35 © 2025 Conscientia Beam. All Rights Reserved. Phylogeny of Trichoplusia ni (Lepidoptera: Noctuidae) 18S and 5S ribosomal RNA gene sequence Hanan Salah El- Din Taha Central Agricultural Pesticide Laboratory, Agricultural Research Center- Dokki-Giza, Egypt. Email: Hanansalah412@yahoo.com ABSTRACT Article History Received: 7 November 2024 Revised: 9 April 2025 Accepted: 18 April 2025 Published: 14 May 2025 Keywords 18 S 5S Phylogeny Ribosomal RNA Sequence alignment Trichoplusia ni. Trichoplusia ni Hübner, a cabbage looper belonging to the Noctuidae family of Lepidoptera, is a highly varied agricultural pest. It is essential to use partial sequences of nuclear DNA, 18S, and 5S ribosomal genes to isolate and analyze the phylogenetic relationships within T. ni and other insect species families and orders using distinct gene markers. T. DNA. After being extracted and sequenced using primers, Clustal W alignment and NCBI BLAST were completed. Members of the 18S BLAST lineage sequences are classified according to the order Coleoptera and the family Coccinellidae. A total of 2461 positions are occupied by the 33 sequences that were chosen for the final dataset. In the final dataset, 19 nucleotide sequences totaling 1935 positions were chosen from the taxonomy asset of 5S BLASTed lineages, which included members of the order Hymenoptera and the family Chalcidoidea. For both genes, phylogenetic analyses were performed using the Maximum Composite Likelihood model (ML), which aids in the construction of phylogenetic relationships at various taxonomic levels of trees, provides phylogenetic insights for understanding relationships between closer clades, and explains some significant regions of substitution rates appropriate for changing evolutionarily distant taxa. Contribution/Originality: Molecular phylogenetic studies and evolutionary biology have garnered more attention recently. They contribute to the knowledge of the traits of foraging behavior and insect resurgence, such as host specificity, transmission patterns, genetic diversity, and natural enemies. There aren't many known phylogenetic analyses of insect ribosomal RNA searches. 1. INTRODUCTION In Egypt, 160 different crops and vegetables, including cotton, are vulnerable to attacks by the highly polyphagous cabbage looper, Trichoplusia ni Hübner (Lepidoptera: Noctuidae), which is regarded as a significant agricultural pest of tomato, eggplant, zucchini, and other members of the Cruscus family [1]. Larvae consume vast amounts of plant leaves and fruits, which leads to population growth and crop damage [2]. The potential for control failure is caused by the economic damage at the lower threshold. The most common issue with this pest is the variation in the intensity of insecticide resistance development by location. Some substitutes, such as pyrethroids, Bacillus thuringiensis, and neem, are still effective, particularly when used in the early stages of larval development, when the high pest resistance status indicates polygenic inheritance or multiple resistance mechanisms [3, 4]. The recently suggested insecticide products for the control of cabbage loopers necessitate careful planning for resistance Current Research in Agricultural Sciences 2025 Vol. 12, No. 1, pp. 35-48 ISSN(e): 2312-6418 ISSN(p): 2313-3716 DOI: 10.18488/cras.v12i1.4210 © 2025 Conscientia Beam. All Rights Reserved. mailto:Hanansalah412@yahoo.com https://orcid.org/0000-0002-8735-0606 https://www.doi.org/10.18488/cras.v12i1.4210 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 36 © 2025 Conscientia Beam. All Rights Reserved. management strategies, choices regarding acquisition, and the preservation of the new insecticide's effectiveness [5]. Five to seven generations of cabbage loopers are produced annually. Temperature and thresholds impact development and reproduction; in winter, reproduction is lower (10–12 °C), but in summer, it is higher (40°C), where this pest overwinters as a pupa. For two to three weeks, larvae feed on leaves and fruit, but tomato crop damage is uncommon. Weekly scouting to find a 5 percent defoliation threshold is necessary for efficient management, followed by effective insecticide, Natwick and Lopez [6]. Large DNA sequence data sets for biological research on the pattern of mitochondrial and nuclear gene evolution in animal, insect, or plant genomes are made available by advances in molecular biology techniques and sequencing. These developments also aid in the construction of phylogenetic relationships at various taxonomic levels [7]. A popular tool for examining the molecular evolution of multigene families is ribosomal DNA (rDNA). The two primary types of rDNA genes found in eukaryotes are 5S rDNA and 45S rDNA repeats, which encode rRNA and are highly conserved gene products found in all cells. According to Zhao et al. [8], the 5S rDNA gene is a unit made up of a gene transcription region (120 bp) and a non-transcribed spacer (NTS), whereas the 45S rDNA in animals contains 18S, 5.8S, 28S, and spacers (IGS, ITS1, and ITS2) [8]. Additionally, many insects' mitochondrial genes, including 16S and COI, have been studied [9, 10], The availability of the 18S rRNA molecule is used to provide phylogenetic gestures for perceptive closer clade relationships and to explain some significant regions of substitution rates appropriate for changing evolutionarily distant taxa, Wu, et al. [11]. The study of evolutionary relationships between species, taxa, individuals, or genes/proteins is known as phylogeny. In order to predict phylogenetic affiliations between molecular characters of the nucleotide data and align appropriate sequences to achieve similarity, it is crucial to determine homology as soon as possible [12-14]. Individual base positions are aligned to maximize overall position resemblance across the sequence [15]. More than a thousand different insect species can be found in Egypt. They all belong to a limited number of orders that share certain traits, despite their differences in size and shape [16, 17]. The previous T organization system. The kingdom Animalia, phylum Arthropoda, subphylum Hexapoda, class Insecta, order Lepidoptera, family Noctuidae, subfamily Plusiinae, and tribe Argyrogrammatini are among the hierarchical categories that comprise insect taxonomic orders. Therefore, it is urgent to create phylogenetic trees and align multiple sequences using software in order to perform evolutionary relationship or phylogeny analysis on some sequences of various holometabolous insect species that are divided into three assemblages: (Neuropterida) includes neuroptera, megalopteran, raphidoptera, strepsiptera, and coleoptera, and (Hymenopterioida) includes hymenoptera and panopridae includes (Siphonaptera, diptera, trichoptera, lepidoptera, and mecoptera.) Additionally, it is necessary to estimate evolutionary distances, build trees, test tree reliability, work with genes and domains, test for selection, manage taxa with groups, compute sequence statistics, and construct likelihood trees, and compare the results using all five different methods [14, 18]. These techniques include Minimum-Evolution, Neighbour-Joining, and Maximum Likelihood (ML). Nevertheless, UPGMA was one of two cluster analysis methods Sayers et al. [19]. 2. MATERIALS AND METHODS 2.1. Insect Sources and DNA Extraction of Larvae A few Trichoplusia ni Hubner larvae were transferred to Cairo University's molecular biology labs after being collected from tomato plants. About 0–5 ml of CTAB buffer was prepared in accordance with the CTAB DNA extraction protocol, which was used to complete the extraction process according to Doyle and Doyle [20]. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 37 © 2025 Conscientia Beam. All Rights Reserved. 2.2. Polymerase Chain Reaction Procedure Preparations After thawing, gently vortex and quickly centrifuge DreamTaq Green PCR Master Mix (2X). Additionally, for each 50 μl reaction, place a thin-walled PCR tube on ice and add the following ingredients: DreamTaq Green PCR Master Mix (2X) 25 μl, Forward primer 2 μl, Reverse primer 2 μl, Template DNA 4 μl, Nuclease-free water 17 μl, and Total volume 50 μl. After adjusting the volume, sample vortexing and gentle spinning were performed. The following suggested thermal cycling conditions were used for the PCR procedures: initial denaturation at 95°C for 5 minutes for one cycle, denaturation at 95°C for 30 seconds for 40 cycles, annealing at 65°C for 30 seconds for 40 cycles, extension at 72°C for 30 seconds for 40 cycles, and final extension at 72°C for 10 minutes for one cycle. Table 1 Sequences of the primers used for PCR amplification and sequencing. Table 1. Primer used in the amplification. Gene Primer name Primer sequence Length bp GC MW Annealing temp 18S 5- AGTACGGTGAAACCGCGAAA Reverse: TTTCGCGGTTTCACCGTACT 20 50 % 6246 56.7 5S 5-AAGTGTACTCATTCCGATTACGG Reverse: CCGTAATCGGAATGAGTACACTT 23 43.47 % 7101 54.4 2.3. Sequencing Procedure As previously mentioned, two primers were used to sequence the purified PCR. The Big Dye Terminator Cycle Sequencing Kit v3.1 (Applied Biosystems, USA) was used for the sequencing process. The Macrogen company's Applied Biosystems model 3730 automated DNA sequencing system was used to resolve the sequencing products. 2.4. Phylogenetic Analysis: Sequence Alignment and Phylogenetic Tree The National Center for Biotechnology Information's (NCBI) BLAST algorithm databases were used to compare the T ni 18s and 5s rRNA nucleotide sequences obtained from the sequencing company with those of other insects (Tables 2,3). aligning multiple sequences with the Thompson et al. [21] was completed, after which Mega 11 software built phylogenetic trees and carried out all phylogenetic analysis [22]. 3. RESULTS AND DISCUSSIONS 3.1. The 18S, 5s rRNA Phylogenetic Analysis Partial nuclear DNA, 18S, and 5S ribosomal gene sequences were used to investigate the evolutionary relationships between lineage groups of the cabbage looper T. ni. In a separate analysis, phylogenetic relationships between insect lineage families and orders were inferred. Members of the taxonomy of 18S blasted lineage sequences belong to the family Coccinellidae and the order Coleoptera. Additionally, the member of the 5S blasted lineage belonged to the family Chalcidoidea, order Hymenoptera. The examination of T's 18S rRNA molecular data set included 33 nucleotide sequences from the ClustalW alignment that were then blasted against the PCR-generated native sequence. The final dataset contained 2646 positions in total. First, second, third, and noncoding codon positions were included. There were nineteen nucleotide sequences in the 5S rRNA analysis. The final dataset contained 1935 positions in total. For both genes, phylogenetic analyses were performed using the (ML) (Table 6). Every sequence pair's ambiguous positions were eliminated. Alignment and evolutionary analyses were performed to calculate different statistical quantities of nucleotide sequences. Table 2 lists the species information for the 18S rRNA sequences that have been aligned, and Table 3 lists the 5S rRNA sequences that have been aligned. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 38 © 2025 Conscientia Beam. All Rights Reserved. The NCBI blast plus identity and E value were displayed in Tables 2 and 3, along with the accession number, distances, homogeneity, divergence, and insect species names and orders. The Disparity Index test (Homogeneity of Substitution Patterns test Between Sequences or the net composition bias) is one of the results of phylogeny analysis [23, 24]. It is used to understand shifts in mutational patterns and selective pressures if sequences and species evolve with heterogeneous patterns, as well as the role of base composition biases between sequences and the probability that the null hypothesis will be rejected if sequences with the same pattern have evolved of substitution. P-values less than 0.05 are considered significant, according to the Monte Carlo test's estimations (500 replicates). According to Tajima and Nei [25], the number of nucleotide substitutions per site between two homologous DNA sequences is an estimate of the evolutionary change of DNA sequences caused by nucleotide substitution, deletion, and insertion. The pattern of change accumulation was calculated using the evolutionary distance, and the amino acid sequence data indicate that deletions and insertions are significantly less common in the coding regions of globin genes than in the noncoding regions. Actually, there is no issue when there are few nucleotide substitutions per site. In order to measure the impact of insertion and deletion on the evolutionary change of DNA sequences, Gamma was introduced. Table 2. List of different insect 18S ribosomal RNA sequences (Practically from the order Coleoptera, family Coccinellidae) obtained from NCBI-BLAST sequences, identity from 99.55 to 97.81, accession number, homogeneity, divergence, and distance between all taxa and T.ni PCR-generated sequence. N. Species name E-value Identity Length Accession n. Distance Hom Div.h 1 Rodolia sp. 3.00E-112 99.55 1857 KP829195.1 0.919 0.226 0.273 2 Monocoryna sp. 3.00E-112 99.55 1866 KP829165.1 0.910 0.190 0.294 3 Epilachna borealis 3.00E-112 99.55 1848 KP123077.1 0.900 0.240 0.234 4 Toxotoma forsteri 3.00E-112 99.55 1848 KP123017.1 0.900 0.192 0.234 5 Neoneuromus ignobilis 3.00E-112 99.55 7345923 CP092098.1 0.900 0.172 0.328 6 Rhyzobius hilura 3.00E-112 99.55 1823 EF209861.1 0.923 0.346 0.099 7 Neohermes californicus 3.00E-112 99.55 1676 EU815261.1 0.919 0.232 0.206 8 Parainocellia bicolor 3.00E-112 99.55 2097 EU815245.1 0.913 0.204 0.266 9 Austroneurorthus brunneipennis 3.00E-112 99.55 2461 EU815229.1 0.925 0.202 0.237 10 Strigocis opacicollis 3.00E-112 99.55 820 FM877872.1 0.925 0.198 0.279 11 Hyperaspidini sp. 3.00E-112 99.55 1768 EU145620.1 0.916 0.296 0.148 12 Negha meridionalis 3.00E-112 99.55 2071 AY521865.1 0.881 0.008 1.578 13 Meropathus zelandicus 3.00E-105 97.82 601 LT990835.1 0.920 0.226 0.262 14 Neostylopyga rhombifolia 3.00E-105 98.24 1842 KP986337.1 0.916 0.302 0.154 15 Ametastegia equiseti 4.00E-111 99.1 25643224 OZ022392.1 0.888 0.000 1.643 16 Libethra strigiventris 3.00E-105 98.23 1823 MN925370.1 0.921 0.220 0.258 17 Adelphydraena orchymonti 3.00E-105 97.82 601 HM588578.1 0.918 0.176 0.333 18 Meropathus sp. 3.00E-105 97.82 1791 EF214162.1 0.900 0.012 1.356 19 Neuroperlopsis patris 3.00E-105 97.41 1996 EF622699.1 0.894 0.000 1.695 20 Desertaclopus lucasi 1.00E-104 97.81 1845 MG924409.1 0.921 0.174 0.341 21 Mikado sp. 1.00E-104 97.81 620 LR742672.1 0.916 0.132 0.424 22 Hydraena paeminosa 1.00E-104 98.65 622 LR742669.1 0.933 0.182 0.286 23 Scirtoidea sp. 1.00E-104 97.81 1921 KX092894.1 0.949 0.166 0.331 24 Belohina inexpectata 1.00E-104 97.81 1917 OR754010.1 0.921 0.112 0.430 25 Satonius sp. 1.00E-104 97.81 1067 KP419279.1 0.913 0.122 0.448 https://www.ncbi.nlm.nih.gov/nucleotide/KP829195.1?report=genbank&log$=nucltop&blast_rank=1&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/KP829165.1?report=genbank&log$=nucltop&blast_rank=2&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/KP123077.1?report=genbank&log$=nucltop&blast_rank=4&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/KP123017.1?report=genbank&log$=nucltop&blast_rank=7&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/CP092098.1?report=genbank&log$=nucltop&blast_rank=8&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EF209861.1?report=genbank&log$=nucltop&blast_rank=9&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EU815261.1?report=genbank&log$=nucltop&blast_rank=10&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EU815245.1?report=genbank&log$=nucltop&blast_rank=11&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EU815229.1?report=genbank&log$=nucltop&blast_rank=12&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/FM877872.1?report=genbank&log$=nucltop&blast_rank=13&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EU145620.1?report=genbank&log$=nucltop&blast_rank=16&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/AY521865.1?report=genbank&log$=nucltop&blast_rank=17&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/LT990835.1?report=genbank&log$=nucltop&blast_rank=17&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP986337.1?report=genbank&log$=nucltop&blast_rank=19&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/OZ022392.1?report=genbank&log$=nucltop&blast_rank=19&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/MN925370.1?report=genbank&log$=nucltop&blast_rank=20&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/HM588578.1?report=genbank&log$=nucltop&blast_rank=21&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/EF214162.1?report=genbank&log$=nucltop&blast_rank=22&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/EF622699.1?report=genbank&log$=nucltop&blast_rank=23&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/MG924409.1?report=genbank&log$=nucltop&blast_rank=24&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/LR742672.1?report=genbank&log$=nucltop&blast_rank=25&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/LR742669.1?report=genbank&log$=nucltop&blast_rank=26&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KX092894.1?report=genbank&log$=nucltop&blast_rank=27&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/OR754010.1?report=genbank&log$=nucltop&blast_rank=28&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP419279.1?report=genbank&log$=nucltop&blast_rank=29&RID=BPYCMG8X016 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 39 © 2025 Conscientia Beam. All Rights Reserved. N. Species name E-value Identity Length Accession n. Distance Hom Div.h 26 Nycteus infumatus 1.00E-104 97.81 1868 KP419194.1 0.913 0.120 0.448 27 Clytra quadripunctata 1.00E-104 97.81 1883 KP762945.1 0.923 0.120 0.542 28 Labidostomis lucida 1.00E-104 97.81 1916 KP762940.1 0.913 0.108 0.448 29 Lachnaia gallaeca 1.00E-104 97.81 1915 KP762933.1 0.913 0.108 0.448 30 Smaragdina rufimana 1.00E-104 97.81 1883 KP762874.1 0.913 0.168 0.448 31 Trigonogenium angulosum 1.00E-104 97.81 1865 KM364119.1 0.926 0.158 0.445 32 Paragrilus aeraticollis 1.00E-104 97.81 1748 KM364075.1 0.933 0.130 0.464 Note: Div=Interspecific genetic divergence, H=heterogeneity and Hom=Homogeneity. Table 3. List of different insect 5s ribosomal RNA sequences (Practically from order Hymenoptera, family Calcidoidae) attained from NCBI- blast information, identity from 89.72 to 88.79, accession number, distance, homogeneity and divergence. N. Species name E-value % Identity Length Accession n. Dist Homo Div. 1 Phymastichus coffea 3.00E-28 89.72 1915 XR_009302357.1 0.441 0.022 0.647 2 Nasonia vitripennis 1.00E-26 88.79 1915 XR_004228347.1 0.559 0.010 0.772 3 Coruna clavata 1.00E-26 88.79 897 KY887836.1 0.559 0.012 0.772 4 Asaphes vulgaris 1.00E-26 88.79 897 KY887833.1 0.559 0.004 0.772 5 Alloxysta victrix 1.00E-26 88.79 893 KY887822.1 0.559 0.018 0.772 6 Aphelinus varipes 1.00E-26 88.79 892 KY887812.1 0.559 0.018 0.772 7 Praon necans 1.00E-26 88.79 903 KY873372.1 0.559 0.014 0.772 8 Ephedrus plagiator 1.00E-26 88.79 904 KY873354.1 0.559 0.012 0.772 9 Kerria yunnanensis 1.00E-26 88.79 568 JQ365156.1 0.559 0.006 0.772 10 Ephuta sp. 1.00E-26 88.79 737 EF473894.1 0.559 0.010 0.772 11 Sphaeropthalma coaequalis 1.00E-26 88.79 730 EF473891.1 0.559 0.016 0.772 12 Odontophotopsis melicausa 1.00E-26 88.79 731 EF473889.1 0.559 0.006 0.772 13 Dasymutilla subhyalina 1.00E-26 88.79 731 EF473888.1 0.559 0.010 0.772 14 Aprostocetus purpureus 1.00E-26 88.79 1775 JQ359003.1 0.559 0.018 0.772 15 Trichogramma platneri 1.00E-26 88.79 1900 JN623531.1 0.500 0.012 0.713 16 Podagrion sp. 1.00E-26 88.79 1895 JN623524.1 0.559 0.016 0.772 17 Tetracampe sp. 1.00E-26 88.79 1268 JN623512.1 0.559 0.022 0.772 18 Foersterella reptans 1.00E-26 88.79 1898 JN623511.1 0.559 0.012 0.772 19 Signiphora dipterophaga 1.00E-26 88.79 1901 JN623482.1 0.441 0.022 0.647 Table 5 displays the maximum composite ML of the nucleotide substitution pattern as well as the rates of various transitional and transversional substitutions for both genes. A = 24.06 percent, T/U = 24.22 percent, C = 23.92 percent, and G = 27.79 percent are the nucleotide frequencies of the 18S alignment. For purines, the transition/transversion rate ratio is k1 = 23.918; for pyrimidines, it is K2 = 291.494. R = [A*G*k1 + T*C*k2]/[(A+G) * (T+C)] is the overall transition/transversion bias, or R = 73.714. However, the estimated ratio (R) value for 5S is 0.53, which is the number of transitional substitutions to that of transversional substitutions. Rates and patterns of substitution were calculated using the Tamura et al. [26] as well as the Takahashi and Nei [27]. A = 25.00 percent, T/U = 25.00 percent, C = 25.00 percent, and G = 25.00 percent are the nucleotide frequencies. A tree topology was automatically calculated for ML value estimation. The gamma shape parameter was 139.2826 and the ML for the 18-second computation was -14371.636; for the 5-second computation, the ML was -4097.380. A total of 1935 positions and 19 nucleotide sequences were included in the final dataset for this analysis. https://www.ncbi.nlm.nih.gov/nucleotide/KP419194.1?report=genbank&log$=nucltop&blast_rank=30&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP762945.1?report=genbank&log$=nucltop&blast_rank=31&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP762940.1?report=genbank&log$=nucltop&blast_rank=32&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP762933.1?report=genbank&log$=nucltop&blast_rank=33&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP762874.1?report=genbank&log$=nucltop&blast_rank=40&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KM364119.1?report=genbank&log$=nucltop&blast_rank=43&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KM364075.1?report=genbank&log$=nucltop&blast_rank=44&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/XR_009302357.1?report=genbank&log$=nucltop&blast_rank=1&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/XR_004228347.1?report=genbank&log$=nucltop&blast_rank=3&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY887836.1?report=genbank&log$=nucltop&blast_rank=13&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY887833.1?report=genbank&log$=nucltop&blast_rank=14&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY887822.1?report=genbank&log$=nucltop&blast_rank=16&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY887812.1?report=genbank&log$=nucltop&blast_rank=21&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY873372.1?report=genbank&log$=nucltop&blast_rank=27&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/KY873354.1?report=genbank&log$=nucltop&blast_rank=28&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JQ365156.1?report=genbank&log$=nucltop&blast_rank=34&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/EF473894.1?report=genbank&log$=nucltop&blast_rank=30&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/EF473891.1?report=genbank&log$=nucltop&blast_rank=31&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/EF473889.1?report=genbank&log$=nucltop&blast_rank=32&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/EF473888.1?report=genbank&log$=nucltop&blast_rank=33&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JQ359003.1?report=genbank&log$=nucltop&blast_rank=35&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JN623531.1?report=genbank&log$=nucltop&blast_rank=36&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JN623524.1?report=genbank&log$=nucltop&blast_rank=37&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JN623512.1?report=genbank&log$=nucltop&blast_rank=38&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JN623511.1?report=genbank&log$=nucltop&blast_rank=39&RID=BPZA2VJU016 https://www.ncbi.nlm.nih.gov/nucleotide/JN623482.1?report=genbank&log$=nucltop&blast_rank=40&RID=BPZA2VJU016 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 40 © 2025 Conscientia Beam. All Rights Reserved. The compositional distance is correlated with the number of differences between sequences. Non- uniformity of evolutionary rate differences among sites was modeled by using a discrete gamma distribution (+G) with 5 rate categories and by assuming that a certain fraction of sites is evolutionarily invariable (+I). Mean evolutionary rates in these categories were 0.88, 0.95, 1.00, 1.04, and 1.12 substitutions per site. The sites showing a rate < 1 are evolving slower than average, and those with a rate > 1 are evolving faster than average. The gamma distribution (ʎ) can be specified by the coefficient of variation of the substitution rate (CV), where the smaller the CV, the higher ʎ. Actually, analysis of ML results that gave the lowest BIC scores (Bayesian Information Criterion) is considered to describe the best substitution pattern (Table 6). For each model, AICc value (Akaike Information Criterion, corrected), ML value (lnL), and the number of parameters, including branch lengths are also presented in Table 6. Estimates of the gamma shape parameter, fraction of invariant sites, and transition/transversion bias (R) are shown for each model. The nucleotide frequencies of the 18s rRNA found in Table 6 and rates of base substitutions (r) for each nucleotide pair found in Table 6, with the sum of r-values made equal to 100. The difference in base composition bias per site (relative frequencies of the four nucleotides) is in Table 6; also, the twenty amino acid residues (amino acid composition) were attained computationally. Table 4. Different in ML models of the 18s and 5s rRNA gene using one of the most parsimonious trees topology fits. No. Blasred 18s r RNA sequences ML Blasted 5s sequences ML Model BIC AICc lnL R Model BIC AICc lnL R 1 TN93+G 27737.48 27123.59 -13492.70 1.262 K2+G 8502.82 8207.70 -4066.78 2.670 2 TN93+G+I 27748.45 27125.67 -13492.74 1.265 T92+G 8511.61 8208.51 -4066.18 2.668 3 GTR+G 27757.79 27117.21 -13486.51 1.260 K2+G+I 8514.44 8211.34 -4067.60 2.586 4 GTR+G+I 27768.75 27119.28 -13486.54 1.263 T92+G+I 8523.24 8212.17 -4067.01 2.585 5 K2+G 27781.00 27202.69 -13536.26 1.231 HKY+G 8526.68 8207.64 -4063.74 2.687 6 T92+G 27782.15 27194.94 -13531.39 1.240 TN93+G 8526.71 8199.69 -4058.77 2.688 7 T92+G+I 27793.02 27196.92 -13531.38 1.242 HKY+G+I 8538.56 8211.54 -4064.69 2.600 8 K2+G+I 27803.93 27216.73 -13542.28 1.492 TN93+G+I 8538.90 8203.91 -4059.87 2.600 9 HKY+G 27808.17 27203.18 -13533.50 1.259 GTR+G 8550.61 8199.68 -4055.75 2.664 10 HKY+G+I 27819.04 27205.15 -13533.49 1.261 GTR+G+I 8566.43 8207.53 -4058.67 2.296 11 JC+G 28021.11 27451.69 -13661.77 0.500 K2+I 8604.27 8309.14 -4117.51 2.287 12 JC+G+I 28044.68 27466.37 -13668.10 0.500 T92+I 8613.08 8309.98 -4116.92 2.288 13 GTR+I 28904.97 28264.40 -14060.10 1.078 TN93+I 8625.82 8298.80 -4108.32 2.348 14 TN93+I 28911.16 28297.27 -14079.55 1.212 JC+G 8626.20 8339.04 -4133.46 0.500 15 K2+I 28989.98 28411.67 -14140.76 1.050 HKY+I 8628.42 8309.38 -4114.61 2.289 16 T92+I 28996.19 28408.99 -14138.41 1.053 JC+G+I 8639.04 8343.91 -4134.89 0.500 17 HKY+I 29024.60 28419.61 -14141.72 1.056 GTR+I 8652.88 8301.94 -4106.88 2.071 18 JC+I 29202.05 28632.63 -14252.24 0.500 K2 8678.14 8390.98 -4159.43 2.095 19 GTR 29733.37 29101.69 -14479.75 0.996 T92 8686.72 8391.59 -4158.73 2.096 20 TN93 29742.70 29137.70 -14500.76 1.113 TN93 8701.04 8381.99 -4150.92 2.098 21 K2 29823.80 29254.38 -14563.12 1.137 HKY 8702.36 8391.28 -4156.57 2.096 22 T92 29834.34 29256.03 -14562.94 1.136 JC+I 8717.71 8430.56 -4179.22 0.500 23 HKY 29860.28 29264.18 -14565.01 1.137 GTR 8725.76 8382.80 -4148.31 2.107 24 JC 30015.88 29455.36 -14664.60 0.500 JC 8786.54 8507.36 -4218.62 0.500 Note: LnL = log likelihood, LRT= likelihood ratio test. 3.2. Parsimony Analysis, Sequence Variation and Nucleotide Composition The principle of parsimony states that the most straightforward explanation for the data should be chosen. Parsimony in phylogenetic analysis refers to the likelihood that a relationship hypothesis that calls for the fewest character changes will be accurate. Additionally, Mega computer software supports the maximum-parsimony (MP) method of reconstructing phylogenetic trees. Equal branch lengths in the tree, consistency of substitution rates between nucleotides, and consistency of rates across nucleotide sites are among the very stringent assumptions about the sequence evolution process that parsimony appears to entail. Few species in the data, relatively long interior branches, and similar substitution rates among lineages (the existence of an approximate molecular clock) are necessary for the practical analysis of data Current Research in Agricultural Sciences, 2025, 12(1): 35-48 41 © 2025 Conscientia Beam. All Rights Reserved. in order to meet the requirement of equal branch lengths. However, a small amount of evolution is not necessary for the method to work. Table 5. Number of taxa, characters, and nucleotide frequency and substitution matrix of the 18s and 5s r RNA gene of the most parsimonious trees topology fits. Gene N. of sequence A% T% C% G% Variable site Pars. informative site Neocleotid frequency 18s 33 0.2435 0.2445 0.246 0.2655 2646 68 Neocleotid frequency 5s 19 0.251 0.2525 0.2385 0.258 1935 40 Substitution rate 18s 3.84 45.6 44.9 4.2 Substitution rate 5s 12.66 21.4 19.17 13.44 3.3. Variation in 18s and 5s Genes rDNA Sequence The intraspecific distance of all species is given in Tables 2 and 3. The minimum intraspecific pairwise distance variation was observed between T.ni tested sequence and Trigonogenium angulosum (Accession number is KM364119.1 and 1865 in length) was 0.547, and the maximum intraspecific distance was calculated between T.ni tested sequence and Monocoryna sp. (Accession number KP829165.1 and 1866 in length) was 2.7. Similarly, evolutionary genetic divergence for species discrimination estimated between sequences refers to the number of base substitutions per site between sequences, which are in Tables 2 and 3. The maximum interspecific genetic divergence ranged from 98.78 for Meropathus sp. (Accession number EF214162.1 and 1791 length) to 228.7 5 for Rhyzobius hilura (Accession number EF209861.1 and 1823 length). To attain the phylogenetic position of T. ni, the phylogenetic tree was constructed, and topology differences were obtained from some trees constructed in this study for 18S and 5S blasted sequences in Figures 1 and 2. Details of the gene alignment of T. ni from the Egypt population sequenced and some from China with their sequence variable sites and parsimony informative sites were observed. The molecular diversity analysis revealed minute intraspecific variation with pairwise genetic distance ranging from 0 to 0%. Pattern heterogeneity ranged from 1.0 to 1.0. Interspecific genetic divergence between the two groups (14 Chinese sequences and the target Egyptian one) was 0.02. The 15-nucleotide sequence alignment result included 391 selected sites, including 247 complete (no gaps, no N), 180 variable (72.9% of complete), and 0 informative (0.0% of complete). Table 6. Test of the homogeneity of substitution patterns between sequences. Position 18s r RNA 5s rRNA A C G T A C G T All position 24.218 23.922 24.048 27.810 25.436 22.764 25.121 26.677 First position 25.084 24.423 23.729 26.761 27.363 20.963 25.822 25.850 Second position 24.004 23.493 24.620 27.881 24.197 22.585 24.030 29.186 Third position 23.566 23.849 23.793 28.790 24.746 24.746 25.510 24.996 Note: Heterogeneous base composition across species was tested with x2 test statistic. Base composition broken down by codon position. Molecular phylogenetics of lepidopteran datasets created using 18S rRNA nucleotide alignments produced by ClustalW between the main Noctuidae lineages, Figure 1. The tree with the highest log likelihood (-44601.14) is shown. Initial trees for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura-Nei model, and then selecting the topology with superior log likelihood value. This analysis involved 43 nucleotide sequences of familiar (Agricultural pests) and total of 2083 positions in the final dataset. The nucleotide frequencies are A = 25.00%, T/U = 25.00%, C = 25.00%, and G = 25.00%. The estimated Transition/Transversion bias (R) is 0.52. BIC=90076.5, AIC=89333.6. And https://www.ncbi.nlm.nih.gov/nucleotide/KM364119.1?report=genbank&log$=nucltop&blast_rank=43&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/KP829165.1?report=genbank&log$=nucltop&blast_rank=2&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/EF214162.1?report=genbank&log$=nucltop&blast_rank=22&RID=BPYCMG8X016 https://www.ncbi.nlm.nih.gov/nucleotide/EF209861.1?report=genbank&log$=nucltop&blast_rank=9&RID=9YTPHZFF013 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 42 © 2025 Conscientia Beam. All Rights Reserved. confidence intervals on phylogenies by the number of bootstrap replicates with 10,000 [28] estimated and tree constructed based on the protein-coding amino acid sequences (Figure 3, 4). Nonetheless molecular phylogeny of 5s alignment with different orders analysis involved 28 nucleotide sequences and a total of 607 positions. InL=2813.6, BIC=5738.8 and BIC= 6084.3. Synonymous and non-synonymous substitution (Silent and amino acid alteration) were also calculated according to Nei and Gojobori [29]. It is obtained by counting silent and amino acid-altering nucleotide differences. Where the silent amino acid substitution is much higher than the altered and looks similar for different genes. The small value refers to there is no more than one nucleotide difference between each pair of homologous codons, but the high value refers to the differences is complicated. Another alignment with some members of the subfamily Plusiinae 18s rRNA sequences and phylogenetic analysis by the ML method was done to generate the evolutionary history. Results indicate that the topology was similar and the pairwise genetic distance is the same Figure 5. Many literature producers’ efforts have been made regarding the subject of phylogeny as well as insect taxonomy, insect detoxifications, and important insect molecules like specific target function encoding proteins such as [30, 31]. Many scientists have proposed some high-quality T. ni genome assembly, which contains 14,384 protein-coding genes of the assembly across 31 chromosomes, as Chen et al. [32] and Talsania et al. [33]. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 43 © 2025 Conscientia Beam. All Rights Reserved. Table 7. The alignment of many insect orders with the species name and accession number indicates varying degrees of homogeneity, distance, and divergence of substitution. N. Species name Order Family E value % Identity Length Accession n Dist. Homo Div. 1 Aedes_aegypti Diptera Culicidae 4.0E-38 82.81 825 HE613439 0.036 1.000 0.000 2 Aphis_gossypii Hemiptera Aphidae 1.0E-40 96.43 1163 KF018922 0.036 1.000 0.000 3 Bemisia_tabaci Homoptera Aleyrodidae 0.009 28.57 506 JQ995259 0.153 1.000 0.000 4 Bombyx_mori Lepidoptera Bombicidae 5.0E-43 82.19 1124 KF982847 2.629 0.014 1.871 5 Cephus_pygmaeuss Coleoptera Cephidae 2.0E-46 98.44 1860 GQ410588 3.357 0.006 2.629 6 Chilo_suppressalis Lepidoptera Crambidae 1.0E-41 80.82 1914 GQ265912 0.017 1.000 0.000 7 Chrysoperla_carnea Neuroptera Chrysopidae 2.0E-46 98.44 989 KT204369 0.031 1.000 0.000 8 Drosophila_melanogaster Diptera Drosophilidae 2.0E-36 79.17 1994 NR_133559 0.031 1.000 0.000 9 Eniclases_pseudoluteolus Ccoleoptera Lycidae 8.0E-46 96.88 221 MG871684 0.031 1.000 0.000 10 Frankliniella_occidentalis Thysanoptera Thyripidae 2.0E-43 90.91 228 KC512959 0.352 1.000 0.000 11 Helicoverpa_zea Lepidoptera Noctuidae 4 81.6 21 KT946004 3.065 0.006 2.324 12 Heliothis_subflexa Lepidoptera Noctuidae 4 81,5 21 KT946000 0.368 1.000 0.000 13 Hypera_postica Coleoptera Curculionidae 1.0E-43 89.39 1609 AF389058 0.866 0.306 0.105 14 Locusta_migratoria Orthoptera Acrididae 1.0E-44 92.42 1893 KM853191 0.085 1.000 0.000 15 Lycorma_delicatula Hemiptera Erebidae 4.0E-44 95.08 230 KC413787 0.425 1.000 0.000 16 Macroglenes sp. Hymenoptera Pirenidae 1E-42 95.31 678 JN623447.1 0.425 1.000 0.000 17 Musca_domestica Diptera Muscidae 3E-34 81.25 1943 KC177313 3.980 0.000 3.251 18 Nala_lividipes Dermaptera Labidoridae 4 69.6 55 AY707362 5.385 0.000 4.623 19 Nasonia_vitripennis Hymenoptera Pteromalidae 2E-11 100 573 MF583329 1.494 0.106 0.749 20 Neohermes_californicus Megaloptera Corydalidae 1E-47 100 223 CP092098.1 5.235 0.000 4.494 21 Neoneuromus_ignobilis Megaloptera Corydalidae 1E-47 100 223 CP092098.1 1.980 0.046 1.235 22 Nilaparvata_lugen Hemipteran Delphacidae 4 57.6 135 JN662398 1.729 0.098 0.947 23 Nomada_panzeri Hymenoptera Apidae 0.002 100 784 KF512686 1.729 0.078 0.996 24 Ostrinia_nubilalis Lepidoptera Crambidae 4 82.4 17 X576726 1.833 0.068 1.059 25 Tuta absoluta Lepidoptera Gelichidae 4 68.2 47 MH644412 1.761 0.052 1.041 26 Parainocellia bicolor Raphidoptera Inocellidae 1E-47 100 223 EU815245 0.049 1.000 0.000 27 Phthorimaea_operculella Lepidoptera Gelichidae 4 54.5 99 OL655414 0.757 0.388 0.008 28 Phytoseiulus_persimilis Acari Phytosidae 4 59.5 42 U39916 3.429 0.004 2.704 29 Pieris_brassicae Lepidoptera Pieridae 4e-46 83.56% 248 XR_006754962 1.243 0.178 0.506 30 Pieris_napi Lepidoptera Pieridae 1E-44 92.42 1893 XR_007118579 1.640 0.094 0.879 31 Planococcus_ficus Hemipteran Coccoidae 4 56.2 80 MF952600 1.826 0.058 1.085 32 Plutella_xylostella Lepidoptera Plutillidae 4 66.7 33 JN410814 0.684 1.000 0.000 33 Pteromalus_albipennis Hymenoptera Pteromalidae 4 68,2 44 KC008498 1.798 0.084 1.028 34 Pulvinaria_psidii Hemiptera Coccoidae 1E-15 96 139 JQ651034 1.239 0.178 0.494 35 Rodolia_cardinalis Coleopteran Coccinillidae GU073726 1.437 0.146 0.684 https://www.ncbi.nlm.nih.gov/nucleotide/CP092098.1?report=genbank&log$=nucltop&blast_rank=8&RID=9YTPHZFF013 https://www.ncbi.nlm.nih.gov/nucleotide/CP092098.1?report=genbank&log$=nucltop&blast_rank=8&RID=9YTPHZFF013 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 44 © 2025 Conscientia Beam. All Rights Reserved. N. Species name Order Family E value % Identity Length Accession n Dist. Homo Div. 36 Signiphora_dipterophaga Hymenoptera Calcidoidae 2E-45 95.31 1901 N623482 3.644 0.004 2.899 37 Spodoptera_exigua Lepidoptera Noctuidae FJ041111 1.081 0.226 0.340 38 Spodoptera_litura Lepidotera Noctuidae JX041469 4.393 0.000 3.640 39 Tenebrio_molitor Coleoptera Tenebrionidae 2E-45 95.31 2083 X07801 1.408 0.130 0.614 41 Tetranychus_urticae Acari Tetranychidae 4 74.3 27 KP642052 1.413 0.150 0.652 42 Thrips_tabaci Thysanoptera Thripidae 2.0 20.2 1545 KM877307 3.862 0.002 3.097 43 Chinese_Trichoplusia_ni Lepidoptera Noctuidae 2E-46 94.15 247 KY514086.1 2.870 0.010 2.105 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 44 © 2025 Conscientia Beam. All Rights Reserved. Table 7 Different levels of homogeneity, distance, and divergence of substitution rate are indicated by the alignment of many insect orders with the species name and accession number. Figure 1. Showed alignment of the most identical sequence to the attained sequence of T. ni 18S rRNA protein. Figure 2. Phylogram characterize the phylogenetic relationships among major evolutionary lineages of T. ni were investigated using partial sequences of nuclear DNA, 18S. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 45 © 2025 Conscientia Beam. All Rights Reserved. Figure 3. Phylogram characterize the phylogenetic relationships among major evolutionary lineages of T. ni were investigated using partial sequences of nuclear DNA, 5S ribosomal protein. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values. Figure 4. Phylogram of 18s rRNA of Egyptian T.ni sequence aligned with other insect orders best ML tree of phylogenetic analysis. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 46 © 2025 Conscientia Beam. All Rights Reserved. Figure 5. Aligned translated sequence of some Chinese T. ni with Egyptian T.ni sequence. Figure 6. The best ML tree of phylogenetic analysis shows the phylogram of the Egyptian T . ni sequence's 5s rRNA aligned with other insect orders. Bootstrap values are represented by numbers above branches, while posterior probability values are represented by numbers below branches. Figure 6. Phylogram of 5s rRNA of Egyptian T.ni sequence aligned with other insect orders best ML tree of phylogenetic analysis. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values 4. CONCLUSIONS The main goal of this study is to realize the phylogenetic relationships among T. ni species and others and between evolutionarily closer clades based on 18S rRNA gene markers. From the results, it can be concluded that the 18S rRNA gene is useful for differentiation between a variety of insects and the agricultural economic moth group. The phylogenetic analysis tool exhibits ease of data handling and provides a clear illustration of this subject of molecular research, depending on the structures, the position of substitutions, and the necessity of aligning sequences, which are characters determining similarity and homology. Current Research in Agricultural Sciences, 2025, 12(1): 35-48 47 © 2025 Conscientia Beam. All Rights Reserved. Funding: This research is supported by Central Agricultural Pesticide Laboratory, Agriculture Research Center, Egypt Institutional Review Board Statement: The Ethical Committee of Cairo University, Egypt has granted DNA lab work approval for this study Transparency: The author states that the manuscript is honest, truthful, and transparent, that no key aspects of the investigation have been omitted, and that any differences from the study as planned have been clarified. This study followed all writing ethics. Competing Interests: The author declares that there are no conflicts of interests regarding the publication of this paper. REFERENCES [1] R. S. Ammar, S. S. Ibrahim, and S. A. Badr, "Hatching process time of the cabbage looper, (Trichoplusia ni) egg as new scientific point of insect life cycle stage," International Journal of Sustainable Development and Science, vol. 3, no. 1, pp. 1-4, 2020. https://doi.org/10.21608/ijsrsd.2020.109387 [2] N. Mpumi, R. S. Machunda, K. M. Mtei, and P. A. Ndakidemi, "Selected insect pests of economic importance to Brassica oleracea, their control strategies and the potential threat to environmental pollution in Africa," Sustainability, vol. 12, no. 9, p. 3824, 2020. https://doi.org/10.3390/su12093824 [3] H. Murillo, D. Hunt, and S. Vanlaerhoven, "Larval parasitoids of the cabbage looper, Trichoplusia ni (Lepidoptera: Noctuidae), in field tomato crops in southwestern Ontario," The Journal of the Entomological Society of Ontario, vol. 143, 2012. https://doi.org/10.1016/j.biocontrol.2012.09.020 [4] Z. N. Kain, J. C. Fitch, J. R. Kirsch, B. Mets, and R. G. Pearl, "Future of anesthesiology is perioperative medicine: A call for action," Anesthesiology, vol. 122, no. 6, pp. 1192-1195, 2015. [5] E. M. Maxwell and H. Y. Fadamiro, "Evaluation of several reduced-risk insecticides in combination with an action threshold for managing lepidopteran pests of cole crops in Alabama," Florida Entomologist, vol. 89, no. 2, pp. 117-126, 2006. [6] E. T. Natwick and M. I. Lopez, "Cabbage worm pest insecticide efficacy evaluation in 2016," Arthropod Management Tests, vol. 41, no. 1, p. tsw087, 2016. [7] L. W. Hugerth et al., "Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia," PloS One, vol. 9, no. 4, p. e95567, 2014. https://doi.org/10.1371/journal.pone.0095567 [8] C. Zhao et al., "Organization and expression analysis of 5S and 45S ribosomal DNA clusters in autotetraploid Carassius auratus," BMC Ecology and Evolution, vol. 21, no. 1, p. 201, 2021. https://doi.org/10.1186/s12862-021-01918-2 [9] F. C. Lee and V. Muthu, "From 18S to 28S rRNA gene: An improved targeted Sarcocystidae PCR amplification, species identification with long DNA sequences," The American Journal of Tropical Medicine and Hygiene, vol. 104, no. 4, p. 1388, 2021. https://doi.org/10.4269/ajtmh.20-0767 [10] C. A. Leonard, M. L. Meli, M. Novacco, and N. Borel, "18S Ribosomal RNA evaluation as preanalytical quality control for animal DNA," BioMed Research International, vol. 2016, no. 1, p. 6104323, 2016. https://doi.org/10.1155/2016/6104323 [11] S. Wu, J. Xiong, and Y. Yu, "Taxonomic resolutions based on 18S rRNA genes: A case study of subclass Copepoda," PloS One, vol. 10, no. 6, p. e0131498, 2015. https://doi.org/10.1371/journal.pone.0131498 [12] B. Michot and J.-P. Bachellerie, "Comparisons of large subunit rRNAs reveal some eukaryote-specific elements of secondary structure," Biochimie, vol. 69, no. 1, pp. 11-23, 1987. https://doi.org/10.1016/0300-9084(87)90267-7 [13] G. Tsagkogeorga et al., "An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models," BMC Evolutionary Biology, vol. 9, pp. 1-16, 2009. https://doi.org/10.1186/1471-2148-9-187 [14] P. Provataris, K. Meusemann, O. Niehuis, S. Grath, and B. Misof, "Signatures of DNA methylation across insects suggest reduced DNA methylation levels in Holometabola," Genome Biology and Evolution, vol. 10, no. 4, pp. 1185-1197, 2018. https://doi.org/10.1093/gbe/evy066 [15] N. Chalwatzis, J. Hauf, Y. Van De Peer, R. Kinzelbach, and F. K. Zimmermann, "18S ribosomal RNA genes of insects: Primary structure of the genes and molecular phylogeny of the Holometabola," Annals of the Entomological Society of America, vol. 89, no. 6, pp. 788-803, 1996. https://doi.org/10.1093/aesa/89.6.788 https://doi.org/10.21608/ijsrsd.2020.109387 https://doi.org/10.3390/su12093824 https://doi.org/10.1016/j.biocontrol.2012.09.020 https://doi.org/10.1371/journal.pone.0095567 https://doi.org/10.1186/s12862-021-01918-2 https://doi.org/10.4269/ajtmh.20-0767 https://doi.org/10.1155/2016/6104323 https://doi.org/10.1371/journal.pone.0131498 https://doi.org/10.1016/0300-9084(87)90267-7 https://doi.org/10.1186/1471-2148-9-187 https://doi.org/10.1093/gbe/evy066 https://doi.org/10.1093/aesa/89.6.788 Current Research in Agricultural Sciences, 2025, 12(1): 35-48 48 © 2025 Conscientia Beam. All Rights Reserved. [16] A. E.-F. Amer, M. Rizk, and A. Iskandar, "Impact of environment on the diversity of lepidopterous insects in three Egyptian governorates," Catrina: The International Journal of Environmental Sciences, vol. 1, no. 1, pp. 81-88, 2006. [17] A. Rahouma, "The most economic lepidopterous pests attacking vegetable crops in Egypt," Journal of Plant Protection and Pathology, vol. 9, no. 7, pp. 417-421, 2018. [18] C. P. Arango, "Molecular approach to the phylogenetics of sea spiders (Arthropoda: Pycnogonida) using partial sequences of nuclear ribosomal DNA," Molecular Phylogenetics and Evolution, vol. 28, no. 3, pp. 588-600, 2003. https://doi.org/10.1016/s1055-7903(03)00069-1 [19] E. W. Sayers et al., "Database resources of the national center for biotechnology information," Nucleic Acids Research, vol. 50, no. D1, pp. D20-D26, 2022. https://doi.org/10.1093/nar/gkab1112 [20] J. J. Doyle and J. L. Doyle, "A rapid DNA isolation procedure for small quantities of fresh leaf tissue," Phytochemical Bulletin, vol. 19, no. 1, pp. 11-15, 1987. https://doi.org/10.1128/aem.53.10.2394-2396.1987 [21] J. D. Thompson, D. G. Higgins, and T. J. Gibson, "CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice," Nucleic Acids Research, vol. 22, no. 22, pp. 4673-4680, 1994. https://doi.org/10.1093/nar/22.22.4673 [22] K. Tamura, G. Stecher, and S. Kumar, "MEGA11: Molecular evolutionary genetics analysis version 11," Molecular Biology and Evolution, vol. 38, no. 7, pp. 3022-3027, 2021. https://doi.org/10.1093/molbev/mst197 [23] S. Kumar and S. R. Gadagkar, "Disparity index: A simple statistic to measure and test the homogeneity of substitution patterns between molecular sequences," Genetics, vol. 158, no. 3, pp. 1321-1327, 2001. [24] S. Q. Le and O. Gascuel, "An improved general amino acid replacement matrix," Molecular Biology and Evolution, vol. 25, no. 7, pp. 1307-1320, 2008. https://doi.org/10.1093/molbev/msn067 [25] F. Tajima and M. Nei, "Estimation of evolutionary distance between nucleotide sequences," Molecular Biology and Evolution, vol. 1, no. 3, pp. 269-285, 1984. https://doi.org/10.1093/oxfordjournals.molbev.a040317 [26] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar, "MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods," Molecular Biology and Evolution, vol. 28, no. 10, pp. 2731-2739, 2011. https://doi.org/10.1093/molbev/msr121 [27] K. Takahashi and M. Nei, "Efficiencies of fast algorithms of phylogenetic inference under the criteria of maximum parsimony, minimum evolution, and maximum likelihood when a large number of sequences are used," Molecular Biology and Evolution, vol. 17, no. 8, pp. 1251-1258, 2000. https://doi.org/10.1093/oxfordjournals.molbev.a026408 [28] P. S. Soltis and D. E. Soltis, "Applying the bootstrap in phylogeny reconstruction," Statistical Science, vol. 18, no. 2, pp. 256-267, 2003. https://doi.org/10.1214/ss/1063994980 [29] M. Nei and T. Gojobori, "Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions," Molecular Biology and Evolution, vol. 3, no. 5, pp. 418-426, 1986. https://doi.org/10.1093/oxfordjournals.molbev.a040410 [30] L. Steyn, M. Karsten, A. Malan, H.-L. Wang, and P. Addison, "Phylogeny of Holocacista capensis (Lepidoptera: Heliozelidae) from vineyards and natural forests in South Africa inferred from mitochondrial and nuclear genes," South African Journal of Enology and Viticulture, vol. 44, no. 1, pp. 64-74, 2023. https://doi.org/10.21548/44-1-5945 [31] E. Kaminskienė et al., "Molecular identification and phylogenetic analysis of Laelapidae mites (Acari: Mesostigmata)," Animals, vol. 13, no. 13, p. 2185, 2023. https://doi.org/10.3390/ani13132185 [32] K. Chen et al., "MMDetection: Open mmlab detection toolbox and benchmark," arXiv preprint arXiv:1906.07155, 2019. [33] K. Talsania et al., "Genome assembly and annotation of the Trichoplusia ni Tni-FNL insect cell line enabled by long-read technologies," Genes, vol. 10, no. 2, p. 79, 2019. Views and opinions expressed in this article are the views and opinions of the author(s), Current Research in Agricultural Sciences shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://doi.org/10.1016/s1055-7903(03)00069-1 https://doi.org/10.1093/nar/gkab1112 https://doi.org/10.1128/aem.53.10.2394-2396.1987 https://doi.org/10.1093/nar/22.22.4673 https://doi.org/10.1093/molbev/mst197 https://doi.org/10.1093/molbev/msn067 https://doi.org/10.1093/oxfordjournals.molbev.a040317 https://doi.org/10.1093/molbev/msr121 https://doi.org/10.1093/oxfordjournals.molbev.a026408 https://doi.org/10.1214/ss/1063994980 https://doi.org/10.1093/oxfordjournals.molbev.a040410 https://doi.org/10.21548/44-1-5945 https://doi.org/10.3390/ani13132185