every	DET
crias-79	36	28	month	month	NOUN
crias-79	36	29	.	.	PUNCT
crias-79	37	1	it	it	PRON
crias-79	37	2	is	be	AUX
crias-79	37	3	therefore	therefore	ADV
crias-79	37	4	important	important	ADJ
crias-79	37	5	to	to	PART
crias-79	37	6	screen	screen	VERB
crias-79	37	7	for	for	ADP
crias-79	37	8	the	the	DET
crias-79	37	9	presence	presence	NOUN
crias-79	37	10	of	of	ADP
crias-79	37	11	viruses	virus	NOUN
crias-79	37	12	in	in	ADP
crias-79	37	13	initiation	initiation	NOUN
crias-79	37	14	materials	material	NOUN
crias-79	37	15	before	before	ADP
crias-79	37	16	using	use	VERB
crias-79	37	17	for	for	ADP
crias-79	37	18	massive	massive	ADJ
crias-79	37	19	tc	tc	NOUN
crias-79	37	20	plantlets	plantlet	NOUN
crias-79	37	21	production	production	NOUN
crias-79	37	22	.	.	PUNCT
crias-79	38	1	banana	banana	PROPN
crias-79	38	2	streak	streak	PROPN
crias-79	38	3	virus	virus	NOUN
crias-79	38	4	-	-	PUNCT
crias-79	38	5	infected	infect	VERB
crias-79	38	6	banana	banana	NOUN
crias-79	38	7	plants	plant	NOUN
crias-79	38	8	frequently	frequently	ADV
crias-79	38	9	express	express	VERB
crias-79	38	10	broken	broken	ADJ
crias-79	38	11	or	or	CCONJ
crias-79	38	12	continuous	continuous	ADJ
crias-79	38	13	chlorotic	chlorotic	ADJ
crias-79	38	14	or	or	CCONJ
crias-79	38	15	necrotic	necrotic	ADJ
crias-79	38	16	streaks	streak	NOUN
crias-79	38	17	on	on	ADP
crias-79	38	18	the	the	DET
crias-79	38	19	leaves	leave	NOUN
crias-79	38	20	,	,	PUNCT
crias-79	38	21	stunting	stunt	VERB
crias-79	38	22	of	of	ADP
crias-79	38	23	diseased	diseased	ADJ
crias-79	38	24	plants	plant	NOUN
crias-79	38	25	and	and	CCONJ
crias-79	38	26	occasionally	occasionally	ADV
crias-79	38	27	heart	heart	NOUN
crias-79	38	28	-	-	PUNCT
crias-79	38	29	rot	rot	NOUN
crias-79	38	30	of	of	ADP
crias-79	38	31	the	the	DET
crias-79	38	32	pseudostem	pseudostem	NOUN
crias-79	38	33	and	and	CCONJ
crias-79	38	34	plant	plant	NOUN
crias-79	38	35	death	death	NOUN
crias-79	38	36	.	.	PUNCT
crias-79	39	1	however	however	ADV
crias-79	39	2	,	,	PUNCT
crias-79	39	3	the	the	DET
crias-79	39	4	disease	disease	NOUN
crias-79	39	5	symptoms	symptom	NOUN
crias-79	39	6	may	may	AUX
crias-79	39	7	vary	vary	VERB
crias-79	39	8	depending	depend	VERB
crias-79	39	9	on	on	ADP
crias-79	39	10	virus	virus	NOUN
crias-79	39	11	strain	strain	NOUN
crias-79	39	12	,	,	PUNCT
crias-79	39	13	host	host	NOUN
crias-79	39	14	genotype	genotype	NOUN
crias-79	39	15	,	,	PUNCT
crias-79	39	16	level	level	NOUN
crias-79	39	17	of	of	ADP
crias-79	39	18	management	management	NOUN
crias-79	39	19	and	and	CCONJ
crias-79	39	20	environmental	environmental	ADJ
crias-79	39	21	conditions	condition	NOUN
crias-79	39	22	harper	harper	PROPN
crias-79	39	23	,	,	PUNCT
crias-79	39	24	et	et	PROPN
crias-79	39	25	al	al	PROPN
crias-79	39	26	.	.	PUNCT
crias-79	40	1	[	[	X
crias-79	40	2	5	5	NUM
crias-79	40	3	]	]	PUNCT
crias-79	40	4	,	,	PUNCT
crias-79	40	5	dahal	dahal	NOUN
crias-79	40	6	,	,	PUNCT
crias-79	40	7	et	et	PROPN
crias-79	40	8	al	al	PROPN
crias-79	40	9	.	.	PUNCT
crias-79	41	1	[	[	X
crias-79	41	2	6	6	NUM
crias-79	41	3	]	]	PUNCT
crias-79	41	4	,	,	PUNCT
crias-79	41	5	and	and	CCONJ
crias-79	41	6	lockhart	lockhart	PROPN
crias-79	41	7	and	and	CCONJ
crias-79	41	8	jones	jones	PROPN
crias-79	41	9	[	[	X
crias-79	41	10	7	7	NUM
crias-79	41	11	]	]	PUNCT
crias-79	41	12	.	.	PUNCT
crias-79	42	1	banana	banana	PROPN
crias-79	42	2	streak	streak	PROPN
crias-79	42	3	virus	virus	NOUN
crias-79	42	4	causes	cause	VERB
crias-79	42	5	yield	yield	VERB
crias-79	42	6	loss	loss	NOUN
crias-79	42	7	of	of	ADP
crias-79	42	8	up	up	ADP
crias-79	42	9	to	to	PART
crias-79	42	10	90	90	NUM
crias-79	42	11	%	%	NOUN
crias-79	43	1	[	[	X
crias-79	43	2	8	8	NUM
crias-79	43	3	]	]	PUNCT
crias-79	43	4	,	,	PUNCT
crias-79	43	5	[	[	X
crias-79	43	6	9	9	NUM
crias-79	43	7	]	]	PUNCT
crias-79	43	8	.	.	PUNCT
crias-79	44	1	there	there	PRON
crias-79	44	2	are	be	VERB
crias-79	44	3	many	many	ADJ
crias-79	44	4	bsv	bsv	ADJ
crias-79	44	5	elimination	elimination	NOUN
crias-79	44	6	methods	method	NOUN
crias-79	44	7	in	in	ADP
crias-79	44	8	use	use	NOUN
crias-79	44	9	today	today	NOUN
crias-79	44	10	which	which	PRON
crias-79	44	11	include	include	VERB
crias-79	44	12	chemotherapy	chemotherapy	NOUN
crias-79	44	13	(	(	PUNCT
crias-79	44	14	the	the	DET
crias-79	44	15	use	use	NOUN
crias-79	44	16	chemicals	chemical	NOUN
crias-79	44	17	such	such	ADJ
crias-79	44	18	as	as	ADP
crias-79	44	19	ribavirin	ribavirin	NOUN
crias-79	44	20	and	and	CCONJ
crias-79	44	21	salicylic	salicylic	ADJ
crias-79	44	22	acid	acid	NOUN
crias-79	44	23	)	)	PUNCT
crias-79	44	24	,	,	PUNCT
crias-79	44	25	thermotherapy	thermotherapy	NOUN
crias-79	44	26	and	and	CCONJ
crias-79	44	27	meristem	meristem	NOUN
crias-79	44	28	tip	tip	NOUN
crias-79	44	29	culture	culture	NOUN
crias-79	44	30	which	which	PRON
crias-79	44	31	involves	involve	VERB
crias-79	44	32	the	the	DET
crias-79	44	33	use	use	NOUN
crias-79	44	34	of	of	ADP
crias-79	44	35	the	the	DET
crias-79	44	36	apical	apical	ADJ
crias-79	44	37	dome	dome	NOUN
crias-79	44	38	or	or	CCONJ
crias-79	44	39	shoot	shoot	VERB
crias-79	44	40	tip	tip	NOUN
crias-79	44	41	with	with	ADP
crias-79	44	42	a	a	DET
crias-79	44	43	few	few	ADJ
crias-79	44	44	leaf	leaf	NOUN
crias-79	44	45	primordia	primordium	NOUN
crias-79	44	46	of	of	ADP
crias-79	44	47	the	the	DET
crias-79	44	48	size	size	NOUN
crias-79	44	49	less	less	ADJ
crias-79	44	50	than	than	ADP
crias-79	44	51	2	2	NUM
crias-79	44	52	mm	mm	NOUN
crias-79	44	53	in	in	ADP
crias-79	44	54	length	length	NOUN
crias-79	44	55	as	as	ADP
crias-79	44	56	explant	explant	NOUN
crias-79	44	57	,	,	PUNCT
crias-79	44	58	cryotherapy	cryotherapy	NOUN
crias-79	44	59	and	and	CCONJ
crias-79	44	60	electrotherapy	electrotherapy	NOUN
crias-79	44	61	[	[	X
crias-79	44	62	10	10	NUM
crias-79	44	63	]	]	PUNCT
crias-79	44	64	.	.	PUNCT
crias-79	45	1	in	in	ADP
crias-79	45	2	this	this	DET
crias-79	45	3	study	study	NOUN
crias-79	45	4	,	,	PUNCT
crias-79	45	5	three	three	NUM
crias-79	45	6	virus	virus	NOUN
crias-79	45	7	elimination	elimination	NOUN
crias-79	45	8	methods	method	NOUN
crias-79	45	9	namely	namely	ADV
crias-79	45	10	chemotherapy	chemotherapy	NOUN
crias-79	45	11	,	,	PUNCT
crias-79	45	12	thermotherapy	thermotherapy	NOUN
crias-79	45	13	and	and	CCONJ
crias-79	45	14	meristem	meristem	NOUN
crias-79	45	15	tip	tip	NOUN
crias-79	45	16	culture	culture	NOUN
crias-79	45	17	were	be	AUX
crias-79	45	18	evaluated	evaluate	VERB
crias-79	45	19	to	to	PART
crias-79	45	20	determine	determine	VERB
crias-79	45	21	their	their	PRON
crias-79	45	22	effectiveness	effectiveness	NOUN
crias-79	45	23	in	in	ADP
crias-79	45	24	eliminating	eliminate	VERB
crias-79	45	25	bsv	bsv	NOUN
crias-79	45	26	from	from	ADP
crias-79	45	27	infected	infected	ADJ
crias-79	45	28	banana	banana	NOUN
crias-79	45	29	explants	explant	NOUN
crias-79	45	30	.	.	PUNCT
crias-79	46	1	2	2	X
crias-79	46	2	.	.	X
crias-79	46	3	materials	material	NOUN
crias-79	46	4	and	and	CCONJ
crias-79	46	5	methods	method	NOUN
crias-79	46	6	2.1	2.1	NUM
crias-79	46	7	.	.	PUNCT
crias-79	47	1	sampling	sample	VERB
crias-79	47	2	sites	site	NOUN
crias-79	47	3	three	three	NUM
crias-79	47	4	orchards	orchard	NOUN
crias-79	47	5	were	be	AUX
crias-79	47	6	selected	select	VERB
crias-79	47	7	from	from	ADP
crias-79	47	8	four	four	NUM
crias-79	47	9	different	different	ADJ
crias-79	47	10	banana	banana	NOUN
crias-79	47	11	orchards	orchard	NOUN
crias-79	47	12	,	,	PUNCT
crias-79	47	13	namely	namely	ADV
crias-79	47	14	kisii	kisii	ADJ
crias-79	47	15	,	,	PUNCT
crias-79	47	16	thika	thika	NOUN
crias-79	47	17	and	and	CCONJ
crias-79	47	18	jkuat	jkuat	PROPN
crias-79	47	19	for	for	ADP
crias-79	47	20	leaf	leaf	NOUN
crias-79	47	21	and	and	CCONJ
crias-79	47	22	sucker	sucker	NOUN
crias-79	47	23	samples	sample	NOUN
crias-79	47	24	.	.	PUNCT
crias-79	48	1	nusu	nusu	NOUN
crias-79	48	2	ng’ombe	ng’ombe	NOUN
crias-79	48	3	,	,	PUNCT
crias-79	48	4	kampala	kampala	PROPN
crias-79	48	5	and	and	CCONJ
crias-79	48	6	fhia	fhia	VERB
crias-79	48	7	18	18	NUM
crias-79	48	8	varieties	variety	NOUN
crias-79	48	9	were	be	AUX
crias-79	48	10	randomly	randomly	ADV
crias-79	48	11	sampled	sample	VERB
crias-79	48	12	(	(	PUNCT
crias-79	48	13	five	five	NUM
crias-79	48	14	symptomatic	symptomatic	ADJ
crias-79	48	15	and	and	CCONJ
crias-79	48	16	five	five	NUM
crias-79	48	17	asymptomatic	asymptomatic	ADJ
crias-79	48	18	)	)	PUNCT
crias-79	48	19	from	from	ADP
crias-79	48	20	kisii	kisii	PROPN
crias-79	48	21	,	,	PUNCT
crias-79	48	22	jkuat	jkuat	PROPN
crias-79	48	23	and	and	CCONJ
crias-79	48	24	thika	thika	NOUN
crias-79	48	25	orchards	orchard	NOUN
crias-79	48	26	respectively	respectively	ADV
crias-79	48	27	.	.	PUNCT
crias-79	49	1	2.2	2.2	NUM
crias-79	49	2	.	.	PUNCT
crias-79	49	3	nucleic	nucleic	ADJ
crias-79	49	4	acid	acid	PROPN
crias-79	49	5	extraction	extraction	NOUN
crias-79	49	6	,	,	PUNCT
crias-79	49	7	pcr	pcr	NOUN
crias-79	49	8	and	and	CCONJ
crias-79	49	9	gel	gel	NOUN
crias-79	49	10	electrophoresis	electrophoresis	NOUN
crias-79	49	11	total	total	ADJ
crias-79	49	12	genomic	genomic	ADJ
crias-79	49	13	dna	dna	NOUN
crias-79	49	14	extraction	extraction	NOUN
crias-79	49	15	from	from	ADP
crias-79	49	16	the	the	DET
crias-79	49	17	leaf	leaf	NOUN
crias-79	49	18	samples	sample	NOUN
crias-79	49	19	was	be	AUX
crias-79	49	20	done	do	VERB
crias-79	49	21	using	use	VERB
crias-79	49	22	the	the	DET
crias-79	49	23	ctab	ctab	ADJ
crias-79	49	24	method	method	NOUN
crias-79	49	25	as	as	SCONJ
crias-79	49	26	described	describe	VERB
crias-79	49	27	by	by	ADP
crias-79	49	28	doyle	doyle	NOUN
crias-79	49	29	and	and	CCONJ
crias-79	49	30	doyle	doyle	NOUN
crias-79	50	1	[	[	X
crias-79	50	2	11	11	NUM
crias-79	50	3	]	]	PUNCT
crias-79	50	4	.	.	PUNCT
crias-79	51	1	nucleic	nucleic	ADJ
crias-79	51	2	acid	acid	ADJ
crias-79	51	3	quantification	quantification	NOUN
crias-79	51	4	was	be	AUX
crias-79	51	5	done	do	VERB
crias-79	51	6	by	by	ADP
crias-79	51	7	observing	observe	VERB
crias-79	51	8	the	the	DET
crias-79	51	9	bands	band	NOUN
crias-79	51	10	on	on	ADP
crias-79	51	11	0.8	0.8	NUM
crias-79	51	12	%	%	NOUN
crias-79	51	13	agarose	agarose	NOUN
crias-79	51	14	gel	gel	NOUN
crias-79	51	15	(	(	PUNCT
crias-79	51	16	0.8	0.8	NUM
crias-79	51	17	g	g	NOUN
crias-79	51	18	agarose	agarose	NOUN
crias-79	51	19	gel	gel	NOUN
crias-79	51	20	dissolved	dissolve	VERB
crias-79	51	21	in	in	ADP
crias-79	51	22	100ml	100ml	PROPN
crias-79	51	23	of	of	ADP
crias-79	51	24	tris	tris	ADJ
crias-79	51	25	boric	boric	ADJ
crias-79	51	26	edta	edta	NOUN
crias-79	51	27	(	(	PUNCT
crias-79	51	28	1	1	NUM
crias-79	51	29	x	x	SYM
crias-79	51	30	tbe	tbe	VERB
crias-79	51	31	)	)	PUNCT
crias-79	51	32	to	to	PART
crias-79	51	33	confirm	confirm	VERB
crias-79	51	34	presence	presence	NOUN
crias-79	51	35	and	and	CCONJ
crias-79	51	36	quality	quality	NOUN
crias-79	51	37	of	of	ADP
crias-79	51	38	nucleic	nucleic	ADJ
crias-79	51	39	acid	acid	NOUN
crias-79	51	40	.	.	PUNCT
crias-79	52	1	the	the	DET
crias-79	52	2	purity	purity	NOUN
crias-79	52	3	and	and	CCONJ
crias-79	52	4	nucleic	nucleic	ADJ
crias-79	52	5	acid	acid	NOUN
crias-79	52	6	concentration	concentration	NOUN
crias-79	52	7	was	be	AUX
crias-79	52	8	determined	determine	VERB
crias-79	52	9	by	by	ADP
crias-79	52	10	measurement	measurement	NOUN
crias-79	52	11	of	of	ADP
crias-79	52	12	the	the	DET
crias-79	52	13	absorbance	absorbance	NOUN
crias-79	52	14	at	at	ADP
crias-79	52	15	260	260	NUM
crias-79	52	16	and	and	CCONJ
crias-79	52	17	280	280	NUM
crias-79	52	18	nm	nm	NOUN
crias-79	52	19	in	in	ADP
crias-79	52	20	a	a	DET
crias-79	52	21	spectrophotometer	spectrophotometer	NOUN
crias-79	52	22	.	.	PUNCT
crias-79	53	1	current	current	ADJ
crias-79	53	2	research	research	NOUN
crias-79	53	3	in	in	ADP
crias-79	53	4	agricultural	agricultural	ADJ
crias-79	53	5	sciences	science	NOUN
crias-79	53	6	,	,	PUNCT
crias-79	53	7	2015	2015	NUM
crias-79	53	8	,	,	PUNCT
crias-79	53	9	2(3	2(3	NUM
crias-79	53	10	):	):	PUNCT
crias-79	53	11	81	81	NUM
crias-79	53	12	-	-	SYM
crias-79	53	13	89	89	NUM
crias-79	53	14	83	83	NUM
crias-79	53	15	©	©	PROPN
crias-79	53	16	2015	2015	NUM
crias-79	53	17	conscientia	conscientia	PROPN
crias-79	53	18	beam	beam	PROPN
crias-79	53	19	.	.	PUNCT
crias-79	54	1	all	all	DET
crias-79	54	2	rights	right	NOUN
crias-79	54	3	reserved	reserve	VERB
crias-79	54	4	.	.	PUNCT
crias-79	55	1	five	five	NUM
crias-79	55	2	specific	specific	ADJ
crias-79	55	3	primer	primer	NOUN
crias-79	55	4	pairs	pair	NOUN
crias-79	55	5	(	(	PUNCT
crias-79	55	6	table	table	NOUN
crias-79	55	7	1.0	1.0	NUM
crias-79	55	8	)	)	PUNCT
crias-79	55	9	for	for	ADP
crias-79	55	10	detecting	detect	VERB
crias-79	55	11	each	each	DET
crias-79	55	12	bsv	bsv	ADJ
crias-79	55	13	strain	strain	NOUN
crias-79	55	14	were	be	AUX
crias-79	55	15	used	use	VERB
crias-79	55	16	for	for	ADP
crias-79	55	17	detecting	detect	VERB
crias-79	55	18	the	the	DET
crias-79	55	19	presence	presence	NOUN
crias-79	55	20	of	of	ADP
crias-79	55	21	the	the	DET
crias-79	55	22	various	various	ADJ
crias-79	55	23	bsv	bsv	NOUN
crias-79	55	24	strains	strain	NOUN
crias-79	55	25	in	in	ADP
crias-79	55	26	the	the	DET
crias-79	55	27	banana	banana	NOUN
crias-79	55	28	leaves	leave	NOUN
crias-79	55	29	.	.	PUNCT
crias-79	56	1	pcr	pcr	NOUN
crias-79	56	2	mixes	mix	NOUN
crias-79	56	3	(	(	PUNCT
crias-79	56	4	20	20	NUM
crias-79	56	5	μl	μl	DET
crias-79	56	6	)	)	PUNCT
crias-79	56	7	containing	contain	VERB
crias-79	56	8	10	10	NUM
crias-79	56	9	μl	μl	NUM
crias-79	56	10	2x	2x	NUM
crias-79	56	11	gotaq	gotaq	PROPN
crias-79	56	12	green	green	ADJ
crias-79	56	13	master	master	NOUN
crias-79	56	14	mix	mix	NOUN
crias-79	56	15	(	(	PUNCT
crias-79	56	16	promega	promega	PROPN
crias-79	56	17	corp	corp	PROPN
crias-79	56	18	,	,	PUNCT
crias-79	56	19	madison	madison	PROPN
crias-79	56	20	,	,	PUNCT
crias-79	56	21	wi	wi	PROPN
crias-79	56	22	)	)	PUNCT
crias-79	56	23	,	,	PUNCT
crias-79	56	24	5	5	NUM
crias-79	56	25	ρmol	ρmol	NOUN
crias-79	56	26	of	of	ADP
crias-79	56	27	each	each	DET
crias-79	56	28	primer	primer	NOUN
crias-79	56	29	,	,	PUNCT
crias-79	56	30	1	1	NUM
crias-79	56	31	μl	μl	ADP
crias-79	56	32	of	of	ADP
crias-79	56	33	nucleic	nucleic	ADJ
crias-79	56	34	acid	acid	NOUN
crias-79	56	35	extract	extract	NOUN
crias-79	56	36	and	and	CCONJ
crias-79	56	37	water	water	NOUN
crias-79	56	38	to	to	ADP
crias-79	56	39	final	final	ADJ
crias-79	56	40	volume	volume	NOUN
crias-79	56	41	.	.	PUNCT
crias-79	57	1	polymerase	polymerase	NOUN
crias-79	57	2	chain	chain	NOUN
crias-79	57	3	reaction	reaction	NOUN
crias-79	57	4	(	(	PUNCT
crias-79	57	5	pcr	pcr	NOUN
crias-79	57	6	)	)	PUNCT
crias-79	57	7	cycling	cycling	NOUN
crias-79	57	8	conditions	condition	NOUN
crias-79	57	9	included	include	VERB
crias-79	57	10	an	an	DET
crias-79	57	11	initial	initial	ADJ
crias-79	57	12	denaturation	denaturation	NOUN
crias-79	57	13	of	of	ADP
crias-79	57	14	94	94	NUM
crias-79	57	15	°	°	ADP
crias-79	57	16	c	c	NOUN
crias-79	57	17	for	for	ADP
crias-79	57	18	2	2	NUM
crias-79	57	19	min	min	NOUN
crias-79	57	20	followed	follow	VERB
crias-79	57	21	by	by	ADP
crias-79	57	22	35	35	NUM
crias-79	57	23	cycles	cycle	NOUN
crias-79	57	24	at	at	ADP
crias-79	57	25	94	94	NUM
crias-79	57	26	°	°	ADP
crias-79	57	27	c	c	NOUN
crias-79	57	28	for	for	ADP
crias-79	57	29	20	20	NUM
crias-79	57	30	s	s	NOUN
crias-79	57	31	,	,	PUNCT
crias-79	57	32	57	57	NUM
crias-79	57	33	°	°	ADP
crias-79	57	34	c	c	NOUN
crias-79	57	35	for	for	ADP
crias-79	57	36	20	20	NUM
crias-79	57	37	s	s	NOUN
crias-79	57	38	,	,	PUNCT
crias-79	57	39	and	and	CCONJ
crias-79	57	40	72	72	NUM
crias-79	57	41	°	°	NOUN
crias-79	57	42	c	c	NOUN
crias-79	57	43	for	for	ADP
crias-79	57	44	30	30	NUM
crias-79	57	45	s	s	NOUN
crias-79	57	46	,	,	PUNCT
crias-79	57	47	with	with	ADP
crias-79	57	48	a	a	DET
crias-79	57	49	final	final	ADJ
crias-79	57	50	extension	extension	NOUN
crias-79	57	51	at	at	ADP
crias-79	57	52	72	72	NUM
crias-79	57	53	°	°	ADP
crias-79	57	54	c	c	NOUN
crias-79	57	55	for	for	ADP
crias-79	57	56	2	2	NUM
crias-79	57	57	min	min	NOUN
crias-79	57	58	.	.	PROPN
crias-79	57	59	reaction	reaction	NOUN
crias-79	57	60	products	product	NOUN
crias-79	57	61	were	be	AUX
crias-79	57	62	analyzed	analyze	VERB
crias-79	57	63	by	by	ADP
crias-79	57	64	agarose	agarose	NOUN
crias-79	57	65	gel	gel	NOUN
crias-79	57	66	electrophoresis	electrophoresis	NOUN
crias-79	57	67	and	and	CCONJ
crias-79	57	68	amplicons	amplicon	NOUN
crias-79	57	69	visualized	visualize	VERB
crias-79	57	70	in	in	ADP
crias-79	57	71	1.5	1.5	NUM
crias-79	57	72	%	%	NOUN
crias-79	57	73	agarose	agarose	X
crias-79	57	74	gel	gel	NOUN
crias-79	57	75	.	.	PUNCT
crias-79	58	1	table-1	table-1	NUM
crias-79	58	2	.	.	PUNCT
crias-79	59	1	primer	primer	NOUN
crias-79	59	2	pairs	pair	NOUN
crias-79	59	3	used	use	VERB
crias-79	59	4	in	in	ADP
crias-79	59	5	the	the	DET
crias-79	59	6	amplification	amplification	NOUN
crias-79	59	7	of	of	ADP
crias-79	59	8	various	various	ADJ
crias-79	59	9	bsv	bsv	NOUN
crias-79	59	10	strains	strain	NOUN
crias-79	59	11	primer	primer	NOUN
crias-79	59	12	name	name	NOUN
crias-79	59	13	primer	primer	NOUN
crias-79	59	14	sequence	sequence	NOUN
crias-79	59	15	gene	gene	NOUN
crias-79	59	16	bank	bank	NOUN
crias-79	59	17	accession	accession	NOUN
crias-79	59	18	no1	no1	PROPN
crias-79	59	19	virus	virus	NOUN
crias-79	59	20	strain2	strain2	NOUN
crias-79	59	21	fragment	fragment	NOUN
crias-79	59	22	length	length	NOUN
crias-79	59	23	(	(	PUNCT
crias-79	59	24	in	in	ADP
crias-79	59	25	base	base	NOUN
crias-79	59	26	pairs	pair	NOUN
crias-79	59	27	)	)	PUNCT
crias-79	59	28	rd	rd	NOUN
crias-79	59	29	-	-	PUNCT
crias-79	59	30	f1	f1	NOUN
crias-79	59	31	5’-atctgaaggtgtgttgatcaatgc-3	5’-atctgaaggtgtgttgatcaatgc-3	NUM
crias-79	59	32	’	'	PUNCT
crias-79	59	33	af215816	af215816	PROPN
crias-79	59	34	bsv	bsv	PROPN
crias-79	59	35	-	-	PROPN
crias-79	59	36	rd	rd	PROPN
crias-79	59	37	522	522	NUM
crias-79	59	38	rd	rd	NOUN
crias-79	59	39	-	-	PUNCT
crias-79	59	40	r1	r1	PROPN
crias-79	59	41	5’-gctcactccgcatcttatcagtc-3	5’-gctcactccgcatcttatcagtc-3	NUM
crias-79	59	42	’	'	PUNCT
crias-79	59	43	af215816	af215816	PROPN
crias-79	59	44	bsv	bsv	PROPN
crias-79	59	45	-	-	PROPN
crias-79	59	46	rd	rd	PROPN
crias-79	59	47	522	522	NUM
crias-79	59	48	cav	cav	NOUN
crias-79	59	49	-	-	PUNCT
crias-79	59	50	f1	f1	NOUN
crias-79	59	51	5’-aggattggatgtgaagtttgagc-3	5’-aggattggatgtgaagtttgagc-3	NUM
crias-79	59	52	’	'	PUNCT
crias-79	59	53	af215815	af215815	NOUN
crias-79	59	54	bsv	bsv	PROPN
crias-79	59	55	-	-	PROPN
crias-79	59	56	cav	cav	NOUN
crias-79	59	57	782	782	NUM
crias-79	59	58	cav	cav	NOUN
crias-79	59	59	-	-	PUNCT
crias-79	59	60	r1	r1	VERB
crias-79	59	61	-r	-r	PUNCT
crias-79	59	62	5’-accaataatgcaagggacgc-3	5’-accaataatgcaagggacgc-3	NUM
crias-79	59	63	’	'	PUNCT
crias-79	59	64	af215815	af215815	NOUN
crias-79	59	65	bsv	bsv	PROPN
crias-79	59	66	-	-	PROPN
crias-79	59	67	cav	cav	NOUN
crias-79	59	68	782	782	NUM
crias-79	59	69	gf	gf	NOUN
crias-79	59	70	-	-	PUNCT
crias-79	59	71	f1	f1	NOUN
crias-79	59	72	5’acgaactatcacgacttgttgttcaagc3	5’acgaactatcacgacttgttgttcaagc3	NUM
crias-79	59	73	’	'	PUNCT
crias-79	59	74	af215814	af215814	PROPN
crias-79	59	75	bsv	bsv	PROPN
crias-79	59	76	-	-	PUNCT
crias-79	59	77	gfv	gfv	NOUN
crias-79	59	78	476	476	NUM
crias-79	59	79	gf	gf	NOUN
crias-79	59	80	-	-	PUNCT
crias-79	59	81	r1	r1	VERB
crias-79	59	82	5’-tcggtggaatagtcctgagtcttc-3	5’-tcggtggaatagtcctgagtcttc-3	NUM
crias-79	59	83	’	'	PUNCT
crias-79	59	84	af215815	af215815	NOUN
crias-79	59	85	bsv	bsv	PROPN
crias-79	59	86	-	-	PUNCT
crias-79	59	87	gfv	gfv	ADJ
crias-79	59	88	476	476	NUM
crias-79	59	89	bsv4673	bsv4673	NOUN
crias-79	59	90	-	-	PUNCT
crias-79	59	91	f1	f1	NOUN
crias-79	59	92	5’-ggaatgaaagagcaggcc-3	5’-ggaatgaaagagcaggcc-3	NUM
crias-79	59	93	’	'	PUNCT
crias-79	59	94	aj002234	aj002234	ADJ
crias-79	59	95	bsoev	bsoev	NOUN
crias-79	59	96	644	644	NUM
crias-79	59	97	bsv5317	bsv5317	NOUN
crias-79	59	98	-	-	PUNCT
crias-79	59	99	r1	r1	PROPN
crias-79	59	100	5’-ggaatgaaagagcaggcc-3	5’-ggaatgaaagagcaggcc-3	NUM
crias-79	59	101	’	'	PUNCT
crias-79	59	102	5’-agtcattgggtcaacctctgtc-3	5’-agtcattgggtcaacctctgtc-3	NUM
crias-79	59	103	’	'	PUNCT
crias-79	59	104	aj002234	aj002234	ADJ
crias-79	59	105	bsvoev	bsvoev	NOUN
crias-79	59	106	644	644	NUM
crias-79	59	107	1a	1a	NUM
crias-79	59	108	-	-	PUNCT
crias-79	59	109	f1	f1	NOUN
crias-79	59	110	5’-ctntaygartggytnatgccnttygg3	5’-ctntaygartggytnatgccnttygg3	NOUN
crias-79	59	111	’	'	PUNCT
crias-79	59	112	ay189378	ay189378	NOUN
crias-79	59	113	badna	badna	NOUN
crias-79	59	114	597	597	NUM
crias-79	59	115	4’-r1	4’-r1	NUM
crias-79	59	116	5’-tccayttrcanaynscnccccancc-3	5’-tccayttrcanaynscnccccancc-3	NUM
crias-79	59	117	’	'	PUNCT
crias-79	59	118	ay189383	ay189383	NOUN
crias-79	59	119	badna	badna	NOUN
crias-79	59	120	597	597	NUM
crias-79	59	121	adopted	adopt	VERB
crias-79	59	122	from	from	ADP
crias-79	59	123	geering	geere	VERB
crias-79	59	124	,	,	PUNCT
crias-79	59	125	et	et	PROPN
crias-79	59	126	al	al	PROPN
crias-79	59	127	.	.	PUNCT
crias-79	60	1	[	[	X
crias-79	60	2	12	12	NUM
crias-79	60	3	]	]	PUNCT
crias-79	60	4	,	,	PUNCT
crias-79	60	5	harper	harper	NOUN
crias-79	60	6	,	,	PUNCT
crias-79	60	7	et	et	PROPN
crias-79	60	8	al	al	PROPN
crias-79	60	9	.	.	PUNCT
crias-79	61	1	[	[	X
crias-79	61	2	13	13	NUM
crias-79	61	3	]	]	X
crias-79	61	4	bsv	bsv	PROPN
crias-79	61	5	-	-	PROPN
crias-79	61	6	rd	rd	NOUN
crias-79	61	7	=	=	NOUN
crias-79	61	8	bsv	bsv	PROPN
crias-79	61	9	red	red	ADJ
crias-79	61	10	dacca	dacca	PROPN
crias-79	61	11	,	,	PUNCT
crias-79	61	12	bsvcav=	bsvcav=	NUM
crias-79	61	13	bsv	bsv	PROPN
crias-79	61	14	cavendish	cavendish	PROPN
crias-79	61	15	,	,	PUNCT
crias-79	61	16	bsvgfv=	bsvgfv=	NUM
crias-79	61	17	bsv	bsv	ADJ
crias-79	61	18	gold	gold	NOUN
crias-79	61	19	finger	finger	NOUN
crias-79	61	20	,	,	PUNCT
crias-79	61	21	bsvbsoev=	bsvbsoev=	NUM
crias-79	61	22	bsv	bsv	X
crias-79	61	23	–	–	PUNCT
crias-79	61	24	mysore	mysore	NOUN
crias-79	61	25	,	,	PUNCT
crias-79	61	26	badna	badna	NOUN
crias-79	61	27	=	=	SYM
crias-79	61	28	degenerate	degenerate	ADJ
crias-79	61	29	primer	primer	NOUN
crias-79	61	30	1represents	1represents	NUM
crias-79	61	31	the	the	DET
crias-79	61	32	accession	accession	NOUN
crias-79	61	33	number	number	NOUN
crias-79	61	34	of	of	ADP
crias-79	61	35	the	the	DET
crias-79	61	36	sequence	sequence	NOUN
crias-79	61	37	used	use	VERB
crias-79	61	38	for	for	ADP
crias-79	61	39	primer	primer	NOUN
crias-79	61	40	designing	design	VERB
crias-79	61	41	2represents	2represents	NUM
crias-79	61	42	the	the	DET
crias-79	61	43	name	name	NOUN
crias-79	61	44	of	of	ADP
crias-79	61	45	the	the	DET
crias-79	61	46	virus	virus	NOUN
crias-79	61	47	strain	strain	VERB
crias-79	61	48	from	from	ADP
crias-79	61	49	which	which	PRON
crias-79	61	50	primers	primer	NOUN
crias-79	61	51	was	be	AUX
crias-79	61	52	designed	design	VERB
crias-79	61	53	2.3	2.3	NUM
crias-79	61	54	.	.	PUNCT
crias-79	62	1	multiplication	multiplication	NOUN
crias-79	62	2	of	of	ADP
crias-79	62	3	bsv	bsv	ADJ
crias-79	62	4	infected	infect	VERB
crias-79	62	5	plantlets	plantlet	NOUN
crias-79	62	6	suckers	sucker	NOUN
crias-79	62	7	were	be	AUX
crias-79	62	8	uprooted	uproot	VERB
crias-79	62	9	from	from	ADP
crias-79	62	10	the	the	DET
crias-79	62	11	three	three	NUM
crias-79	62	12	mother	mother	NOUN
crias-79	62	13	orchards	orchard	NOUN
crias-79	62	14	supplying	supply	VERB
crias-79	62	15	jkuat	jkuat	PROPN
crias-79	62	16	banana	banana	PROPN
crias-79	62	17	commercial	commercial	ADJ
crias-79	62	18	laboratory	laboratory	NOUN
crias-79	62	19	with	with	ADP
crias-79	62	20	planting	planting	NOUN
crias-79	62	21	materials	material	NOUN
crias-79	62	22	and	and	CCONJ
crias-79	62	23	taken	take	VERB
crias-79	62	24	in	in	ADP
crias-79	62	25	the	the	DET
crias-79	62	26	laboratory	laboratory	NOUN
crias-79	62	27	.	.	PUNCT
crias-79	63	1	they	they	PRON
crias-79	63	2	were	be	AUX
crias-79	63	3	surface	surface	NOUN
crias-79	63	4	sterilized	sterilize	VERB
crias-79	63	5	using	use	VERB
crias-79	63	6	70	70	NUM
crias-79	63	7	%	%	NOUN
crias-79	63	8	ethanol	ethanol	NOUN
crias-79	63	9	for	for	ADP
crias-79	63	10	about	about	ADV
crias-79	63	11	8	8	NUM
crias-79	63	12	to	to	PART
crias-79	63	13	10	10	NUM
crias-79	63	14	seconds	second	NOUN
crias-79	63	15	after	after	ADP
crias-79	63	16	which	which	PRON
crias-79	63	17	they	they	PRON
crias-79	63	18	were	be	AUX
crias-79	63	19	transferred	transfer	VERB
crias-79	63	20	for	for	ADP
crias-79	63	21	20	20	NUM
crias-79	63	22	minutes	minute	NOUN
crias-79	63	23	in	in	ADP
crias-79	63	24	70	70	NUM
crias-79	63	25	%	%	NOUN
crias-79	63	26	sodium	sodium	NOUN
crias-79	63	27	hypochlorite	hypochlorite	NOUN
crias-79	63	28	where	where	SCONJ
crias-79	63	29	three	three	NUM
crias-79	63	30	drops	drop	NOUN
crias-79	63	31	of	of	ADP
crias-79	63	32	tween	tween	NOUN
crias-79	63	33	20	20	NUM
crias-79	63	34	(	(	PUNCT
crias-79	63	35	wetting	wet	VERB
crias-79	63	36	agent	agent	NOUN
crias-79	63	37	)	)	PUNCT
crias-79	63	38	had	have	AUX
crias-79	63	39	been	be	AUX
crias-79	63	40	added	add	VERB
crias-79	63	41	,	,	PUNCT
crias-79	63	42	the	the	DET
crias-79	63	43	explants	explant	NOUN
crias-79	63	44	were	be	AUX
crias-79	63	45	then	then	ADV
crias-79	63	46	rinsed	rinse	VERB
crias-79	63	47	twice	twice	ADV
crias-79	63	48	using	use	VERB
crias-79	63	49	double	double	ADJ
crias-79	63	50	distilled	distil	VERB
crias-79	63	51	water	water	NOUN
crias-79	63	52	in	in	ADP
crias-79	63	53	the	the	DET
crias-79	63	54	clean	clean	ADJ
crias-79	63	55	bench	bench	NOUN
crias-79	63	56	.	.	PUNCT
crias-79	64	1	the	the	DET
crias-79	64	2	scorched	scorch	VERB
crias-79	64	3	outer	outer	ADJ
crias-79	64	4	coverings	covering	NOUN
crias-79	64	5	caused	cause	VERB
crias-79	64	6	by	by	ADP
crias-79	64	7	the	the	DET
crias-79	64	8	sodium	sodium	NOUN
crias-79	64	9	hypochlorite	hypochlorite	NOUN
crias-79	64	10	were	be	AUX
crias-79	64	11	removed	remove	VERB
crias-79	64	12	using	use	VERB
crias-79	64	13	sterile	sterile	ADJ
crias-79	64	14	surgical	surgical	ADJ
crias-79	64	15	blades	blade	NOUN
crias-79	64	16	,	,	PUNCT
crias-79	64	17	leaving	leave	VERB
crias-79	64	18	a	a	DET
crias-79	64	19	cube	cube	NOUN
crias-79	64	20	of	of	ADP
crias-79	64	21	about	about	ADP
crias-79	64	22	2.5	2.5	NUM
crias-79	64	23	cm3	cm3	NOUN
crias-79	64	24	.	.	PUNCT
crias-79	65	1	using	use	VERB
crias-79	65	2	sterile	sterile	ADJ
crias-79	65	3	forceps	forceps	NOUN
crias-79	65	4	,	,	PUNCT
crias-79	65	5	the	the	DET
crias-79	65	6	explants	explant	NOUN
crias-79	65	7	were	be	AUX
crias-79	65	8	placed	place	VERB
crias-79	65	9	in	in	ADP
crias-79	65	10	500ml3	500ml3	NUM
crias-79	65	11	jam	jam	NOUN
crias-79	65	12	jars	jar	NOUN
crias-79	65	13	containing	contain	VERB
crias-79	65	14	semisolid	semisolid	NOUN
crias-79	65	15	ms	ms	PROPN
crias-79	65	16	medium	medium	NOUN
crias-79	65	17	.	.	PUNCT
crias-79	66	1	cultures	culture	NOUN
crias-79	66	2	were	be	AUX
crias-79	66	3	incubated	incubate	VERB
crias-79	66	4	at	at	ADP
crias-79	66	5	26	26	NUM
crias-79	66	6	±	±	NUM
crias-79	66	7	1	1	NUM
crias-79	66	8	°	°	ADP
crias-79	66	9	c	c	NOUN
crias-79	66	10	under	under	ADP
crias-79	66	11	photoperiod	photoperiod	NOUN
crias-79	66	12	cycles	cycle	NOUN
crias-79	66	13	of	of	ADP
crias-79	66	14	16	16	NUM
crias-79	66	15	hour	hour	NOUN
crias-79	66	16	under	under	ADP
crias-79	66	17	light	light	NOUN
crias-79	66	18	and	and	CCONJ
crias-79	66	19	8	8	NUM
crias-79	66	20	hours	hour	NOUN
crias-79	66	21	dark	dark	ADJ
crias-79	66	22	.	.	PUNCT
crias-79	67	1	light	light	ADJ
crias-79	67	2	intensity	intensity	NOUN
crias-79	67	3	of	of	ADP
crias-79	67	4	25000	25000	NUM
crias-79	67	5	lux	lux	NOUN
crias-79	67	6	,	,	PUNCT
crias-79	67	7	from	from	ADP
crias-79	67	8	white	white	ADJ
crias-79	67	9	fluorescent	fluorescent	NOUN
crias-79	67	10	tubes	tube	NOUN
crias-79	67	11	was	be	AUX
crias-79	67	12	used	use	VERB
crias-79	67	13	.	.	PUNCT
crias-79	68	1	the	the	DET
crias-79	68	2	explants	explant	NOUN
crias-79	68	3	were	be	AUX
crias-79	68	4	sub	sub	NOUN
crias-79	68	5	cultured	cultured	ADJ
crias-79	68	6	after	after	ADP
crias-79	68	7	every	every	DET
crias-79	68	8	4	4	NUM
crias-79	68	9	weeks	week	NOUN
crias-79	68	10	to	to	PART
crias-79	68	11	fresh	fresh	VERB
crias-79	68	12	ms	ms	NOUN
crias-79	68	13	multiplication	multiplication	NOUN
crias-79	68	14	medium	medium	NOUN
crias-79	68	15	until	until	SCONJ
crias-79	68	16	they	they	PRON
crias-79	68	17	reached	reach	VERB
crias-79	68	18	the	the	DET
crias-79	68	19	2nd	2nd	ADJ
crias-79	68	20	subculture	subculture	NOUN
crias-79	68	21	while	while	SCONJ
crias-79	68	22	those	those	DET
crias-79	68	23	explants	explant	NOUN
crias-79	68	24	that	that	PRON
crias-79	68	25	were	be	AUX
crias-79	68	26	bsv	bsv	NOUN
crias-79	68	27	infected	infect	VERB
crias-79	68	28	were	be	AUX
crias-79	68	29	subjected	subject	VERB
crias-79	68	30	to	to	ADP
crias-79	68	31	virus	virus	NOUN
crias-79	68	32	elimination	elimination	NOUN
crias-79	68	33	methods	method	NOUN
crias-79	68	34	namely	namely	ADV
crias-79	68	35	chemotherapy	chemotherapy	NOUN
crias-79	68	36	,	,	PUNCT
crias-79	68	37	thermotherapy	thermotherapy	NOUN
crias-79	68	38	,	,	PUNCT
crias-79	68	39	and	and	CCONJ
crias-79	68	40	meristematic	meristematic	ADJ
crias-79	68	41	tip	tip	NOUN
crias-79	68	42	culture	culture	NOUN
crias-79	68	43	.	.	PUNCT
crias-79	69	1	the	the	DET
crias-79	69	2	infected	infected	ADJ
crias-79	69	3	banana	banana	NOUN
crias-79	69	4	explants	explant	NOUN
crias-79	69	5	were	be	AUX
crias-79	69	6	cultured	cultured	ADJ
crias-79	69	7	in	in	ADP
crias-79	69	8	murashige	murashige	PROPN
crias-79	69	9	and	and	CCONJ
crias-79	69	10	skoog	skoog	VERB
crias-79	69	11	medium	medium	NOUN
crias-79	69	12	with	with	ADP
crias-79	69	13	specification	specification	NOUN
crias-79	69	14	[	[	X
crias-79	69	15	14	14	NUM
crias-79	69	16	]	]	PUNCT
crias-79	69	17	for	for	ADP
crias-79	69	18	multiplication	multiplication	NOUN
crias-79	69	19	.	.	PUNCT
crias-79	70	1	2.4	2.4	NUM
crias-79	70	2	.	.	X
crias-79	71	1	chemotherapy	chemotherapy	NOUN
crias-79	71	2	,	,	PUNCT
crias-79	71	3	thermotherapy	thermotherapy	NOUN
crias-79	71	4	and	and	CCONJ
crias-79	71	5	meristem	meristem	NOUN
crias-79	71	6	tip	tip	NOUN
crias-79	71	7	culture	culture	NOUN
crias-79	71	8	of	of	ADP
crias-79	71	9	bsv	bsv	NOUN
crias-79	71	10	-	-	PUNCT
crias-79	71	11	infected	infect	VERB
crias-79	71	12	plantlets	plantlet	NOUN
crias-79	71	13	the	the	DET
crias-79	71	14	plantlets	plantlet	NOUN
crias-79	71	15	were	be	AUX
crias-79	71	16	transferred	transfer	VERB
crias-79	71	17	to	to	PART
crias-79	71	18	fresh	fresh	VERB
crias-79	71	19	ms	ms	NOUN
crias-79	71	20	medium	medium	NOUN
crias-79	71	21	after	after	ADP
crias-79	71	22	every	every	DET
crias-79	71	23	4	4	NUM
crias-79	71	24	weeks	week	NOUN
crias-79	71	25	to	to	PART
crias-79	71	26	obtain	obtain	VERB
crias-79	71	27	enough	enough	ADJ
crias-79	71	28	tc	tc	NOUN
crias-79	71	29	material	material	NOUN
crias-79	71	30	for	for	ADP
crias-79	71	31	the	the	DET
crias-79	71	32	purposes	purpose	NOUN
crias-79	71	33	of	of	ADP
crias-79	71	34	eliminating	eliminate	VERB
crias-79	71	35	the	the	DET
crias-79	71	36	virus	virus	NOUN
crias-79	71	37	.	.	PUNCT
crias-79	72	1	after	after	ADP
crias-79	72	2	the	the	DET
crias-79	72	3	second	second	ADJ
crias-79	72	4	subculture	subculture	NOUN
crias-79	72	5	,	,	PUNCT
crias-79	72	6	the	the	DET
crias-79	72	7	plantlets	plantlet	NOUN
crias-79	72	8	were	be	AUX
crias-79	72	9	current	current	ADJ
crias-79	72	10	research	research	NOUN
crias-79	72	11	in	in	ADP
crias-79	72	12	agricultural	agricultural	ADJ
crias-79	72	13	sciences	science	NOUN
crias-79	72	14	,	,	PUNCT
crias-79	72	15	2015	2015	NUM
crias-79	72	16	,	,	PUNCT
crias-79	72	17	2(3	2(3	NUM
crias-79	72	18	):	):	PUNCT
crias-79	72	19	81	81	NUM
crias-79	72	20	-	-	SYM
crias-79	72	21	89	89	NUM
crias-79	72	22	84	84	NUM
crias-79	72	23	©	©	PROPN
crias-79	72	24	2015	2015	NUM
crias-79	72	25	conscientia	conscientia	PROPN
crias-79	72	26	beam	beam	PROPN
crias-79	72	27	.	.	PUNCT
crias-79	73	1	all	all	DET
crias-79	73	2	rights	right	NOUN
crias-79	73	3	reserved	reserve	VERB
crias-79	73	4	.	.	PUNCT
crias-79	73	5	subjected	subject	VERB
crias-79	73	6	to	to	ADP
crias-79	73	7	the	the	DET
crias-79	73	8	three	three	NUM
crias-79	73	9	virus	virus	NOUN
crias-79	73	10	elimination	elimination	NOUN
crias-79	73	11	techniques	technique	NOUN
crias-79	73	12	namely	namely	ADV
crias-79	73	13	chemotherapy	chemotherapy	NOUN
crias-79	73	14	,	,	PUNCT
crias-79	73	15	using	use	VERB
crias-79	73	16	two	two	NUM
crias-79	73	17	chemicals	chemical	NOUN
crias-79	73	18	(	(	PUNCT
crias-79	73	19	ribavirin	ribavirin	NOUN
crias-79	73	20	and	and	CCONJ
crias-79	73	21	salicylic	salicylic	ADJ
crias-79	73	22	acid	acid	NOUN
crias-79	73	23	)	)	PUNCT
crias-79	73	24	at	at	ADP
crias-79	73	25	10	10	NUM
crias-79	73	26	,	,	PUNCT
crias-79	73	27	20	20	NUM
crias-79	73	28	,	,	PUNCT
crias-79	73	29	30	30	NUM
crias-79	73	30	and	and	CCONJ
crias-79	73	31	40	40	NUM
crias-79	73	32	mg	mg	NUM
crias-79	73	33	/	/	SYM
crias-79	73	34	l	l	NOUN
crias-79	73	35	concentrations	concentration	NOUN
crias-79	73	36	,	,	PUNCT
crias-79	73	37	thermotherapy	thermotherapy	NOUN
crias-79	73	38	at	at	ADP
crias-79	73	39	32	32	NUM
crias-79	73	40	°	°	NOUN
crias-79	73	41	c	c	NOUN
crias-79	73	42	,	,	PUNCT
crias-79	73	43	34	34	NUM
crias-79	73	44	°	°	NOUN
crias-79	73	45	c	c	NOUN
crias-79	73	46	,	,	PUNCT
crias-79	73	47	36	36	NUM
crias-79	73	48	°	°	NOUN
crias-79	73	49	c	c	NOUN
crias-79	73	50	and	and	CCONJ
crias-79	73	51	38	38	NUM
crias-79	73	52	°	°	NOUN
crias-79	73	53	c	c	NOUN
crias-79	73	54	and	and	CCONJ
crias-79	73	55	27	27	NUM
crias-79	73	56	°	°	NOUN
crias-79	73	57	c	c	NOUN
crias-79	73	58	as	as	ADP
crias-79	73	59	control	control	NOUN
crias-79	73	60	and	and	CCONJ
crias-79	73	61	meristematic	meristematic	ADJ
crias-79	73	62	tip	tip	NOUN
crias-79	73	63	culture	culture	NOUN
crias-79	73	64	using	use	VERB
crias-79	73	65	1	1	NUM
crias-79	73	66	,	,	PUNCT
crias-79	73	67	2	2	NUM
crias-79	73	68	,	,	PUNCT
crias-79	73	69	3	3	NUM
crias-79	73	70	,	,	PUNCT
crias-79	73	71	4	4	NUM
crias-79	73	72	,	,	PUNCT
crias-79	73	73	and	and	CCONJ
crias-79	73	74	5	5	NUM
crias-79	73	75	mm	mm	NOUN
crias-79	73	76	size	size	NOUN
crias-79	73	77	explants	explant	NOUN
crias-79	73	78	.	.	PUNCT
crias-79	74	1	in	in	ADP
crias-79	74	2	chemotherapy	chemotherapy	NOUN
crias-79	74	3	,	,	PUNCT
crias-79	74	4	in	in	ADP
crias-79	74	5	vitro	vitro	X
crias-79	74	6	meristems	meristem	NOUN
crias-79	74	7	tips	tip	NOUN
crias-79	74	8	(	(	PUNCT
crias-79	74	9	5	5	NUM
crias-79	74	10	mm	mm	NOUN
crias-79	74	11	long	long	ADJ
crias-79	74	12	)	)	PUNCT
crias-79	74	13	at	at	ADP
crias-79	74	14	the	the	DET
crias-79	74	15	2nd	2nd	ADJ
crias-79	74	16	subculture	subculture	NOUN
crias-79	74	17	were	be	AUX
crias-79	74	18	excised	excise	VERB
crias-79	74	19	in	in	ADP
crias-79	74	20	a	a	DET
crias-79	74	21	laminar	laminar	ADJ
crias-79	74	22	flow	flow	NOUN
crias-79	74	23	hood	hood	NOUN
crias-79	74	24	and	and	CCONJ
crias-79	74	25	cultured	cultured	ADJ
crias-79	74	26	in	in	ADP
crias-79	74	27	ms	ms	PROPN
crias-79	74	28	medium	medium	NOUN
crias-79	74	29	supplemented	supplement	VERB
crias-79	74	30	with	with	ADP
crias-79	74	31	0	0	NUM
crias-79	74	32	(	(	PUNCT
crias-79	74	33	control	control	NOUN
crias-79	74	34	)	)	PUNCT
crias-79	74	35	,	,	PUNCT
crias-79	74	36	10	10	NUM
crias-79	74	37	,	,	PUNCT
crias-79	74	38	20	20	NUM
crias-79	74	39	,	,	PUNCT
crias-79	74	40	30	30	NUM
crias-79	74	41	and	and	CCONJ
crias-79	74	42	40	40	NUM
crias-79	74	43	mg	mg	NUM
crias-79	74	44	/l	/l	PUNCT
crias-79	74	45	of	of	ADP
crias-79	74	46	ribavirin	ribavirin	NOUN
crias-79	74	47	.	.	PUNCT
crias-79	75	1	another	another	DET
crias-79	75	2	set	set	NOUN
crias-79	75	3	of	of	ADP
crias-79	75	4	cultures	culture	NOUN
crias-79	75	5	were	be	AUX
crias-79	75	6	supplemented	supplement	VERB
crias-79	75	7	with	with	ADP
crias-79	75	8	0	0	NUM
crias-79	75	9	(	(	PUNCT
crias-79	75	10	control	control	NOUN
crias-79	75	11	)	)	PUNCT
crias-79	75	12	,	,	PUNCT
crias-79	75	13	10	10	NUM
crias-79	75	14	,	,	PUNCT
crias-79	75	15	20	20	NUM
crias-79	75	16	,	,	PUNCT
crias-79	75	17	30	30	NUM
crias-79	75	18	and	and	CCONJ
crias-79	75	19	40	40	NUM
crias-79	75	20	mg	mg	NUM
crias-79	75	21	/	/	SYM
crias-79	75	22	l	l	NOUN
crias-79	75	23	of	of	ADP
crias-79	75	24	salicylic	salicylic	ADJ
crias-79	75	25	acid	acid	NOUN
crias-79	75	26	.	.	PUNCT
crias-79	76	1	after	after	ADP
crias-79	76	2	4	4	NUM
crias-79	76	3	weeks	week	NOUN
crias-79	76	4	of	of	ADP
crias-79	76	5	incubation	incubation	NOUN
crias-79	76	6	in	in	ADP
crias-79	76	7	the	the	DET
crias-79	76	8	laboratory	laboratory	NOUN
crias-79	76	9	,	,	PUNCT
crias-79	76	10	the	the	DET
crias-79	76	11	leaves	leave	NOUN
crias-79	76	12	were	be	AUX
crias-79	76	13	removed	remove	VERB
crias-79	76	14	using	use	VERB
crias-79	76	15	sterile	sterile	ADJ
crias-79	76	16	surgical	surgical	ADJ
crias-79	76	17	blades	blade	NOUN
crias-79	76	18	in	in	ADP
crias-79	76	19	a	a	DET
crias-79	76	20	laminar	laminar	ADJ
crias-79	76	21	flow	flow	NOUN
crias-79	76	22	hood	hood	NOUN
crias-79	76	23	,	,	PUNCT
crias-79	76	24	and	and	CCONJ
crias-79	76	25	put	put	VERB
crias-79	76	26	in	in	ADP
crias-79	76	27	well	well	ADV
crias-79	76	28	labelled	label	VERB
crias-79	76	29	packing	packing	NOUN
crias-79	76	30	bags	bag	NOUN
crias-79	76	31	then	then	ADV
crias-79	76	32	stored	store	VERB
crias-79	76	33	in	in	ADP
crias-79	76	34	a	a	DET
crias-79	76	35	freezer	freezer	NOUN
crias-79	76	36	for	for	ADP
crias-79	76	37	virus	virus	NOUN
crias-79	76	38	indexing	indexing	NOUN
crias-79	76	39	.	.	PUNCT
crias-79	77	1	in	in	ADP
crias-79	77	2	thermotherapy	thermotherapy	NOUN
crias-79	77	3	,	,	PUNCT
crias-79	77	4	explants	explant	NOUN
crias-79	77	5	at	at	ADP
crias-79	77	6	2nd	2nd	ADJ
crias-79	77	7	stage	stage	NOUN
crias-79	77	8	subculture	subculture	NOUN
crias-79	77	9	with	with	ADP
crias-79	77	10	well	well	ADV
crias-79	77	11	-	-	PUNCT
crias-79	77	12	formed	form	VERB
crias-79	77	13	shoots	shoot	NOUN
crias-79	77	14	were	be	AUX
crias-79	77	15	incubated	incubate	VERB
crias-79	77	16	at	at	ADP
crias-79	77	17	varying	vary	VERB
crias-79	77	18	temperatures	temperature	NOUN
crias-79	77	19	,	,	PUNCT
crias-79	77	20	27	27	NUM
crias-79	77	21	°	°	ADP
crias-79	77	22	c	c	NOUN
crias-79	77	23	(	(	PUNCT
crias-79	77	24	control	control	NOUN
crias-79	77	25	)	)	PUNCT
crias-79	77	26	,	,	PUNCT
crias-79	77	27	32	32	NUM
crias-79	77	28	°	°	SYM
crias-79	77	29	c	c	NOUN
crias-79	77	30	,	,	PUNCT
crias-79	77	31	34	34	NUM
crias-79	77	32	°	°	NOUN
crias-79	77	33	c	c	NOUN
crias-79	77	34	,	,	PUNCT
crias-79	77	35	36	36	NUM
crias-79	77	36	°	°	NOUN
crias-79	77	37	c	c	NOUN
crias-79	77	38	and	and	CCONJ
crias-79	77	39	38	38	NUM
crias-79	77	40	°	°	NOUN
crias-79	77	41	c	c	NOUN
crias-79	77	42	for	for	ADP
crias-79	77	43	ten	ten	NUM
crias-79	77	44	days	day	NOUN
crias-79	77	45	.	.	PUNCT
crias-79	78	1	the	the	DET
crias-79	78	2	leaves	leave	NOUN
crias-79	78	3	were	be	AUX
crias-79	78	4	then	then	ADV
crias-79	78	5	removed	remove	VERB
crias-79	78	6	using	use	VERB
crias-79	78	7	sterile	sterile	ADJ
crias-79	78	8	surgical	surgical	ADJ
crias-79	78	9	blades	blade	NOUN
crias-79	78	10	in	in	ADP
crias-79	78	11	a	a	DET
crias-79	78	12	laminar	laminar	ADJ
crias-79	78	13	flow	flow	NOUN
crias-79	78	14	hood	hood	NOUN
crias-79	78	15	,	,	PUNCT
crias-79	78	16	and	and	CCONJ
crias-79	78	17	placed	place	VERB
crias-79	78	18	in	in	ADP
crias-79	78	19	well	well	ADV
crias-79	78	20	labelled	label	VERB
crias-79	78	21	packing	packing	NOUN
crias-79	78	22	bags	bag	NOUN
crias-79	78	23	and	and	CCONJ
crias-79	78	24	then	then	ADV
crias-79	78	25	stored	store	VERB
crias-79	78	26	in	in	ADP
crias-79	78	27	a	a	DET
crias-79	78	28	freezer	freezer	NOUN
crias-79	78	29	for	for	ADP
crias-79	78	30	pcr	pcr	ADJ
crias-79	78	31	detection	detection	NOUN
crias-79	78	32	of	of	ADP
crias-79	78	33	bsv	bsv	PROPN
crias-79	78	34	.	.	PUNCT
crias-79	79	1	in	in	ADP
crias-79	79	2	meristem	meristem	NOUN
crias-79	79	3	tip	tip	NOUN
crias-79	79	4	culture	culture	NOUN
crias-79	79	5	,	,	PUNCT
crias-79	79	6	at	at	ADP
crias-79	79	7	the	the	DET
crias-79	79	8	2nd	2nd	ADJ
crias-79	79	9	sub	sub	NOUN
crias-79	79	10	-	-	NOUN
crias-79	79	11	culture	culture	ADJ
crias-79	79	12	,	,	PUNCT
crias-79	79	13	explants	explant	NOUN
crias-79	79	14	of	of	ADP
crias-79	79	15	1	1	NUM
crias-79	79	16	mm	mm	NOUN
crias-79	79	17	,	,	PUNCT
crias-79	79	18	2	2	NUM
crias-79	79	19	mm	mm	NOUN
crias-79	79	20	,	,	PUNCT
crias-79	79	21	3	3	NUM
crias-79	79	22	mm	mm	NOUN
crias-79	79	23	,	,	PUNCT
crias-79	79	24	4	4	NUM
crias-79	79	25	mm	mm	NUM
crias-79	79	26	and	and	CCONJ
crias-79	79	27	5	5	NUM
crias-79	79	28	mm	mm	NOUN
crias-79	79	29	(	(	PUNCT
crias-79	79	30	control	control	NOUN
crias-79	79	31	)	)	PUNCT
crias-79	79	32	in	in	ADP
crias-79	79	33	size	size	NOUN
crias-79	79	34	were	be	AUX
crias-79	79	35	excised	excise	VERB
crias-79	79	36	using	use	VERB
crias-79	79	37	clean	clean	ADJ
crias-79	79	38	surgical	surgical	ADJ
crias-79	79	39	blades	blade	NOUN
crias-79	79	40	in	in	ADP
crias-79	79	41	the	the	DET
crias-79	79	42	clean	clean	ADJ
crias-79	79	43	bench	bench	NOUN
crias-79	79	44	,	,	PUNCT
crias-79	79	45	before	before	ADP
crias-79	79	46	being	be	AUX
crias-79	79	47	inoculated	inoculate	VERB
crias-79	79	48	onto	onto	ADP
crias-79	79	49	petri	petri	ADJ
crias-79	79	50	dishes	dish	NOUN
crias-79	79	51	containing	contain	VERB
crias-79	79	52	ms	ms	PROPN
crias-79	79	53	medium	medium	NOUN
crias-79	79	54	.	.	PUNCT
crias-79	80	1	they	they	PRON
crias-79	80	2	were	be	AUX
crias-79	80	3	left	leave	VERB
crias-79	80	4	for	for	ADP
crias-79	80	5	2	2	NUM
crias-79	80	6	to	to	PART
crias-79	80	7	3	3	NUM
crias-79	80	8	days	day	NOUN
crias-79	80	9	after	after	ADP
crias-79	80	10	which	which	PRON
crias-79	80	11	they	they	PRON
crias-79	80	12	were	be	AUX
crias-79	80	13	transferred	transfer	VERB
crias-79	80	14	to	to	ADP
crias-79	80	15	jars	jar	NOUN
crias-79	80	16	containing	contain	VERB
crias-79	80	17	500mls	500mls	NUM
crias-79	80	18	hormone	hormone	NOUN
crias-79	80	19	free	free	ADJ
crias-79	80	20	ms	ms	NOUN
crias-79	80	21	medium	medium	NOUN
crias-79	80	22	to	to	PART
crias-79	80	23	enhance	enhance	VERB
crias-79	80	24	shoot	shoot	NOUN
crias-79	80	25	elongation	elongation	NOUN
crias-79	80	26	,	,	PUNCT
crias-79	80	27	for	for	ADP
crias-79	80	28	4	4	NUM
crias-79	80	29	weeks	week	NOUN
crias-79	80	30	.	.	PUNCT
crias-79	81	1	the	the	DET
crias-79	81	2	explants	explant	NOUN
crias-79	81	3	were	be	AUX
crias-79	81	4	then	then	ADV
crias-79	81	5	transferred	transfer	VERB
crias-79	81	6	to	to	ADP
crias-79	81	7	jars	jar	NOUN
crias-79	81	8	containing	contain	VERB
crias-79	81	9	fresh	fresh	ADJ
crias-79	81	10	ms	ms	NOUN
crias-79	81	11	medium	medium	NOUN
crias-79	81	12	supplemented	supplement	VERB
crias-79	81	13	with	with	ADP
crias-79	81	14	10mg	10mg	ADJ
crias-79	81	15	/	/	SYM
crias-79	81	16	l	l	NOUN
crias-79	81	17	naa	naa	NOUN
crias-79	81	18	to	to	PART
crias-79	81	19	enhance	enhance	VERB
crias-79	81	20	root	root	NOUN
crias-79	81	21	formation	formation	NOUN
crias-79	81	22	and	and	CCONJ
crias-79	81	23	the	the	DET
crias-79	81	24	leaves	leave	NOUN
crias-79	81	25	were	be	AUX
crias-79	81	26	put	put	VERB
crias-79	81	27	in	in	ADP
crias-79	81	28	well	well	ADV
crias-79	81	29	labeled	label	VERB
crias-79	81	30	packing	packing	NOUN
crias-79	81	31	bags	bag	NOUN
crias-79	81	32	and	and	CCONJ
crias-79	81	33	stored	store	VERB
crias-79	81	34	at	at	ADP
crias-79	81	35	–	–	PUNCT
crias-79	81	36	20	20	NUM
crias-79	81	37	°	°	PROPN
crias-79	81	38	c.	c.	PROPN
crias-79	81	39	dna	dna	PROPN
crias-79	81	40	was	be	AUX
crias-79	81	41	extracted	extract	VERB
crias-79	81	42	using	use	VERB
crias-79	81	43	ctab	ctab	NOUN
crias-79	81	44	method	method	NOUN
crias-79	81	45	according	accord	VERB
crias-79	81	46	to	to	ADP
crias-79	81	47	doyle	doyle	NOUN
crias-79	81	48	and	and	CCONJ
crias-79	81	49	doyle	doyle	NOUN
crias-79	82	1	[	[	X
crias-79	82	2	11	11	NUM
crias-79	82	3	]	]	PUNCT
crias-79	82	4	and	and	CCONJ
crias-79	82	5	dna	dna	PROPN
crias-79	82	6	visualized	visualize	VERB
crias-79	82	7	in	in	ADP
crias-79	82	8	0.8	0.8	NUM
crias-79	82	9	%	%	NOUN
crias-79	82	10	agarose	agarose	X
crias-79	82	11	gel	gel	NOUN
crias-79	82	12	.	.	PUNCT
crias-79	83	1	once	once	SCONJ
crias-79	83	2	the	the	DET
crias-79	83	3	quantity	quantity	NOUN
crias-79	83	4	of	of	ADP
crias-79	83	5	dna	dna	PROPN
crias-79	83	6	was	be	AUX
crias-79	83	7	confirmed	confirm	VERB
crias-79	83	8	,	,	PUNCT
crias-79	83	9	pcr	pcr	PROPN
crias-79	83	10	was	be	AUX
crias-79	83	11	done	do	VERB
crias-79	83	12	to	to	PART
crias-79	83	13	determine	determine	VERB
crias-79	83	14	whether	whether	SCONJ
crias-79	83	15	the	the	DET
crias-79	83	16	virus	virus	NOUN
crias-79	83	17	had	have	AUX
crias-79	83	18	been	be	AUX
crias-79	83	19	eliminated	eliminate	VERB
crias-79	83	20	.	.	PUNCT
crias-79	84	1	2.5	2.5	NUM
crias-79	84	2	.	.	PUNCT
crias-79	85	1	data	datum	NOUN
crias-79	85	2	collection	collection	NOUN
crias-79	85	3	and	and	CCONJ
crias-79	85	4	analysis	analysis	NOUN
crias-79	85	5	the	the	DET
crias-79	85	6	number	number	NOUN
crias-79	85	7	of	of	ADP
crias-79	85	8	explants	explant	NOUN
crias-79	85	9	that	that	PRON
crias-79	85	10	survived	survive	VERB
crias-79	85	11	and	and	CCONJ
crias-79	85	12	number	number	NOUN
crias-79	85	13	of	of	ADP
crias-79	85	14	plantlets	plantlet	NOUN
crias-79	85	15	without	without	ADP
crias-79	85	16	the	the	DET
crias-79	85	17	bsv	bsv	NOUN
crias-79	85	18	was	be	AUX
crias-79	85	19	recorded	record	VERB
crias-79	85	20	after	after	ADP
crias-79	85	21	every	every	DET
crias-79	85	22	four	four	NUM
crias-79	85	23	weeks	week	NOUN
crias-79	85	24	in	in	ADP
crias-79	85	25	spread	spread	ADJ
crias-79	85	26	sheets	sheet	NOUN
crias-79	85	27	and	and	CCONJ
crias-79	85	28	before	before	ADP
crias-79	85	29	the	the	DET
crias-79	85	30	analysis	analysis	NOUN
crias-79	85	31	,	,	PUNCT
crias-79	85	32	the	the	DET
crias-79	85	33	collected	collect	VERB
crias-79	85	34	data	datum	NOUN
crias-79	85	35	was	be	AUX
crias-79	85	36	converted	convert	VERB
crias-79	85	37	into	into	ADP
crias-79	85	38	percentages	percentage	NOUN
crias-79	85	39	then	then	ADV
crias-79	85	40	they	they	PRON
crias-79	85	41	were	be	AUX
crias-79	85	42	analyzed	analyze	VERB
crias-79	85	43	using	use	VERB
crias-79	85	44	the	the	DET
crias-79	85	45	generalized	generalize	VERB
crias-79	85	46	linear	linear	NOUN
crias-79	85	47	model	model	NOUN
crias-79	85	48	using	use	VERB
crias-79	85	49	the	the	DET
crias-79	85	50	poisson	poisson	NOUN
crias-79	85	51	log	log	NOUN
crias-79	85	52	linear	linear	PROPN
crias-79	85	53	model	model	NOUN
crias-79	85	54	.	.	PUNCT
crias-79	86	1	3	3	X
crias-79	86	2	.	.	NOUN
crias-79	86	3	results	result	VERB
crias-79	86	4	3.1	3.1	NUM
crias-79	86	5	.	.	PUNCT
crias-79	87	1	detection	detection	NOUN
crias-79	87	2	bsv	bsv	ADJ
crias-79	87	3	infection	infection	NOUN
crias-79	87	4	in	in	ADP
crias-79	87	5	banana	banana	NOUN
crias-79	87	6	plantlets	plantlet	NOUN
crias-79	87	7	by	by	ADP
crias-79	87	8	pcr	pcr	NOUN
crias-79	87	9	all	all	DET
crias-79	87	10	bsvspecific	bsvspecific	NOUN
crias-79	87	11	strains	strain	NOUN
crias-79	87	12	were	be	AUX
crias-79	87	13	detected	detect	VERB
crias-79	87	14	in	in	ADP
crias-79	87	15	all	all	DET
crias-79	87	16	the	the	DET
crias-79	87	17	samples	sample	NOUN
crias-79	87	18	except	except	SCONJ
crias-79	87	19	bsvcavendish	bsvcavendish	ADJ
crias-79	87	20	.	.	PUNCT
crias-79	88	1	double	double	ADJ
crias-79	88	2	infections	infection	NOUN
crias-79	88	3	of	of	ADP
crias-79	88	4	bsv	bsv	NOUN
crias-79	88	5	strains	strain	NOUN
crias-79	88	6	were	be	AUX
crias-79	88	7	observed	observe	VERB
crias-79	88	8	in	in	ADP
crias-79	88	9	three	three	NUM
crias-79	88	10	samples	sample	NOUN
crias-79	88	11	while	while	SCONJ
crias-79	88	12	one	one	NUM
crias-79	88	13	sample	sample	NOUN
crias-79	88	14	had	have	VERB
crias-79	88	15	three	three	NUM
crias-79	88	16	bsv	bsv	NOUN
crias-79	88	17	strains	strain	NOUN
crias-79	88	18	(	(	PUNCT
crias-79	88	19	fig	fig	NOUN
crias-79	88	20	1	1	NUM
crias-79	88	21	)	)	PUNCT
crias-79	88	22	.	.	PUNCT
crias-79	89	1	only	only	ADV
crias-79	89	2	red	red	ADJ
crias-79	89	3	dacca	dacca	NOUN
crias-79	89	4	and	and	CCONJ
crias-79	89	5	gold	gold	NOUN
crias-79	89	6	finger	finger	NOUN
crias-79	89	7	strains	strain	NOUN
crias-79	89	8	were	be	AUX
crias-79	89	9	amplified	amplify	VERB
crias-79	89	10	when	when	SCONJ
crias-79	89	11	pcr	pcr	PROPN
crias-79	89	12	was	be	AUX
crias-79	89	13	performed	perform	VERB
crias-79	89	14	on	on	ADP
crias-79	89	15	fhia	fhia	PROPN
crias-79	89	16	18	18	NUM
crias-79	89	17	samples	sample	NOUN
crias-79	89	18	.	.	PUNCT
crias-79	90	1	out	out	ADP
crias-79	90	2	of	of	ADP
crias-79	90	3	the	the	DET
crias-79	90	4	ten	ten	NUM
crias-79	90	5	samples	sample	NOUN
crias-79	90	6	amplified	amplify	VERB
crias-79	90	7	,	,	PUNCT
crias-79	90	8	five	five	NUM
crias-79	90	9	had	have	VERB
crias-79	90	10	at	at	ADV
crias-79	90	11	least	least	ADV
crias-79	90	12	one	one	NUM
crias-79	90	13	bsv	bsv	NOUN
crias-79	90	14	strain	strain	NOUN
crias-79	90	15	infection	infection	NOUN
crias-79	90	16	(	(	PUNCT
crias-79	90	17	table	table	NOUN
crias-79	90	18	2.0	2.0	NUM
crias-79	90	19	)	)	PUNCT
crias-79	90	20	.	.	PUNCT
crias-79	91	1	in	in	ADP
crias-79	91	2	nusu	nusu	ADP
crias-79	91	3	ng’ombe	ng’ombe	PROPN
crias-79	91	4	variety	variety	NOUN
crias-79	91	5	,	,	PUNCT
crias-79	91	6	pcr	pcr	ADJ
crias-79	91	7	analysis	analysis	NOUN
crias-79	91	8	using	use	VERB
crias-79	91	9	the	the	DET
crias-79	91	10	five	five	NUM
crias-79	91	11	bsv	bsv	ADJ
crias-79	91	12	specific	specific	ADJ
crias-79	91	13	primers	primer	NOUN
crias-79	91	14	,	,	PUNCT
crias-79	91	15	showed	show	VERB
crias-79	91	16	that	that	SCONJ
crias-79	91	17	out	out	ADP
crias-79	91	18	of	of	ADP
crias-79	91	19	the	the	DET
crias-79	91	20	ten	ten	NUM
crias-79	91	21	samples	sample	NOUN
crias-79	91	22	tested	test	VERB
crias-79	91	23	,	,	PUNCT
crias-79	91	24	nine	nine	NUM
crias-79	91	25	had	have	VERB
crias-79	91	26	at	at	ADV
crias-79	91	27	least	least	ADV
crias-79	91	28	one	one	NUM
crias-79	91	29	or	or	CCONJ
crias-79	91	30	more	more	ADJ
crias-79	91	31	bsv	bsv	NOUN
crias-79	91	32	strain	strain	NOUN
crias-79	91	33	detected	detect	VERB
crias-79	91	34	(	(	PUNCT
crias-79	91	35	table	table	NOUN
crias-79	91	36	2.0	2.0	NUM
crias-79	91	37	)	)	PUNCT
crias-79	91	38	.	.	PUNCT
crias-79	92	1	current	current	ADJ
crias-79	92	2	research	research	NOUN
crias-79	92	3	in	in	ADP
crias-79	92	4	agricultural	agricultural	ADJ
crias-79	92	5	sciences	science	NOUN
crias-79	92	6	,	,	PUNCT
crias-79	92	7	2015	2015	NUM
crias-79	92	8	,	,	PUNCT
crias-79	92	9	2(3	2(3	NUM
crias-79	92	10	):	):	PUNCT
crias-79	92	11	81	81	NUM
crias-79	92	12	-	-	SYM
crias-79	92	13	89	89	NUM
crias-79	92	14	85	85	NUM
crias-79	92	15	©	©	PROPN
crias-79	92	16	2015	2015	NUM
crias-79	92	17	conscientia	conscientia	PROPN
crias-79	92	18	beam	beam	PROPN
crias-79	92	19	.	.	PUNCT
crias-79	93	1	all	all	DET
crias-79	93	2	rights	right	NOUN
crias-79	93	3	reserved	reserve	VERB
crias-79	93	4	.	.	PUNCT
crias-79	94	1	fig-1	fig-1	NOUN
crias-79	94	2	.	.	PUNCT
crias-79	95	1	detection	detection	NOUN
crias-79	95	2	of	of	ADP
crias-79	95	3	banana	banana	PROPN
crias-79	95	4	streak	streak	PROPN
crias-79	95	5	virus	virus	NOUN
crias-79	95	6	(	(	PUNCT
crias-79	95	7	bsv	bsv	NOUN
crias-79	95	8	)	)	PUNCT
crias-79	95	9	in	in	ADP
crias-79	95	10	banana	banana	NOUN
crias-79	95	11	variety	variety	NOUN
crias-79	95	12	kampala	kampala	PROPN
crias-79	95	13	using	use	VERB
crias-79	95	14	four	four	NUM
crias-79	95	15	specific	specific	ADJ
crias-79	95	16	primers	primer	NOUN
crias-79	95	17	.	.	PUNCT
crias-79	96	1	the	the	DET
crias-79	96	2	four	four	NUM
crias-79	96	3	specific	specific	ADJ
crias-79	96	4	primers	primer	NOUN
crias-79	96	5	detected	detect	VERB
crias-79	96	6	the	the	DET
crias-79	96	7	virus	virus	NOUN
crias-79	96	8	in	in	ADP
crias-79	96	9	eight	eight	NUM
crias-79	96	10	out	out	ADP
crias-79	96	11	of	of	ADP
crias-79	96	12	the	the	DET
crias-79	96	13	ten	ten	NUM
crias-79	96	14	samples	sample	NOUN
crias-79	96	15	tested	test	VERB
crias-79	96	16	,	,	PUNCT
crias-79	96	17	bsv	bsv	NOUN
crias-79	96	18	mysore	mysore	NOUN
crias-79	96	19	(	(	PUNCT
crias-79	96	20	589bp	589bp	NOUN
crias-79	96	21	)	)	PUNCT
crias-79	96	22	,	,	PUNCT
crias-79	96	23	bsv	bsv	X
crias-79	96	24	–	–	PUNCT
crias-79	96	25	rd	rd	PROPN
crias-79	96	26	(	(	PUNCT
crias-79	96	27	522bp	522bp	PROPN
crias-79	96	28	)	)	PUNCT
crias-79	96	29	,	,	PUNCT
crias-79	96	30	bsv	bsv	ADJ
crias-79	96	31	gold	gold	NOUN
crias-79	96	32	finger	finger	NOUN
crias-79	96	33	(	(	PUNCT
crias-79	96	34	476bp	476bp	NOUN
crias-79	96	35	)	)	PUNCT
crias-79	96	36	.	.	PUNCT
crias-79	97	1	lane	lane	PROPN
crias-79	97	2	1	1	NUM
crias-79	97	3	-	-	SYM
crias-79	97	4	10	10	NUM
crias-79	97	5	:	:	PUNCT
crias-79	97	6	bsv	bsv	NOUN
crias-79	97	7	mysore	mysore	NOUN
crias-79	97	8	,	,	PUNCT
crias-79	97	9	lane	lane	NOUN
crias-79	97	10	11	11	NUM
crias-79	97	11	-	-	SYM
crias-79	97	12	20	20	NUM
crias-79	97	13	:	:	PUNCT
crias-79	97	14	bsv	bsv	PROPN
crias-79	97	15	red	red	PROPN
crias-79	97	16	dacca	dacca	PROPN
crias-79	97	17	,	,	PUNCT
crias-79	97	18	lane	lane	NOUN
crias-79	97	19	21	21	NUM
crias-79	97	20	-	-	SYM
crias-79	97	21	29	29	NUM
crias-79	97	22	:	:	PUNCT
crias-79	97	23	bsv	bsv	ADJ
crias-79	97	24	gold	gold	NOUN
crias-79	97	25	finger	finger	NOUN
crias-79	97	26	,	,	PUNCT
crias-79	97	27	lane	lane	NOUN
crias-79	97	28	m	m	NOUN
crias-79	97	29	:	:	PUNCT
crias-79	97	30	molecular	molecular	ADJ
crias-79	97	31	weight	weight	NOUN
crias-79	97	32	marker	marker	NOUN
crias-79	97	33	no	no	DET
crias-79	97	34	bsv	bsv	NOUN
crias-79	97	35	–	–	PUNCT
crias-79	97	36	cavendish	cavendish	PROPN
crias-79	97	37	strain	strain	NOUN
crias-79	97	38	was	be	AUX
crias-79	97	39	detected	detect	VERB
crias-79	97	40	in	in	ADP
crias-79	97	41	this	this	DET
crias-79	97	42	variety	variety	NOUN
crias-79	97	43	while	while	SCONJ
crias-79	97	44	the	the	DET
crias-79	97	45	most	most	ADV
crias-79	97	46	prevalent	prevalent	ADJ
crias-79	97	47	bsv	bsv	NOUN
crias-79	97	48	strain	strain	NOUN
crias-79	97	49	from	from	ADP
crias-79	97	50	nusu	nusu	PROPN
crias-79	97	51	ng’ombe	ng’ombe	PROPN
crias-79	97	52	variety	variety	NOUN
crias-79	97	53	was	be	AUX
crias-79	97	54	red	red	ADJ
crias-79	97	55	dacca	dacca	NOUN
crias-79	97	56	(	(	PUNCT
crias-79	97	57	522bp	522bp	PROPN
crias-79	97	58	)	)	PUNCT
crias-79	97	59	,	,	PUNCT
crias-79	97	60	which	which	PRON
crias-79	97	61	was	be	AUX
crias-79	97	62	amplified	amplify	VERB
crias-79	97	63	in	in	ADP
crias-79	97	64	seven	seven	NUM
crias-79	97	65	out	out	ADP
crias-79	97	66	of	of	ADP
crias-79	97	67	ten	ten	NUM
crias-79	97	68	samples	sample	NOUN
crias-79	97	69	tested	test	VERB
crias-79	97	70	.	.	PUNCT
crias-79	98	1	bsvgold	bsvgold	ADJ
crias-79	98	2	finger	finger	NOUN
crias-79	98	3	(	(	PUNCT
crias-79	98	4	476bp	476bp	ADJ
crias-79	98	5	)	)	PUNCT
crias-79	98	6	strain	strain	NOUN
crias-79	98	7	was	be	AUX
crias-79	98	8	amplified	amplify	VERB
crias-79	98	9	in	in	ADP
crias-79	98	10	three	three	NUM
crias-79	98	11	samples	sample	NOUN
crias-79	98	12	.	.	PUNCT
crias-79	99	1	three	three	NUM
crias-79	99	2	samples	sample	NOUN
crias-79	99	3	had	have	VERB
crias-79	99	4	double	double	ADJ
crias-79	99	5	infections	infection	NOUN
crias-79	99	6	while	while	SCONJ
crias-79	99	7	the	the	DET
crias-79	99	8	other	other	ADJ
crias-79	99	9	six	six	NUM
crias-79	99	10	had	have	VERB
crias-79	99	11	only	only	ADV
crias-79	99	12	one	one	NUM
crias-79	99	13	infection	infection	NOUN
crias-79	99	14	.	.	PUNCT
crias-79	100	1	when	when	SCONJ
crias-79	100	2	the	the	DET
crias-79	100	3	degenerate	degenerate	ADJ
crias-79	100	4	primer	primer	NOUN
crias-79	100	5	(	(	PUNCT
crias-79	100	6	badna-596bp	badna-596bp	NOUN
crias-79	100	7	)	)	PUNCT
crias-79	100	8	was	be	AUX
crias-79	100	9	used	use	VERB
crias-79	100	10	,	,	PUNCT
crias-79	100	11	bsv	bsv	NOUN
crias-79	100	12	strains	strain	NOUN
crias-79	100	13	were	be	AUX
crias-79	100	14	detected	detect	VERB
crias-79	100	15	in	in	ADP
crias-79	100	16	all	all	DET
crias-79	100	17	samples	sample	NOUN
crias-79	100	18	except	except	SCONJ
crias-79	100	19	in	in	ADP
crias-79	100	20	56k	56k	NUM
crias-79	100	21	.	.	PUNCT
crias-79	101	1	table-2	table-2	NUM
crias-79	101	2	.	.	PUNCT
crias-79	102	1	detection	detection	NOUN
crias-79	102	2	of	of	ADP
crias-79	102	3	bsv	bsv	PROPN
crias-79	102	4	in	in	ADP
crias-79	102	5	mother	mother	NOUN
crias-79	102	6	orchards	orchard	NOUN
crias-79	102	7	by	by	ADP
crias-79	102	8	pcr	pcr	PROPN
crias-79	102	9	orchard	orchard	ADJ
crias-79	102	10	variety	variety	NOUN
crias-79	102	11	%	%	NOUN
crias-79	102	12	bsv	bsv	ADJ
crias-79	102	13	infection	infection	NOUN
crias-79	102	14	detection	detection	NOUN
crias-79	102	15	via	via	ADP
crias-79	102	16	pcr	pcr	PROPN
crias-79	102	17	jkuat	jkuat	PROPN
crias-79	102	18	kampala	kampala	PROPN
crias-79	102	19	80	80	NUM
crias-79	102	20	kisii	kisii	PROPN
crias-79	102	21	nusu	nusu	PROPN
crias-79	102	22	ng’ombe	ng’ombe	PROPN
crias-79	102	23	90	90	NUM
crias-79	102	24	thika	thika	NOUN
crias-79	102	25	fhia	fhia	NOUN
crias-79	102	26	18	18	NUM
crias-79	102	27	50	50	NUM
crias-79	102	28	3.2	3.2	NUM
crias-79	102	29	.	.	PUNCT
crias-79	103	1	virus	virus	NOUN
crias-79	103	2	elimination	elimination	NOUN
crias-79	103	3	the	the	DET
crias-79	103	4	bsv	bsv	NOUN
crias-79	103	5	infected	infect	VERB
crias-79	103	6	samples	sample	NOUN
crias-79	103	7	confirmed	confirm	VERB
crias-79	103	8	by	by	ADP
crias-79	103	9	pcr	pcr	PROPN
crias-79	103	10	were	be	AUX
crias-79	103	11	subjected	subject	VERB
crias-79	103	12	to	to	ADP
crias-79	103	13	the	the	DET
crias-79	103	14	three	three	NUM
crias-79	103	15	virus	virus	NOUN
crias-79	103	16	elimination	elimination	NOUN
crias-79	103	17	techniques	technique	NOUN
crias-79	103	18	and	and	CCONJ
crias-79	103	19	the	the	DET
crias-79	103	20	virus	virus	NOUN
crias-79	103	21	eliminations	elimination	NOUN
crias-79	103	22	recorded	record	VERB
crias-79	103	23	(	(	PUNCT
crias-79	103	24	table	table	NOUN
crias-79	103	25	3	3	NUM
crias-79	103	26	,	,	PUNCT
crias-79	103	27	4	4	NUM
crias-79	103	28	and	and	CCONJ
crias-79	103	29	5	5	NUM
crias-79	103	30	)	)	PUNCT
crias-79	103	31	.	.	PUNCT
crias-79	104	1	for	for	ADP
crias-79	104	2	chemotherapy	chemotherapy	NOUN
crias-79	104	3	,	,	PUNCT
crias-79	104	4	the	the	PRON
crias-79	104	5	higher	high	ADJ
crias-79	104	6	the	the	DET
crias-79	104	7	concentration	concentration	NOUN
crias-79	104	8	of	of	ADP
crias-79	104	9	the	the	DET
crias-79	104	10	chemicals	chemical	NOUN
crias-79	104	11	used	use	VERB
crias-79	104	12	(	(	PUNCT
crias-79	104	13	ribavirin	ribavirin	NOUN
crias-79	104	14	and	and	CCONJ
crias-79	104	15	salicylic	salicylic	ADJ
crias-79	104	16	acid	acid	NOUN
crias-79	104	17	)	)	PUNCT
crias-79	104	18	,	,	PUNCT
crias-79	104	19	the	the	PRON
crias-79	104	20	higher	high	ADJ
crias-79	104	21	the	the	DET
crias-79	104	22	percentage	percentage	NOUN
crias-79	104	23	in	in	ADP
crias-79	104	24	virus	virus	NOUN
crias-79	104	25	elimination	elimination	NOUN
crias-79	104	26	in	in	ADP
crias-79	104	27	all	all	DET
crias-79	104	28	the	the	DET
crias-79	104	29	three	three	NUM
crias-79	104	30	banana	banana	NOUN
crias-79	104	31	varieties	variety	NOUN
crias-79	104	32	(	(	PUNCT
crias-79	104	33	df=1	df=1	PROPN
crias-79	104	34	;	;	PUNCT
crias-79	104	35	p	p	X
crias-79	104	36	<	<	X
crias-79	104	37	0.05	0.05	NUM
crias-79	104	38	)	)	PUNCT
crias-79	104	39	.	.	PUNCT
crias-79	105	1	for	for	ADP
crias-79	105	2	thermotherapy	thermotherapy	NOUN
crias-79	105	3	,	,	PUNCT
crias-79	105	4	there	there	PRON
crias-79	105	5	was	be	VERB
crias-79	105	6	100	100	NUM
crias-79	105	7	%	%	NOUN
crias-79	105	8	survival	survival	NOUN
crias-79	105	9	in	in	ADP
crias-79	105	10	all	all	DET
crias-79	105	11	the	the	DET
crias-79	105	12	temperatures	temperature	NOUN
crias-79	105	13	used	use	VERB
crias-79	105	14	except	except	SCONJ
crias-79	105	15	at	at	ADP
crias-79	105	16	38	38	NUM
crias-79	105	17	°	°	NOUN
crias-79	105	18	c	c	NOUN
crias-79	105	19	in	in	ADP
crias-79	105	20	which	which	PRON
crias-79	105	21	all	all	DET
crias-79	105	22	the	the	DET
crias-79	105	23	explants	explant	NOUN
crias-79	105	24	were	be	AUX
crias-79	105	25	scorched	scorch	VERB
crias-79	105	26	.	.	PUNCT
crias-79	106	1	higher	high	ADJ
crias-79	106	2	virus	virus	NOUN
crias-79	106	3	elimination	elimination	NOUN
crias-79	106	4	was	be	AUX
crias-79	106	5	recorded	record	VERB
crias-79	106	6	at	at	ADP
crias-79	106	7	36	36	NUM
crias-79	106	8	°	°	NOUN
crias-79	106	9	c	c	NOUN
crias-79	106	10	(	(	PUNCT
crias-79	106	11	df=2	df=2	NOUN
crias-79	106	12	;	;	PUNCT
crias-79	106	13	p<0.01	p<0.01	PROPN
crias-79	106	14	)	)	PUNCT
crias-79	106	15	(	(	PUNCT
crias-79	106	16	table	table	NOUN
crias-79	106	17	4.0	4.0	NUM
crias-79	106	18	)	)	PUNCT
crias-79	106	19	.	.	PUNCT
crias-79	107	1	for	for	ADP
crias-79	107	2	meristem	meristem	NOUN
crias-79	107	3	tip	tip	NOUN
crias-79	107	4	culture	culture	NOUN
crias-79	107	5	,	,	PUNCT
crias-79	107	6	the	the	PRON
crias-79	107	7	smaller	small	ADJ
crias-79	107	8	the	the	DET
crias-79	107	9	size	size	NOUN
crias-79	107	10	of	of	ADP
crias-79	107	11	the	the	DET
crias-79	107	12	explants	explant	NOUN
crias-79	107	13	,	,	PUNCT
crias-79	107	14	the	the	PRON
crias-79	107	15	higher	high	ADJ
crias-79	107	16	the	the	DET
crias-79	107	17	percentage	percentage	NOUN
crias-79	107	18	in	in	ADP
crias-79	107	19	virus	virus	NOUN
crias-79	107	20	elimination	elimination	NOUN
crias-79	107	21	.	.	PUNCT
crias-79	108	1	however	however	ADV
crias-79	108	2	,	,	PUNCT
crias-79	108	3	the	the	PRON
crias-79	108	4	smaller	small	ADJ
crias-79	108	5	the	the	DET
crias-79	108	6	size	size	NOUN
crias-79	108	7	of	of	ADP
crias-79	108	8	the	the	DET
crias-79	108	9	explants	explant	NOUN
crias-79	108	10	the	the	DET
crias-79	108	11	lower	low	ADJ
crias-79	108	12	was	be	AUX
crias-79	108	13	the	the	DET
crias-79	108	14	regeneration	regeneration	NOUN
crias-79	108	15	of	of	ADP
crias-79	108	16	the	the	DET
crias-79	108	17	explants	explant	NOUN
crias-79	108	18	(	(	PUNCT
crias-79	108	19	df=	df=	PROPN
crias-79	108	20	4	4	NUM
crias-79	108	21	;	;	PUNCT
crias-79	108	22	p	p	X
crias-79	108	23	<	<	X
crias-79	108	24	0.001	0.001	NUM
crias-79	108	25	)	)	PUNCT
crias-79	108	26	,	,	PUNCT
crias-79	108	27	(	(	PUNCT
crias-79	108	28	table	table	NOUN
crias-79	108	29	5.0	5.0	NUM
crias-79	108	30	)	)	PUNCT
crias-79	108	31	3.2.1	3.2.1	NUM
crias-79	108	32	.	.	PUNCT
crias-79	109	1	chemotherapy	chemotherapy	NOUN
crias-79	109	2	in	in	ADP
crias-79	109	3	chemotherapy	chemotherapy	NOUN
crias-79	109	4	,	,	PUNCT
crias-79	109	5	variety	variety	NOUN
crias-79	109	6	,	,	PUNCT
crias-79	109	7	chemical	chemical	NOUN
crias-79	109	8	and	and	CCONJ
crias-79	109	9	chemical	chemical	NOUN
crias-79	109	10	concentration	concentration	NOUN
crias-79	109	11	had	have	VERB
crias-79	109	12	an	an	DET
crias-79	109	13	effect	effect	NOUN
crias-79	109	14	on	on	ADP
crias-79	109	15	survival	survival	NOUN
crias-79	109	16	of	of	ADP
crias-79	109	17	the	the	DET
crias-79	109	18	explants	explant	NOUN
crias-79	109	19	and	and	CCONJ
crias-79	109	20	virus	virus	NOUN
crias-79	109	21	elimination	elimination	NOUN
crias-79	109	22	.	.	PUNCT
crias-79	110	1	(	(	PUNCT
crias-79	110	2	table	table	NOUN
crias-79	110	3	3.0	3.0	NUM
crias-79	110	4	,	,	PUNCT
crias-79	110	5	4.0	4.0	NUM
crias-79	110	6	,	,	PUNCT
crias-79	110	7	5.0	5.0	NUM
crias-79	110	8	)	)	PUNCT
crias-79	110	9	3.2.1.1	3.2.1.1	NUM
crias-79	110	10	.	.	PUNCT
crias-79	111	1	effect	effect	NOUN
crias-79	111	2	of	of	ADP
crias-79	111	3	variety	variety	NOUN
crias-79	111	4	on	on	ADP
crias-79	111	5	survival	survival	NOUN
crias-79	111	6	of	of	ADP
crias-79	111	7	explants	explant	NOUN
crias-79	111	8	and	and	CCONJ
crias-79	111	9	bsv	bsv	ADJ
crias-79	111	10	elimination	elimination	NOUN
crias-79	111	11	variety	variety	NOUN
crias-79	111	12	used	use	VERB
crias-79	111	13	had	have	VERB
crias-79	111	14	an	an	DET
crias-79	111	15	effect	effect	NOUN
crias-79	111	16	on	on	ADP
crias-79	111	17	virus	virus	NOUN
crias-79	111	18	elimination	elimination	NOUN
crias-79	111	19	and	and	CCONJ
crias-79	111	20	survival	survival	NOUN
crias-79	111	21	(	(	PUNCT
crias-79	111	22	df=	df=	PROPN
crias-79	111	23	;	;	PUNCT
crias-79	111	24	p<0.05	p<0.05	PROPN
crias-79	111	25	)	)	PUNCT
crias-79	111	26	.	.	PUNCT
crias-79	112	1	nusu	nusu	ADP
crias-79	112	2	ng’ombe	ng’ombe	PROPN
crias-79	112	3	variety	variety	PROPN
crias-79	112	4	had	have	VERB
crias-79	112	5	the	the	DET
crias-79	112	6	highest	high	ADJ
crias-79	112	7	80.9±2.35	80.9±2.35	NUM
crias-79	112	8	bsv	bsv	NOUN
crias-79	112	9	elimination	elimination	NOUN
crias-79	112	10	against	against	ADP
crias-79	112	11	kampala	kampala	PROPN
crias-79	112	12	and	and	CCONJ
crias-79	112	13	fhia	fhia	NOUN
crias-79	112	14	18	18	NUM
crias-79	112	15	at	at	ADP
crias-79	112	16	73.3±5.42	73.3±5.42	NUM
crias-79	112	17	and	and	CCONJ
crias-79	112	18	80.8±2.16	80.8±2.16	NUM
crias-79	112	19	respectively	respectively	ADV
crias-79	112	20	using	use	VERB
crias-79	112	21	the	the	DET
crias-79	112	22	same	same	ADJ
crias-79	112	23	chemicals	chemical	NOUN
crias-79	112	24	and	and	CCONJ
crias-79	112	25	same	same	ADJ
crias-79	112	26	chemical	chemical	NOUN
crias-79	112	27	concentrations	concentration	NOUN
crias-79	112	28	.	.	PUNCT
crias-79	113	1	variety	variety	PROPN
crias-79	114	1	nusu	nusu	PROPN
crias-79	114	2	current	current	ADJ
crias-79	114	3	research	research	NOUN
crias-79	114	4	in	in	ADP
crias-79	114	5	agricultural	agricultural	ADJ
crias-79	114	6	sciences	science	NOUN
crias-79	114	7	,	,	PUNCT
crias-79	114	8	2015	2015	NUM
crias-79	114	9	,	,	PUNCT
crias-79	114	10	2(3	2(3	NUM
crias-79	114	11	):	):	PUNCT
crias-79	114	12	81	81	NUM
crias-79	114	13	-	-	SYM
crias-79	114	14	89	89	NUM
crias-79	114	15	86	86	NUM
crias-79	114	16	©	©	PROPN
crias-79	114	17	2015	2015	NUM
crias-79	114	18	conscientia	conscientia	PROPN
crias-79	114	19	beam	beam	PROPN
crias-79	114	20	.	.	PUNCT
crias-79	115	1	all	all	DET
crias-79	115	2	rights	right	NOUN
crias-79	115	3	reserved	reserve	VERB
crias-79	115	4	.	.	PUNCT
crias-79	116	1	ng’ombe	ng’ombe	PROPN
crias-79	116	2	had	have	VERB
crias-79	116	3	the	the	DET
crias-79	116	4	highest	high	ADJ
crias-79	116	5	mean	mean	NOUN
crias-79	116	6	of	of	ADP
crias-79	116	7	the	the	DET
crias-79	116	8	surviving	survive	VERB
crias-79	116	9	explants	explant	NOUN
crias-79	116	10	of	of	ADP
crias-79	116	11	65.65	65.65	NUM
crias-79	116	12	against	against	ADP
crias-79	116	13	kampala	kampala	PROPN
crias-79	116	14	and	and	CCONJ
crias-79	116	15	fhia	fhia	NOUN
crias-79	116	16	18	18	NUM
crias-79	116	17	at	at	ADP
crias-79	116	18	62.6	62.6	NUM
crias-79	116	19	±6.01	±6.01	NOUN
crias-79	116	20	and	and	CCONJ
crias-79	116	21	57.92	57.92	NUM
crias-79	116	22	±7.57	±7.57	PROPN
crias-79	116	23	respectively	respectively	ADV
crias-79	116	24	(	(	PUNCT
crias-79	116	25	df=2	df=2	NOUN
crias-79	116	26	;	;	PUNCT
crias-79	116	27	p<0.05	p<0.05	NOUN
crias-79	116	28	)	)	PUNCT
crias-79	116	29	(	(	PUNCT
crias-79	116	30	table	table	NOUN
crias-79	116	31	3.0	3.0	NUM
crias-79	116	32	)	)	PUNCT
crias-79	116	33	table-3	table-3	NUM
crias-79	116	34	.	.	PUNCT
crias-79	117	1	effect	effect	NOUN
crias-79	117	2	of	of	ADP
crias-79	117	3	variety	variety	NOUN
crias-79	117	4	on	on	ADP
crias-79	117	5	survival	survival	NOUN
crias-79	117	6	of	of	ADP
crias-79	117	7	explants	explant	NOUN
crias-79	117	8	and	and	CCONJ
crias-79	117	9	bsv	bsv	ADJ
crias-79	117	10	elimination	elimination	NOUN
crias-79	117	11	variety	variety	NOUN
crias-79	117	12	survival	survival	NOUN
crias-79	117	13	of	of	ADP
crias-79	117	14	explants	explant	NOUN
crias-79	117	15	virus	virus	NOUN
crias-79	117	16	elimination	elimination	NOUN
crias-79	117	17	fhia	fhia	NOUN
crias-79	117	18	18	18	NUM
crias-79	117	19	57.92	57.92	NUM
crias-79	117	20	+	+	NOUN
crias-79	117	21	7.566	7.566	NUM
crias-79	117	22	80.83	80.83	NUM
crias-79	117	23	+	+	PROPN
crias-79	117	24	2.163	2.163	NUM
crias-79	117	25	kampala	kampala	NOUN
crias-79	117	26	62.59	62.59	NUM
crias-79	117	27	+	+	NOUN
crias-79	117	28	6.006	6.006	NUM
crias-79	117	29	73.33	73.33	NUM
crias-79	117	30	+	+	SYM
crias-79	117	31	5.417	5.417	NUM
crias-79	117	32	nusu	nusu	NOUN
crias-79	117	33	ng’ombe	ng’ombe	ADP
crias-79	117	34	65.65	65.65	NUM
crias-79	118	1	+	+	NOUN
crias-79	118	2	6.090	6.090	NUM
crias-79	118	3	80.87	80.87	NUM
crias-79	118	4	+	+	ADP
crias-79	118	5	2.345	2.345	NUM
crias-79	118	6	there	there	PRON
crias-79	118	7	was	be	VERB
crias-79	118	8	an	an	DET
crias-79	118	9	effect	effect	NOUN
crias-79	118	10	of	of	ADP
crias-79	118	11	variety	variety	NOUN
crias-79	118	12	used	use	VERB
crias-79	118	13	on	on	ADP
crias-79	118	14	survival	survival	NOUN
crias-79	118	15	and	and	CCONJ
crias-79	118	16	bsv	bsv	ADJ
crias-79	118	17	elimination	elimination	NOUN
crias-79	118	18	(	(	PUNCT
crias-79	118	19	df=2	df=2	NOUN
crias-79	118	20	,	,	PUNCT
crias-79	118	21	p<0.05	p<0.05	NOUN
crias-79	118	22	)	)	PUNCT
crias-79	118	23	.	.	PUNCT
crias-79	119	1	3.2.1.2	3.2.1.2	X
crias-79	119	2	.	.	PUNCT
crias-79	119	3	effect	effect	NOUN
crias-79	119	4	of	of	ADP
crias-79	119	5	chemical	chemical	NOUN
crias-79	119	6	on	on	ADP
crias-79	119	7	survival	survival	NOUN
crias-79	119	8	of	of	ADP
crias-79	119	9	explants	explant	NOUN
crias-79	119	10	and	and	CCONJ
crias-79	119	11	virus	virus	NOUN
crias-79	119	12	elimination	elimination	NOUN
crias-79	119	13	even	even	ADV
crias-79	119	14	though	though	SCONJ
crias-79	119	15	both	both	DET
crias-79	119	16	chemicals	chemical	NOUN
crias-79	119	17	eliminated	eliminate	VERB
crias-79	119	18	the	the	DET
crias-79	119	19	virus	virus	NOUN
crias-79	119	20	,	,	PUNCT
crias-79	119	21	elimination	elimination	NOUN
crias-79	119	22	using	use	VERB
crias-79	119	23	salicylic	salicylic	ADJ
crias-79	119	24	acid	acid	NOUN
crias-79	119	25	was	be	AUX
crias-79	119	26	higher	high	ADJ
crias-79	119	27	than	than	ADP
crias-79	119	28	that	that	PRON
crias-79	119	29	of	of	ADP
crias-79	119	30	ribavirin	ribavirin	NOUN
crias-79	119	31	(	(	PUNCT
crias-79	119	32	df=2	df=2	NOUN
crias-79	119	33	;	;	PUNCT
crias-79	119	34	p<0.05	p<0.05	NOUN
crias-79	119	35	)	)	PUNCT
crias-79	119	36	salicylic	salicylic	NOUN
crias-79	119	37	acid	acid	NOUN
crias-79	119	38	had	have	VERB
crias-79	119	39	a	a	DET
crias-79	119	40	higher	high	ADJ
crias-79	119	41	survival	survival	NOUN
crias-79	119	42	mean	mean	NOUN
crias-79	119	43	of	of	ADP
crias-79	119	44	62.1	62.1	NUM
crias-79	119	45	±	±	NUM
crias-79	119	46	3.97	3.97	NUM
crias-79	119	47	compared	compare	VERB
crias-79	119	48	to	to	ADP
crias-79	119	49	ribavirin	ribavirin	NOUN
crias-79	119	50	at	at	ADP
crias-79	119	51	61.9	61.9	NUM
crias-79	119	52	±	±	NUM
crias-79	119	53	5.18	5.18	NUM
crias-79	119	54	salicylic	salicylic	NOUN
crias-79	119	55	acid	acid	NOUN
crias-79	119	56	had	have	VERB
crias-79	119	57	a	a	DET
crias-79	119	58	higher	high	ADJ
crias-79	119	59	bsv	bsv	NOUN
crias-79	119	60	elimination	elimination	NOUN
crias-79	119	61	of	of	ADP
crias-79	119	62	81.1	81.1	NUM
crias-79	119	63	±	±	NUM
crias-79	119	64	1.816b%	1.816b%	PROPN
crias-79	119	65	as	as	SCONJ
crias-79	119	66	compared	compare	VERB
crias-79	119	67	to	to	ADP
crias-79	119	68	75.26	75.26	NUM
crias-79	119	69	±	±	NUM
crias-79	119	70	3.969a%	3.969a%	NOUN
crias-79	119	71	across	across	ADP
crias-79	119	72	the	the	DET
crias-79	119	73	three	three	NUM
crias-79	119	74	varieties	variety	NOUN
crias-79	119	75	and	and	CCONJ
crias-79	119	76	chemical	chemical	NOUN
crias-79	119	77	concentrations	concentration	NOUN
crias-79	119	78	(	(	PUNCT
crias-79	119	79	table	table	NOUN
crias-79	119	80	4.0	4.0	NUM
crias-79	119	81	)	)	PUNCT
crias-79	119	82	.	.	PUNCT
crias-79	120	1	table	table	NOUN
crias-79	120	2	4	4	NUM
crias-79	120	3	.	.	PUNCT
crias-79	120	4	effect	effect	NOUN
crias-79	120	5	of	of	ADP
crias-79	120	6	chemical	chemical	NOUN
crias-79	120	7	on	on	ADP
crias-79	120	8	survival	survival	NOUN
crias-79	120	9	of	of	ADP
crias-79	120	10	explants	explant	NOUN
crias-79	120	11	and	and	CCONJ
crias-79	120	12	virus	virus	NOUN
crias-79	120	13	elimination	elimination	NOUN
crias-79	120	14	chemical	chemical	PROPN
crias-79	120	15	survival	survival	NOUN
crias-79	120	16	bsv	bsv	PROPN
crias-79	120	17	elimination	elimination	NOUN
crias-79	120	18	ribavirin	ribavirin	NOUN
crias-79	120	19	61.94	61.94	NUM
crias-79	120	20	±	±	NUM
crias-79	120	21	5.177	5.177	NUM
crias-79	120	22	75.26	75.26	NUM
crias-79	120	23	±	±	NUM
crias-79	120	24	3.969	3.969	NUM
crias-79	120	25	salicylic	salicylic	ADJ
crias-79	120	26	acid	acid	NOUN
crias-79	120	27	62.11	62.11	NUM
crias-79	120	28	±	±	NUM
crias-79	120	29	3.969	3.969	NUM
crias-79	120	30	81.11	81.11	NUM
crias-79	120	31	±	±	NUM
crias-79	120	32	1.816	1.816	NUM
crias-79	120	33	3.2.1.3	3.2.1.3	NUM
crias-79	120	34	.	.	PUNCT
crias-79	121	1	effect	effect	NOUN
crias-79	121	2	of	of	ADP
crias-79	121	3	chemical	chemical	ADJ
crias-79	121	4	concentration	concentration	NOUN
crias-79	121	5	to	to	ADP
crias-79	121	6	survival	survival	NOUN
crias-79	121	7	of	of	ADP
crias-79	121	8	explants	explant	NOUN
crias-79	121	9	and	and	CCONJ
crias-79	121	10	bsv	bsv	ADJ
crias-79	121	11	elimination	elimination	NOUN
crias-79	121	12	at	at	ADP
crias-79	121	13	0mg	0mg	ADJ
crias-79	121	14	/	/	SYM
crias-79	121	15	l	l	NOUN
crias-79	121	16	,	,	PUNCT
crias-79	121	17	survival	survival	NOUN
crias-79	121	18	of	of	ADP
crias-79	121	19	explants	explant	NOUN
crias-79	121	20	was	be	AUX
crias-79	121	21	as	as	ADV
crias-79	121	22	higher	high	ADJ
crias-79	121	23	as	as	ADP
crias-79	121	24	96.8	96.8	NUM
crias-79	121	25	+	+	NOUN
crias-79	121	26	3.33	3.33	NUM
crias-79	121	27	with	with	ADP
crias-79	121	28	0.0	0.0	NUM
crias-79	121	29	+	+	SYM
crias-79	121	30	0.0	0.0	NUM
crias-79	121	31	bsv	bsv	ADJ
crias-79	121	32	elimination	elimination	NOUN
crias-79	121	33	.	.	PUNCT
crias-79	122	1	when	when	SCONJ
crias-79	122	2	concentration	concentration	NOUN
crias-79	122	3	was	be	AUX
crias-79	122	4	increased	increase	VERB
crias-79	122	5	,	,	PUNCT
crias-79	122	6	survival	survival	NOUN
crias-79	122	7	of	of	ADP
crias-79	122	8	explants	explant	NOUN
crias-79	122	9	reduced	reduce	VERB
crias-79	122	10	with	with	ADP
crias-79	122	11	increase	increase	NOUN
crias-79	122	12	in	in	ADP
crias-79	122	13	bsv	bsv	ADJ
crias-79	122	14	elimination	elimination	NOUN
crias-79	122	15	.	.	PUNCT
crias-79	123	1	at	at	ADP
crias-79	123	2	10	10	NUM
crias-79	123	3	,	,	PUNCT
crias-79	123	4	20	20	NUM
crias-79	123	5	,	,	PUNCT
crias-79	123	6	30	30	NUM
crias-79	123	7	and	and	CCONJ
crias-79	123	8	40mg	40mg	NOUN
crias-79	123	9	/	/	SYM
crias-79	123	10	l	l	PROPN
crias-79	123	11	had	have	VERB
crias-79	123	12	83	83	NUM
crias-79	123	13	,	,	PUNCT
crias-79	123	14	78	78	NUM
crias-79	123	15	,	,	PUNCT
crias-79	123	16	66	66	NUM
crias-79	123	17	and	and	CCONJ
crias-79	123	18	11explants	11explants	NUM
crias-79	123	19	survival	survival	NOUN
crias-79	123	20	and	and	CCONJ
crias-79	123	21	76	76	NUM
crias-79	123	22	,	,	PUNCT
crias-79	123	23	82	82	NUM
crias-79	123	24	,	,	PUNCT
crias-79	123	25	84	84	NUM
crias-79	123	26	and	and	CCONJ
crias-79	123	27	88	88	NUM
crias-79	123	28	bsv	bsv	NOUN
crias-79	123	29	elimination	elimination	NOUN
crias-79	123	30	respectively	respectively	ADV
crias-79	123	31	(	(	PUNCT
crias-79	123	32	table	table	NOUN
crias-79	123	33	5.0	5.0	NUM
crias-79	123	34	)	)	PUNCT
crias-79	123	35	(	(	PUNCT
crias-79	123	36	df=4	df=4	X
crias-79	123	37	;	;	PUNCT
crias-79	123	38	p<0.05	p<0.05	NOUN
crias-79	123	39	)	)	PUNCT
crias-79	123	40	table	table	NOUN
crias-79	123	41	5	5	NUM
crias-79	123	42	.	.	PUNCT
crias-79	123	43	effect	effect	NOUN
crias-79	123	44	of	of	ADP
crias-79	123	45	chemical	chemical	ADJ
crias-79	123	46	concentration	concentration	NOUN
crias-79	123	47	on	on	ADP
crias-79	123	48	survival	survival	NOUN
crias-79	123	49	of	of	ADP
crias-79	123	50	explants	explant	NOUN
crias-79	123	51	and	and	CCONJ
crias-79	123	52	bsv	bsv	ADJ
crias-79	123	53	elimination	elimination	NOUN
crias-79	123	54	chemical	chemical	NOUN
crias-79	123	55	concentration	concentration	NOUN
crias-79	123	56	(	(	PUNCT
crias-79	123	57	mg	mg	PROPN
crias-79	123	58	/	/	SYM
crias-79	123	59	l	l	NOUN
crias-79	123	60	)	)	PUNCT
crias-79	123	61	explant	explant	ADJ
crias-79	123	62	survival	survival	NOUN
crias-79	123	63	bsv	bsv	PROPN
crias-79	123	64	elimination	elimination	NOUN
crias-79	123	65	0	0	NUM
crias-79	124	1	96.67	96.67	NUM
crias-79	125	1	+	+	NUM
crias-79	125	2	3.333	3.333	NUM
crias-79	125	3	0.00	0.00	NUM
crias-79	125	4	+	+	NUM
crias-79	125	5	0.00	0.00	NUM
crias-79	125	6	10	10	NUM
crias-79	125	7	83.33±3.052	83.33±3.052	NUM
crias-79	126	1	76.67±2.567	76.67±2.567	NUM
crias-79	126	2	20	20	NUM
crias-79	127	1	78.33±3.052	78.33±3.052	NUM
crias-79	127	2	82.78±1.948	82.78±1.948	NUM
crias-79	127	3	30	30	NUM
crias-79	128	1	66.11±5.248	66.11±5.248	NUM
crias-79	128	2	84.44±2.318	84.44±2.318	NUM
crias-79	128	3	40	40	NUM
crias-79	128	4	11.76±2.461	11.76±2.461	NUM
crias-79	128	5	88.76±0832	88.76±0832	NUM
crias-79	128	6	chemical	chemical	NOUN
crias-79	128	7	concentration	concentration	NOUN
crias-79	128	8	had	have	VERB
crias-79	128	9	a	a	DET
crias-79	128	10	significant	significant	ADJ
crias-79	128	11	effect	effect	NOUN
crias-79	128	12	on	on	ADP
crias-79	128	13	explant	explant	ADJ
crias-79	128	14	survival	survival	NOUN
crias-79	128	15	and	and	CCONJ
crias-79	128	16	bsv	bsv	ADJ
crias-79	128	17	elimination	elimination	NOUN
crias-79	128	18	at	at	ADP
crias-79	128	19	df=	df=	PROPN
crias-79	128	20	4	4	NUM
crias-79	128	21	;	;	PUNCT
crias-79	128	22	p<0.05	p<0.05	NOUN
crias-79	128	23	)	)	PUNCT
crias-79	128	24	3.2.2	3.2.2	NUM
crias-79	128	25	.	.	PUNCT
crias-79	129	1	thermotherapy	thermotherapy	PROPN
crias-79	129	2	3.2.2.1	3.2.2.1	NUM
crias-79	129	3	.	.	PUNCT
crias-79	129	4	effect	effect	NOUN
crias-79	129	5	of	of	ADP
crias-79	129	6	variety	variety	NOUN
crias-79	129	7	on	on	ADP
crias-79	129	8	bsv	bsv	ADJ
crias-79	129	9	elimination	elimination	NOUN
crias-79	129	10	and	and	CCONJ
crias-79	129	11	survival	survival	NOUN
crias-79	129	12	of	of	ADP
crias-79	129	13	explants	explant	NOUN
crias-79	129	14	the	the	DET
crias-79	129	15	variety	variety	NOUN
crias-79	129	16	had	have	VERB
crias-79	129	17	a	a	DET
crias-79	129	18	significant	significant	ADJ
crias-79	129	19	effect	effect	NOUN
crias-79	129	20	on	on	ADP
crias-79	129	21	both	both	DET
crias-79	129	22	bsv	bsv	ADJ
crias-79	129	23	elimination	elimination	NOUN
crias-79	129	24	from	from	ADP
crias-79	129	25	the	the	DET
crias-79	129	26	explants	explant	NOUN
crias-79	129	27	(	(	PUNCT
crias-79	129	28	df=2	df=2	NOUN
crias-79	129	29	;	;	PUNCT
crias-79	129	30	p<0.001	p<0.001	X
crias-79	129	31	)	)	PUNCT
crias-79	129	32	kampala	kampala	PROPN
crias-79	129	33	variety	variety	NOUN
crias-79	129	34	had	have	VERB
crias-79	129	35	the	the	DET
crias-79	129	36	highest	high	ADJ
crias-79	129	37	bsv	bsv	NOUN
crias-79	129	38	elimination	elimination	NOUN
crias-79	129	39	(	(	PUNCT
crias-79	129	40	39.6	39.6	NUM
crias-79	129	41	±10.86	±10.86	NOUN
crias-79	129	42	while	while	SCONJ
crias-79	129	43	nusu	nusu	PROPN
crias-79	129	44	ng’ombe	ng’ombe	PROPN
crias-79	129	45	had	have	VERB
crias-79	129	46	the	the	DET
crias-79	129	47	lowest	low	ADJ
crias-79	129	48	virus	virus	NOUN
crias-79	129	49	elimination	elimination	NOUN
crias-79	129	50	(	(	PUNCT
crias-79	129	51	37.9±10.93	37.9±10.93	NUM
crias-79	129	52	)	)	PUNCT
crias-79	129	53	at	at	ADP
crias-79	129	54	the	the	DET
crias-79	129	55	same	same	ADJ
crias-79	129	56	temperatures	temperature	NOUN
crias-79	129	57	(	(	PUNCT
crias-79	129	58	table	table	NOUN
crias-79	129	59	6.0	6.0	NUM
crias-79	129	60	)	)	PUNCT
crias-79	129	61	.	.	PUNCT
crias-79	130	1	current	current	ADJ
crias-79	130	2	research	research	NOUN
crias-79	130	3	in	in	ADP
crias-79	130	4	agricultural	agricultural	ADJ
crias-79	130	5	sciences	science	NOUN
crias-79	130	6	,	,	PUNCT
crias-79	130	7	2015	2015	NUM
crias-79	130	8	,	,	PUNCT
crias-79	130	9	2(3	2(3	NUM
crias-79	130	10	):	):	PUNCT
crias-79	130	11	81	81	NUM
crias-79	130	12	-	-	SYM
crias-79	130	13	89	89	NUM
crias-79	130	14	87	87	NUM
crias-79	130	15	©	©	PROPN
crias-79	130	16	2015	2015	NUM
crias-79	130	17	conscientia	conscientia	PROPN
crias-79	130	18	beam	beam	PROPN
crias-79	130	19	.	.	PUNCT
crias-79	131	1	all	all	DET
crias-79	131	2	rights	right	NOUN
crias-79	131	3	reserved	reserve	VERB
crias-79	131	4	.	.	PUNCT
crias-79	132	1	table	table	NOUN
crias-79	132	2	6	6	NUM
crias-79	132	3	.	.	PUNCT
crias-79	132	4	effect	effect	NOUN
crias-79	132	5	of	of	ADP
crias-79	132	6	variety	variety	NOUN
crias-79	132	7	to	to	ADP
crias-79	132	8	bsv	bsv	ADJ
crias-79	132	9	elimination	elimination	NOUN
crias-79	132	10	and	and	CCONJ
crias-79	132	11	survival	survival	NOUN
crias-79	132	12	of	of	ADP
crias-79	132	13	explants	explant	NOUN
crias-79	132	14	variety	variety	PROPN
crias-79	132	15	virus	virus	PROPN
crias-79	132	16	elimination	elimination	NOUN
crias-79	132	17	survival	survival	NOUN
crias-79	132	18	fhia	fhia	VERB
crias-79	132	19	18	18	NUM
crias-79	132	20	39.17±10.88a	39.17±10.88a	NUM
crias-79	132	21	100.00±0.00a	100.00±0.00a	NUM
crias-79	132	22	kampala	kampala	NOUN
crias-79	132	23	39.58±10.86a	39.58±10.86a	NUM
crias-79	132	24	100.00±0.00a	100.00±0.00a	NUM
crias-79	132	25	nusu	nusu	NOUN
crias-79	132	26	ng’ombe	ng’ombe	NOUN
crias-79	132	27	37.92±10.93a	37.92±10.93a	NUM
crias-79	132	28	100.00±0.00a	100.00±0.00a	NUM
crias-79	132	29	variety	variety	NOUN
crias-79	132	30	used	use	VERB
crias-79	132	31	had	have	VERB
crias-79	132	32	a	a	DET
crias-79	132	33	significant	significant	ADJ
crias-79	132	34	effect	effect	NOUN
crias-79	132	35	on	on	ADP
crias-79	132	36	both	both	DET
crias-79	132	37	bsv	bsv	ADJ
crias-79	132	38	elimination	elimination	NOUN
crias-79	132	39	from	from	ADP
crias-79	132	40	the	the	DET
crias-79	132	41	explants	explant	NOUN
crias-79	132	42	(	(	PUNCT
crias-79	132	43	df=2	df=2	NOUN
crias-79	132	44	;	;	PUNCT
crias-79	132	45	p<0.001	p<0.001	X
crias-79	132	46	)	)	PUNCT
crias-79	133	1	3.2.2.2	3.2.2.2	X
crias-79	133	2	.	.	PROPN
crias-79	133	3	effect	effect	NOUN
crias-79	133	4	of	of	ADP
crias-79	133	5	temperature	temperature	NOUN
crias-79	133	6	on	on	ADP
crias-79	133	7	bsv	bsv	ADJ
crias-79	133	8	elimination	elimination	NOUN
crias-79	133	9	and	and	CCONJ
crias-79	133	10	survival	survival	NOUN
crias-79	133	11	of	of	ADP
crias-79	133	12	explants	explant	NOUN
crias-79	133	13	temperature	temperature	NOUN
crias-79	133	14	had	have	VERB
crias-79	133	15	a	a	DET
crias-79	133	16	significant	significant	ADJ
crias-79	133	17	effect	effect	NOUN
crias-79	133	18	on	on	ADP
crias-79	133	19	bsv	bsv	ADJ
crias-79	133	20	elimination	elimination	NOUN
crias-79	133	21	as	as	ADV
crias-79	133	22	well	well	ADV
crias-79	133	23	as	as	ADP
crias-79	133	24	survival	survival	NOUN
crias-79	133	25	of	of	ADP
crias-79	133	26	explants	explant	NOUN
crias-79	133	27	(	(	PUNCT
crias-79	133	28	p<0.05	p<0.05	NOUN
crias-79	133	29	)	)	PUNCT
crias-79	133	30	.	.	PUNCT
crias-79	134	1	the	the	DET
crias-79	134	2	higher	high	ADJ
crias-79	134	3	temperature	temperature	NOUN
crias-79	134	4	,	,	PUNCT
crias-79	134	5	contributed	contribute	VERB
crias-79	134	6	to	to	ADP
crias-79	134	7	higher	high	ADJ
crias-79	134	8	bsv	bsv	NOUN
crias-79	134	9	elimination	elimination	NOUN
crias-79	134	10	.	.	PUNCT
crias-79	135	1	all	all	DET
crias-79	135	2	temperature	temperature	NOUN
crias-79	135	3	levels	level	NOUN
crias-79	135	4	used	use	VERB
crias-79	135	5	had	have	VERB
crias-79	135	6	a	a	DET
crias-79	135	7	100.0	100.0	NUM
crias-79	135	8	±	±	NUM
crias-79	135	9	0.00	0.00	NUM
crias-79	135	10	explants	explant	NOUN
crias-79	135	11	survival	survival	NOUN
crias-79	135	12	except	except	SCONJ
crias-79	135	13	when	when	SCONJ
crias-79	135	14	the	the	DET
crias-79	135	15	explants	explant	NOUN
crias-79	135	16	were	be	AUX
crias-79	135	17	placed	place	VERB
crias-79	135	18	at	at	ADP
crias-79	135	19	38	38	NUM
crias-79	135	20	°	°	NOUN
crias-79	135	21	c	c	NOUN
crias-79	135	22	when	when	SCONJ
crias-79	135	23	all	all	DET
crias-79	135	24	explants	explant	NOUN
crias-79	135	25	got	get	AUX
crias-79	135	26	scorched	scorch	VERB
crias-79	135	27	the	the	DET
crias-79	135	28	lower	low	ADJ
crias-79	135	29	the	the	DET
crias-79	135	30	temperature	temperature	NOUN
crias-79	135	31	,	,	PUNCT
crias-79	135	32	the	the	PRON
crias-79	135	33	higher	high	ADJ
crias-79	135	34	the	the	DET
crias-79	135	35	bsv	bsv	NOUN
crias-79	135	36	elimination	elimination	NOUN
crias-79	135	37	(	(	PUNCT
crias-79	135	38	table	table	NOUN
crias-79	135	39	7.0	7.0	NUM
crias-79	135	40	)	)	PUNCT
crias-79	135	41	.	.	PUNCT
crias-79	136	1	table	table	NOUN
crias-79	136	2	7	7	NUM
crias-79	136	3	.	.	PUNCT
crias-79	136	4	effect	effect	NOUN
crias-79	136	5	of	of	ADP
crias-79	136	6	temperature	temperature	NOUN
crias-79	136	7	on	on	ADP
crias-79	136	8	bsv	bsv	ADJ
crias-79	136	9	elimination	elimination	NOUN
crias-79	136	10	and	and	CCONJ
crias-79	136	11	survival	survival	NOUN
crias-79	136	12	of	of	ADP
crias-79	136	13	explants	explant	NOUN
crias-79	136	14	temperature	temperature	NOUN
crias-79	136	15	(	(	PUNCT
crias-79	136	16	°	°	ADP
crias-79	136	17	c	c	NOUN
crias-79	136	18	)	)	PUNCT
crias-79	136	19	virus	virus	NOUN
crias-79	136	20	elimination	elimination	NOUN
crias-79	136	21	survival	survival	NOUN
crias-79	136	22	27	27	NUM
crias-79	136	23	0.00±0.00	0.00±0.00	NOUN
crias-79	136	24	100.00±0.00	100.00±0.00	NUM
crias-79	136	25	32	32	NUM
crias-79	136	26	13.33±	13.33±	NUM
crias-79	136	27	6.47	6.47	NUM
crias-79	136	28	100.00±0.00	100.00±0.00	NUM
crias-79	136	29	34	34	NUM
crias-79	136	30	57.78±5.54	57.78±5.54	NUM
crias-79	136	31	100.00±0.00	100.00±0.00	NUM
crias-79	136	32	36	36	NUM
crias-79	136	33	84.89±1.54	84.89±1.54	NUM
crias-79	136	34	100.00±0.00	100.00±0.00	NUM
crias-79	136	35	38	38	NUM
crias-79	136	36	n	n	CCONJ
crias-79	136	37	/	/	SYM
crias-79	136	38	a	a	DET
crias-79	136	39	died	die	VERB
crias-79	136	40	temperature	temperature	NOUN
crias-79	136	41	had	have	VERB
crias-79	136	42	a	a	DET
crias-79	136	43	significant	significant	ADJ
crias-79	136	44	effect	effect	NOUN
crias-79	136	45	on	on	ADP
crias-79	136	46	bsv	bsv	ADJ
crias-79	136	47	elimination	elimination	NOUN
crias-79	136	48	(	(	PUNCT
crias-79	136	49	df	df	NOUN
crias-79	136	50	=	=	NOUN
crias-79	136	51	4	4	NUM
crias-79	136	52	;	;	PUNCT
crias-79	136	53	p<0.05	p<0.05	NOUN
crias-79	136	54	)	)	PUNCT
crias-79	136	55	3.2.3	3.2.3	NUM
crias-79	136	56	.	.	PUNCT
crias-79	137	1	meristem	meristem	NOUN
crias-79	137	2	tip	tip	NOUN
crias-79	137	3	culture	culture	PROPN
crias-79	137	4	3.2.3.2	3.2.3.2	NUM
crias-79	137	5	.	.	PUNCT
crias-79	137	6	effect	effect	NOUN
crias-79	137	7	of	of	ADP
crias-79	137	8	meristem	meristem	NOUN
crias-79	137	9	tip	tip	NOUN
crias-79	137	10	size	size	NOUN
crias-79	137	11	on	on	ADP
crias-79	137	12	bsv	bsv	ADJ
crias-79	137	13	elimination	elimination	NOUN
crias-79	137	14	and	and	CCONJ
crias-79	137	15	explants	explant	NOUN
crias-79	137	16	survival	survival	VERB
crias-79	137	17	the	the	DET
crias-79	137	18	highest	high	ADJ
crias-79	137	19	virus	virus	NOUN
crias-79	137	20	elimination	elimination	NOUN
crias-79	137	21	was	be	AUX
crias-79	137	22	at	at	ADP
crias-79	137	23	1	1	NUM
crias-79	137	24	mm	mm	NOUN
crias-79	137	25	sized	sized	ADJ
crias-79	137	26	explants	explant	NOUN
crias-79	137	27	.	.	PUNCT
crias-79	138	1	the	the	PRON
crias-79	138	2	smaller	small	ADJ
crias-79	138	3	the	the	DET
crias-79	138	4	explant	explant	NOUN
crias-79	138	5	used	use	VERB
crias-79	138	6	the	the	DET
crias-79	138	7	lower	low	ADJ
crias-79	138	8	the	the	DET
crias-79	138	9	survival	survival	NOUN
crias-79	138	10	and	and	CCONJ
crias-79	138	11	the	the	PRON
crias-79	138	12	higher	high	ADJ
crias-79	138	13	the	the	DET
crias-79	138	14	bsv	bsv	NOUN
crias-79	138	15	elimination	elimination	NOUN
crias-79	138	16	and	and	CCONJ
crias-79	138	17	vice	vice	NOUN
crias-79	138	18	versa	versa	ADV
crias-79	138	19	in	in	ADP
crias-79	138	20	all	all	DET
crias-79	138	21	the	the	DET
crias-79	138	22	three	three	NUM
crias-79	138	23	varieties	variety	NOUN
crias-79	138	24	.	.	PUNCT
crias-79	139	1	at	at	ADP
crias-79	139	2	1	1	NUM
crias-79	139	3	mm	mm	NOUN
crias-79	139	4	,	,	PUNCT
crias-79	139	5	bsv	bsv	ADJ
crias-79	139	6	elimination	elimination	NOUN
crias-79	139	7	was	be	AUX
crias-79	139	8	89.0±1.20	89.0±1.20	NUM
crias-79	139	9	and	and	CCONJ
crias-79	139	10	32.4±0.38	32.4±0.38	NUM
crias-79	139	11	plants	plant	NOUN
crias-79	139	12	survival	survival	NOUN
crias-79	139	13	respectively	respectively	ADV
crias-79	139	14	,	,	PUNCT
crias-79	139	15	(	(	PUNCT
crias-79	139	16	df	df	NOUN
crias-79	139	17	=	=	SYM
crias-79	139	18	4	4	NUM
crias-79	139	19	;	;	PUNCT
crias-79	139	20	p<0.001	p<0.001	X
crias-79	139	21	)	)	PUNCT
crias-79	139	22	(	(	PUNCT
crias-79	139	23	table	table	NOUN
crias-79	139	24	9.0	9.0	NUM
crias-79	139	25	)	)	PUNCT
crias-79	139	26	table	table	NOUN
crias-79	139	27	9	9	NUM
crias-79	139	28	.	.	PUNCT
crias-79	139	29	effect	effect	NOUN
crias-79	139	30	of	of	ADP
crias-79	139	31	meristem	meristem	NOUN
crias-79	139	32	tip	tip	NOUN
crias-79	139	33	size	size	NOUN
crias-79	139	34	on	on	ADP
crias-79	139	35	bsv	bsv	ADJ
crias-79	139	36	elimination	elimination	NOUN
crias-79	139	37	and	and	CCONJ
crias-79	139	38	explants	explant	NOUN
crias-79	139	39	survival	survival	NOUN
crias-79	139	40	size	size	NOUN
crias-79	139	41	(	(	PUNCT
crias-79	139	42	mm	mm	NOUN
crias-79	139	43	)	)	PUNCT
crias-79	139	44	bsv	bsv	ADJ
crias-79	139	45	elimination	elimination	NOUN
crias-79	139	46	explants	explant	NOUN
crias-79	139	47	survival	survival	VERB
crias-79	139	48	1	1	NUM
crias-79	139	49	89.00±1.202a	89.00±1.202a	NUM
crias-79	139	50	32.44±0.377b	32.44±0.377b	NUM
crias-79	139	51	2	2	NUM
crias-79	140	1	62.56±0.766a	62.56±0.766a	NUM
crias-79	140	2	100.00±0.00a	100.00±0.00a	NUM
crias-79	140	3	3	3	NUM
crias-79	140	4	43.00±3.00b	43.00±3.00b	NUM
crias-79	140	5	100.00±0.00a	100.00±0.00a	NUM
crias-79	140	6	4	4	NUM
crias-79	140	7	0.56±0.242c	0.56±0.242c	NOUN
crias-79	141	1	100.00±0.00a	100.00±0.00a	NUM
crias-79	141	2	5	5	NUM
crias-79	141	3	0.11±0.11c	0.11±0.11c	NOUN
crias-79	141	4	100.00±0.00a	100.00±0.00a	NUM
crias-79	141	5	the	the	DET
crias-79	141	6	size	size	NOUN
crias-79	141	7	of	of	ADP
crias-79	141	8	the	the	DET
crias-79	141	9	explant	explant	NOUN
crias-79	141	10	used	use	VERB
crias-79	141	11	had	have	VERB
crias-79	141	12	a	a	DET
crias-79	141	13	significant	significant	ADJ
crias-79	141	14	effect	effect	NOUN
crias-79	141	15	on	on	ADP
crias-79	141	16	both	both	CCONJ
crias-79	141	17	the	the	DET
crias-79	141	18	bsv	bsv	ADJ
crias-79	141	19	elimination	elimination	NOUN
crias-79	141	20	and	and	CCONJ
crias-79	141	21	survival	survival	NOUN
crias-79	141	22	of	of	ADP
crias-79	141	23	the	the	DET
crias-79	141	24	explants	explant	NOUN
crias-79	141	25	in	in	ADP
crias-79	141	26	all	all	DET
crias-79	141	27	the	the	DET
crias-79	141	28	varieties	variety	NOUN
crias-79	141	29	(	(	PUNCT
crias-79	141	30	df=4	df=4	ADJ
crias-79	141	31	;	;	PUNCT
crias-79	141	32	p<0.001	p<0.001	X
crias-79	141	33	)	)	PUNCT
crias-79	141	34	.	.	PUNCT
crias-79	142	1	4	4	X
crias-79	142	2	.	.	X
crias-79	142	3	discussion	discussion	NOUN
crias-79	142	4	all	all	DET
crias-79	142	5	the	the	DET
crias-79	142	6	three	three	NUM
crias-79	142	7	methods	method	NOUN
crias-79	142	8	evaluated	evaluate	VERB
crias-79	142	9	for	for	ADP
crias-79	142	10	elimination	elimination	NOUN
crias-79	142	11	of	of	ADP
crias-79	142	12	banana	banana	NOUN
crias-79	142	13	streak	streak	PROPN
crias-79	142	14	virus	virus	NOUN
crias-79	142	15	were	be	AUX
crias-79	142	16	effective	effective	ADJ
crias-79	142	17	though	though	ADV
crias-79	142	18	at	at	ADP
crias-79	142	19	different	different	ADJ
crias-79	142	20	specifications	specification	NOUN
crias-79	142	21	.	.	PUNCT
crias-79	143	1	heat	heat	NOUN
crias-79	143	2	therapy	therapy	NOUN
crias-79	143	3	gave	give	VERB
crias-79	143	4	the	the	DET
crias-79	143	5	best	good	ADJ
crias-79	143	6	results	result	NOUN
crias-79	143	7	at	at	ADP
crias-79	143	8	36	36	NUM
crias-79	143	9	°	°	NOUN
crias-79	143	10	c	c	NOUN
crias-79	143	11	,	,	PUNCT
crias-79	143	12	while	while	SCONJ
crias-79	143	13	chemotherapy	chemotherapy	NOUN
crias-79	143	14	gave	give	VERB
crias-79	143	15	the	the	DET
crias-79	143	16	best	good	ADJ
crias-79	143	17	results	result	NOUN
crias-79	143	18	at	at	ADP
crias-79	143	19	20mg	20mg	ADJ
crias-79	143	20	/	/	SYM
crias-79	143	21	l	l	NOUN
crias-79	143	22	for	for	ADP
crias-79	143	23	both	both	DET
crias-79	143	24	chemicals	chemical	NOUN
crias-79	143	25	used	use	VERB
crias-79	143	26	separately	separately	ADV
crias-79	143	27	and	and	CCONJ
crias-79	143	28	meristem	meristem	NOUN
crias-79	143	29	tip	tip	NOUN
crias-79	143	30	culture	culture	NOUN
crias-79	143	31	at	at	ADP
crias-79	143	32	1	1	NUM
crias-79	143	33	mm	mm	NOUN
crias-79	143	34	.	.	PUNCT
crias-79	144	1	current	current	ADJ
crias-79	144	2	research	research	NOUN
crias-79	144	3	in	in	ADP
crias-79	144	4	agricultural	agricultural	ADJ
crias-79	144	5	sciences	science	NOUN
crias-79	144	6	,	,	PUNCT
crias-79	144	7	2015	2015	NUM
crias-79	144	8	,	,	PUNCT
crias-79	144	9	2(3	2(3	NUM
crias-79	144	10	):	):	PUNCT
crias-79	144	11	81	81	NUM
crias-79	144	12	-	-	SYM
crias-79	144	13	89	89	NUM
crias-79	144	14	88	88	NUM
crias-79	144	15	©	©	PROPN
crias-79	144	16	2015	2015	NUM
crias-79	144	17	conscientia	conscientia	PROPN
crias-79	144	18	beam	beam	PROPN
crias-79	144	19	.	.	PUNCT
crias-79	145	1	all	all	DET
crias-79	145	2	rights	right	NOUN
crias-79	145	3	reserved	reserve	VERB
crias-79	145	4	.	.	PUNCT
crias-79	146	1	the	the	DET
crias-79	146	2	different	different	ADJ
crias-79	146	3	specific	specific	ADJ
crias-79	146	4	primers	primer	NOUN
crias-79	146	5	pairs	pair	NOUN
crias-79	146	6	(	(	PUNCT
crias-79	146	7	table	table	NOUN
crias-79	146	8	1.0	1.0	NUM
crias-79	146	9	)	)	PUNCT
crias-79	146	10	used	use	VERB
crias-79	146	11	to	to	PART
crias-79	146	12	detect	detect	VERB
crias-79	146	13	different	different	ADJ
crias-79	146	14	strains	strain	NOUN
crias-79	146	15	of	of	ADP
crias-79	146	16	bsv	bsv	NOUN
crias-79	146	17	amplified	amplify	VERB
crias-79	146	18	all	all	DET
crias-79	146	19	the	the	DET
crias-79	146	20	bsv	bsv	NOUN
crias-79	146	21	strains	strain	VERB
crias-79	146	22	present	present	ADJ
crias-79	146	23	except	except	SCONJ
crias-79	146	24	for	for	ADP
crias-79	146	25	bsv	bsv	PROPN
crias-79	146	26	cavendish	cavendish	PROPN
crias-79	146	27	.	.	PUNCT
crias-79	147	1	results	result	NOUN
crias-79	147	2	of	of	ADP
crias-79	147	3	this	this	DET
crias-79	147	4	work	work	NOUN
crias-79	147	5	showed	show	VERB
crias-79	147	6	that	that	SCONJ
crias-79	147	7	50	50	NUM
crias-79	147	8	%	%	NOUN
crias-79	147	9	of	of	ADP
crias-79	147	10	the	the	DET
crias-79	147	11	samples	sample	NOUN
crias-79	147	12	collected	collect	VERB
crias-79	147	13	were	be	AUX
crias-79	147	14	bsv	bsv	NOUN
crias-79	147	15	infected	infect	VERB
crias-79	147	16	(	(	PUNCT
crias-79	147	17	table	table	NOUN
crias-79	147	18	2.0	2.0	NUM
crias-79	147	19	)	)	PUNCT
crias-79	147	20	.	.	PUNCT
crias-79	148	1	these	these	DET
crias-79	148	2	results	result	NOUN
crias-79	148	3	are	be	AUX
crias-79	148	4	in	in	ADP
crias-79	148	5	agreement	agreement	NOUN
crias-79	148	6	with	with	ADP
crias-79	148	7	previous	previous	ADJ
crias-79	148	8	studies	study	NOUN
crias-79	148	9	carried	carry	VERB
crias-79	148	10	out	out	ADP
crias-79	148	11	in	in	ADP
crias-79	148	12	kenya	kenya	NOUN
crias-79	148	13	which	which	PRON
crias-79	148	14	showed	show	VERB
crias-79	148	15	that	that	SCONJ
crias-79	148	16	bsv	bsv	PROPN
crias-79	148	17	is	be	AUX
crias-79	148	18	prevalent	prevalent	ADJ
crias-79	148	19	in	in	ADP
crias-79	148	20	all	all	DET
crias-79	148	21	banana	banana	NOUN
crias-79	148	22	growing	grow	VERB
crias-79	148	23	regions	region	NOUN
crias-79	148	24	and	and	CCONJ
crias-79	148	25	that	that	SCONJ
crias-79	148	26	all	all	DET
crias-79	148	27	popular	popular	ADJ
crias-79	148	28	cultivars	cultivar	NOUN
crias-79	148	29	grown	grow	VERB
crias-79	148	30	by	by	ADP
crias-79	148	31	farmers	farmer	NOUN
crias-79	148	32	are	be	AUX
crias-79	148	33	susceptible	susceptible	ADJ
crias-79	148	34	[	[	X
crias-79	148	35	15	15	NUM
crias-79	148	36	]	]	PUNCT
crias-79	148	37	,	,	PUNCT
crias-79	148	38	[	[	X
crias-79	148	39	16	16	NUM
crias-79	148	40	]	]	PUNCT
crias-79	148	41	,	,	PUNCT
crias-79	148	42	[	[	X
crias-79	148	43	3	3	NUM
crias-79	148	44	]	]	PUNCT
crias-79	148	45	.	.	PUNCT
crias-79	149	1	in	in	ADP
crias-79	149	2	meristem	meristem	NOUN
crias-79	149	3	tip	tip	NOUN
crias-79	149	4	culture	culture	NOUN
crias-79	149	5	,	,	PUNCT
crias-79	149	6	the	the	DET
crias-79	149	7	size	size	NOUN
crias-79	149	8	of	of	ADP
crias-79	149	9	the	the	DET
crias-79	149	10	explant	explant	NOUN
crias-79	149	11	used	use	VERB
crias-79	149	12	had	have	VERB
crias-79	149	13	a	a	DET
crias-79	149	14	significant	significant	ADJ
crias-79	149	15	effect	effect	NOUN
crias-79	149	16	on	on	ADP
crias-79	149	17	both	both	PRON
crias-79	149	18	explant	explant	ADJ
crias-79	149	19	survival	survival	NOUN
crias-79	149	20	and	and	CCONJ
crias-79	149	21	bsv	bsv	ADJ
crias-79	149	22	elimination	elimination	NOUN
crias-79	149	23	.	.	PUNCT
crias-79	150	1	the	the	PRON
crias-79	150	2	smaller	small	ADJ
crias-79	150	3	the	the	DET
crias-79	150	4	size	size	NOUN
crias-79	150	5	of	of	ADP
crias-79	150	6	the	the	DET
crias-79	150	7	meristem	meristem	NOUN
crias-79	150	8	used	use	VERB
crias-79	150	9	the	the	DET
crias-79	150	10	higher	high	ADJ
crias-79	150	11	the	the	DET
crias-79	150	12	bsv	bsv	NOUN
crias-79	150	13	elimination	elimination	NOUN
crias-79	150	14	(	(	PUNCT
crias-79	150	15	table	table	NOUN
crias-79	150	16	8.0	8.0	NUM
crias-79	150	17	and	and	CCONJ
crias-79	150	18	9.0	9.0	NUM
crias-79	150	19	)	)	PUNCT
crias-79	150	20	.	.	PUNCT
crias-79	151	1	the	the	DET
crias-79	151	2	success	success	NOUN
crias-79	151	3	of	of	ADP
crias-79	151	4	heat	heat	NOUN
crias-79	151	5	therapy	therapy	NOUN
crias-79	151	6	depends	depend	VERB
crias-79	151	7	on	on	ADP
crias-79	151	8	selecting	select	VERB
crias-79	151	9	the	the	DET
crias-79	151	10	temperature	temperature	NOUN
crias-79	151	11	and	and	CCONJ
crias-79	151	12	the	the	DET
crias-79	151	13	duration	duration	NOUN
crias-79	151	14	of	of	ADP
crias-79	151	15	the	the	DET
crias-79	151	16	treatment	treatment	NOUN
crias-79	151	17	for	for	ADP
crias-79	151	18	the	the	DET
crias-79	151	19	elimination	elimination	NOUN
crias-79	151	20	of	of	ADP
crias-79	151	21	the	the	DET
crias-79	151	22	virus	virus	NOUN
crias-79	151	23	and	and	CCONJ
crias-79	151	24	also	also	ADV
crias-79	151	25	with	with	ADP
crias-79	151	26	the	the	DET
crias-79	151	27	survival	survival	NOUN
crias-79	151	28	of	of	ADP
crias-79	151	29	the	the	DET
crias-79	151	30	plant	plant	NOUN
crias-79	151	31	.	.	PUNCT
crias-79	152	1	in	in	ADP
crias-79	152	2	this	this	DET
crias-79	152	3	study	study	NOUN
crias-79	152	4	,	,	PUNCT
crias-79	152	5	all	all	DET
crias-79	152	6	explants	explant	NOUN
crias-79	152	7	exposed	expose	VERB
crias-79	152	8	to	to	ADP
crias-79	152	9	temperatures	temperature	NOUN
crias-79	152	10	of	of	ADP
crias-79	152	11	27	27	NUM
crias-79	152	12	°	°	NOUN
crias-79	152	13	c	c	NOUN
crias-79	152	14	,	,	PUNCT
crias-79	152	15	32	32	NUM
crias-79	152	16	°	°	NOUN
crias-79	152	17	c	c	NOUN
crias-79	152	18	,	,	PUNCT
crias-79	152	19	34	34	NUM
crias-79	152	20	°	°	NOUN
crias-79	152	21	c	c	NOUN
crias-79	152	22	and	and	CCONJ
crias-79	152	23	36	36	NUM
crias-79	152	24	°	°	NOUN
crias-79	152	25	c	c	NOUN
crias-79	152	26	survived	survive	VERB
crias-79	152	27	after	after	ADP
crias-79	152	28	being	be	AUX
crias-79	152	29	put	put	VERB
crias-79	152	30	in	in	ADP
crias-79	152	31	an	an	DET
crias-79	152	32	incubator	incubator	NOUN
crias-79	152	33	for	for	ADP
crias-79	152	34	10	10	NUM
crias-79	152	35	days	day	NOUN
crias-79	152	36	,	,	PUNCT
crias-79	152	37	but	but	CCONJ
crias-79	152	38	at	at	ADP
crias-79	152	39	38	38	NUM
crias-79	152	40	°	°	NOUN
crias-79	152	41	c	c	NOUN
crias-79	152	42	all	all	DET
crias-79	152	43	the	the	DET
crias-79	152	44	explants	explant	NOUN
crias-79	152	45	were	be	AUX
crias-79	152	46	scorched	scorch	VERB
crias-79	152	47	by	by	ADP
crias-79	152	48	the	the	DET
crias-79	152	49	heat	heat	NOUN
crias-79	152	50	and	and	CCONJ
crias-79	152	51	therefore	therefore	ADV
crias-79	152	52	no	no	DET
crias-79	152	53	plantlet	plantlet	NOUN
crias-79	152	54	could	could	AUX
crias-79	152	55	be	be	AUX
crias-79	152	56	regenerated	regenerate	VERB
crias-79	152	57	from	from	ADP
crias-79	152	58	this	this	DET
crias-79	152	59	treatment	treatment	NOUN
crias-79	152	60	.	.	PUNCT
crias-79	153	1	the	the	DET
crias-79	153	2	highest	high	ADJ
crias-79	153	3	virus	virus	NOUN
crias-79	153	4	elimination	elimination	NOUN
crias-79	153	5	percent	percent	NOUN
crias-79	153	6	was	be	AUX
crias-79	153	7	at	at	ADP
crias-79	153	8	36	36	NUM
crias-79	153	9	°	°	NOUN
crias-79	153	10	c	c	NOUN
crias-79	153	11	(	(	PUNCT
crias-79	153	12	table	table	NOUN
crias-79	153	13	6.0	6.0	NUM
crias-79	153	14	and	and	CCONJ
crias-79	153	15	table	table	NOUN
crias-79	153	16	7.0	7.0	NUM
crias-79	153	17	)	)	PUNCT
crias-79	153	18	.	.	PUNCT
crias-79	154	1	the	the	DET
crias-79	154	2	results	result	NOUN
crias-79	154	3	demonstrate	demonstrate	VERB
crias-79	154	4	that	that	SCONJ
crias-79	154	5	ribavirin	ribavirin	NOUN
crias-79	154	6	and	and	CCONJ
crias-79	154	7	salicylic	salicylic	ADJ
crias-79	154	8	acid	acid	NOUN
crias-79	154	9	at	at	ADP
crias-79	154	10	concentration	concentration	NOUN
crias-79	154	11	of	of	ADP
crias-79	154	12	10mg	10mg	NOUN
crias-79	154	13	/	/	SYM
crias-79	154	14	l	l	NOUN
crias-79	154	15	enhanced	enhance	VERB
crias-79	154	16	growth	growth	NOUN
crias-79	154	17	differentiation	differentiation	NOUN
crias-79	154	18	of	of	ADP
crias-79	154	19	propagated	propagate	VERB
crias-79	154	20	meristems	meristem	NOUN
crias-79	154	21	.	.	PUNCT
crias-79	155	1	it	it	PRON
crias-79	155	2	can	can	AUX
crias-79	155	3	be	be	AUX
crias-79	155	4	concluded	conclude	VERB
crias-79	155	5	that	that	SCONJ
crias-79	155	6	the	the	DET
crias-79	155	7	use	use	NOUN
crias-79	155	8	of	of	ADP
crias-79	155	9	ribavirin	ribavirin	NOUN
crias-79	155	10	and	and	CCONJ
crias-79	155	11	salicylic	salicylic	ADJ
crias-79	155	12	acid	acid	NOUN
crias-79	155	13	separately	separately	ADV
crias-79	155	14	at	at	ADP
crias-79	155	15	20	20	NUM
crias-79	155	16	mg	mg	NUM
crias-79	155	17	/	/	SYM
crias-79	155	18	l	l	NOUN
crias-79	155	19	combined	combine	VERB
crias-79	155	20	with	with	ADP
crias-79	155	21	tc	tc	NOUN
crias-79	155	22	process	process	NOUN
crias-79	155	23	can	can	AUX
crias-79	155	24	increase	increase	VERB
crias-79	155	25	the	the	DET
crias-79	155	26	percentage	percentage	NOUN
crias-79	155	27	of	of	ADP
crias-79	155	28	virus	virus	NOUN
crias-79	155	29	-	-	PUNCT
crias-79	155	30	free	free	ADJ
crias-79	155	31	plants	plant	NOUN
crias-79	155	32	.	.	PUNCT
crias-79	156	1	it	it	PRON
crias-79	156	2	was	be	AUX
crias-79	156	3	noted	note	VERB
crias-79	156	4	that	that	SCONJ
crias-79	156	5	the	the	PRON
crias-79	156	6	higher	high	ADJ
crias-79	156	7	the	the	DET
crias-79	156	8	chemical	chemical	NOUN
crias-79	156	9	concentration	concentration	NOUN
crias-79	156	10	,	,	PUNCT
crias-79	156	11	the	the	PRON
crias-79	156	12	higher	high	ADJ
crias-79	156	13	the	the	DET
crias-79	156	14	virus	virus	NOUN
crias-79	156	15	elimination	elimination	NOUN
crias-79	156	16	percentage	percentage	NOUN
crias-79	156	17	(	(	PUNCT
crias-79	156	18	table	table	NOUN
crias-79	156	19	5.0	5.0	NUM
crias-79	156	20	)	)	PUNCT
crias-79	156	21	.	.	PUNCT
crias-79	157	1	this	this	DET
crias-79	157	2	results	result	NOUN
crias-79	157	3	are	be	AUX
crias-79	157	4	in	in	ADP
crias-79	157	5	agreement	agreement	NOUN
crias-79	157	6	with	with	ADP
crias-79	157	7	those	those	PRON
crias-79	157	8	obtained	obtain	VERB
crias-79	157	9	by	by	ADP
crias-79	157	10	qiaochunand	qiaochunand	PROPN
crias-79	157	11	,	,	PUNCT
crias-79	157	12	et	et	PROPN
crias-79	157	13	al	al	PROPN
crias-79	157	14	.	.	PUNCT
crias-79	158	1	[	[	X
crias-79	158	2	10	10	NUM
crias-79	158	3	]	]	PUNCT
crias-79	158	4	.	.	PUNCT
crias-79	159	1	although	although	SCONJ
crias-79	159	2	,	,	PUNCT
crias-79	159	3	thermal	thermal	ADJ
crias-79	159	4	treatment	treatment	NOUN
crias-79	159	5	at	at	ADP
crias-79	159	6	36	36	NUM
crias-79	159	7	°	°	NOUN
crias-79	159	8	c	c	NOUN
crias-79	159	9	resulted	result	VERB
crias-79	159	10	in	in	ADP
crias-79	159	11	high	high	ADJ
crias-79	159	12	viral	viral	ADJ
crias-79	159	13	elimination	elimination	NOUN
crias-79	159	14	and	and	CCONJ
crias-79	159	15	survival	survival	NOUN
crias-79	159	16	rate	rate	NOUN
crias-79	159	17	of	of	ADP
crias-79	159	18	explants	explant	NOUN
crias-79	159	19	treated	treat	VERB
crias-79	159	20	,	,	PUNCT
crias-79	159	21	the	the	DET
crias-79	159	22	technique	technique	NOUN
crias-79	159	23	can	can	AUX
crias-79	159	24	be	be	AUX
crias-79	159	25	cumbersome	cumbersome	ADJ
crias-79	159	26	for	for	ADP
crias-79	159	27	commercial	commercial	ADJ
crias-79	159	28	laboratories	laboratory	NOUN
crias-79	159	29	leaving	leave	VERB
crias-79	159	30	20mg	20mg	NUM
crias-79	159	31	/	/	SYM
crias-79	159	32	l	l	NOUN
crias-79	159	33	of	of	ADP
crias-79	159	34	salicylic	salicylic	ADJ
crias-79	159	35	acid	acid	NOUN
crias-79	159	36	as	as	ADP
crias-79	159	37	the	the	DET
crias-79	159	38	best	good	ADJ
crias-79	159	39	option	option	NOUN
crias-79	159	40	.	.	PUNCT
crias-79	160	1	this	this	PRON
crias-79	160	2	is	be	AUX
crias-79	160	3	because	because	SCONJ
crias-79	160	4	it	it	PRON
crias-79	160	5	is	be	AUX
crias-79	160	6	easy	easy	ADJ
crias-79	160	7	to	to	PART
crias-79	160	8	incorporate	incorporate	VERB
crias-79	160	9	the	the	DET
crias-79	160	10	chemical	chemical	NOUN
crias-79	160	11	into	into	ADP
crias-79	160	12	the	the	DET
crias-79	160	13	medium	medium	NOUN
crias-79	160	14	used	use	VERB
crias-79	160	15	in	in	ADP
crias-79	160	16	tc	tc	NOUN
crias-79	161	1	and	and	CCONJ
crias-79	161	2	it	it	PRON
crias-79	161	3	is	be	AUX
crias-79	161	4	far	far	ADV
crias-79	161	5	much	much	ADV
crias-79	161	6	cheaper	cheap	ADJ
crias-79	161	7	than	than	ADP
crias-79	161	8	thermotherapy	thermotherapy	NOUN
crias-79	161	9	which	which	PRON
crias-79	161	10	requires	require	VERB
crias-79	161	11	an	an	DET
crias-79	161	12	incubator	incubator	NOUN
crias-79	161	13	and	and	CCONJ
crias-79	161	14	frequent	frequent	ADJ
crias-79	161	15	monitoring	monitoring	NOUN
crias-79	161	16	.	.	PUNCT
crias-79	162	1	when	when	SCONJ
crias-79	162	2	tc	tc	NOUN
crias-79	162	3	procedures	procedure	NOUN
crias-79	162	4	without	without	ADP
crias-79	162	5	any	any	PRON
crias-79	162	6	of	of	ADP
crias-79	162	7	the	the	DET
crias-79	162	8	three	three	NUM
crias-79	162	9	virus	virus	NOUN
crias-79	162	10	elimination	elimination	NOUN
crias-79	162	11	techniques	technique	NOUN
crias-79	162	12	was	be	AUX
crias-79	162	13	used	use	VERB
crias-79	162	14	as	as	ADP
crias-79	162	15	control	control	NOUN
crias-79	162	16	,	,	PUNCT
crias-79	162	17	there	there	PRON
crias-79	162	18	were	be	VERB
crias-79	162	19	no	no	DET
crias-79	162	20	viral	viral	ADJ
crias-79	162	21	elimination	elimination	NOUN
crias-79	162	22	which	which	PRON
crias-79	162	23	is	be	AUX
crias-79	162	24	in	in	ADP
crias-79	162	25	agreement	agreement	NOUN
crias-79	162	26	[	[	X
crias-79	162	27	15	15	NUM
crias-79	162	28	]	]	PUNCT
crias-79	162	29	,	,	PUNCT
crias-79	162	30	[	[	X
crias-79	162	31	3	3	X
crias-79	162	32	]	]	PUNCT
crias-79	162	33	that	that	SCONJ
crias-79	162	34	tc	tc	NOUN
crias-79	162	35	technique	technique	NOUN
crias-79	162	36	does	do	AUX
crias-79	162	37	not	not	PART
crias-79	162	38	eliminate	eliminate	VERB
crias-79	162	39	banana	banana	NOUN
crias-79	162	40	streak	streak	PROPN
crias-79	162	41	virus	virus	NOUN
crias-79	162	42	.	.	PUNCT
crias-79	163	1	therefore	therefore	ADV
crias-79	163	2	,	,	PUNCT
crias-79	163	3	though	though	SCONJ
crias-79	163	4	tc	tc	NOUN
crias-79	163	5	has	have	VERB
crias-79	163	6	very	very	ADV
crias-79	163	7	many	many	ADJ
crias-79	163	8	advantages	advantage	NOUN
crias-79	163	9	over	over	ADP
crias-79	163	10	the	the	DET
crias-79	163	11	conventional	conventional	ADJ
crias-79	163	12	methods	method	NOUN
crias-79	163	13	of	of	ADP
crias-79	163	14	mass	mass	ADJ
crias-79	163	15	propagation	propagation	NOUN
crias-79	163	16	,	,	PUNCT
crias-79	163	17	it	it	PRON
crias-79	163	18	does	do	AUX
crias-79	163	19	not	not	PART
crias-79	163	20	eliminate	eliminate	VERB
crias-79	163	21	bsv	bsv	NOUN
crias-79	163	22	.	.	PUNCT
crias-79	164	1	therefore	therefore	ADV
crias-79	164	2	,	,	PUNCT
crias-79	164	3	a	a	DET
crias-79	164	4	combination	combination	NOUN
crias-79	164	5	of	of	ADP
crias-79	164	6	tc	tc	NOUN
crias-79	164	7	with	with	ADP
crias-79	164	8	a	a	DET
crias-79	164	9	reliable	reliable	ADJ
crias-79	164	10	virus	virus	NOUN
crias-79	164	11	elimination	elimination	NOUN
crias-79	164	12	method	method	NOUN
crias-79	164	13	is	be	AUX
crias-79	164	14	required	require	VERB
crias-79	164	15	to	to	PART
crias-79	164	16	be	be	AUX
crias-79	164	17	put	put	VERB
crias-79	164	18	in	in	ADP
crias-79	164	19	place	place	NOUN
crias-79	164	20	to	to	PART
crias-79	164	21	be	be	AUX
crias-79	164	22	able	able	ADJ
crias-79	164	23	to	to	PART
crias-79	164	24	eliminate	eliminate	VERB
crias-79	164	25	bsv	bsv	NOUN
crias-79	164	26	.	.	PUNCT
crias-79	165	1	5	5	NUM
crias-79	165	2	.	.	X
crias-79	165	3	conclusions	conclusion	NOUN
crias-79	165	4	and	and	CCONJ
crias-79	165	5	recommendations	recommendation	NOUN
crias-79	165	6	this	this	DET
crias-79	165	7	study	study	NOUN
crias-79	165	8	demonstrated	demonstrate	VERB
crias-79	165	9	that	that	SCONJ
crias-79	165	10	banana	banana	NOUN
crias-79	165	11	streak	streak	PROPN
crias-79	165	12	virus	virus	NOUN
crias-79	165	13	can	can	AUX
crias-79	165	14	be	be	AUX
crias-79	165	15	eliminated	eliminate	VERB
crias-79	165	16	using	use	VERB
crias-79	165	17	chemotherapy	chemotherapy	NOUN
crias-79	165	18	,	,	PUNCT
crias-79	165	19	thermotherapy	thermotherapy	NOUN
crias-79	165	20	and	and	CCONJ
crias-79	165	21	meristem	meristem	NOUN
crias-79	165	22	tip	tip	NOUN
crias-79	165	23	culture	culture	NOUN
crias-79	165	24	.	.	PUNCT
crias-79	166	1	chemotherapy	chemotherapy	NOUN
crias-79	166	2	using	use	VERB
crias-79	166	3	salicylic	salicylic	ADJ
crias-79	166	4	acid	acid	NOUN
crias-79	166	5	at	at	ADP
crias-79	166	6	20mg	20mg	NUM
crias-79	166	7	/	/	SYM
crias-79	166	8	l	l	NOUN
crias-79	166	9	was	be	AUX
crias-79	166	10	selected	select	VERB
crias-79	166	11	as	as	ADP
crias-79	166	12	the	the	DET
crias-79	166	13	best	good	ADJ
crias-79	166	14	method	method	NOUN
crias-79	166	15	with	with	ADP
crias-79	166	16	up	up	ADP
crias-79	166	17	to	to	PART
crias-79	166	18	90	90	NUM
crias-79	166	19	%	%	NOUN
crias-79	166	20	bsv	bsv	ADJ
crias-79	166	21	elimination	elimination	NOUN
crias-79	166	22	.	.	PUNCT
crias-79	167	1	the	the	DET
crias-79	167	2	method	method	NOUN
crias-79	167	3	is	be	AUX
crias-79	167	4	also	also	ADV
crias-79	167	5	easy	easy	ADJ
crias-79	167	6	to	to	PART
crias-79	167	7	implement	implement	VERB
crias-79	167	8	since	since	SCONJ
crias-79	167	9	it	it	PRON
crias-79	167	10	is	be	AUX
crias-79	167	11	incorporated	incorporate	VERB
crias-79	167	12	into	into	ADP
crias-79	167	13	the	the	DET
crias-79	167	14	medium	medium	NOUN
crias-79	167	15	.	.	PUNCT
crias-79	168	1	it	it	PRON
crias-79	168	2	is	be	AUX
crias-79	168	3	recommended	recommend	VERB
crias-79	168	4	that	that	SCONJ
crias-79	168	5	banana	banana	NOUN
crias-79	168	6	streak	streak	PROPN
crias-79	168	7	virus	virus	NOUN
crias-79	168	8	free	free	ADJ
crias-79	168	9	orchards	orchard	NOUN
crias-79	168	10	be	be	AUX
crias-79	168	11	established	establish	VERB
crias-79	168	12	and	and	CCONJ
crias-79	168	13	continuous	continuous	ADJ
crias-79	168	14	checks	check	NOUN
crias-79	168	15	be	be	AUX
crias-79	168	16	done	do	VERB
crias-79	168	17	to	to	PART
crias-79	168	18	ensure	ensure	VERB
crias-79	168	19	only	only	ADV
crias-79	168	20	bsv	bsv	ADJ
crias-79	168	21	plantlets	plantlet	NOUN
crias-79	168	22	are	be	AUX
crias-79	168	23	in	in	ADP
crias-79	168	24	circulation	circulation	NOUN
crias-79	168	25	.	.	PUNCT
crias-79	169	1	current	current	ADJ
crias-79	169	2	research	research	NOUN
crias-79	169	3	in	in	ADP
crias-79	169	4	agricultural	agricultural	ADJ
crias-79	169	5	sciences	science	NOUN
crias-79	169	6	,	,	PUNCT
crias-79	169	7	2015	2015	NUM
crias-79	169	8	,	,	PUNCT
crias-79	169	9	2(3	2(3	NUM
crias-79	169	10	):	):	PUNCT
crias-79	169	11	81	81	NUM
crias-79	169	12	-	-	SYM
crias-79	169	13	89	89	NUM
crias-79	169	14	89	89	NUM
crias-79	169	15	©	©	PROPN
crias-79	169	16	2015	2015	NUM
crias-79	169	17	conscientia	conscientia	PROPN
crias-79	169	18	beam	beam	PROPN
crias-79	169	19	.	.	PUNCT
crias-79	170	1	all	all	DET
crias-79	170	2	rights	right	NOUN
crias-79	170	3	reserved	reserve	VERB
crias-79	170	4	.	.	PUNCT
crias-79	171	1	references	reference	NOUN
crias-79	171	2	[	[	X
crias-79	171	3	1	1	NUM
crias-79	171	4	]	]	X
crias-79	171	5	fao	fao	ADJ
crias-79	171	6	,	,	PUNCT
crias-79	171	7	"	"	PUNCT
crias-79	171	8	food	food	NOUN
crias-79	171	9	and	and	CCONJ
crias-79	171	10	agriculture	agriculture	NOUN
crias-79	171	11	organization	organization	NOUN
crias-79	171	12	of	of	ADP
crias-79	171	13	the	the	DET
crias-79	171	14	united	united	PROPN
crias-79	171	15	nations	nations	PROPN
crias-79	171	16	,	,	PUNCT
crias-79	171	17	"	"	PUNCT
crias-79	171	18	2010	2010	NUM
crias-79	171	19	.	.	PUNCT
crias-79	172	1	[	[	X
crias-79	172	2	2	2	NUM
crias-79	172	3	]	]	PUNCT
crias-79	172	4	isaaa	isaaa	NOUN
crias-79	172	5	,	,	PUNCT
crias-79	172	6	"	"	PUNCT
crias-79	172	7	international	international	ADJ
crias-79	172	8	service	service	NOUN
crias-79	172	9	for	for	ADP
crias-79	172	10	the	the	DET
crias-79	172	11	acquisition	acquisition	NOUN
crias-79	172	12	of	of	ADP
crias-79	172	13	agri	agri	NOUN
crias-79	172	14	-	-	PUNCT
crias-79	172	15	biotech	biotech	NOUN
crias-79	172	16	applications	application	NOUN
crias-79	172	17	,	,	PUNCT
crias-79	172	18	"	"	PUNCT
crias-79	172	19	annual	annual	ADJ
crias-79	172	20	report	report	NOUN
crias-79	172	21	,	,	PUNCT
crias-79	172	22	available	available	ADJ
crias-79	172	23	:	:	PUNCT
crias-79	172	24	http://	http://	PROPN
crias-79	172	25	www.isaaa.org	www.isaaa.org	PROPN
crias-79	172	26	,	,	PUNCT
crias-79	172	27	1999	1999	NUM
crias-79	172	28	.	.	PUNCT
crias-79	173	1	[	[	X
crias-79	173	2	3	3	X
crias-79	173	3	]	]	X
crias-79	173	4	l.	l.	PROPN
crias-79	173	5	karanja	karanja	PROPN
crias-79	173	6	,	,	PUNCT
crias-79	173	7	a.	a.	PROPN
crias-79	173	8	wangai	wangai	PROPN
crias-79	173	9	,	,	PUNCT
crias-79	173	10	g.	g.	PROPN
crias-79	173	11	harper	harper	PROPN
crias-79	173	12	,	,	PUNCT
crias-79	173	13	j.	j.	PROPN
crias-79	173	14	stanley	stanley	PROPN
crias-79	173	15	,	,	PUNCT
crias-79	173	16	and	and	CCONJ
crias-79	173	17	r.	r.	PROPN
crias-79	173	18	pathak	pathak	PROPN
crias-79	173	19	,	,	PUNCT
crias-79	173	20	"	"	PUNCT
crias-79	173	21	molecular	molecular	ADJ
crias-79	173	22	detection	detection	NOUN
crias-79	173	23	and	and	CCONJ
crias-79	173	24	variability	variability	NOUN
crias-79	173	25	of	of	ADP
crias-79	173	26	banana	banana	NOUN
crias-79	173	27	streak	streak	PROPN
crias-79	173	28	virus	virus	NOUN
crias-79	173	29	isolates	isolate	NOUN
crias-79	173	30	in	in	ADP
crias-79	173	31	kenya	kenya	NOUN
crias-79	173	32	,	,	PUNCT
crias-79	173	33	"	"	PUNCT
crias-79	173	34	journal	journal	NOUN
crias-79	173	35	of	of	ADP
crias-79	173	36	phytopathology	phytopathology	NOUN
crias-79	173	37	,	,	PUNCT
crias-79	173	38	vol	vol	NOUN
crias-79	173	39	.	.	PROPN
crias-79	173	40	156	156	NUM
crias-79	173	41	,	,	PUNCT
crias-79	173	42	pp	pp	ADJ
crias-79	173	43	.	.	PUNCT
crias-79	174	1	678	678	NUM
crias-79	174	2	-	-	SYM
crias-79	174	3	686	686	NUM
crias-79	174	4	,	,	PUNCT
crias-79	174	5	2008	2008	NUM
crias-79	174	6	.	.	PUNCT
crias-79	175	1	[	[	X
crias-79	175	2	4	4	X
crias-79	175	3	]	]	PUNCT
crias-79	175	4	e.	e.	PROPN
crias-79	175	5	kahangi	kahangi	PROPN
crias-79	175	6	,	,	PUNCT
crias-79	175	7	a.	a.	NOUN
crias-79	175	8	muthee	muthee	NOUN
crias-79	175	9	,	,	PUNCT
crias-79	175	10	and	and	CCONJ
crias-79	175	11	b.	b.	PROPN
crias-79	175	12	chege	chege	PROPN
crias-79	175	13	,	,	PUNCT
crias-79	175	14	"	"	PUNCT
crias-79	175	15	constraints	constraint	NOUN
crias-79	175	16	and	and	CCONJ
crias-79	175	17	sustainable	sustainable	ADJ
crias-79	175	18	solutions	solution	NOUN
crias-79	175	19	for	for	ADP
crias-79	175	20	adoption	adoption	NOUN
crias-79	175	21	of	of	ADP
crias-79	175	22	tissue	tissue	NOUN
crias-79	175	23	cultured	cultured	ADJ
crias-79	175	24	banana	banana	NOUN
crias-79	175	25	technology	technology	NOUN
crias-79	175	26	and	and	CCONJ
crias-79	175	27	marketing	marketing	NOUN
crias-79	175	28	,	,	PUNCT
crias-79	175	29	"	"	PUNCT
crias-79	175	30	acta	acta	PROPN
crias-79	175	31	horticulturae	horticulturae	PROPN
crias-79	175	32	,	,	PUNCT
crias-79	175	33	vol	vol	NOUN
crias-79	175	34	.	.	PROPN
crias-79	175	35	638	638	NUM
crias-79	175	36	,	,	PUNCT
crias-79	175	37	pp	pp	ADJ
crias-79	175	38	.	.	PUNCT
crias-79	176	1	441	441	NUM
crias-79	176	2	-	-	NUM
crias-79	176	3	447	447	NUM
crias-79	176	4	,	,	PUNCT
crias-79	176	5	2004	2004	NUM
crias-79	176	6	.	.	PUNCT
crias-79	177	1	[	[	X
crias-79	177	2	5	5	X
crias-79	177	3	]	]	X
crias-79	177	4	g.	g.	PROPN
crias-79	177	5	harper	harper	PROPN
crias-79	177	6	,	,	PUNCT
crias-79	177	7	r.	r.	PROPN
crias-79	177	8	hull	hull	PROPN
crias-79	177	9	,	,	PUNCT
crias-79	177	10	b.	b.	PROPN
crias-79	177	11	lockhart	lockhart	PROPN
crias-79	177	12	,	,	PUNCT
crias-79	177	13	and	and	CCONJ
crias-79	177	14	n.	n.	PROPN
crias-79	177	15	olszewski	olszewski	PROPN
crias-79	177	16	,	,	PUNCT
crias-79	177	17	"	"	PUNCT
crias-79	177	18	viral	viral	ADJ
crias-79	177	19	sequences	sequence	NOUN
crias-79	177	20	integrated	integrate	VERB
crias-79	177	21	into	into	ADP
crias-79	177	22	plant	plant	NOUN
crias-79	177	23	genomes	genome	NOUN
crias-79	177	24	,	,	PUNCT
crias-79	177	25	"	"	PUNCT
crias-79	177	26	annual	annual	ADJ
crias-79	177	27	review	review	NOUN
crias-79	177	28	of	of	ADP
crias-79	177	29	phytopathology	phytopathology	NOUN
crias-79	177	30	,	,	PUNCT
crias-79	177	31	vol	vol	NOUN
crias-79	177	32	.	.	PROPN
crias-79	177	33	40	40	NUM
crias-79	177	34	,	,	PUNCT
crias-79	177	35	pp	pp	ADJ
crias-79	177	36	.	.	PUNCT
crias-79	178	1	119	119	NUM
crias-79	178	2	-	-	SYM
crias-79	178	3	136	136	NUM
crias-79	178	4	,	,	PUNCT
crias-79	178	5	2002a	2002a	NOUN
crias-79	178	6	.	.	PUNCT
crias-79	179	1	[	[	X
crias-79	179	2	6	6	NUM
crias-79	179	3	]	]	X
crias-79	179	4	g.	g.	PROPN
crias-79	179	5	dahal	dahal	PROPN
crias-79	179	6	,	,	PUNCT
crias-79	179	7	j.	j.	PROPN
crias-79	179	8	hughes	hughes	PROPN
crias-79	179	9	,	,	PUNCT
crias-79	179	10	g.	g.	PROPN
crias-79	179	11	thottappilly	thottappilly	ADV
crias-79	179	12	,	,	PUNCT
crias-79	179	13	and	and	CCONJ
crias-79	179	14	b.	b.	PROPN
crias-79	179	15	lockhart	lockhart	PROPN
crias-79	179	16	,	,	PUNCT
crias-79	179	17	"	"	PUNCT
crias-79	179	18	effect	effect	NOUN
crias-79	179	19	of	of	ADP
crias-79	179	20	temperature	temperature	NOUN
crias-79	179	21	on	on	ADP
crias-79	179	22	symptom	symptom	NOUN
crias-79	179	23	expression	expression	NOUN
crias-79	179	24	and	and	CCONJ
crias-79	179	25	reliability	reliability	NOUN
crias-79	179	26	of	of	ADP
crias-79	179	27	banana	banana	NOUN
crias-79	179	28	streak	streak	PROPN
crias-79	179	29	badnavirus	badnavirus	PROPN
crias-79	179	30	detection	detection	NOUN
crias-79	179	31	in	in	ADP
crias-79	179	32	naturally	naturally	ADV
crias-79	179	33	infected	infect	VERB
crias-79	179	34	plantain	plantain	NOUN
crias-79	179	35	and	and	CCONJ
crias-79	179	36	banana	banana	PROPN
crias-79	179	37	(	(	PUNCT
crias-79	179	38	musa	musa	PROPN
crias-79	179	39	spp	spp	PROPN
crias-79	179	40	)	)	PUNCT
crias-79	179	41	,	,	PUNCT
crias-79	179	42	"	"	PUNCT
crias-79	179	43	plant	plant	NOUN
crias-79	179	44	disease	disease	NOUN
crias-79	179	45	,	,	PUNCT
crias-79	179	46	vol	vol	NOUN
crias-79	179	47	.	.	PROPN
crias-79	179	48	82	82	NUM
crias-79	179	49	,	,	PUNCT
crias-79	179	50	pp	pp	ADJ
crias-79	179	51	.	.	PUNCT
crias-79	179	52	16	16	NUM
crias-79	179	53	-	-	SYM
crias-79	179	54	21	21	NUM
crias-79	179	55	,	,	PUNCT
crias-79	179	56	1998a	1998a	NUM
crias-79	179	57	.	.	PUNCT
crias-79	180	1	[	[	X
crias-79	180	2	7	7	X
crias-79	180	3	]	]	X
crias-79	180	4	b.	b.	PROPN
crias-79	180	5	lockhart	lockhart	PROPN
crias-79	180	6	and	and	CCONJ
crias-79	180	7	d.	d.	PROPN
crias-79	180	8	jones	jones	PROPN
crias-79	180	9	,	,	PUNCT
crias-79	180	10	banana	banana	PROPN
crias-79	180	11	streak	streak	NOUN
crias-79	180	12	.	.	PUNCT
crias-79	181	1	in	in	ADP
crias-79	181	2	diseases	disease	NOUN
crias-79	181	3	of	of	ADP
crias-79	181	4	banana	banana	NOUN
crias-79	181	5	,	,	PUNCT
crias-79	181	6	abaca	abaca	PROPN
crias-79	181	7	and	and	CCONJ
crias-79	181	8	ensete	ensete	PROPN
crias-79	181	9	,	,	PUNCT
crias-79	181	10	edited	edit	VERB
crias-79	181	11	by	by	ADP
crias-79	181	12	d.r	d.r	PROPN
crias-79	181	13	.	.	PROPN
crias-79	181	14	jones	jones	PROPN
crias-79	181	15	.	.	PUNCT
crias-79	182	1	uk	uk	PROPN
crias-79	182	2	.	.	PROPN
crias-79	182	3	london	london	PROPN
crias-79	182	4	:	:	PUNCT
crias-79	182	5	cab	cab	PROPN
crias-79	182	6	international	international	PROPN
crias-79	182	7	,	,	PUNCT
crias-79	182	8	wallingford	wallingford	PROPN
crias-79	182	9	,	,	PUNCT
crias-79	182	10	2000	2000	NUM
crias-79	182	11	.	.	PUNCT
crias-79	183	1	[	[	X
crias-79	183	2	8	8	NUM
crias-79	183	3	]	]	X
crias-79	183	4	g.	g.	PROPN
crias-79	183	5	dahal	dahal	PROPN
crias-79	183	6	,	,	PUNCT
crias-79	183	7	r.	r.	PROPN
crias-79	183	8	vortiz	vortiz	PROPN
crias-79	183	9	,	,	PUNCT
crias-79	183	10	a.	a.	PROPN
crias-79	183	11	tenkouano	tenkouano	PROPN
crias-79	183	12	,	,	PUNCT
crias-79	183	13	j.	j.	PROPN
crias-79	183	14	d.	d.	PROPN
crias-79	183	15	a.	a.	PROPN
crias-79	183	16	hughes	hughes	PROPN
crias-79	183	17	,	,	PUNCT
crias-79	183	18	g.	g.	PROPN
crias-79	183	19	thottappilly	thottappilly	ADV
crias-79	183	20	,	,	PUNCT
crias-79	183	21	d.	d.	PROPN
crias-79	183	22	vuylsteke	vuylsteke	NOUN
crias-79	183	23	,	,	PUNCT
crias-79	183	24	and	and	CCONJ
crias-79	183	25	b.	b.	PROPN
crias-79	183	26	lockhart	lockhart	PROPN
crias-79	183	27	,	,	PUNCT
crias-79	183	28	"	"	PUNCT
crias-79	183	29	relationship	relationship	NOUN
crias-79	183	30	between	between	ADP
crias-79	183	31	natural	natural	ADJ
crias-79	183	32	occurrence	occurrence	NOUN
crias-79	183	33	of	of	ADP
crias-79	183	34	banana	banana	NOUN
crias-79	183	35	streak	streak	PROPN
crias-79	183	36	badnavirus	badnavirus	PROPN
crias-79	183	37	and	and	CCONJ
crias-79	183	38	symptom	symptom	NOUN
crias-79	183	39	expression	expression	NOUN
crias-79	183	40	,	,	PUNCT
crias-79	183	41	relative	relative	ADJ
crias-79	183	42	concentration	concentration	NOUN
crias-79	183	43	of	of	ADP
crias-79	183	44	viral	viral	ADJ
crias-79	183	45	antigen	antigen	NOUN
crias-79	183	46	,	,	PUNCT
crias-79	183	47	and	and	CCONJ
crias-79	183	48	yield	yield	VERB
crias-79	183	49	characteristics	characteristic	NOUN
crias-79	183	50	of	of	ADP
crias-79	183	51	some	some	DET
crias-79	183	52	micropropagated	micropropagate	VERB
crias-79	183	53	musa	musa	PROPN
crias-79	183	54	spp	spp	PROPN
crias-79	183	55	,	,	PUNCT
crias-79	183	56	"	"	PUNCT
crias-79	183	57	plant	plant	NOUN
crias-79	183	58	pathology	pathology	NOUN
crias-79	183	59	,	,	PUNCT
crias-79	183	60	vol	vol	NOUN
crias-79	183	61	.	.	PROPN
crias-79	183	62	49	49	NUM
crias-79	183	63	,	,	PUNCT
crias-79	183	64	pp	pp	ADJ
crias-79	183	65	.	.	PUNCT
crias-79	184	1	68	68	NUM
crias-79	184	2	-	-	SYM
crias-79	184	3	79	79	NUM
crias-79	184	4	,	,	PUNCT
crias-79	184	5	2000	2000	NUM
crias-79	184	6	.	.	PUNCT
crias-79	185	1	[	[	X
crias-79	185	2	9	9	NUM
crias-79	185	3	]	]	PUNCT
crias-79	185	4	j.	j.	PROPN
crias-79	185	5	daniells	daniells	PROPN
crias-79	185	6	,	,	PUNCT
crias-79	185	7	a.	a.	NOUN
crias-79	185	8	geering	geering	NOUN
crias-79	185	9	,	,	PUNCT
crias-79	185	10	n.	n.	NOUN
crias-79	185	11	bryde	bryde	PROPN
crias-79	185	12	,	,	PUNCT
crias-79	185	13	and	and	CCONJ
crias-79	185	14	j.	j.	PROPN
crias-79	185	15	thomas	thomas	PROPN
crias-79	185	16	,	,	PUNCT
crias-79	185	17	"	"	PUNCT
crias-79	185	18	the	the	DET
crias-79	185	19	effect	effect	NOUN
crias-79	185	20	of	of	ADP
crias-79	185	21	banana	banana	NOUN
crias-79	185	22	streak	streak	PROPN
crias-79	185	23	virus	virus	NOUN
crias-79	185	24	on	on	ADP
crias-79	185	25	the	the	DET
crias-79	185	26	growth	growth	NOUN
crias-79	185	27	and	and	CCONJ
crias-79	185	28	yield	yield	NOUN
crias-79	185	29	of	of	ADP
crias-79	185	30	dessert	dessert	NOUN
crias-79	185	31	bananas	banana	NOUN
crias-79	185	32	in	in	ADP
crias-79	185	33	tropical	tropical	ADJ
crias-79	185	34	australia	australia	PROPN
crias-79	185	35	,	,	PUNCT
crias-79	185	36	"	"	PUNCT
crias-79	185	37	annals	annal	NOUN
crias-79	185	38	of	of	ADP
crias-79	185	39	applied	apply	VERB
crias-79	185	40	biology	biology	NOUN
crias-79	185	41	,	,	PUNCT
crias-79	185	42	vol	vol	NOUN
crias-79	185	43	.	.	NOUN
crias-79	185	44	139	139	NUM
crias-79	185	45	,	,	PUNCT
crias-79	185	46	pp	pp	ADJ
crias-79	185	47	.	.	PUNCT
crias-79	186	1	51	51	NUM
crias-79	186	2	-	-	SYM
crias-79	186	3	60	60	NUM
crias-79	186	4	,	,	PUNCT
crias-79	186	5	2001	2001	NUM
crias-79	186	6	.	.	PUNCT
crias-79	187	1	[	[	X
crias-79	187	2	10	10	NUM
crias-79	187	3	]	]	X
crias-79	187	4	w.	w.	PROPN
crias-79	187	5	qiaochunand	qiaochunand	PROPN
crias-79	187	6	,	,	PUNCT
crias-79	187	7	p.	p.	NOUN
crias-79	187	8	jari	jari	PROPN
crias-79	187	9	,	,	PUNCT
crias-79	187	10	and	and	CCONJ
crias-79	187	11	t.	t.	PROPN
crias-79	187	12	valkonen	valkonen	PROPN
crias-79	187	13	,	,	PUNCT
crias-79	187	14	"	"	PUNCT
crias-79	187	15	therapy	therapy	NOUN
crias-79	187	16	of	of	ADP
crias-79	187	17	shoot	shoot	NOUN
crias-79	187	18	tips	tip	NOUN
crias-79	187	19	and	and	CCONJ
crias-79	187	20	novel	novel	ADJ
crias-79	187	21	pathogen	pathogen	NOUN
crias-79	187	22	eradication	eradication	NOUN
crias-79	187	23	method	method	NOUN
crias-79	187	24	science	science	NOUN
crias-79	187	25	,	,	PUNCT
crias-79	187	26	"	"	PUNCT
crias-79	187	27	vol	vol	NOUN
crias-79	187	28	.	.	PROPN
crias-79	187	29	14	14	NUM
crias-79	187	30	,	,	PUNCT
crias-79	187	31	pp	pp	ADJ
crias-79	187	32	.	.	PUNCT
crias-79	188	1	119	119	NUM
crias-79	188	2	–	–	PUNCT
crias-79	188	3	122	122	NUM
crias-79	188	4	,	,	PUNCT
crias-79	188	5	2009	2009	NUM
crias-79	188	6	.	.	PUNCT
crias-79	189	1	[	[	X
crias-79	189	2	11	11	NUM
crias-79	189	3	]	]	PUNCT
crias-79	189	4	j.	j.	PROPN
crias-79	189	5	doyle	doyle	PROPN
crias-79	189	6	and	and	CCONJ
crias-79	189	7	j.	j.	PROPN
crias-79	189	8	doyle	doyle	PROPN
crias-79	189	9	,	,	PUNCT
crias-79	189	10	"	"	PUNCT
crias-79	189	11	isolation	isolation	NOUN
crias-79	189	12	of	of	ADP
crias-79	189	13	dna	dna	NOUN
crias-79	189	14	from	from	ADP
crias-79	189	15	fresh	fresh	ADJ
crias-79	189	16	tissue	tissue	NOUN
crias-79	189	17	,	,	PUNCT
crias-79	189	18	"	"	PUNCT
crias-79	189	19	focus	focus	NOUN
crias-79	189	20	,	,	PUNCT
crias-79	189	21	vol	vol	NOUN
crias-79	189	22	.	.	PROPN
crias-79	189	23	12	12	NUM
crias-79	189	24	,	,	PUNCT
crias-79	189	25	pp	pp	ADJ
crias-79	189	26	.	.	PUNCT
crias-79	190	1	13	13	NUM
crias-79	190	2	-	-	SYM
crias-79	190	3	15	15	NUM
crias-79	190	4	,	,	PUNCT
crias-79	190	5	1990	1990	NUM
crias-79	190	6	.	.	PUNCT
crias-79	191	1	[	[	X
crias-79	191	2	12	12	NUM
crias-79	191	3	]	]	PUNCT
crias-79	191	4	a.	a.	NOUN
crias-79	191	5	geering	geering	NOUN
crias-79	191	6	,	,	PUNCT
crias-79	191	7	l.	l.	PROPN
crias-79	191	8	mcmichael	mcmichael	PROPN
crias-79	191	9	,	,	PUNCT
crias-79	191	10	r.	r.	PROPN
crias-79	191	11	dietzgen	dietzgen	PROPN
crias-79	191	12	,	,	PUNCT
crias-79	191	13	and	and	CCONJ
crias-79	191	14	j.	j.	PROPN
crias-79	191	15	thomas	thomas	PROPN
crias-79	191	16	,	,	PUNCT
crias-79	191	17	"	"	PUNCT
crias-79	191	18	genetic	genetic	ADJ
crias-79	191	19	diversity	diversity	NOUN
crias-79	191	20	among	among	ADP
crias-79	191	21	banana	banana	NOUN
crias-79	191	22	streak	streak	NOUN
crias-79	191	23	virus	virus	NOUN
crias-79	191	24	isolates	isolate	NOUN
crias-79	191	25	from	from	ADP
crias-79	191	26	australia	australia	PROPN
crias-79	191	27	,	,	PUNCT
crias-79	191	28	"	"	PUNCT
crias-79	191	29	phytopathology	phytopathology	NOUN
crias-79	191	30	,	,	PUNCT
crias-79	191	31	vol	vol	NOUN
crias-79	191	32	.	.	PROPN
crias-79	191	33	90	90	NUM
crias-79	191	34	,	,	PUNCT
crias-79	191	35	pp	pp	ADJ
crias-79	191	36	.	.	PUNCT
crias-79	192	1	921	921	NUM
crias-79	192	2	-	-	SYM
crias-79	192	3	927	927	NUM
crias-79	192	4	,	,	PUNCT
crias-79	192	5	2000	2000	NUM
crias-79	192	6	.	.	PUNCT
crias-79	193	1	[	[	X
crias-79	193	2	13	13	NUM
crias-79	193	3	]	]	X
crias-79	193	4	g.	g.	PROPN
crias-79	193	5	harper	harper	PROPN
crias-79	193	6	,	,	PUNCT
crias-79	193	7	d.	d.	PROPN
crias-79	193	8	hart	hart	PROPN
crias-79	193	9	,	,	PUNCT
crias-79	193	10	s.	s.	PROPN
crias-79	193	11	moult	moult	PROPN
crias-79	193	12	,	,	PUNCT
crias-79	193	13	and	and	CCONJ
crias-79	193	14	r.	r.	PROPN
crias-79	193	15	hull	hull	NOUN
crias-79	193	16	,	,	PUNCT
crias-79	193	17	"	"	PUNCT
crias-79	193	18	detection	detection	NOUN
crias-79	193	19	of	of	ADP
crias-79	193	20	banana	banana	NOUN
crias-79	193	21	streak	streak	PROPN
crias-79	193	22	virus	virus	NOUN
crias-79	193	23	in	in	ADP
crias-79	193	24	field	field	NOUN
crias-79	193	25	samples	sample	NOUN
crias-79	193	26	of	of	ADP
crias-79	193	27	bananas	banana	NOUN
crias-79	193	28	from	from	ADP
crias-79	193	29	uganda	uganda	PROPN
crias-79	193	30	,	,	PUNCT
crias-79	193	31	"	"	PUNCT
crias-79	193	32	annals	annal	NOUN
crias-79	193	33	of	of	ADP
crias-79	193	34	applied	apply	VERB
crias-79	193	35	biology	biology	NOUN
crias-79	193	36	,	,	PUNCT
crias-79	193	37	vol	vol	NOUN
crias-79	193	38	.	.	PROPN
crias-79	193	39	141	141	NUM
crias-79	193	40	,	,	PUNCT
crias-79	193	41	pp	pp	ADJ
crias-79	193	42	.	.	PUNCT
crias-79	194	1	247	247	NUM
crias-79	194	2	-	-	SYM
crias-79	194	3	257	257	NUM
crias-79	194	4	,	,	PUNCT
crias-79	194	5	2002b	2002b	NUM
crias-79	194	6	.	.	PUNCT
crias-79	195	1	[	[	X
crias-79	195	2	14	14	NUM
crias-79	195	3	]	]	PUNCT
crias-79	195	4	t.	t.	PROPN
crias-79	195	5	murashige	murashige	PROPN
crias-79	195	6	and	and	CCONJ
crias-79	195	7	f.	f.	PROPN
crias-79	195	8	skoog	skoog	PROPN
crias-79	195	9	,	,	PUNCT
crias-79	195	10	"	"	PUNCT
crias-79	195	11	a	a	DET
crias-79	195	12	revised	revised	ADJ
crias-79	195	13	medium	medium	NOUN
crias-79	195	14	for	for	ADP
crias-79	195	15	rapid	rapid	ADJ
crias-79	195	16	growth	growth	NOUN
crias-79	195	17	and	and	CCONJ
crias-79	195	18	bioassays	bioassay	NOUN
crias-79	195	19	with	with	ADP
crias-79	195	20	tobacco	tobacco	NOUN
crias-79	195	21	cultures	culture	NOUN
crias-79	195	22	,	,	PUNCT
crias-79	195	23	"	"	PUNCT
crias-79	195	24	physiol	physiol	NOUN
crias-79	195	25	.	.	PUNCT
crias-79	196	1	plant	plant	NOUN
crias-79	196	2	,	,	PUNCT
crias-79	196	3	vol	vol	NOUN
crias-79	196	4	.	.	PROPN
crias-79	196	5	15	15	NUM
crias-79	196	6	,	,	PUNCT
crias-79	196	7	pp	pp	ADJ
crias-79	196	8	.	.	PUNCT
crias-79	197	1	473	473	NUM
crias-79	197	2	-	-	SYM
crias-79	197	3	497	497	NUM
crias-79	197	4	,	,	PUNCT
crias-79	197	5	1962	1962	NUM
crias-79	197	6	.	.	PUNCT
crias-79	198	1	[	[	X
crias-79	198	2	15	15	NUM
crias-79	198	3	]	]	X
crias-79	198	4	a.	a.	NOUN
crias-79	198	5	wangai	wangai	PROPN
crias-79	198	6	,	,	PUNCT
crias-79	198	7	l.	l.	PROPN
crias-79	198	8	karanja	karanja	PROPN
crias-79	198	9	,	,	PUNCT
crias-79	198	10	j.	j.	PROPN
crias-79	198	11	ndung’u	ndung’u	PROPN
crias-79	198	12	,	,	PUNCT
crias-79	198	13	e.	e.	PROPN
crias-79	198	14	kimani	kimani	PROPN
crias-79	198	15	,	,	PUNCT
crias-79	198	16	s.	s.	PROPN
crias-79	198	17	kilonzo	kilonzo	PROPN
crias-79	198	18	,	,	PUNCT
crias-79	198	19	and	and	CCONJ
crias-79	198	20	f.	f.	PROPN
crias-79	198	21	nguthi	nguthi	PROPN
crias-79	198	22	,	,	PUNCT
crias-79	198	23	"	"	PUNCT
crias-79	198	24	preliminary	preliminary	ADJ
crias-79	198	25	results	result	NOUN
crias-79	198	26	on	on	ADP
crias-79	198	27	surveys	survey	NOUN
crias-79	198	28	of	of	ADP
crias-79	198	29	banana	banana	NOUN
crias-79	198	30	streak	streak	PROPN
crias-79	198	31	virus	virus	NOUN
crias-79	198	32	(	(	PUNCT
crias-79	198	33	bsv	bsv	NOUN
crias-79	198	34	)	)	PUNCT
crias-79	198	35	in	in	ADP
crias-79	198	36	kenya	kenya	PROPN
crias-79	198	37	,	,	PUNCT
crias-79	198	38	"	"	PUNCT
crias-79	198	39	presented	present	VERB
crias-79	198	40	at	at	ADP
crias-79	198	41	the	the	DET
crias-79	198	42	2nd	2nd	ADJ
crias-79	198	43	annual	annual	ADJ
crias-79	198	44	symposium	symposium	NOUN
crias-79	198	45	kari	kari	X
crias-79	198	46	–	–	PUNCT
crias-79	198	47	npbrc	npbrc	NOUN
crias-79	198	48	,	,	PUNCT
crias-79	198	49	njoro	njoro	PROPN
crias-79	198	50	kenya	kenya	PROPN
crias-79	198	51	,	,	PUNCT
crias-79	198	52	and	and	CCONJ
crias-79	198	53	egerton	egerton	PROPN
crias-79	198	54	university	university	PROPN
crias-79	198	55	,	,	PUNCT
crias-79	198	56	2002	2002	NUM
crias-79	198	57	.	.	PUNCT
crias-79	199	1	[	[	X
crias-79	199	2	16	16	NUM
crias-79	199	3	]	]	X
crias-79	199	4	g.	g.	PROPN
crias-79	199	5	harper	harper	PROPN
crias-79	199	6	,	,	PUNCT
crias-79	199	7	d.	d.	PROPN
crias-79	199	8	hart	hart	PROPN
crias-79	199	9	,	,	PUNCT
crias-79	199	10	s.	s.	PROPN
crias-79	199	11	moult	moult	PROPN
crias-79	199	12	,	,	PUNCT
crias-79	199	13	r.	r.	PROPN
crias-79	199	14	hull	hull	PROPN
crias-79	199	15	,	,	PUNCT
crias-79	199	16	a.	a.	NOUN
crias-79	199	17	geering	geering	NOUN
crias-79	199	18	,	,	PUNCT
crias-79	199	19	and	and	CCONJ
crias-79	199	20	j.	j.	PROPN
crias-79	199	21	thomas	thomas	PROPN
crias-79	199	22	,	,	PUNCT
crias-79	199	23	"	"	PUNCT
crias-79	199	24	the	the	DET
crias-79	199	25	diversity	diversity	NOUN
crias-79	199	26	of	of	ADP
crias-79	199	27	banana	banana	PROPN
crias-79	199	28	streak	streak	PROPN
crias-79	199	29	virus	virus	NOUN
crias-79	199	30	isolates	isolate	NOUN
crias-79	199	31	in	in	ADP
crias-79	199	32	uganda	uganda	PROPN
crias-79	199	33	,	,	PUNCT
crias-79	199	34	"	"	PUNCT
crias-79	199	35	arch	arch	NOUN
crias-79	199	36	.	.	PUNCT
crias-79	200	1	virol	virol	NOUN
crias-79	200	2	.	.	PUNCT
crias-79	201	1	,	,	PUNCT
crias-79	201	2	vol	vol	NOUN
crias-79	201	3	.	.	PROPN
crias-79	202	1	150	150	NUM
crias-79	202	2	,	,	PUNCT
crias-79	202	3	pp	pp	ADJ
crias-79	202	4	.	.	PUNCT
crias-79	203	1	2407–2420	2407–2420	NUM
crias-79	203	2	,	,	PUNCT
crias-79	203	3	2005	2005	NUM
crias-79	203	4	.	.	PUNCT
crias-79	204	1	views	view	NOUN
crias-79	204	2	and	and	CCONJ
crias-79	204	3	opinions	opinion	NOUN
crias-79	204	4	expressed	express	VERB
crias-79	204	5	in	in	ADP
crias-79	204	6	this	this	DET
crias-79	204	7	article	article	NOUN
crias-79	204	8	are	be	AUX
crias-79	204	9	the	the	DET
crias-79	204	10	views	view	NOUN
crias-79	204	11	and	and	CCONJ
crias-79	204	12	opinions	opinion	NOUN
crias-79	204	13	of	of	ADP
crias-79	204	14	the	the	DET
crias-79	204	15	authors	author	NOUN
crias-79	204	16	,	,	PUNCT
crias-79	204	17	current	current	ADJ
crias-79	204	18	research	research	NOUN
crias-79	204	19	in	in	ADP
crias-79	204	20	agricultural	agricultural	ADJ
crias-79	204	21	sciences	science	NOUN
crias-79	204	22	shall	shall	AUX
crias-79	204	23	not	not	PART
crias-79	204	24	be	be	AUX
crias-79	204	25	responsible	responsible	ADJ
crias-79	204	26	or	or	CCONJ
crias-79	204	27	answerable	answerable	ADJ
crias-79	204	28	for	for	ADP
crias-79	204	29	any	any	DET
crias-79	204	30	loss	loss	NOUN
crias-79	204	31	,	,	PUNCT
crias-79	204	32	damage	damage	NOUN
crias-79	204	33	or	or	CCONJ
crias-79	204	34	liability	liability	NOUN
crias-79	204	35	etc	etc	X
crias-79	204	36	.	.	X
crias-79	205	1	caused	cause	VERB
crias-79	205	2	in	in	ADP
crias-79	205	3	relation	relation	NOUN
crias-79	205	4	to	to	PART
crias-79	205	5	/	/	PUNCT
crias-79	205	6	arising	arise	VERB
crias-79	205	7	out	out	ADP
crias-79	205	8	of	of	ADP
crias-79	205	9	the	the	DET
crias-79	205	10	use	use	NOUN
crias-79	205	11	of	of	ADP
crias-79	205	12	the	the	DET
crias-79	205	13	content	content	NOUN
crias-79	205	14	.	.	PUNCT