id	sid	tid	token	lemma	pos
dentistry3000-164	1	1	differential	differential	ADJ
dentistry3000-164	1	2	expression	expression	NOUN
dentistry3000-164	1	3	of	of	ADP
dentistry3000-164	1	4	the	the	DET
dentistry3000-164	1	5	irf6	irf6	PROPN
dentistry3000-164	1	6	gene	gene	NOUN
dentistry3000-164	1	7	in	in	ADP
dentistry3000-164	1	8	the	the	DET
dentistry3000-164	1	9	signs	sign	NOUN
dentistry3000-164	1	10	of	of	ADP
dentistry3000-164	1	11	van	van	PROPN
dentistry3000-164	1	12	der	der	PROPN
dentistry3000-164	1	13	woude	woude	VERB
dentistry3000-164	1	14	syndrome	syndrome	NOUN
dentistry3000-164	1	15	:	:	PUNCT
dentistry3000-164	1	16	are	be	AUX
dentistry3000-164	1	17	distinct	distinct	ADJ
dentistry3000-164	1	18	genetic	genetic	ADJ
dentistry3000-164	1	19	modifiers	modifier	NOUN
dentistry3000-164	1	20	operating	operate	VERB
dentistry3000-164	1	21	?	?	PUNCT
dentistry3000-164	2	1	vol	vol	NOUN
dentistry3000-164	2	2	9	9	NUM
dentistry3000-164	2	3	no	no	DET
dentistry3000-164	2	4	1	1	NUM
dentistry3000-164	2	5	(	(	PUNCT
dentistry3000-164	2	6	2021	2021	NUM
dentistry3000-164	2	7	)	)	PUNCT
dentistry3000-164	2	8	doi	doi	NOUN
dentistry3000-164	2	9	10.5195	10.5195	NUM
dentistry3000-164	2	10	/	/	SYM
dentistry3000-164	2	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	2	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	2	13	differential	differential	ADJ
dentistry3000-164	2	14	expression	expression	NOUN
dentistry3000-164	2	15	of	of	ADP
dentistry3000-164	2	16	the	the	DET
dentistry3000-164	2	17	irf6	irf6	PROPN
dentistry3000-164	2	18	gene	gene	NOUN
dentistry3000-164	2	19	in	in	ADP
dentistry3000-164	2	20	the	the	DET
dentistry3000-164	2	21	signs	sign	NOUN
dentistry3000-164	2	22	of	of	ADP
dentistry3000-164	2	23	van	van	PROPN
dentistry3000-164	2	24	der	der	PROPN
dentistry3000-164	2	25	woude	woude	VERB
dentistry3000-164	2	26	syndrome	syndrome	NOUN
dentistry3000-164	2	27	:	:	PUNCT
dentistry3000-164	2	28	are	be	AUX
dentistry3000-164	2	29	distinct	distinct	ADJ
dentistry3000-164	2	30	genetic	genetic	ADJ
dentistry3000-164	2	31	modifiers	modifier	NOUN
dentistry3000-164	2	32	operating	operate	VERB
dentistry3000-164	2	33	?	?	PUNCT
dentistry3000-164	3	1	rosany	rosany	PROPN
dentistry3000-164	3	2	de	de	PROPN
dentistry3000-164	3	3	oliveira	oliveira	PROPN
dentistry3000-164	3	4	lisboa1,7,9	lisboa1,7,9	PROPN
dentistry3000-164	3	5	,	,	PUNCT
dentistry3000-164	3	6	cláudia	cláudia	PROPN
dentistry3000-164	3	7	maria	maria	PROPN
dentistry3000-164	3	8	da	da	PROPN
dentistry3000-164	3	9	rocha	rocha	PROPN
dentistry3000-164	3	10	martins5	martins5	PROPN
dentistry3000-164	3	11	,	,	PUNCT
dentistry3000-164	3	12	maria	maria	PROPN
dentistry3000-164	3	13	elisabete	elisabete	PROPN
dentistry3000-164	3	14	silva	silva	PROPN
dentistry3000-164	3	15	santos1,8	santos1,8	PROPN
dentistry3000-164	3	16	,	,	PUNCT
dentistry3000-164	3	17	danilo	danilo	PROPN
dentistry3000-164	3	18	leôncio	leôncio	PROPN
dentistry3000-164	3	19	aguiar	aguiar	PROPN
dentistry3000-164	3	20	pereira1,8	pereira1,8	PROPN
dentistry3000-164	3	21	,	,	PUNCT
dentistry3000-164	3	22	flávia	flávia	PROPN
dentistry3000-164	3	23	martinez	martinez	PROPN
dentistry3000-164	3	24	de	de	PROPN
dentistry3000-164	3	25	carvalho4	carvalho4	PROPN
dentistry3000-164	3	26	,	,	PUNCT
dentistry3000-164	3	27	ieda	ieda	NOUN
dentistry3000-164	3	28	maria	maria	PROPN
dentistry3000-164	3	29	orioli2,3	orioli2,3	PROPN
dentistry3000-164	3	30	,	,	PUNCT
dentistry3000-164	3	31	joão	joão	PROPN
dentistry3000-164	3	32	farias	farias	PROPN
dentistry3000-164	3	33	guerreiro6,8	guerreiro6,8	PROPN
dentistry3000-164	3	34	,	,	PUNCT
dentistry3000-164	3	35	alexandre	alexandre	PROPN
dentistry3000-164	3	36	rezende	rezende	PROPN
dentistry3000-164	3	37	vieira7	vieira7	PROPN
dentistry3000-164	3	38	,	,	PUNCT
dentistry3000-164	3	39	luiz	luiz	PROPN
dentistry3000-164	3	40	carlos	carlos	PROPN
dentistry3000-164	3	41	santana	santana	PROPN
dentistry3000-164	3	42	-	-	PUNCT
dentistry3000-164	3	43	da	da	NOUN
dentistry3000-164	3	44	-	-	PUNCT
dentistry3000-164	3	45	silva1,9,10	silva1,9,10	ADJ
dentistry3000-164	3	46	¹	¹	PROPN
dentistry3000-164	3	47	laboratory	laboratory	NOUN
dentistry3000-164	3	48	of	of	ADP
dentistry3000-164	3	49	inborn	inborn	ADJ
dentistry3000-164	3	50	errors	error	NOUN
dentistry3000-164	3	51	of	of	ADP
dentistry3000-164	3	52	metabolism	metabolism	NOUN
dentistry3000-164	3	53	,	,	PUNCT
dentistry3000-164	3	54	institute	institute	NOUN
dentistry3000-164	3	55	of	of	ADP
dentistry3000-164	3	56	biological	biological	ADJ
dentistry3000-164	3	57	sciences	sciences	PROPN
dentistry3000-164	3	58	,	,	PUNCT
dentistry3000-164	3	59	federal	federal	ADJ
dentistry3000-164	3	60	university	university	PROPN
dentistry3000-164	3	61	of	of	ADP
dentistry3000-164	3	62	pará	pará	PROPN
dentistry3000-164	3	63	,	,	PUNCT
dentistry3000-164	3	64	pará	pará	PROPN
dentistry3000-164	3	65	,	,	PUNCT
dentistry3000-164	3	66	brazil	brazil	PROPN
dentistry3000-164	3	67	.	.	PUNCT
dentistry3000-164	4	1	2	2	NUM
dentistry3000-164	4	2	department	department	NOUN
dentistry3000-164	4	3	of	of	ADP
dentistry3000-164	4	4	genetics	genetics	PROPN
dentistry3000-164	4	5	,	,	PUNCT
dentistry3000-164	4	6	institute	institute	NOUN
dentistry3000-164	4	7	of	of	ADP
dentistry3000-164	4	8	biology	biology	NOUN
dentistry3000-164	4	9	,	,	PUNCT
dentistry3000-164	4	10	federal	federal	ADJ
dentistry3000-164	4	11	university	university	PROPN
dentistry3000-164	4	12	of	of	ADP
dentistry3000-164	4	13	rio	rio	PROPN
dentistry3000-164	4	14	de	de	PROPN
dentistry3000-164	4	15	janeiro	janeiro	PROPN
dentistry3000-164	4	16	,	,	PUNCT
dentistry3000-164	4	17	rio	rio	PROPN
dentistry3000-164	4	18	de	de	PROPN
dentistry3000-164	4	19	janeiro	janeiro	PROPN
dentistry3000-164	4	20	,	,	PUNCT
dentistry3000-164	4	21	brazil	brazil	PROPN
dentistry3000-164	4	22	.	.	PUNCT
dentistry3000-164	5	1	3	3	NUM
dentistry3000-164	5	2	eclamc	eclamc	NOUN
dentistry3000-164	5	3	(	(	PUNCT
dentistry3000-164	5	4	latin‐american	latin‐american	PROPN
dentistry3000-164	5	5	collaborative	collaborative	ADJ
dentistry3000-164	5	6	study	study	NOUN
dentistry3000-164	5	7	of	of	ADP
dentistry3000-164	5	8	congenital	congenital	ADJ
dentistry3000-164	5	9	malformations	malformation	NOUN
dentistry3000-164	5	10	)	)	PUNCT
dentistry3000-164	5	11	at	at	ADP
dentistry3000-164	5	12	inagemp	inagemp	NOUN
dentistry3000-164	5	13	(	(	PUNCT
dentistry3000-164	5	14	national	national	PROPN
dentistry3000-164	5	15	institute	institute	PROPN
dentistry3000-164	5	16	of	of	ADP
dentistry3000-164	5	17	population	population	PROPN
dentistry3000-164	5	18	medical	medical	ADJ
dentistry3000-164	5	19	genetics	genetic	NOUN
dentistry3000-164	5	20	)	)	PUNCT
dentistry3000-164	5	21	,	,	PUNCT
dentistry3000-164	5	22	rio	rio	PROPN
dentistry3000-164	5	23	de	de	PROPN
dentistry3000-164	5	24	janeiro	janeiro	PROPN
dentistry3000-164	5	25	,	,	PUNCT
dentistry3000-164	5	26	brazil	brazil	PROPN
dentistry3000-164	5	27	.	.	PUNCT
dentistry3000-164	6	1	4	4	NUM
dentistry3000-164	6	2	eclamc	eclamc	NOUN
dentistry3000-164	6	3	at	at	ADP
dentistry3000-164	6	4	lemc	lemc	NOUN
dentistry3000-164	6	5	(	(	PUNCT
dentistry3000-164	6	6	laboratory	laboratory	NOUN
dentistry3000-164	6	7	of	of	ADP
dentistry3000-164	6	8	congenital	congenital	ADJ
dentistry3000-164	6	9	malformation	malformation	NOUN
dentistry3000-164	6	10	epidemiology	epidemiology	NOUN
dentistry3000-164	6	11	)	)	PUNCT
dentistry3000-164	6	12	,	,	PUNCT
dentistry3000-164	6	13	oswaldo	oswaldo	PROPN
dentistry3000-164	6	14	cruz	cruz	PROPN
dentistry3000-164	6	15	institute	institute	PROPN
dentistry3000-164	6	16	,	,	PUNCT
dentistry3000-164	6	17	fiocruz	fiocruz	PROPN
dentistry3000-164	6	18	,	,	PUNCT
dentistry3000-164	6	19	rio	rio	PROPN
dentistry3000-164	6	20	de	de	PROPN
dentistry3000-164	6	21	janeiro	janeiro	PROPN
dentistry3000-164	6	22	,	,	PUNCT
dentistry3000-164	6	23	brazil	brazil	PROPN
dentistry3000-164	6	24	.	.	PUNCT
dentistry3000-164	7	1	5	5	NUM
dentistry3000-164	7	2	department	department	NOUN
dentistry3000-164	7	3	of	of	ADP
dentistry3000-164	7	4	speech	speech	NOUN
dentistry3000-164	7	5	therapy	therapy	NOUN
dentistry3000-164	7	6	,	,	PUNCT
dentistry3000-164	7	7	ophir	ophir	PROPN
dentistry3000-164	7	8	loyola	loyola	PROPN
dentistry3000-164	7	9	hospital	hospital	NOUN
dentistry3000-164	7	10	,	,	PUNCT
dentistry3000-164	7	11	pará	pará	PROPN
dentistry3000-164	7	12	,	,	PUNCT
dentistry3000-164	7	13	brazil	brazil	PROPN
dentistry3000-164	7	14	.	.	PUNCT
dentistry3000-164	8	1	6	6	NUM
dentistry3000-164	8	2	laboratory	laboratory	NOUN
dentistry3000-164	8	3	of	of	ADP
dentistry3000-164	8	4	human	human	ADJ
dentistry3000-164	8	5	and	and	CCONJ
dentistry3000-164	8	6	medical	medical	ADJ
dentistry3000-164	8	7	genetics	genetic	NOUN
dentistry3000-164	8	8	,	,	PUNCT
dentistry3000-164	8	9	federal	federal	ADJ
dentistry3000-164	8	10	university	university	PROPN
dentistry3000-164	8	11	of	of	ADP
dentistry3000-164	8	12	pará	pará	PROPN
dentistry3000-164	8	13	,	,	PUNCT
dentistry3000-164	8	14	pará	pará	PROPN
dentistry3000-164	8	15	,	,	PUNCT
dentistry3000-164	8	16	brazil	brazil	PROPN
dentistry3000-164	8	17	.	.	PUNCT
dentistry3000-164	9	1	7	7	NUM
dentistry3000-164	9	2	departments	department	NOUN
dentistry3000-164	9	3	of	of	ADP
dentistry3000-164	9	4	oral	oral	ADJ
dentistry3000-164	9	5	biology	biology	NOUN
dentistry3000-164	9	6	and	and	CCONJ
dentistry3000-164	9	7	pediatric	pediatric	ADJ
dentistry3000-164	9	8	dentistry	dentistry	NOUN
dentistry3000-164	9	9	and	and	CCONJ
dentistry3000-164	9	10	center	center	NOUN
dentistry3000-164	9	11	for	for	ADP
dentistry3000-164	9	12	craniofacial	craniofacial	ADJ
dentistry3000-164	9	13	and	and	CCONJ
dentistry3000-164	9	14	dental	dental	ADJ
dentistry3000-164	9	15	genetics	genetic	NOUN
dentistry3000-164	9	16	,	,	PUNCT
dentistry3000-164	9	17	school	school	NOUN
dentistry3000-164	9	18	of	of	ADP
dentistry3000-164	9	19	dental	dental	ADJ
dentistry3000-164	9	20	medicine	medicine	NOUN
dentistry3000-164	9	21	,	,	PUNCT
dentistry3000-164	9	22	university	university	PROPN
dentistry3000-164	9	23	of	of	ADP
dentistry3000-164	9	24	pittsburgh	pittsburgh	PROPN
dentistry3000-164	9	25	,	,	PUNCT
dentistry3000-164	9	26	pittsburgh	pittsburgh	PROPN
dentistry3000-164	9	27	,	,	PUNCT
dentistry3000-164	9	28	pennsylvania	pennsylvania	PROPN
dentistry3000-164	9	29	,	,	PUNCT
dentistry3000-164	9	30	usa	usa	PROPN
dentistry3000-164	9	31	.	.	PROPN
dentistry3000-164	9	32	8	8	NUM
dentistry3000-164	9	33	genetics	genetic	NOUN
dentistry3000-164	9	34	and	and	CCONJ
dentistry3000-164	9	35	molecular	molecular	ADJ
dentistry3000-164	9	36	biology	biology	NOUN
dentistry3000-164	9	37	postgraduate	postgraduate	NOUN
dentistry3000-164	9	38	studies	study	NOUN
dentistry3000-164	9	39	program	program	NOUN
dentistry3000-164	9	40	,	,	PUNCT
dentistry3000-164	9	41	federal	federal	ADJ
dentistry3000-164	9	42	university	university	PROPN
dentistry3000-164	9	43	of	of	ADP
dentistry3000-164	9	44	pará	pará	PROPN
dentistry3000-164	9	45	,	,	PUNCT
dentistry3000-164	9	46	pará	pará	PROPN
dentistry3000-164	9	47	,	,	PUNCT
dentistry3000-164	9	48	brazil	brazil	PROPN
dentistry3000-164	9	49	.	.	PUNCT
dentistry3000-164	9	50	9	9	NUM
dentistry3000-164	9	51	oncology	oncology	NOUN
dentistry3000-164	9	52	and	and	CCONJ
dentistry3000-164	9	53	medical	medical	ADJ
dentistry3000-164	9	54	sciences	sciences	PROPN
dentistry3000-164	9	55	graduate	graduate	PROPN
dentistry3000-164	9	56	program	program	NOUN
dentistry3000-164	9	57	,	,	PUNCT
dentistry3000-164	9	58	federal	federal	ADJ
dentistry3000-164	9	59	university	university	PROPN
dentistry3000-164	9	60	of	of	ADP
dentistry3000-164	9	61	pará	pará	PROPN
dentistry3000-164	9	62	,	,	PUNCT
dentistry3000-164	9	63	pará	pará	NOUN
dentistry3000-164	9	64	,	,	PUNCT
dentistry3000-164	9	65	brazil	brazil	PROPN
dentistry3000-164	9	66	.	.	PUNCT
dentistry3000-164	10	1	10national	10national	PROPN
dentistry3000-164	10	2	institute	institute	PROPN
dentistry3000-164	10	3	on	on	ADP
dentistry3000-164	10	4	population	population	NOUN
dentistry3000-164	10	5	medical	medical	ADJ
dentistry3000-164	10	6	genetics	genetics	PROPN
dentistry3000-164	10	7	,	,	PUNCT
dentistry3000-164	10	8	institute	institute	NOUN
dentistry3000-164	10	9	of	of	ADP
dentistry3000-164	10	10	biological	biological	ADJ
dentistry3000-164	10	11	sciences	sciences	PROPN
dentistry3000-164	10	12	,	,	PUNCT
dentistry3000-164	10	13	federal	federal	ADJ
dentistry3000-164	10	14	university	university	PROPN
dentistry3000-164	10	15	of	of	ADP
dentistry3000-164	10	16	pará	pará	PROPN
dentistry3000-164	10	17	,	,	PUNCT
dentistry3000-164	10	18	pará	pará	PROPN
dentistry3000-164	10	19	,	,	PUNCT
dentistry3000-164	10	20	brazil	brazil	PROPN
dentistry3000-164	10	21	.	.	PUNCT
dentistry3000-164	11	1	abstract	abstract	ADJ
dentistry3000-164	11	2	objective	objective	NOUN
dentistry3000-164	11	3	:	:	PUNCT
dentistry3000-164	11	4	the	the	DET
dentistry3000-164	11	5	purpose	purpose	NOUN
dentistry3000-164	11	6	of	of	ADP
dentistry3000-164	11	7	this	this	DET
dentistry3000-164	11	8	study	study	NOUN
dentistry3000-164	11	9	was	be	AUX
dentistry3000-164	11	10	to	to	PART
dentistry3000-164	11	11	report	report	VERB
dentistry3000-164	11	12	a	a	DET
dentistry3000-164	11	13	new	new	ADJ
dentistry3000-164	11	14	variant	variant	NOUN
dentistry3000-164	11	15	in	in	ADP
dentistry3000-164	11	16	the	the	DET
dentistry3000-164	11	17	interferon	interferon	ADJ
dentistry3000-164	11	18	regulatory	regulatory	ADJ
dentistry3000-164	11	19	factor	factor	NOUN
dentistry3000-164	11	20	6	6	NUM
dentistry3000-164	11	21	gene	gene	NOUN
dentistry3000-164	11	22	(	(	PUNCT
dentistry3000-164	11	23	irf6	irf6	PROPN
dentistry3000-164	11	24	)	)	PUNCT
dentistry3000-164	11	25	and	and	CCONJ
dentistry3000-164	11	26	to	to	PART
dentistry3000-164	11	27	determine	determine	VERB
dentistry3000-164	11	28	phenotype	phenotype	NOUN
dentistry3000-164	11	29	-	-	PUNCT
dentistry3000-164	11	30	genotype	genotype	NOUN
dentistry3000-164	11	31	correlations	correlation	NOUN
dentistry3000-164	11	32	in	in	ADP
dentistry3000-164	11	33	a	a	DET
dentistry3000-164	11	34	family	family	NOUN
dentistry3000-164	11	35	segregating	segregate	VERB
dentistry3000-164	11	36	van	van	PROPN
dentistry3000-164	11	37	der	der	PROPN
dentistry3000-164	11	38	woude	woude	VERB
dentistry3000-164	11	39	syndrome	syndrome	NOUN
dentistry3000-164	11	40	.	.	PUNCT
dentistry3000-164	12	1	methods	method	NOUN
dentistry3000-164	12	2	:	:	PUNCT
dentistry3000-164	12	3	a	a	DET
dentistry3000-164	12	4	five	five	NUM
dentistry3000-164	12	5	-	-	PUNCT
dentistry3000-164	12	6	generation	generation	NOUN
dentistry3000-164	12	7	family	family	NOUN
dentistry3000-164	12	8	of	of	ADP
dentistry3000-164	12	9	80	80	NUM
dentistry3000-164	12	10	individuals	individual	NOUN
dentistry3000-164	12	11	segregating	segregate	VERB
dentistry3000-164	12	12	vws	vws	PROPN
dentistry3000-164	12	13	was	be	AUX
dentistry3000-164	12	14	investigated	investigate	VERB
dentistry3000-164	12	15	using	use	VERB
dentistry3000-164	12	16	a	a	DET
dentistry3000-164	12	17	tabulated	tabulate	VERB
dentistry3000-164	12	18	pedigree	pedigree	NOUN
dentistry3000-164	12	19	but	but	CCONJ
dentistry3000-164	12	20	considering	consider	VERB
dentistry3000-164	12	21	that	that	SCONJ
dentistry3000-164	12	22	three	three	NUM
dentistry3000-164	12	23	individuals	individual	NOUN
dentistry3000-164	12	24	registered	register	VERB
dentistry3000-164	12	25	in	in	ADP
dentistry3000-164	12	26	the	the	DET
dentistry3000-164	12	27	pedigree	pedigree	NOUN
dentistry3000-164	12	28	died	die	VERB
dentistry3000-164	12	29	shortly	shortly	ADV
dentistry3000-164	12	30	after	after	ADP
dentistry3000-164	12	31	birth	birth	NOUN
dentistry3000-164	12	32	,	,	PUNCT
dentistry3000-164	12	33	the	the	DET
dentistry3000-164	12	34	final	final	ADJ
dentistry3000-164	12	35	sample	sample	NOUN
dentistry3000-164	12	36	size	size	NOUN
dentistry3000-164	12	37	was	be	AUX
dentistry3000-164	12	38	77	77	NUM
dentistry3000-164	12	39	individuals	individual	NOUN
dentistry3000-164	12	40	.	.	PUNCT
dentistry3000-164	13	1	five	five	NUM
dentistry3000-164	13	2	individuals	individual	NOUN
dentistry3000-164	13	3	had	have	VERB
dentistry3000-164	13	4	a	a	DET
dentistry3000-164	13	5	complete	complete	ADJ
dentistry3000-164	13	6	dental	dental	ADJ
dentistry3000-164	13	7	clinical	clinical	ADJ
dentistry3000-164	13	8	examination	examination	NOUN
dentistry3000-164	13	9	and	and	CCONJ
dentistry3000-164	13	10	molecular	molecular	ADJ
dentistry3000-164	13	11	analysis	analysis	NOUN
dentistry3000-164	13	12	performed	perform	VERB
dentistry3000-164	13	13	using	use	VERB
dentistry3000-164	13	14	direct	direct	ADJ
dentistry3000-164	13	15	sequencing	sequencing	NOUN
dentistry3000-164	13	16	of	of	ADP
dentistry3000-164	13	17	the	the	DET
dentistry3000-164	13	18	exon	exon	NOUN
dentistry3000-164	13	19	4	4	NUM
dentistry3000-164	13	20	and	and	CCONJ
dentistry3000-164	13	21	an	an	DET
dentistry3000-164	13	22	adjacent	adjacent	ADJ
dentistry3000-164	13	23	region	region	NOUN
dentistry3000-164	13	24	with	with	ADP
dentistry3000-164	13	25	23	23	NUM
dentistry3000-164	13	26	base	base	NOUN
dentistry3000-164	13	27	pairs	pair	NOUN
dentistry3000-164	13	28	of	of	ADP
dentistry3000-164	13	29	the	the	DET
dentistry3000-164	13	30	irf6	irf6	PROPN
dentistry3000-164	13	31	gene	gene	NOUN
dentistry3000-164	13	32	.	.	PUNCT
dentistry3000-164	14	1	results	result	NOUN
dentistry3000-164	14	2	:	:	PUNCT
dentistry3000-164	14	3	features	feature	NOUN
dentistry3000-164	14	4	of	of	ADP
dentistry3000-164	14	5	vws	vws	PROPN
dentistry3000-164	14	6	reported	report	VERB
dentistry3000-164	14	7	in	in	ADP
dentistry3000-164	14	8	family	family	NOUN
dentistry3000-164	14	9	history	history	NOUN
dentistry3000-164	14	10	were	be	AUX
dentistry3000-164	14	11	present	present	ADJ
dentistry3000-164	14	12	in	in	ADP
dentistry3000-164	14	13	36.4	36.4	NUM
dentistry3000-164	14	14	%	%	NOUN
dentistry3000-164	14	15	(	(	PUNCT
dentistry3000-164	14	16	28/77	28/77	NUM
dentistry3000-164	14	17	)	)	PUNCT
dentistry3000-164	14	18	of	of	ADP
dentistry3000-164	14	19	all	all	DET
dentistry3000-164	14	20	family	family	NOUN
dentistry3000-164	14	21	members	member	NOUN
dentistry3000-164	14	22	;	;	PUNCT
dentistry3000-164	14	23	of	of	ADP
dentistry3000-164	14	24	these	these	DET
dentistry3000-164	14	25	57	57	NUM
dentistry3000-164	14	26	%	%	NOUN
dentistry3000-164	14	27	(	(	PUNCT
dentistry3000-164	14	28	16/28	16/28	NUM
dentistry3000-164	14	29	)	)	PUNCT
dentistry3000-164	14	30	had	have	VERB
dentistry3000-164	14	31	pits	pit	NOUN
dentistry3000-164	14	32	in	in	ADP
dentistry3000-164	14	33	the	the	DET
dentistry3000-164	14	34	lower	low	ADJ
dentistry3000-164	14	35	lip	lip	NOUN
dentistry3000-164	14	36	,	,	PUNCT
dentistry3000-164	14	37	36	36	NUM
dentistry3000-164	14	38	%	%	NOUN
dentistry3000-164	14	39	(	(	PUNCT
dentistry3000-164	14	40	10/28	10/28	NUM
dentistry3000-164	14	41	)	)	PUNCT
dentistry3000-164	14	42	had	have	VERB
dentistry3000-164	14	43	both	both	DET
dentistry3000-164	14	44	pits	pit	NOUN
dentistry3000-164	14	45	and	and	CCONJ
dentistry3000-164	14	46	orofacial	orofacial	ADJ
dentistry3000-164	14	47	clefts	cleft	NOUN
dentistry3000-164	14	48	and	and	CCONJ
dentistry3000-164	14	49	7	7	NUM
dentistry3000-164	14	50	%	%	NOUN
dentistry3000-164	14	51	(	(	PUNCT
dentistry3000-164	14	52	2/28	2/28	NUM
dentistry3000-164	14	53	)	)	PUNCT
dentistry3000-164	14	54	had	have	VERB
dentistry3000-164	14	55	only	only	ADJ
dentistry3000-164	14	56	orofacial	orofacial	ADJ
dentistry3000-164	14	57	clefts	cleft	NOUN
dentistry3000-164	14	58	.	.	PUNCT
dentistry3000-164	15	1	developmental	developmental	ADJ
dentistry3000-164	15	2	dental	dental	ADJ
dentistry3000-164	15	3	anomalies	anomaly	NOUN
dentistry3000-164	15	4	were	be	AUX
dentistry3000-164	15	5	observed	observe	VERB
dentistry3000-164	15	6	in	in	ADP
dentistry3000-164	15	7	three	three	NUM
dentistry3000-164	15	8	individuals	individual	NOUN
dentistry3000-164	15	9	.	.	PUNCT
dentistry3000-164	16	1	the	the	DET
dentistry3000-164	16	2	sequence	sequence	NOUN
dentistry3000-164	16	3	analysis	analysis	NOUN
dentistry3000-164	16	4	of	of	ADP
dentistry3000-164	16	5	exon	exon	NOUN
dentistry3000-164	16	6	4	4	NUM
dentistry3000-164	16	7	of	of	ADP
dentistry3000-164	16	8	the	the	DET
dentistry3000-164	16	9	irf6	irf6	PROPN
dentistry3000-164	16	10	gene	gene	NOUN
dentistry3000-164	16	11	carried	carry	VERB
dentistry3000-164	16	12	out	out	ADP
dentistry3000-164	16	13	for	for	ADP
dentistry3000-164	16	14	4	4	NUM
dentistry3000-164	16	15	family	family	NOUN
dentistry3000-164	16	16	members	member	NOUN
dentistry3000-164	16	17	revealed	reveal	VERB
dentistry3000-164	16	18	the	the	DET
dentistry3000-164	16	19	presence	presence	NOUN
dentistry3000-164	16	20	of	of	ADP
dentistry3000-164	16	21	the	the	DET
dentistry3000-164	16	22	snp	snp	ADJ
dentistry3000-164	16	23	rs7552506	rs7552506	NOUN
dentistry3000-164	16	24	(	(	PUNCT
dentistry3000-164	16	25	c.175	c.175	NOUN
dentistry3000-164	16	26	-	-	PUNCT
dentistry3000-164	16	27	5c	5c	NOUN
dentistry3000-164	16	28	>	>	SYM
dentistry3000-164	16	29	g	g	NOUN
dentistry3000-164	16	30	)	)	PUNCT
dentistry3000-164	16	31	located	locate	VERB
dentistry3000-164	16	32	in	in	ADP
dentistry3000-164	16	33	five	five	NUM
dentistry3000-164	16	34	base	base	NOUN
dentistry3000-164	16	35	pairs	pair	NOUN
dentistry3000-164	16	36	before	before	ADP
dentistry3000-164	16	37	the	the	DET
dentistry3000-164	16	38	start	start	NOUN
dentistry3000-164	16	39	of	of	ADP
dentistry3000-164	16	40	exon	exon	NOUN
dentistry3000-164	16	41	.	.	PUNCT
dentistry3000-164	17	1	the	the	DET
dentistry3000-164	17	2	analysis	analysis	NOUN
dentistry3000-164	17	3	of	of	ADP
dentistry3000-164	17	4	exon	exon	NOUN
dentistry3000-164	17	5	4	4	NUM
dentistry3000-164	17	6	of	of	ADP
dentistry3000-164	17	7	the	the	DET
dentistry3000-164	17	8	irf6	irf6	PROPN
dentistry3000-164	17	9	gene	gene	NOUN
dentistry3000-164	17	10	also	also	ADV
dentistry3000-164	17	11	revealed	reveal	VERB
dentistry3000-164	17	12	a	a	DET
dentistry3000-164	17	13	new	new	ADJ
dentistry3000-164	17	14	variant	variant	NOUN
dentistry3000-164	17	15	c.269g	c.269g	PROPN
dentistry3000-164	17	16	>	>	X
dentistry3000-164	17	17	c	c	X
dentistry3000-164	17	18	(	(	PUNCT
dentistry3000-164	17	19	p.ser90thr	p.ser90thr	PROPN
dentistry3000-164	17	20	)	)	PUNCT
dentistry3000-164	17	21	which	which	PRON
dentistry3000-164	17	22	causes	cause	VERB
dentistry3000-164	17	23	exchange	exchange	NOUN
dentistry3000-164	17	24	of	of	ADP
dentistry3000-164	17	25	the	the	DET
dentistry3000-164	17	26	serine	serine	NOUN
dentistry3000-164	17	27	amino	amino	NOUN
dentistry3000-164	17	28	acid	acid	NOUN
dentistry3000-164	17	29	residue	residue	NOUN
dentistry3000-164	17	30	for	for	ADP
dentistry3000-164	17	31	the	the	DET
dentistry3000-164	17	32	threonine	threonine	ADJ
dentistry3000-164	17	33	residue	residue	NOUN
dentistry3000-164	17	34	.	.	PUNCT
dentistry3000-164	18	1	conclusion	conclusion	NOUN
dentistry3000-164	18	2	:	:	PUNCT
dentistry3000-164	18	3	the	the	DET
dentistry3000-164	18	4	c.269g	c.269g	PROPN
dentistry3000-164	18	5	>	>	X
dentistry3000-164	18	6	c(p.ser90thr	c(p.ser90thr	PROPN
dentistry3000-164	18	7	)	)	PUNCT
dentistry3000-164	18	8	can	can	AUX
dentistry3000-164	18	9	interfere	interfere	VERB
dentistry3000-164	18	10	with	with	ADP
dentistry3000-164	18	11	multimeric	multimeric	ADJ
dentistry3000-164	18	12	interactions	interaction	NOUN
dentistry3000-164	18	13	and	and	CCONJ
dentistry3000-164	18	14	with	with	ADP
dentistry3000-164	18	15	protein	protein	NOUN
dentistry3000-164	18	16	conformation	conformation	NOUN
dentistry3000-164	18	17	that	that	PRON
dentistry3000-164	18	18	will	will	AUX
dentistry3000-164	18	19	be	be	AUX
dentistry3000-164	18	20	slightly	slightly	ADV
dentistry3000-164	18	21	destabilized	destabilize	VERB
dentistry3000-164	18	22	,	,	PUNCT
dentistry3000-164	18	23	because	because	SCONJ
dentistry3000-164	18	24	the	the	DET
dentistry3000-164	18	25	mutant	mutant	ADJ
dentistry3000-164	18	26	residue	residue	NOUN
dentistry3000-164	18	27	is	be	AUX
dentistry3000-164	18	28	bigger	big	ADJ
dentistry3000-164	18	29	than	than	ADP
dentistry3000-164	18	30	the	the	DET
dentistry3000-164	18	31	wild	wild	ADJ
dentistry3000-164	18	32	-	-	PUNCT
dentistry3000-164	18	33	type	type	NOUN
dentistry3000-164	18	34	residue	residue	NOUN
dentistry3000-164	18	35	.	.	PUNCT
dentistry3000-164	19	1	the	the	DET
dentistry3000-164	19	2	phenotypic	phenotypic	ADJ
dentistry3000-164	19	3	variations	variation	NOUN
dentistry3000-164	19	4	in	in	ADP
dentistry3000-164	19	5	the	the	DET
dentistry3000-164	19	6	cases	case	NOUN
dentistry3000-164	19	7	studied	study	VERB
dentistry3000-164	19	8	,	,	PUNCT
dentistry3000-164	19	9	despite	despite	SCONJ
dentistry3000-164	19	10	carrying	carry	VERB
dentistry3000-164	19	11	the	the	DET
dentistry3000-164	19	12	same	same	ADJ
dentistry3000-164	19	13	genetic	genetic	ADJ
dentistry3000-164	19	14	mutation	mutation	NOUN
dentistry3000-164	19	15	,	,	PUNCT
dentistry3000-164	19	16	suggest	suggest	VERB
dentistry3000-164	19	17	that	that	SCONJ
dentistry3000-164	19	18	distinct	distinct	ADJ
dentistry3000-164	19	19	genetic	genetic	ADJ
dentistry3000-164	19	20	modifiers	modifier	NOUN
dentistry3000-164	19	21	operate	operate	VERB
dentistry3000-164	19	22	on	on	ADP
dentistry3000-164	19	23	the	the	DET
dentistry3000-164	19	24	formation	formation	NOUN
dentistry3000-164	19	25	of	of	ADP
dentistry3000-164	19	26	clefts	cleft	NOUN
dentistry3000-164	19	27	and	and	CCONJ
dentistry3000-164	19	28	dental	dental	ADJ
dentistry3000-164	19	29	development	development	NOUN
dentistry3000-164	19	30	.	.	PUNCT
dentistry3000-164	20	1	keywords	keyword	NOUN
dentistry3000-164	20	2	:	:	PUNCT
dentistry3000-164	20	3	van	van	PROPN
dentistry3000-164	20	4	der	der	NOUN
dentistry3000-164	20	5	woude	woude	VERB
dentistry3000-164	20	6	syndrome	syndrome	NOUN
dentistry3000-164	20	7	;	;	PUNCT
dentistry3000-164	20	8	orofacial	orofacial	ADJ
dentistry3000-164	20	9	clefts	cleft	NOUN
dentistry3000-164	20	10	;	;	PUNCT
dentistry3000-164	20	11	irf6	irf6	ADJ
dentistry3000-164	20	12	gene	gene	NOUN
dentistry3000-164	20	13	citation	citation	NOUN
dentistry3000-164	20	14	:	:	PUNCT
dentistry3000-164	21	1	lisboa	lisboa	PROPN
dentistry3000-164	21	2	ro	ro	PROPN
dentistry3000-164	21	3	,	,	PUNCT
dentistry3000-164	21	4	et	et	PROPN
dentistry3000-164	21	5	al	al	PROPN
dentistry3000-164	21	6	.	.	PROPN
dentistry3000-164	21	7	(	(	PUNCT
dentistry3000-164	21	8	2021	2021	NUM
dentistry3000-164	21	9	)	)	PUNCT
dentistry3000-164	21	10	differential	differential	NOUN
dentistry3000-164	21	11	expression	expression	NOUN
dentistry3000-164	21	12	of	of	ADP
dentistry3000-164	21	13	the	the	DET
dentistry3000-164	21	14	irf6	irf6	PROPN
dentistry3000-164	21	15	gene	gene	NOUN
dentistry3000-164	21	16	in	in	ADP
dentistry3000-164	21	17	the	the	DET
dentistry3000-164	21	18	signs	sign	NOUN
dentistry3000-164	21	19	of	of	ADP
dentistry3000-164	21	20	van	van	PROPN
dentistry3000-164	21	21	der	der	PROPN
dentistry3000-164	21	22	woude	woude	VERB
dentistry3000-164	21	23	syndrome	syndrome	NOUN
dentistry3000-164	21	24	:	:	PUNCT
dentistry3000-164	21	25	are	be	AUX
dentistry3000-164	21	26	distinct	distinct	ADJ
dentistry3000-164	21	27	genetic	genetic	ADJ
dentistry3000-164	21	28	modifiers	modifier	NOUN
dentistry3000-164	21	29	operating	operate	VERB
dentistry3000-164	21	30	?	?	PUNCT
dentistry3000-164	22	1	dentistry	dentistry	NOUN
dentistry3000-164	22	2	3000	3000	NUM
dentistry3000-164	22	3	.	.	PUNCT
dentistry3000-164	23	1	1	1	NUM
dentistry3000-164	23	2	:	:	PUNCT
dentistry3000-164	23	3	a001	a001	PROPN
dentistry3000-164	23	4	doi:10.5195	doi:10.5195	NOUN
dentistry3000-164	23	5	/	/	SYM
dentistry3000-164	23	6	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	23	7	received	receive	VERB
dentistry3000-164	23	8	:	:	PUNCT
dentistry3000-164	23	9	march	march	PROPN
dentistry3000-164	23	10	30	30	NUM
dentistry3000-164	23	11	,	,	PUNCT
dentistry3000-164	23	12	2021	2021	NUM
dentistry3000-164	23	13	accepted	accept	VERB
dentistry3000-164	23	14	:	:	PUNCT
dentistry3000-164	23	15	august	august	PROPN
dentistry3000-164	23	16	5	5	NUM
dentistry3000-164	23	17	,	,	PUNCT
dentistry3000-164	23	18	2021	2021	NUM
dentistry3000-164	23	19	published	publish	VERB
dentistry3000-164	23	20	:	:	PUNCT
dentistry3000-164	23	21	november	november	PROPN
dentistry3000-164	23	22	4	4	NUM
dentistry3000-164	23	23	,	,	PUNCT
dentistry3000-164	23	24	2021	2021	NUM
dentistry3000-164	23	25	copyright	copyright	NOUN
dentistry3000-164	23	26	:	:	PUNCT
dentistry3000-164	24	1	©	©	PROPN
dentistry3000-164	24	2	2021	2021	NUM
dentistry3000-164	24	3	lisboa	lisboa	PROPN
dentistry3000-164	24	4	ro	ro	PROPN
dentistry3000-164	24	5	,	,	PUNCT
dentistry3000-164	24	6	et	et	PROPN
dentistry3000-164	24	7	al	al	PROPN
dentistry3000-164	24	8	.	.	PUNCT
dentistry3000-164	25	1	this	this	PRON
dentistry3000-164	25	2	is	be	AUX
dentistry3000-164	25	3	an	an	DET
dentistry3000-164	25	4	open	open	ADJ
dentistry3000-164	25	5	access	access	NOUN
dentistry3000-164	25	6	article	article	NOUN
dentistry3000-164	25	7	licensed	license	VERB
dentistry3000-164	25	8	under	under	ADP
dentistry3000-164	25	9	a	a	DET
dentistry3000-164	25	10	creative	creative	ADJ
dentistry3000-164	25	11	commons	common	NOUN
dentistry3000-164	25	12	attribution	attribution	NOUN
dentistry3000-164	25	13	work	work	VERB
dentistry3000-164	25	14	4.0	4.0	NUM
dentistry3000-164	25	15	united	united	ADJ
dentistry3000-164	25	16	states	states	PROPN
dentistry3000-164	25	17	license	license	NOUN
dentistry3000-164	25	18	.	.	PUNCT
dentistry3000-164	26	1	email	email	NOUN
dentistry3000-164	26	2	:	:	PUNCT
dentistry3000-164	26	3	lcsantana-pa@hotmail.com	lcsantana-pa@hotmail.com	PROPN
dentistry3000-164	26	4	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	26	5	differential	differential	ADJ
dentistry3000-164	26	6	expression	expression	NOUN
dentistry3000-164	26	7	of	of	ADP
dentistry3000-164	26	8	the	the	DET
dentistry3000-164	26	9	irf6	irf6	PROPN
dentistry3000-164	26	10	gene	gene	NOUN
dentistry3000-164	26	11	in	in	ADP
dentistry3000-164	26	12	the	the	DET
dentistry3000-164	26	13	signs	sign	NOUN
dentistry3000-164	26	14	of	of	ADP
dentistry3000-164	26	15	van	van	PROPN
dentistry3000-164	26	16	der	der	PROPN
dentistry3000-164	26	17	woude	woude	VERB
dentistry3000-164	26	18	syndrome	syndrome	NOUN
dentistry3000-164	26	19	:	:	PUNCT
dentistry3000-164	26	20	are	be	AUX
dentistry3000-164	26	21	distinct	distinct	ADJ
dentistry3000-164	26	22	genetic	genetic	ADJ
dentistry3000-164	26	23	modifiers	modifier	NOUN
dentistry3000-164	26	24	operating	operate	VERB
dentistry3000-164	26	25	?	?	PUNCT
dentistry3000-164	27	1	vol	vol	NOUN
dentistry3000-164	27	2	9	9	NUM
dentistry3000-164	27	3	no	no	DET
dentistry3000-164	27	4	1	1	NUM
dentistry3000-164	27	5	(	(	PUNCT
dentistry3000-164	27	6	2021	2021	NUM
dentistry3000-164	27	7	)	)	PUNCT
dentistry3000-164	27	8	doi	doi	NOUN
dentistry3000-164	27	9	10.5195	10.5195	NUM
dentistry3000-164	27	10	/	/	SYM
dentistry3000-164	27	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	27	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	27	13	introduction	introduction	NOUN
dentistry3000-164	27	14	orofacial	orofacial	ADJ
dentistry3000-164	27	15	clefts	cleft	NOUN
dentistry3000-164	27	16	may	may	AUX
dentistry3000-164	27	17	occur	occur	VERB
dentistry3000-164	27	18	in	in	ADP
dentistry3000-164	27	19	association	association	NOUN
dentistry3000-164	27	20	with	with	ADP
dentistry3000-164	27	21	other	other	ADJ
dentistry3000-164	27	22	birth	birth	NOUN
dentistry3000-164	27	23	defects	defect	NOUN
dentistry3000-164	27	24	or	or	CCONJ
dentistry3000-164	27	25	be	be	AUX
dentistry3000-164	27	26	isolated	isolate	VERB
dentistry3000-164	27	27	.	.	PUNCT
dentistry3000-164	28	1	the	the	DET
dentistry3000-164	28	2	van	van	PROPN
dentistry3000-164	28	3	der	der	PROPN
dentistry3000-164	28	4	woude	woude	VERB
dentistry3000-164	28	5	syndrome	syndrome	NOUN
dentistry3000-164	28	6	(	(	PUNCT
dentistry3000-164	28	7	vws	vws	PROPN
dentistry3000-164	28	8	)	)	PUNCT
dentistry3000-164	28	9	(	(	PUNCT
dentistry3000-164	28	10	online	online	ADJ
dentistry3000-164	28	11	mendelian	mendelian	ADJ
dentistry3000-164	28	12	inheritance	inheritance	NOUN
dentistry3000-164	28	13	in	in	ADP
dentistry3000-164	28	14	man	man	NOUN
dentistry3000-164	28	15	[	[	X
dentistry3000-164	28	16	omim]119300	omim]119300	NOUN
dentistry3000-164	28	17	)	)	PUNCT
dentistry3000-164	28	18	is	be	AUX
dentistry3000-164	28	19	the	the	DET
dentistry3000-164	28	20	most	most	ADV
dentistry3000-164	28	21	common	common	ADJ
dentistry3000-164	28	22	and	and	CCONJ
dentistry3000-164	28	23	well	well	ADV
dentistry3000-164	28	24	-	-	PUNCT
dentistry3000-164	28	25	known	know	VERB
dentistry3000-164	28	26	syndrome	syndrome	NOUN
dentistry3000-164	28	27	associated	associate	VERB
dentistry3000-164	28	28	with	with	ADP
dentistry3000-164	28	29	orofacial	orofacial	ADJ
dentistry3000-164	28	30	clefts	cleft	NOUN
dentistry3000-164	28	31	,	,	PUNCT
dentistry3000-164	28	32	being	be	AUX
dentistry3000-164	28	33	present	present	ADJ
dentistry3000-164	28	34	in	in	ADP
dentistry3000-164	28	35	approximately	approximately	ADV
dentistry3000-164	28	36	2	2	NUM
dentistry3000-164	28	37	%	%	NOUN
dentistry3000-164	28	38	of	of	ADP
dentistry3000-164	28	39	orofacial	orofacial	ADJ
dentistry3000-164	28	40	cleft	cleft	NOUN
dentistry3000-164	28	41	cases	case	NOUN
dentistry3000-164	28	42	[	[	X
dentistry3000-164	28	43	1	1	NUM
dentistry3000-164	28	44	,	,	PUNCT
dentistry3000-164	28	45	2	2	NUM
dentistry3000-164	28	46	]	]	PUNCT
dentistry3000-164	28	47	.	.	PUNCT
dentistry3000-164	29	1	vws	vws	PROPN
dentistry3000-164	29	2	consists	consist	VERB
dentistry3000-164	29	3	of	of	ADP
dentistry3000-164	29	4	a	a	DET
dentistry3000-164	29	5	rare	rare	ADJ
dentistry3000-164	29	6	congenital	congenital	ADJ
dentistry3000-164	29	7	malformation	malformation	NOUN
dentistry3000-164	29	8	and	and	CCONJ
dentistry3000-164	29	9	presents	present	VERB
dentistry3000-164	29	10	clinical	clinical	ADJ
dentistry3000-164	29	11	features	feature	NOUN
dentistry3000-164	29	12	in	in	ADP
dentistry3000-164	29	13	addition	addition	NOUN
dentistry3000-164	29	14	to	to	ADP
dentistry3000-164	29	15	orofacial	orofacial	ADJ
dentistry3000-164	29	16	clefts	cleft	NOUN
dentistry3000-164	29	17	,	,	PUNCT
dentistry3000-164	29	18	such	such	ADJ
dentistry3000-164	29	19	as	as	ADP
dentistry3000-164	29	20	lower	low	ADJ
dentistry3000-164	29	21	lip	lip	NOUN
dentistry3000-164	29	22	pits	pit	NOUN
dentistry3000-164	29	23	and	and	CCONJ
dentistry3000-164	29	24	occasionally	occasionally	ADV
dentistry3000-164	29	25	,	,	PUNCT
dentistry3000-164	29	26	hypodontia	hypodontia	PROPN
dentistry3000-164	29	27	.	.	PUNCT
dentistry3000-164	30	1	the	the	DET
dentistry3000-164	30	2	frequency	frequency	NOUN
dentistry3000-164	30	3	of	of	ADP
dentistry3000-164	30	4	vws	vws	PROPN
dentistry3000-164	30	5	in	in	ADP
dentistry3000-164	30	6	the	the	DET
dentistry3000-164	30	7	population	population	NOUN
dentistry3000-164	30	8	varies	vary	VERB
dentistry3000-164	30	9	from	from	ADP
dentistry3000-164	30	10	1	1	NUM
dentistry3000-164	30	11	:	:	SYM
dentistry3000-164	30	12	100,000	100,000	NUM
dentistry3000-164	30	13	to	to	PART
dentistry3000-164	30	14	1	1	NUM
dentistry3000-164	30	15	:	:	SYM
dentistry3000-164	30	16	40,000	40,000	NUM
dentistry3000-164	30	17	,	,	PUNCT
dentistry3000-164	30	18	and	and	CCONJ
dentistry3000-164	30	19	there	there	PRON
dentistry3000-164	30	20	are	be	VERB
dentistry3000-164	30	21	no	no	DET
dentistry3000-164	30	22	reports	report	NOUN
dentistry3000-164	30	23	of	of	ADP
dentistry3000-164	30	24	differences	difference	NOUN
dentistry3000-164	30	25	between	between	ADP
dentistry3000-164	30	26	males	male	NOUN
dentistry3000-164	30	27	and	and	CCONJ
dentistry3000-164	30	28	females	female	NOUN
dentistry3000-164	30	29	[	[	X
dentistry3000-164	30	30	3,4	3,4	NUM
dentistry3000-164	30	31	]	]	PUNCT
dentistry3000-164	30	32	.	.	PUNCT
dentistry3000-164	31	1	the	the	DET
dentistry3000-164	31	2	expression	expression	NOUN
dentistry3000-164	31	3	of	of	ADP
dentistry3000-164	31	4	vws	vws	PROPN
dentistry3000-164	31	5	is	be	AUX
dentistry3000-164	31	6	highly	highly	ADV
dentistry3000-164	31	7	variable	variable	ADJ
dentistry3000-164	31	8	,	,	PUNCT
dentistry3000-164	31	9	both	both	CCONJ
dentistry3000-164	31	10	interfamilial	interfamilial	ADJ
dentistry3000-164	31	11	and	and	CCONJ
dentistry3000-164	31	12	within	within	ADP
dentistry3000-164	31	13	the	the	DET
dentistry3000-164	31	14	same	same	ADJ
dentistry3000-164	31	15	family	family	NOUN
dentistry3000-164	31	16	.	.	PUNCT
dentistry3000-164	32	1	in	in	ADP
dentistry3000-164	32	2	other	other	ADJ
dentistry3000-164	32	3	words	word	NOUN
dentistry3000-164	32	4	,	,	PUNCT
dentistry3000-164	32	5	there	there	PRON
dentistry3000-164	32	6	is	be	VERB
dentistry3000-164	32	7	a	a	DET
dentistry3000-164	32	8	range	range	NOUN
dentistry3000-164	32	9	of	of	ADP
dentistry3000-164	32	10	associated	associated	ADJ
dentistry3000-164	32	11	phenotypes	phenotype	NOUN
dentistry3000-164	32	12	,	,	PUNCT
dentistry3000-164	32	13	from	from	ADP
dentistry3000-164	32	14	the	the	DET
dentistry3000-164	32	15	complete	complete	ADJ
dentistry3000-164	32	16	absence	absence	NOUN
dentistry3000-164	32	17	of	of	ADP
dentistry3000-164	32	18	visible	visible	ADJ
dentistry3000-164	32	19	abnormalities	abnormality	NOUN
dentistry3000-164	32	20	,	,	PUNCT
dentistry3000-164	32	21	only	only	ADV
dentistry3000-164	32	22	the	the	DET
dentistry3000-164	32	23	presence	presence	NOUN
dentistry3000-164	32	24	of	of	ADP
dentistry3000-164	32	25	pits	pit	NOUN
dentistry3000-164	32	26	in	in	ADP
dentistry3000-164	32	27	the	the	DET
dentistry3000-164	32	28	lower	low	ADJ
dentistry3000-164	32	29	lip	lip	NOUN
dentistry3000-164	32	30	,	,	PUNCT
dentistry3000-164	32	31	to	to	ADP
dentistry3000-164	32	32	the	the	DET
dentistry3000-164	32	33	combination	combination	NOUN
dentistry3000-164	32	34	of	of	ADP
dentistry3000-164	32	35	these	these	DET
dentistry3000-164	32	36	pits	pit	NOUN
dentistry3000-164	32	37	with	with	ADP
dentistry3000-164	32	38	different	different	ADJ
dentistry3000-164	32	39	types	type	NOUN
dentistry3000-164	32	40	of	of	ADP
dentistry3000-164	32	41	clefts	cleft	NOUN
dentistry3000-164	32	42	.	.	PUNCT
dentistry3000-164	33	1	these	these	DET
dentistry3000-164	33	2	types	type	NOUN
dentistry3000-164	33	3	may	may	AUX
dentistry3000-164	33	4	include	include	VERB
dentistry3000-164	33	5	aspects	aspect	NOUN
dentistry3000-164	33	6	such	such	ADJ
dentistry3000-164	33	7	as	as	ADP
dentistry3000-164	33	8	laterality	laterality	NOUN
dentistry3000-164	33	9	(	(	PUNCT
dentistry3000-164	33	10	unilateral	unilateral	ADJ
dentistry3000-164	33	11	or	or	CCONJ
dentistry3000-164	33	12	bilateral	bilateral	ADJ
dentistry3000-164	33	13	)	)	PUNCT
dentistry3000-164	33	14	,	,	PUNCT
dentistry3000-164	33	15	extension	extension	NOUN
dentistry3000-164	33	16	(	(	PUNCT
dentistry3000-164	33	17	complete	complete	ADJ
dentistry3000-164	33	18	and	and	CCONJ
dentistry3000-164	33	19	incomplete	incomplete	ADJ
dentistry3000-164	33	20	)	)	PUNCT
dentistry3000-164	33	21	and	and	CCONJ
dentistry3000-164	33	22	may	may	AUX
dentistry3000-164	33	23	involve	involve	VERB
dentistry3000-164	33	24	lip	lip	NOUN
dentistry3000-164	33	25	,	,	PUNCT
dentistry3000-164	33	26	palate	palate	VERB
dentistry3000-164	33	27	or	or	CCONJ
dentistry3000-164	33	28	both	both	PRON
dentistry3000-164	34	1	[	[	X
dentistry3000-164	34	2	2	2	NUM
dentistry3000-164	34	3	,	,	PUNCT
dentistry3000-164	34	4	5	5	NUM
dentistry3000-164	34	5	-	-	SYM
dentistry3000-164	34	6	7	7	NUM
dentistry3000-164	34	7	]	]	PUNCT
dentistry3000-164	34	8	.	.	PUNCT
dentistry3000-164	35	1	the	the	DET
dentistry3000-164	35	2	etiology	etiology	NOUN
dentistry3000-164	35	3	of	of	ADP
dentistry3000-164	35	4	vws	vws	PROPN
dentistry3000-164	35	5	has	have	AUX
dentistry3000-164	35	6	been	be	AUX
dentistry3000-164	35	7	attributed	attribute	VERB
dentistry3000-164	35	8	to	to	ADP
dentistry3000-164	35	9	mutations	mutation	NOUN
dentistry3000-164	35	10	in	in	ADP
dentistry3000-164	35	11	the	the	DET
dentistry3000-164	35	12	irf6	irf6	PROPN
dentistry3000-164	35	13	gene	gene	NOUN
dentistry3000-164	35	14	(	(	PUNCT
dentistry3000-164	35	15	interferon	interferon	ADJ
dentistry3000-164	35	16	regulatory	regulatory	ADJ
dentistry3000-164	35	17	factor	factor	NOUN
dentistry3000-164	35	18	6	6	NUM
dentistry3000-164	35	19	)	)	PUNCT
dentistry3000-164	35	20	.	.	PUNCT
dentistry3000-164	36	1	however	however	ADV
dentistry3000-164	36	2	,	,	PUNCT
dentistry3000-164	36	3	from	from	ADP
dentistry3000-164	36	4	a	a	DET
dentistry3000-164	36	5	molecular	molecular	ADJ
dentistry3000-164	36	6	point	point	NOUN
dentistry3000-164	36	7	of	of	ADP
dentistry3000-164	36	8	view	view	NOUN
dentistry3000-164	36	9	,	,	PUNCT
dentistry3000-164	36	10	mutations	mutation	NOUN
dentistry3000-164	36	11	in	in	ADP
dentistry3000-164	36	12	the	the	DET
dentistry3000-164	36	13	irf6	irf6	PROPN
dentistry3000-164	36	14	gene	gene	NOUN
dentistry3000-164	36	15	can	can	AUX
dentistry3000-164	36	16	explain	explain	VERB
dentistry3000-164	36	17	70	70	NUM
dentistry3000-164	36	18	%	%	NOUN
dentistry3000-164	36	19	of	of	ADP
dentistry3000-164	36	20	the	the	DET
dentistry3000-164	36	21	cases	case	NOUN
dentistry3000-164	36	22	of	of	ADP
dentistry3000-164	36	23	vws	vws	PROPN
dentistry3000-164	36	24	.	.	PUNCT
dentistry3000-164	37	1	several	several	ADJ
dentistry3000-164	37	2	studies	study	NOUN
dentistry3000-164	37	3	also	also	ADV
dentistry3000-164	37	4	point	point	VERB
dentistry3000-164	37	5	to	to	ADP
dentistry3000-164	37	6	the	the	DET
dentistry3000-164	37	7	possibility	possibility	NOUN
dentistry3000-164	37	8	of	of	ADP
dentistry3000-164	37	9	other	other	ADJ
dentistry3000-164	37	10	genes	gene	NOUN
dentistry3000-164	37	11	causing	cause	VERB
dentistry3000-164	37	12	vws	vws	PROPN
dentistry3000-164	37	13	,	,	PUNCT
dentistry3000-164	37	14	despite	despite	SCONJ
dentistry3000-164	37	15	the	the	DET
dentistry3000-164	37	16	limitations	limitation	NOUN
dentistry3000-164	37	17	of	of	ADP
dentistry3000-164	37	18	molecular	molecular	ADJ
dentistry3000-164	37	19	biology	biology	NOUN
dentistry3000-164	37	20	techniques	technique	NOUN
dentistry3000-164	37	21	in	in	ADP
dentistry3000-164	37	22	identifying	identify	VERB
dentistry3000-164	37	23	mutations	mutation	NOUN
dentistry3000-164	37	24	in	in	ADP
dentistry3000-164	37	25	many	many	ADJ
dentistry3000-164	37	26	of	of	ADP
dentistry3000-164	37	27	these	these	DET
dentistry3000-164	37	28	genes	gene	NOUN
dentistry3000-164	37	29	[	[	X
dentistry3000-164	37	30	8	8	NUM
dentistry3000-164	37	31	-	-	SYM
dentistry3000-164	37	32	10	10	NUM
dentistry3000-164	37	33	]	]	PUNCT
dentistry3000-164	37	34	.	.	PUNCT
dentistry3000-164	38	1	the	the	DET
dentistry3000-164	38	2	irf6	irf6	PROPN
dentistry3000-164	38	3	gene	gene	NOUN
dentistry3000-164	38	4	is	be	AUX
dentistry3000-164	38	5	located	locate	VERB
dentistry3000-164	38	6	on	on	ADP
dentistry3000-164	38	7	the	the	DET
dentistry3000-164	38	8	long	long	ADJ
dentistry3000-164	38	9	arm	arm	NOUN
dentistry3000-164	38	10	of	of	ADP
dentistry3000-164	38	11	chromosome	chromosome	NOUN
dentistry3000-164	38	12	1	1	NUM
dentistry3000-164	38	13	(	(	PUNCT
dentistry3000-164	38	14	1q32.3	1q32.3	NUM
dentistry3000-164	38	15	q41	q41	NOUN
dentistry3000-164	38	16	)	)	PUNCT
dentistry3000-164	38	17	and	and	CCONJ
dentistry3000-164	38	18	contains	contain	VERB
dentistry3000-164	38	19	10	10	NUM
dentistry3000-164	38	20	exons	exon	NOUN
dentistry3000-164	38	21	;	;	PUNCT
dentistry3000-164	38	22	exons	exon	NOUN
dentistry3000-164	38	23	1	1	NUM
dentistry3000-164	38	24	,	,	PUNCT
dentistry3000-164	38	25	2	2	NUM
dentistry3000-164	38	26	and	and	CCONJ
dentistry3000-164	38	27	10	10	NUM
dentistry3000-164	38	28	are	be	AUX
dentistry3000-164	38	29	not	not	PART
dentistry3000-164	38	30	translated	translate	VERB
dentistry3000-164	38	31	.	.	PUNCT
dentistry3000-164	39	1	the	the	DET
dentistry3000-164	39	2	product	product	NOUN
dentistry3000-164	39	3	encoded	encode	VERB
dentistry3000-164	39	4	by	by	ADP
dentistry3000-164	39	5	the	the	DET
dentistry3000-164	39	6	irf6	irf6	PROPN
dentistry3000-164	39	7	gene	gene	NOUN
dentistry3000-164	39	8	is	be	AUX
dentistry3000-164	39	9	a	a	DET
dentistry3000-164	39	10	467	467	NUM
dentistry3000-164	39	11	amino	amino	NOUN
dentistry3000-164	39	12	acid	acid	NOUN
dentistry3000-164	39	13	polypeptide	polypeptide	ADP
dentistry3000-164	39	14	[	[	X
dentistry3000-164	39	15	8	8	NUM
dentistry3000-164	39	16	,	,	PUNCT
dentistry3000-164	39	17	11	11	NUM
dentistry3000-164	39	18	,	,	PUNCT
dentistry3000-164	39	19	12	12	NUM
dentistry3000-164	39	20	]	]	PUNCT
dentistry3000-164	39	21	.	.	PUNCT
dentistry3000-164	40	1	in	in	ADP
dentistry3000-164	40	2	contrast	contrast	NOUN
dentistry3000-164	40	3	to	to	ADP
dentistry3000-164	40	4	the	the	DET
dentistry3000-164	40	5	other	other	ADJ
dentistry3000-164	40	6	members	member	NOUN
dentistry3000-164	40	7	of	of	ADP
dentistry3000-164	40	8	the	the	DET
dentistry3000-164	40	9	irf	irf	PROPN
dentistry3000-164	40	10	family	family	PROPN
dentistry3000-164	40	11	(	(	PUNCT
dentistry3000-164	40	12	interferon	interferon	ADJ
dentistry3000-164	40	13	regulating	regulating	NOUN
dentistry3000-164	40	14	factors	factor	NOUN
dentistry3000-164	40	15	)	)	PUNCT
dentistry3000-164	40	16	,	,	PUNCT
dentistry3000-164	40	17	irf6	irf6	PROPN
dentistry3000-164	40	18	does	do	AUX
dentistry3000-164	40	19	not	not	PART
dentistry3000-164	40	20	participate	participate	VERB
dentistry3000-164	40	21	in	in	ADP
dentistry3000-164	40	22	the	the	DET
dentistry3000-164	40	23	innate	innate	ADJ
dentistry3000-164	40	24	immune	immune	ADJ
dentistry3000-164	40	25	response	response	NOUN
dentistry3000-164	40	26	,	,	PUNCT
dentistry3000-164	40	27	however	however	ADV
dentistry3000-164	40	28	it	it	PRON
dentistry3000-164	40	29	is	be	AUX
dentistry3000-164	40	30	essential	essential	ADJ
dentistry3000-164	40	31	for	for	ADP
dentistry3000-164	40	32	embryonic	embryonic	ADJ
dentistry3000-164	40	33	development	development	NOUN
dentistry3000-164	40	34	,	,	PUNCT
dentistry3000-164	40	35	can	can	AUX
dentistry3000-164	40	36	act	act	VERB
dentistry3000-164	40	37	as	as	ADP
dentistry3000-164	40	38	a	a	DET
dentistry3000-164	40	39	tumor	tumor	NOUN
dentistry3000-164	40	40	suppressor	suppressor	NOUN
dentistry3000-164	40	41	and	and	CCONJ
dentistry3000-164	40	42	participate	participate	VERB
dentistry3000-164	40	43	in	in	ADP
dentistry3000-164	40	44	the	the	DET
dentistry3000-164	40	45	differentiation	differentiation	NOUN
dentistry3000-164	40	46	of	of	ADP
dentistry3000-164	40	47	ectodermal	ectodermal	ADJ
dentistry3000-164	40	48	tissues	tissue	NOUN
dentistry3000-164	40	49	[	[	X
dentistry3000-164	40	50	13	13	NUM
dentistry3000-164	40	51	-	-	SYM
dentistry3000-164	40	52	15	15	NUM
dentistry3000-164	40	53	]	]	PUNCT
dentistry3000-164	40	54	.	.	PUNCT
dentistry3000-164	41	1	recently	recently	ADV
dentistry3000-164	41	2	,	,	PUNCT
dentistry3000-164	41	3	a	a	DET
dentistry3000-164	41	4	new	new	ADJ
dentistry3000-164	41	5	role	role	NOUN
dentistry3000-164	41	6	assigned	assign	VERB
dentistry3000-164	41	7	to	to	ADP
dentistry3000-164	41	8	the	the	DET
dentistry3000-164	41	9	irf6	irf6	ADJ
dentistry3000-164	41	10	ortholog	ortholog	NOUN
dentistry3000-164	41	11	gene	gene	NOUN
dentistry3000-164	41	12	is	be	AUX
dentistry3000-164	41	13	participation	participation	NOUN
dentistry3000-164	41	14	in	in	ADP
dentistry3000-164	41	15	the	the	DET
dentistry3000-164	41	16	development	development	NOUN
dentistry3000-164	41	17	of	of	ADP
dentistry3000-164	41	18	the	the	DET
dentistry3000-164	41	19	exocrine	exocrine	NOUN
dentistry3000-164	41	20	gland	gland	NOUN
dentistry3000-164	41	21	.	.	PUNCT
dentistry3000-164	42	1	this	this	DET
dentistry3000-164	42	2	information	information	NOUN
dentistry3000-164	42	3	can	can	AUX
dentistry3000-164	42	4	be	be	AUX
dentistry3000-164	42	5	used	use	VERB
dentistry3000-164	42	6	to	to	PART
dentistry3000-164	42	7	investigate	investigate	VERB
dentistry3000-164	42	8	the	the	DET
dentistry3000-164	42	9	suspicion	suspicion	NOUN
dentistry3000-164	42	10	of	of	ADP
dentistry3000-164	42	11	disorders	disorder	NOUN
dentistry3000-164	42	12	in	in	ADP
dentistry3000-164	42	13	the	the	DET
dentistry3000-164	42	14	salivary	salivary	ADJ
dentistry3000-164	42	15	glands	gland	NOUN
dentistry3000-164	42	16	of	of	ADP
dentistry3000-164	42	17	patients	patient	NOUN
dentistry3000-164	42	18	with	with	ADP
dentistry3000-164	42	19	the	the	DET
dentistry3000-164	42	20	two	two	NUM
dentistry3000-164	42	21	forms	form	NOUN
dentistry3000-164	42	22	of	of	ADP
dentistry3000-164	42	23	syndrome	syndrome	NOUN
dentistry3000-164	42	24	caused	cause	VERB
dentistry3000-164	42	25	by	by	ADP
dentistry3000-164	42	26	mutations	mutation	NOUN
dentistry3000-164	42	27	in	in	ADP
dentistry3000-164	42	28	the	the	DET
dentistry3000-164	42	29	irf6	irf6	PROPN
dentistry3000-164	42	30	gene	gene	NOUN
dentistry3000-164	42	31	,	,	PUNCT
dentistry3000-164	42	32	the	the	DET
dentistry3000-164	42	33	vws	vws	PROPN
dentistry3000-164	42	34	and	and	CCONJ
dentistry3000-164	42	35	popliteal	popliteal	NOUN
dentistry3000-164	42	36	pterygium	pterygium	NOUN
dentistry3000-164	42	37	syndrome	syndrome	NOUN
dentistry3000-164	42	38	(	(	PUNCT
dentistry3000-164	42	39	spp	spp	NOUN
dentistry3000-164	42	40	)	)	PUNCT
dentistry3000-164	42	41	,	,	PUNCT
dentistry3000-164	42	42	as	as	ADV
dentistry3000-164	42	43	well	well	ADV
dentistry3000-164	42	44	as	as	ADP
dentistry3000-164	42	45	to	to	PART
dentistry3000-164	42	46	understand	understand	VERB
dentistry3000-164	42	47	the	the	DET
dentistry3000-164	42	48	presence	presence	NOUN
dentistry3000-164	42	49	of	of	ADP
dentistry3000-164	42	50	dental	dental	ADJ
dentistry3000-164	42	51	problems	problem	NOUN
dentistry3000-164	42	52	,	,	PUNCT
dentistry3000-164	42	53	for	for	ADP
dentistry3000-164	42	54	example	example	NOUN
dentistry3000-164	42	55	,	,	PUNCT
dentistry3000-164	42	56	caries	carie	NOUN
dentistry3000-164	42	57	,	,	PUNCT
dentistry3000-164	42	58	in	in	ADP
dentistry3000-164	42	59	patients	patient	NOUN
dentistry3000-164	42	60	with	with	ADP
dentistry3000-164	42	61	orofacial	orofacial	ADJ
dentistry3000-164	42	62	clefts	cleft	NOUN
dentistry3000-164	42	63	[	[	X
dentistry3000-164	42	64	16	16	NUM
dentistry3000-164	42	65	]	]	PUNCT
dentistry3000-164	42	66	.	.	PUNCT
dentistry3000-164	43	1	the	the	DET
dentistry3000-164	43	2	aim	aim	NOUN
dentistry3000-164	43	3	of	of	ADP
dentistry3000-164	43	4	this	this	DET
dentistry3000-164	43	5	study	study	NOUN
dentistry3000-164	43	6	was	be	AUX
dentistry3000-164	43	7	to	to	PART
dentistry3000-164	43	8	report	report	VERB
dentistry3000-164	43	9	a	a	DET
dentistry3000-164	43	10	new	new	ADJ
dentistry3000-164	43	11	variant	variant	NOUN
dentistry3000-164	43	12	in	in	ADP
dentistry3000-164	43	13	the	the	DET
dentistry3000-164	43	14	irf6	irf6	ADJ
dentistry3000-164	43	15	gene	gene	NOUN
dentistry3000-164	43	16	and	and	CCONJ
dentistry3000-164	43	17	to	to	PART
dentistry3000-164	43	18	determine	determine	VERB
dentistry3000-164	43	19	phenotype	phenotype	NOUN
dentistry3000-164	43	20	-	-	PUNCT
dentistry3000-164	43	21	genotype	genotype	NOUN
dentistry3000-164	43	22	correlations	correlation	NOUN
dentistry3000-164	43	23	in	in	ADP
dentistry3000-164	43	24	a	a	DET
dentistry3000-164	43	25	family	family	NOUN
dentistry3000-164	43	26	segregating	segregate	VERB
dentistry3000-164	43	27	van	van	PROPN
dentistry3000-164	43	28	der	der	PROPN
dentistry3000-164	43	29	woude	woude	VERB
dentistry3000-164	43	30	syndrome	syndrome	NOUN
dentistry3000-164	43	31	.	.	PUNCT
dentistry3000-164	44	1	material	material	NOUN
dentistry3000-164	44	2	and	and	CCONJ
dentistry3000-164	44	3	methods	method	NOUN
dentistry3000-164	44	4	genealogical	genealogical	ADJ
dentistry3000-164	44	5	data	datum	NOUN
dentistry3000-164	44	6	the	the	DET
dentistry3000-164	44	7	family	family	NOUN
dentistry3000-164	44	8	participating	participate	VERB
dentistry3000-164	44	9	in	in	ADP
dentistry3000-164	44	10	the	the	DET
dentistry3000-164	44	11	study	study	NOUN
dentistry3000-164	44	12	was	be	AUX
dentistry3000-164	44	13	located	locate	VERB
dentistry3000-164	44	14	in	in	ADP
dentistry3000-164	44	15	the	the	DET
dentistry3000-164	44	16	service	service	NOUN
dentistry3000-164	44	17	of	of	ADP
dentistry3000-164	44	18	assistance	assistance	NOUN
dentistry3000-164	44	19	to	to	ADP
dentistry3000-164	44	20	the	the	DET
dentistry3000-164	44	21	patients	patient	NOUN
dentistry3000-164	44	22	with	with	ADP
dentistry3000-164	44	23	orofacial	orofacial	ADJ
dentistry3000-164	44	24	clefts	cleft	NOUN
dentistry3000-164	44	25	at	at	ADP
dentistry3000-164	44	26	ophir	ophir	PROPN
dentistry3000-164	44	27	loyola	loyola	PROPN
dentistry3000-164	44	28	hospital	hospital	NOUN
dentistry3000-164	44	29	(	(	PUNCT
dentistry3000-164	44	30	belém	belém	PROPN
dentistry3000-164	44	31	pará	pará	PROPN
dentistry3000-164	44	32	,	,	PUNCT
dentistry3000-164	44	33	brazil	brazil	PROPN
dentistry3000-164	44	34	)	)	PUNCT
dentistry3000-164	44	35	.	.	PUNCT
dentistry3000-164	45	1	at	at	ADP
dentistry3000-164	45	2	the	the	DET
dentistry3000-164	45	3	time	time	NOUN
dentistry3000-164	45	4	,	,	PUNCT
dentistry3000-164	45	5	five	five	NUM
dentistry3000-164	45	6	members	member	NOUN
dentistry3000-164	45	7	of	of	ADP
dentistry3000-164	45	8	this	this	DET
dentistry3000-164	45	9	family	family	NOUN
dentistry3000-164	45	10	were	be	AUX
dentistry3000-164	45	11	present	present	ADJ
dentistry3000-164	45	12	,	,	PUNCT
dentistry3000-164	45	13	a	a	DET
dentistry3000-164	45	14	mother	mother	NOUN
dentistry3000-164	45	15	and	and	CCONJ
dentistry3000-164	45	16	four	four	NUM
dentistry3000-164	45	17	children	child	NOUN
dentistry3000-164	45	18	(	(	PUNCT
dentistry3000-164	45	19	two	two	NUM
dentistry3000-164	45	20	girls	girl	NOUN
dentistry3000-164	45	21	and	and	CCONJ
dentistry3000-164	45	22	two	two	NUM
dentistry3000-164	45	23	boys	boy	NOUN
dentistry3000-164	45	24	)	)	PUNCT
dentistry3000-164	45	25	.	.	PUNCT
dentistry3000-164	46	1	all	all	DET
dentistry3000-164	46	2	five	five	NUM
dentistry3000-164	46	3	had	have	VERB
dentistry3000-164	46	4	congenital	congenital	ADJ
dentistry3000-164	46	5	pits	pit	NOUN
dentistry3000-164	46	6	in	in	ADP
dentistry3000-164	46	7	the	the	DET
dentistry3000-164	46	8	lower	low	ADJ
dentistry3000-164	46	9	lip	lip	NOUN
dentistry3000-164	46	10	and	and	CCONJ
dentistry3000-164	46	11	only	only	ADV
dentistry3000-164	46	12	one	one	NUM
dentistry3000-164	46	13	of	of	ADP
dentistry3000-164	46	14	them	they	PRON
dentistry3000-164	46	15	did	do	AUX
dentistry3000-164	46	16	not	not	PART
dentistry3000-164	46	17	present	present	VERB
dentistry3000-164	46	18	orofacial	orofacial	ADJ
dentistry3000-164	46	19	cleft	cleft	NOUN
dentistry3000-164	46	20	but	but	CCONJ
dentistry3000-164	46	21	instead	instead	ADV
dentistry3000-164	46	22	presented	present	VERB
dentistry3000-164	46	23	excess	excess	NOUN
dentistry3000-164	46	24	of	of	ADP
dentistry3000-164	46	25	lower	low	ADJ
dentistry3000-164	46	26	lip	lip	NOUN
dentistry3000-164	46	27	.	.	PUNCT
dentistry3000-164	47	1	the	the	DET
dentistry3000-164	47	2	research	research	NOUN
dentistry3000-164	47	3	was	be	AUX
dentistry3000-164	47	4	carried	carry	VERB
dentistry3000-164	47	5	out	out	ADP
dentistry3000-164	47	6	in	in	ADP
dentistry3000-164	47	7	accordance	accordance	NOUN
dentistry3000-164	47	8	with	with	ADP
dentistry3000-164	47	9	the	the	DET
dentistry3000-164	47	10	basic	basic	ADJ
dentistry3000-164	47	11	ethical	ethical	ADJ
dentistry3000-164	47	12	principles	principle	NOUN
dentistry3000-164	47	13	of	of	ADP
dentistry3000-164	47	14	the	the	DET
dentistry3000-164	47	15	guidelines	guideline	NOUN
dentistry3000-164	47	16	and	and	CCONJ
dentistry3000-164	47	17	standards	standard	NOUN
dentistry3000-164	47	18	that	that	PRON
dentistry3000-164	47	19	regulate	regulate	VERB
dentistry3000-164	47	20	research	research	NOUN
dentistry3000-164	47	21	in	in	ADP
dentistry3000-164	47	22	human	human	ADJ
dentistry3000-164	47	23	beings	being	NOUN
dentistry3000-164	47	24	:	:	PUNCT
dentistry3000-164	47	25	autonomy	autonomy	NOUN
dentistry3000-164	47	26	,	,	PUNCT
dentistry3000-164	47	27	beneficence	beneficence	NOUN
dentistry3000-164	47	28	,	,	PUNCT
dentistry3000-164	47	29	non	non	ADJ
dentistry3000-164	47	30	-	-	ADJ
dentistry3000-164	47	31	maleficence	maleficence	NOUN
dentistry3000-164	47	32	and	and	CCONJ
dentistry3000-164	47	33	justice	justice	NOUN
dentistry3000-164	47	34	.	.	PUNCT
dentistry3000-164	48	1	the	the	DET
dentistry3000-164	48	2	project	project	NOUN
dentistry3000-164	48	3	was	be	AUX
dentistry3000-164	48	4	previously	previously	ADV
dentistry3000-164	48	5	approved	approve	VERB
dentistry3000-164	48	6	by	by	ADP
dentistry3000-164	48	7	the	the	DET
dentistry3000-164	48	8	ethics	ethic	NOUN
dentistry3000-164	48	9	committee	committee	PROPN
dentistry3000-164	48	10	of	of	ADP
dentistry3000-164	48	11	the	the	DET
dentistry3000-164	48	12	health	health	NOUN
dentistry3000-164	48	13	science	science	NOUN
dentistry3000-164	48	14	center	center	NOUN
dentistry3000-164	48	15	of	of	ADP
dentistry3000-164	48	16	the	the	DET
dentistry3000-164	48	17	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	48	18	differential	differential	ADJ
dentistry3000-164	48	19	expression	expression	NOUN
dentistry3000-164	48	20	of	of	ADP
dentistry3000-164	48	21	the	the	DET
dentistry3000-164	48	22	irf6	irf6	PROPN
dentistry3000-164	48	23	gene	gene	NOUN
dentistry3000-164	48	24	in	in	ADP
dentistry3000-164	48	25	the	the	DET
dentistry3000-164	48	26	signs	sign	NOUN
dentistry3000-164	48	27	of	of	ADP
dentistry3000-164	48	28	van	van	PROPN
dentistry3000-164	48	29	der	der	PROPN
dentistry3000-164	48	30	woude	woude	VERB
dentistry3000-164	48	31	syndrome	syndrome	NOUN
dentistry3000-164	48	32	:	:	PUNCT
dentistry3000-164	48	33	are	be	AUX
dentistry3000-164	48	34	distinct	distinct	ADJ
dentistry3000-164	48	35	genetic	genetic	ADJ
dentistry3000-164	48	36	modifiers	modifier	NOUN
dentistry3000-164	48	37	operating	operate	VERB
dentistry3000-164	48	38	?	?	PUNCT
dentistry3000-164	49	1	vol	vol	NOUN
dentistry3000-164	49	2	9	9	NUM
dentistry3000-164	49	3	no	no	DET
dentistry3000-164	49	4	1	1	NUM
dentistry3000-164	49	5	(	(	PUNCT
dentistry3000-164	49	6	2021	2021	NUM
dentistry3000-164	49	7	)	)	PUNCT
dentistry3000-164	49	8	doi	doi	NOUN
dentistry3000-164	49	9	10.5195	10.5195	NUM
dentistry3000-164	49	10	/	/	SYM
dentistry3000-164	49	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	49	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	49	13	federal	federal	ADJ
dentistry3000-164	49	14	university	university	PROPN
dentistry3000-164	49	15	of	of	ADP
dentistry3000-164	49	16	pará	pará	PROPN
dentistry3000-164	49	17	(	(	PUNCT
dentistry3000-164	49	18	caae	caae	PROPN
dentistry3000-164	49	19	4879.0.000.073	4879.0.000.073	PROPN
dentistry3000-164	49	20	-	-	PUNCT
dentistry3000-164	49	21	10	10	NUM
dentistry3000-164	49	22	,	,	PUNCT
dentistry3000-164	49	23	no140	no140	PROPN
dentistry3000-164	49	24	/10	/10	PUNCT
dentistry3000-164	49	25	)	)	PUNCT
dentistry3000-164	49	26	.	.	PUNCT
dentistry3000-164	50	1	to	to	PART
dentistry3000-164	50	2	obtain	obtain	VERB
dentistry3000-164	50	3	genealogical	genealogical	ADJ
dentistry3000-164	50	4	data	datum	NOUN
dentistry3000-164	50	5	,	,	PUNCT
dentistry3000-164	50	6	the	the	DET
dentistry3000-164	50	7	tabulated	tabulate	VERB
dentistry3000-164	50	8	pedigree	pedigree	ADJ
dentistry3000-164	50	9	method	method	NOUN
dentistry3000-164	50	10	according	accord	VERB
dentistry3000-164	50	11	to	to	ADP
dentistry3000-164	50	12	polleta	polleta	PROPN
dentistry3000-164	50	13	et	et	PROPN
dentistry3000-164	50	14	al	al	PROPN
dentistry3000-164	50	15	.	.	PROPN
dentistry3000-164	51	1	(	(	PUNCT
dentistry3000-164	51	2	2014	2014	NUM
dentistry3000-164	51	3	)	)	PUNCT
dentistry3000-164	52	1	[	[	X
dentistry3000-164	52	2	17	17	NUM
dentistry3000-164	52	3	]	]	PUNCT
dentistry3000-164	52	4	was	be	AUX
dentistry3000-164	52	5	used	use	VERB
dentistry3000-164	52	6	.	.	PUNCT
dentistry3000-164	53	1	the	the	DET
dentistry3000-164	53	2	graphical	graphical	ADJ
dentistry3000-164	53	3	construction	construction	NOUN
dentistry3000-164	53	4	of	of	ADP
dentistry3000-164	53	5	the	the	DET
dentistry3000-164	53	6	pedigree	pedigree	NOUN
dentistry3000-164	53	7	was	be	AUX
dentistry3000-164	53	8	performed	perform	VERB
dentistry3000-164	53	9	using	use	VERB
dentistry3000-164	53	10	an	an	DET
dentistry3000-164	53	11	online	online	ADJ
dentistry3000-164	53	12	tool	tool	NOUN
dentistry3000-164	53	13	from	from	ADP
dentistry3000-164	53	14	the	the	DET
dentistry3000-164	53	15	progeny	progeny	NOUN
dentistry3000-164	53	16	program	program	NOUN
dentistry3000-164	53	17	,	,	PUNCT
dentistry3000-164	53	18	available	available	ADJ
dentistry3000-164	53	19	at	at	ADP
dentistry3000-164	53	20	:	:	PUNCT
dentistry3000-164	53	21	www.progenygenetics.com	www.progenygenetics.com	X
dentistry3000-164	53	22	.	.	PUNCT
dentistry3000-164	54	1	information	information	NOUN
dentistry3000-164	54	2	about	about	ADP
dentistry3000-164	54	3	other	other	ADJ
dentistry3000-164	54	4	members	member	NOUN
dentistry3000-164	54	5	of	of	ADP
dentistry3000-164	54	6	this	this	DET
dentistry3000-164	54	7	family	family	NOUN
dentistry3000-164	54	8	was	be	AUX
dentistry3000-164	54	9	obtained	obtain	VERB
dentistry3000-164	54	10	during	during	ADP
dentistry3000-164	54	11	three	three	NUM
dentistry3000-164	54	12	interviews	interview	NOUN
dentistry3000-164	54	13	at	at	ADP
dentistry3000-164	54	14	different	different	ADJ
dentistry3000-164	54	15	times	time	NOUN
dentistry3000-164	54	16	,	,	PUNCT
dentistry3000-164	54	17	resulting	result	VERB
dentistry3000-164	54	18	in	in	ADP
dentistry3000-164	54	19	the	the	DET
dentistry3000-164	54	20	registration	registration	NOUN
dentistry3000-164	54	21	of	of	ADP
dentistry3000-164	54	22	80	80	NUM
dentistry3000-164	54	23	individuals	individual	NOUN
dentistry3000-164	54	24	in	in	ADP
dentistry3000-164	54	25	the	the	DET
dentistry3000-164	54	26	pedigree	pedigree	NOUN
dentistry3000-164	54	27	,	,	PUNCT
dentistry3000-164	54	28	belonging	belong	VERB
dentistry3000-164	54	29	to	to	ADP
dentistry3000-164	54	30	five	five	NUM
dentistry3000-164	54	31	generations	generation	NOUN
dentistry3000-164	54	32	of	of	ADP
dentistry3000-164	54	33	the	the	DET
dentistry3000-164	54	34	index	index	NOUN
dentistry3000-164	54	35	family	family	NOUN
dentistry3000-164	54	36	.	.	PUNCT
dentistry3000-164	55	1	it	it	PRON
dentistry3000-164	55	2	was	be	AUX
dentistry3000-164	55	3	not	not	PART
dentistry3000-164	55	4	possible	possible	ADJ
dentistry3000-164	55	5	to	to	PART
dentistry3000-164	55	6	specify	specify	VERB
dentistry3000-164	55	7	the	the	DET
dentistry3000-164	55	8	gender	gender	NOUN
dentistry3000-164	55	9	and	and	CCONJ
dentistry3000-164	55	10	the	the	DET
dentistry3000-164	55	11	presence	presence	NOUN
dentistry3000-164	55	12	of	of	ADP
dentistry3000-164	55	13	any	any	DET
dentistry3000-164	55	14	manifestations	manifestation	NOUN
dentistry3000-164	55	15	of	of	ADP
dentistry3000-164	55	16	vws	vws	PROPN
dentistry3000-164	55	17	in	in	ADP
dentistry3000-164	55	18	only	only	ADV
dentistry3000-164	55	19	three	three	NUM
dentistry3000-164	55	20	cases	case	NOUN
dentistry3000-164	55	21	,	,	PUNCT
dentistry3000-164	55	22	all	all	PRON
dentistry3000-164	55	23	of	of	ADP
dentistry3000-164	55	24	whom	whom	PRON
dentistry3000-164	55	25	had	have	AUX
dentistry3000-164	55	26	died	die	VERB
dentistry3000-164	55	27	shortly	shortly	ADV
dentistry3000-164	55	28	after	after	ADP
dentistry3000-164	55	29	birth	birth	NOUN
dentistry3000-164	55	30	;	;	PUNCT
dentistry3000-164	55	31	of	of	ADP
dentistry3000-164	55	32	these	these	DET
dentistry3000-164	55	33	three	three	NUM
dentistry3000-164	55	34	cases	case	NOUN
dentistry3000-164	55	35	,	,	PUNCT
dentistry3000-164	55	36	two	two	NUM
dentistry3000-164	55	37	were	be	AUX
dentistry3000-164	55	38	siamese	siamese	ADJ
dentistry3000-164	55	39	twin	twin	ADJ
dentistry3000-164	55	40	siblings	sibling	NOUN
dentistry3000-164	55	41	.	.	PUNCT
dentistry3000-164	56	1	of	of	ADP
dentistry3000-164	56	2	the	the	DET
dentistry3000-164	56	3	final	final	ADJ
dentistry3000-164	56	4	sample	sample	NOUN
dentistry3000-164	56	5	size	size	NOUN
dentistry3000-164	56	6	of	of	ADP
dentistry3000-164	56	7	77	77	NUM
dentistry3000-164	56	8	individuals	individual	NOUN
dentistry3000-164	56	9	analyzed	analyze	VERB
dentistry3000-164	56	10	,	,	PUNCT
dentistry3000-164	56	11	36	36	NUM
dentistry3000-164	56	12	(	(	PUNCT
dentistry3000-164	56	13	45	45	NUM
dentistry3000-164	56	14	%	%	NOUN
dentistry3000-164	56	15	)	)	PUNCT
dentistry3000-164	56	16	were	be	AUX
dentistry3000-164	56	17	females	female	NOUN
dentistry3000-164	56	18	and	and	CCONJ
dentistry3000-164	56	19	41	41	NUM
dentistry3000-164	56	20	(	(	PUNCT
dentistry3000-164	56	21	51	51	NUM
dentistry3000-164	56	22	%	%	NOUN
dentistry3000-164	56	23	)	)	PUNCT
dentistry3000-164	56	24	were	be	AUX
dentistry3000-164	56	25	males	male	NOUN
dentistry3000-164	56	26	(	(	PUNCT
dentistry3000-164	56	27	figure	figure	NOUN
dentistry3000-164	56	28	1	1	NUM
dentistry3000-164	56	29	)	)	PUNCT
dentistry3000-164	56	30	.	.	PUNCT
dentistry3000-164	57	1	phenotypic	phenotypic	ADJ
dentistry3000-164	57	2	characteristics	characteristic	NOUN
dentistry3000-164	57	3	family	family	NOUN
dentistry3000-164	57	4	members	member	NOUN
dentistry3000-164	57	5	with	with	ADP
dentistry3000-164	57	6	one	one	NUM
dentistry3000-164	57	7	or	or	CCONJ
dentistry3000-164	57	8	more	more	ADJ
dentistry3000-164	57	9	phenotypic	phenotypic	ADJ
dentistry3000-164	57	10	characteristics	characteristic	NOUN
dentistry3000-164	57	11	of	of	ADP
dentistry3000-164	57	12	vws	vws	PROPN
dentistry3000-164	57	13	were	be	AUX
dentistry3000-164	57	14	considered	consider	VERB
dentistry3000-164	57	15	affected	affected	ADJ
dentistry3000-164	57	16	individuals	individual	NOUN
dentistry3000-164	57	17	.	.	PUNCT
dentistry3000-164	58	1	these	these	DET
dentistry3000-164	58	2	characteristics	characteristic	NOUN
dentistry3000-164	58	3	included	include	VERB
dentistry3000-164	58	4	cleft	cleft	NOUN
dentistry3000-164	58	5	lip	lip	NOUN
dentistry3000-164	58	6	with	with	ADP
dentistry3000-164	58	7	or	or	CCONJ
dentistry3000-164	58	8	without	without	ADP
dentistry3000-164	58	9	palate	palate	NOUN
dentistry3000-164	58	10	,	,	PUNCT
dentistry3000-164	58	11	cleft	cleft	NOUN
dentistry3000-164	58	12	palate	palate	NOUN
dentistry3000-164	58	13	,	,	PUNCT
dentistry3000-164	58	14	and	and	CCONJ
dentistry3000-164	58	15	the	the	DET
dentistry3000-164	58	16	presence	presence	NOUN
dentistry3000-164	58	17	of	of	ADP
dentistry3000-164	58	18	pits	pit	NOUN
dentistry3000-164	58	19	,	,	PUNCT
dentistry3000-164	58	20	whether	whether	SCONJ
dentistry3000-164	58	21	bilateral	bilateral	ADJ
dentistry3000-164	58	22	or	or	CCONJ
dentistry3000-164	58	23	unilateral	unilateral	ADJ
dentistry3000-164	58	24	.	.	PUNCT
dentistry3000-164	59	1	the	the	DET
dentistry3000-164	59	2	types	type	NOUN
dentistry3000-164	59	3	of	of	ADP
dentistry3000-164	59	4	orofacial	orofacial	ADJ
dentistry3000-164	59	5	clefts	cleft	NOUN
dentistry3000-164	59	6	found	find	VERB
dentistry3000-164	59	7	were	be	AUX
dentistry3000-164	59	8	grouped	group	VERB
dentistry3000-164	59	9	into	into	ADP
dentistry3000-164	59	10	:	:	PUNCT
dentistry3000-164	59	11	cleft	cleft	ADJ
dentistry3000-164	59	12	lip	lip	NOUN
dentistry3000-164	59	13	(	(	PUNCT
dentistry3000-164	59	14	cl	cl	NOUN
dentistry3000-164	59	15	)	)	PUNCT
dentistry3000-164	59	16	,	,	PUNCT
dentistry3000-164	59	17	cleft	cleft	NOUN
dentistry3000-164	59	18	lip	lip	NOUN
dentistry3000-164	59	19	with	with	ADP
dentistry3000-164	59	20	cleft	cleft	ADJ
dentistry3000-164	59	21	palate	palate	NOUN
dentistry3000-164	59	22	(	(	PUNCT
dentistry3000-164	59	23	clp	clp	NOUN
dentistry3000-164	59	24	)	)	PUNCT
dentistry3000-164	59	25	and	and	CCONJ
dentistry3000-164	59	26	cleft	cleft	NOUN
dentistry3000-164	59	27	palate	palate	NOUN
dentistry3000-164	59	28	(	(	PUNCT
dentistry3000-164	59	29	cp	cp	NOUN
dentistry3000-164	59	30	)	)	PUNCT
dentistry3000-164	59	31	.	.	PUNCT
dentistry3000-164	60	1	dental	dental	ADJ
dentistry3000-164	60	2	information	information	NOUN
dentistry3000-164	60	3	was	be	AUX
dentistry3000-164	60	4	gathered	gather	VERB
dentistry3000-164	60	5	through	through	ADP
dentistry3000-164	60	6	a	a	DET
dentistry3000-164	60	7	complete	complete	ADJ
dentistry3000-164	60	8	dental	dental	ADJ
dentistry3000-164	60	9	clinical	clinical	ADJ
dentistry3000-164	60	10	examination	examination	NOUN
dentistry3000-164	60	11	.	.	PUNCT
dentistry3000-164	61	1	dna	dna	PROPN
dentistry3000-164	61	2	analysis	analysis	NOUN
dentistry3000-164	61	3	four	four	NUM
dentistry3000-164	61	4	family	family	NOUN
dentistry3000-164	61	5	members	member	NOUN
dentistry3000-164	61	6	underwent	undergo	VERB
dentistry3000-164	61	7	molecular	molecular	ADJ
dentistry3000-164	61	8	analysis	analysis	NOUN
dentistry3000-164	61	9	of	of	ADP
dentistry3000-164	61	10	exon	exon	NOUN
dentistry3000-164	61	11	4	4	NUM
dentistry3000-164	61	12	of	of	ADP
dentistry3000-164	61	13	the	the	DET
dentistry3000-164	61	14	irf6	irf6	PROPN
dentistry3000-164	61	15	gene	gene	NOUN
dentistry3000-164	61	16	.	.	PUNCT
dentistry3000-164	62	1	the	the	DET
dentistry3000-164	62	2	samples	sample	NOUN
dentistry3000-164	62	3	of	of	ADP
dentistry3000-164	62	4	biological	biological	ADJ
dentistry3000-164	62	5	material	material	NOUN
dentistry3000-164	62	6	,	,	PUNCT
dentistry3000-164	62	7	3	3	NUM
dentistry3000-164	62	8	to	to	PART
dentistry3000-164	62	9	4	4	NUM
dentistry3000-164	62	10	ml	ml	NOUN
dentistry3000-164	62	11	of	of	ADP
dentistry3000-164	62	12	blood	blood	NOUN
dentistry3000-164	62	13	,	,	PUNCT
dentistry3000-164	62	14	were	be	AUX
dentistry3000-164	62	15	collected	collect	VERB
dentistry3000-164	62	16	through	through	ADP
dentistry3000-164	62	17	venipuncture	venipuncture	NOUN
dentistry3000-164	62	18	and	and	CCONJ
dentistry3000-164	62	19	transferred	transfer	VERB
dentistry3000-164	62	20	to	to	PART
dentistry3000-164	62	21	test	test	NOUN
dentistry3000-164	62	22	tubes	tube	NOUN
dentistry3000-164	62	23	containing	contain	VERB
dentistry3000-164	62	24	edta	edta	NOUN
dentistry3000-164	62	25	.	.	PUNCT
dentistry3000-164	63	1	for	for	ADP
dentistry3000-164	63	2	the	the	DET
dentistry3000-164	63	3	extraction	extraction	NOUN
dentistry3000-164	63	4	of	of	ADP
dentistry3000-164	63	5	dna	dna	PROPN
dentistry3000-164	63	6	,	,	PUNCT
dentistry3000-164	63	7	the	the	DET
dentistry3000-164	63	8	invirsob	invirsob	NOUN
dentistry3000-164	63	9	spin	spin	VERB
dentistry3000-164	63	10	blood	blood	NOUN
dentistry3000-164	63	11	mini	mini	NOUN
dentistry3000-164	63	12	kit	kit	NOUN
dentistry3000-164	63	13	(	(	PUNCT
dentistry3000-164	63	14	invitek	invitek	PROPN
dentistry3000-164	63	15	)	)	PUNCT
dentistry3000-164	63	16	was	be	AUX
dentistry3000-164	63	17	used	use	VERB
dentistry3000-164	63	18	.	.	PUNCT
dentistry3000-164	64	1	for	for	ADP
dentistry3000-164	64	2	the	the	DET
dentistry3000-164	64	3	amplification	amplification	NOUN
dentistry3000-164	64	4	of	of	ADP
dentistry3000-164	64	5	the	the	DET
dentistry3000-164	64	6	sequence	sequence	NOUN
dentistry3000-164	64	7	of	of	ADP
dentistry3000-164	64	8	interest	interest	NOUN
dentistry3000-164	64	9	in	in	ADP
dentistry3000-164	64	10	the	the	DET
dentistry3000-164	64	11	polymerase	polymerase	NOUN
dentistry3000-164	64	12	chain	chain	NOUN
dentistry3000-164	64	13	(	(	PUNCT
dentistry3000-164	64	14	polymerase	polymerase	NOUN
dentistry3000-164	64	15	chain	chain	NOUN
dentistry3000-164	64	16	reaction	reaction	NOUN
dentistry3000-164	64	17	,	,	PUNCT
dentistry3000-164	64	18	pcr	pcr	PROPN
dentistry3000-164	64	19	)	)	PUNCT
dentistry3000-164	64	20	,	,	PUNCT
dentistry3000-164	64	21	the	the	DET
dentistry3000-164	64	22	primers	primer	NOUN
dentistry3000-164	64	23	used	use	VERB
dentistry3000-164	64	24	were	be	AUX
dentistry3000-164	64	25	forward	forward	ADV
dentistry3000-164	64	26	–	–	PUNCT
dentistry3000-164	64	27	gctctgggcaatgataggac	gctctgggcaatgataggac	NOUN
dentistry3000-164	64	28	and	and	CCONJ
dentistry3000-164	64	29	reverse	reverse	ADJ
dentistry3000-164	64	30	accttctccccagcacct	accttctccccagcacct	NOUN
dentistry3000-164	64	31	.	.	PUNCT
dentistry3000-164	65	1	the	the	DET
dentistry3000-164	65	2	pcr	pcr	PROPN
dentistry3000-164	65	3	products	product	NOUN
dentistry3000-164	65	4	were	be	AUX
dentistry3000-164	65	5	subjected	subject	VERB
dentistry3000-164	65	6	to	to	ADP
dentistry3000-164	65	7	direct	direct	VERB
dentistry3000-164	65	8	sequencing	sequence	VERB
dentistry3000-164	65	9	analysis	analysis	NOUN
dentistry3000-164	65	10	of	of	ADP
dentistry3000-164	65	11	exon	exon	NOUN
dentistry3000-164	65	12	4	4	NUM
dentistry3000-164	65	13	of	of	ADP
dentistry3000-164	65	14	irf6	irf6	NOUN
dentistry3000-164	65	15	and	and	CCONJ
dentistry3000-164	65	16	its	its	PRON
dentistry3000-164	65	17	exon	exon	NOUN
dentistry3000-164	65	18	-	-	PUNCT
dentistry3000-164	65	19	intron	intron	NOUN
dentistry3000-164	65	20	boundaries	boundary	NOUN
dentistry3000-164	65	21	based	base	VERB
dentistry3000-164	65	22	on	on	ADP
dentistry3000-164	65	23	capillary	capillary	ADJ
dentistry3000-164	65	24	electrophoresis	electrophoresis	NOUN
dentistry3000-164	65	25	,	,	PUNCT
dentistry3000-164	65	26	using	use	VERB
dentistry3000-164	65	27	the	the	DET
dentistry3000-164	65	28	abi	abi	PROPN
dentistry3000-164	65	29	prism	prism	PROPN
dentistry3000-164	65	30	bigdye	bigdye	PROPN
dentistry3000-164	65	31	kit	kit	PROPN
dentistry3000-164	65	32	,	,	PUNCT
dentistry3000-164	65	33	terminator	terminator	NOUN
dentistry3000-164	65	34	cycle	cycle	NOUN
dentistry3000-164	65	35	sequencing	sequencing	NOUN
dentistry3000-164	65	36	.	.	PUNCT
dentistry3000-164	66	1	the	the	DET
dentistry3000-164	66	2	same	same	ADJ
dentistry3000-164	66	3	primers	primer	NOUN
dentistry3000-164	66	4	were	be	AUX
dentistry3000-164	66	5	used	use	VERB
dentistry3000-164	66	6	for	for	ADP
dentistry3000-164	66	7	pcr	pcr	ADJ
dentistry3000-164	66	8	reactions	reaction	NOUN
dentistry3000-164	66	9	and	and	CCONJ
dentistry3000-164	66	10	the	the	DET
dentistry3000-164	66	11	abi	abi	PROPN
dentistry3000-164	66	12	prism	prism	NOUN
dentistry3000-164	66	13	®	®	PROPN
dentistry3000-164	66	14	3500	3500	NUM
dentistry3000-164	66	15	genetic	genetic	ADJ
dentistry3000-164	66	16	analyzer	analyzer	NOUN
dentistry3000-164	66	17	capillary	capillary	ADJ
dentistry3000-164	66	18	sequencer	sequencer	NOUN
dentistry3000-164	66	19	by	by	ADP
dentistry3000-164	66	20	applied	applied	ADJ
dentistry3000-164	66	21	biosystems	biosystem	NOUN
dentistry3000-164	66	22	.	.	PUNCT
dentistry3000-164	67	1	data	datum	NOUN
dentistry3000-164	67	2	analysis	analysis	NOUN
dentistry3000-164	67	3	the	the	DET
dentistry3000-164	67	4	family	family	NOUN
dentistry3000-164	67	5	history	history	NOUN
dentistry3000-164	67	6	information	information	NOUN
dentistry3000-164	67	7	obtained	obtain	VERB
dentistry3000-164	67	8	from	from	ADP
dentistry3000-164	67	9	the	the	DET
dentistry3000-164	67	10	tabulated	tabulate	VERB
dentistry3000-164	67	11	pedigree	pedigree	NOUN
dentistry3000-164	67	12	was	be	AUX
dentistry3000-164	67	13	inserted	insert	VERB
dentistry3000-164	67	14	in	in	ADP
dentistry3000-164	67	15	the	the	DET
dentistry3000-164	67	16	spreadsheet	spreadsheet	NOUN
dentistry3000-164	67	17	of	of	ADP
dentistry3000-164	67	18	the	the	DET
dentistry3000-164	67	19	microsoft	microsoft	PROPN
dentistry3000-164	67	20	excel	excel	PROPN
dentistry3000-164	67	21	2010	2010	NUM
dentistry3000-164	67	22	program	program	NOUN
dentistry3000-164	67	23	and	and	CCONJ
dentistry3000-164	67	24	later	later	ADV
dentistry3000-164	67	25	analyzed	analyze	VERB
dentistry3000-164	67	26	with	with	ADP
dentistry3000-164	67	27	the	the	DET
dentistry3000-164	67	28	aid	aid	NOUN
dentistry3000-164	67	29	of	of	ADP
dentistry3000-164	67	30	the	the	DET
dentistry3000-164	67	31	pedinfo	pedinfo	NOUN
dentistry3000-164	67	32	program	program	NOUN
dentistry3000-164	67	33	available	available	ADJ
dentistry3000-164	67	34	at	at	ADP
dentistry3000-164	67	35	s.a.g.e	s.a.g.e	PROPN
dentistry3000-164	67	36	.	.	PUNCT
dentistry3000-164	68	1	(	(	PUNCT
dentistry3000-164	68	2	statistical	statistical	ADJ
dentistry3000-164	68	3	analysis	analysis	NOUN
dentistry3000-164	68	4	for	for	ADP
dentistry3000-164	68	5	genetic	genetic	ADJ
dentistry3000-164	68	6	epidemiology	epidemiology	NOUN
dentistry3000-164	68	7	)	)	PUNCT
dentistry3000-164	68	8	version	version	NOUN
dentistry3000-164	68	9	6.3	6.3	NUM
dentistry3000-164	68	10	(	(	PUNCT
dentistry3000-164	68	11	2012	2012	NUM
dentistry3000-164	68	12	)	)	PUNCT
dentistry3000-164	68	13	(	(	PUNCT
dentistry3000-164	68	14	http://darwin.cwru.edu	http://darwin.cwru.edu	NOUN
dentistry3000-164	68	15	)	)	PUNCT
dentistry3000-164	68	16	.	.	PUNCT
dentistry3000-164	69	1	the	the	DET
dentistry3000-164	69	2	analysis	analysis	NOUN
dentistry3000-164	69	3	of	of	ADP
dentistry3000-164	69	4	the	the	DET
dentistry3000-164	69	5	occurrence	occurrence	NOUN
dentistry3000-164	69	6	of	of	ADP
dentistry3000-164	69	7	polymorphic	polymorphic	ADJ
dentistry3000-164	69	8	mutations	mutation	NOUN
dentistry3000-164	69	9	or	or	CCONJ
dentistry3000-164	69	10	variations	variation	NOUN
dentistry3000-164	69	11	in	in	ADP
dentistry3000-164	69	12	exon	exon	NOUN
dentistry3000-164	69	13	4	4	NUM
dentistry3000-164	69	14	of	of	ADP
dentistry3000-164	69	15	the	the	DET
dentistry3000-164	69	16	irf6	irf6	PROPN
dentistry3000-164	69	17	gene	gene	NOUN
dentistry3000-164	69	18	was	be	AUX
dentistry3000-164	69	19	performed	perform	VERB
dentistry3000-164	69	20	using	use	VERB
dentistry3000-164	69	21	the	the	DET
dentistry3000-164	69	22	bioedit	bioedit	NOUN
dentistry3000-164	69	23	program	program	NOUN
dentistry3000-164	69	24	version	version	NOUN
dentistry3000-164	69	25	7.1.9	7.1.9	NUM
dentistry3000-164	69	26	(	(	PUNCT
dentistry3000-164	69	27	http://www.mbio.ncsu.edu/bioed	http://www.mbio.ncsu.edu/bioe	VERB
dentistry3000-164	69	28	it	it	PRON
dentistry3000-164	69	29	/	/	SYM
dentistry3000-164	69	30	bioedit.html	bioedit.html	NOUN
dentistry3000-164	69	31	)	)	PUNCT
dentistry3000-164	69	32	.	.	PUNCT
dentistry3000-164	70	1	for	for	ADP
dentistry3000-164	70	2	the	the	DET
dentistry3000-164	70	3	in	in	ADP
dentistry3000-164	70	4	silico	silico	NOUN
dentistry3000-164	70	5	prediction	prediction	NOUN
dentistry3000-164	70	6	of	of	ADP
dentistry3000-164	70	7	functional	functional	ADJ
dentistry3000-164	70	8	effects	effect	NOUN
dentistry3000-164	70	9	on	on	ADP
dentistry3000-164	70	10	the	the	DET
dentistry3000-164	70	11	protein	protein	NOUN
dentistry3000-164	70	12	,	,	PUNCT
dentistry3000-164	70	13	the	the	DET
dentistry3000-164	70	14	bioinformatics	bioinformatics	NOUN
dentistry3000-164	70	15	tools	tool	NOUN
dentistry3000-164	70	16	hope	hope	VERB
dentistry3000-164	70	17	(	(	PUNCT
dentistry3000-164	70	18	http://www.cmbi.ru.nl/hope	http://www.cmbi.ru.nl/hope	NOUN
dentistry3000-164	70	19	)	)	PUNCT
dentistry3000-164	71	1	[	[	X
dentistry3000-164	71	2	18	18	NUM
dentistry3000-164	71	3	]	]	PUNCT
dentistry3000-164	71	4	,	,	PUNCT
dentistry3000-164	71	5	provean	provean	PROPN
dentistry3000-164	71	6	(	(	PUNCT
dentistry3000-164	71	7	available	available	ADJ
dentistry3000-164	71	8	at	at	ADP
dentistry3000-164	71	9	:	:	PUNCT
dentistry3000-164	71	10	http	http	ADJ
dentistry3000-164	71	11	:	:	PUNCT
dentistry3000-164	71	12	//	//	X
dentistry3000-164	71	13	provean.jcvi.org/index.php	provean.jcvi.org/index.php	NOUN
dentistry3000-164	71	14	)	)	PUNCT
dentistry3000-164	72	1	[	[	X
dentistry3000-164	72	2	19	19	NUM
dentistry3000-164	72	3	]	]	PUNCT
dentistry3000-164	72	4	,	,	PUNCT
dentistry3000-164	72	5	sift	sift	ADJ
dentistry3000-164	72	6	(	(	PUNCT
dentistry3000-164	72	7	available	available	ADJ
dentistry3000-164	72	8	at	at	ADP
dentistry3000-164	72	9	:	:	PUNCT
dentistry3000-164	72	10	http://sift.jcvi.org/	http://sift.jcvi.org/	NOUN
dentistry3000-164	72	11	)	)	PUNCT
dentistry3000-164	73	1	[	[	X
dentistry3000-164	73	2	20	20	NUM
dentistry3000-164	73	3	]	]	PUNCT
dentistry3000-164	73	4	and	and	CCONJ
dentistry3000-164	73	5	polyphen-2	polyphen-2	X
dentistry3000-164	73	6	(	(	PUNCT
dentistry3000-164	73	7	available	available	ADJ
dentistry3000-164	73	8	at	at	ADP
dentistry3000-164	73	9	:	:	PUNCT
dentistry3000-164	73	10	http://genetics.bwh.harvard.edu/	http://genetics.bwh.harvard.edu/	PROPN
dentistry3000-164	73	11	pph2/	pph2/	NOUN
dentistry3000-164	73	12	)	)	PUNCT
dentistry3000-164	74	1	[	[	X
dentistry3000-164	74	2	21	21	NUM
dentistry3000-164	74	3	]	]	PUNCT
dentistry3000-164	74	4	were	be	AUX
dentistry3000-164	74	5	utilized	utilize	VERB
dentistry3000-164	74	6	.	.	PUNCT
dentistry3000-164	75	1	the	the	DET
dentistry3000-164	75	2	data	datum	NOUN
dentistry3000-164	75	3	obtained	obtain	VERB
dentistry3000-164	75	4	was	be	AUX
dentistry3000-164	75	5	analyzed	analyze	VERB
dentistry3000-164	75	6	using	use	VERB
dentistry3000-164	75	7	descriptive	descriptive	ADJ
dentistry3000-164	75	8	statistics	statistic	NOUN
dentistry3000-164	75	9	.	.	PUNCT
dentistry3000-164	76	1	results	result	VERB
dentistry3000-164	76	2	the	the	DET
dentistry3000-164	76	3	family	family	NOUN
dentistry3000-164	76	4	did	do	AUX
dentistry3000-164	76	5	not	not	PART
dentistry3000-164	76	6	present	present	VERB
dentistry3000-164	76	7	a	a	DET
dentistry3000-164	76	8	history	history	NOUN
dentistry3000-164	76	9	of	of	ADP
dentistry3000-164	76	10	consanguineous	consanguineous	ADJ
dentistry3000-164	76	11	marriage	marriage	NOUN
dentistry3000-164	76	12	and	and	CCONJ
dentistry3000-164	76	13	from	from	ADP
dentistry3000-164	76	14	the	the	DET
dentistry3000-164	76	15	second	second	ADJ
dentistry3000-164	76	16	generation	generation	NOUN
dentistry3000-164	76	17	on	on	ADP
dentistry3000-164	76	18	,	,	PUNCT
dentistry3000-164	76	19	where	where	SCONJ
dentistry3000-164	76	20	a	a	DET
dentistry3000-164	76	21	family	family	NOUN
dentistry3000-164	76	22	member	member	NOUN
dentistry3000-164	76	23	has	have	VERB
dentistry3000-164	76	24	a	a	DET
dentistry3000-164	76	25	cleft	cleft	NOUN
dentistry3000-164	76	26	lip	lip	NOUN
dentistry3000-164	76	27	and	and	CCONJ
dentistry3000-164	76	28	pits	pit	NOUN
dentistry3000-164	76	29	,	,	PUNCT
dentistry3000-164	76	30	all	all	DET
dentistry3000-164	76	31	subsequent	subsequent	ADJ
dentistry3000-164	76	32	generations	generation	NOUN
dentistry3000-164	76	33	have	have	VERB
dentistry3000-164	76	34	more	more	ADJ
dentistry3000-164	76	35	than	than	ADP
dentistry3000-164	76	36	one	one	NUM
dentistry3000-164	76	37	affected	affect	VERB
dentistry3000-164	76	38	relative	relative	NOUN
dentistry3000-164	76	39	.	.	PUNCT
dentistry3000-164	77	1	it	it	PRON
dentistry3000-164	77	2	is	be	AUX
dentistry3000-164	77	3	observed	observe	VERB
dentistry3000-164	77	4	through	through	ADP
dentistry3000-164	77	5	the	the	DET
dentistry3000-164	77	6	pedigree	pedigree	NOUN
dentistry3000-164	77	7	that	that	SCONJ
dentistry3000-164	77	8	the	the	DET
dentistry3000-164	77	9	affected	affect	VERB
dentistry3000-164	77	10	individuals	individual	NOUN
dentistry3000-164	77	11	belong	belong	VERB
dentistry3000-164	77	12	only	only	ADV
dentistry3000-164	77	13	to	to	ADP
dentistry3000-164	77	14	the	the	DET
dentistry3000-164	77	15	paternal	paternal	ADJ
dentistry3000-164	77	16	,	,	PUNCT
dentistry3000-164	77	17	ascending	ascend	VERB
dentistry3000-164	77	18	and	and	CCONJ
dentistry3000-164	77	19	descending	descend	VERB
dentistry3000-164	77	20	sides	side	NOUN
dentistry3000-164	77	21	in	in	ADP
dentistry3000-164	77	22	relation	relation	NOUN
dentistry3000-164	77	23	to	to	ADP
dentistry3000-164	77	24	the	the	DET
dentistry3000-164	77	25	index	index	NOUN
dentistry3000-164	77	26	case	case	NOUN
dentistry3000-164	77	27	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	77	28	differential	differential	ADJ
dentistry3000-164	77	29	expression	expression	NOUN
dentistry3000-164	77	30	of	of	ADP
dentistry3000-164	77	31	the	the	DET
dentistry3000-164	77	32	irf6	irf6	PROPN
dentistry3000-164	77	33	gene	gene	NOUN
dentistry3000-164	77	34	in	in	ADP
dentistry3000-164	77	35	the	the	DET
dentistry3000-164	77	36	signs	sign	NOUN
dentistry3000-164	77	37	of	of	ADP
dentistry3000-164	77	38	van	van	PROPN
dentistry3000-164	77	39	der	der	PROPN
dentistry3000-164	77	40	woude	woude	VERB
dentistry3000-164	77	41	syndrome	syndrome	NOUN
dentistry3000-164	77	42	:	:	PUNCT
dentistry3000-164	77	43	are	be	AUX
dentistry3000-164	77	44	distinct	distinct	ADJ
dentistry3000-164	77	45	genetic	genetic	ADJ
dentistry3000-164	77	46	modifiers	modifier	NOUN
dentistry3000-164	77	47	operating	operate	VERB
dentistry3000-164	77	48	?	?	PUNCT
dentistry3000-164	78	1	vol	vol	NOUN
dentistry3000-164	78	2	9	9	NUM
dentistry3000-164	78	3	no	no	DET
dentistry3000-164	78	4	1	1	NUM
dentistry3000-164	78	5	(	(	PUNCT
dentistry3000-164	78	6	2021	2021	NUM
dentistry3000-164	78	7	)	)	PUNCT
dentistry3000-164	78	8	doi	doi	NOUN
dentistry3000-164	78	9	10.5195	10.5195	NUM
dentistry3000-164	78	10	/	/	SYM
dentistry3000-164	78	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	78	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	78	13	(	(	PUNCT
dentistry3000-164	78	14	indicated	indicate	VERB
dentistry3000-164	78	15	with	with	ADP
dentistry3000-164	78	16	an	an	DET
dentistry3000-164	78	17	arrow	arrow	NOUN
dentistry3000-164	78	18	in	in	ADP
dentistry3000-164	78	19	the	the	DET
dentistry3000-164	78	20	pedigree	pedigree	NOUN
dentistry3000-164	78	21	,	,	PUNCT
dentistry3000-164	78	22	figure	figure	NOUN
dentistry3000-164	78	23	1	1	NUM
dentistry3000-164	78	24	)	)	PUNCT
dentistry3000-164	78	25	.	.	PUNCT
dentistry3000-164	79	1	lip	lip	NOUN
dentistry3000-164	79	2	pits	pit	NOUN
dentistry3000-164	79	3	were	be	AUX
dentistry3000-164	79	4	present	present	ADJ
dentistry3000-164	79	5	in	in	ADP
dentistry3000-164	79	6	26	26	NUM
dentistry3000-164	79	7	of	of	ADP
dentistry3000-164	79	8	the	the	DET
dentistry3000-164	79	9	28	28	NUM
dentistry3000-164	79	10	affected	affect	VERB
dentistry3000-164	79	11	individuals	individual	NOUN
dentistry3000-164	79	12	and	and	CCONJ
dentistry3000-164	79	13	12	12	NUM
dentistry3000-164	79	14	out	out	ADP
dentistry3000-164	79	15	of	of	ADP
dentistry3000-164	79	16	28	28	NUM
dentistry3000-164	79	17	individuals	individual	NOUN
dentistry3000-164	79	18	had	have	VERB
dentistry3000-164	79	19	orofacial	orofacial	ADJ
dentistry3000-164	79	20	clefts	cleft	NOUN
dentistry3000-164	79	21	,	,	PUNCT
dentistry3000-164	79	22	with	with	ADP
dentistry3000-164	79	23	six	six	NUM
dentistry3000-164	79	24	of	of	ADP
dentistry3000-164	79	25	them	they	PRON
dentistry3000-164	79	26	having	have	VERB
dentistry3000-164	79	27	the	the	DET
dentistry3000-164	79	28	lip	lip	NOUN
dentistry3000-164	79	29	and	and	CCONJ
dentistry3000-164	79	30	palate	palate	VERB
dentistry3000-164	79	31	affected	affect	VERB
dentistry3000-164	79	32	.	.	PUNCT
dentistry3000-164	80	1	ten	ten	NUM
dentistry3000-164	80	2	individuals	individual	NOUN
dentistry3000-164	80	3	had	have	VERB
dentistry3000-164	80	4	both	both	DET
dentistry3000-164	80	5	pits	pit	NOUN
dentistry3000-164	80	6	and	and	CCONJ
dentistry3000-164	80	7	orofacial	orofacial	ADJ
dentistry3000-164	80	8	clefts	cleft	NOUN
dentistry3000-164	80	9	(	(	PUNCT
dentistry3000-164	80	10	table	table	NOUN
dentistry3000-164	80	11	1	1	NUM
dentistry3000-164	80	12	)	)	PUNCT
dentistry3000-164	80	13	.	.	PUNCT
dentistry3000-164	81	1	out	out	ADP
dentistry3000-164	81	2	of	of	ADP
dentistry3000-164	81	3	the	the	DET
dentistry3000-164	81	4	five	five	NUM
dentistry3000-164	81	5	individuals	individual	NOUN
dentistry3000-164	81	6	that	that	PRON
dentistry3000-164	81	7	had	have	VERB
dentistry3000-164	81	8	a	a	DET
dentistry3000-164	81	9	dental	dental	ADJ
dentistry3000-164	81	10	examination	examination	NOUN
dentistry3000-164	81	11	(	(	PUNCT
dentistry3000-164	81	12	table	table	NOUN
dentistry3000-164	81	13	2	2	NUM
dentistry3000-164	81	14	)	)	PUNCT
dentistry3000-164	81	15	,	,	PUNCT
dentistry3000-164	81	16	one	one	NUM
dentistry3000-164	81	17	had	have	VERB
dentistry3000-164	81	18	permanent	permanent	ADJ
dentistry3000-164	81	19	dentition	dentition	NOUN
dentistry3000-164	81	20	and	and	CCONJ
dentistry3000-164	81	21	four	four	NUM
dentistry3000-164	81	22	had	have	VERB
dentistry3000-164	81	23	primary	primary	ADJ
dentistry3000-164	81	24	dentition	dentition	NOUN
dentistry3000-164	81	25	.	.	PUNCT
dentistry3000-164	82	1	three	three	NUM
dentistry3000-164	82	2	out	out	ADP
dentistry3000-164	82	3	of	of	ADP
dentistry3000-164	82	4	five	five	NUM
dentistry3000-164	82	5	had	have	VERB
dentistry3000-164	82	6	developmental	developmental	ADJ
dentistry3000-164	82	7	dental	dental	ADJ
dentistry3000-164	82	8	anomalies	anomaly	NOUN
dentistry3000-164	82	9	.	.	PUNCT
dentistry3000-164	83	1	phenotype	phenotype	NOUN
dentistry3000-164	83	2	n	n	CCONJ
dentistry3000-164	83	3	%	%	NOUN
dentistry3000-164	83	4	pits	pit	NOUN
dentistry3000-164	83	5	16	16	NUM
dentistry3000-164	83	6	57	57	NUM
dentistry3000-164	83	7	pits	pit	NOUN
dentistry3000-164	83	8	and	and	CCONJ
dentistry3000-164	83	9	clef	clef	NOUN
dentistry3000-164	83	10	lip	lip	VERB
dentistry3000-164	83	11	4	4	NUM
dentistry3000-164	83	12	14	14	NUM
dentistry3000-164	83	13	pits	pit	NOUN
dentistry3000-164	83	14	and	and	CCONJ
dentistry3000-164	83	15	cleft	cleft	NOUN
dentistry3000-164	83	16	lip	lip	NOUN
dentistry3000-164	83	17	with	with	ADP
dentistry3000-164	83	18	cleft	cleft	NOUN
dentistry3000-164	83	19	palate	palate	NOUN
dentistry3000-164	83	20	6	6	NUM
dentistry3000-164	83	21	21	21	NUM
dentistry3000-164	83	22	cleft	cleft	NOUN
dentistry3000-164	83	23	palate	palate	NOUN
dentistry3000-164	83	24	2	2	NUM
dentistry3000-164	83	25	7	7	NUM
dentistry3000-164	83	26	total	total	NOUN
dentistry3000-164	83	27	28	28	NUM
dentistry3000-164	83	28	100	100	NUM
dentistry3000-164	83	29	figure	figure	NOUN
dentistry3000-164	83	30	1	1	NUM
dentistry3000-164	83	31	.	.	PUNCT
dentistry3000-164	84	1	pedigree	pedigree	ADJ
dentistry3000-164	84	2	showing	show	VERB
dentistry3000-164	84	3	family	family	NOUN
dentistry3000-164	84	4	members	member	NOUN
dentistry3000-164	84	5	affected	affect	VERB
dentistry3000-164	84	6	by	by	ADP
dentistry3000-164	84	7	van	van	PROPN
dentistry3000-164	84	8	der	der	PROPN
dentistry3000-164	84	9	woude	woude	VERB
dentistry3000-164	84	10	syndrome	syndrome	NOUN
dentistry3000-164	84	11	.	.	PUNCT
dentistry3000-164	85	1	table	table	NOUN
dentistry3000-164	85	2	1	1	NUM
dentistry3000-164	85	3	.	.	PUNCT
dentistry3000-164	86	1	phenotypic	phenotypic	ADJ
dentistry3000-164	86	2	characteristics	characteristic	NOUN
dentistry3000-164	86	3	of	of	ADP
dentistry3000-164	86	4	van	van	PROPN
dentistry3000-164	86	5	der	der	PROPN
dentistry3000-164	86	6	woude	woude	VERB
dentistry3000-164	86	7	syndrome	syndrome	NOUN
dentistry3000-164	86	8	present	present	ADJ
dentistry3000-164	86	9	in	in	ADP
dentistry3000-164	86	10	affected	affect	VERB
dentistry3000-164	86	11	family	family	NOUN
dentistry3000-164	86	12	members	member	NOUN
dentistry3000-164	86	13	.	.	PUNCT
dentistry3000-164	87	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	87	2	differential	differential	ADJ
dentistry3000-164	87	3	expression	expression	NOUN
dentistry3000-164	87	4	of	of	ADP
dentistry3000-164	87	5	the	the	DET
dentistry3000-164	87	6	irf6	irf6	PROPN
dentistry3000-164	87	7	gene	gene	NOUN
dentistry3000-164	87	8	in	in	ADP
dentistry3000-164	87	9	the	the	DET
dentistry3000-164	87	10	signs	sign	NOUN
dentistry3000-164	87	11	of	of	ADP
dentistry3000-164	87	12	van	van	PROPN
dentistry3000-164	87	13	der	der	PROPN
dentistry3000-164	87	14	woude	woude	VERB
dentistry3000-164	87	15	syndrome	syndrome	NOUN
dentistry3000-164	87	16	:	:	PUNCT
dentistry3000-164	87	17	are	be	AUX
dentistry3000-164	87	18	distinct	distinct	ADJ
dentistry3000-164	87	19	genetic	genetic	ADJ
dentistry3000-164	87	20	modifiers	modifier	NOUN
dentistry3000-164	87	21	operating	operate	VERB
dentistry3000-164	87	22	?	?	PUNCT
dentistry3000-164	88	1	vol	vol	NOUN
dentistry3000-164	88	2	9	9	NUM
dentistry3000-164	88	3	no	no	DET
dentistry3000-164	88	4	1	1	NUM
dentistry3000-164	88	5	(	(	PUNCT
dentistry3000-164	88	6	2021	2021	NUM
dentistry3000-164	88	7	)	)	PUNCT
dentistry3000-164	88	8	doi	doi	NOUN
dentistry3000-164	88	9	10.5195	10.5195	NUM
dentistry3000-164	88	10	/	/	SYM
dentistry3000-164	88	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	88	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	88	13	table	table	NOUN
dentistry3000-164	88	14	2	2	NUM
dentistry3000-164	88	15	.	.	PUNCT
dentistry3000-164	89	1	phenotype	phenotype	NOUN
dentistry3000-164	89	2	variation	variation	NOUN
dentistry3000-164	89	3	of	of	ADP
dentistry3000-164	89	4	individuals	individual	NOUN
dentistry3000-164	89	5	with	with	ADP
dentistry3000-164	89	6	irf6	irf6	PROPN
dentistry3000-164	89	7	ser90thr	ser90thr	PROPN
dentistry3000-164	89	8	variant	variant	NOUN
dentistry3000-164	89	9	and	and	CCONJ
dentistry3000-164	89	10	van	van	PROPN
dentistry3000-164	89	11	der	der	PROPN
dentistry3000-164	89	12	woude	woude	VERB
dentistry3000-164	89	13	syndrome	syndrome	NOUN
dentistry3000-164	89	14	.	.	PUNCT
dentistry3000-164	90	1	affected	affect	VERB
dentistry3000-164	90	2	individuals	individual	NOUN
dentistry3000-164	90	3	pits	pit	VERB
dentistry3000-164	90	4	orofacial	orofacial	ADJ
dentistry3000-164	90	5	clefts	cleft	NOUN
dentistry3000-164	90	6	dental	dental	ADJ
dentistry3000-164	90	7	anomalies	anomaly	NOUN
dentistry3000-164	90	8	27	27	NUM
dentistry3000-164	90	9	-	-	PUNCT
dentistry3000-164	90	10	year	year	NOUN
dentistry3000-164	90	11	-	-	PUNCT
dentistry3000-164	90	12	old	old	ADJ
dentistry3000-164	90	13	female	female	NOUN
dentistry3000-164	90	14	,	,	PUNCT
dentistry3000-164	90	15	mother	mother	NOUN
dentistry3000-164	90	16	of	of	ADP
dentistry3000-164	90	17	2	2	NUM
dentistry3000-164	90	18	,	,	PUNCT
dentistry3000-164	90	19	3	3	NUM
dentistry3000-164	90	20	,	,	PUNCT
dentistry3000-164	90	21	4	4	NUM
dentistry3000-164	90	22	,	,	PUNCT
dentistry3000-164	90	23	and	and	CCONJ
dentistry3000-164	90	24	5	5	NUM
dentistry3000-164	90	25	yes	yes	NOUN
dentistry3000-164	90	26	left	leave	VERB
dentistry3000-164	90	27	cleft	cleft	NOUN
dentistry3000-164	90	28	lip	lip	NOUN
dentistry3000-164	90	29	microdontia	microdontia	PROPN
dentistry3000-164	90	30	of	of	ADP
dentistry3000-164	90	31	right	right	ADJ
dentistry3000-164	90	32	maxillary	maxillary	NOUN
dentistry3000-164	90	33	lateral	lateral	ADJ
dentistry3000-164	90	34	incisor	incisor	NOUN
dentistry3000-164	90	35	and	and	CCONJ
dentistry3000-164	90	36	agenesis	agenesis	NOUN
dentistry3000-164	90	37	of	of	ADP
dentistry3000-164	90	38	right	right	ADJ
dentistry3000-164	90	39	mandibular	mandibular	NOUN
dentistry3000-164	90	40	lateral	lateral	ADJ
dentistry3000-164	90	41	incisor	incisor	NOUN
dentistry3000-164	90	42	7	7	NUM
dentistry3000-164	90	43	-	-	PUNCT
dentistry3000-164	90	44	year	year	NOUN
dentistry3000-164	90	45	-	-	PUNCT
dentistry3000-164	90	46	old	old	ADJ
dentistry3000-164	90	47	female	female	NOUN
dentistry3000-164	90	48	,	,	PUNCT
dentistry3000-164	90	49	halfsister	halfsister	NOUN
dentistry3000-164	90	50	of	of	ADP
dentistry3000-164	90	51	3	3	NUM
dentistry3000-164	90	52	,	,	PUNCT
dentistry3000-164	90	53	4	4	NUM
dentistry3000-164	90	54	,	,	PUNCT
dentistry3000-164	90	55	and	and	CCONJ
dentistry3000-164	90	56	5	5	NUM
dentistry3000-164	90	57	*	*	NOUN
dentistry3000-164	90	58	yes	yes	INTJ
dentistry3000-164	90	59	bilateral	bilateral	ADJ
dentistry3000-164	90	60	cleft	cleft	NOUN
dentistry3000-164	90	61	lip	lip	NOUN
dentistry3000-164	90	62	with	with	ADP
dentistry3000-164	90	63	cleft	cleft	ADJ
dentistry3000-164	90	64	palate	palate	NOUN
dentistry3000-164	90	65	fusion	fusion	NOUN
dentistry3000-164	90	66	of	of	ADP
dentistry3000-164	90	67	mandibular	mandibular	ADJ
dentistry3000-164	90	68	primary	primary	ADJ
dentistry3000-164	90	69	left	leave	VERB
dentistry3000-164	90	70	lateral	lateral	ADJ
dentistry3000-164	90	71	incisor	incisor	NOUN
dentistry3000-164	90	72	and	and	CCONJ
dentistry3000-164	90	73	canine	canine	VERB
dentistry3000-164	90	74	4	4	NUM
dentistry3000-164	90	75	-	-	PUNCT
dentistry3000-164	90	76	year	year	NOUN
dentistry3000-164	90	77	-	-	PUNCT
dentistry3000-164	90	78	old	old	ADJ
dentistry3000-164	90	79	male	male	NOUN
dentistry3000-164	90	80	,	,	PUNCT
dentistry3000-164	90	81	brother	brother	NOUN
dentistry3000-164	90	82	of	of	ADP
dentistry3000-164	90	83	4	4	NUM
dentistry3000-164	90	84	and	and	CCONJ
dentistry3000-164	90	85	5	5	NUM
dentistry3000-164	91	1	yes	yes	INTJ
dentistry3000-164	91	2	no	no	DET
dentistry3000-164	91	3	agenesis	agenesis	NOUN
dentistry3000-164	91	4	of	of	ADP
dentistry3000-164	91	5	mandibular	mandibular	ADJ
dentistry3000-164	91	6	primary	primary	ADJ
dentistry3000-164	91	7	left	leave	VERB
dentistry3000-164	91	8	lateral	lateral	ADJ
dentistry3000-164	91	9	incisor	incisor	NOUN
dentistry3000-164	91	10	2	2	NUM
dentistry3000-164	91	11	-	-	PUNCT
dentistry3000-164	91	12	year	year	NOUN
dentistry3000-164	91	13	-	-	PUNCT
dentistry3000-164	91	14	old	old	ADJ
dentistry3000-164	91	15	female	female	NOUN
dentistry3000-164	91	16	,	,	PUNCT
dentistry3000-164	91	17	sister	sister	NOUN
dentistry3000-164	91	18	of	of	ADP
dentistry3000-164	91	19	5	5	NUM
dentistry3000-164	91	20	yes	yes	INTJ
dentistry3000-164	91	21	bilateral	bilateral	ADJ
dentistry3000-164	91	22	cleft	cleft	NOUN
dentistry3000-164	91	23	lip	lip	NOUN
dentistry3000-164	91	24	with	with	ADP
dentistry3000-164	91	25	cleft	cleft	NOUN
dentistry3000-164	91	26	palate	palate	NOUN
dentistry3000-164	91	27	none	none	NOUN
dentistry3000-164	91	28	evident	evident	ADJ
dentistry3000-164	91	29	1	1	NUM
dentistry3000-164	91	30	-	-	PUNCT
dentistry3000-164	91	31	year	year	NOUN
dentistry3000-164	91	32	-	-	PUNCT
dentistry3000-164	91	33	old	old	ADJ
dentistry3000-164	91	34	male	male	NOUN
dentistry3000-164	92	1	yes	yes	INTJ
dentistry3000-164	92	2	bilateral	bilateral	ADJ
dentistry3000-164	92	3	cleft	cleft	NOUN
dentistry3000-164	92	4	lip	lip	NOUN
dentistry3000-164	92	5	with	with	ADP
dentistry3000-164	92	6	cleft	cleft	NOUN
dentistry3000-164	92	7	palate	palate	NOUN
dentistry3000-164	92	8	none	none	NOUN
dentistry3000-164	92	9	evident	evident	ADJ
dentistry3000-164	92	10	*	*	PUNCT
dentistry3000-164	92	11	biological	biological	ADJ
dentistry3000-164	92	12	sample	sample	NOUN
dentistry3000-164	92	13	not	not	PART
dentistry3000-164	92	14	collected	collect	VERB
dentistry3000-164	92	15	.	.	PUNCT
dentistry3000-164	93	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	93	2	differential	differential	ADJ
dentistry3000-164	93	3	expression	expression	NOUN
dentistry3000-164	93	4	of	of	ADP
dentistry3000-164	93	5	the	the	DET
dentistry3000-164	93	6	irf6	irf6	PROPN
dentistry3000-164	93	7	gene	gene	NOUN
dentistry3000-164	93	8	in	in	ADP
dentistry3000-164	93	9	the	the	DET
dentistry3000-164	93	10	signs	sign	NOUN
dentistry3000-164	93	11	of	of	ADP
dentistry3000-164	93	12	van	van	PROPN
dentistry3000-164	93	13	der	der	PROPN
dentistry3000-164	93	14	woude	woude	VERB
dentistry3000-164	93	15	syndrome	syndrome	NOUN
dentistry3000-164	93	16	:	:	PUNCT
dentistry3000-164	93	17	are	be	AUX
dentistry3000-164	93	18	distinct	distinct	ADJ
dentistry3000-164	93	19	genetic	genetic	ADJ
dentistry3000-164	93	20	modifiers	modifier	NOUN
dentistry3000-164	93	21	operating	operate	VERB
dentistry3000-164	93	22	?	?	PUNCT
dentistry3000-164	94	1	vol	vol	NOUN
dentistry3000-164	94	2	9	9	NUM
dentistry3000-164	94	3	no	no	DET
dentistry3000-164	94	4	1	1	NUM
dentistry3000-164	94	5	(	(	PUNCT
dentistry3000-164	94	6	2021	2021	NUM
dentistry3000-164	94	7	)	)	PUNCT
dentistry3000-164	94	8	doi	doi	NOUN
dentistry3000-164	94	9	10.5195	10.5195	NUM
dentistry3000-164	94	10	/	/	SYM
dentistry3000-164	94	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	94	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	94	13	the	the	DET
dentistry3000-164	94	14	sequencing	sequence	VERB
dentistry3000-164	94	15	analysis	analysis	NOUN
dentistry3000-164	94	16	of	of	ADP
dentistry3000-164	94	17	exon	exon	NOUN
dentistry3000-164	94	18	4	4	NUM
dentistry3000-164	94	19	of	of	ADP
dentistry3000-164	94	20	the	the	DET
dentistry3000-164	94	21	irf6	irf6	PROPN
dentistry3000-164	94	22	gene	gene	NOUN
dentistry3000-164	94	23	,	,	PUNCT
dentistry3000-164	94	24	performed	perform	VERB
dentistry3000-164	94	25	for	for	ADP
dentistry3000-164	94	26	4	4	NUM
dentistry3000-164	94	27	family	family	NOUN
dentistry3000-164	94	28	members	member	NOUN
dentistry3000-164	94	29	(	(	PUNCT
dentistry3000-164	94	30	table	table	NOUN
dentistry3000-164	94	31	2	2	NUM
dentistry3000-164	94	32	)	)	PUNCT
dentistry3000-164	94	33	,	,	PUNCT
dentistry3000-164	94	34	revealed	reveal	VERB
dentistry3000-164	94	35	the	the	DET
dentistry3000-164	94	36	presence	presence	NOUN
dentistry3000-164	94	37	of	of	ADP
dentistry3000-164	94	38	the	the	DET
dentistry3000-164	94	39	snp	snp	ADJ
dentistry3000-164	94	40	rs7552506	rs7552506	NOUN
dentistry3000-164	94	41	(	(	PUNCT
dentistry3000-164	94	42	nm_006147.3	nm_006147.3	NOUN
dentistry3000-164	94	43	:	:	PUNCT
dentistry3000-164	94	44	c.1755c	c.1755c	NOUN
dentistry3000-164	94	45	>	>	X
dentistry3000-164	94	46	g	g	PROPN
dentistry3000-164	94	47	)	)	PUNCT
dentistry3000-164	94	48	,	,	PUNCT
dentistry3000-164	94	49	located	locate	VERB
dentistry3000-164	94	50	five	five	NUM
dentistry3000-164	94	51	base	base	NOUN
dentistry3000-164	94	52	pairs	pair	NOUN
dentistry3000-164	94	53	before	before	ADP
dentistry3000-164	94	54	exon	exon	NOUN
dentistry3000-164	94	55	and	and	CCONJ
dentistry3000-164	94	56	revealed	reveal	VERB
dentistry3000-164	94	57	a	a	DET
dentistry3000-164	94	58	new	new	ADJ
dentistry3000-164	94	59	variant	variant	NOUN
dentistry3000-164	94	60	c.269g	c.269g	PROPN
dentistry3000-164	94	61	>	>	X
dentistry3000-164	94	62	c	c	X
dentistry3000-164	94	63	(	(	PUNCT
dentistry3000-164	94	64	p.ser90thr	p.ser90thr	NOUN
dentistry3000-164	94	65	)	)	PUNCT
dentistry3000-164	94	66	present	present	NOUN
dentistry3000-164	94	67	in	in	ADP
dentistry3000-164	94	68	heterozygosity	heterozygosity	NOUN
dentistry3000-164	94	69	in	in	ADP
dentistry3000-164	94	70	the	the	DET
dentistry3000-164	94	71	4	4	NUM
dentistry3000-164	94	72	affected	affected	ADJ
dentistry3000-164	94	73	family	family	NOUN
dentistry3000-164	94	74	members	member	NOUN
dentistry3000-164	94	75	(	(	PUNCT
dentistry3000-164	94	76	figure	figure	NOUN
dentistry3000-164	94	77	2	2	NUM
dentistry3000-164	94	78	)	)	PUNCT
dentistry3000-164	94	79	.	.	PUNCT
dentistry3000-164	95	1	the	the	PRON
dentistry3000-164	95	2	in	in	ADP
dentistry3000-164	95	3	silico	silico	NOUN
dentistry3000-164	95	4	analysis	analysis	NOUN
dentistry3000-164	95	5	using	use	VERB
dentistry3000-164	95	6	the	the	DET
dentistry3000-164	95	7	provean	provean	ADJ
dentistry3000-164	95	8	tool	tool	NOUN
dentistry3000-164	95	9	,	,	PUNCT
dentistry3000-164	95	10	pointed	point	VERB
dentistry3000-164	95	11	out	out	ADP
dentistry3000-164	95	12	that	that	SCONJ
dentistry3000-164	95	13	the	the	DET
dentistry3000-164	95	14	c.269	c.269	NOUN
dentistry3000-164	95	15	g	g	NOUN
dentistry3000-164	95	16	>	>	X
dentistry3000-164	95	17	c	c	PROPN
dentistry3000-164	95	18	variant	variant	NOUN
dentistry3000-164	95	19	(	(	PUNCT
dentistry3000-164	95	20	p.ser90thr	p.ser90thr	NOUN
dentistry3000-164	95	21	)	)	PUNCT
dentistry3000-164	95	22	should	should	AUX
dentistry3000-164	95	23	be	be	AUX
dentistry3000-164	95	24	considered	consider	VERB
dentistry3000-164	95	25	as	as	ADV
dentistry3000-164	95	26	deleterious	deleterious	ADJ
dentistry3000-164	95	27	since	since	SCONJ
dentistry3000-164	95	28	this	this	DET
dentistry3000-164	95	29	variant	variant	NOUN
dentistry3000-164	95	30	had	have	VERB
dentistry3000-164	95	31	a	a	DET
dentistry3000-164	95	32	score	score	NOUN
dentistry3000-164	95	33	of	of	ADP
dentistry3000-164	95	34	-2.704	-2.704	NOUN
dentistry3000-164	95	35	;	;	PUNCT
dentistry3000-164	95	36	according	accord	VERB
dentistry3000-164	95	37	to	to	ADP
dentistry3000-164	95	38	the	the	DET
dentistry3000-164	95	39	platform	platform	NOUN
dentistry3000-164	95	40	parameters	parameter	NOUN
dentistry3000-164	95	41	,	,	PUNCT
dentistry3000-164	95	42	a	a	DET
dentistry3000-164	95	43	variant	variant	NOUN
dentistry3000-164	95	44	below	below	ADP
dentistry3000-164	95	45	the	the	DET
dentistry3000-164	95	46	score	score	NOUN
dentistry3000-164	95	47	of	of	ADP
dentistry3000-164	95	48	-2.5	-2.5	PROPN
dentistry3000-164	95	49	is	be	AUX
dentistry3000-164	95	50	considered	consider	VERB
dentistry3000-164	95	51	deleterious	deleterious	ADJ
dentistry3000-164	95	52	.	.	PUNCT
dentistry3000-164	96	1	as	as	ADP
dentistry3000-164	96	2	for	for	ADP
dentistry3000-164	96	3	the	the	DET
dentistry3000-164	96	4	prediction	prediction	NOUN
dentistry3000-164	96	5	result	result	NOUN
dentistry3000-164	96	6	obtained	obtain	VERB
dentistry3000-164	96	7	by	by	ADP
dentistry3000-164	96	8	the	the	DET
dentistry3000-164	96	9	poliphen-2	poliphen-2	NUM
dentistry3000-164	96	10	tool	tool	NOUN
dentistry3000-164	96	11	,	,	PUNCT
dentistry3000-164	96	12	the	the	DET
dentistry3000-164	96	13	new	new	ADJ
dentistry3000-164	96	14	variant	variant	NOUN
dentistry3000-164	96	15	was	be	AUX
dentistry3000-164	96	16	considered	consider	VERB
dentistry3000-164	96	17	potentially	potentially	ADV
dentistry3000-164	96	18	deleterious	deleterious	ADJ
dentistry3000-164	96	19	,	,	PUNCT
dentistry3000-164	96	20	with	with	ADP
dentistry3000-164	96	21	a	a	DET
dentistry3000-164	96	22	score	score	NOUN
dentistry3000-164	96	23	of	of	ADP
dentistry3000-164	96	24	1,000	1,000	NUM
dentistry3000-164	96	25	(	(	PUNCT
dentistry3000-164	96	26	sensitivity	sensitivity	NOUN
dentistry3000-164	96	27	:	:	PUNCT
dentistry3000-164	96	28	0.00	0.00	NUM
dentistry3000-164	96	29	;	;	PUNCT
dentistry3000-164	96	30	specificity	specificity	NOUN
dentistry3000-164	96	31	:	:	PUNCT
dentistry3000-164	96	32	1.00	1.00	NUM
dentistry3000-164	96	33	)	)	PUNCT
dentistry3000-164	96	34	.	.	PUNCT
dentistry3000-164	97	1	according	accord	VERB
dentistry3000-164	97	2	to	to	ADP
dentistry3000-164	97	3	the	the	DET
dentistry3000-164	97	4	sift	sift	ADJ
dentistry3000-164	97	5	tool	tool	NOUN
dentistry3000-164	97	6	this	this	DET
dentistry3000-164	97	7	variant	variant	NOUN
dentistry3000-164	97	8	is	be	AUX
dentistry3000-164	97	9	predicted	predict	VERB
dentistry3000-164	97	10	as	as	SCONJ
dentistry3000-164	97	11	tolerated	tolerate	VERB
dentistry3000-164	97	12	with	with	ADP
dentistry3000-164	97	13	a	a	DET
dentistry3000-164	97	14	score	score	NOUN
dentistry3000-164	97	15	of	of	ADP
dentistry3000-164	97	16	0.37	0.37	NUM
dentistry3000-164	97	17	.	.	PUNCT
dentistry3000-164	98	1	one	one	NUM
dentistry3000-164	98	2	of	of	ADP
dentistry3000-164	98	3	the	the	DET
dentistry3000-164	98	4	most	most	ADV
dentistry3000-164	98	5	informative	informative	ADJ
dentistry3000-164	98	6	prediction	prediction	NOUN
dentistry3000-164	98	7	tools	tool	NOUN
dentistry3000-164	98	8	was	be	AUX
dentistry3000-164	98	9	hope	hope	NOUN
dentistry3000-164	98	10	.	.	PUNCT
dentistry3000-164	99	1	the	the	DET
dentistry3000-164	99	2	analysis	analysis	NOUN
dentistry3000-164	99	3	derived	derive	VERB
dentistry3000-164	99	4	from	from	ADP
dentistry3000-164	99	5	it	it	PRON
dentistry3000-164	99	6	provided	provide	VERB
dentistry3000-164	99	7	information	information	NOUN
dentistry3000-164	99	8	about	about	ADP
dentistry3000-164	99	9	the	the	DET
dentistry3000-164	99	10	structure	structure	NOUN
dentistry3000-164	99	11	of	of	ADP
dentistry3000-164	99	12	the	the	DET
dentistry3000-164	99	13	mutant	mutant	ADJ
dentistry3000-164	99	14	amino	amino	NOUN
dentistry3000-164	99	15	acid	acid	NOUN
dentistry3000-164	99	16	residue	residue	NOUN
dentistry3000-164	99	17	compared	compare	VERB
dentistry3000-164	99	18	to	to	ADP
dentistry3000-164	99	19	the	the	DET
dentistry3000-164	99	20	wild	wild	ADJ
dentistry3000-164	99	21	type	type	NOUN
dentistry3000-164	99	22	of	of	ADP
dentistry3000-164	99	23	residue	residue	NOUN
dentistry3000-164	99	24	,	,	PUNCT
dentistry3000-164	99	25	showing	show	VERB
dentistry3000-164	99	26	that	that	SCONJ
dentistry3000-164	99	27	the	the	DET
dentistry3000-164	99	28	mutant	mutant	ADJ
dentistry3000-164	99	29	residue	residue	NOUN
dentistry3000-164	99	30	is	be	AUX
dentistry3000-164	99	31	structurally	structurally	ADV
dentistry3000-164	99	32	larger	large	ADJ
dentistry3000-164	99	33	,	,	PUNCT
dentistry3000-164	99	34	a	a	DET
dentistry3000-164	99	35	factor	factor	NOUN
dentistry3000-164	99	36	that	that	PRON
dentistry3000-164	99	37	can	can	AUX
dentistry3000-164	99	38	interfere	interfere	VERB
dentistry3000-164	99	39	in	in	ADP
dentistry3000-164	99	40	the	the	DET
dentistry3000-164	99	41	multimeric	multimeric	ADJ
dentistry3000-164	99	42	interactions	interaction	NOUN
dentistry3000-164	99	43	and	and	CCONJ
dentistry3000-164	99	44	in	in	ADP
dentistry3000-164	99	45	the	the	DET
dentistry3000-164	99	46	conformation	conformation	NOUN
dentistry3000-164	99	47	of	of	ADP
dentistry3000-164	99	48	the	the	DET
dentistry3000-164	99	49	protein	protein	NOUN
dentistry3000-164	99	50	(	(	PUNCT
dentistry3000-164	99	51	figure	figure	NOUN
dentistry3000-164	99	52	3	3	NUM
dentistry3000-164	99	53	)	)	PUNCT
dentistry3000-164	99	54	.	.	PUNCT
dentistry3000-164	100	1	b	b	X
dentistry3000-164	100	2	a	a	DET
dentistry3000-164	100	3	figure	figure	NOUN
dentistry3000-164	100	4	2	2	NUM
dentistry3000-164	100	5	.	.	PUNCT
dentistry3000-164	101	1	electropherograms	electropherogram	NOUN
dentistry3000-164	101	2	showing	show	VERB
dentistry3000-164	101	3	sequence	sequence	NOUN
dentistry3000-164	101	4	without	without	ADP
dentistry3000-164	101	5	variant	variant	NOUN
dentistry3000-164	101	6	(	(	PUNCT
dentistry3000-164	101	7	a	a	NOUN
dentistry3000-164	101	8	)	)	PUNCT
dentistry3000-164	101	9	and	and	CCONJ
dentistry3000-164	101	10	with	with	ADP
dentistry3000-164	101	11	the	the	DET
dentistry3000-164	101	12	new	new	ADJ
dentistry3000-164	101	13	mutation	mutation	NOUN
dentistry3000-164	101	14	in	in	ADP
dentistry3000-164	101	15	exon	exon	NOUN
dentistry3000-164	101	16	4	4	NUM
dentistry3000-164	101	17	of	of	ADP
dentistry3000-164	101	18	the	the	DET
dentistry3000-164	101	19	irf6	irf6	PROPN
dentistry3000-164	101	20	gene	gene	NOUN
dentistry3000-164	101	21	(	(	PUNCT
dentistry3000-164	101	22	b	b	NOUN
dentistry3000-164	101	23	)	)	PUNCT
dentistry3000-164	101	24	.	.	PUNCT
dentistry3000-164	102	1	an	an	DET
dentistry3000-164	102	2	arrow	arrow	NOUN
dentistry3000-164	102	3	indicates	indicate	VERB
dentistry3000-164	102	4	the	the	DET
dentistry3000-164	102	5	altered	altered	ADJ
dentistry3000-164	102	6	nucleotide	nucleotide	NOUN
dentistry3000-164	102	7	.	.	PUNCT
dentistry3000-164	103	1	a	a	DET
dentistry3000-164	103	2	b	b	NOUN
dentistry3000-164	103	3	c	c	X
dentistry3000-164	103	4	figure	figure	NOUN
dentistry3000-164	103	5	3	3	NUM
dentistry3000-164	103	6	.	.	NOUN
dentistry3000-164	103	7	images	image	NOUN
dentistry3000-164	103	8	representing	represent	VERB
dentistry3000-164	103	9	parts	part	NOUN
dentistry3000-164	103	10	of	of	ADP
dentistry3000-164	103	11	the	the	DET
dentistry3000-164	103	12	protein	protein	NOUN
dentistry3000-164	103	13	structure	structure	NOUN
dentistry3000-164	103	14	with	with	ADP
dentistry3000-164	103	15	the	the	DET
dentistry3000-164	103	16	mutant	mutant	ADJ
dentistry3000-164	103	17	residue	residue	NOUN
dentistry3000-164	103	18	.	.	PUNCT
dentistry3000-164	104	1	a.	a.	NOUN
dentistry3000-164	104	2	ribbon	ribbon	NOUN
dentistry3000-164	104	3	overview	overview	NOUN
dentistry3000-164	104	4	of	of	ADP
dentistry3000-164	104	5	the	the	DET
dentistry3000-164	104	6	protein	protein	NOUN
dentistry3000-164	104	7	,	,	PUNCT
dentistry3000-164	104	8	in	in	ADP
dentistry3000-164	104	9	gray	gray	ADJ
dentistry3000-164	104	10	,	,	PUNCT
dentistry3000-164	104	11	with	with	ADP
dentistry3000-164	104	12	the	the	DET
dentistry3000-164	104	13	mutant	mutant	ADJ
dentistry3000-164	104	14	residue	residue	NOUN
dentistry3000-164	104	15	represented	represent	VERB
dentistry3000-164	104	16	in	in	ADP
dentistry3000-164	104	17	purple	purple	NOUN
dentistry3000-164	104	18	.	.	PUNCT
dentistry3000-164	105	1	b	b	NOUN
dentistry3000-164	105	2	and	and	CCONJ
dentistry3000-164	105	3	c.	c.	NOUN
dentistry3000-164	105	4	detailed	detailed	ADJ
dentistry3000-164	105	5	view	view	NOUN
dentistry3000-164	105	6	of	of	ADP
dentistry3000-164	105	7	the	the	DET
dentistry3000-164	105	8	representation	representation	NOUN
dentistry3000-164	105	9	of	of	ADP
dentistry3000-164	105	10	the	the	DET
dentistry3000-164	105	11	side	side	NOUN
dentistry3000-164	105	12	chains	chain	NOUN
dentistry3000-164	105	13	of	of	ADP
dentistry3000-164	105	14	the	the	DET
dentistry3000-164	105	15	mutant	mutant	ADJ
dentistry3000-164	105	16	amino	amino	NOUN
dentistry3000-164	105	17	acid	acid	NOUN
dentistry3000-164	105	18	residue	residue	NOUN
dentistry3000-164	105	19	,	,	PUNCT
dentistry3000-164	105	20	in	in	ADP
dentistry3000-164	105	21	red	red	NOUN
dentistry3000-164	105	22	compared	compare	VERB
dentistry3000-164	105	23	to	to	ADP
dentistry3000-164	105	24	the	the	DET
dentistry3000-164	105	25	wild	wild	ADJ
dentistry3000-164	105	26	residue	residue	NOUN
dentistry3000-164	105	27	,	,	PUNCT
dentistry3000-164	105	28	in	in	ADP
dentistry3000-164	105	29	green	green	ADJ
dentistry3000-164	105	30	.	.	PUNCT
dentistry3000-164	106	1	source	source	NOUN
dentistry3000-164	106	2	:	:	PUNCT
dentistry3000-164	106	3	generated	generate	VERB
dentistry3000-164	106	4	by	by	ADP
dentistry3000-164	106	5	the	the	DET
dentistry3000-164	106	6	hope	hope	PROPN
dentistry3000-164	106	7	tool	tool	PROPN
dentistry3000-164	106	8	report	report	PROPN
dentistry3000-164	106	9	.	.	PUNCT
dentistry3000-164	107	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	107	2	differential	differential	ADJ
dentistry3000-164	107	3	expression	expression	NOUN
dentistry3000-164	107	4	of	of	ADP
dentistry3000-164	107	5	the	the	DET
dentistry3000-164	107	6	irf6	irf6	PROPN
dentistry3000-164	107	7	gene	gene	NOUN
dentistry3000-164	107	8	in	in	ADP
dentistry3000-164	107	9	the	the	DET
dentistry3000-164	107	10	signs	sign	NOUN
dentistry3000-164	107	11	of	of	ADP
dentistry3000-164	107	12	van	van	PROPN
dentistry3000-164	107	13	der	der	PROPN
dentistry3000-164	107	14	woude	woude	VERB
dentistry3000-164	107	15	syndrome	syndrome	NOUN
dentistry3000-164	107	16	:	:	PUNCT
dentistry3000-164	107	17	are	be	AUX
dentistry3000-164	107	18	distinct	distinct	ADJ
dentistry3000-164	107	19	genetic	genetic	ADJ
dentistry3000-164	107	20	modifiers	modifier	NOUN
dentistry3000-164	107	21	operating	operate	VERB
dentistry3000-164	107	22	?	?	PUNCT
dentistry3000-164	108	1	vol	vol	NOUN
dentistry3000-164	108	2	9	9	NUM
dentistry3000-164	108	3	no	no	DET
dentistry3000-164	108	4	1	1	NUM
dentistry3000-164	108	5	(	(	PUNCT
dentistry3000-164	108	6	2021	2021	NUM
dentistry3000-164	108	7	)	)	PUNCT
dentistry3000-164	108	8	doi	doi	NOUN
dentistry3000-164	108	9	10.5195	10.5195	NUM
dentistry3000-164	108	10	/	/	SYM
dentistry3000-164	108	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	108	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	108	13	discussion	discussion	NOUN
dentistry3000-164	108	14	for	for	ADP
dentistry3000-164	108	15	the	the	DET
dentistry3000-164	108	16	clinical	clinical	ADJ
dentistry3000-164	108	17	diagnosis	diagnosis	NOUN
dentistry3000-164	108	18	of	of	ADP
dentistry3000-164	108	19	vws	vws	PROPN
dentistry3000-164	108	20	,	,	PUNCT
dentistry3000-164	108	21	lower	low	ADJ
dentistry3000-164	108	22	lip	lip	NOUN
dentistry3000-164	108	23	pits	pit	NOUN
dentistry3000-164	108	24	must	must	AUX
dentistry3000-164	108	25	be	be	AUX
dentistry3000-164	108	26	present	present	ADJ
dentistry3000-164	108	27	in	in	ADP
dentistry3000-164	108	28	one	one	NUM
dentistry3000-164	108	29	or	or	CCONJ
dentistry3000-164	108	30	more	more	ADJ
dentistry3000-164	108	31	members	member	NOUN
dentistry3000-164	108	32	of	of	ADP
dentistry3000-164	108	33	a	a	DET
dentistry3000-164	108	34	family	family	NOUN
dentistry3000-164	108	35	,	,	PUNCT
dentistry3000-164	108	36	together	together	ADV
dentistry3000-164	108	37	with	with	ADP
dentistry3000-164	108	38	the	the	DET
dentistry3000-164	108	39	presence	presence	NOUN
dentistry3000-164	108	40	of	of	ADP
dentistry3000-164	108	41	cleft	cleft	NOUN
dentistry3000-164	108	42	lip	lip	NOUN
dentistry3000-164	108	43	with	with	ADP
dentistry3000-164	108	44	or	or	CCONJ
dentistry3000-164	108	45	without	without	ADP
dentistry3000-164	108	46	cleft	cleft	NOUN
dentistry3000-164	108	47	palate	palate	NOUN
dentistry3000-164	108	48	and	and	CCONJ
dentistry3000-164	108	49	cleft	cleft	NOUN
dentistry3000-164	108	50	palate	palate	NOUN
dentistry3000-164	109	1	[	[	X
dentistry3000-164	109	2	22	22	NUM
dentistry3000-164	109	3	]	]	PUNCT
dentistry3000-164	109	4	.	.	PUNCT
dentistry3000-164	110	1	the	the	DET
dentistry3000-164	110	2	family	family	NOUN
dentistry3000-164	110	3	investigated	investigate	VERB
dentistry3000-164	110	4	in	in	ADP
dentistry3000-164	110	5	this	this	DET
dentistry3000-164	110	6	study	study	NOUN
dentistry3000-164	110	7	presented	present	VERB
dentistry3000-164	110	8	both	both	CCONJ
dentistry3000-164	110	9	the	the	DET
dentistry3000-164	110	10	classic	classic	ADJ
dentistry3000-164	110	11	vws	vws	PROPN
dentistry3000-164	110	12	triad	triad	NUM
dentistry3000-164	110	13	and	and	CCONJ
dentistry3000-164	110	14	mixed	mixed	ADJ
dentistry3000-164	110	15	types	type	NOUN
dentistry3000-164	110	16	of	of	ADP
dentistry3000-164	110	17	clefts	cleft	NOUN
dentistry3000-164	110	18	.	.	PUNCT
dentistry3000-164	111	1	compared	compare	VERB
dentistry3000-164	111	2	to	to	ADP
dentistry3000-164	111	3	other	other	ADJ
dentistry3000-164	111	4	families	family	NOUN
dentistry3000-164	111	5	,	,	PUNCT
dentistry3000-164	111	6	the	the	DET
dentistry3000-164	111	7	percentage	percentage	NOUN
dentistry3000-164	111	8	of	of	ADP
dentistry3000-164	111	9	individuals	individual	NOUN
dentistry3000-164	111	10	affected	affect	VERB
dentistry3000-164	111	11	in	in	ADP
dentistry3000-164	111	12	the	the	DET
dentistry3000-164	111	13	studied	studied	ADJ
dentistry3000-164	111	14	family	family	NOUN
dentistry3000-164	111	15	(	(	PUNCT
dentistry3000-164	111	16	36.4	36.4	NUM
dentistry3000-164	111	17	%	%	NOUN
dentistry3000-164	111	18	,	,	PUNCT
dentistry3000-164	111	19	28/77	28/77	NUM
dentistry3000-164	111	20	)	)	PUNCT
dentistry3000-164	111	21	differs	differ	VERB
dentistry3000-164	111	22	little	little	ADJ
dentistry3000-164	111	23	from	from	ADP
dentistry3000-164	111	24	the	the	DET
dentistry3000-164	111	25	percentages	percentage	NOUN
dentistry3000-164	111	26	found	find	VERB
dentistry3000-164	111	27	by	by	ADP
dentistry3000-164	111	28	martellijúnior	martellijúnior	PROPN
dentistry3000-164	111	29	et	et	PROPN
dentistry3000-164	111	30	al	al	PROPN
dentistry3000-164	111	31	.	.	PROPN
dentistry3000-164	112	1	(	(	PUNCT
dentistry3000-164	112	2	2007	2007	NUM
dentistry3000-164	112	3	)	)	PUNCT
dentistry3000-164	113	1	[	[	X
dentistry3000-164	113	2	23	23	NUM
dentistry3000-164	113	3	]	]	PUNCT
dentistry3000-164	113	4	who	who	PRON
dentistry3000-164	113	5	studied	study	VERB
dentistry3000-164	113	6	two	two	NUM
dentistry3000-164	113	7	brazilian	brazilian	ADJ
dentistry3000-164	113	8	families	family	NOUN
dentistry3000-164	113	9	with	with	ADP
dentistry3000-164	113	10	vws	vws	PROPN
dentistry3000-164	113	11	,	,	PUNCT
dentistry3000-164	113	12	one	one	NUM
dentistry3000-164	113	13	with	with	ADP
dentistry3000-164	113	14	54	54	NUM
dentistry3000-164	113	15	and	and	CCONJ
dentistry3000-164	113	16	the	the	DET
dentistry3000-164	113	17	other	other	ADJ
dentistry3000-164	113	18	with	with	ADP
dentistry3000-164	113	19	17	17	NUM
dentistry3000-164	113	20	descendants	descendant	NOUN
dentistry3000-164	113	21	,	,	PUNCT
dentistry3000-164	113	22	where	where	SCONJ
dentistry3000-164	113	23	the	the	DET
dentistry3000-164	113	24	phenotypic	phenotypic	ADJ
dentistry3000-164	113	25	characteristics	characteristic	NOUN
dentistry3000-164	113	26	of	of	ADP
dentistry3000-164	113	27	the	the	DET
dentistry3000-164	113	28	syndrome	syndrome	NOUN
dentistry3000-164	113	29	were	be	AUX
dentistry3000-164	113	30	present	present	ADJ
dentistry3000-164	113	31	in	in	ADP
dentistry3000-164	113	32	22.23	22.23	NUM
dentistry3000-164	113	33	%	%	NOUN
dentistry3000-164	113	34	and	and	CCONJ
dentistry3000-164	113	35	47.06	47.06	NUM
dentistry3000-164	113	36	%	%	NOUN
dentistry3000-164	113	37	of	of	ADP
dentistry3000-164	113	38	the	the	DET
dentistry3000-164	113	39	family	family	NOUN
dentistry3000-164	113	40	members	member	NOUN
dentistry3000-164	113	41	,	,	PUNCT
dentistry3000-164	113	42	respectively	respectively	ADV
dentistry3000-164	113	43	.	.	PUNCT
dentistry3000-164	114	1	due	due	ADP
dentistry3000-164	114	2	to	to	ADP
dentistry3000-164	114	3	the	the	DET
dentistry3000-164	114	4	fact	fact	NOUN
dentistry3000-164	114	5	that	that	SCONJ
dentistry3000-164	114	6	in	in	ADP
dentistry3000-164	114	7	each	each	DET
dentistry3000-164	114	8	generation	generation	NOUN
dentistry3000-164	114	9	of	of	ADP
dentistry3000-164	114	10	the	the	DET
dentistry3000-164	114	11	studied	studied	ADJ
dentistry3000-164	114	12	family	family	NOUN
dentistry3000-164	114	13	there	there	PRON
dentistry3000-164	114	14	is	be	VERB
dentistry3000-164	114	15	at	at	ADV
dentistry3000-164	114	16	least	least	ADJ
dentistry3000-164	114	17	one	one	NUM
dentistry3000-164	114	18	affected	affected	ADJ
dentistry3000-164	114	19	member	member	NOUN
dentistry3000-164	114	20	and	and	CCONJ
dentistry3000-164	114	21	they	they	PRON
dentistry3000-164	114	22	also	also	ADV
dentistry3000-164	114	23	had	have	VERB
dentistry3000-164	114	24	at	at	ADV
dentistry3000-164	114	25	least	least	ADJ
dentistry3000-164	114	26	one	one	NUM
dentistry3000-164	114	27	of	of	ADP
dentistry3000-164	114	28	their	their	PRON
dentistry3000-164	114	29	parents	parent	NOUN
dentistry3000-164	114	30	affected	affect	VERB
dentistry3000-164	114	31	,	,	PUNCT
dentistry3000-164	114	32	it	it	PRON
dentistry3000-164	114	33	’s	’	VERB
dentistry3000-164	114	34	clear	clear	ADJ
dentistry3000-164	114	35	that	that	SCONJ
dentistry3000-164	114	36	this	this	DET
dentistry3000-164	114	37	family	family	NOUN
dentistry3000-164	114	38	follows	follow	VERB
dentistry3000-164	114	39	the	the	DET
dentistry3000-164	114	40	expected	expect	VERB
dentistry3000-164	114	41	high	high	ADJ
dentistry3000-164	114	42	penetrance	penetrance	NOUN
dentistry3000-164	114	43	that	that	PRON
dentistry3000-164	114	44	can	can	AUX
dentistry3000-164	114	45	vary	vary	VERB
dentistry3000-164	114	46	from	from	ADP
dentistry3000-164	114	47	80	80	NUM
dentistry3000-164	114	48	%	%	NOUN
dentistry3000-164	114	49	to	to	PART
dentistry3000-164	114	50	100	100	NUM
dentistry3000-164	114	51	%	%	NOUN
dentistry3000-164	114	52	according	accord	VERB
dentistry3000-164	114	53	to	to	ADP
dentistry3000-164	114	54	previous	previous	ADJ
dentistry3000-164	114	55	studies	study	NOUN
dentistry3000-164	114	56	in	in	ADP
dentistry3000-164	114	57	the	the	DET
dentistry3000-164	114	58	literature	literature	NOUN
dentistry3000-164	114	59	[	[	X
dentistry3000-164	114	60	2	2	NUM
dentistry3000-164	114	61	,	,	PUNCT
dentistry3000-164	114	62	24	24	NUM
dentistry3000-164	114	63	]	]	PUNCT
dentistry3000-164	114	64	.	.	PUNCT
dentistry3000-164	115	1	variable	variable	ADJ
dentistry3000-164	115	2	expression	expression	NOUN
dentistry3000-164	115	3	was	be	AUX
dentistry3000-164	115	4	observed	observe	VERB
dentistry3000-164	115	5	in	in	ADP
dentistry3000-164	115	6	the	the	DET
dentistry3000-164	115	7	studied	studied	ADJ
dentistry3000-164	115	8	family	family	NOUN
dentistry3000-164	115	9	,	,	PUNCT
dentistry3000-164	115	10	with	with	ADP
dentistry3000-164	115	11	the	the	DET
dentistry3000-164	115	12	main	main	ADJ
dentistry3000-164	115	13	phenotypic	phenotypic	ADJ
dentistry3000-164	115	14	manifestation	manifestation	NOUN
dentistry3000-164	115	15	of	of	ADP
dentistry3000-164	115	16	vws	vws	PROPN
dentistry3000-164	115	17	in	in	ADP
dentistry3000-164	115	18	the	the	DET
dentistry3000-164	115	19	affected	affected	ADJ
dentistry3000-164	115	20	individuals	individual	NOUN
dentistry3000-164	115	21	being	be	AUX
dentistry3000-164	115	22	congenital	congenital	ADJ
dentistry3000-164	115	23	lip	lip	NOUN
dentistry3000-164	115	24	pits	pit	NOUN
dentistry3000-164	115	25	.	.	PUNCT
dentistry3000-164	116	1	according	accord	VERB
dentistry3000-164	116	2	to	to	ADP
dentistry3000-164	116	3	the	the	DET
dentistry3000-164	116	4	literature	literature	NOUN
dentistry3000-164	116	5	,	,	PUNCT
dentistry3000-164	116	6	this	this	DET
dentistry3000-164	116	7	type	type	NOUN
dentistry3000-164	116	8	of	of	ADP
dentistry3000-164	116	9	pits	pit	NOUN
dentistry3000-164	116	10	occurs	occur	VERB
dentistry3000-164	116	11	in	in	ADP
dentistry3000-164	116	12	around	around	ADP
dentistry3000-164	116	13	85	85	NUM
dentistry3000-164	116	14	%	%	NOUN
dentistry3000-164	116	15	of	of	ADP
dentistry3000-164	116	16	individuals	individual	NOUN
dentistry3000-164	116	17	affected	affect	VERB
dentistry3000-164	116	18	by	by	ADP
dentistry3000-164	116	19	vws	vws	PROPN
dentistry3000-164	116	20	and	and	CCONJ
dentistry3000-164	116	21	in	in	ADP
dentistry3000-164	116	22	64	64	NUM
dentistry3000-164	116	23	%	%	NOUN
dentistry3000-164	116	24	of	of	ADP
dentistry3000-164	116	25	cases	case	NOUN
dentistry3000-164	116	26	it	it	PRON
dentistry3000-164	116	27	is	be	AUX
dentistry3000-164	116	28	the	the	DET
dentistry3000-164	116	29	only	only	ADJ
dentistry3000-164	116	30	manifestation	manifestation	NOUN
dentistry3000-164	116	31	of	of	ADP
dentistry3000-164	116	32	the	the	DET
dentistry3000-164	116	33	syndrome	syndrome	NOUN
dentistry3000-164	116	34	[	[	X
dentistry3000-164	116	35	4	4	NUM
dentistry3000-164	116	36	,	,	PUNCT
dentistry3000-164	116	37	7	7	NUM
dentistry3000-164	116	38	]	]	PUNCT
dentistry3000-164	116	39	.	.	PUNCT
dentistry3000-164	117	1	regarding	regard	VERB
dentistry3000-164	117	2	orofacial	orofacial	ADJ
dentistry3000-164	117	3	clefts	cleft	NOUN
dentistry3000-164	117	4	,	,	PUNCT
dentistry3000-164	117	5	the	the	DET
dentistry3000-164	117	6	studied	studied	ADJ
dentistry3000-164	117	7	family	family	NOUN
dentistry3000-164	117	8	presented	present	VERB
dentistry3000-164	117	9	mixed	mixed	ADJ
dentistry3000-164	117	10	types	type	NOUN
dentistry3000-164	117	11	of	of	ADP
dentistry3000-164	117	12	clefts	cleft	NOUN
dentistry3000-164	117	13	,	,	PUNCT
dentistry3000-164	117	14	with	with	ADP
dentistry3000-164	117	15	the	the	DET
dentistry3000-164	117	16	most	most	ADV
dentistry3000-164	117	17	prevalent	prevalent	ADJ
dentistry3000-164	117	18	type	type	NOUN
dentistry3000-164	117	19	(	(	PUNCT
dentistry3000-164	117	20	50	50	NUM
dentistry3000-164	117	21	%	%	NOUN
dentistry3000-164	117	22	)	)	PUNCT
dentistry3000-164	117	23	being	be	AUX
dentistry3000-164	117	24	the	the	DET
dentistry3000-164	117	25	clp	clp	NOUN
dentistry3000-164	117	26	,	,	PUNCT
dentistry3000-164	117	27	a	a	DET
dentistry3000-164	117	28	finding	finding	NOUN
dentistry3000-164	117	29	similar	similar	ADJ
dentistry3000-164	117	30	to	to	ADP
dentistry3000-164	117	31	other	other	ADJ
dentistry3000-164	117	32	studies	study	NOUN
dentistry3000-164	117	33	[	[	X
dentistry3000-164	117	34	2	2	NUM
dentistry3000-164	117	35	,	,	PUNCT
dentistry3000-164	117	36	7	7	NUM
dentistry3000-164	117	37	,	,	PUNCT
dentistry3000-164	117	38	25	25	NUM
dentistry3000-164	117	39	]	]	PUNCT
dentistry3000-164	117	40	.	.	PUNCT
dentistry3000-164	118	1	the	the	DET
dentistry3000-164	118	2	presence	presence	NOUN
dentistry3000-164	118	3	of	of	ADP
dentistry3000-164	118	4	mixed	mixed	ADJ
dentistry3000-164	118	5	types	type	NOUN
dentistry3000-164	118	6	of	of	ADP
dentistry3000-164	118	7	orofacial	orofacial	ADJ
dentistry3000-164	118	8	clefts	cleft	NOUN
dentistry3000-164	118	9	in	in	ADP
dentistry3000-164	118	10	the	the	DET
dentistry3000-164	118	11	same	same	ADJ
dentistry3000-164	118	12	family	family	NOUN
dentistry3000-164	118	13	is	be	AUX
dentistry3000-164	118	14	often	often	ADV
dentistry3000-164	118	15	observed	observe	VERB
dentistry3000-164	118	16	in	in	ADP
dentistry3000-164	118	17	families	family	NOUN
dentistry3000-164	118	18	with	with	ADP
dentistry3000-164	118	19	vws	vws	PROPN
dentistry3000-164	118	20	.	.	PUNCT
dentistry3000-164	119	1	in	in	ADP
dentistry3000-164	119	2	an	an	DET
dentistry3000-164	119	3	attempt	attempt	NOUN
dentistry3000-164	119	4	to	to	PART
dentistry3000-164	119	5	explain	explain	VERB
dentistry3000-164	119	6	this	this	DET
dentistry3000-164	119	7	occurrence	occurrence	NOUN
dentistry3000-164	119	8	,	,	PUNCT
dentistry3000-164	119	9	it	it	PRON
dentistry3000-164	119	10	has	have	AUX
dentistry3000-164	119	11	been	be	AUX
dentistry3000-164	119	12	proposed	propose	VERB
dentistry3000-164	119	13	that	that	SCONJ
dentistry3000-164	119	14	individuals	individual	NOUN
dentistry3000-164	119	15	with	with	ADP
dentistry3000-164	119	16	genetic	genetic	ADJ
dentistry3000-164	119	17	components	component	NOUN
dentistry3000-164	119	18	that	that	PRON
dentistry3000-164	119	19	cause	cause	VERB
dentistry3000-164	119	20	vws	vws	PROPN
dentistry3000-164	119	21	are	be	AUX
dentistry3000-164	119	22	subject	subject	ADJ
dentistry3000-164	119	23	to	to	ADP
dentistry3000-164	119	24	some	some	DET
dentistry3000-164	119	25	type	type	NOUN
dentistry3000-164	119	26	of	of	ADP
dentistry3000-164	119	27	multifactorial	multifactorial	ADJ
dentistry3000-164	119	28	influence	influence	NOUN
dentistry3000-164	119	29	,	,	PUNCT
dentistry3000-164	119	30	similar	similar	ADJ
dentistry3000-164	119	31	to	to	ADP
dentistry3000-164	119	32	the	the	DET
dentistry3000-164	119	33	non	non	ADJ
dentistry3000-164	119	34	-	-	ADJ
dentistry3000-164	119	35	syndromic	syndromic	ADJ
dentistry3000-164	119	36	form	form	NOUN
dentistry3000-164	119	37	of	of	ADP
dentistry3000-164	119	38	orofacial	orofacial	ADJ
dentistry3000-164	119	39	clefts	cleft	NOUN
dentistry3000-164	119	40	[	[	X
dentistry3000-164	119	41	8	8	NUM
dentistry3000-164	119	42	,	,	PUNCT
dentistry3000-164	119	43	26	26	NUM
dentistry3000-164	119	44	-	-	SYM
dentistry3000-164	119	45	28	28	NUM
dentistry3000-164	119	46	]	]	PUNCT
dentistry3000-164	119	47	.	.	PUNCT
dentistry3000-164	120	1	furthermore	furthermore	ADV
dentistry3000-164	120	2	,	,	PUNCT
dentistry3000-164	120	3	another	another	DET
dentistry3000-164	120	4	possible	possible	ADJ
dentistry3000-164	120	5	explanation	explanation	NOUN
dentistry3000-164	120	6	could	could	AUX
dentistry3000-164	120	7	be	be	AUX
dentistry3000-164	120	8	the	the	DET
dentistry3000-164	120	9	fact	fact	NOUN
dentistry3000-164	120	10	that	that	SCONJ
dentistry3000-164	120	11	another	another	DET
dentistry3000-164	120	12	gene	gene	NOUN
dentistry3000-164	120	13	could	could	AUX
dentistry3000-164	120	14	be	be	AUX
dentistry3000-164	120	15	involved	involve	VERB
dentistry3000-164	120	16	in	in	ADP
dentistry3000-164	120	17	this	this	DET
dentistry3000-164	120	18	difference	difference	NOUN
dentistry3000-164	120	19	,	,	PUNCT
dentistry3000-164	120	20	for	for	ADP
dentistry3000-164	120	21	example	example	NOUN
dentistry3000-164	120	22	variants	variant	NOUN
dentistry3000-164	120	23	in	in	ADP
dentistry3000-164	120	24	the	the	DET
dentistry3000-164	120	25	gene	gene	NOUN
dentistry3000-164	120	26	grhl3	grhl3	NOUN
dentistry3000-164	121	1	(	(	PUNCT
dentistry3000-164	121	2	grainyhead	grainyhead	VERB
dentistry3000-164	121	3	like	like	ADP
dentistry3000-164	121	4	transcription	transcription	NOUN
dentistry3000-164	121	5	factor	factor	NOUN
dentistry3000-164	121	6	3	3	NUM
dentistry3000-164	121	7	)	)	PUNCT
dentistry3000-164	121	8	are	be	AUX
dentistry3000-164	121	9	more	more	ADV
dentistry3000-164	121	10	likely	likely	ADJ
dentistry3000-164	121	11	to	to	PART
dentistry3000-164	121	12	have	have	VERB
dentistry3000-164	121	13	cp	cp	INTJ
dentistry3000-164	121	14	and	and	CCONJ
dentistry3000-164	121	15	less	less	ADV
dentistry3000-164	121	16	likely	likely	ADJ
dentistry3000-164	121	17	to	to	PART
dentistry3000-164	121	18	have	have	VERB
dentistry3000-164	121	19	cl	cl	NOUN
dentistry3000-164	121	20	or	or	CCONJ
dentistry3000-164	121	21	lip	lip	NOUN
dentistry3000-164	121	22	pits	pit	NOUN
dentistry3000-164	121	23	than	than	ADP
dentistry3000-164	121	24	individuals	individual	NOUN
dentistry3000-164	121	25	with	with	ADP
dentistry3000-164	121	26	an	an	DET
dentistry3000-164	121	27	irf6	irf6	ADJ
dentistry3000-164	121	28	mutations	mutation	NOUN
dentistry3000-164	121	29	[	[	X
dentistry3000-164	121	30	10	10	NUM
dentistry3000-164	121	31	]	]	PUNCT
dentistry3000-164	121	32	as	as	ADP
dentistry3000-164	121	33	for	for	ADP
dentistry3000-164	121	34	the	the	DET
dentistry3000-164	121	35	molecular	molecular	ADJ
dentistry3000-164	121	36	analysis	analysis	NOUN
dentistry3000-164	121	37	in	in	ADP
dentistry3000-164	121	38	exon	exon	NOUN
dentistry3000-164	121	39	4	4	NUM
dentistry3000-164	121	40	,	,	PUNCT
dentistry3000-164	121	41	the	the	DET
dentistry3000-164	121	42	snp	snp	ADJ
dentistry3000-164	121	43	rs7552506	rs7552506	NOUN
dentistry3000-164	121	44	identified	identify	VERB
dentistry3000-164	121	45	in	in	ADP
dentistry3000-164	121	46	the	the	DET
dentistry3000-164	121	47	investigated	investigate	VERB
dentistry3000-164	121	48	family	family	NOUN
dentistry3000-164	121	49	members	member	NOUN
dentistry3000-164	121	50	is	be	AUX
dentistry3000-164	121	51	a	a	DET
dentistry3000-164	121	52	polymorphism	polymorphism	NOUN
dentistry3000-164	121	53	already	already	ADV
dentistry3000-164	121	54	described	describe	VERB
dentistry3000-164	121	55	in	in	ADP
dentistry3000-164	121	56	the	the	DET
dentistry3000-164	121	57	literature	literature	NOUN
dentistry3000-164	121	58	in	in	ADP
dentistry3000-164	121	59	studies	study	NOUN
dentistry3000-164	121	60	with	with	ADP
dentistry3000-164	121	61	families	family	NOUN
dentistry3000-164	121	62	with	with	ADP
dentistry3000-164	121	63	non	non	ADJ
dentistry3000-164	121	64	-	-	ADJ
dentistry3000-164	121	65	syndromic	syndromic	ADJ
dentistry3000-164	121	66	orofacial	orofacial	ADJ
dentistry3000-164	121	67	clefts	cleft	NOUN
dentistry3000-164	121	68	and	and	CCONJ
dentistry3000-164	121	69	also	also	ADV
dentistry3000-164	121	70	in	in	ADP
dentistry3000-164	121	71	studies	study	NOUN
dentistry3000-164	121	72	with	with	ADP
dentistry3000-164	121	73	families	family	NOUN
dentistry3000-164	121	74	with	with	ADP
dentistry3000-164	121	75	vws	vws	PROPN
dentistry3000-164	121	76	[	[	X
dentistry3000-164	121	77	28	28	NUM
dentistry3000-164	121	78	,	,	PUNCT
dentistry3000-164	121	79	29	29	NUM
dentistry3000-164	121	80	]	]	PUNCT
dentistry3000-164	121	81	.	.	PUNCT
dentistry3000-164	122	1	in	in	ADP
dentistry3000-164	122	2	the	the	DET
dentistry3000-164	122	3	study	study	NOUN
dentistry3000-164	122	4	by	by	ADP
dentistry3000-164	122	5	pegelow	pegelow	NOUN
dentistry3000-164	122	6	et	et	PROPN
dentistry3000-164	122	7	al	al	PROPN
dentistry3000-164	122	8	.	.	PROPN
dentistry3000-164	123	1	(	(	PUNCT
dentistry3000-164	123	2	2008	2008	NUM
dentistry3000-164	123	3	)	)	PUNCT
dentistry3000-164	124	1	[	[	X
dentistry3000-164	124	2	30	30	NUM
dentistry3000-164	124	3	]	]	PUNCT
dentistry3000-164	124	4	with	with	ADP
dentistry3000-164	124	5	17	17	NUM
dentistry3000-164	124	6	swedish	swedish	ADJ
dentistry3000-164	124	7	families	family	NOUN
dentistry3000-164	124	8	this	this	DET
dentistry3000-164	124	9	snp	snp	NOUN
dentistry3000-164	124	10	showed	show	VERB
dentistry3000-164	124	11	an	an	DET
dentistry3000-164	124	12	association	association	NOUN
dentistry3000-164	124	13	with	with	ADP
dentistry3000-164	124	14	clp	clp	PROPN
dentistry3000-164	124	15	.	.	PUNCT
dentistry3000-164	125	1	in	in	ADP
dentistry3000-164	125	2	addition	addition	NOUN
dentistry3000-164	125	3	,	,	PUNCT
dentistry3000-164	125	4	in	in	ADP
dentistry3000-164	125	5	the	the	DET
dentistry3000-164	125	6	same	same	ADJ
dentistry3000-164	125	7	study	study	NOUN
dentistry3000-164	125	8	it	it	PRON
dentistry3000-164	125	9	was	be	AUX
dentistry3000-164	125	10	found	find	VERB
dentistry3000-164	125	11	that	that	SCONJ
dentistry3000-164	125	12	when	when	SCONJ
dentistry3000-164	125	13	there	there	PRON
dentistry3000-164	125	14	was	be	VERB
dentistry3000-164	125	15	combined	combined	ADJ
dentistry3000-164	125	16	unilateral	unilateral	ADJ
dentistry3000-164	125	17	and	and	CCONJ
dentistry3000-164	125	18	bilateral	bilateral	ADJ
dentistry3000-164	125	19	clp	clp	NOUN
dentistry3000-164	125	20	in	in	ADP
dentistry3000-164	125	21	the	the	DET
dentistry3000-164	125	22	same	same	ADJ
dentistry3000-164	125	23	family	family	NOUN
dentistry3000-164	125	24	,	,	PUNCT
dentistry3000-164	125	25	there	there	PRON
dentistry3000-164	125	26	was	be	VERB
dentistry3000-164	125	27	an	an	DET
dentistry3000-164	125	28	association	association	NOUN
dentistry3000-164	125	29	of	of	ADP
dentistry3000-164	125	30	this	this	DET
dentistry3000-164	125	31	polymorphism	polymorphism	NOUN
dentistry3000-164	125	32	.	.	PUNCT
dentistry3000-164	126	1	this	this	DET
dentistry3000-164	126	2	information	information	NOUN
dentistry3000-164	126	3	corroborates	corroborate	VERB
dentistry3000-164	126	4	the	the	DET
dentistry3000-164	126	5	findings	finding	NOUN
dentistry3000-164	126	6	in	in	ADP
dentistry3000-164	126	7	the	the	DET
dentistry3000-164	126	8	present	present	ADJ
dentistry3000-164	126	9	study	study	NOUN
dentistry3000-164	126	10	.	.	PUNCT
dentistry3000-164	127	1	according	accord	VERB
dentistry3000-164	127	2	to	to	ADP
dentistry3000-164	127	3	the	the	DET
dentistry3000-164	127	4	analysis	analysis	NOUN
dentistry3000-164	127	5	performed	perform	VERB
dentistry3000-164	127	6	by	by	ADP
dentistry3000-164	127	7	the	the	DET
dentistry3000-164	127	8	hope	hope	PROPN
dentistry3000-164	127	9	tool	tool	PROPN
dentistry3000-164	127	10	,	,	PUNCT
dentistry3000-164	127	11	the	the	DET
dentistry3000-164	127	12	c.269	c.269	NOUN
dentistry3000-164	127	13	g	g	NOUN
dentistry3000-164	127	14	>	>	X
dentistry3000-164	127	15	c	c	PROPN
dentistry3000-164	127	16	variant	variant	NOUN
dentistry3000-164	127	17	(	(	PUNCT
dentistry3000-164	127	18	p.ser90thr	p.ser90thr	NOUN
dentistry3000-164	127	19	)	)	PUNCT
dentistry3000-164	127	20	found	find	VERB
dentistry3000-164	127	21	in	in	ADP
dentistry3000-164	127	22	the	the	DET
dentistry3000-164	127	23	present	present	ADJ
dentistry3000-164	127	24	study	study	NOUN
dentistry3000-164	127	25	results	result	NOUN
dentistry3000-164	127	26	in	in	ADP
dentistry3000-164	127	27	a	a	DET
dentistry3000-164	127	28	mutant	mutant	ADJ
dentistry3000-164	127	29	amino	amino	NOUN
dentistry3000-164	127	30	acid	acid	NOUN
dentistry3000-164	127	31	residue	residue	NOUN
dentistry3000-164	127	32	that	that	PRON
dentistry3000-164	127	33	is	be	AUX
dentistry3000-164	127	34	larger	large	ADJ
dentistry3000-164	127	35	than	than	ADP
dentistry3000-164	127	36	the	the	DET
dentistry3000-164	127	37	wild	wild	ADJ
dentistry3000-164	127	38	type	type	NOUN
dentistry3000-164	127	39	residue	residue	NOUN
dentistry3000-164	127	40	,	,	PUNCT
dentistry3000-164	127	41	which	which	PRON
dentistry3000-164	127	42	can	can	AUX
dentistry3000-164	127	43	influence	influence	VERB
dentistry3000-164	127	44	the	the	DET
dentistry3000-164	127	45	conformation	conformation	NOUN
dentistry3000-164	127	46	of	of	ADP
dentistry3000-164	127	47	the	the	DET
dentistry3000-164	127	48	protein	protein	NOUN
dentistry3000-164	127	49	that	that	PRON
dentistry3000-164	127	50	will	will	AUX
dentistry3000-164	127	51	be	be	AUX
dentistry3000-164	127	52	slightly	slightly	ADV
dentistry3000-164	127	53	destabilized	destabilize	VERB
dentistry3000-164	127	54	and	and	CCONJ
dentistry3000-164	127	55	,	,	PUNCT
dentistry3000-164	127	56	in	in	ADP
dentistry3000-164	127	57	addition	addition	NOUN
dentistry3000-164	127	58	,	,	PUNCT
dentistry3000-164	127	59	there	there	PRON
dentistry3000-164	127	60	may	may	AUX
dentistry3000-164	127	61	be	be	AUX
dentistry3000-164	127	62	disturbances	disturbance	NOUN
dentistry3000-164	127	63	in	in	ADP
dentistry3000-164	127	64	the	the	DET
dentistry3000-164	127	65	multimeric	multimeric	ADJ
dentistry3000-164	127	66	interactions	interaction	NOUN
dentistry3000-164	127	67	.	.	PUNCT
dentistry3000-164	128	1	the	the	DET
dentistry3000-164	128	2	ser90	ser90	NOUN
dentistry3000-164	128	3	position	position	NOUN
dentistry3000-164	128	4	of	of	ADP
dentistry3000-164	128	5	the	the	DET
dentistry3000-164	128	6	polypeptide	polypeptide	ADJ
dentistry3000-164	128	7	chain	chain	NOUN
dentistry3000-164	128	8	is	be	AUX
dentistry3000-164	128	9	located	locate	VERB
dentistry3000-164	128	10	in	in	ADP
dentistry3000-164	128	11	the	the	DET
dentistry3000-164	128	12	dna	dna	NOUN
dentistry3000-164	128	13	-	-	PUNCT
dentistry3000-164	128	14	binding	bind	VERB
dentistry3000-164	128	15	domain	domain	NOUN
dentistry3000-164	128	16	(	(	PUNCT
dentistry3000-164	128	17	structural	structural	ADJ
dentistry3000-164	128	18	motif	motif	NOUN
dentistry3000-164	128	19	of	of	ADP
dentistry3000-164	128	20	the	the	DET
dentistry3000-164	128	21	helix	helix	ADJ
dentistry3000-164	128	22	-	-	PUNCT
dentistry3000-164	128	23	gyrohelix	gyrohelix	NOUN
dentistry3000-164	128	24	type	type	NOUN
dentistry3000-164	128	25	)	)	PUNCT
dentistry3000-164	128	26	,	,	PUNCT
dentistry3000-164	128	27	which	which	PRON
dentistry3000-164	128	28	is	be	AUX
dentistry3000-164	128	29	important	important	ADJ
dentistry3000-164	128	30	for	for	ADP
dentistry3000-164	128	31	the	the	DET
dentistry3000-164	128	32	binding	binding	NOUN
dentistry3000-164	128	33	of	of	ADP
dentistry3000-164	128	34	other	other	ADJ
dentistry3000-164	128	35	molecules	molecule	NOUN
dentistry3000-164	128	36	and	and	CCONJ
dentistry3000-164	128	37	is	be	AUX
dentistry3000-164	128	38	in	in	ADP
dentistry3000-164	128	39	contact	contact	NOUN
dentistry3000-164	128	40	with	with	ADP
dentistry3000-164	128	41	the	the	DET
dentistry3000-164	128	42	residue	residue	NOUN
dentistry3000-164	128	43	of	of	ADP
dentistry3000-164	128	44	a	a	DET
dentistry3000-164	128	45	regulatory	regulatory	ADJ
dentistry3000-164	128	46	domain	domain	NOUN
dentistry3000-164	128	47	.	.	PUNCT
dentistry3000-164	129	1	therefore	therefore	ADV
dentistry3000-164	129	2	,	,	PUNCT
dentistry3000-164	129	3	this	this	DET
dentistry3000-164	129	4	mutation	mutation	NOUN
dentistry3000-164	129	5	can	can	AUX
dentistry3000-164	129	6	affect	affect	VERB
dentistry3000-164	129	7	this	this	DET
dentistry3000-164	129	8	interaction	interaction	NOUN
dentistry3000-164	129	9	and	and	CCONJ
dentistry3000-164	129	10	disrupt	disrupt	VERB
dentistry3000-164	129	11	protein	protein	NOUN
dentistry3000-164	129	12	regulation	regulation	NOUN
dentistry3000-164	129	13	.	.	PUNCT
dentistry3000-164	130	1	variants	variant	NOUN
dentistry3000-164	130	2	that	that	PRON
dentistry3000-164	130	3	occur	occur	VERB
dentistry3000-164	130	4	in	in	ADP
dentistry3000-164	130	5	the	the	DET
dentistry3000-164	130	6	irf6	irf6	PROPN
dentistry3000-164	130	7	gene	gene	NOUN
dentistry3000-164	130	8	are	be	AUX
dentistry3000-164	130	9	mostly	mostly	ADV
dentistry3000-164	130	10	missense	missense	NOUN
dentistry3000-164	130	11	-	-	PUNCT
dentistry3000-164	130	12	type	type	NOUN
dentistry3000-164	130	13	and	and	CCONJ
dentistry3000-164	130	14	occur	occur	VERB
dentistry3000-164	130	15	mainly	mainly	ADV
dentistry3000-164	130	16	in	in	ADP
dentistry3000-164	130	17	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	130	18	differential	differential	ADJ
dentistry3000-164	130	19	expression	expression	NOUN
dentistry3000-164	130	20	of	of	ADP
dentistry3000-164	130	21	the	the	DET
dentistry3000-164	130	22	irf6	irf6	PROPN
dentistry3000-164	130	23	gene	gene	NOUN
dentistry3000-164	130	24	in	in	ADP
dentistry3000-164	130	25	the	the	DET
dentistry3000-164	130	26	signs	sign	NOUN
dentistry3000-164	130	27	of	of	ADP
dentistry3000-164	130	28	van	van	PROPN
dentistry3000-164	130	29	der	der	PROPN
dentistry3000-164	130	30	woude	woude	VERB
dentistry3000-164	130	31	syndrome	syndrome	NOUN
dentistry3000-164	130	32	:	:	PUNCT
dentistry3000-164	130	33	are	be	AUX
dentistry3000-164	130	34	distinct	distinct	ADJ
dentistry3000-164	130	35	genetic	genetic	ADJ
dentistry3000-164	130	36	modifiers	modifier	NOUN
dentistry3000-164	130	37	operating	operate	VERB
dentistry3000-164	130	38	?	?	PUNCT
dentistry3000-164	131	1	vol	vol	NOUN
dentistry3000-164	131	2	9	9	NUM
dentistry3000-164	131	3	no	no	DET
dentistry3000-164	131	4	1	1	NUM
dentistry3000-164	131	5	(	(	PUNCT
dentistry3000-164	131	6	2021	2021	NUM
dentistry3000-164	131	7	)	)	PUNCT
dentistry3000-164	131	8	doi	doi	NOUN
dentistry3000-164	131	9	10.5195	10.5195	NUM
dentistry3000-164	131	10	/	/	SYM
dentistry3000-164	131	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	131	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	131	13	the	the	DET
dentistry3000-164	131	14	dna	dna	NOUN
dentistry3000-164	131	15	-	-	PUNCT
dentistry3000-164	131	16	binding	bind	VERB
dentistry3000-164	131	17	or	or	CCONJ
dentistry3000-164	131	18	proteinbinding	proteinbinde	VERB
dentistry3000-164	131	19	domains	domain	NOUN
dentistry3000-164	131	20	;	;	PUNCT
dentistry3000-164	131	21	variants	variant	NOUN
dentistry3000-164	131	22	in	in	ADP
dentistry3000-164	131	23	these	these	DET
dentistry3000-164	131	24	domains	domain	NOUN
dentistry3000-164	131	25	are	be	AUX
dentistry3000-164	131	26	critical	critical	ADJ
dentistry3000-164	131	27	to	to	ADP
dentistry3000-164	131	28	the	the	DET
dentistry3000-164	131	29	function	function	NOUN
dentistry3000-164	131	30	of	of	ADP
dentistry3000-164	131	31	the	the	DET
dentistry3000-164	131	32	irf6	irf6	ADJ
dentistry3000-164	131	33	gene	gene	NOUN
dentistry3000-164	131	34	[	[	X
dentistry3000-164	131	35	8	8	NUM
dentistry3000-164	131	36	,	,	PUNCT
dentistry3000-164	131	37	29	29	NUM
dentistry3000-164	131	38	,	,	PUNCT
dentistry3000-164	131	39	31	31	NUM
dentistry3000-164	131	40	]	]	PUNCT
dentistry3000-164	131	41	.	.	PUNCT
dentistry3000-164	132	1	in	in	ADP
dentistry3000-164	132	2	addition	addition	NOUN
dentistry3000-164	132	3	,	,	PUNCT
dentistry3000-164	132	4	the	the	DET
dentistry3000-164	132	5	silico	silico	NOUN
dentistry3000-164	132	6	analysis	analysis	NOUN
dentistry3000-164	132	7	to	to	PART
dentistry3000-164	132	8	verify	verify	VERB
dentistry3000-164	132	9	the	the	DET
dentistry3000-164	132	10	effect	effect	NOUN
dentistry3000-164	132	11	on	on	ADP
dentistry3000-164	132	12	the	the	DET
dentistry3000-164	132	13	protein	protein	NOUN
dentistry3000-164	132	14	conformation	conformation	NOUN
dentistry3000-164	132	15	of	of	ADP
dentistry3000-164	132	16	irf6	irf6	PROPN
dentistry3000-164	132	17	,	,	PUNCT
dentistry3000-164	132	18	suggests	suggest	VERB
dentistry3000-164	132	19	that	that	SCONJ
dentistry3000-164	132	20	this	this	DET
dentistry3000-164	132	21	mutation	mutation	NOUN
dentistry3000-164	132	22	is	be	AUX
dentistry3000-164	132	23	potentially	potentially	ADV
dentistry3000-164	132	24	pathogenic	pathogenic	ADJ
dentistry3000-164	132	25	.	.	PUNCT
dentistry3000-164	133	1	more	more	ADV
dentistry3000-164	133	2	specifically	specifically	ADV
dentistry3000-164	133	3	,	,	PUNCT
dentistry3000-164	133	4	the	the	DET
dentistry3000-164	133	5	wild	wild	ADJ
dentistry3000-164	133	6	-	-	PUNCT
dentistry3000-164	133	7	type	type	NOUN
dentistry3000-164	133	8	residue	residue	NOUN
dentistry3000-164	133	9	interacts	interact	VERB
dentistry3000-164	133	10	with	with	ADP
dentistry3000-164	133	11	the	the	DET
dentistry3000-164	133	12	amino	amino	NOUN
dentistry3000-164	133	13	acid	acid	NOUN
dentistry3000-164	133	14	residue	residue	NOUN
dentistry3000-164	133	15	alanine	alanine	NOUN
dentistry3000-164	133	16	at	at	ADP
dentistry3000-164	133	17	position	position	NOUN
dentistry3000-164	133	18	86	86	NUM
dentistry3000-164	133	19	of	of	ADP
dentistry3000-164	133	20	the	the	DET
dentistry3000-164	133	21	polypeptide	polypeptide	ADJ
dentistry3000-164	133	22	chain	chain	NOUN
dentistry3000-164	133	23	;	;	PUNCT
dentistry3000-164	133	24	the	the	DET
dentistry3000-164	133	25	size	size	NOUN
dentistry3000-164	133	26	difference	difference	NOUN
dentistry3000-164	133	27	observed	observe	VERB
dentistry3000-164	133	28	in	in	ADP
dentistry3000-164	133	29	the	the	DET
dentistry3000-164	133	30	mutant	mutant	ADJ
dentistry3000-164	133	31	residue	residue	NOUN
dentistry3000-164	133	32	prevents	prevent	VERB
dentistry3000-164	133	33	it	it	PRON
dentistry3000-164	133	34	from	from	ADP
dentistry3000-164	133	35	being	be	AUX
dentistry3000-164	133	36	in	in	ADP
dentistry3000-164	133	37	the	the	DET
dentistry3000-164	133	38	correct	correct	ADJ
dentistry3000-164	133	39	position	position	NOUN
dentistry3000-164	133	40	to	to	PART
dentistry3000-164	133	41	perform	perform	VERB
dentistry3000-164	133	42	the	the	DET
dentistry3000-164	133	43	hydrogen	hydrogen	NOUN
dentistry3000-164	133	44	bonding	bonding	NOUN
dentistry3000-164	133	45	possible	possible	ADJ
dentistry3000-164	133	46	in	in	ADP
dentistry3000-164	133	47	the	the	DET
dentistry3000-164	133	48	wild	wild	ADJ
dentistry3000-164	133	49	type	type	NOUN
dentistry3000-164	133	50	of	of	ADP
dentistry3000-164	133	51	residue	residue	NOUN
dentistry3000-164	133	52	.	.	PUNCT
dentistry3000-164	134	1	only	only	ADV
dentistry3000-164	134	2	two	two	NUM
dentistry3000-164	134	3	mutations	mutation	NOUN
dentistry3000-164	134	4	for	for	ADP
dentistry3000-164	134	5	position	position	NOUN
dentistry3000-164	134	6	90	90	NUM
dentistry3000-164	134	7	of	of	ADP
dentistry3000-164	134	8	the	the	DET
dentistry3000-164	134	9	protein	protein	NOUN
dentistry3000-164	134	10	chain	chain	NOUN
dentistry3000-164	134	11	encoded	encode	VERB
dentistry3000-164	134	12	by	by	ADP
dentistry3000-164	134	13	the	the	DET
dentistry3000-164	134	14	irf6	irf6	PROPN
dentistry3000-164	134	15	gene	gene	NOUN
dentistry3000-164	134	16	are	be	AUX
dentistry3000-164	134	17	described	describe	VERB
dentistry3000-164	134	18	in	in	ADP
dentistry3000-164	134	19	the	the	DET
dentistry3000-164	134	20	literature	literature	NOUN
dentistry3000-164	134	21	,	,	PUNCT
dentistry3000-164	134	22	one	one	NUM
dentistry3000-164	134	23	of	of	ADP
dentistry3000-164	134	24	which	which	PRON
dentistry3000-164	134	25	is	be	AUX
dentistry3000-164	134	26	mutation	mutation	NOUN
dentistry3000-164	134	27	c.	c.	PROPN
dentistry3000-164	134	28	a268	a268	PROPN
dentistry3000-164	134	29	g	g	PROPN
dentistry3000-164	134	30	(	(	PUNCT
dentistry3000-164	134	31	p.ser90gly	p.ser90gly	ADV
dentistry3000-164	134	32	)	)	PUNCT
dentistry3000-164	134	33	as	as	SCONJ
dentistry3000-164	134	34	described	describe	VERB
dentistry3000-164	134	35	by	by	ADP
dentistry3000-164	134	36	kondo	kondo	PROPN
dentistry3000-164	134	37	et	et	PROPN
dentistry3000-164	134	38	al	al	PROPN
dentistry3000-164	134	39	.	.	PROPN
dentistry3000-164	135	1	(	(	PUNCT
dentistry3000-164	135	2	2002	2002	NUM
dentistry3000-164	135	3	)	)	PUNCT
dentistry3000-164	136	1	[	[	X
dentistry3000-164	136	2	8	8	X
dentistry3000-164	136	3	]	]	PUNCT
dentistry3000-164	136	4	that	that	PRON
dentistry3000-164	136	5	causes	cause	VERB
dentistry3000-164	136	6	an	an	DET
dentistry3000-164	136	7	exchange	exchange	NOUN
dentistry3000-164	136	8	of	of	ADP
dentistry3000-164	136	9	the	the	DET
dentistry3000-164	136	10	amino	amino	NOUN
dentistry3000-164	136	11	acid	acid	NOUN
dentistry3000-164	136	12	residue	residue	NOUN
dentistry3000-164	136	13	serine	serine	NOUN
dentistry3000-164	136	14	for	for	ADP
dentistry3000-164	136	15	the	the	DET
dentistry3000-164	136	16	amino	amino	NOUN
dentistry3000-164	136	17	acid	acid	NOUN
dentistry3000-164	136	18	residue	residue	NOUN
dentistry3000-164	136	19	glycine	glycine	NOUN
dentistry3000-164	136	20	.	.	PUNCT
dentistry3000-164	137	1	the	the	DET
dentistry3000-164	137	2	other	other	ADJ
dentistry3000-164	137	3	mutation	mutation	NOUN
dentistry3000-164	137	4	,	,	PUNCT
dentistry3000-164	137	5	c.g269	c.g269	PROPN
dentistry3000-164	137	6	t	t	PROPN
dentistry3000-164	137	7	(	(	PUNCT
dentistry3000-164	137	8	p.	p.	NOUN
dentistry3000-164	137	9	ser90il2	ser90il2	PROPN
dentistry3000-164	137	10	)	)	PUNCT
dentistry3000-164	137	11	as	as	SCONJ
dentistry3000-164	137	12	described	describe	VERB
dentistry3000-164	137	13	by	by	ADP
dentistry3000-164	137	14	lima	lima	PROPN
dentistry3000-164	137	15	et	et	PROPN
dentistry3000-164	137	16	al	al	PROPN
dentistry3000-164	137	17	.	.	PROPN
dentistry3000-164	137	18	(	(	PUNCT
dentistry3000-164	137	19	2009	2009	NUM
dentistry3000-164	137	20	)	)	PUNCT
dentistry3000-164	138	1	[	[	X
dentistry3000-164	138	2	29	29	NUM
dentistry3000-164	138	3	]	]	PUNCT
dentistry3000-164	138	4	,	,	PUNCT
dentistry3000-164	138	5	promotes	promote	VERB
dentistry3000-164	138	6	the	the	DET
dentistry3000-164	138	7	exchange	exchange	NOUN
dentistry3000-164	138	8	of	of	ADP
dentistry3000-164	138	9	the	the	DET
dentistry3000-164	138	10	amino	amino	NOUN
dentistry3000-164	138	11	acid	acid	NOUN
dentistry3000-164	138	12	residue	residue	NOUN
dentistry3000-164	138	13	serine	serine	NOUN
dentistry3000-164	138	14	for	for	ADP
dentistry3000-164	138	15	the	the	DET
dentistry3000-164	138	16	amino	amino	NOUN
dentistry3000-164	138	17	acid	acid	NOUN
dentistry3000-164	138	18	residue	residue	NOUN
dentistry3000-164	138	19	isoleucine	isoleucine	NOUN
dentistry3000-164	138	20	.	.	PUNCT
dentistry3000-164	139	1	among	among	ADP
dentistry3000-164	139	2	the	the	DET
dentistry3000-164	139	3	dental	dental	ADJ
dentistry3000-164	139	4	anomalies	anomaly	NOUN
dentistry3000-164	139	5	associated	associate	VERB
dentistry3000-164	139	6	with	with	ADP
dentistry3000-164	139	7	vws	vws	PROPN
dentistry3000-164	139	8	,	,	PUNCT
dentistry3000-164	139	9	the	the	DET
dentistry3000-164	139	10	most	most	ADV
dentistry3000-164	139	11	common	common	ADJ
dentistry3000-164	139	12	among	among	ADP
dentistry3000-164	139	13	patients	patient	NOUN
dentistry3000-164	139	14	is	be	AUX
dentistry3000-164	139	15	hypodontia	hypodontia	NOUN
dentistry3000-164	139	16	[	[	X
dentistry3000-164	139	17	32	32	NUM
dentistry3000-164	139	18	]	]	PUNCT
dentistry3000-164	139	19	.	.	PUNCT
dentistry3000-164	140	1	in	in	ADP
dentistry3000-164	140	2	our	our	PRON
dentistry3000-164	140	3	study	study	NOUN
dentistry3000-164	140	4	,	,	PUNCT
dentistry3000-164	140	5	individuals	individual	NOUN
dentistry3000-164	140	6	who	who	PRON
dentistry3000-164	140	7	presented	present	VERB
dentistry3000-164	140	8	dental	dental	ADJ
dentistry3000-164	140	9	anomalies	anomaly	NOUN
dentistry3000-164	140	10	,	,	PUNCT
dentistry3000-164	140	11	as	as	SCONJ
dentistry3000-164	140	12	tooth	tooth	NOUN
dentistry3000-164	140	13	agenesis	agenesis	NOUN
dentistry3000-164	140	14	were	be	AUX
dentistry3000-164	140	15	in	in	ADP
dentistry3000-164	140	16	the	the	DET
dentistry3000-164	140	17	mandibular	mandibular	NOUN
dentistry3000-164	140	18	arch	arch	NOUN
dentistry3000-164	140	19	,	,	PUNCT
dentistry3000-164	140	20	which	which	PRON
dentistry3000-164	140	21	is	be	AUX
dentistry3000-164	140	22	something	something	PRON
dentistry3000-164	140	23	already	already	ADV
dentistry3000-164	140	24	predicted	predict	VERB
dentistry3000-164	140	25	in	in	ADP
dentistry3000-164	140	26	the	the	DET
dentistry3000-164	140	27	literature	literature	NOUN
dentistry3000-164	140	28	.	.	PUNCT
dentistry3000-164	141	1	syndromic	syndromic	ADJ
dentistry3000-164	141	2	agenesis	agenesis	NOUN
dentistry3000-164	141	3	generally	generally	ADV
dentistry3000-164	141	4	appears	appear	VERB
dentistry3000-164	141	5	associated	associate	VERB
dentistry3000-164	141	6	with	with	ADP
dentistry3000-164	141	7	other	other	ADJ
dentistry3000-164	141	8	manifestations	manifestation	NOUN
dentistry3000-164	141	9	such	such	ADJ
dentistry3000-164	141	10	as	as	ADP
dentistry3000-164	141	11	microdontia	microdontia	NOUN
dentistry3000-164	141	12	and	and	CCONJ
dentistry3000-164	141	13	the	the	DET
dentistry3000-164	141	14	upper	upper	ADJ
dentistry3000-164	141	15	lateral	lateral	ADJ
dentistry3000-164	141	16	incisor	incisor	NOUN
dentistry3000-164	141	17	is	be	AUX
dentistry3000-164	141	18	the	the	DET
dentistry3000-164	141	19	most	most	ADV
dentistry3000-164	141	20	frequently	frequently	ADV
dentistry3000-164	141	21	affected	affect	VERB
dentistry3000-164	141	22	tooth	tooth	NOUN
dentistry3000-164	141	23	in	in	ADP
dentistry3000-164	141	24	the	the	DET
dentistry3000-164	141	25	cleft	cleft	NOUN
dentistry3000-164	141	26	area	area	NOUN
dentistry3000-164	141	27	[	[	X
dentistry3000-164	141	28	33	33	NUM
dentistry3000-164	141	29	,	,	PUNCT
dentistry3000-164	141	30	34	34	NUM
dentistry3000-164	141	31	]	]	PUNCT
dentistry3000-164	141	32	.	.	PUNCT
dentistry3000-164	142	1	considering	consider	VERB
dentistry3000-164	142	2	the	the	DET
dentistry3000-164	142	3	data	datum	NOUN
dentistry3000-164	142	4	shown	show	VERB
dentistry3000-164	142	5	in	in	ADP
dentistry3000-164	142	6	table	table	NOUN
dentistry3000-164	142	7	2	2	NUM
dentistry3000-164	142	8	,	,	PUNCT
dentistry3000-164	142	9	it	it	PRON
dentistry3000-164	142	10	’s	’	VERB
dentistry3000-164	142	11	possible	possible	ADJ
dentistry3000-164	142	12	to	to	PART
dentistry3000-164	142	13	see	see	VERB
dentistry3000-164	142	14	the	the	DET
dentistry3000-164	142	15	phenotypic	phenotypic	ADJ
dentistry3000-164	142	16	variation	variation	NOUN
dentistry3000-164	142	17	of	of	ADP
dentistry3000-164	142	18	the	the	DET
dentistry3000-164	142	19	cases	case	NOUN
dentistry3000-164	142	20	presented	present	VERB
dentistry3000-164	142	21	despite	despite	SCONJ
dentistry3000-164	142	22	carrying	carry	VERB
dentistry3000-164	142	23	the	the	DET
dentistry3000-164	142	24	same	same	ADJ
dentistry3000-164	142	25	genetic	genetic	ADJ
dentistry3000-164	142	26	mutation	mutation	NOUN
dentistry3000-164	142	27	,	,	PUNCT
dentistry3000-164	142	28	suggesting	suggest	VERB
dentistry3000-164	142	29	that	that	SCONJ
dentistry3000-164	142	30	distinct	distinct	ADJ
dentistry3000-164	142	31	genetic	genetic	ADJ
dentistry3000-164	142	32	modifiers	modifier	NOUN
dentistry3000-164	142	33	operate	operate	VERB
dentistry3000-164	142	34	on	on	ADP
dentistry3000-164	142	35	the	the	DET
dentistry3000-164	142	36	formation	formation	NOUN
dentistry3000-164	142	37	of	of	ADP
dentistry3000-164	142	38	clefts	cleft	NOUN
dentistry3000-164	142	39	and	and	CCONJ
dentistry3000-164	142	40	the	the	DET
dentistry3000-164	142	41	dental	dental	ADJ
dentistry3000-164	142	42	development	development	NOUN
dentistry3000-164	142	43	.	.	PUNCT
dentistry3000-164	143	1	despite	despite	SCONJ
dentistry3000-164	143	2	being	be	AUX
dentistry3000-164	143	3	one	one	NUM
dentistry3000-164	143	4	of	of	ADP
dentistry3000-164	143	5	the	the	DET
dentistry3000-164	143	6	most	most	ADV
dentistry3000-164	143	7	studied	studied	ADJ
dentistry3000-164	143	8	syndromic	syndromic	ADJ
dentistry3000-164	143	9	forms	form	NOUN
dentistry3000-164	143	10	of	of	ADP
dentistry3000-164	143	11	orofacial	orofacial	ADJ
dentistry3000-164	143	12	clefts	cleft	NOUN
dentistry3000-164	143	13	,	,	PUNCT
dentistry3000-164	143	14	this	this	DET
dentistry3000-164	143	15	study	study	NOUN
dentistry3000-164	143	16	reveals	reveal	VERB
dentistry3000-164	143	17	how	how	SCONJ
dentistry3000-164	143	18	much	much	ADJ
dentistry3000-164	143	19	remains	remain	VERB
dentistry3000-164	143	20	to	to	PART
dentistry3000-164	143	21	be	be	AUX
dentistry3000-164	143	22	discovered	discover	VERB
dentistry3000-164	143	23	in	in	ADP
dentistry3000-164	143	24	terms	term	NOUN
dentistry3000-164	143	25	of	of	ADP
dentistry3000-164	143	26	how	how	SCONJ
dentistry3000-164	143	27	genetic	genetic	ADJ
dentistry3000-164	143	28	factors	factor	NOUN
dentistry3000-164	143	29	act	act	VERB
dentistry3000-164	143	30	underlying	underlie	VERB
dentistry3000-164	143	31	the	the	DET
dentistry3000-164	143	32	phenotypic	phenotypic	ADJ
dentistry3000-164	143	33	expression	expression	NOUN
dentistry3000-164	143	34	of	of	ADP
dentistry3000-164	143	35	vws	vws	PROPN
dentistry3000-164	143	36	.	.	PUNCT
dentistry3000-164	144	1	in	in	ADP
dentistry3000-164	144	2	addition	addition	NOUN
dentistry3000-164	144	3	,	,	PUNCT
dentistry3000-164	144	4	we	we	PRON
dentistry3000-164	144	5	emphasize	emphasize	VERB
dentistry3000-164	144	6	that	that	SCONJ
dentistry3000-164	144	7	families	family	NOUN
dentistry3000-164	144	8	with	with	ADP
dentistry3000-164	144	9	this	this	DET
dentistry3000-164	144	10	syndrome	syndrome	NOUN
dentistry3000-164	144	11	still	still	ADV
dentistry3000-164	144	12	go	go	VERB
dentistry3000-164	144	13	unnoticed	unnoticed	ADJ
dentistry3000-164	144	14	in	in	ADP
dentistry3000-164	144	15	health	health	NOUN
dentistry3000-164	144	16	systems	system	NOUN
dentistry3000-164	144	17	.	.	PUNCT
dentistry3000-164	145	1	observationally	observationally	ADV
dentistry3000-164	145	2	,	,	PUNCT
dentistry3000-164	145	3	many	many	ADJ
dentistry3000-164	145	4	families	family	NOUN
dentistry3000-164	145	5	in	in	ADP
dentistry3000-164	145	6	turn	turn	NOUN
dentistry3000-164	145	7	see	see	VERB
dentistry3000-164	145	8	congenital	congenital	ADJ
dentistry3000-164	145	9	lower	low	ADJ
dentistry3000-164	145	10	lip	lip	NOUN
dentistry3000-164	145	11	pits	pit	NOUN
dentistry3000-164	145	12	as	as	ADP
dentistry3000-164	145	13	a	a	DET
dentistry3000-164	145	14	family	family	NOUN
dentistry3000-164	145	15	trait	trait	NOUN
dentistry3000-164	145	16	and	and	CCONJ
dentistry3000-164	145	17	therefore	therefore	ADV
dentistry3000-164	145	18	fail	fail	VERB
dentistry3000-164	145	19	to	to	PART
dentistry3000-164	145	20	seek	seek	VERB
dentistry3000-164	145	21	specialized	specialized	ADJ
dentistry3000-164	145	22	care	care	NOUN
dentistry3000-164	145	23	and	and	CCONJ
dentistry3000-164	145	24	appropriate	appropriate	ADJ
dentistry3000-164	145	25	treatment	treatment	NOUN
dentistry3000-164	145	26	.	.	PUNCT
dentistry3000-164	146	1	thus	thus	ADV
dentistry3000-164	146	2	,	,	PUNCT
dentistry3000-164	146	3	it	it	PRON
dentistry3000-164	146	4	is	be	AUX
dentistry3000-164	146	5	also	also	ADV
dentistry3000-164	146	6	expected	expect	VERB
dentistry3000-164	146	7	that	that	SCONJ
dentistry3000-164	146	8	this	this	DET
dentistry3000-164	146	9	study	study	NOUN
dentistry3000-164	146	10	will	will	AUX
dentistry3000-164	146	11	contribute	contribute	VERB
dentistry3000-164	146	12	in	in	ADP
dentistry3000-164	146	13	the	the	DET
dentistry3000-164	146	14	future	future	NOUN
dentistry3000-164	146	15	to	to	ADP
dentistry3000-164	146	16	the	the	DET
dentistry3000-164	146	17	genetic	genetic	ADJ
dentistry3000-164	146	18	counseling	counseling	NOUN
dentistry3000-164	146	19	for	for	ADP
dentistry3000-164	146	20	these	these	DET
dentistry3000-164	146	21	families	family	NOUN
dentistry3000-164	146	22	and	and	CCONJ
dentistry3000-164	146	23	also	also	ADV
dentistry3000-164	146	24	will	will	AUX
dentistry3000-164	146	25	improve	improve	VERB
dentistry3000-164	146	26	the	the	DET
dentistry3000-164	146	27	knowledge	knowledge	NOUN
dentistry3000-164	146	28	and	and	CCONJ
dentistry3000-164	146	29	qualifications	qualification	NOUN
dentistry3000-164	146	30	of	of	ADP
dentistry3000-164	146	31	health	health	NOUN
dentistry3000-164	146	32	professionals	professional	NOUN
dentistry3000-164	146	33	who	who	PRON
dentistry3000-164	146	34	care	care	VERB
dentistry3000-164	146	35	for	for	ADP
dentistry3000-164	146	36	them	they	PRON
dentistry3000-164	146	37	.	.	PUNCT
dentistry3000-164	147	1	acknowledgment	acknowledgment	NOUN
dentistry3000-164	147	2	the	the	DET
dentistry3000-164	147	3	authors	author	NOUN
dentistry3000-164	147	4	would	would	AUX
dentistry3000-164	147	5	like	like	VERB
dentistry3000-164	147	6	to	to	PART
dentistry3000-164	147	7	thank	thank	VERB
dentistry3000-164	147	8	the	the	DET
dentistry3000-164	147	9	national	national	PROPN
dentistry3000-164	147	10	institute	institute	PROPN
dentistry3000-164	147	11	of	of	ADP
dentistry3000-164	147	12	population	population	PROPN
dentistry3000-164	147	13	medical	medical	ADJ
dentistry3000-164	147	14	genetics	genetic	NOUN
dentistry3000-164	147	15	,	,	PUNCT
dentistry3000-164	147	16	hospital	hospital	NOUN
dentistry3000-164	147	17	ophir	ophir	PROPN
dentistry3000-164	147	18	loyola	loyola	PROPN
dentistry3000-164	147	19	and	and	CCONJ
dentistry3000-164	147	20	the	the	DET
dentistry3000-164	147	21	graduate	graduate	NOUN
dentistry3000-164	147	22	program	program	NOUN
dentistry3000-164	147	23	in	in	ADP
dentistry3000-164	147	24	oncology	oncology	NOUN
dentistry3000-164	147	25	and	and	CCONJ
dentistry3000-164	147	26	medical	medical	ADJ
dentistry3000-164	147	27	science	science	NOUN
dentistry3000-164	147	28	(	(	PUNCT
dentistry3000-164	147	29	ppocm	ppocm	PROPN
dentistry3000-164	147	30	)	)	PUNCT
dentistry3000-164	147	31	of	of	ADP
dentistry3000-164	147	32	the	the	DET
dentistry3000-164	147	33	federal	federal	ADJ
dentistry3000-164	147	34	university	university	PROPN
dentistry3000-164	147	35	of	of	ADP
dentistry3000-164	147	36	pará	pará	PROPN
dentistry3000-164	147	37	(	(	PUNCT
dentistry3000-164	147	38	ufpa	ufpa	NOUN
dentistry3000-164	147	39	)	)	PUNCT
dentistry3000-164	147	40	.	.	PUNCT
dentistry3000-164	148	1	this	this	DET
dentistry3000-164	148	2	study	study	NOUN
dentistry3000-164	148	3	was	be	AUX
dentistry3000-164	148	4	supported	support	VERB
dentistry3000-164	148	5	by	by	ADP
dentistry3000-164	148	6	the	the	DET
dentistry3000-164	148	7	national	national	PROPN
dentistry3000-164	148	8	institute	institute	PROPN
dentistry3000-164	148	9	of	of	ADP
dentistry3000-164	148	10	population	population	PROPN
dentistry3000-164	148	11	medical	medical	ADJ
dentistry3000-164	148	12	genetics	genetic	NOUN
dentistry3000-164	148	13	(	(	PUNCT
dentistry3000-164	148	14	465549/2014	465549/2014	NUM
dentistry3000-164	148	15	-	-	SYM
dentistry3000-164	148	16	4	4	NUM
dentistry3000-164	148	17	/	/	SYM
dentistry3000-164	148	18	conselho	conselho	NOUN
dentistry3000-164	148	19	nacional	nacional	PROPN
dentistry3000-164	148	20	de	de	X
dentistry3000-164	148	21	desenvolvimento	desenvolvimento	PROPN
dentistry3000-164	148	22	científico	científico	PROPN
dentistry3000-164	148	23	e	e	NOUN
dentistry3000-164	148	24	tecnológico	tecnológico	NOUN
dentistry3000-164	148	25	cnpq	cnpq	PROPN
dentistry3000-164	148	26	88887,136366/201700	88887,136366/201700	NUM
dentistry3000-164	148	27	/	/	SYM
dentistry3000-164	148	28	coodernação	coodernação	NOUN
dentistry3000-164	148	29	de	de	X
dentistry3000-164	148	30	aperfeiçoamento	aperfeiçoamento	PROPN
dentistry3000-164	148	31	de	de	X
dentistry3000-164	148	32	pessoal	pessoal	PROPN
dentistry3000-164	148	33	de	de	PROPN
dentistry3000-164	148	34	nível	nível	PROPN
dentistry3000-164	148	35	superior	superior	PROPN
dentistry3000-164	148	36	capes	capes	PROPN
dentistry3000-164	148	37	17/25510000521	17/25510000521	NOUN
dentistry3000-164	148	38	-	-	SYM
dentistry3000-164	148	39	0	0	NUM
dentistry3000-164	148	40	/	/	SYM
dentistry3000-164	148	41	fundação	fundação	NOUN
dentistry3000-164	148	42	de	de	X
dentistry3000-164	148	43	amparo	amparo	PROPN
dentistry3000-164	148	44	à	à	X
dentistry3000-164	148	45	pesquisa	pesquisa	PROPN
dentistry3000-164	148	46	do	do	AUX
dentistry3000-164	148	47	estado	estado	VERB
dentistry3000-164	148	48	do	do	AUX
dentistry3000-164	148	49	rio	rio	NOUN
dentistry3000-164	148	50	grande	grande	PROPN
dentistry3000-164	148	51	do	do	AUX
dentistry3000-164	148	52	sul	sul	PROPN
dentistry3000-164	148	53	–	–	PUNCT
dentistry3000-164	148	54	fapergs	fapergs	NOUN
dentistry3000-164	148	55	)	)	PUNCT
dentistry3000-164	148	56	and	and	CCONJ
dentistry3000-164	148	57	prorectory	prorectory	NOUN
dentistry3000-164	148	58	of	of	ADP
dentistry3000-164	148	59	research	research	NOUN
dentistry3000-164	148	60	and	and	CCONJ
dentistry3000-164	148	61	graduate	graduate	NOUN
dentistry3000-164	148	62	program	program	NOUN
dentistry3000-164	148	63	ufpa	ufpa	NOUN
dentistry3000-164	148	64	(	(	PUNCT
dentistry3000-164	148	65	propesp	propesp	NOUN
dentistry3000-164	148	66	)	)	PUNCT
dentistry3000-164	148	67	.	.	PUNCT
dentistry3000-164	149	1	this	this	DET
dentistry3000-164	149	2	study	study	NOUN
dentistry3000-164	149	3	was	be	AUX
dentistry3000-164	149	4	financed	finance	VERB
dentistry3000-164	149	5	in	in	ADP
dentistry3000-164	149	6	part	part	NOUN
dentistry3000-164	149	7	by	by	ADP
dentistry3000-164	149	8	the	the	DET
dentistry3000-164	149	9	coordenação	coordenação	PROPN
dentistry3000-164	149	10	de	de	PROPN
dentistry3000-164	149	11	aperfeiçoamento	aperfeiçoamento	PROPN
dentistry3000-164	149	12	de	de	X
dentistry3000-164	149	13	pessoal	pessoal	PROPN
dentistry3000-164	149	14	de	de	PROPN
dentistry3000-164	149	15	nível	nível	PROPN
dentistry3000-164	149	16	superior	superior	PROPN
dentistry3000-164	149	17	brasil	brasil	PROPN
dentistry3000-164	149	18	(	(	PUNCT
dentistry3000-164	149	19	capes	cape	NOUN
dentistry3000-164	149	20	)	)	PUNCT
dentistry3000-164	149	21	finance	finance	NOUN
dentistry3000-164	149	22	code	code	NOUN
dentistry3000-164	149	23	001	001	NUM
dentistry3000-164	149	24	.	.	PUNCT
dentistry3000-164	150	1	conflicts	conflict	NOUN
dentistry3000-164	150	2	of	of	ADP
dentistry3000-164	150	3	interest	interest	NOUN
dentistry3000-164	150	4	the	the	DET
dentistry3000-164	150	5	authors	author	NOUN
dentistry3000-164	150	6	declare	declare	VERB
dentistry3000-164	150	7	no	no	DET
dentistry3000-164	150	8	competing	compete	VERB
dentistry3000-164	150	9	interest	interest	NOUN
dentistry3000-164	150	10	.	.	PUNCT
dentistry3000-164	151	1	references	reference	NOUN
dentistry3000-164	151	2	[	[	X
dentistry3000-164	151	3	1	1	NUM
dentistry3000-164	151	4	]	]	PUNCT
dentistry3000-164	151	5	cleft	cleft	NOUN
dentistry3000-164	151	6	lip	lip	NOUN
dentistry3000-164	151	7	a	a	DET
dentistry3000-164	151	8	comprehensive	comprehensive	ADJ
dentistry3000-164	151	9	review	review	NOUN
dentistry3000-164	151	10	.	.	PUNCT
dentistry3000-164	152	1	shkoukani	shkoukani	PROPN
dentistry3000-164	152	2	ma	ma	PROPN
dentistry3000-164	152	3	,	,	PUNCT
dentistry3000-164	152	4	chen	chen	PROPN
dentistry3000-164	152	5	m	m	PROPN
dentistry3000-164	152	6	,	,	PUNCT
dentistry3000-164	152	7	vong	vong	ADJ
dentistry3000-164	152	8	a.	a.	PROPN
dentistry3000-164	152	9	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	152	10	differential	differential	ADJ
dentistry3000-164	152	11	expression	expression	NOUN
dentistry3000-164	152	12	of	of	ADP
dentistry3000-164	152	13	the	the	DET
dentistry3000-164	152	14	irf6	irf6	PROPN
dentistry3000-164	152	15	gene	gene	NOUN
dentistry3000-164	152	16	in	in	ADP
dentistry3000-164	152	17	the	the	DET
dentistry3000-164	152	18	signs	sign	NOUN
dentistry3000-164	152	19	of	of	ADP
dentistry3000-164	152	20	van	van	PROPN
dentistry3000-164	152	21	der	der	PROPN
dentistry3000-164	152	22	woude	woude	VERB
dentistry3000-164	152	23	syndrome	syndrome	NOUN
dentistry3000-164	152	24	:	:	PUNCT
dentistry3000-164	152	25	are	be	AUX
dentistry3000-164	152	26	distinct	distinct	ADJ
dentistry3000-164	152	27	genetic	genetic	ADJ
dentistry3000-164	152	28	modifiers	modifier	NOUN
dentistry3000-164	152	29	operating	operate	VERB
dentistry3000-164	152	30	?	?	PUNCT
dentistry3000-164	153	1	vol	vol	NOUN
dentistry3000-164	153	2	9	9	NUM
dentistry3000-164	153	3	no	no	DET
dentistry3000-164	153	4	1	1	NUM
dentistry3000-164	153	5	(	(	PUNCT
dentistry3000-164	153	6	2021	2021	NUM
dentistry3000-164	153	7	)	)	PUNCT
dentistry3000-164	153	8	doi	doi	NOUN
dentistry3000-164	153	9	10.5195	10.5195	NUM
dentistry3000-164	153	10	/	/	SYM
dentistry3000-164	153	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	153	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	153	13	front	front	ADJ
dentistry3000-164	153	14	pediatr	pediatr	NOUN
dentistry3000-164	153	15	.	.	PUNCT
dentistry3000-164	154	1	2013	2013	NUM
dentistry3000-164	154	2	dec	dec	PROPN
dentistry3000-164	154	3	.	.	PROPN
dentistry3000-164	155	1	53	53	NUM
dentistry3000-164	155	2	(	(	PUNCT
dentistry3000-164	155	3	1	1	NUM
dentistry3000-164	155	4	):	):	SYM
dentistry3000-164	155	5	1	1	NUM
dentistry3000-164	155	6	10	10	NUM
dentistry3000-164	155	7	.	.	PUNCT
dentistry3000-164	156	1	pmid	pmid	NOUN
dentistry3000-164	156	2	:	:	PUNCT
dentistry3000-164	156	3	2440029	2440029	NUM
dentistry3000-164	156	4	.	.	PUNCT
dentistry3000-164	157	1	[	[	X
dentistry3000-164	157	2	2	2	NUM
dentistry3000-164	157	3	]	]	PUNCT
dentistry3000-164	157	4	van	van	PROPN
dentistry3000-164	157	5	der	der	PROPN
dentistry3000-164	157	6	woude	woude	VERB
dentistry3000-164	157	7	syndrome	syndrome	NOUN
dentistry3000-164	157	8	:	:	PUNCT
dentistry3000-164	157	9	clinical	clinical	ADJ
dentistry3000-164	157	10	presentation	presentation	NOUN
dentistry3000-164	157	11	in	in	ADP
dentistry3000-164	157	12	64	64	NUM
dentistry3000-164	157	13	patients	patient	NOUN
dentistry3000-164	157	14	.	.	PUNCT
dentistry3000-164	158	1	huang	huang	PROPN
dentistry3000-164	158	2	jj	jj	PROPN
dentistry3000-164	158	3	,	,	PUNCT
dentistry3000-164	158	4	hou	hou	PROPN
dentistry3000-164	158	5	jw	jw	PROPN
dentistry3000-164	158	6	,	,	PUNCT
dentistry3000-164	158	7	tan	tan	PROPN
dentistry3000-164	158	8	yc	yc	PROPN
dentistry3000-164	158	9	,	,	PUNCT
dentistry3000-164	158	10	chen	chen	PROPN
dentistry3000-164	158	11	kt	kt	PROPN
dentistry3000-164	158	12	,	,	PUNCT
dentistry3000-164	158	13	lo	lo	PROPN
dentistry3000-164	158	14	lj	lj	PROPN
dentistry3000-164	158	15	,	,	PUNCT
dentistry3000-164	158	16	chen	chen	PROPN
dentistry3000-164	158	17	yr	yr	PROPN
dentistry3000-164	158	18	.	.	PUNCT
dentistry3000-164	158	19	cleft	cleft	PROPN
dentistry3000-164	158	20	palate	palate	PROPN
dentistry3000-164	158	21	craniofac	craniofac	NOUN
dentistry3000-164	158	22	j.	j.	PROPN
dentistry3000-164	158	23	2007	2007	NUM
dentistry3000-164	158	24	nov;44(6):649	nov;44(6):649	NOUN
dentistry3000-164	158	25	-	-	SYM
dentistry3000-164	158	26	52	52	NUM
dentistry3000-164	158	27	.	.	PUNCT
dentistry3000-164	159	1	pmid	pmid	NOUN
dentistry3000-164	159	2	:	:	PUNCT
dentistry3000-164	159	3	18177185	18177185	NUM
dentistry3000-164	159	4	.	.	PUNCT
dentistry3000-164	160	1	[	[	X
dentistry3000-164	160	2	3	3	X
dentistry3000-164	160	3	]	]	X
dentistry3000-164	160	4	van	van	PROPN
dentistry3000-164	160	5	der	der	PROPN
dentistry3000-164	160	6	woude	woude	VERB
dentistry3000-164	160	7	syndrome	syndrome	NOUN
dentistry3000-164	160	8	:	:	PUNCT
dentistry3000-164	160	9	a	a	DET
dentistry3000-164	160	10	review	review	NOUN
dentistry3000-164	160	11	of	of	ADP
dentistry3000-164	160	12	11	11	NUM
dentistry3000-164	160	13	cases	case	NOUN
dentistry3000-164	160	14	seen	see	VERB
dentistry3000-164	160	15	at	at	ADP
dentistry3000-164	160	16	the	the	DET
dentistry3000-164	160	17	lagos	lagos	NOUN
dentistry3000-164	160	18	university	university	PROPN
dentistry3000-164	160	19	teaching	teaching	NOUN
dentistry3000-164	160	20	hospital	hospital	NOUN
dentistry3000-164	160	21	.	.	PUNCT
dentistry3000-164	161	1	james	james	PROPN
dentistry3000-164	161	2	o	o	PROPN
dentistry3000-164	161	3	,	,	PUNCT
dentistry3000-164	161	4	adeyemo	adeyemo	PROPN
dentistry3000-164	161	5	wl	wl	PROPN
dentistry3000-164	161	6	,	,	PUNCT
dentistry3000-164	161	7	emeka	emeka	PROPN
dentistry3000-164	161	8	ci	ci	PROPN
dentistry3000-164	161	9	,	,	PUNCT
dentistry3000-164	161	10	ogunlewe	ogunlewe	PROPN
dentistry3000-164	161	11	mo	mo	PROPN
dentistry3000-164	161	12	,	,	PUNCT
dentistry3000-164	161	13	ladeinde	ladeinde	PROPN
dentistry3000-164	161	14	al	al	PROPN
dentistry3000-164	161	15	,	,	PUNCT
dentistry3000-164	161	16	butali	butali	PROPN
dentistry3000-164	161	17	a.	a.	PROPN
dentistry3000-164	161	18	afr	afr	PROPN
dentistry3000-164	161	19	j	j	PROPN
dentistry3000-164	161	20	paediatr	paediatr	NOUN
dentistry3000-164	161	21	surg	surg	NOUN
dentistry3000-164	161	22	.	.	PUNCT
dentistry3000-164	162	1	2014	2014	NUM
dentistry3000-164	163	1	jan	jan	PROPN
dentistry3000-164	163	2	-	-	PUNCT
dentistry3000-164	163	3	mar;11(1):525	mar;11(1):525	PROPN
dentistry3000-164	163	4	.	.	PUNCT
dentistry3000-164	164	1	pmid	pmid	NOUN
dentistry3000-164	164	2	:	:	PUNCT
dentistry3000-164	164	3	24647295	24647295	NUM
dentistry3000-164	164	4	.	.	PUNCT
dentistry3000-164	165	1	[	[	X
dentistry3000-164	165	2	4	4	NUM
dentistry3000-164	165	3	]	]	X
dentistry3000-164	165	4	van	van	PROPN
dentistry3000-164	165	5	der	der	PROPN
dentistry3000-164	165	6	woude	woude	VERB
dentistry3000-164	165	7	syndrome	syndrome	NOUN
dentistry3000-164	165	8	:	:	PUNCT
dentistry3000-164	165	9	a	a	DET
dentistry3000-164	165	10	review	review	NOUN
dentistry3000-164	165	11	.	.	PUNCT
dentistry3000-164	166	1	cardinal	cardinal	ADJ
dentistry3000-164	166	2	signs	sign	NOUN
dentistry3000-164	166	3	,	,	PUNCT
dentistry3000-164	166	4	epidemiology	epidemiology	NOUN
dentistry3000-164	166	5	,	,	PUNCT
dentistry3000-164	166	6	associated	associated	ADJ
dentistry3000-164	166	7	features	feature	NOUN
dentistry3000-164	166	8	,	,	PUNCT
dentistry3000-164	166	9	differential	differential	ADJ
dentistry3000-164	166	10	diagnosis	diagnosis	NOUN
dentistry3000-164	166	11	,	,	PUNCT
dentistry3000-164	166	12	expressivity	expressivity	NOUN
dentistry3000-164	166	13	,	,	PUNCT
dentistry3000-164	166	14	genetic	genetic	ADJ
dentistry3000-164	166	15	counselling	counselling	NOUN
dentistry3000-164	166	16	and	and	CCONJ
dentistry3000-164	166	17	treatment	treatment	NOUN
dentistry3000-164	166	18	.	.	PUNCT
dentistry3000-164	167	1	rizos	rizos	PROPN
dentistry3000-164	167	2	m	m	PROPN
dentistry3000-164	167	3	,	,	PUNCT
dentistry3000-164	167	4	spyropoulos	spyropoulos	PROPN
dentistry3000-164	167	5	mn	mn	PROPN
dentistry3000-164	167	6	.	.	PROPN
dentistry3000-164	167	7	eur	eur	PROPN
dentistry3000-164	167	8	j	j	PROPN
dentistry3000-164	167	9	orthod	orthod	NOUN
dentistry3000-164	167	10	.	.	PUNCT
dentistry3000-164	168	1	2004	2004	NUM
dentistry3000-164	168	2	feb;26(1):17	feb;26(1):17	PROPN
dentistry3000-164	168	3	-	-	PROPN
dentistry3000-164	168	4	24	24	NUM
dentistry3000-164	168	5	.	.	PUNCT
dentistry3000-164	169	1	pmid	pmid	NOUN
dentistry3000-164	169	2	:	:	PUNCT
dentistry3000-164	169	3	14994878	14994878	NUM
dentistry3000-164	169	4	.	.	PUNCT
dentistry3000-164	170	1	[	[	X
dentistry3000-164	170	2	5	5	X
dentistry3000-164	170	3	]	]	PUNCT
dentistry3000-164	170	4	the	the	DET
dentistry3000-164	170	5	penetrance	penetrance	NOUN
dentistry3000-164	170	6	and	and	CCONJ
dentistry3000-164	170	7	variable	variable	ADJ
dentistry3000-164	170	8	expression	expression	NOUN
dentistry3000-164	170	9	of	of	ADP
dentistry3000-164	170	10	the	the	DET
dentistry3000-164	170	11	van	van	PROPN
dentistry3000-164	170	12	der	der	NOUN
dentistry3000-164	170	13	woude	woude	VERB
dentistry3000-164	170	14	syndrome	syndrome	NOUN
dentistry3000-164	170	15	:	:	PUNCT
dentistry3000-164	170	16	implications	implication	NOUN
dentistry3000-164	170	17	for	for	ADP
dentistry3000-164	170	18	genetic	genetic	ADJ
dentistry3000-164	170	19	counseling	counseling	NOUN
dentistry3000-164	170	20	.	.	PUNCT
dentistry3000-164	171	1	shprintzen	shprintzen	PROPN
dentistry3000-164	171	2	rj	rj	PROPN
dentistry3000-164	171	3	,	,	PUNCT
dentistry3000-164	171	4	goldberg	goldberg	PROPN
dentistry3000-164	171	5	rb	rb	PROPN
dentistry3000-164	171	6	,	,	PUNCT
dentistry3000-164	171	7	sidoti	sidoti	PROPN
dentistry3000-164	171	8	ej	ej	PROPN
dentistry3000-164	171	9	.	.	PROPN
dentistry3000-164	171	10	cleft	cleft	PROPN
dentistry3000-164	171	11	palate	palate	PROPN
dentistry3000-164	171	12	j.	j.	PROPN
dentistry3000-164	171	13	1980	1980	NUM
dentistry3000-164	171	14	jan;17(1):52	jan;17(1):52	PROPN
dentistry3000-164	171	15	-	-	PUNCT
dentistry3000-164	171	16	7	7	NUM
dentistry3000-164	171	17	.	.	PUNCT
dentistry3000-164	171	18	pmid	pmid	NOUN
dentistry3000-164	171	19	:	:	PUNCT
dentistry3000-164	171	20	6928118	6928118	NUM
dentistry3000-164	171	21	.	.	PUNCT
dentistry3000-164	172	1	[	[	X
dentistry3000-164	172	2	6	6	NUM
dentistry3000-164	172	3	]	]	PUNCT
dentistry3000-164	172	4	epidemiology	epidemiology	NOUN
dentistry3000-164	172	5	of	of	ADP
dentistry3000-164	172	6	van	van	PROPN
dentistry3000-164	172	7	der	der	PROPN
dentistry3000-164	172	8	woude	woude	VERB
dentistry3000-164	172	9	syndrome	syndrome	NOUN
dentistry3000-164	172	10	from	from	ADP
dentistry3000-164	172	11	mutational	mutational	ADJ
dentistry3000-164	172	12	analyses	analysis	NOUN
dentistry3000-164	172	13	in	in	ADP
dentistry3000-164	172	14	affected	affected	ADJ
dentistry3000-164	172	15	patients	patient	NOUN
dentistry3000-164	172	16	from	from	ADP
dentistry3000-164	172	17	pakistan	pakistan	PROPN
dentistry3000-164	172	18	.	.	PUNCT
dentistry3000-164	173	1	malik	malik	PROPN
dentistry3000-164	173	2	s	s	PROPN
dentistry3000-164	173	3	,	,	PUNCT
dentistry3000-164	173	4	kakar	kakar	NOUN
dentistry3000-164	173	5	n	n	CCONJ
dentistry3000-164	173	6	,	,	PUNCT
dentistry3000-164	173	7	hasnain	hasnain	VERB
dentistry3000-164	173	8	s	s	PROPN
dentistry3000-164	173	9	,	,	PUNCT
dentistry3000-164	173	10	ahmad	ahmad	PROPN
dentistry3000-164	173	11	j	j	PROPN
dentistry3000-164	173	12	,	,	PUNCT
dentistry3000-164	173	13	wilcox	wilcox	PROPN
dentistry3000-164	173	14	er	er	INTJ
dentistry3000-164	173	15	,	,	PUNCT
dentistry3000-164	173	16	naz	naz	PROPN
dentistry3000-164	173	17	s.	s.	PROPN
dentistry3000-164	173	18	clin	clin	PROPN
dentistry3000-164	173	19	genet	genet	PROPN
dentistry3000-164	173	20	.	.	PUNCT
dentistry3000-164	174	1	2010	2010	NUM
dentistry3000-164	174	2	sep;78(3):247	sep;78(3):247	PROPN
dentistry3000-164	174	3	-	-	PUNCT
dentistry3000-164	174	4	56	56	NUM
dentistry3000-164	174	5	.	.	PUNCT
dentistry3000-164	175	1	pmid	pmid	NOUN
dentistry3000-164	175	2	:	:	PUNCT
dentistry3000-164	175	3	20184620	20184620	NUM
dentistry3000-164	175	4	.	.	PUNCT
dentistry3000-164	176	1	[	[	X
dentistry3000-164	176	2	7	7	X
dentistry3000-164	176	3	]	]	X
dentistry3000-164	176	4	van	van	PROPN
dentistry3000-164	176	5	der	der	PROPN
dentistry3000-164	176	6	woude	woude	VERB
dentistry3000-164	176	7	syndrome	syndrome	NOUN
dentistry3000-164	176	8	:	:	PUNCT
dentistry3000-164	176	9	dentofacial	dentofacial	ADJ
dentistry3000-164	176	10	features	feature	NOUN
dentistry3000-164	176	11	and	and	CCONJ
dentistry3000-164	176	12	implications	implication	NOUN
dentistry3000-164	176	13	for	for	ADP
dentistry3000-164	176	14	clinical	clinical	ADJ
dentistry3000-164	176	15	practice	practice	NOUN
dentistry3000-164	176	16	.	.	PUNCT
dentistry3000-164	177	1	lam	lam	PROPN
dentistry3000-164	177	2	ak	ak	PROPN
dentistry3000-164	177	3	,	,	PUNCT
dentistry3000-164	177	4	david	david	PROPN
dentistry3000-164	177	5	dj	dj	PROPN
dentistry3000-164	177	6	,	,	PUNCT
dentistry3000-164	177	7	townsend	townsend	PROPN
dentistry3000-164	177	8	gc	gc	PROPN
dentistry3000-164	177	9	,	,	PUNCT
dentistry3000-164	177	10	anderson	anderson	PROPN
dentistry3000-164	177	11	pj	pj	PROPN
dentistry3000-164	177	12	.	.	PROPN
dentistry3000-164	178	1	aust	aust	PROPN
dentistry3000-164	178	2	dent	dent	PROPN
dentistry3000-164	178	3	j.	j.	PROPN
dentistry3000-164	178	4	2010	2010	NUM
dentistry3000-164	178	5	mar;55(1):51	mar;55(1):51	PROPN
dentistry3000-164	178	6	-	-	PUNCT
dentistry3000-164	178	7	8	8	NUM
dentistry3000-164	178	8	.	.	PUNCT
dentistry3000-164	179	1	pmid	pmid	NOUN
dentistry3000-164	179	2	:	:	PUNCT
dentistry3000-164	179	3	20415912	20415912	NUM
dentistry3000-164	179	4	.	.	PUNCT
dentistry3000-164	180	1	[	[	X
dentistry3000-164	180	2	8	8	NUM
dentistry3000-164	180	3	]	]	ADJ
dentistry3000-164	180	4	mutations	mutation	NOUN
dentistry3000-164	180	5	in	in	ADP
dentistry3000-164	180	6	irf6	irf6	PROPN
dentistry3000-164	180	7	cause	cause	SCONJ
dentistry3000-164	180	8	van	van	PROPN
dentistry3000-164	180	9	der	der	PROPN
dentistry3000-164	180	10	woude	woude	NOUN
dentistry3000-164	180	11	and	and	CCONJ
dentistry3000-164	180	12	popliteal	popliteal	NOUN
dentistry3000-164	180	13	pterygium	pterygium	NOUN
dentistry3000-164	180	14	syndromes	syndrome	NOUN
dentistry3000-164	180	15	.	.	PUNCT
dentistry3000-164	181	1	kondo	kondo	PROPN
dentistry3000-164	181	2	s	s	PROPN
dentistry3000-164	181	3	,	,	PUNCT
dentistry3000-164	181	4	schutte	schutte	PROPN
dentistry3000-164	181	5	bc	bc	PROPN
dentistry3000-164	181	6	,	,	PUNCT
dentistry3000-164	181	7	richardson	richardson	PROPN
dentistry3000-164	181	8	rj	rj	PROPN
dentistry3000-164	181	9	,	,	PUNCT
dentistry3000-164	181	10	bjork	bjork	PROPN
dentistry3000-164	181	11	bc	bc	PROPN
dentistry3000-164	181	12	,	,	PUNCT
dentistry3000-164	181	13	knight	knight	VERB
dentistry3000-164	181	14	as	as	ADP
dentistry3000-164	181	15	,	,	PUNCT
dentistry3000-164	181	16	watanabe	watanabe	PROPN
dentistry3000-164	181	17	y	y	PROPN
dentistry3000-164	181	18	,	,	PUNCT
dentistry3000-164	181	19	howard	howard	PROPN
dentistry3000-164	181	20	e	e	PROPN
dentistry3000-164	181	21	,	,	PUNCT
dentistry3000-164	181	22	de	de	X
dentistry3000-164	181	23	lima	lima	X
dentistry3000-164	181	24	rl	rl	PROPN
dentistry3000-164	181	25	,	,	PUNCT
dentistry3000-164	181	26	daack	daack	PROPN
dentistry3000-164	181	27	-	-	PUNCT
dentistry3000-164	181	28	hirsch	hirsch	PROPN
dentistry3000-164	181	29	s	s	PART
dentistry3000-164	181	30	,	,	PUNCT
dentistry3000-164	181	31	sander	sander	X
dentistry3000-164	181	32	a	a	PRON
dentistry3000-164	181	33	,	,	PUNCT
dentistry3000-164	181	34	mcdonaldmcginn	mcdonaldmcginn	ADJ
dentistry3000-164	181	35	dm	dm	PROPN
dentistry3000-164	181	36	,	,	PUNCT
dentistry3000-164	181	37	zackai	zackai	PROPN
dentistry3000-164	181	38	eh	eh	INTJ
dentistry3000-164	181	39	,	,	PUNCT
dentistry3000-164	181	40	lammer	lammer	PROPN
dentistry3000-164	181	41	ej	ej	PROPN
dentistry3000-164	181	42	,	,	PUNCT
dentistry3000-164	181	43	aylsworth	aylsworth	ADV
dentistry3000-164	181	44	as	as	ADP
dentistry3000-164	181	45	,	,	PUNCT
dentistry3000-164	181	46	ardinger	ardinger	NOUN
dentistry3000-164	181	47	hh	hh	PROPN
dentistry3000-164	181	48	,	,	PUNCT
dentistry3000-164	181	49	lidral	lidral	ADJ
dentistry3000-164	181	50	ac	ac	PROPN
dentistry3000-164	181	51	,	,	PUNCT
dentistry3000-164	181	52	pober	pober	PROPN
dentistry3000-164	181	53	br	br	PROPN
dentistry3000-164	181	54	,	,	PUNCT
dentistry3000-164	181	55	moreno	moreno	PROPN
dentistry3000-164	181	56	l	l	PROPN
dentistry3000-164	181	57	,	,	PUNCT
dentistry3000-164	181	58	arcos	arcos	PROPN
dentistry3000-164	181	59	-	-	PROPN
dentistry3000-164	181	60	burgos	burgos	PROPN
dentistry3000-164	181	61	m	m	PROPN
dentistry3000-164	181	62	,	,	PUNCT
dentistry3000-164	181	63	valencia	valencia	PROPN
dentistry3000-164	181	64	c	c	PROPN
dentistry3000-164	181	65	,	,	PUNCT
dentistry3000-164	181	66	houdayer	houdayer	PROPN
dentistry3000-164	181	67	c	c	NOUN
dentistry3000-164	181	68	,	,	PUNCT
dentistry3000-164	181	69	bahuau	bahuau	PROPN
dentistry3000-164	181	70	m	m	PROPN
dentistry3000-164	181	71	,	,	PUNCT
dentistry3000-164	181	72	moretti	moretti	PROPN
dentistry3000-164	181	73	-	-	PUNCT
dentistry3000-164	181	74	ferreira	ferreira	PROPN
dentistry3000-164	181	75	d	d	PROPN
dentistry3000-164	181	76	,	,	PUNCT
dentistry3000-164	181	77	richieri	richieri	PROPN
dentistry3000-164	181	78	-	-	PUNCT
dentistry3000-164	181	79	costa	costa	PROPN
dentistry3000-164	181	80	a	a	PROPN
dentistry3000-164	181	81	,	,	PUNCT
dentistry3000-164	181	82	dixon	dixon	PROPN
dentistry3000-164	181	83	mj	mj	PROPN
dentistry3000-164	181	84	,	,	PUNCT
dentistry3000-164	181	85	murray	murray	PROPN
dentistry3000-164	181	86	jc	jc	PROPN
dentistry3000-164	181	87	.	.	PROPN
dentistry3000-164	182	1	nat	nat	PROPN
dentistry3000-164	182	2	genet	genet	PROPN
dentistry3000-164	182	3	.	.	PUNCT
dentistry3000-164	183	1	2002	2002	NUM
dentistry3000-164	183	2	oct;32(2):285	oct;32(2):285	NUM
dentistry3000-164	183	3	-	-	SYM
dentistry3000-164	183	4	9	9	NUM
dentistry3000-164	183	5	.	.	PUNCT
dentistry3000-164	184	1	pmid	pmid	NOUN
dentistry3000-164	184	2	:	:	PUNCT
dentistry3000-164	184	3	12219090	12219090	NUM
dentistry3000-164	184	4	.	.	PUNCT
dentistry3000-164	185	1	[	[	X
dentistry3000-164	185	2	9	9	NUM
dentistry3000-164	185	3	]	]	PUNCT
dentistry3000-164	185	4	an	an	DET
dentistry3000-164	185	5	etiologic	etiologic	ADJ
dentistry3000-164	185	6	regulatory	regulatory	ADJ
dentistry3000-164	185	7	mutation	mutation	NOUN
dentistry3000-164	185	8	in	in	ADP
dentistry3000-164	185	9	irf6	irf6	NOUN
dentistry3000-164	185	10	with	with	ADP
dentistry3000-164	185	11	lossand	lossand	ADJ
dentistry3000-164	185	12	gain	gain	VERB
dentistry3000-164	185	13	-	-	PUNCT
dentistry3000-164	185	14	of	of	ADP
dentistry3000-164	185	15	-	-	PUNCT
dentistry3000-164	185	16	function	function	NOUN
dentistry3000-164	185	17	effects	effect	NOUN
dentistry3000-164	185	18	.	.	PUNCT
dentistry3000-164	186	1	fakhouri	fakhouri	PROPN
dentistry3000-164	186	2	wd	wd	PROPN
dentistry3000-164	186	3	,	,	PUNCT
dentistry3000-164	186	4	rahimov	rahimov	ADJ
dentistry3000-164	186	5	f	f	PROPN
dentistry3000-164	186	6	,	,	PUNCT
dentistry3000-164	186	7	attanasio	attanasio	NOUN
dentistry3000-164	186	8	c	c	NOUN
dentistry3000-164	186	9	,	,	PUNCT
dentistry3000-164	186	10	kouwenhoven	kouwenhoven	VERB
dentistry3000-164	186	11	en	en	PROPN
dentistry3000-164	186	12	,	,	PUNCT
dentistry3000-164	186	13	ferreira	ferreira	PROPN
dentistry3000-164	186	14	de	de	PROPN
dentistry3000-164	186	15	lima	lima	PROPN
dentistry3000-164	186	16	rl	rl	PROPN
dentistry3000-164	186	17	,	,	PUNCT
dentistry3000-164	186	18	felix	felix	PROPN
dentistry3000-164	186	19	tm	tm	PROPN
dentistry3000-164	186	20	,	,	PUNCT
dentistry3000-164	186	21	nitschke	nitschke	ADJ
dentistry3000-164	186	22	l	l	NOUN
dentistry3000-164	186	23	,	,	PUNCT
dentistry3000-164	186	24	huver	huver	ADV
dentistry3000-164	186	25	d	d	NOUN
dentistry3000-164	186	26	,	,	PUNCT
dentistry3000-164	186	27	barrons	barrons	PROPN
dentistry3000-164	186	28	j	j	PROPN
dentistry3000-164	186	29	,	,	PUNCT
dentistry3000-164	186	30	kousa	kousa	PROPN
dentistry3000-164	186	31	ya	ya	PROPN
dentistry3000-164	186	32	,	,	PUNCT
dentistry3000-164	186	33	leslie	leslie	PROPN
dentistry3000-164	186	34	e	e	PROPN
dentistry3000-164	186	35	,	,	PUNCT
dentistry3000-164	186	36	pennacchio	pennacchio	PROPN
dentistry3000-164	186	37	la	la	PROPN
dentistry3000-164	186	38	,	,	PUNCT
dentistry3000-164	186	39	van	van	PROPN
dentistry3000-164	186	40	bokhoven	bokhoven	NOUN
dentistry3000-164	186	41	h	h	PROPN
dentistry3000-164	186	42	,	,	PUNCT
dentistry3000-164	186	43	visel	visel	NOUN
dentistry3000-164	186	44	a	a	NOUN
dentistry3000-164	186	45	,	,	PUNCT
dentistry3000-164	186	46	zhou	zhou	PROPN
dentistry3000-164	186	47	h	h	PROPN
dentistry3000-164	186	48	,	,	PUNCT
dentistry3000-164	186	49	murray	murray	PROPN
dentistry3000-164	186	50	jc	jc	PROPN
dentistry3000-164	186	51	,	,	PUNCT
dentistry3000-164	186	52	schutte	schutte	PROPN
dentistry3000-164	186	53	bc	bc	PROPN
dentistry3000-164	186	54	.	.	PROPN
dentistry3000-164	186	55	hum	hum	PROPN
dentistry3000-164	186	56	mol	mol	ADP
dentistry3000-164	186	57	genet	genet	PROPN
dentistry3000-164	186	58	.	.	PUNCT
dentistry3000-164	187	1	2014	2014	NUM
dentistry3000-164	187	2	may	may	AUX
dentistry3000-164	187	3	15;23(10):2711	15;23(10):2711	NOUN
dentistry3000-164	187	4	-	-	SYM
dentistry3000-164	187	5	20	20	NUM
dentistry3000-164	187	6	.	.	PUNCT
dentistry3000-164	188	1	pmid	pmid	NOUN
dentistry3000-164	188	2	:	:	PUNCT
dentistry3000-164	188	3	24442519	24442519	NUM
dentistry3000-164	188	4	.	.	PUNCT
dentistry3000-164	189	1	[	[	X
dentistry3000-164	189	2	10	10	NUM
dentistry3000-164	189	3	]	]	X
dentistry3000-164	189	4	dominant	dominant	ADJ
dentistry3000-164	189	5	mutations	mutation	NOUN
dentistry3000-164	189	6	in	in	ADP
dentistry3000-164	189	7	grhl3	grhl3	NOUN
dentistry3000-164	189	8	cause	cause	SCONJ
dentistry3000-164	189	9	van	van	PROPN
dentistry3000-164	189	10	der	der	PROPN
dentistry3000-164	189	11	woude	woude	VERB
dentistry3000-164	189	12	syndrome	syndrome	NOUN
dentistry3000-164	189	13	and	and	CCONJ
dentistry3000-164	189	14	disrupt	disrupt	VERB
dentistry3000-164	189	15	oral	oral	ADJ
dentistry3000-164	189	16	periderm	periderm	NOUN
dentistry3000-164	189	17	development	development	NOUN
dentistry3000-164	189	18	.	.	PUNCT
dentistry3000-164	190	1	peyrard	peyrard	PROPN
dentistry3000-164	190	2	-	-	PUNCT
dentistry3000-164	190	3	janvid	janvid	PROPN
dentistry3000-164	190	4	m	m	PROPN
dentistry3000-164	190	5	,	,	PUNCT
dentistry3000-164	190	6	leslie	leslie	PROPN
dentistry3000-164	190	7	ej	ej	PROPN
dentistry3000-164	190	8	,	,	PUNCT
dentistry3000-164	190	9	kousa	kousa	PROPN
dentistry3000-164	190	10	ya	ya	PROPN
dentistry3000-164	190	11	,	,	PUNCT
dentistry3000-164	190	12	smith	smith	PROPN
dentistry3000-164	190	13	tl	tl	PROPN
dentistry3000-164	190	14	,	,	PUNCT
dentistry3000-164	190	15	dunnwald	dunnwald	PROPN
dentistry3000-164	190	16	m	m	PROPN
dentistry3000-164	190	17	,	,	PUNCT
dentistry3000-164	190	18	magnusson	magnusson	PROPN
dentistry3000-164	190	19	m	m	PROPN
dentistry3000-164	190	20	,	,	PUNCT
dentistry3000-164	190	21	lentz	lentz	PROPN
dentistry3000-164	190	22	ba	ba	PROPN
dentistry3000-164	190	23	,	,	PUNCT
dentistry3000-164	190	24	unneberg	unneberg	PROPN
dentistry3000-164	190	25	p	p	PROPN
dentistry3000-164	190	26	,	,	PUNCT
dentistry3000-164	190	27	fransson	fransson	PROPN
dentistry3000-164	190	28	i	i	PROPN
dentistry3000-164	190	29	,	,	PUNCT
dentistry3000-164	190	30	koillinen	koillinen	PROPN
dentistry3000-164	190	31	hk	hk	PROPN
dentistry3000-164	190	32	,	,	PUNCT
dentistry3000-164	190	33	rautio	rautio	PROPN
dentistry3000-164	190	34	j	j	PROPN
dentistry3000-164	190	35	,	,	PUNCT
dentistry3000-164	190	36	pegelow	pegelow	VERB
dentistry3000-164	190	37	m	m	PROPN
dentistry3000-164	190	38	,	,	PUNCT
dentistry3000-164	190	39	karsten	karsten	PROPN
dentistry3000-164	190	40	a	a	PROPN
dentistry3000-164	190	41	,	,	PUNCT
dentistry3000-164	190	42	basel	basel	PROPN
dentistry3000-164	190	43	-	-	PUNCT
dentistry3000-164	190	44	vanagaite	vanagaite	NOUN
dentistry3000-164	190	45	l	l	PROPN
dentistry3000-164	190	46	,	,	PUNCT
dentistry3000-164	190	47	gordon	gordon	PROPN
dentistry3000-164	190	48	w	w	PROPN
dentistry3000-164	190	49	,	,	PUNCT
dentistry3000-164	190	50	andersen	andersen	PROPN
dentistry3000-164	190	51	b	b	PROPN
dentistry3000-164	190	52	,	,	PUNCT
dentistry3000-164	190	53	svensson	svensson	PROPN
dentistry3000-164	190	54	t	t	PROPN
dentistry3000-164	190	55	,	,	PUNCT
dentistry3000-164	190	56	murray	murray	PROPN
dentistry3000-164	190	57	jc	jc	PROPN
dentistry3000-164	190	58	,	,	PUNCT
dentistry3000-164	190	59	cornell	cornell	PROPN
dentistry3000-164	190	60	ra	ra	PROPN
dentistry3000-164	190	61	,	,	PUNCT
dentistry3000-164	190	62	kere	kere	PROPN
dentistry3000-164	190	63	j	j	PROPN
dentistry3000-164	190	64	,	,	PUNCT
dentistry3000-164	190	65	schutte	schutte	PROPN
dentistry3000-164	190	66	bc	bc	PROPN
dentistry3000-164	190	67	.	.	PROPN
dentistry3000-164	190	68	am	be	AUX
dentistry3000-164	190	69	j	j	PROPN
dentistry3000-164	190	70	hum	hum	PROPN
dentistry3000-164	190	71	genet	genet	PROPN
dentistry3000-164	190	72	.	.	PUNCT
dentistry3000-164	191	1	2014	2014	NUM
dentistry3000-164	191	2	jan	jan	PROPN
dentistry3000-164	191	3	2;94(1):23	2;94(1):23	PROPN
dentistry3000-164	191	4	-	-	SYM
dentistry3000-164	191	5	32	32	NUM
dentistry3000-164	191	6	.	.	PUNCT
dentistry3000-164	192	1	pmid	pmid	NOUN
dentistry3000-164	192	2	:	:	PUNCT
dentistry3000-164	192	3	24360809	24360809	NUM
dentistry3000-164	192	4	.	.	PUNCT
dentistry3000-164	193	1	[	[	X
dentistry3000-164	193	2	11	11	NUM
dentistry3000-164	193	3	]	]	PUNCT
dentistry3000-164	193	4	a	a	DET
dentistry3000-164	193	5	preliminary	preliminary	ADJ
dentistry3000-164	193	6	gene	gene	NOUN
dentistry3000-164	193	7	map	map	NOUN
dentistry3000-164	193	8	for	for	ADP
dentistry3000-164	193	9	the	the	DET
dentistry3000-164	193	10	van	van	PROPN
dentistry3000-164	193	11	der	der	NOUN
dentistry3000-164	193	12	woude	woude	VERB
dentistry3000-164	193	13	syndrome	syndrome	NOUN
dentistry3000-164	193	14	critical	critical	ADJ
dentistry3000-164	193	15	region	region	NOUN
dentistry3000-164	193	16	derived	derive	VERB
dentistry3000-164	193	17	from	from	ADP
dentistry3000-164	193	18	900	900	NUM
dentistry3000-164	193	19	kb	kb	NOUN
dentistry3000-164	193	20	of	of	ADP
dentistry3000-164	193	21	genomic	genomic	ADJ
dentistry3000-164	193	22	sequence	sequence	NOUN
dentistry3000-164	193	23	at	at	ADP
dentistry3000-164	193	24	1q32	1q32	NOUN
dentistry3000-164	193	25	-	-	PUNCT
dentistry3000-164	193	26	q41	q41	NOUN
dentistry3000-164	193	27	.	.	PUNCT
dentistry3000-164	194	1	schutte	schutte	PROPN
dentistry3000-164	194	2	bc	bc	PROPN
dentistry3000-164	194	3	,	,	PUNCT
dentistry3000-164	194	4	bjork	bjork	PROPN
dentistry3000-164	194	5	bc	bc	PROPN
dentistry3000-164	194	6	,	,	PUNCT
dentistry3000-164	194	7	coppage	coppage	PROPN
dentistry3000-164	194	8	kb	kb	PROPN
dentistry3000-164	194	9	,	,	PUNCT
dentistry3000-164	194	10	malik	malik	PROPN
dentistry3000-164	194	11	mi	mi	PROPN
dentistry3000-164	194	12	,	,	PUNCT
dentistry3000-164	194	13	gregory	gregory	PROPN
dentistry3000-164	194	14	sg	sg	PROPN
dentistry3000-164	194	15	,	,	PUNCT
dentistry3000-164	194	16	scott	scott	PROPN
dentistry3000-164	194	17	dj	dj	PROPN
dentistry3000-164	194	18	,	,	PUNCT
dentistry3000-164	194	19	brentzell	brentzell	VERB
dentistry3000-164	194	20	lm	lm	PROPN
dentistry3000-164	194	21	,	,	PUNCT
dentistry3000-164	194	22	watanabe	watanabe	PROPN
dentistry3000-164	194	23	y	y	PROPN
dentistry3000-164	194	24	,	,	PUNCT
dentistry3000-164	194	25	dixon	dixon	PROPN
dentistry3000-164	194	26	mj	mj	PROPN
dentistry3000-164	194	27	,	,	PUNCT
dentistry3000-164	194	28	murray	murray	PROPN
dentistry3000-164	194	29	jc	jc	PROPN
dentistry3000-164	194	30	.	.	PROPN
dentistry3000-164	194	31	genome	genome	NOUN
dentistry3000-164	194	32	res	re	NOUN
dentistry3000-164	194	33	.	.	PUNCT
dentistry3000-164	195	1	2000	2000	NUM
dentistry3000-164	195	2	jan;10(1):81	jan;10(1):81	PROPN
dentistry3000-164	195	3	-	-	PUNCT
dentistry3000-164	195	4	94	94	PROPN
dentistry3000-164	195	5	.	.	PUNCT
dentistry3000-164	196	1	pmid	pmid	NOUN
dentistry3000-164	196	2	:	:	PUNCT
dentistry3000-164	196	3	10645953	10645953	NUM
dentistry3000-164	196	4	.	.	PUNCT
dentistry3000-164	197	1	[	[	X
dentistry3000-164	197	2	12	12	NUM
dentistry3000-164	197	3	]	]	PUNCT
dentistry3000-164	197	4	the	the	DET
dentistry3000-164	197	5	irf	irf	PROPN
dentistry3000-164	197	6	family	family	PROPN
dentistry3000-164	197	7	of	of	ADP
dentistry3000-164	197	8	transcription	transcription	NOUN
dentistry3000-164	197	9	factors	factor	NOUN
dentistry3000-164	197	10	:	:	PUNCT
dentistry3000-164	197	11	inception	inception	ADJ
dentistry3000-164	197	12	,	,	PUNCT
dentistry3000-164	197	13	impact	impact	NOUN
dentistry3000-164	197	14	and	and	CCONJ
dentistry3000-164	197	15	implications	implication	NOUN
dentistry3000-164	197	16	in	in	ADP
dentistry3000-164	197	17	oncogenesis	oncogenesis	NOUN
dentistry3000-164	197	18	.	.	PUNCT
dentistry3000-164	198	1	yanai	yanai	PROPN
dentistry3000-164	198	2	h	h	PROPN
dentistry3000-164	198	3	,	,	PUNCT
dentistry3000-164	198	4	negishi	negishi	PROPN
dentistry3000-164	198	5	h	h	PROPN
dentistry3000-164	198	6	,	,	PUNCT
dentistry3000-164	198	7	taniguchi	taniguchi	PROPN
dentistry3000-164	198	8	t.	t.	PROPN
dentistry3000-164	198	9	oncoimmunology	oncoimmunology	NOUN
dentistry3000-164	198	10	.	.	PUNCT
dentistry3000-164	199	1	2012	2012	NUM
dentistry3000-164	199	2	nov	nov	NOUN
dentistry3000-164	199	3	1;1(8):1376	1;1(8):1376	NUM
dentistry3000-164	199	4	-	-	SYM
dentistry3000-164	199	5	1386	1386	NUM
dentistry3000-164	199	6	.	.	PUNCT
dentistry3000-164	200	1	pmid	pmid	NOUN
dentistry3000-164	200	2	:	:	PUNCT
dentistry3000-164	200	3	23243601	23243601	NUM
dentistry3000-164	200	4	.	.	PUNCT
dentistry3000-164	201	1	[	[	X
dentistry3000-164	201	2	13	13	NUM
dentistry3000-164	201	3	]	]	X
dentistry3000-164	201	4	maternal	maternal	ADJ
dentistry3000-164	201	5	interferon	interferon	ADJ
dentistry3000-164	201	6	regulatory	regulatory	ADJ
dentistry3000-164	201	7	factor	factor	NOUN
dentistry3000-164	201	8	6	6	NUM
dentistry3000-164	201	9	is	be	AUX
dentistry3000-164	201	10	required	require	VERB
dentistry3000-164	201	11	for	for	ADP
dentistry3000-164	201	12	the	the	DET
dentistry3000-164	201	13	differentiation	differentiation	NOUN
dentistry3000-164	201	14	of	of	ADP
dentistry3000-164	201	15	primary	primary	ADJ
dentistry3000-164	201	16	superficial	superficial	ADJ
dentistry3000-164	201	17	epithelia	epithelium	NOUN
dentistry3000-164	201	18	in	in	ADP
dentistry3000-164	201	19	danio	danio	PROPN
dentistry3000-164	201	20	and	and	CCONJ
dentistry3000-164	201	21	xenopus	xenopus	PROPN
dentistry3000-164	201	22	embryos	embryos	PROPN
dentistry3000-164	201	23	.	.	PUNCT
dentistry3000-164	202	1	sabel	sabel	PROPN
dentistry3000-164	202	2	jl	jl	PROPN
dentistry3000-164	202	3	,	,	PUNCT
dentistry3000-164	202	4	d'alençon	d'alençon	PROPN
dentistry3000-164	202	5	c	c	PROPN
dentistry3000-164	202	6	,	,	PUNCT
dentistry3000-164	202	7	o'brien	o'brien	PROPN
dentistry3000-164	202	8	ek	ek	PROPN
dentistry3000-164	202	9	,	,	PUNCT
dentistry3000-164	202	10	van	van	PROPN
dentistry3000-164	202	11	otterloo	otterloo	PROPN
dentistry3000-164	202	12	e	e	PROPN
dentistry3000-164	202	13	,	,	PUNCT
dentistry3000-164	202	14	lutz	lutz	PROPN
dentistry3000-164	202	15	k	k	PROPN
dentistry3000-164	202	16	,	,	PUNCT
dentistry3000-164	202	17	cuykendall	cuykendall	PROPN
dentistry3000-164	202	18	tn	tn	PROPN
dentistry3000-164	202	19	,	,	PUNCT
dentistry3000-164	202	20	schutte	schutte	PROPN
dentistry3000-164	202	21	bc	bc	PROPN
dentistry3000-164	202	22	,	,	PUNCT
dentistry3000-164	202	23	houston	houston	PROPN
dentistry3000-164	202	24	dw	dw	PROPN
dentistry3000-164	202	25	,	,	PUNCT
dentistry3000-164	202	26	cornell	cornell	PROPN
dentistry3000-164	202	27	ra	ra	PROPN
dentistry3000-164	202	28	.	.	PUNCT
dentistry3000-164	203	1	dev	dev	PROPN
dentistry3000-164	203	2	biol	biol	PROPN
dentistry3000-164	203	3	.	.	PUNCT
dentistry3000-164	204	1	2009	2009	NUM
dentistry3000-164	204	2	jan	jan	NOUN
dentistry3000-164	204	3	1;325(1):249	1;325(1):249	NUM
dentistry3000-164	204	4	-	-	SYM
dentistry3000-164	204	5	62	62	NUM
dentistry3000-164	204	6	.	.	PUNCT
dentistry3000-164	205	1	pmid	pmid	NOUN
dentistry3000-164	205	2	:	:	PUNCT
dentistry3000-164	205	3	19013452	19013452	NUM
dentistry3000-164	205	4	.	.	PUNCT
dentistry3000-164	206	1	[	[	X
dentistry3000-164	206	2	14	14	NUM
dentistry3000-164	206	3	]	]	SYM
dentistry3000-164	206	4	abnormal	abnormal	ADJ
dentistry3000-164	206	5	skin	skin	NOUN
dentistry3000-164	206	6	,	,	PUNCT
dentistry3000-164	206	7	limb	limb	NOUN
dentistry3000-164	206	8	and	and	CCONJ
dentistry3000-164	206	9	craniofacial	craniofacial	ADJ
dentistry3000-164	206	10	morphogenesis	morphogenesis	NOUN
dentistry3000-164	206	11	in	in	ADP
dentistry3000-164	206	12	mice	mouse	NOUN
dentistry3000-164	206	13	deficient	deficient	ADJ
dentistry3000-164	206	14	for	for	ADP
dentistry3000-164	206	15	interferon	interferon	ADJ
dentistry3000-164	206	16	regulatory	regulatory	ADJ
dentistry3000-164	206	17	factor	factor	NOUN
dentistry3000-164	206	18	6	6	NUM
dentistry3000-164	206	19	(	(	PUNCT
dentistry3000-164	206	20	irf6	irf6	PROPN
dentistry3000-164	206	21	)	)	PUNCT
dentistry3000-164	206	22	.	.	PUNCT
dentistry3000-164	207	1	ingraham	ingraham	PROPN
dentistry3000-164	207	2	cr	cr	PROPN
dentistry3000-164	207	3	,	,	PUNCT
dentistry3000-164	207	4	kinoshita	kinoshita	PROPN
dentistry3000-164	207	5	a	a	PRON
dentistry3000-164	207	6	,	,	PUNCT
dentistry3000-164	207	7	kondo	kondo	PROPN
dentistry3000-164	207	8	s	s	PROPN
dentistry3000-164	207	9	,	,	PUNCT
dentistry3000-164	207	10	yang	yang	PROPN
dentistry3000-164	207	11	b	b	PROPN
dentistry3000-164	207	12	,	,	PUNCT
dentistry3000-164	207	13	sajan	sajan	PROPN
dentistry3000-164	207	14	s	s	PROPN
dentistry3000-164	207	15	,	,	PUNCT
dentistry3000-164	207	16	trout	trout	PROPN
dentistry3000-164	207	17	kj	kj	PROPN
dentistry3000-164	207	18	,	,	PUNCT
dentistry3000-164	207	19	malik	malik	PROPN
dentistry3000-164	207	20	mi	mi	PROPN
dentistry3000-164	207	21	,	,	PUNCT
dentistry3000-164	207	22	dunnwald	dunnwald	PROPN
dentistry3000-164	207	23	m	m	PROPN
dentistry3000-164	207	24	,	,	PUNCT
dentistry3000-164	207	25	goudy	goudy	ADJ
dentistry3000-164	207	26	sl	sl	PROPN
dentistry3000-164	207	27	,	,	PUNCT
dentistry3000-164	207	28	lovett	lovett	PROPN
dentistry3000-164	207	29	m	m	PROPN
dentistry3000-164	207	30	,	,	PUNCT
dentistry3000-164	207	31	murray	murray	PROPN
dentistry3000-164	207	32	jc	jc	PROPN
dentistry3000-164	207	33	,	,	PUNCT
dentistry3000-164	207	34	schutte	schutte	PROPN
dentistry3000-164	207	35	bc	bc	PROPN
dentistry3000-164	207	36	.	.	PUNCT
dentistry3000-164	208	1	nat	nat	PROPN
dentistry3000-164	208	2	genet	genet	PROPN
dentistry3000-164	208	3	.	.	PUNCT
dentistry3000-164	209	1	2006	2006	NUM
dentistry3000-164	209	2	nov;38(11):1335	nov;38(11):1335	NOUN
dentistry3000-164	209	3	-	-	SYM
dentistry3000-164	209	4	40	40	NUM
dentistry3000-164	209	5	.	.	PUNCT
dentistry3000-164	210	1	pmid	pmid	NOUN
dentistry3000-164	210	2	:	:	PUNCT
dentistry3000-164	210	3	17041601	17041601	NUM
dentistry3000-164	210	4	.	.	PUNCT
dentistry3000-164	211	1	[	[	X
dentistry3000-164	211	2	15	15	NUM
dentistry3000-164	211	3	]	]	X
dentistry3000-164	211	4	irf	irf	PROPN
dentistry3000-164	211	5	family	family	PROPN
dentistry3000-164	211	6	of	of	ADP
dentistry3000-164	211	7	transcription	transcription	NOUN
dentistry3000-164	211	8	factors	factor	NOUN
dentistry3000-164	211	9	as	as	ADP
dentistry3000-164	211	10	regulators	regulator	NOUN
dentistry3000-164	211	11	of	of	ADP
dentistry3000-164	211	12	host	host	NOUN
dentistry3000-164	211	13	defense	defense	NOUN
dentistry3000-164	211	14	.	.	PUNCT
dentistry3000-164	212	1	taniguchi	taniguchi	PROPN
dentistry3000-164	212	2	t	t	PROPN
dentistry3000-164	212	3	,	,	PUNCT
dentistry3000-164	212	4	ogasawara	ogasawara	PROPN
dentistry3000-164	212	5	k	k	NOUN
dentistry3000-164	212	6	,	,	PUNCT
dentistry3000-164	212	7	takaoka	takaoka	NOUN
dentistry3000-164	212	8	a	a	PRON
dentistry3000-164	212	9	,	,	PUNCT
dentistry3000-164	212	10	tanaka	tanaka	PROPN
dentistry3000-164	212	11	n.	n.	PROPN
dentistry3000-164	212	12	annu	annu	PROPN
dentistry3000-164	212	13	rev	rev	VERB
dentistry3000-164	212	14	immunol	immunol	NOUN
dentistry3000-164	212	15	.	.	PUNCT
dentistry3000-164	213	1	2001;19	2001;19	NOUN
dentistry3000-164	213	2	:	:	PUNCT
dentistry3000-164	213	3	623	623	NUM
dentistry3000-164	213	4	-	-	SYM
dentistry3000-164	213	5	55	55	NUM
dentistry3000-164	213	6	.	.	PUNCT
dentistry3000-164	214	1	pmid	pmid	NOUN
dentistry3000-164	214	2	:	:	PUNCT
dentistry3000-164	214	3	11244049	11244049	NUM
dentistry3000-164	214	4	.	.	PUNCT
dentistry3000-164	215	1	[	[	X
dentistry3000-164	215	2	16	16	NUM
dentistry3000-164	215	3	]	]	PUNCT
dentistry3000-164	215	4	interferon	interferon	ADJ
dentistry3000-164	215	5	regulatory	regulatory	ADJ
dentistry3000-164	215	6	factor	factor	NOUN
dentistry3000-164	215	7	6	6	NUM
dentistry3000-164	215	8	is	be	AUX
dentistry3000-164	215	9	necessary	necessary	ADJ
dentistry3000-164	215	10	for	for	ADP
dentistry3000-164	215	11	salivary	salivary	ADJ
dentistry3000-164	215	12	glands	gland	NOUN
dentistry3000-164	215	13	and	and	CCONJ
dentistry3000-164	215	14	pancreas	pancreas	NOUN
dentistry3000-164	215	15	development	development	NOUN
dentistry3000-164	215	16	.	.	PUNCT
dentistry3000-164	216	1	metwalli	metwalli	PROPN
dentistry3000-164	216	2	ka	ka	PROPN
dentistry3000-164	216	3	,	,	PUNCT
dentistry3000-164	216	4	do	do	VERB
dentistry3000-164	216	5	ma	ma	PROPN
dentistry3000-164	216	6	,	,	PUNCT
dentistry3000-164	216	7	nguyen	nguyen	PROPN
dentistry3000-164	216	8	k	k	PROPN
dentistry3000-164	216	9	,	,	PUNCT
dentistry3000-164	216	10	mallick	mallick	PROPN
dentistry3000-164	216	11	s	s	PROPN
dentistry3000-164	216	12	,	,	PUNCT
dentistry3000-164	216	13	kin	kin	PROPN
dentistry3000-164	216	14	k	k	PROPN
dentistry3000-164	216	15	,	,	PUNCT
dentistry3000-164	216	16	farokhnia	farokhnia	PROPN
dentistry3000-164	216	17	n	n	PRON
dentistry3000-164	216	18	,	,	PUNCT
dentistry3000-164	216	19	jun	jun	PROPN
dentistry3000-164	216	20	g	g	PROPN
dentistry3000-164	216	21	,	,	PUNCT
dentistry3000-164	216	22	fakhouri	fakhouri	PROPN
dentistry3000-164	216	23	wd	wd	PROPN
dentistry3000-164	216	24	.	.	PUNCT
dentistry3000-164	217	1	j	j	PROPN
dentistry3000-164	217	2	dent	dent	PROPN
dentistry3000-164	217	3	res	re	NOUN
dentistry3000-164	217	4	.	.	PUNCT
dentistry3000-164	217	5	2018	2018	NUM
dentistry3000-164	217	6	feb;97(2):226	feb;97(2):226	NOUN
dentistry3000-164	217	7	-	-	PROPN
dentistry3000-164	217	8	236	236	NUM
dentistry3000-164	217	9	.	.	PUNCT
dentistry3000-164	218	1	pmid	pmid	NOUN
dentistry3000-164	218	2	:	:	PUNCT
dentistry3000-164	218	3	28898113	28898113	NUM
dentistry3000-164	218	4	.	.	PUNCT
dentistry3000-164	219	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	219	2	differential	differential	ADJ
dentistry3000-164	219	3	expression	expression	NOUN
dentistry3000-164	219	4	of	of	ADP
dentistry3000-164	219	5	the	the	DET
dentistry3000-164	219	6	irf6	irf6	PROPN
dentistry3000-164	219	7	gene	gene	NOUN
dentistry3000-164	219	8	in	in	ADP
dentistry3000-164	219	9	the	the	DET
dentistry3000-164	219	10	signs	sign	NOUN
dentistry3000-164	219	11	of	of	ADP
dentistry3000-164	219	12	van	van	PROPN
dentistry3000-164	219	13	der	der	PROPN
dentistry3000-164	219	14	woude	woude	VERB
dentistry3000-164	219	15	syndrome	syndrome	NOUN
dentistry3000-164	219	16	:	:	PUNCT
dentistry3000-164	219	17	are	be	AUX
dentistry3000-164	219	18	distinct	distinct	ADJ
dentistry3000-164	219	19	genetic	genetic	ADJ
dentistry3000-164	219	20	modifiers	modifier	NOUN
dentistry3000-164	219	21	operating	operate	VERB
dentistry3000-164	219	22	?	?	PUNCT
dentistry3000-164	220	1	vol	vol	NOUN
dentistry3000-164	220	2	9	9	NUM
dentistry3000-164	220	3	no	no	DET
dentistry3000-164	220	4	1	1	NUM
dentistry3000-164	220	5	(	(	PUNCT
dentistry3000-164	220	6	2021	2021	NUM
dentistry3000-164	220	7	)	)	PUNCT
dentistry3000-164	220	8	doi	doi	NOUN
dentistry3000-164	220	9	10.5195	10.5195	NUM
dentistry3000-164	220	10	/	/	SYM
dentistry3000-164	220	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	220	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	220	13	[	[	X
dentistry3000-164	220	14	17	17	NUM
dentistry3000-164	220	15	]	]	X
dentistry3000-164	220	16	genealogical	genealogical	ADJ
dentistry3000-164	220	17	data	datum	NOUN
dentistry3000-164	220	18	in	in	ADP
dentistry3000-164	220	19	population	population	NOUN
dentistry3000-164	220	20	medical	medical	ADJ
dentistry3000-164	220	21	genetics	genetic	NOUN
dentistry3000-164	220	22	:	:	PUNCT
dentistry3000-164	220	23	field	field	NOUN
dentistry3000-164	220	24	guidelines.poletta	guidelines.poletta	PROPN
dentistry3000-164	220	25	fa	fa	NOUN
dentistry3000-164	220	26	,	,	PUNCT
dentistry3000-164	220	27	orioli	orioli	ADP
dentistry3000-164	220	28	i	i	PRON
dentistry3000-164	220	29	m	m	PROPN
dentistry3000-164	220	30	,	,	PUNCT
dentistry3000-164	220	31	castilla	castilla	PROPN
dentistry3000-164	220	32	ee	ee	PROPN
dentistry3000-164	220	33	.	.	PROPN
dentistry3000-164	221	1	genet	genet	PROPN
dentistry3000-164	221	2	mol	mol	ADP
dentistry3000-164	221	3	biol	biol	PROPN
dentistry3000-164	221	4	.	.	PUNCT
dentistry3000-164	222	1	2014	2014	NUM
dentistry3000-164	222	2	mar;37(1	mar;37(1	ADP
dentistry3000-164	222	3	suppl):171	suppl):171	PROPN
dentistry3000-164	222	4	-	-	PUNCT
dentistry3000-164	222	5	85	85	NUM
dentistry3000-164	222	6	.	.	PUNCT
dentistry3000-164	223	1	pmid	pmid	NOUN
dentistry3000-164	223	2	:	:	PUNCT
dentistry3000-164	223	3	24764752	24764752	NUM
dentistry3000-164	223	4	.	.	PUNCT
dentistry3000-164	224	1	[	[	X
dentistry3000-164	224	2	18	18	NUM
dentistry3000-164	224	3	]	]	PUNCT
dentistry3000-164	224	4	protein	protein	NOUN
dentistry3000-164	224	5	structure	structure	NOUN
dentistry3000-164	224	6	analysis	analysis	NOUN
dentistry3000-164	224	7	of	of	ADP
dentistry3000-164	224	8	mutations	mutation	NOUN
dentistry3000-164	224	9	causing	cause	VERB
dentistry3000-164	224	10	inheritable	inheritable	ADJ
dentistry3000-164	224	11	diseases	disease	NOUN
dentistry3000-164	224	12	.	.	PUNCT
dentistry3000-164	225	1	an	an	DET
dentistry3000-164	225	2	e	e	NOUN
dentistry3000-164	225	3	-	-	NOUN
dentistry3000-164	225	4	science	science	ADJ
dentistry3000-164	225	5	approach	approach	NOUN
dentistry3000-164	225	6	with	with	ADP
dentistry3000-164	225	7	life	life	NOUN
dentistry3000-164	225	8	scientist	scientist	NOUN
dentistry3000-164	225	9	friendly	friendly	ADJ
dentistry3000-164	225	10	interfaces	interface	NOUN
dentistry3000-164	225	11	.	.	PUNCT
dentistry3000-164	226	1	venselaar	venselaar	NOUN
dentistry3000-164	226	2	h	h	PROPN
dentistry3000-164	226	3	,	,	PUNCT
dentistry3000-164	226	4	te	te	ADP
dentistry3000-164	226	5	beek	beek	PROPN
dentistry3000-164	226	6	ta	ta	PROPN
dentistry3000-164	226	7	,	,	PUNCT
dentistry3000-164	226	8	kuipers	kuiper	NOUN
dentistry3000-164	226	9	rk	rk	NOUN
dentistry3000-164	226	10	,	,	PUNCT
dentistry3000-164	226	11	hekkelman	hekkelman	NOUN
dentistry3000-164	226	12	ml	ml	PROPN
dentistry3000-164	226	13	,	,	PUNCT
dentistry3000-164	226	14	vriend	vriend	PROPN
dentistry3000-164	226	15	g.	g.	PROPN
dentistry3000-164	226	16	bmc	bmc	PROPN
dentistry3000-164	226	17	bioinformatics	bioinformatics	PROPN
dentistry3000-164	226	18	.	.	PUNCT
dentistry3000-164	227	1	2010	2010	NUM
dentistry3000-164	227	2	nov	nov	NOUN
dentistry3000-164	227	3	8;11:548	8;11:548	NUM
dentistry3000-164	227	4	.	.	PUNCT
dentistry3000-164	228	1	pmid	pmid	NOUN
dentistry3000-164	228	2	:	:	PUNCT
dentistry3000-164	228	3	21059217	21059217	NUM
dentistry3000-164	228	4	.	.	PUNCT
dentistry3000-164	229	1	[	[	X
dentistry3000-164	229	2	19	19	NUM
dentistry3000-164	229	3	]	]	PUNCT
dentistry3000-164	229	4	provean	provean	PROPN
dentistry3000-164	229	5	web	web	NOUN
dentistry3000-164	229	6	server	server	NOUN
dentistry3000-164	229	7	:	:	PUNCT
dentistry3000-164	229	8	a	a	DET
dentistry3000-164	229	9	tool	tool	NOUN
dentistry3000-164	229	10	to	to	PART
dentistry3000-164	229	11	predict	predict	VERB
dentistry3000-164	229	12	the	the	DET
dentistry3000-164	229	13	functional	functional	ADJ
dentistry3000-164	229	14	effect	effect	NOUN
dentistry3000-164	229	15	of	of	ADP
dentistry3000-164	229	16	amino	amino	NOUN
dentistry3000-164	229	17	acid	acid	NOUN
dentistry3000-164	229	18	substitutions	substitution	NOUN
dentistry3000-164	229	19	and	and	CCONJ
dentistry3000-164	229	20	indels	indel	NOUN
dentistry3000-164	229	21	.	.	PUNCT
dentistry3000-164	230	1	choi	choi	PROPN
dentistry3000-164	230	2	y	y	PROPN
dentistry3000-164	230	3	,	,	PUNCT
dentistry3000-164	230	4	chan	chan	PROPN
dentistry3000-164	230	5	ap	ap	PROPN
dentistry3000-164	230	6	.	.	PUNCT
dentistry3000-164	231	1	bioinformatics	bioinformatic	NOUN
dentistry3000-164	231	2	.	.	PUNCT
dentistry3000-164	232	1	2015	2015	NUM
dentistry3000-164	232	2	aug	aug	NOUN
dentistry3000-164	232	3	15;31(16):2745	15;31(16):2745	NUM
dentistry3000-164	232	4	-	-	SYM
dentistry3000-164	232	5	7	7	NUM
dentistry3000-164	232	6	.	.	PUNCT
dentistry3000-164	232	7	pmid	pmid	NOUN
dentistry3000-164	232	8	:	:	PUNCT
dentistry3000-164	232	9	25851949	25851949	NUM
dentistry3000-164	232	10	.	.	PUNCT
dentistry3000-164	233	1	[	[	X
dentistry3000-164	233	2	20	20	NUM
dentistry3000-164	233	3	]	]	X
dentistry3000-164	233	4	sift	sift	PROPN
dentistry3000-164	233	5	web	web	NOUN
dentistry3000-164	233	6	server	server	NOUN
dentistry3000-164	233	7	:	:	PUNCT
dentistry3000-164	233	8	predicting	predict	VERB
dentistry3000-164	233	9	effects	effect	NOUN
dentistry3000-164	233	10	of	of	ADP
dentistry3000-164	233	11	amino	amino	NOUN
dentistry3000-164	233	12	acid	acid	NOUN
dentistry3000-164	233	13	substitutions	substitution	NOUN
dentistry3000-164	233	14	on	on	ADP
dentistry3000-164	233	15	proteins	protein	NOUN
dentistry3000-164	233	16	.	.	PUNCT
dentistry3000-164	234	1	sim	sim	PROPN
dentistry3000-164	234	2	nl	nl	PROPN
dentistry3000-164	234	3	,	,	PUNCT
dentistry3000-164	234	4	kumar	kumar	PROPN
dentistry3000-164	234	5	p	p	PROPN
dentistry3000-164	234	6	,	,	PUNCT
dentistry3000-164	234	7	hu	hu	PROPN
dentistry3000-164	234	8	j	j	PROPN
dentistry3000-164	234	9	,	,	PUNCT
dentistry3000-164	234	10	henikoff	henikoff	PROPN
dentistry3000-164	234	11	s	s	PROPN
dentistry3000-164	234	12	,	,	PUNCT
dentistry3000-164	234	13	schneider	schneider	PROPN
dentistry3000-164	234	14	g	g	PROPN
dentistry3000-164	234	15	,	,	PUNCT
dentistry3000-164	234	16	ng	ng	PROPN
dentistry3000-164	234	17	pc	pc	PROPN
dentistry3000-164	234	18	.	.	PUNCT
dentistry3000-164	235	1	nucleic	nucleic	ADJ
dentistry3000-164	235	2	acids	acid	NOUN
dentistry3000-164	235	3	res	re	NOUN
dentistry3000-164	235	4	.	.	PUNCT
dentistry3000-164	235	5	2012	2012	NUM
dentistry3000-164	235	6	jul;40(web	jul;40(web	PROPN
dentistry3000-164	235	7	server	server	PROPN
dentistry3000-164	235	8	issue):w452	issue):w452	PROPN
dentistry3000-164	235	9	-	-	PUNCT
dentistry3000-164	235	10	7	7	NUM
dentistry3000-164	235	11	.	.	PUNCT
dentistry3000-164	236	1	pmid	pmid	NOUN
dentistry3000-164	236	2	:	:	PUNCT
dentistry3000-164	236	3	22689647	22689647	NUM
dentistry3000-164	236	4	.	.	PUNCT
dentistry3000-164	237	1	[	[	X
dentistry3000-164	237	2	21	21	NUM
dentistry3000-164	237	3	]	]	PUNCT
dentistry3000-164	237	4	predicting	predict	VERB
dentistry3000-164	237	5	functional	functional	ADJ
dentistry3000-164	237	6	effect	effect	NOUN
dentistry3000-164	237	7	of	of	ADP
dentistry3000-164	237	8	human	human	ADJ
dentistry3000-164	237	9	missense	missense	NOUN
dentistry3000-164	237	10	mutations	mutation	NOUN
dentistry3000-164	237	11	using	use	VERB
dentistry3000-164	237	12	polyphen-2	polyphen-2	NUM
dentistry3000-164	237	13	.	.	PUNCT
dentistry3000-164	238	1	adzhubei	adzhubei	NOUN
dentistry3000-164	238	2	i	i	PRON
dentistry3000-164	238	3	,	,	PUNCT
dentistry3000-164	238	4	jordan	jordan	PROPN
dentistry3000-164	238	5	dm	dm	PROPN
dentistry3000-164	238	6	,	,	PUNCT
dentistry3000-164	238	7	sunyaev	sunyaev	PROPN
dentistry3000-164	238	8	sr	sr	PROPN
dentistry3000-164	238	9	.	.	PUNCT
dentistry3000-164	239	1	curr	curr	PROPN
dentistry3000-164	239	2	protoc	protoc	VERB
dentistry3000-164	239	3	hum	hum	PROPN
dentistry3000-164	239	4	genet	genet	PROPN
dentistry3000-164	239	5	.	.	PUNCT
dentistry3000-164	240	1	2013	2013	NUM
dentistry3000-164	240	2	jan	jan	PROPN
dentistry3000-164	240	3	;	;	PUNCT
dentistry3000-164	240	4	chapter	chapter	NOUN
dentistry3000-164	240	5	7	7	NUM
dentistry3000-164	240	6	:	:	PUNCT
dentistry3000-164	240	7	unit7.20	unit7.20	PROPN
dentistry3000-164	240	8	.	.	PUNCT
dentistry3000-164	241	1	pmid	pmid	NOUN
dentistry3000-164	241	2	:	:	PUNCT
dentistry3000-164	241	3	23315928	23315928	NUM
dentistry3000-164	241	4	.	.	PUNCT
dentistry3000-164	242	1	[	[	X
dentistry3000-164	242	2	22	22	NUM
dentistry3000-164	242	3	]	]	PUNCT
dentistry3000-164	242	4	novel	novel	ADJ
dentistry3000-164	242	5	irf6	irf6	NOUN
dentistry3000-164	242	6	mutations	mutation	NOUN
dentistry3000-164	242	7	in	in	ADP
dentistry3000-164	242	8	families	family	NOUN
dentistry3000-164	242	9	with	with	ADP
dentistry3000-164	242	10	van	van	PROPN
dentistry3000-164	242	11	der	der	PROPN
dentistry3000-164	242	12	woude	woude	VERB
dentistry3000-164	242	13	syndrome	syndrome	NOUN
dentistry3000-164	242	14	and	and	CCONJ
dentistry3000-164	242	15	popliteal	popliteal	NOUN
dentistry3000-164	242	16	pterygium	pterygium	NOUN
dentistry3000-164	242	17	syndrome	syndrome	NOUN
dentistry3000-164	242	18	from	from	ADP
dentistry3000-164	242	19	sub	sub	ADJ
dentistry3000-164	242	20	-	-	ADJ
dentistry3000-164	242	21	saharan	saharan	ADJ
dentistry3000-164	242	22	africa	africa	PROPN
dentistry3000-164	242	23	.	.	PUNCT
dentistry3000-164	243	1	butali	butali	PROPN
dentistry3000-164	243	2	a	a	DET
dentistry3000-164	243	3	,	,	PUNCT
dentistry3000-164	243	4	mossey	mossey	PROPN
dentistry3000-164	243	5	pa	pa	PROPN
dentistry3000-164	243	6	,	,	PUNCT
dentistry3000-164	243	7	adeyemo	adeyemo	PROPN
dentistry3000-164	243	8	wl	wl	PROPN
dentistry3000-164	243	9	,	,	PUNCT
dentistry3000-164	243	10	eshete	eshete	PROPN
dentistry3000-164	243	11	ma	ma	PROPN
dentistry3000-164	243	12	,	,	PUNCT
dentistry3000-164	243	13	gaines	gaines	PROPN
dentistry3000-164	243	14	la	la	PROPN
dentistry3000-164	243	15	,	,	PUNCT
dentistry3000-164	243	16	even	even	ADV
dentistry3000-164	243	17	d	d	PROPN
dentistry3000-164	243	18	,	,	PUNCT
dentistry3000-164	243	19	braimah	braimah	PROPN
dentistry3000-164	243	20	ro	ro	NOUN
dentistry3000-164	243	21	,	,	PUNCT
dentistry3000-164	243	22	aregbesola	aregbesola	PROPN
dentistry3000-164	243	23	bs	bs	PROPN
dentistry3000-164	243	24	,	,	PUNCT
dentistry3000-164	243	25	rigdon	rigdon	PROPN
dentistry3000-164	243	26	jv	jv	PROPN
dentistry3000-164	243	27	,	,	PUNCT
dentistry3000-164	243	28	emeka	emeka	PROPN
dentistry3000-164	243	29	ci	ci	PROPN
dentistry3000-164	243	30	,	,	PUNCT
dentistry3000-164	243	31	james	james	PROPN
dentistry3000-164	243	32	o	o	PROPN
dentistry3000-164	243	33	,	,	PUNCT
dentistry3000-164	243	34	ogunlewe	ogunlewe	PROPN
dentistry3000-164	243	35	mo	mo	PROPN
dentistry3000-164	243	36	,	,	PUNCT
dentistry3000-164	243	37	ladeinde	ladeinde	PROPN
dentistry3000-164	243	38	al	al	PROPN
dentistry3000-164	243	39	,	,	PUNCT
dentistry3000-164	243	40	abate	abate	VERB
dentistry3000-164	243	41	f	f	PROPN
dentistry3000-164	243	42	,	,	PUNCT
dentistry3000-164	243	43	hailu	hailu	NOUN
dentistry3000-164	243	44	t	t	PROPN
dentistry3000-164	243	45	,	,	PUNCT
dentistry3000-164	243	46	mohammed	mohammed	PROPN
dentistry3000-164	243	47	i	i	PROPN
dentistry3000-164	243	48	,	,	PUNCT
dentistry3000-164	243	49	gravem	gravem	NOUN
dentistry3000-164	243	50	pe	pe	PROPN
dentistry3000-164	243	51	,	,	PUNCT
dentistry3000-164	243	52	deribew	deribew	NOUN
dentistry3000-164	243	53	m	m	PROPN
dentistry3000-164	243	54	,	,	PUNCT
dentistry3000-164	243	55	gesses	gesse	NOUN
dentistry3000-164	243	56	m	m	PROPN
dentistry3000-164	243	57	,	,	PUNCT
dentistry3000-164	243	58	adeyemo	adeyemo	PROPN
dentistry3000-164	243	59	aa	aa	PROPN
dentistry3000-164	243	60	,	,	PUNCT
dentistry3000-164	243	61	murray	murray	PROPN
dentistry3000-164	243	62	jc	jc	PROPN
dentistry3000-164	243	63	.	.	PROPN
dentistry3000-164	243	64	mol	mol	ADP
dentistry3000-164	243	65	genet	genet	PROPN
dentistry3000-164	243	66	genomic	genomic	NOUN
dentistry3000-164	243	67	med	med	PROPN
dentistry3000-164	243	68	.	.	PUNCT
dentistry3000-164	244	1	2014	2014	NUM
dentistry3000-164	244	2	may;2(3):254	may;2(3):254	PROPN
dentistry3000-164	244	3	-	-	PUNCT
dentistry3000-164	244	4	60	60	NUM
dentistry3000-164	244	5	.	.	PUNCT
dentistry3000-164	245	1	pmid	pmid	NOUN
dentistry3000-164	245	2	:	:	PUNCT
dentistry3000-164	245	3	24936515	24936515	NUM
dentistry3000-164	245	4	.	.	PUNCT
dentistry3000-164	246	1	[	[	X
dentistry3000-164	246	2	23	23	NUM
dentistry3000-164	246	3	]	]	X
dentistry3000-164	246	4	clinical	clinical	ADJ
dentistry3000-164	246	5	and	and	CCONJ
dentistry3000-164	246	6	genetic	genetic	ADJ
dentistry3000-164	246	7	features	feature	NOUN
dentistry3000-164	246	8	of	of	ADP
dentistry3000-164	246	9	van	van	PROPN
dentistry3000-164	246	10	der	der	PROPN
dentistry3000-164	246	11	woude	woude	VERB
dentistry3000-164	246	12	syndrome	syndrome	NOUN
dentistry3000-164	246	13	in	in	ADP
dentistry3000-164	246	14	two	two	NUM
dentistry3000-164	246	15	large	large	ADJ
dentistry3000-164	246	16	families	family	NOUN
dentistry3000-164	246	17	in	in	ADP
dentistry3000-164	246	18	brazil	brazil	PROPN
dentistry3000-164	246	19	.	.	PUNCT
dentistry3000-164	247	1	martelli	martelli	PROPN
dentistry3000-164	247	2	-	-	PUNCT
dentistry3000-164	247	3	junior	junior	PROPN
dentistry3000-164	247	4	h	h	NOUN
dentistry3000-164	247	5	,	,	PUNCT
dentistry3000-164	247	6	chaves	chaves	PROPN
dentistry3000-164	247	7	mr	mr	PROPN
dentistry3000-164	247	8	,	,	PUNCT
dentistry3000-164	247	9	swerts	swert	VERB
dentistry3000-164	247	10	ms	ms	PROPN
dentistry3000-164	247	11	,	,	PUNCT
dentistry3000-164	247	12	de	de	PROPN
dentistry3000-164	247	13	miranda	miranda	PROPN
dentistry3000-164	247	14	rt	rt	PROPN
dentistry3000-164	247	15	,	,	PUNCT
dentistry3000-164	247	16	bonan	bonan	PROPN
dentistry3000-164	247	17	pr	pr	PROPN
dentistry3000-164	247	18	,	,	PUNCT
dentistry3000-164	247	19	coletta	coletta	PROPN
dentistry3000-164	247	20	rd	rd	PROPN
dentistry3000-164	247	21	.	.	PUNCT
dentistry3000-164	248	1	cleft	cleft	PROPN
dentistry3000-164	248	2	palate	palate	PROPN
dentistry3000-164	248	3	craniofac	craniofac	NOUN
dentistry3000-164	248	4	j.	j.	PROPN
dentistry3000-164	248	5	2007	2007	NUM
dentistry3000-164	248	6	may;44(3):239	may;44(3):239	PROPN
dentistry3000-164	248	7	-	-	PUNCT
dentistry3000-164	248	8	43	43	NUM
dentistry3000-164	248	9	.	.	PUNCT
dentistry3000-164	249	1	pmid	pmid	NOUN
dentistry3000-164	249	2	:	:	PUNCT
dentistry3000-164	249	3	17477759	17477759	NUM
dentistry3000-164	249	4	.	.	PUNCT
dentistry3000-164	250	1	[	[	X
dentistry3000-164	250	2	24	24	NUM
dentistry3000-164	250	3	]	]	X
dentistry3000-164	250	4	congenital	congenital	ADJ
dentistry3000-164	250	5	symmetrical	symmetrical	ADJ
dentistry3000-164	250	6	lower	low	ADJ
dentistry3000-164	250	7	lip	lip	NOUN
dentistry3000-164	250	8	pits	pit	NOUN
dentistry3000-164	250	9	:	:	PUNCT
dentistry3000-164	250	10	van	van	PROPN
dentistry3000-164	250	11	der	der	NOUN
dentistry3000-164	250	12	woude	woude	VERB
dentistry3000-164	250	13	syndrome	syndrome	NOUN
dentistry3000-164	250	14	.	.	PUNCT
dentistry3000-164	251	1	ibrahim	ibrahim	PROPN
dentistry3000-164	251	2	a	a	PRON
dentistry3000-164	251	3	,	,	PUNCT
dentistry3000-164	251	4	ajike	ajike	PROPN
dentistry3000-164	251	5	s.	s.	PROPN
dentistry3000-164	251	6	oman	oman	PROPN
dentistry3000-164	251	7	med	med	PROPN
dentistry3000-164	251	8	j.	j.	PROPN
dentistry3000-164	251	9	2015	2015	NUM
dentistry3000-164	251	10	jan;30(1):e081	jan;30(1):e081	PROPN
dentistry3000-164	251	11	.	.	PUNCT
dentistry3000-164	252	1	pmid	pmid	NOUN
dentistry3000-164	252	2	:	:	PUNCT
dentistry3000-164	252	3	30838101	30838101	NUM
dentistry3000-164	252	4	.	.	PUNCT
dentistry3000-164	253	1	[	[	X
dentistry3000-164	253	2	25	25	NUM
dentistry3000-164	253	3	]	]	PUNCT
dentistry3000-164	253	4	wound	wound	NOUN
dentistry3000-164	253	5	complications	complication	NOUN
dentistry3000-164	253	6	after	after	ADP
dentistry3000-164	253	7	cleft	cleft	NOUN
dentistry3000-164	253	8	repair	repair	NOUN
dentistry3000-164	253	9	in	in	ADP
dentistry3000-164	253	10	children	child	NOUN
dentistry3000-164	253	11	with	with	ADP
dentistry3000-164	253	12	van	van	PROPN
dentistry3000-164	253	13	der	der	PROPN
dentistry3000-164	253	14	woude	woude	VERB
dentistry3000-164	253	15	syndrome	syndrome	NOUN
dentistry3000-164	253	16	.	.	PUNCT
dentistry3000-164	254	1	jones	jones	PROPN
dentistry3000-164	254	2	jl	jl	PROPN
dentistry3000-164	254	3	,	,	PUNCT
dentistry3000-164	254	4	canady	canady	PROPN
dentistry3000-164	254	5	jw	jw	PROPN
dentistry3000-164	254	6	,	,	PUNCT
dentistry3000-164	254	7	brookes	brookes	PROPN
dentistry3000-164	254	8	jt	jt	PROPN
dentistry3000-164	254	9	,	,	PUNCT
dentistry3000-164	254	10	wehby	wehby	PROPN
dentistry3000-164	254	11	gl	gl	PROPN
dentistry3000-164	254	12	,	,	PUNCT
dentistry3000-164	254	13	l'heureux	l'heureux	PROPN
dentistry3000-164	254	14	j	j	PROPN
dentistry3000-164	254	15	,	,	PUNCT
dentistry3000-164	254	16	schutte	schutte	PROPN
dentistry3000-164	254	17	bc	bc	PROPN
dentistry3000-164	254	18	,	,	PUNCT
dentistry3000-164	254	19	murray	murray	PROPN
dentistry3000-164	254	20	jc	jc	PROPN
dentistry3000-164	254	21	,	,	PUNCT
dentistry3000-164	254	22	dunnwald	dunnwald	ADJ
dentistry3000-164	254	23	m.	m.	NOUN
dentistry3000-164	254	24	j	j	PROPN
dentistry3000-164	254	25	craniofac	craniofac	PROPN
dentistry3000-164	254	26	surg	surg	PROPN
dentistry3000-164	254	27	.	.	PUNCT
dentistry3000-164	255	1	2010	2010	NUM
dentistry3000-164	255	2	sep;21(5):1350	sep;21(5):1350	PROPN
dentistry3000-164	255	3	-	-	PUNCT
dentistry3000-164	255	4	3	3	PROPN
dentistry3000-164	255	5	.	.	PUNCT
dentistry3000-164	255	6	pmid	pmid	NOUN
dentistry3000-164	255	7	:	:	PUNCT
dentistry3000-164	255	8	20856020	20856020	NUM
dentistry3000-164	255	9	.	.	PUNCT
dentistry3000-164	256	1	[	[	X
dentistry3000-164	256	2	26	26	NUM
dentistry3000-164	256	3	]	]	PUNCT
dentistry3000-164	256	4	the	the	DET
dentistry3000-164	256	5	genetics	genetic	NOUN
dentistry3000-164	256	6	of	of	ADP
dentistry3000-164	256	7	isolated	isolated	ADJ
dentistry3000-164	256	8	orofacial	orofacial	ADJ
dentistry3000-164	256	9	clefts	cleft	NOUN
dentistry3000-164	256	10	:	:	PUNCT
dentistry3000-164	256	11	from	from	ADP
dentistry3000-164	256	12	genotypes	genotype	NOUN
dentistry3000-164	256	13	to	to	ADP
dentistry3000-164	256	14	subphenotypes	subphenotype	NOUN
dentistry3000-164	256	15	.	.	PUNCT
dentistry3000-164	257	1	jugessur	jugessur	PROPN
dentistry3000-164	257	2	a	a	PRON
dentistry3000-164	257	3	,	,	PUNCT
dentistry3000-164	257	4	farlie	farlie	NOUN
dentistry3000-164	257	5	pg	pg	NOUN
dentistry3000-164	257	6	,	,	PUNCT
dentistry3000-164	257	7	kilpatrick	kilpatrick	PROPN
dentistry3000-164	257	8	n.	n.	PROPN
dentistry3000-164	257	9	oral	oral	PROPN
dentistry3000-164	257	10	dis	dis	PROPN
dentistry3000-164	257	11	.	.	PUNCT
dentistry3000-164	258	1	2009	2009	NUM
dentistry3000-164	258	2	oct;15(7):437	oct;15(7):437	SYM
dentistry3000-164	258	3	-	-	SYM
dentistry3000-164	258	4	53	53	NUM
dentistry3000-164	258	5	.	.	PUNCT
dentistry3000-164	259	1	pmid	pmid	NOUN
dentistry3000-164	259	2	:	:	PUNCT
dentistry3000-164	259	3	19583827	19583827	NUM
dentistry3000-164	259	4	.	.	PUNCT
dentistry3000-164	260	1	[	[	X
dentistry3000-164	260	2	27	27	NUM
dentistry3000-164	260	3	]	]	PUNCT
dentistry3000-164	260	4	gene	gene	NOUN
dentistry3000-164	260	5	/	/	SYM
dentistry3000-164	260	6	environment	environment	NOUN
dentistry3000-164	260	7	causes	cause	NOUN
dentistry3000-164	260	8	of	of	ADP
dentistry3000-164	260	9	cleft	cleft	NOUN
dentistry3000-164	260	10	lip	lip	NOUN
dentistry3000-164	260	11	and/or	and/or	CCONJ
dentistry3000-164	260	12	palate	palate	VERB
dentistry3000-164	260	13	.	.	PUNCT
dentistry3000-164	261	1	murray	murray	PROPN
dentistry3000-164	261	2	jc	jc	PROPN
dentistry3000-164	261	3	.	.	PROPN
dentistry3000-164	261	4	clin	clin	PROPN
dentistry3000-164	261	5	genet	genet	PROPN
dentistry3000-164	261	6	.	.	PUNCT
dentistry3000-164	262	1	2002	2002	NUM
dentistry3000-164	262	2	apr;61(4):248	apr;61(4):248	PROPN
dentistry3000-164	262	3	-	-	SYM
dentistry3000-164	262	4	56	56	NUM
dentistry3000-164	262	5	.	.	PUNCT
dentistry3000-164	263	1	pmid	pmid	NOUN
dentistry3000-164	263	2	:	:	PUNCT
dentistry3000-164	263	3	12030886	12030886	NUM
dentistry3000-164	263	4	.	.	PUNCT
dentistry3000-164	264	1	[	[	X
dentistry3000-164	264	2	28	28	NUM
dentistry3000-164	264	3	]	]	PUNCT
dentistry3000-164	264	4	identification	identification	NOUN
dentistry3000-164	264	5	of	of	ADP
dentistry3000-164	264	6	irf6	irf6	ADJ
dentistry3000-164	264	7	gene	gene	NOUN
dentistry3000-164	264	8	variants	variant	NOUN
dentistry3000-164	264	9	in	in	ADP
dentistry3000-164	264	10	three	three	NUM
dentistry3000-164	264	11	families	family	NOUN
dentistry3000-164	264	12	with	with	ADP
dentistry3000-164	264	13	van	van	PROPN
dentistry3000-164	264	14	der	der	PROPN
dentistry3000-164	264	15	woude	woude	VERB
dentistry3000-164	264	16	syndrome	syndrome	NOUN
dentistry3000-164	264	17	.	.	PUNCT
dentistry3000-164	265	1	tan	tan	PROPN
dentistry3000-164	265	2	ec	ec	PROPN
dentistry3000-164	265	3	,	,	PUNCT
dentistry3000-164	265	4	lim	lim	PROPN
dentistry3000-164	265	5	ec	ec	PROPN
dentistry3000-164	265	6	,	,	PUNCT
dentistry3000-164	265	7	yap	yap	PROPN
dentistry3000-164	265	8	sh	sh	PROPN
dentistry3000-164	265	9	,	,	PUNCT
dentistry3000-164	265	10	lee	lee	PROPN
dentistry3000-164	265	11	st	st	PROPN
dentistry3000-164	265	12	,	,	PUNCT
dentistry3000-164	265	13	cheng	cheng	PROPN
dentistry3000-164	265	14	j	j	PROPN
dentistry3000-164	265	15	,	,	PUNCT
dentistry3000-164	265	16	por	por	PROPN
dentistry3000-164	265	17	yc	yc	PROPN
dentistry3000-164	265	18	,	,	PUNCT
dentistry3000-164	265	19	yeow	yeow	PROPN
dentistry3000-164	266	1	v.	v.	PROPN
dentistry3000-164	266	2	int	int	PROPN
dentistry3000-164	266	3	j	j	PROPN
dentistry3000-164	266	4	mol	mol	ADP
dentistry3000-164	266	5	med	med	PROPN
dentistry3000-164	266	6	.	.	PROPN
dentistry3000-164	266	7	2008	2008	NUM
dentistry3000-164	267	1	jun;21(6):74751	jun;21(6):74751	PROPN
dentistry3000-164	267	2	.	.	PUNCT
dentistry3000-164	268	1	pmid	pmid	PROPN
dentistry3000-164	268	2	:	:	PUNCT
dentistry3000-164	268	3	18506368	18506368	NUM
dentistry3000-164	268	4	.	.	PUNCT
dentistry3000-164	269	1	[	[	X
dentistry3000-164	269	2	29	29	NUM
dentistry3000-164	269	3	]	]	X
dentistry3000-164	269	4	prevalence	prevalence	NOUN
dentistry3000-164	269	5	and	and	CCONJ
dentistry3000-164	269	6	nonrandom	nonrandom	NOUN
dentistry3000-164	269	7	distribution	distribution	NOUN
dentistry3000-164	269	8	of	of	ADP
dentistry3000-164	269	9	exonic	exonic	ADJ
dentistry3000-164	269	10	mutations	mutation	NOUN
dentistry3000-164	269	11	in	in	ADP
dentistry3000-164	269	12	interferon	interferon	ADJ
dentistry3000-164	269	13	regulatory	regulatory	ADJ
dentistry3000-164	269	14	factor	factor	NOUN
dentistry3000-164	269	15	6	6	NUM
dentistry3000-164	269	16	in	in	ADP
dentistry3000-164	269	17	307	307	NUM
dentistry3000-164	269	18	families	family	NOUN
dentistry3000-164	269	19	with	with	ADP
dentistry3000-164	269	20	van	van	PROPN
dentistry3000-164	269	21	der	der	PROPN
dentistry3000-164	269	22	woude	woude	VERB
dentistry3000-164	269	23	syndrome	syndrome	NOUN
dentistry3000-164	269	24	and	and	CCONJ
dentistry3000-164	269	25	37	37	NUM
dentistry3000-164	269	26	families	family	NOUN
dentistry3000-164	269	27	with	with	ADP
dentistry3000-164	269	28	popliteal	popliteal	NOUN
dentistry3000-164	269	29	pterygium	pterygium	NOUN
dentistry3000-164	269	30	syndrome	syndrome	NOUN
dentistry3000-164	269	31	.	.	PUNCT
dentistry3000-164	270	1	de	de	ADP
dentistry3000-164	270	2	lima	lima	PROPN
dentistry3000-164	270	3	rl	rl	PROPN
dentistry3000-164	270	4	,	,	PUNCT
dentistry3000-164	270	5	hoper	hoper	NOUN
dentistry3000-164	270	6	sa	sa	PROPN
dentistry3000-164	270	7	,	,	PUNCT
dentistry3000-164	270	8	ghassibe	ghassibe	NOUN
dentistry3000-164	270	9	m	m	PROPN
dentistry3000-164	270	10	,	,	PUNCT
dentistry3000-164	270	11	cooper	cooper	PROPN
dentistry3000-164	270	12	me	i	PRON
dentistry3000-164	270	13	,	,	PUNCT
dentistry3000-164	270	14	rorick	rorick	VERB
dentistry3000-164	270	15	nk	nk	PROPN
dentistry3000-164	270	16	,	,	PUNCT
dentistry3000-164	270	17	kondo	kondo	PROPN
dentistry3000-164	270	18	s	s	PROPN
dentistry3000-164	270	19	,	,	PUNCT
dentistry3000-164	270	20	katz	katz	PROPN
dentistry3000-164	270	21	l	l	PROPN
dentistry3000-164	270	22	,	,	PUNCT
dentistry3000-164	270	23	marazita	marazita	PROPN
dentistry3000-164	270	24	ml	ml	PROPN
dentistry3000-164	270	25	,	,	PUNCT
dentistry3000-164	270	26	compton	compton	PROPN
dentistry3000-164	270	27	j	j	PROPN
dentistry3000-164	270	28	,	,	PUNCT
dentistry3000-164	270	29	bale	bale	NOUN
dentistry3000-164	270	30	s	s	PROPN
dentistry3000-164	270	31	,	,	PUNCT
dentistry3000-164	270	32	hehr	hehr	NOUN
dentistry3000-164	270	33	u	u	PROPN
dentistry3000-164	270	34	,	,	PUNCT
dentistry3000-164	270	35	dixon	dixon	PROPN
dentistry3000-164	270	36	mj	mj	PROPN
dentistry3000-164	270	37	,	,	PUNCT
dentistry3000-164	270	38	daack	daack	PROPN
dentistry3000-164	270	39	-	-	PUNCT
dentistry3000-164	270	40	hirsch	hirsch	PROPN
dentistry3000-164	270	41	s	s	PART
dentistry3000-164	270	42	,	,	PUNCT
dentistry3000-164	270	43	boute	boute	NOUN
dentistry3000-164	270	44	o	o	NOUN
dentistry3000-164	270	45	,	,	PUNCT
dentistry3000-164	270	46	bayet	bayet	PROPN
dentistry3000-164	270	47	b	b	PROPN
dentistry3000-164	270	48	,	,	PUNCT
dentistry3000-164	270	49	revencu	revencu	PROPN
dentistry3000-164	270	50	n	n	CCONJ
dentistry3000-164	270	51	,	,	PUNCT
dentistry3000-164	270	52	verellen	verellen	ADJ
dentistry3000-164	270	53	-	-	PUNCT
dentistry3000-164	270	54	dumoulin	dumoulin	NOUN
dentistry3000-164	270	55	c	c	NOUN
dentistry3000-164	270	56	,	,	PUNCT
dentistry3000-164	270	57	vikkula	vikkula	PROPN
dentistry3000-164	270	58	m	m	PROPN
dentistry3000-164	270	59	,	,	PUNCT
dentistry3000-164	270	60	richieri	richieri	PROPN
dentistry3000-164	270	61	-	-	PUNCT
dentistry3000-164	270	62	costa	costa	PROPN
dentistry3000-164	270	63	a	a	PROPN
dentistry3000-164	270	64	,	,	PUNCT
dentistry3000-164	270	65	moretti	moretti	PROPN
dentistry3000-164	270	66	-	-	PUNCT
dentistry3000-164	270	67	ferreira	ferreira	PROPN
dentistry3000-164	270	68	d	d	PROPN
dentistry3000-164	270	69	,	,	PUNCT
dentistry3000-164	270	70	murray	murray	PROPN
dentistry3000-164	270	71	jc	jc	PROPN
dentistry3000-164	270	72	,	,	PUNCT
dentistry3000-164	270	73	schutte	schutte	PROPN
dentistry3000-164	270	74	bc	bc	PROPN
dentistry3000-164	270	75	.	.	PROPN
dentistry3000-164	270	76	genet	genet	PROPN
dentistry3000-164	270	77	med	med	PROPN
dentistry3000-164	270	78	.	.	PUNCT
dentistry3000-164	271	1	2009	2009	NUM
dentistry3000-164	271	2	apr;11(4):241	apr;11(4):241	NOUN
dentistry3000-164	271	3	-	-	SYM
dentistry3000-164	271	4	7	7	NUM
dentistry3000-164	271	5	.	.	PUNCT
dentistry3000-164	272	1	pmid	pmid	NOUN
dentistry3000-164	272	2	:	:	PUNCT
dentistry3000-164	272	3	19282774	19282774	NUM
dentistry3000-164	272	4	.	.	PUNCT
dentistry3000-164	273	1	[	[	X
dentistry3000-164	273	2	30	30	NUM
dentistry3000-164	273	3	]	]	PUNCT
dentistry3000-164	273	4	familial	familial	ADJ
dentistry3000-164	273	5	non	non	ADJ
dentistry3000-164	273	6	-	-	ADJ
dentistry3000-164	273	7	syndromic	syndromic	ADJ
dentistry3000-164	273	8	cleft	cleft	NOUN
dentistry3000-164	273	9	lip	lip	NOUN
dentistry3000-164	273	10	and	and	CCONJ
dentistry3000-164	273	11	palate	palate	VERB
dentistry3000-164	273	12	--	--	PUNCT
dentistry3000-164	273	13	analysis	analysis	NOUN
dentistry3000-164	273	14	of	of	ADP
dentistry3000-164	273	15	the	the	DET
dentistry3000-164	273	16	irf6	irf6	ADJ
dentistry3000-164	273	17	gene	gene	NOUN
dentistry3000-164	273	18	and	and	CCONJ
dentistry3000-164	273	19	clinical	clinical	ADJ
dentistry3000-164	273	20	phenotypes	phenotype	NOUN
dentistry3000-164	273	21	.	.	PUNCT
dentistry3000-164	274	1	pegelow	pegelow	PROPN
dentistry3000-164	274	2	m	m	PROPN
dentistry3000-164	274	3	,	,	PUNCT
dentistry3000-164	274	4	peyrard	peyrard	PROPN
dentistry3000-164	274	5	-	-	PUNCT
dentistry3000-164	274	6	janvid	janvid	PROPN
dentistry3000-164	274	7	m	m	PROPN
dentistry3000-164	274	8	,	,	PUNCT
dentistry3000-164	274	9	zucchelli	zucchelli	PROPN
dentistry3000-164	274	10	m	m	PROPN
dentistry3000-164	274	11	,	,	PUNCT
dentistry3000-164	274	12	fransson	fransson	PROPN
dentistry3000-164	274	13	i	i	PRON
dentistry3000-164	274	14	,	,	PUNCT
dentistry3000-164	274	15	larson	larson	PROPN
dentistry3000-164	274	16	o	o	PROPN
dentistry3000-164	274	17	,	,	PUNCT
dentistry3000-164	274	18	kere	kere	PROPN
dentistry3000-164	274	19	j	j	PROPN
dentistry3000-164	274	20	,	,	PUNCT
dentistry3000-164	274	21	larsson	larsson	PROPN
dentistry3000-164	274	22	c	c	X
dentistry3000-164	274	23	,	,	PUNCT
dentistry3000-164	274	24	karsten	karsten	PROPN
dentistry3000-164	274	25	a.	a.	PROPN
dentistry3000-164	274	26	eur	eur	PROPN
dentistry3000-164	274	27	j	j	PROPN
dentistry3000-164	274	28	orthod	orthod	NOUN
dentistry3000-164	274	29	.	.	PUNCT
dentistry3000-164	275	1	2008	2008	NUM
dentistry3000-164	275	2	apr;30(2):169	apr;30(2):169	NOUN
dentistry3000-164	275	3	-	-	PUNCT
dentistry3000-164	275	4	75	75	NUM
dentistry3000-164	275	5	.	.	PUNCT
dentistry3000-164	276	1	pmid	pmid	NOUN
dentistry3000-164	276	2	:	:	PUNCT
dentistry3000-164	276	3	18209213	18209213	NUM
dentistry3000-164	276	4	.	.	PUNCT
dentistry3000-164	277	1	[	[	X
dentistry3000-164	277	2	31	31	NUM
dentistry3000-164	277	3	]	]	PUNCT
dentistry3000-164	277	4	novel	novel	ADJ
dentistry3000-164	277	5	mutations	mutation	NOUN
dentistry3000-164	277	6	in	in	ADP
dentistry3000-164	277	7	the	the	DET
dentistry3000-164	277	8	irf6	irf6	PROPN
dentistry3000-164	277	9	gene	gene	NOUN
dentistry3000-164	277	10	for	for	ADP
dentistry3000-164	277	11	van	van	PROPN
dentistry3000-164	277	12	der	der	PROPN
dentistry3000-164	277	13	woude	woude	VERB
dentistry3000-164	277	14	syndrome	syndrome	NOUN
dentistry3000-164	277	15	.	.	PUNCT
dentistry3000-164	278	1	wang	wang	PROPN
dentistry3000-164	278	2	x	x	PROPN
dentistry3000-164	278	3	,	,	PUNCT
dentistry3000-164	278	4	liu	liu	PROPN
dentistry3000-164	278	5	j	j	PROPN
dentistry3000-164	278	6	,	,	PUNCT
dentistry3000-164	278	7	zhang	zhang	PROPN
dentistry3000-164	278	8	h	h	PROPN
dentistry3000-164	278	9	,	,	PUNCT
dentistry3000-164	278	10	xiao	xiao	PROPN
dentistry3000-164	278	11	m	m	PROPN
dentistry3000-164	278	12	,	,	PUNCT
dentistry3000-164	278	13	li	li	PROPN
dentistry3000-164	278	14	j	j	PROPN
dentistry3000-164	278	15	,	,	PUNCT
dentistry3000-164	278	16	yang	yang	PROPN
dentistry3000-164	278	17	c	c	PROPN
dentistry3000-164	278	18	,	,	PUNCT
dentistry3000-164	278	19	lin	lin	PROPN
dentistry3000-164	278	20	x	x	PROPN
dentistry3000-164	278	21	,	,	PUNCT
dentistry3000-164	278	22	wu	wu	PROPN
dentistry3000-164	278	23	z	z	PROPN
dentistry3000-164	278	24	,	,	PUNCT
dentistry3000-164	278	25	hu	hu	PROPN
dentistry3000-164	278	26	l	l	PROPN
dentistry3000-164	278	27	,	,	PUNCT
dentistry3000-164	278	28	kong	kong	PROPN
dentistry3000-164	278	29	x.	x.	PROPN
dentistry3000-164	278	30	hum	hum	PROPN
dentistry3000-164	278	31	genet	genet	PROPN
dentistry3000-164	278	32	.	.	PUNCT
dentistry3000-164	279	1	2003	2003	NUM
dentistry3000-164	279	2	oct;113(5):382	oct;113(5):382	PROPN
dentistry3000-164	279	3	-	-	PUNCT
dentistry3000-164	279	4	6	6	NUM
dentistry3000-164	279	5	.	.	PUNCT
dentistry3000-164	280	1	pmid	pmid	NOUN
dentistry3000-164	280	2	:	:	PUNCT
dentistry3000-164	280	3	12920575	12920575	NUM
dentistry3000-164	280	4	.	.	PUNCT
dentistry3000-164	281	1	[	[	X
dentistry3000-164	281	2	32	32	NUM
dentistry3000-164	281	3	]	]	PUNCT
dentistry3000-164	281	4	van	van	PROPN
dentistry3000-164	281	5	der	der	PROPN
dentistry3000-164	281	6	woude	woude	VERB
dentistry3000-164	281	7	syndrome	syndrome	NOUN
dentistry3000-164	281	8	with	with	ADP
dentistry3000-164	281	9	short	short	ADJ
dentistry3000-164	281	10	review	review	NOUN
dentistry3000-164	281	11	of	of	ADP
dentistry3000-164	281	12	the	the	DET
dentistry3000-164	281	13	literature	literature	NOUN
dentistry3000-164	281	14	.	.	PUNCT
dentistry3000-164	282	1	deshmukh	deshmukh	PROPN
dentistry3000-164	282	2	pk	pk	PROPN
dentistry3000-164	282	3	,	,	PUNCT
dentistry3000-164	282	4	deshmukh	deshmukh	PROPN
dentistry3000-164	282	5	k	k	NOUN
dentistry3000-164	282	6	,	,	PUNCT
dentistry3000-164	282	7	mangalgi	mangalgi	ADV
dentistry3000-164	282	8	a	a	X
dentistry3000-164	282	9	,	,	PUNCT
dentistry3000-164	282	10	patil	patil	PROPN
dentistry3000-164	282	11	s	s	PROPN
dentistry3000-164	282	12	,	,	PUNCT
dentistry3000-164	282	13	hugar	hugar	NOUN
dentistry3000-164	282	14	d	d	NOUN
dentistry3000-164	282	15	,	,	PUNCT
dentistry3000-164	282	16	kodangal	kodangal	PROPN
dentistry3000-164	282	17	sf	sf	PROPN
dentistry3000-164	282	18	.	.	PROPN
dentistry3000-164	282	19	case	case	NOUN
dentistry3000-164	282	20	rep	rep	PROPN
dentistry3000-164	282	21	dent	dent	NOUN
dentistry3000-164	282	22	.	.	PUNCT
dentistry3000-164	283	1	2014	2014	NUM
dentistry3000-164	283	2	;	;	PUNCT
dentistry3000-164	283	3	2014:871460	2014:871460	X
dentistry3000-164	283	4	.	.	PUNCT
dentistry3000-164	284	1	pmid	pmid	NOUN
dentistry3000-164	284	2	:	:	PUNCT
dentistry3000-164	284	3	25050184	25050184	NUM
dentistry3000-164	284	4	.	.	PUNCT
dentistry3000-164	285	1	[	[	X
dentistry3000-164	285	2	33	33	NUM
dentistry3000-164	285	3	]	]	X
dentistry3000-164	285	4	hypoplasia	hypoplasia	NOUN
dentistry3000-164	285	5	and	and	CCONJ
dentistry3000-164	285	6	hypodontia	hypodontia	PROPN
dentistry3000-164	285	7	in	in	ADP
dentistry3000-164	285	8	van	van	PROPN
dentistry3000-164	285	9	der	der	PROPN
dentistry3000-164	285	10	woude	woude	VERB
dentistry3000-164	285	11	syndrome	syndrome	NOUN
dentistry3000-164	285	12	.	.	PUNCT
dentistry3000-164	286	1	oberoi	oberoi	PROPN
dentistry3000-164	286	2	s	s	PROPN
dentistry3000-164	286	3	,	,	PUNCT
dentistry3000-164	286	4	vargervik	vargervik	PROPN
dentistry3000-164	286	5	k.	k.	PROPN
dentistry3000-164	286	6	cleft	cleft	PROPN
dentistry3000-164	286	7	palate	palate	PROPN
dentistry3000-164	286	8	craniofac	craniofac	NOUN
dentistry3000-164	286	9	j.	j.	PROPN
dentistry3000-164	286	10	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-164	286	11	differential	differential	ADJ
dentistry3000-164	286	12	expression	expression	NOUN
dentistry3000-164	286	13	of	of	ADP
dentistry3000-164	286	14	the	the	DET
dentistry3000-164	286	15	irf6	irf6	PROPN
dentistry3000-164	286	16	gene	gene	NOUN
dentistry3000-164	286	17	in	in	ADP
dentistry3000-164	286	18	the	the	DET
dentistry3000-164	286	19	signs	sign	NOUN
dentistry3000-164	286	20	of	of	ADP
dentistry3000-164	286	21	van	van	PROPN
dentistry3000-164	286	22	der	der	PROPN
dentistry3000-164	286	23	woude	woude	VERB
dentistry3000-164	286	24	syndrome	syndrome	NOUN
dentistry3000-164	286	25	:	:	PUNCT
dentistry3000-164	286	26	are	be	AUX
dentistry3000-164	286	27	distinct	distinct	ADJ
dentistry3000-164	286	28	genetic	genetic	ADJ
dentistry3000-164	286	29	modifiers	modifier	NOUN
dentistry3000-164	286	30	operating	operate	VERB
dentistry3000-164	286	31	?	?	PUNCT
dentistry3000-164	287	1	vol	vol	NOUN
dentistry3000-164	287	2	9	9	NUM
dentistry3000-164	287	3	no	no	DET
dentistry3000-164	287	4	1	1	NUM
dentistry3000-164	287	5	(	(	PUNCT
dentistry3000-164	287	6	2021	2021	NUM
dentistry3000-164	287	7	)	)	PUNCT
dentistry3000-164	287	8	doi	doi	NOUN
dentistry3000-164	287	9	10.5195	10.5195	NUM
dentistry3000-164	287	10	/	/	SYM
dentistry3000-164	287	11	d3000.2021.164	d3000.2021.164	NOUN
dentistry3000-164	287	12	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-164	287	13	2005	2005	NUM
dentistry3000-164	287	14	sep;42(5):459	sep;42(5):459	PROPN
dentistry3000-164	287	15	-	-	PUNCT
dentistry3000-164	287	16	66	66	NUM
dentistry3000-164	287	17	.	.	PUNCT
dentistry3000-164	288	1	pmid	pmid	NOUN
dentistry3000-164	288	2	:	:	PUNCT
dentistry3000-164	288	3	16149825	16149825	NUM
dentistry3000-164	288	4	.	.	PUNCT
dentistry3000-164	289	1	[	[	X
dentistry3000-164	289	2	34	34	NUM
dentistry3000-164	289	3	]	]	X
dentistry3000-164	289	4	dental	dental	ADJ
dentistry3000-164	289	5	agenesis	agenesis	NOUN
dentistry3000-164	289	6	:	:	PUNCT
dentistry3000-164	289	7	genetic	genetic	ADJ
dentistry3000-164	289	8	and	and	CCONJ
dentistry3000-164	289	9	clinical	clinical	ADJ
dentistry3000-164	289	10	perspectives	perspective	NOUN
dentistry3000-164	289	11	.	.	PUNCT
dentistry3000-164	290	1	de	de	PROPN
dentistry3000-164	290	2	coster	coster	PROPN
dentistry3000-164	290	3	pj	pj	PROPN
dentistry3000-164	290	4	,	,	PUNCT
dentistry3000-164	290	5	marks	mark	VERB
dentistry3000-164	290	6	la	la	PROPN
dentistry3000-164	290	7	,	,	PUNCT
dentistry3000-164	290	8	martens	martens	PROPN
dentistry3000-164	290	9	lc	lc	PROPN
dentistry3000-164	290	10	,	,	PUNCT
dentistry3000-164	290	11	huysseune	huysseune	PROPN
dentistry3000-164	290	12	a.	a.	PROPN
dentistry3000-164	290	13	j	j	PROPN
dentistry3000-164	290	14	oral	oral	ADJ
dentistry3000-164	290	15	pathol	pathol	NOUN
dentistry3000-164	290	16	med	me	VERB
dentistry3000-164	290	17	.	.	PUNCT
dentistry3000-164	290	18	2009	2009	NUM
dentistry3000-164	290	19	jan;38(1):1	jan;38(1):1	NOUN
dentistry3000-164	290	20	-	-	PUNCT
dentistry3000-164	290	21	17	17	NUM
dentistry3000-164	290	22	.	.	PUNCT
dentistry3000-164	291	1	pmid	pmid	NOUN
dentistry3000-164	291	2	:	:	PUNCT
dentistry3000-164	291	3	18771513	18771513	NUM
dentistry3000-164	291	4	.	.	PUNCT
dentistry3000-164	292	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN