id	sid	tid	token	lemma	pos
dentistry3000-465	1	1	bacterial	bacterial	ADJ
dentistry3000-465	1	2	community	community	NOUN
dentistry3000-465	1	3	in	in	ADP
dentistry3000-465	1	4	dental	dental	ADJ
dentistry3000-465	1	5	biofilms	biofilm	NOUN
dentistry3000-465	1	6	linked	link	VERB
dentistry3000-465	1	7	to	to	ADP
dentistry3000-465	1	8	periodontal	periodontal	ADJ
dentistry3000-465	1	9	disease	disease	NOUN
dentistry3000-465	1	10	:	:	PUNCT
dentistry3000-465	1	11	an	an	DET
dentistry3000-465	1	12	intra	intra	ADJ
dentistry3000-465	1	13	-	-	ADJ
dentistry3000-465	1	14	subject	subject	ADJ
dentistry3000-465	1	15	metagenomics	metagenomics	NOUN
dentistry3000-465	1	16	study	study	NOUN
dentistry3000-465	1	17	vol	vol	NOUN
dentistry3000-465	1	18	12	12	NUM
dentistry3000-465	1	19	no	no	PRON
dentistry3000-465	1	20	1	1	NUM
dentistry3000-465	1	21	(	(	PUNCT
dentistry3000-465	1	22	2024	2024	NUM
dentistry3000-465	1	23	)	)	PUNCT
dentistry3000-465	1	24	doi	doi	NOUN
dentistry3000-465	1	25	10.5195	10.5195	NUM
dentistry3000-465	1	26	/	/	SYM
dentistry3000-465	1	27	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	1	28	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	1	29	bacterial	bacterial	ADJ
dentistry3000-465	1	30	community	community	NOUN
dentistry3000-465	1	31	in	in	ADP
dentistry3000-465	1	32	dental	dental	ADJ
dentistry3000-465	1	33	biofilms	biofilm	NOUN
dentistry3000-465	1	34	linked	link	VERB
dentistry3000-465	1	35	to	to	ADP
dentistry3000-465	1	36	periodontal	periodontal	ADJ
dentistry3000-465	1	37	disease	disease	NOUN
dentistry3000-465	1	38	:	:	PUNCT
dentistry3000-465	1	39	an	an	DET
dentistry3000-465	1	40	intra	intra	ADJ
dentistry3000-465	1	41	-	-	ADJ
dentistry3000-465	1	42	subject	subject	ADJ
dentistry3000-465	1	43	metagenomics	metagenomics	NOUN
dentistry3000-465	1	44	study	study	NOUN
dentistry3000-465	1	45	maheen	maheen	PROPN
dentistry3000-465	1	46	tariq	tariq	PROPN
dentistry3000-465	1	47	,	,	PUNCT
dentistry3000-465	1	48	wan	wan	PROPN
dentistry3000-465	1	49	nazatul	nazatul	PROPN
dentistry3000-465	1	50	shima	shima	PROPN
dentistry3000-465	1	51	shahidan	shahidan	PROPN
dentistry3000-465	1	52	,	,	PUNCT
dentistry3000-465	1	53	raja	raja	PROPN
dentistry3000-465	1	54	azman	azman	PROPN
dentistry3000-465	1	55	awang	awang	PROPN
dentistry3000-465	1	56	school	school	NOUN
dentistry3000-465	1	57	of	of	ADP
dentistry3000-465	1	58	dental	dental	ADJ
dentistry3000-465	1	59	sciences	science	NOUN
dentistry3000-465	1	60	,	,	PUNCT
dentistry3000-465	1	61	health	health	NOUN
dentistry3000-465	1	62	campus	campus	NOUN
dentistry3000-465	1	63	,	,	PUNCT
dentistry3000-465	1	64	universiti	universiti	PROPN
dentistry3000-465	1	65	sains	sain	VERB
dentistry3000-465	1	66	malaysia	malaysia	PROPN
dentistry3000-465	1	67	,	,	PUNCT
dentistry3000-465	1	68	kelantan	kelantan	PROPN
dentistry3000-465	1	69	,	,	PUNCT
dentistry3000-465	1	70	malaysia	malaysia	PROPN
dentistry3000-465	1	71	.	.	PUNCT
dentistry3000-465	2	1	abstract	abstract	ADJ
dentistry3000-465	2	2	objectives	objective	NOUN
dentistry3000-465	2	3	:	:	PUNCT
dentistry3000-465	2	4	to	to	PART
dentistry3000-465	2	5	study	study	VERB
dentistry3000-465	2	6	the	the	DET
dentistry3000-465	2	7	intra	intra	ADJ
dentistry3000-465	2	8	-	-	ADJ
dentistry3000-465	2	9	subject	subject	ADJ
dentistry3000-465	2	10	subgingival	subgingival	NOUN
dentistry3000-465	2	11	plaque	plaque	NOUN
dentistry3000-465	2	12	microbiota	microbiota	NOUN
dentistry3000-465	2	13	composition	composition	NOUN
dentistry3000-465	2	14	of	of	ADP
dentistry3000-465	2	15	gingivitis	gingivitis	NOUN
dentistry3000-465	2	16	and	and	CCONJ
dentistry3000-465	2	17	periodontitis	periodontitis	NOUN
dentistry3000-465	2	18	sites	site	NOUN
dentistry3000-465	2	19	in	in	ADP
dentistry3000-465	2	20	periodontitis	periodontitis	NOUN
dentistry3000-465	2	21	patients	patient	NOUN
dentistry3000-465	2	22	using	use	VERB
dentistry3000-465	2	23	16s	16s	PROPN
dentistry3000-465	2	24	rrna	rrna	PROPN
dentistry3000-465	2	25	metagenomics	metagenomics	PROPN
dentistry3000-465	2	26	.	.	PUNCT
dentistry3000-465	3	1	methods	method	NOUN
dentistry3000-465	3	2	:	:	PUNCT
dentistry3000-465	3	3	samples	sample	NOUN
dentistry3000-465	3	4	of	of	ADP
dentistry3000-465	3	5	subgingival	subgingival	ADJ
dentistry3000-465	3	6	plaque	plaque	NOUN
dentistry3000-465	3	7	were	be	AUX
dentistry3000-465	3	8	collected	collect	VERB
dentistry3000-465	3	9	from	from	ADP
dentistry3000-465	3	10	16	16	NUM
dentistry3000-465	3	11	periodontitis	periodontitis	NOUN
dentistry3000-465	3	12	participants	participant	NOUN
dentistry3000-465	3	13	enrolled	enrol	VERB
dentistry3000-465	3	14	on	on	ADP
dentistry3000-465	3	15	the	the	DET
dentistry3000-465	3	16	study	study	NOUN
dentistry3000-465	3	17	.	.	PUNCT
dentistry3000-465	4	1	the	the	DET
dentistry3000-465	4	2	extracted	extract	VERB
dentistry3000-465	4	3	dna	dna	NOUN
dentistry3000-465	4	4	from	from	ADP
dentistry3000-465	4	5	dental	dental	ADJ
dentistry3000-465	4	6	plaque	plaque	NOUN
dentistry3000-465	4	7	was	be	AUX
dentistry3000-465	4	8	sent	send	VERB
dentistry3000-465	4	9	to	to	ADP
dentistry3000-465	4	10	the	the	DET
dentistry3000-465	4	11	illumina	illumina	PROPN
dentistry3000-465	4	12	laboratory	laboratory	NOUN
dentistry3000-465	4	13	for	for	ADP
dentistry3000-465	4	14	16s	16s	PROPN
dentistry3000-465	4	15	rrna	rrna	PROPN
dentistry3000-465	4	16	metagenomics	metagenomic	NOUN
dentistry3000-465	4	17	.	.	PUNCT
dentistry3000-465	5	1	the	the	DET
dentistry3000-465	5	2	v₃	v₃	ADJ
dentistry3000-465	5	3	and	and	CCONJ
dentistry3000-465	5	4	v₄	v₄	PROPN
dentistry3000-465	5	5	region	region	NOUN
dentistry3000-465	5	6	of	of	ADP
dentistry3000-465	5	7	16s	16s	PROPN
dentistry3000-465	5	8	rna	rna	NOUN
dentistry3000-465	5	9	gene	gene	NOUN
dentistry3000-465	5	10	were	be	AUX
dentistry3000-465	5	11	amplified	amplify	VERB
dentistry3000-465	5	12	and	and	CCONJ
dentistry3000-465	5	13	sequenced	sequence	VERB
dentistry3000-465	5	14	using	use	VERB
dentistry3000-465	5	15	illumina	illumina	PROPN
dentistry3000-465	5	16	technology	technology	PROPN
dentistry3000-465	5	17	.	.	PUNCT
dentistry3000-465	6	1	after	after	ADP
dentistry3000-465	6	2	quality	quality	NOUN
dentistry3000-465	6	3	filtering	filtering	NOUN
dentistry3000-465	6	4	,	,	PUNCT
dentistry3000-465	6	5	313480	313480	NUM
dentistry3000-465	6	6	sequences	sequence	NOUN
dentistry3000-465	6	7	were	be	AUX
dentistry3000-465	6	8	obtained	obtain	VERB
dentistry3000-465	6	9	and	and	CCONJ
dentistry3000-465	6	10	arranged	arrange	VERB
dentistry3000-465	6	11	in	in	ADP
dentistry3000-465	6	12	otu	otu	PROPN
dentistry3000-465	6	13	based	base	VERB
dentistry3000-465	6	14	on	on	ADP
dentistry3000-465	6	15	the	the	DET
dentistry3000-465	6	16	97	97	NUM
dentistry3000-465	6	17	%	%	NOUN
dentistry3000-465	6	18	threshold	threshold	NOUN
dentistry3000-465	6	19	.	.	PUNCT
dentistry3000-465	7	1	the	the	DET
dentistry3000-465	7	2	reads	read	NOUN
dentistry3000-465	7	3	were	be	AUX
dentistry3000-465	7	4	assigned	assign	VERB
dentistry3000-465	7	5	to	to	ADP
dentistry3000-465	7	6	species	specie	NOUN
dentistry3000-465	7	7	.	.	PUNCT
dentistry3000-465	8	1	results	result	NOUN
dentistry3000-465	8	2	:	:	PUNCT
dentistry3000-465	8	3	the	the	DET
dentistry3000-465	8	4	alpha	alpha	NOUN
dentistry3000-465	8	5	diversity	diversity	NOUN
dentistry3000-465	8	6	analyses	analysis	NOUN
dentistry3000-465	8	7	revealed	reveal	VERB
dentistry3000-465	8	8	that	that	SCONJ
dentistry3000-465	8	9	periodontitis	periodontitis	NOUN
dentistry3000-465	8	10	sites	site	NOUN
dentistry3000-465	8	11	had	have	VERB
dentistry3000-465	8	12	more	more	ADV
dentistry3000-465	8	13	diverse	diverse	ADJ
dentistry3000-465	8	14	and	and	CCONJ
dentistry3000-465	8	15	rich	rich	ADJ
dentistry3000-465	8	16	bacterial	bacterial	ADJ
dentistry3000-465	8	17	communities	community	NOUN
dentistry3000-465	8	18	than	than	ADP
dentistry3000-465	8	19	gingivitis	gingivitis	NOUN
dentistry3000-465	8	20	sites	site	NOUN
dentistry3000-465	8	21	.	.	PUNCT
dentistry3000-465	9	1	however	however	ADV
dentistry3000-465	9	2	,	,	PUNCT
dentistry3000-465	9	3	the	the	DET
dentistry3000-465	9	4	pcoa	pcoa	NOUN
dentistry3000-465	9	5	analysis	analysis	NOUN
dentistry3000-465	9	6	(	(	PUNCT
dentistry3000-465	9	7	beta	beta	NOUN
dentistry3000-465	9	8	diversity	diversity	NOUN
dentistry3000-465	9	9	)	)	PUNCT
dentistry3000-465	9	10	did	do	AUX
dentistry3000-465	9	11	not	not	PART
dentistry3000-465	9	12	reveal	reveal	VERB
dentistry3000-465	9	13	any	any	DET
dentistry3000-465	9	14	clustering	clustering	NOUN
dentistry3000-465	9	15	of	of	ADP
dentistry3000-465	9	16	the	the	DET
dentistry3000-465	9	17	bacterial	bacterial	ADJ
dentistry3000-465	9	18	community	community	NOUN
dentistry3000-465	9	19	in	in	ADP
dentistry3000-465	9	20	gingivitis	gingivitis	NOUN
dentistry3000-465	9	21	and	and	CCONJ
dentistry3000-465	9	22	periodontitis	periodontitis	NOUN
dentistry3000-465	9	23	.	.	PUNCT
dentistry3000-465	10	1	taxonomic	taxonomic	ADJ
dentistry3000-465	10	2	analysis	analysis	NOUN
dentistry3000-465	10	3	verified	verify	VERB
dentistry3000-465	10	4	the	the	DET
dentistry3000-465	10	5	presence	presence	NOUN
dentistry3000-465	10	6	of	of	ADP
dentistry3000-465	10	7	56	56	NUM
dentistry3000-465	10	8	known	know	VERB
dentistry3000-465	10	9	species	specie	NOUN
dentistry3000-465	10	10	.	.	PUNCT
dentistry3000-465	11	1	however	however	ADV
dentistry3000-465	11	2	,	,	PUNCT
dentistry3000-465	11	3	there	there	PRON
dentistry3000-465	11	4	was	be	VERB
dentistry3000-465	11	5	no	no	DET
dentistry3000-465	11	6	apparent	apparent	ADJ
dentistry3000-465	11	7	pattern	pattern	NOUN
dentistry3000-465	11	8	in	in	ADP
dentistry3000-465	11	9	the	the	DET
dentistry3000-465	11	10	bacterial	bacterial	ADJ
dentistry3000-465	11	11	community	community	NOUN
dentistry3000-465	11	12	between	between	ADP
dentistry3000-465	11	13	gingivitis	gingivitis	NOUN
dentistry3000-465	11	14	and	and	CCONJ
dentistry3000-465	11	15	periodontitis	periodontitis	NOUN
dentistry3000-465	11	16	sites	site	NOUN
dentistry3000-465	11	17	.	.	PUNCT
dentistry3000-465	12	1	yet	yet	ADV
dentistry3000-465	12	2	,	,	PUNCT
dentistry3000-465	12	3	a	a	DET
dentistry3000-465	12	4	slight	slight	ADJ
dentistry3000-465	12	5	distinction	distinction	NOUN
dentistry3000-465	12	6	was	be	AUX
dentistry3000-465	12	7	observed	observe	VERB
dentistry3000-465	12	8	.	.	PUNCT
dentistry3000-465	13	1	species	specie	NOUN
dentistry3000-465	13	2	like	like	ADP
dentistry3000-465	13	3	p.	p.	PROPN
dentistry3000-465	13	4	intermedia	intermedia	PROPN
dentistry3000-465	13	5	,	,	PUNCT
dentistry3000-465	13	6	r.	r.	PROPN
dentistry3000-465	13	7	dentocariosa	dentocariosa	PROPN
dentistry3000-465	13	8	and	and	CCONJ
dentistry3000-465	13	9	p.	p.	PROPN
dentistry3000-465	13	10	endodontalis	endodontalis	PROPN
dentistry3000-465	13	11	were	be	AUX
dentistry3000-465	13	12	more	more	ADV
dentistry3000-465	13	13	abundant	abundant	ADJ
dentistry3000-465	13	14	in	in	ADP
dentistry3000-465	13	15	gingivitis	gingivitis	NOUN
dentistry3000-465	13	16	sites	site	NOUN
dentistry3000-465	13	17	compared	compare	VERB
dentistry3000-465	13	18	to	to	ADP
dentistry3000-465	13	19	periodontitis	periodontitis	NOUN
dentistry3000-465	13	20	sites	site	NOUN
dentistry3000-465	13	21	,	,	PUNCT
dentistry3000-465	13	22	while	while	SCONJ
dentistry3000-465	13	23	some	some	DET
dentistry3000-465	13	24	other	other	ADJ
dentistry3000-465	13	25	species	specie	NOUN
dentistry3000-465	13	26	like	like	ADP
dentistry3000-465	13	27	v.	v.	PROPN
dentistry3000-465	13	28	dispar	dispar	PROPN
dentistry3000-465	13	29	,	,	PUNCT
dentistry3000-465	13	30	c.	c.	PROPN
dentistry3000-465	13	31	ochracea	ochracea	PROPN
dentistry3000-465	13	32	and	and	CCONJ
dentistry3000-465	13	33	a.	a.	NOUN
dentistry3000-465	13	34	segnis	segnis	NOUN
dentistry3000-465	13	35	were	be	AUX
dentistry3000-465	13	36	more	more	ADV
dentistry3000-465	13	37	abundant	abundant	ADJ
dentistry3000-465	13	38	in	in	ADP
dentistry3000-465	13	39	periodontitis	periodontitis	NOUN
dentistry3000-465	13	40	sites	site	NOUN
dentistry3000-465	13	41	.	.	PUNCT
dentistry3000-465	14	1	conclusion	conclusion	NOUN
dentistry3000-465	14	2	:	:	PUNCT
dentistry3000-465	14	3	this	this	DET
dentistry3000-465	14	4	study	study	NOUN
dentistry3000-465	14	5	supports	support	VERB
dentistry3000-465	14	6	the	the	DET
dentistry3000-465	14	7	fundamental	fundamental	ADJ
dentistry3000-465	14	8	idea	idea	NOUN
dentistry3000-465	14	9	that	that	SCONJ
dentistry3000-465	14	10	individual	individual	ADJ
dentistry3000-465	14	11	bacterial	bacterial	ADJ
dentistry3000-465	14	12	species	specie	NOUN
dentistry3000-465	14	13	are	be	AUX
dentistry3000-465	14	14	not	not	PART
dentistry3000-465	14	15	responsible	responsible	ADJ
dentistry3000-465	14	16	for	for	ADP
dentistry3000-465	14	17	the	the	DET
dentistry3000-465	14	18	advancement	advancement	NOUN
dentistry3000-465	14	19	of	of	ADP
dentistry3000-465	14	20	gingivitis	gingivitis	NOUN
dentistry3000-465	14	21	to	to	ADP
dentistry3000-465	14	22	periodontitis	periodontitis	NOUN
dentistry3000-465	14	23	but	but	CCONJ
dentistry3000-465	14	24	rather	rather	ADV
dentistry3000-465	14	25	the	the	DET
dentistry3000-465	14	26	abundance	abundance	NOUN
dentistry3000-465	14	27	of	of	ADP
dentistry3000-465	14	28	bacteria	bacteria	NOUN
dentistry3000-465	14	29	in	in	ADP
dentistry3000-465	14	30	the	the	DET
dentistry3000-465	14	31	bacterial	bacterial	ADJ
dentistry3000-465	14	32	community	community	NOUN
dentistry3000-465	14	33	.	.	PUNCT
dentistry3000-465	15	1	keywords	keyword	NOUN
dentistry3000-465	15	2	:	:	PUNCT
dentistry3000-465	15	3	intra	intra	ADJ
dentistry3000-465	15	4	-	-	ADJ
dentistry3000-465	15	5	subject	subject	ADJ
dentistry3000-465	15	6	,	,	PUNCT
dentistry3000-465	15	7	periodontitis	periodontitis	NOUN
dentistry3000-465	15	8	,	,	PUNCT
dentistry3000-465	15	9	gingivitis	gingivitis	NOUN
dentistry3000-465	15	10	,	,	PUNCT
dentistry3000-465	15	11	subgingival	subgingival	NOUN
dentistry3000-465	15	12	plaque	plaque	NOUN
dentistry3000-465	15	13	,	,	PUNCT
dentistry3000-465	15	14	16s	16	NOUN
dentistry3000-465	15	15	rna	rna	NOUN
dentistry3000-465	15	16	metagenomics	metagenomic	NOUN
dentistry3000-465	15	17	.	.	PUNCT
dentistry3000-465	16	1	citation	citation	NOUN
dentistry3000-465	16	2	:	:	PUNCT
dentistry3000-465	17	1	tariq	tariq	PROPN
dentistry3000-465	17	2	m	m	PROPN
dentistry3000-465	17	3	,	,	PUNCT
dentistry3000-465	17	4	et	et	PROPN
dentistry3000-465	17	5	al	al	PROPN
dentistry3000-465	17	6	.	.	PROPN
dentistry3000-465	18	1	(	(	PUNCT
dentistry3000-465	18	2	2024	2024	NUM
dentistry3000-465	18	3	)	)	PUNCT
dentistry3000-465	18	4	bacterial	bacterial	ADJ
dentistry3000-465	18	5	community	community	NOUN
dentistry3000-465	18	6	in	in	ADP
dentistry3000-465	18	7	dental	dental	ADJ
dentistry3000-465	18	8	biofilms	biofilm	NOUN
dentistry3000-465	18	9	linked	link	VERB
dentistry3000-465	18	10	to	to	ADP
dentistry3000-465	18	11	periodontal	periodontal	ADJ
dentistry3000-465	18	12	disease	disease	NOUN
dentistry3000-465	18	13	:	:	PUNCT
dentistry3000-465	18	14	an	an	DET
dentistry3000-465	18	15	intrasubject	intrasubject	ADJ
dentistry3000-465	18	16	metagenomics	metagenomics	NOUN
dentistry3000-465	18	17	study	study	NOUN
dentistry3000-465	18	18	dentistry	dentistry	NOUN
dentistry3000-465	18	19	3000	3000	NUM
dentistry3000-465	18	20	.	.	PUNCT
dentistry3000-465	19	1	1	1	NUM
dentistry3000-465	19	2	:	:	PUNCT
dentistry3000-465	19	3	a001	a001	PROPN
dentistry3000-465	19	4	doi:10.5195	doi:10.5195	NOUN
dentistry3000-465	19	5	/	/	SYM
dentistry3000-465	19	6	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	19	7	received	receive	VERB
dentistry3000-465	19	8	:	:	PUNCT
dentistry3000-465	19	9	march	march	PROPN
dentistry3000-465	19	10	5	5	NUM
dentistry3000-465	19	11	,	,	PUNCT
dentistry3000-465	19	12	2023	2023	NUM
dentistry3000-465	19	13	accepted	accept	VERB
dentistry3000-465	19	14	:	:	PUNCT
dentistry3000-465	19	15	july	july	PROPN
dentistry3000-465	19	16	14	14	NUM
dentistry3000-465	19	17	,	,	PUNCT
dentistry3000-465	19	18	2023	2023	NUM
dentistry3000-465	19	19	published	publish	VERB
dentistry3000-465	19	20	:	:	PUNCT
dentistry3000-465	19	21	august	august	PROPN
dentistry3000-465	19	22	28	28	NUM
dentistry3000-465	19	23	,	,	PUNCT
dentistry3000-465	19	24	2024	2024	NUM
dentistry3000-465	19	25	copyright	copyright	NOUN
dentistry3000-465	19	26	:	:	PUNCT
dentistry3000-465	19	27	©	©	PROPN
dentistry3000-465	19	28	2024	2024	NUM
dentistry3000-465	19	29	tariq	tariq	PROPN
dentistry3000-465	19	30	m	m	PROPN
dentistry3000-465	19	31	,	,	PUNCT
dentistry3000-465	19	32	et	et	PROPN
dentistry3000-465	19	33	al	al	PROPN
dentistry3000-465	19	34	.	.	PUNCT
dentistry3000-465	20	1	this	this	PRON
dentistry3000-465	20	2	is	be	AUX
dentistry3000-465	20	3	an	an	DET
dentistry3000-465	20	4	open	open	ADJ
dentistry3000-465	20	5	access	access	NOUN
dentistry3000-465	20	6	article	article	NOUN
dentistry3000-465	20	7	licensed	license	VERB
dentistry3000-465	20	8	under	under	ADP
dentistry3000-465	20	9	a	a	DET
dentistry3000-465	20	10	creative	creative	ADJ
dentistry3000-465	20	11	commons	common	NOUN
dentistry3000-465	20	12	attribution	attribution	NOUN
dentistry3000-465	20	13	work	work	VERB
dentistry3000-465	20	14	4.0	4.0	NUM
dentistry3000-465	20	15	united	united	ADJ
dentistry3000-465	20	16	states	states	PROPN
dentistry3000-465	20	17	license	license	NOUN
dentistry3000-465	20	18	.	.	PUNCT
dentistry3000-465	21	1	email	email	NOUN
dentistry3000-465	21	2	:	:	PUNCT
dentistry3000-465	21	3	rjazman@usm.my	rjazman@usm.my	PROPN
dentistry3000-465	21	4	introduction	introduction	NOUN
dentistry3000-465	21	5	gingivitis	gingivitis	NOUN
dentistry3000-465	21	6	and	and	CCONJ
dentistry3000-465	21	7	periodontitis	periodontitis	NOUN
dentistry3000-465	21	8	are	be	AUX
dentistry3000-465	21	9	the	the	DET
dentistry3000-465	21	10	two	two	NUM
dentistry3000-465	21	11	most	most	ADV
dentistry3000-465	21	12	common	common	ADJ
dentistry3000-465	21	13	forms	form	NOUN
dentistry3000-465	21	14	of	of	ADP
dentistry3000-465	21	15	periodontal	periodontal	ADJ
dentistry3000-465	21	16	diseases	disease	NOUN
dentistry3000-465	21	17	linked	link	VERB
dentistry3000-465	21	18	to	to	ADP
dentistry3000-465	21	19	bacterial	bacterial	ADJ
dentistry3000-465	21	20	dental	dental	ADJ
dentistry3000-465	21	21	biofilm	biofilm	NOUN
dentistry3000-465	21	22	.	.	PUNCT
dentistry3000-465	22	1	gingivitis	gingivitis	NOUN
dentistry3000-465	22	2	,	,	PUNCT
dentistry3000-465	22	3	the	the	DET
dentistry3000-465	22	4	reversible	reversible	ADJ
dentistry3000-465	22	5	form	form	NOUN
dentistry3000-465	22	6	,	,	PUNCT
dentistry3000-465	22	7	causes	cause	VERB
dentistry3000-465	22	8	bleeding	bleed	VERB
dentistry3000-465	22	9	and	and	CCONJ
dentistry3000-465	22	10	inflamed	inflame	VERB
dentistry3000-465	22	11	gums	gum	NOUN
dentistry3000-465	22	12	.	.	PUNCT
dentistry3000-465	23	1	if	if	SCONJ
dentistry3000-465	23	2	gingivitis	gingivitis	NOUN
dentistry3000-465	23	3	is	be	AUX
dentistry3000-465	23	4	left	leave	VERB
dentistry3000-465	23	5	untreated	untreated	ADJ
dentistry3000-465	23	6	,	,	PUNCT
dentistry3000-465	23	7	it	it	PRON
dentistry3000-465	23	8	can	can	AUX
dentistry3000-465	23	9	progress	progress	VERB
dentistry3000-465	23	10	to	to	ADP
dentistry3000-465	23	11	periodontitis	periodontitis	NOUN
dentistry3000-465	23	12	,	,	PUNCT
dentistry3000-465	23	13	an	an	DET
dentistry3000-465	23	14	irreversible	irreversible	ADJ
dentistry3000-465	23	15	condition	condition	NOUN
dentistry3000-465	24	1	[	[	X
dentistry3000-465	24	2	1	1	NUM
dentistry3000-465	24	3	]	]	PUNCT
dentistry3000-465	24	4	.	.	PUNCT
dentistry3000-465	25	1	approximately	approximately	ADV
dentistry3000-465	25	2	775	775	NUM
dentistry3000-465	25	3	bacterial	bacterial	ADJ
dentistry3000-465	25	4	species	specie	NOUN
dentistry3000-465	25	5	have	have	AUX
dentistry3000-465	25	6	been	be	AUX
dentistry3000-465	25	7	found	find	VERB
dentistry3000-465	25	8	in	in	ADP
dentistry3000-465	25	9	the	the	DET
dentistry3000-465	25	10	oral	oral	ADJ
dentistry3000-465	25	11	cavity	cavity	NOUN
dentistry3000-465	25	12	;	;	PUNCT
dentistry3000-465	25	13	however	however	ADV
dentistry3000-465	25	14	,	,	PUNCT
dentistry3000-465	25	15	only	only	ADV
dentistry3000-465	25	16	about	about	ADV
dentistry3000-465	25	17	57	57	NUM
dentistry3000-465	25	18	%	%	NOUN
dentistry3000-465	25	19	are	be	AUX
dentistry3000-465	25	20	culturable	culturable	ADJ
dentistry3000-465	25	21	[	[	X
dentistry3000-465	25	22	2	2	NUM
dentistry3000-465	25	23	]	]	PUNCT
dentistry3000-465	25	24	.	.	PUNCT
dentistry3000-465	26	1	the	the	DET
dentistry3000-465	26	2	possibility	possibility	NOUN
dentistry3000-465	26	3	exists	exist	VERB
dentistry3000-465	26	4	that	that	SCONJ
dentistry3000-465	26	5	periodontal	periodontal	ADJ
dentistry3000-465	26	6	tissue	tissue	NOUN
dentistry3000-465	26	7	deterioration	deterioration	NOUN
dentistry3000-465	26	8	may	may	AUX
dentistry3000-465	26	9	be	be	AUX
dentistry3000-465	26	10	caused	cause	VERB
dentistry3000-465	26	11	partly	partly	ADV
dentistry3000-465	26	12	by	by	ADP
dentistry3000-465	26	13	bacteria	bacteria	NOUN
dentistry3000-465	26	14	that	that	PRON
dentistry3000-465	26	15	have	have	AUX
dentistry3000-465	26	16	never	never	ADV
dentistry3000-465	26	17	been	be	AUX
dentistry3000-465	26	18	cultivated	cultivate	VERB
dentistry3000-465	26	19	or	or	CCONJ
dentistry3000-465	26	20	studied	study	VERB
dentistry3000-465	26	21	before	before	ADV
dentistry3000-465	26	22	.	.	PUNCT
dentistry3000-465	27	1	thus	thus	ADV
dentistry3000-465	27	2	,	,	PUNCT
dentistry3000-465	27	3	researches	research	VERB
dentistry3000-465	27	4	addressing	address	VERB
dentistry3000-465	27	5	the	the	DET
dentistry3000-465	27	6	entire	entire	ADJ
dentistry3000-465	27	7	population	population	NOUN
dentistry3000-465	27	8	of	of	ADP
dentistry3000-465	27	9	dental	dental	ADJ
dentistry3000-465	27	10	biofilm	biofilm	NOUN
dentistry3000-465	27	11	microorganisms	microorganism	NOUN
dentistry3000-465	27	12	are	be	AUX
dentistry3000-465	27	13	necessary	necessary	ADJ
dentistry3000-465	27	14	.	.	PUNCT
dentistry3000-465	28	1	recent	recent	ADJ
dentistry3000-465	28	2	years	year	NOUN
dentistry3000-465	28	3	have	have	AUX
dentistry3000-465	28	4	seen	see	VERB
dentistry3000-465	28	5	the	the	DET
dentistry3000-465	28	6	introduction	introduction	NOUN
dentistry3000-465	28	7	of	of	ADP
dentistry3000-465	28	8	high	high	ADJ
dentistry3000-465	28	9	throughput	throughput	NOUN
dentistry3000-465	28	10	sequencing	sequence	VERB
dentistry3000-465	28	11	technologies	technology	NOUN
dentistry3000-465	28	12	such	such	ADJ
dentistry3000-465	28	13	as	as	ADP
dentistry3000-465	28	14	16s	16	NOUN
dentistry3000-465	28	15	rrna	rrna	PROPN
dentistry3000-465	28	16	metagenomics	metagenomic	NOUN
dentistry3000-465	28	17	,	,	PUNCT
dentistry3000-465	28	18	which	which	PRON
dentistry3000-465	28	19	are	be	AUX
dentistry3000-465	28	20	timeefficient	timeefficient	ADJ
dentistry3000-465	28	21	,	,	PUNCT
dentistry3000-465	28	22	cost	cost	NOUN
dentistry3000-465	28	23	-	-	PUNCT
dentistry3000-465	28	24	effective	effective	ADJ
dentistry3000-465	28	25	,	,	PUNCT
dentistry3000-465	28	26	and	and	CCONJ
dentistry3000-465	28	27	can	can	AUX
dentistry3000-465	28	28	also	also	ADV
dentistry3000-465	28	29	reveal	reveal	VERB
dentistry3000-465	28	30	information	information	NOUN
dentistry3000-465	28	31	about	about	ADP
dentistry3000-465	28	32	nonculturable	nonculturable	ADJ
dentistry3000-465	28	33	bacteria	bacteria	NOUN
dentistry3000-465	28	34	.	.	PUNCT
dentistry3000-465	29	1	this	this	DET
dentistry3000-465	29	2	cutting	cut	VERB
dentistry3000-465	29	3	-	-	PUNCT
dentistry3000-465	29	4	edge	edge	NOUN
dentistry3000-465	29	5	technology	technology	NOUN
dentistry3000-465	29	6	may	may	AUX
dentistry3000-465	29	7	aid	aid	VERB
dentistry3000-465	29	8	in	in	ADP
dentistry3000-465	29	9	the	the	DET
dentistry3000-465	29	10	study	study	NOUN
dentistry3000-465	29	11	of	of	ADP
dentistry3000-465	29	12	how	how	SCONJ
dentistry3000-465	29	13	biofilm	biofilm	NOUN
dentistry3000-465	29	14	microorganisms	microorganism	NOUN
dentistry3000-465	29	15	contribute	contribute	VERB
dentistry3000-465	29	16	to	to	ADP
dentistry3000-465	29	17	oral	oral	ADJ
dentistry3000-465	29	18	disease	disease	NOUN
dentistry3000-465	29	19	,	,	PUNCT
dentistry3000-465	29	20	especially	especially	ADV
dentistry3000-465	29	21	periodontal	periodontal	ADJ
dentistry3000-465	29	22	disease	disease	NOUN
dentistry3000-465	29	23	.	.	PUNCT
dentistry3000-465	30	1	numerous	numerous	ADJ
dentistry3000-465	30	2	studies	study	NOUN
dentistry3000-465	30	3	have	have	AUX
dentistry3000-465	30	4	been	be	AUX
dentistry3000-465	30	5	conducted	conduct	VERB
dentistry3000-465	30	6	using	use	VERB
dentistry3000-465	30	7	16s	16	NOUN
dentistry3000-465	30	8	rna	rna	NOUN
dentistry3000-465	30	9	metagenomics	metagenomic	NOUN
dentistry3000-465	30	10	analysis	analysis	NOUN
dentistry3000-465	30	11	to	to	PART
dentistry3000-465	30	12	gain	gain	VERB
dentistry3000-465	30	13	a	a	DET
dentistry3000-465	30	14	better	well	ADJ
dentistry3000-465	30	15	understanding	understanding	NOUN
dentistry3000-465	30	16	of	of	ADP
dentistry3000-465	30	17	the	the	DET
dentistry3000-465	30	18	oral	oral	ADJ
dentistry3000-465	30	19	microbiota	microbiota	NOUN
dentistry3000-465	31	1	[	[	X
dentistry3000-465	31	2	3,4	3,4	NUM
dentistry3000-465	31	3	]	]	PUNCT
dentistry3000-465	31	4	.	.	PUNCT
dentistry3000-465	32	1	it	it	PRON
dentistry3000-465	32	2	is	be	AUX
dentistry3000-465	32	3	well	well	ADV
dentistry3000-465	32	4	-	-	PUNCT
dentistry3000-465	32	5	known	know	VERB
dentistry3000-465	32	6	that	that	SCONJ
dentistry3000-465	32	7	the	the	DET
dentistry3000-465	32	8	dental	dental	ADJ
dentistry3000-465	32	9	biofilm	biofilm	NOUN
dentistry3000-465	32	10	microbiota	microbiota	NOUN
dentistry3000-465	32	11	community	community	NOUN
dentistry3000-465	32	12	varies	vary	VERB
dentistry3000-465	32	13	between	between	ADP
dentistry3000-465	32	14	periodontally	periodontally	ADV
dentistry3000-465	32	15	healthy	healthy	ADJ
dentistry3000-465	32	16	and	and	CCONJ
dentistry3000-465	32	17	periodontitis	periodontitis	NOUN
dentistry3000-465	32	18	-	-	PUNCT
dentistry3000-465	32	19	afflicted	afflict	VERB
dentistry3000-465	32	20	individuals	individual	NOUN
dentistry3000-465	32	21	[	[	X
dentistry3000-465	32	22	5	5	NUM
dentistry3000-465	32	23	]	]	PUNCT
dentistry3000-465	32	24	,	,	PUNCT
dentistry3000-465	32	25	but	but	CCONJ
dentistry3000-465	32	26	how	how	SCONJ
dentistry3000-465	32	27	these	these	DET
dentistry3000-465	32	28	bacterial	bacterial	ADJ
dentistry3000-465	32	29	populations	population	NOUN
dentistry3000-465	32	30	induce	induce	VERB
dentistry3000-465	32	31	periodontal	periodontal	ADJ
dentistry3000-465	32	32	disease	disease	NOUN
dentistry3000-465	32	33	is	be	AUX
dentistry3000-465	32	34	unknown	unknown	ADJ
dentistry3000-465	32	35	.	.	PUNCT
dentistry3000-465	33	1	to	to	PART
dentistry3000-465	33	2	further	far	ADV
dentistry3000-465	33	3	understand	understand	VERB
dentistry3000-465	33	4	the	the	DET
dentistry3000-465	33	5	role	role	NOUN
dentistry3000-465	33	6	of	of	ADP
dentistry3000-465	33	7	microbiota	microbiota	NOUN
dentistry3000-465	33	8	in	in	ADP
dentistry3000-465	33	9	periodontal	periodontal	ADJ
dentistry3000-465	33	10	disease	disease	NOUN
dentistry3000-465	33	11	,	,	PUNCT
dentistry3000-465	33	12	numerous	numerous	ADJ
dentistry3000-465	33	13	metagenomic	metagenomic	ADJ
dentistry3000-465	33	14	analyses	analysis	NOUN
dentistry3000-465	33	15	of	of	ADP
dentistry3000-465	33	16	the	the	DET
dentistry3000-465	33	17	biofilm	biofilm	NOUN
dentistry3000-465	33	18	microbiota	microbiota	NOUN
dentistry3000-465	33	19	of	of	ADP
dentistry3000-465	33	20	healthy	healthy	ADJ
dentistry3000-465	33	21	and	and	CCONJ
dentistry3000-465	33	22	periodontitis	periodontitis	NOUN
dentistry3000-465	33	23	-	-	PUNCT
dentistry3000-465	33	24	affected	affect	VERB
dentistry3000-465	33	25	individuals	individual	NOUN
dentistry3000-465	33	26	were	be	AUX
dentistry3000-465	33	27	designed	design	VERB
dentistry3000-465	33	28	[	[	PUNCT
dentistry3000-465	33	29	4,6	4,6	X
dentistry3000-465	33	30	]	]	PUNCT
dentistry3000-465	33	31	.	.	PUNCT
dentistry3000-465	34	1	however	however	ADV
dentistry3000-465	34	2	,	,	PUNCT
dentistry3000-465	34	3	the	the	DET
dentistry3000-465	34	4	findings	finding	NOUN
dentistry3000-465	34	5	of	of	ADP
dentistry3000-465	34	6	these	these	DET
dentistry3000-465	34	7	approaches	approach	NOUN
dentistry3000-465	34	8	could	could	AUX
dentistry3000-465	34	9	be	be	AUX
dentistry3000-465	34	10	questioned	question	VERB
dentistry3000-465	34	11	because	because	SCONJ
dentistry3000-465	34	12	the	the	DET
dentistry3000-465	34	13	composition	composition	NOUN
dentistry3000-465	34	14	of	of	ADP
dentistry3000-465	34	15	the	the	DET
dentistry3000-465	34	16	oral	oral	ADJ
dentistry3000-465	34	17	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	34	18	bacterial	bacterial	ADJ
dentistry3000-465	34	19	community	community	NOUN
dentistry3000-465	34	20	in	in	ADP
dentistry3000-465	34	21	dental	dental	ADJ
dentistry3000-465	34	22	biofilms	biofilm	NOUN
dentistry3000-465	34	23	linked	link	VERB
dentistry3000-465	34	24	to	to	ADP
dentistry3000-465	34	25	periodontal	periodontal	ADJ
dentistry3000-465	34	26	disease	disease	NOUN
dentistry3000-465	34	27	:	:	PUNCT
dentistry3000-465	34	28	an	an	DET
dentistry3000-465	34	29	intra	intra	ADJ
dentistry3000-465	34	30	-	-	ADJ
dentistry3000-465	34	31	subject	subject	ADJ
dentistry3000-465	34	32	metagenomics	metagenomics	NOUN
dentistry3000-465	34	33	study	study	NOUN
dentistry3000-465	34	34	vol	vol	NOUN
dentistry3000-465	34	35	12	12	NUM
dentistry3000-465	34	36	no	no	PRON
dentistry3000-465	34	37	1	1	NUM
dentistry3000-465	34	38	(	(	PUNCT
dentistry3000-465	34	39	2024	2024	NUM
dentistry3000-465	34	40	)	)	PUNCT
dentistry3000-465	34	41	doi	doi	NOUN
dentistry3000-465	34	42	10.5195	10.5195	NUM
dentistry3000-465	34	43	/	/	SYM
dentistry3000-465	34	44	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	34	45	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	34	46	microbiota	microbiota	NOUN
dentistry3000-465	34	47	is	be	AUX
dentistry3000-465	34	48	influenced	influence	VERB
dentistry3000-465	34	49	by	by	ADP
dentistry3000-465	34	50	a	a	DET
dentistry3000-465	34	51	variety	variety	NOUN
dentistry3000-465	34	52	of	of	ADP
dentistry3000-465	34	53	individual	individual	ADJ
dentistry3000-465	34	54	factors	factor	NOUN
dentistry3000-465	34	55	,	,	PUNCT
dentistry3000-465	34	56	including	include	VERB
dentistry3000-465	34	57	lifestyle	lifestyle	NOUN
dentistry3000-465	34	58	,	,	PUNCT
dentistry3000-465	34	59	diet	diet	NOUN
dentistry3000-465	34	60	,	,	PUNCT
dentistry3000-465	34	61	oral	oral	ADJ
dentistry3000-465	34	62	care	care	NOUN
dentistry3000-465	34	63	habits	habit	NOUN
dentistry3000-465	34	64	,	,	PUNCT
dentistry3000-465	34	65	oral	oral	ADJ
dentistry3000-465	34	66	disease	disease	NOUN
dentistry3000-465	34	67	or	or	CCONJ
dentistry3000-465	34	68	systemic	systemic	ADJ
dentistry3000-465	34	69	disease	disease	NOUN
dentistry3000-465	34	70	,	,	PUNCT
dentistry3000-465	34	71	host	host	NOUN
dentistry3000-465	34	72	immune	immune	ADJ
dentistry3000-465	34	73	response	response	NOUN
dentistry3000-465	34	74	,	,	PUNCT
dentistry3000-465	34	75	genetic	genetic	ADJ
dentistry3000-465	34	76	susceptibility	susceptibility	NOUN
dentistry3000-465	34	77	,	,	PUNCT
dentistry3000-465	34	78	and	and	CCONJ
dentistry3000-465	34	79	location	location	NOUN
dentistry3000-465	34	80	in	in	ADP
dentistry3000-465	34	81	the	the	DET
dentistry3000-465	34	82	oral	oral	ADJ
dentistry3000-465	34	83	cavity	cavity	NOUN
dentistry3000-465	35	1	[	[	X
dentistry3000-465	35	2	2	2	NUM
dentistry3000-465	35	3	]	]	PUNCT
dentistry3000-465	35	4	.	.	PUNCT
dentistry3000-465	36	1	to	to	PART
dentistry3000-465	36	2	eliminate	eliminate	VERB
dentistry3000-465	36	3	all	all	PRON
dentistry3000-465	36	4	of	of	ADP
dentistry3000-465	36	5	these	these	DET
dentistry3000-465	36	6	confounding	confound	VERB
dentistry3000-465	36	7	factors	factor	NOUN
dentistry3000-465	36	8	,	,	PUNCT
dentistry3000-465	36	9	internal	internal	ADJ
dentistry3000-465	36	10	comparisons	comparison	NOUN
dentistry3000-465	36	11	within	within	ADP
dentistry3000-465	36	12	subjects	subject	NOUN
dentistry3000-465	36	13	should	should	AUX
dentistry3000-465	36	14	be	be	AUX
dentistry3000-465	36	15	conducted	conduct	VERB
dentistry3000-465	36	16	.	.	PUNCT
dentistry3000-465	37	1	to	to	ADP
dentistry3000-465	37	2	date	date	NOUN
dentistry3000-465	37	3	,	,	PUNCT
dentistry3000-465	37	4	only	only	ADV
dentistry3000-465	37	5	a	a	DET
dentistry3000-465	37	6	few	few	ADJ
dentistry3000-465	37	7	metagenomics	metagenomic	NOUN
dentistry3000-465	37	8	studies	study	NOUN
dentistry3000-465	37	9	have	have	AUX
dentistry3000-465	37	10	compared	compare	VERB
dentistry3000-465	37	11	the	the	DET
dentistry3000-465	37	12	biofilm	biofilm	NOUN
dentistry3000-465	37	13	microbial	microbial	ADJ
dentistry3000-465	37	14	community	community	NOUN
dentistry3000-465	37	15	within	within	ADP
dentistry3000-465	37	16	subjects	subject	NOUN
dentistry3000-465	37	17	,	,	PUNCT
dentistry3000-465	37	18	either	either	CCONJ
dentistry3000-465	37	19	among	among	ADP
dentistry3000-465	37	20	healthy	healthy	ADJ
dentistry3000-465	37	21	sites	site	NOUN
dentistry3000-465	37	22	[	[	X
dentistry3000-465	37	23	2	2	NUM
dentistry3000-465	37	24	]	]	PUNCT
dentistry3000-465	37	25	or	or	CCONJ
dentistry3000-465	37	26	between	between	ADP
dentistry3000-465	37	27	healthy	healthy	ADJ
dentistry3000-465	37	28	and	and	CCONJ
dentistry3000-465	37	29	periodontitis	periodontitis	NOUN
dentistry3000-465	37	30	-	-	PUNCT
dentistry3000-465	37	31	affected	affect	VERB
dentistry3000-465	37	32	sites	site	NOUN
dentistry3000-465	37	33	[	[	X
dentistry3000-465	37	34	4,7	4,7	NUM
dentistry3000-465	37	35	]	]	PUNCT
dentistry3000-465	37	36	.	.	PUNCT
dentistry3000-465	38	1	we	we	PRON
dentistry3000-465	38	2	did	do	AUX
dentistry3000-465	38	3	n't	not	PART
dentistry3000-465	38	4	come	come	VERB
dentistry3000-465	38	5	across	across	ADP
dentistry3000-465	38	6	any	any	DET
dentistry3000-465	38	7	studies	study	NOUN
dentistry3000-465	38	8	that	that	PRON
dentistry3000-465	38	9	compared	compare	VERB
dentistry3000-465	38	10	gingivitis	gingivitis	NOUN
dentistry3000-465	38	11	and	and	CCONJ
dentistry3000-465	38	12	periodontitis	periodontitis	NOUN
dentistry3000-465	38	13	-	-	PUNCT
dentistry3000-465	38	14	affected	affect	VERB
dentistry3000-465	38	15	sites	site	NOUN
dentistry3000-465	38	16	.	.	PUNCT
dentistry3000-465	39	1	thus	thus	ADV
dentistry3000-465	39	2	,	,	PUNCT
dentistry3000-465	39	3	the	the	DET
dentistry3000-465	39	4	objective	objective	NOUN
dentistry3000-465	39	5	of	of	ADP
dentistry3000-465	39	6	this	this	DET
dentistry3000-465	39	7	study	study	NOUN
dentistry3000-465	39	8	was	be	AUX
dentistry3000-465	39	9	to	to	PART
dentistry3000-465	39	10	evaluate	evaluate	VERB
dentistry3000-465	39	11	the	the	DET
dentistry3000-465	39	12	microbial	microbial	ADJ
dentistry3000-465	39	13	communities	community	NOUN
dentistry3000-465	39	14	of	of	ADP
dentistry3000-465	39	15	gingivitis	gingivitis	NOUN
dentistry3000-465	39	16	and	and	CCONJ
dentistry3000-465	39	17	periodontitis	periodontitis	NOUN
dentistry3000-465	39	18	sites	site	NOUN
dentistry3000-465	39	19	within	within	ADP
dentistry3000-465	39	20	the	the	DET
dentistry3000-465	39	21	same	same	ADJ
dentistry3000-465	39	22	periodontitis	periodontitis	NOUN
dentistry3000-465	39	23	subjects	subject	NOUN
dentistry3000-465	39	24	using	use	VERB
dentistry3000-465	39	25	16s	16	NOUN
dentistry3000-465	39	26	rna	rna	NOUN
dentistry3000-465	39	27	metagenomics	metagenomic	NOUN
dentistry3000-465	39	28	,	,	PUNCT
dentistry3000-465	39	29	where	where	SCONJ
dentistry3000-465	39	30	microbial	microbial	ADJ
dentistry3000-465	39	31	community	community	NOUN
dentistry3000-465	39	32	diversity	diversity	NOUN
dentistry3000-465	39	33	,	,	PUNCT
dentistry3000-465	39	34	clustering	clustering	NOUN
dentistry3000-465	39	35	,	,	PUNCT
dentistry3000-465	39	36	composition	composition	NOUN
dentistry3000-465	39	37	,	,	PUNCT
dentistry3000-465	39	38	and	and	CCONJ
dentistry3000-465	39	39	relative	relative	ADJ
dentistry3000-465	39	40	abundance	abundance	NOUN
dentistry3000-465	39	41	were	be	AUX
dentistry3000-465	39	42	compared	compare	VERB
dentistry3000-465	39	43	.	.	PUNCT
dentistry3000-465	40	1	materials	material	NOUN
dentistry3000-465	40	2	and	and	CCONJ
dentistry3000-465	40	3	methods	method	NOUN
dentistry3000-465	40	4	subject	subject	ADJ
dentistry3000-465	40	5	selection	selection	NOUN
dentistry3000-465	40	6	this	this	DET
dentistry3000-465	40	7	study	study	NOUN
dentistry3000-465	40	8	recruited	recruit	VERB
dentistry3000-465	40	9	16	16	NUM
dentistry3000-465	40	10	periodontitis	periodontitis	NOUN
dentistry3000-465	40	11	patients	patient	NOUN
dentistry3000-465	40	12	(	(	PUNCT
dentistry3000-465	40	13	9	9	NUM
dentistry3000-465	40	14	males	male	NOUN
dentistry3000-465	40	15	and	and	CCONJ
dentistry3000-465	40	16	7	7	NUM
dentistry3000-465	40	17	females	female	NOUN
dentistry3000-465	40	18	)	)	PUNCT
dentistry3000-465	40	19	from	from	ADP
dentistry3000-465	40	20	hospital	hospital	NOUN
dentistry3000-465	40	21	universiti	universiti	PROPN
dentistry3000-465	40	22	sains	sain	VERB
dentistry3000-465	40	23	malaysia	malaysia	PROPN
dentistry3000-465	40	24	.	.	PUNCT
dentistry3000-465	41	1	the	the	DET
dentistry3000-465	41	2	ages	age	NOUN
dentistry3000-465	41	3	of	of	ADP
dentistry3000-465	41	4	the	the	DET
dentistry3000-465	41	5	subjects	subject	NOUN
dentistry3000-465	41	6	ranged	range	VERB
dentistry3000-465	41	7	from	from	ADP
dentistry3000-465	41	8	42	42	NUM
dentistry3000-465	41	9	to	to	PART
dentistry3000-465	41	10	62	62	NUM
dentistry3000-465	41	11	years	year	NOUN
dentistry3000-465	41	12	.	.	PUNCT
dentistry3000-465	42	1	inclusion	inclusion	NOUN
dentistry3000-465	42	2	was	be	AUX
dentistry3000-465	42	3	determined	determine	VERB
dentistry3000-465	42	4	based	base	VERB
dentistry3000-465	42	5	on	on	ADP
dentistry3000-465	42	6	the	the	DET
dentistry3000-465	42	7	following	follow	VERB
dentistry3000-465	42	8	criteria	criterion	NOUN
dentistry3000-465	42	9	:	:	PUNCT
dentistry3000-465	42	10	(	(	PUNCT
dentistry3000-465	42	11	1	1	X
dentistry3000-465	42	12	)	)	PUNCT
dentistry3000-465	42	13	clinical	clinical	ADJ
dentistry3000-465	42	14	probing	probe	VERB
dentistry3000-465	42	15	depth	depth	NOUN
dentistry3000-465	42	16	greater	great	ADJ
dentistry3000-465	42	17	than	than	ADP
dentistry3000-465	42	18	5	5	NUM
dentistry3000-465	42	19	mm	mm	NOUN
dentistry3000-465	42	20	in	in	ADP
dentistry3000-465	42	21	50	50	NUM
dentistry3000-465	42	22	%	%	NOUN
dentistry3000-465	42	23	of	of	ADP
dentistry3000-465	42	24	teeth	tooth	NOUN
dentistry3000-465	42	25	;	;	PUNCT
dentistry3000-465	42	26	(	(	PUNCT
dentistry3000-465	42	27	2	2	X
dentistry3000-465	42	28	)	)	PUNCT
dentistry3000-465	42	29	lost	lose	VERB
dentistry3000-465	42	30	more	more	ADJ
dentistry3000-465	42	31	than	than	ADP
dentistry3000-465	42	32	30	30	NUM
dentistry3000-465	42	33	%	%	NOUN
dentistry3000-465	42	34	of	of	ADP
dentistry3000-465	42	35	alveolar	alveolar	ADJ
dentistry3000-465	42	36	bone	bone	NOUN
dentistry3000-465	42	37	;	;	PUNCT
dentistry3000-465	42	38	(	(	PUNCT
dentistry3000-465	42	39	3	3	X
dentistry3000-465	42	40	)	)	PUNCT
dentistry3000-465	42	41	had	have	VERB
dentistry3000-465	42	42	more	more	ADJ
dentistry3000-465	42	43	than	than	ADP
dentistry3000-465	42	44	20	20	NUM
dentistry3000-465	42	45	teeth	tooth	NOUN
dentistry3000-465	42	46	in	in	ADP
dentistry3000-465	42	47	dentition	dentition	NOUN
dentistry3000-465	42	48	;	;	PUNCT
dentistry3000-465	42	49	(	(	PUNCT
dentistry3000-465	42	50	4	4	X
dentistry3000-465	42	51	)	)	PUNCT
dentistry3000-465	42	52	had	have	AUX
dentistry3000-465	42	53	not	not	PART
dentistry3000-465	42	54	received	receive	VERB
dentistry3000-465	42	55	periodontal	periodontal	ADJ
dentistry3000-465	42	56	therapy	therapy	NOUN
dentistry3000-465	42	57	in	in	ADP
dentistry3000-465	42	58	the	the	DET
dentistry3000-465	42	59	previous	previous	ADJ
dentistry3000-465	42	60	6	6	NUM
dentistry3000-465	42	61	months	month	NOUN
dentistry3000-465	42	62	;	;	PUNCT
dentistry3000-465	42	63	(	(	PUNCT
dentistry3000-465	42	64	5	5	X
dentistry3000-465	42	65	)	)	PUNCT
dentistry3000-465	42	66	had	have	VERB
dentistry3000-465	42	67	no	no	DET
dentistry3000-465	42	68	systemic	systemic	ADJ
dentistry3000-465	42	69	disease	disease	NOUN
dentistry3000-465	42	70	;	;	PUNCT
dentistry3000-465	42	71	(	(	PUNCT
dentistry3000-465	42	72	6	6	X
dentistry3000-465	42	73	)	)	PUNCT
dentistry3000-465	42	74	had	have	AUX
dentistry3000-465	42	75	not	not	PART
dentistry3000-465	42	76	received	receive	VERB
dentistry3000-465	42	77	antibiotic	antibiotic	ADJ
dentistry3000-465	42	78	treatment	treatment	NOUN
dentistry3000-465	42	79	in	in	ADP
dentistry3000-465	42	80	the	the	DET
dentistry3000-465	42	81	previous	previous	ADJ
dentistry3000-465	42	82	3	3	NUM
dentistry3000-465	42	83	months	month	NOUN
dentistry3000-465	42	84	;	;	PUNCT
dentistry3000-465	42	85	and	and	CCONJ
dentistry3000-465	42	86	(	(	PUNCT
dentistry3000-465	42	87	7	7	X
dentistry3000-465	42	88	)	)	PUNCT
dentistry3000-465	42	89	was	be	AUX
dentistry3000-465	42	90	neither	neither	CCONJ
dentistry3000-465	42	91	pregnant	pregnant	ADJ
dentistry3000-465	42	92	nor	nor	CCONJ
dentistry3000-465	42	93	nursing	nursing	NOUN
dentistry3000-465	42	94	.	.	PUNCT
dentistry3000-465	43	1	ethical	ethical	ADJ
dentistry3000-465	43	2	approval	approval	NOUN
dentistry3000-465	43	3	was	be	AUX
dentistry3000-465	43	4	granted	grant	VERB
dentistry3000-465	43	5	by	by	ADP
dentistry3000-465	43	6	universiti	universiti	PROPN
dentistry3000-465	43	7	sains	sain	NOUN
dentistry3000-465	43	8	malaysia	malaysia	PROPN
dentistry3000-465	43	9	(	(	PUNCT
dentistry3000-465	43	10	ethical	ethical	ADJ
dentistry3000-465	43	11	ref	ref	NOUN
dentistry3000-465	43	12	number	number	NOUN
dentistry3000-465	43	13	:	:	PUNCT
dentistry3000-465	43	14	usm	usm	ADJ
dentistry3000-465	43	15	/	/	SYM
dentistry3000-465	43	16	jepem/15100370	jepem/15100370	NOUN
dentistry3000-465	43	17	)	)	PUNCT
dentistry3000-465	43	18	.	.	PUNCT
dentistry3000-465	44	1	the	the	DET
dentistry3000-465	44	2	written	write	VERB
dentistry3000-465	44	3	informed	inform	VERB
dentistry3000-465	44	4	consent	consent	NOUN
dentistry3000-465	44	5	was	be	AUX
dentistry3000-465	44	6	taken	take	VERB
dentistry3000-465	44	7	from	from	ADP
dentistry3000-465	44	8	all	all	DET
dentistry3000-465	44	9	participants	participant	NOUN
dentistry3000-465	44	10	.	.	PUNCT
dentistry3000-465	45	1	the	the	DET
dentistry3000-465	45	2	research	research	NOUN
dentistry3000-465	45	3	had	have	AUX
dentistry3000-465	45	4	been	be	AUX
dentistry3000-465	45	5	carried	carry	VERB
dentistry3000-465	45	6	out	out	ADP
dentistry3000-465	45	7	in	in	ADP
dentistry3000-465	45	8	accordance	accordance	NOUN
dentistry3000-465	45	9	with	with	ADP
dentistry3000-465	45	10	the	the	DET
dentistry3000-465	45	11	declaration	declaration	NOUN
dentistry3000-465	45	12	of	of	ADP
dentistry3000-465	45	13	helsinki	helsinki	PROPN
dentistry3000-465	45	14	.	.	PUNCT
dentistry3000-465	46	1	a	a	DET
dentistry3000-465	46	2	single	single	ADJ
dentistry3000-465	46	3	examiner	examiner	NOUN
dentistry3000-465	46	4	performed	perform	VERB
dentistry3000-465	46	5	a	a	DET
dentistry3000-465	46	6	fullmouth	fullmouth	NOUN
dentistry3000-465	46	7	periodontal	periodontal	ADJ
dentistry3000-465	46	8	examination	examination	NOUN
dentistry3000-465	46	9	on	on	ADP
dentistry3000-465	46	10	six	six	NUM
dentistry3000-465	46	11	tooth	tooth	NOUN
dentistry3000-465	46	12	surfaces	surface	NOUN
dentistry3000-465	46	13	mesiobuccal	mesiobuccal	ADJ
dentistry3000-465	46	14	,	,	PUNCT
dentistry3000-465	46	15	buccal	buccal	ADJ
dentistry3000-465	46	16	,	,	PUNCT
dentistry3000-465	46	17	distobuccal	distobuccal	ADJ
dentistry3000-465	46	18	,	,	PUNCT
dentistry3000-465	46	19	distolingual	distolingual	ADJ
dentistry3000-465	46	20	,	,	PUNCT
dentistry3000-465	46	21	lingual	lingual	NOUN
dentistry3000-465	46	22	,	,	PUNCT
dentistry3000-465	46	23	and	and	CCONJ
dentistry3000-465	46	24	mesiolingual	mesiolingual	NOUN
dentistry3000-465	46	25	.	.	PUNCT
dentistry3000-465	47	1	the	the	DET
dentistry3000-465	47	2	periodontal	periodontal	ADJ
dentistry3000-465	47	3	pocket	pocket	NOUN
dentistry3000-465	47	4	depth	depth	NOUN
dentistry3000-465	47	5	(	(	PUNCT
dentistry3000-465	47	6	ppd	ppd	NOUN
dentistry3000-465	47	7	)	)	PUNCT
dentistry3000-465	47	8	and	and	CCONJ
dentistry3000-465	47	9	bleeding	bleed	VERB
dentistry3000-465	47	10	on	on	ADP
dentistry3000-465	47	11	probing	probe	VERB
dentistry3000-465	47	12	(	(	PUNCT
dentistry3000-465	47	13	bop	bop	INTJ
dentistry3000-465	47	14	)	)	PUNCT
dentistry3000-465	47	15	were	be	AUX
dentistry3000-465	47	16	measured	measure	VERB
dentistry3000-465	47	17	using	use	VERB
dentistry3000-465	47	18	the	the	DET
dentistry3000-465	47	19	university	university	NOUN
dentistry3000-465	47	20	of	of	ADP
dentistry3000-465	47	21	north	north	PROPN
dentistry3000-465	47	22	carolina	carolina	PROPN
dentistry3000-465	47	23	probe	probe	NOUN
dentistry3000-465	47	24	(	(	PUNCT
dentistry3000-465	47	25	unc-15	unc-15	INTJ
dentistry3000-465	47	26	,	,	PUNCT
dentistry3000-465	47	27	hufriedy	hufriedy	NOUN
dentistry3000-465	47	28	,	,	PUNCT
dentistry3000-465	47	29	chicago	chicago	PROPN
dentistry3000-465	47	30	,	,	PUNCT
dentistry3000-465	47	31	il	il	PROPN
dentistry3000-465	47	32	,	,	PUNCT
dentistry3000-465	47	33	usa	usa	PROPN
dentistry3000-465	47	34	)	)	PUNCT
dentistry3000-465	47	35	.	.	PUNCT
dentistry3000-465	48	1	the	the	DET
dentistry3000-465	48	2	ppd	ppd	PROPN
dentistry3000-465	48	3	was	be	AUX
dentistry3000-465	48	4	determined	determine	VERB
dentistry3000-465	48	5	by	by	ADP
dentistry3000-465	48	6	measuring	measure	VERB
dentistry3000-465	48	7	the	the	DET
dentistry3000-465	48	8	distance	distance	NOUN
dentistry3000-465	48	9	between	between	ADP
dentistry3000-465	48	10	the	the	DET
dentistry3000-465	48	11	free	free	ADJ
dentistry3000-465	48	12	gingival	gingival	NOUN
dentistry3000-465	48	13	margin	margin	NOUN
dentistry3000-465	48	14	and	and	CCONJ
dentistry3000-465	48	15	the	the	DET
dentistry3000-465	48	16	periodontal	periodontal	ADJ
dentistry3000-465	48	17	pocket	pocket	NOUN
dentistry3000-465	48	18	base	base	NOUN
dentistry3000-465	48	19	.	.	PUNCT
dentistry3000-465	49	1	during	during	ADP
dentistry3000-465	49	2	probing	probe	VERB
dentistry3000-465	49	3	,	,	PUNCT
dentistry3000-465	49	4	sites	site	NOUN
dentistry3000-465	49	5	were	be	AUX
dentistry3000-465	49	6	examined	examine	VERB
dentistry3000-465	49	7	for	for	ADP
dentistry3000-465	49	8	the	the	DET
dentistry3000-465	49	9	presence	presence	NOUN
dentistry3000-465	49	10	or	or	CCONJ
dentistry3000-465	49	11	absence	absence	NOUN
dentistry3000-465	49	12	of	of	ADP
dentistry3000-465	49	13	bleeding	bleed	VERB
dentistry3000-465	49	14	to	to	PART
dentistry3000-465	49	15	quantify	quantify	VERB
dentistry3000-465	49	16	bleeding	bleed	VERB
dentistry3000-465	49	17	on	on	ADP
dentistry3000-465	49	18	probing	probe	VERB
dentistry3000-465	49	19	(	(	PUNCT
dentistry3000-465	49	20	bop	bop	INTJ
dentistry3000-465	49	21	)	)	PUNCT
dentistry3000-465	49	22	.	.	PUNCT
dentistry3000-465	50	1	for	for	ADP
dentistry3000-465	50	2	each	each	DET
dentistry3000-465	50	3	subject	subject	NOUN
dentistry3000-465	50	4	,	,	PUNCT
dentistry3000-465	50	5	three	three	NUM
dentistry3000-465	50	6	teeth	tooth	NOUN
dentistry3000-465	50	7	with	with	ADP
dentistry3000-465	50	8	pocket	pocket	NOUN
dentistry3000-465	50	9	depth	depth	NOUN
dentistry3000-465	50	10	(	(	PUNCT
dentistry3000-465	50	11	pd	pd	NOUN
dentistry3000-465	50	12	)	)	PUNCT
dentistry3000-465	50	13	on	on	ADP
dentistry3000-465	50	14	gingivitis	gingivitis	NOUN
dentistry3000-465	50	15	sites	site	NOUN
dentistry3000-465	50	16	(	(	PUNCT
dentistry3000-465	50	17	pd	pd	NOUN
dentistry3000-465	50	18	≤	≤	ADJ
dentistry3000-465	50	19	3	3	NUM
dentistry3000-465	50	20	mm	mm	NOUN
dentistry3000-465	50	21	)	)	PUNCT
dentistry3000-465	50	22	and	and	CCONJ
dentistry3000-465	50	23	three	three	NUM
dentistry3000-465	50	24	with	with	ADP
dentistry3000-465	50	25	periodontitis	periodontitis	NOUN
dentistry3000-465	50	26	sites	site	NOUN
dentistry3000-465	50	27	(	(	PUNCT
dentistry3000-465	50	28	pd	pd	X
dentistry3000-465	50	29	≥	≥	NUM
dentistry3000-465	50	30	5	5	NUM
dentistry3000-465	50	31	mm	mm	NOUN
dentistry3000-465	50	32	)	)	PUNCT
dentistry3000-465	50	33	were	be	AUX
dentistry3000-465	50	34	selected	select	VERB
dentistry3000-465	50	35	for	for	ADP
dentistry3000-465	50	36	subgingival	subgingival	ADJ
dentistry3000-465	50	37	plaque	plaque	NOUN
dentistry3000-465	50	38	sample	sample	NOUN
dentistry3000-465	50	39	collection	collection	NOUN
dentistry3000-465	50	40	.	.	PUNCT
dentistry3000-465	51	1	subgingival	subgingival	PROPN
dentistry3000-465	51	2	plaque	plaque	NOUN
dentistry3000-465	51	3	sample	sample	NOUN
dentistry3000-465	51	4	collection	collection	NOUN
dentistry3000-465	51	5	teeth	tooth	NOUN
dentistry3000-465	51	6	and	and	CCONJ
dentistry3000-465	51	7	gingiva	gingiva	NOUN
dentistry3000-465	51	8	were	be	AUX
dentistry3000-465	51	9	air	air	NOUN
dentistry3000-465	51	10	-	-	PUNCT
dentistry3000-465	51	11	dried	dry	VERB
dentistry3000-465	51	12	before	before	ADP
dentistry3000-465	51	13	being	be	AUX
dentistry3000-465	51	14	separated	separate	VERB
dentistry3000-465	51	15	with	with	ADP
dentistry3000-465	51	16	cotton	cotton	NOUN
dentistry3000-465	51	17	rolls	roll	NOUN
dentistry3000-465	51	18	.	.	PUNCT
dentistry3000-465	52	1	a	a	DET
dentistry3000-465	52	2	gracey	gracey	PROPN
dentistry3000-465	52	3	curette	curette	NOUN
dentistry3000-465	52	4	was	be	AUX
dentistry3000-465	52	5	initially	initially	ADV
dentistry3000-465	52	6	used	use	VERB
dentistry3000-465	52	7	to	to	PART
dentistry3000-465	52	8	remove	remove	VERB
dentistry3000-465	52	9	a	a	DET
dentistry3000-465	52	10	supragingival	supragingival	NOUN
dentistry3000-465	52	11	plaque	plaque	NOUN
dentistry3000-465	52	12	(	(	PUNCT
dentistry3000-465	52	13	hu	hu	PROPN
dentistry3000-465	52	14	-	-	ADJ
dentistry3000-465	52	15	friedy	friedy	PROPN
dentistry3000-465	52	16	,	,	PUNCT
dentistry3000-465	52	17	usa	usa	PROPN
dentistry3000-465	52	18	)	)	PUNCT
dentistry3000-465	52	19	.	.	PUNCT
dentistry3000-465	53	1	subgingival	subgingival	PROPN
dentistry3000-465	53	2	plaque	plaque	NOUN
dentistry3000-465	53	3	was	be	AUX
dentistry3000-465	53	4	then	then	ADV
dentistry3000-465	53	5	collected	collect	VERB
dentistry3000-465	53	6	using	use	VERB
dentistry3000-465	53	7	a	a	DET
dentistry3000-465	53	8	new	new	ADJ
dentistry3000-465	53	9	sterile	sterile	ADJ
dentistry3000-465	53	10	curette	curette	NOUN
dentistry3000-465	53	11	by	by	ADP
dentistry3000-465	53	12	inserting	insert	VERB
dentistry3000-465	53	13	it	it	PRON
dentistry3000-465	53	14	parallel	parallel	ADJ
dentistry3000-465	53	15	to	to	ADP
dentistry3000-465	53	16	the	the	DET
dentistry3000-465	53	17	long	long	ADJ
dentistry3000-465	53	18	axis	axis	NOUN
dentistry3000-465	53	19	of	of	ADP
dentistry3000-465	53	20	the	the	DET
dentistry3000-465	53	21	tooth	tooth	NOUN
dentistry3000-465	53	22	into	into	ADP
dentistry3000-465	53	23	the	the	DET
dentistry3000-465	53	24	deepest	deep	ADJ
dentistry3000-465	53	25	part	part	NOUN
dentistry3000-465	53	26	of	of	ADP
dentistry3000-465	53	27	the	the	DET
dentistry3000-465	53	28	pocket	pocket	NOUN
dentistry3000-465	53	29	and	and	CCONJ
dentistry3000-465	53	30	then	then	ADV
dentistry3000-465	53	31	moving	move	VERB
dentistry3000-465	53	32	coronally	coronally	ADV
dentistry3000-465	53	33	,	,	PUNCT
dentistry3000-465	53	34	scraping	scrape	VERB
dentistry3000-465	53	35	along	along	ADP
dentistry3000-465	53	36	the	the	DET
dentistry3000-465	53	37	root	root	NOUN
dentistry3000-465	53	38	surface	surface	NOUN
dentistry3000-465	53	39	.	.	PUNCT
dentistry3000-465	54	1	subgingival	subgingival	ADJ
dentistry3000-465	54	2	plaque	plaque	NOUN
dentistry3000-465	54	3	was	be	AUX
dentistry3000-465	54	4	subsequently	subsequently	ADV
dentistry3000-465	54	5	dispersed	disperse	VERB
dentistry3000-465	54	6	in	in	ADP
dentistry3000-465	54	7	a	a	DET
dentistry3000-465	54	8	1.5	1.5	NUM
dentistry3000-465	54	9	ml	ml	NOUN
dentistry3000-465	54	10	microcentrifuge	microcentrifuge	ADJ
dentistry3000-465	54	11	tube	tube	NOUN
dentistry3000-465	54	12	containing	contain	VERB
dentistry3000-465	54	13	0.5	0.5	NUM
dentistry3000-465	54	14	ml	ml	NOUN
dentistry3000-465	54	15	tris	tris	ADJ
dentistry3000-465	54	16	-	-	PUNCT
dentistry3000-465	54	17	edta	edta	NOUN
dentistry3000-465	54	18	buffer	buffer	NOUN
dentistry3000-465	54	19	solution	solution	NOUN
dentistry3000-465	54	20	(	(	PUNCT
dentistry3000-465	54	21	sigma	sigma	PROPN
dentistry3000-465	54	22	aldrich	aldrich	PROPN
dentistry3000-465	54	23	,	,	PUNCT
dentistry3000-465	54	24	germany	germany	PROPN
dentistry3000-465	54	25	)	)	PUNCT
dentistry3000-465	54	26	.	.	PUNCT
dentistry3000-465	55	1	for	for	ADP
dentistry3000-465	55	2	the	the	DET
dentistry3000-465	55	3	gingivitis	gingivitis	NOUN
dentistry3000-465	55	4	and	and	CCONJ
dentistry3000-465	55	5	periodontitis	periodontitis	NOUN
dentistry3000-465	55	6	site	site	NOUN
dentistry3000-465	55	7	of	of	ADP
dentistry3000-465	55	8	each	each	DET
dentistry3000-465	55	9	subject	subject	NOUN
dentistry3000-465	55	10	,	,	PUNCT
dentistry3000-465	55	11	dental	dental	ADJ
dentistry3000-465	55	12	plaque	plaque	NOUN
dentistry3000-465	55	13	from	from	ADP
dentistry3000-465	55	14	three	three	NUM
dentistry3000-465	55	15	teeth	tooth	NOUN
dentistry3000-465	55	16	was	be	AUX
dentistry3000-465	55	17	pooled	pool	VERB
dentistry3000-465	55	18	and	and	CCONJ
dentistry3000-465	55	19	stored	store	VERB
dentistry3000-465	55	20	in	in	ADP
dentistry3000-465	55	21	a	a	DET
dentistry3000-465	55	22	single	single	ADJ
dentistry3000-465	55	23	centrifuge	centrifuge	NOUN
dentistry3000-465	55	24	at	at	ADP
dentistry3000-465	55	25	-80	-80	NOUN
dentistry3000-465	55	26	°	°	NOUN
dentistry3000-465	55	27	c	c	NOUN
dentistry3000-465	55	28	until	until	SCONJ
dentistry3000-465	55	29	needed	need	VERB
dentistry3000-465	55	30	.	.	PUNCT
dentistry3000-465	56	1	dna	dna	PROPN
dentistry3000-465	56	2	extraction	extraction	NOUN
dentistry3000-465	56	3	the	the	DET
dentistry3000-465	56	4	dna	dna	NOUN
dentistry3000-465	56	5	was	be	AUX
dentistry3000-465	56	6	extracted	extract	VERB
dentistry3000-465	56	7	from	from	ADP
dentistry3000-465	56	8	dental	dental	ADJ
dentistry3000-465	56	9	plaque	plaque	NOUN
dentistry3000-465	56	10	samples	sample	NOUN
dentistry3000-465	56	11	using	use	VERB
dentistry3000-465	56	12	the	the	DET
dentistry3000-465	56	13	epicentre	epicentre	NOUN
dentistry3000-465	56	14	masterpure	masterpure	NOUN
dentistry3000-465	56	15	dna	dna	PROPN
dentistry3000-465	56	16	purification	purification	NOUN
dentistry3000-465	56	17	kit	kit	NOUN
dentistry3000-465	56	18	(	(	PUNCT
dentistry3000-465	56	19	cambio	cambio	PROPN
dentistry3000-465	56	20	,	,	PUNCT
dentistry3000-465	56	21	irvine	irvine	PROPN
dentistry3000-465	56	22	,	,	PUNCT
dentistry3000-465	56	23	uk	uk	PROPN
dentistry3000-465	56	24	)	)	PUNCT
dentistry3000-465	56	25	,	,	PUNCT
dentistry3000-465	56	26	following	follow	VERB
dentistry3000-465	56	27	the	the	DET
dentistry3000-465	56	28	manufacturer	manufacturer	NOUN
dentistry3000-465	56	29	’s	’s	PART
dentistry3000-465	56	30	instructions	instruction	NOUN
dentistry3000-465	56	31	.	.	PUNCT
dentistry3000-465	57	1	the	the	DET
dentistry3000-465	57	2	concentration	concentration	NOUN
dentistry3000-465	57	3	of	of	ADP
dentistry3000-465	57	4	extracted	extract	VERB
dentistry3000-465	57	5	dna	dna	NOUN
dentistry3000-465	57	6	was	be	AUX
dentistry3000-465	57	7	quantified	quantify	VERB
dentistry3000-465	57	8	using	use	VERB
dentistry3000-465	57	9	a	a	DET
dentistry3000-465	57	10	nanodrop	nanodrop	NOUN
dentistry3000-465	57	11	spectrophotometer	spectrophotometer	NOUN
dentistry3000-465	57	12	(	(	PUNCT
dentistry3000-465	57	13	thermo	thermo	NOUN
dentistry3000-465	57	14	scientific	scientific	PROPN
dentistry3000-465	57	15	-	-	PUNCT
dentistry3000-465	57	16	ge	ge	PROPN
dentistry3000-465	57	17	,	,	PUNCT
dentistry3000-465	57	18	usa	usa	PROPN
dentistry3000-465	57	19	)	)	PUNCT
dentistry3000-465	57	20	,	,	PUNCT
dentistry3000-465	57	21	and	and	CCONJ
dentistry3000-465	57	22	only	only	ADV
dentistry3000-465	57	23	dna	dna	NOUN
dentistry3000-465	57	24	with	with	ADP
dentistry3000-465	57	25	a	a	DET
dentistry3000-465	57	26	260/280	260/280	NUM
dentistry3000-465	57	27	ratio	ratio	NOUN
dentistry3000-465	57	28	between	between	ADP
dentistry3000-465	57	29	1.8	1.8	NUM
dentistry3000-465	57	30	and	and	CCONJ
dentistry3000-465	57	31	2.0	2.0	NUM
dentistry3000-465	57	32	was	be	AUX
dentistry3000-465	57	33	included	include	VERB
dentistry3000-465	57	34	in	in	ADP
dentistry3000-465	57	35	the	the	DET
dentistry3000-465	57	36	study	study	NOUN
dentistry3000-465	57	37	.	.	PUNCT
dentistry3000-465	58	1	gel	gel	NOUN
dentistry3000-465	58	2	electrophoresis	electrophoresis	NOUN
dentistry3000-465	58	3	was	be	AUX
dentistry3000-465	58	4	used	use	VERB
dentistry3000-465	58	5	to	to	PART
dentistry3000-465	58	6	further	far	ADV
dentistry3000-465	58	7	verify	verify	VERB
dentistry3000-465	58	8	the	the	DET
dentistry3000-465	58	9	dna	dna	NOUN
dentistry3000-465	58	10	’s	’s	PART
dentistry3000-465	58	11	integrity	integrity	NOUN
dentistry3000-465	58	12	.	.	PUNCT
dentistry3000-465	59	1	sixteen	sixteen	NUM
dentistry3000-465	59	2	gingivitis	gingivitis	NOUN
dentistry3000-465	59	3	and	and	CCONJ
dentistry3000-465	59	4	fourteen	fourteen	NUM
dentistry3000-465	59	5	periodontitis	periodontitis	NOUN
dentistry3000-465	59	6	samples	sample	NOUN
dentistry3000-465	59	7	yielded	yield	VERB
dentistry3000-465	59	8	dna	dna	NOUN
dentistry3000-465	59	9	in	in	ADP
dentistry3000-465	59	10	sufficient	sufficient	ADJ
dentistry3000-465	59	11	quantity	quantity	NOUN
dentistry3000-465	59	12	and	and	CCONJ
dentistry3000-465	59	13	quality	quality	NOUN
dentistry3000-465	59	14	were	be	AUX
dentistry3000-465	59	15	selected	select	VERB
dentistry3000-465	59	16	for	for	ADP
dentistry3000-465	59	17	16s	16	NOUN
dentistry3000-465	59	18	metagenomic	metagenomic	ADJ
dentistry3000-465	59	19	analysis	analysis	NOUN
dentistry3000-465	59	20	using	use	VERB
dentistry3000-465	59	21	illumina	illumina	PROPN
dentistry3000-465	59	22	technology	technology	PROPN
dentistry3000-465	59	23	.	.	PUNCT
dentistry3000-465	60	1	dna	dna	PROPN
dentistry3000-465	60	2	plaque	plaque	NOUN
dentistry3000-465	60	3	samples	sample	NOUN
dentistry3000-465	60	4	were	be	AUX
dentistry3000-465	60	5	kept	keep	VERB
dentistry3000-465	60	6	at	at	ADP
dentistry3000-465	60	7	-80	-80	NOUN
dentistry3000-465	60	8	°	°	NOUN
dentistry3000-465	60	9	c	c	NOUN
dentistry3000-465	60	10	before	before	ADP
dentistry3000-465	60	11	being	be	AUX
dentistry3000-465	60	12	sent	send	VERB
dentistry3000-465	60	13	to	to	ADP
dentistry3000-465	60	14	the	the	DET
dentistry3000-465	60	15	illumina	illumina	PROPN
dentistry3000-465	60	16	miseq	miseq	PROPN
dentistry3000-465	60	17	lab	lab	PROPN
dentistry3000-465	60	18	(	(	PUNCT
dentistry3000-465	60	19	malaysian	malaysian	ADJ
dentistry3000-465	60	20	genomic	genomic	PROPN
dentistry3000-465	60	21	institute	institute	PROPN
dentistry3000-465	60	22	,	,	PUNCT
dentistry3000-465	60	23	kajang	kajang	PROPN
dentistry3000-465	60	24	selangor	selangor	PROPN
dentistry3000-465	60	25	,	,	PUNCT
dentistry3000-465	60	26	malaysia	malaysia	PROPN
dentistry3000-465	60	27	)	)	PUNCT
dentistry3000-465	60	28	for	for	ADP
dentistry3000-465	60	29	illumina	illumina	NOUN
dentistry3000-465	60	30	sequencing	sequencing	NOUN
dentistry3000-465	60	31	.	.	PUNCT
dentistry3000-465	61	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	61	2	bacterial	bacterial	ADJ
dentistry3000-465	61	3	community	community	NOUN
dentistry3000-465	61	4	in	in	ADP
dentistry3000-465	61	5	dental	dental	ADJ
dentistry3000-465	61	6	biofilms	biofilm	NOUN
dentistry3000-465	61	7	linked	link	VERB
dentistry3000-465	61	8	to	to	ADP
dentistry3000-465	61	9	periodontal	periodontal	ADJ
dentistry3000-465	61	10	disease	disease	NOUN
dentistry3000-465	61	11	:	:	PUNCT
dentistry3000-465	61	12	an	an	DET
dentistry3000-465	61	13	intra	intra	ADJ
dentistry3000-465	61	14	-	-	ADJ
dentistry3000-465	61	15	subject	subject	ADJ
dentistry3000-465	61	16	metagenomics	metagenomics	NOUN
dentistry3000-465	61	17	study	study	NOUN
dentistry3000-465	61	18	vol	vol	NOUN
dentistry3000-465	61	19	12	12	NUM
dentistry3000-465	61	20	no	no	PRON
dentistry3000-465	61	21	1	1	NUM
dentistry3000-465	61	22	(	(	PUNCT
dentistry3000-465	61	23	2024	2024	NUM
dentistry3000-465	61	24	)	)	PUNCT
dentistry3000-465	61	25	doi	doi	NOUN
dentistry3000-465	61	26	10.5195	10.5195	NUM
dentistry3000-465	61	27	/	/	SYM
dentistry3000-465	61	28	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	61	29	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	61	30	pcr	pcr	ADJ
dentistry3000-465	61	31	amplification	amplification	NOUN
dentistry3000-465	61	32	and	and	CCONJ
dentistry3000-465	61	33	sequencing	sequence	VERB
dentistry3000-465	61	34	analysis	analysis	NOUN
dentistry3000-465	61	35	we	we	PRON
dentistry3000-465	61	36	used	use	VERB
dentistry3000-465	61	37	the	the	DET
dentistry3000-465	61	38	following	follow	VERB
dentistry3000-465	61	39	primers	primer	NOUN
dentistry3000-465	61	40	to	to	PART
dentistry3000-465	61	41	amplify	amplify	VERB
dentistry3000-465	61	42	the	the	DET
dentistry3000-465	61	43	v3	v3	PROPN
dentistry3000-465	61	44	and	and	CCONJ
dentistry3000-465	61	45	v4	v4	PROPN
dentistry3000-465	61	46	region	region	NOUN
dentistry3000-465	61	47	of	of	ADP
dentistry3000-465	61	48	16s	16s	PROPN
dentistry3000-465	61	49	rrna	rrna	PROPN
dentistry3000-465	61	50	gene	gene	NOUN
dentistry3000-465	61	51	[	[	X
dentistry3000-465	61	52	8	8	NUM
dentistry3000-465	61	53	]	]	SYM
dentistry3000-465	61	54	:	:	PUNCT
dentistry3000-465	61	55	forward	forward	NOUN
dentistry3000-465	61	56	primer	primer	NOUN
dentistry3000-465	61	57	:	:	PUNCT
dentistry3000-465	61	58	5'tcgtcggcagcgtcagatgtgtataag	5'tcgtcggcagcgtcagatgtgtataag	NUM
dentistry3000-465	61	59	agacagcctacgggnggcwgcag	agacagcctacgggnggcwgcag	ADJ
dentistry3000-465	61	60	reverse	reverse	NOUN
dentistry3000-465	61	61	primer	primer	NOUN
dentistry3000-465	61	62	:	:	PUNCT
dentistry3000-465	61	63	5'gtctcgtgggctcggagatgtgtataa	5'gtctcgtgggctcggagatgtgtataa	NUM
dentistry3000-465	61	64	gagacaggactachvgggtatctaatc	gagacaggactachvgggtatctaatc	NOUN
dentistry3000-465	61	65	c	c	PROPN
dentistry3000-465	61	66	pcr	pcr	PROPN
dentistry3000-465	61	67	reaction	reaction	NOUN
dentistry3000-465	61	68	was	be	AUX
dentistry3000-465	61	69	performed	perform	VERB
dentistry3000-465	61	70	using	use	VERB
dentistry3000-465	61	71	readymix	readymix	NOUN
dentistry3000-465	61	72	pcr	pcr	PROPN
dentistry3000-465	61	73	kit	kit	PROPN
dentistry3000-465	61	74	,	,	PUNCT
dentistry3000-465	61	75	kapa	kapa	PROPN
dentistry3000-465	61	76	hifi	hifi	PROPN
dentistry3000-465	61	77	hotstart	hotstart	PROPN
dentistry3000-465	61	78	dna	dna	PROPN
dentistry3000-465	61	79	polymerase	polymerase	NOUN
dentistry3000-465	61	80	(	(	PUNCT
dentistry3000-465	61	81	roche	roche	NOUN
dentistry3000-465	61	82	,	,	PUNCT
dentistry3000-465	61	83	switzerland	switzerland	PROPN
dentistry3000-465	61	84	)	)	PUNCT
dentistry3000-465	61	85	.	.	PUNCT
dentistry3000-465	62	1	briefly	briefly	NOUN
dentistry3000-465	62	2	,	,	PUNCT
dentistry3000-465	62	3	a	a	DET
dentistry3000-465	62	4	25μl	25μl	ADJ
dentistry3000-465	62	5	pcr	pcr	ADJ
dentistry3000-465	62	6	reaction	reaction	NOUN
dentistry3000-465	62	7	was	be	AUX
dentistry3000-465	62	8	prepared	prepare	VERB
dentistry3000-465	62	9	by	by	ADP
dentistry3000-465	62	10	adding	add	VERB
dentistry3000-465	62	11	2.5μl	2.5μl	NUM
dentistry3000-465	62	12	of	of	ADP
dentistry3000-465	62	13	dna	dna	PROPN
dentistry3000-465	62	14	sample	sample	NOUN
dentistry3000-465	62	15	,	,	PUNCT
dentistry3000-465	62	16	5μl	5μl	NOUN
dentistry3000-465	62	17	of	of	ADP
dentistry3000-465	62	18	each	each	DET
dentistry3000-465	62	19	forward	forward	NOUN
dentistry3000-465	62	20	and	and	CCONJ
dentistry3000-465	62	21	reverse	reverse	ADJ
dentistry3000-465	62	22	primers	primer	NOUN
dentistry3000-465	62	23	,	,	PUNCT
dentistry3000-465	62	24	and	and	CCONJ
dentistry3000-465	62	25	12.5μl	12.5μl	PRON
dentistry3000-465	62	26	2x	2x	NUM
dentistry3000-465	62	27	kapa	kapa	VERB
dentistry3000-465	62	28	ready	ready	ADJ
dentistry3000-465	62	29	mix	mix	NOUN
dentistry3000-465	62	30	(	(	PUNCT
dentistry3000-465	62	31	roche	roche	NOUN
dentistry3000-465	62	32	,	,	PUNCT
dentistry3000-465	62	33	switzerland	switzerland	PROPN
dentistry3000-465	62	34	)	)	PUNCT
dentistry3000-465	62	35	.	.	PUNCT
dentistry3000-465	63	1	thermal	thermal	ADJ
dentistry3000-465	63	2	cycling	cycling	NOUN
dentistry3000-465	63	3	was	be	AUX
dentistry3000-465	63	4	set	set	VERB
dentistry3000-465	63	5	to	to	PART
dentistry3000-465	63	6	consist	consist	VERB
dentistry3000-465	63	7	of	of	ADP
dentistry3000-465	63	8	an	an	DET
dentistry3000-465	63	9	initial	initial	ADJ
dentistry3000-465	63	10	denaturation	denaturation	NOUN
dentistry3000-465	63	11	at	at	ADP
dentistry3000-465	63	12	95	95	NUM
dentistry3000-465	63	13	°	°	ADP
dentistry3000-465	63	14	c	c	NOUN
dentistry3000-465	63	15	for	for	ADP
dentistry3000-465	63	16	3	3	NUM
dentistry3000-465	63	17	min	min	NOUN
dentistry3000-465	63	18	,	,	PUNCT
dentistry3000-465	63	19	followed	follow	VERB
dentistry3000-465	63	20	by	by	ADP
dentistry3000-465	63	21	25	25	NUM
dentistry3000-465	63	22	cycles	cycle	NOUN
dentistry3000-465	63	23	of	of	ADP
dentistry3000-465	63	24	denaturation	denaturation	NOUN
dentistry3000-465	63	25	at	at	ADP
dentistry3000-465	63	26	95	95	NUM
dentistry3000-465	63	27	°	°	NUM
dentistry3000-465	63	28	c	c	NOUN
dentistry3000-465	63	29	for	for	ADP
dentistry3000-465	63	30	30	30	NUM
dentistry3000-465	63	31	sec	sec	PROPN
dentistry3000-465	63	32	,	,	PUNCT
dentistry3000-465	63	33	annealing	anneal	VERB
dentistry3000-465	63	34	at	at	ADP
dentistry3000-465	63	35	55	55	NUM
dentistry3000-465	63	36	°	°	ADP
dentistry3000-465	63	37	c	c	NOUN
dentistry3000-465	63	38	for	for	ADP
dentistry3000-465	63	39	30	30	NUM
dentistry3000-465	63	40	sec	sec	NOUN
dentistry3000-465	63	41	and	and	CCONJ
dentistry3000-465	63	42	extension	extension	NOUN
dentistry3000-465	63	43	at	at	ADP
dentistry3000-465	63	44	72	72	NUM
dentistry3000-465	63	45	°	°	ADP
dentistry3000-465	63	46	c	c	NOUN
dentistry3000-465	63	47	for	for	ADP
dentistry3000-465	63	48	30	30	NUM
dentistry3000-465	63	49	sec	sec	PROPN
dentistry3000-465	63	50	.	.	PUNCT
dentistry3000-465	64	1	the	the	DET
dentistry3000-465	64	2	reaction	reaction	NOUN
dentistry3000-465	64	3	was	be	AUX
dentistry3000-465	64	4	completed	complete	VERB
dentistry3000-465	64	5	after	after	ADP
dentistry3000-465	64	6	a	a	DET
dentistry3000-465	64	7	5minute	5minute	NUM
dentistry3000-465	64	8	extension	extension	NOUN
dentistry3000-465	64	9	at	at	ADP
dentistry3000-465	64	10	72	72	NUM
dentistry3000-465	64	11	ºc	ºc	NOUN
dentistry3000-465	64	12	.	.	PUNCT
dentistry3000-465	65	1	the	the	DET
dentistry3000-465	65	2	pcr	pcr	ADJ
dentistry3000-465	65	3	amplicons	amplicon	NOUN
dentistry3000-465	65	4	were	be	AUX
dentistry3000-465	65	5	then	then	ADV
dentistry3000-465	65	6	purified	purified	ADJ
dentistry3000-465	65	7	using	use	VERB
dentistry3000-465	65	8	ampure	ampure	NOUN
dentistry3000-465	65	9	xp	xp	PROPN
dentistry3000-465	65	10	beads	bead	NOUN
dentistry3000-465	65	11	(	(	PUNCT
dentistry3000-465	65	12	beckman	beckman	PROPN
dentistry3000-465	65	13	coulter	coulter	PROPN
dentistry3000-465	65	14	,	,	PUNCT
dentistry3000-465	65	15	usa	usa	PROPN
dentistry3000-465	65	16	)	)	PUNCT
dentistry3000-465	65	17	.	.	PUNCT
dentistry3000-465	66	1	nextera	nextera	PROPN
dentistry3000-465	66	2	xt	xt	PROPN
dentistry3000-465	66	3	index	index	PROPN
dentistry3000-465	66	4	kit	kit	NOUN
dentistry3000-465	66	5	(	(	PUNCT
dentistry3000-465	66	6	illumina	illumina	PROPN
dentistry3000-465	66	7	,	,	PUNCT
dentistry3000-465	66	8	san	san	PROPN
dentistry3000-465	66	9	diego	diego	PROPN
dentistry3000-465	66	10	,	,	PUNCT
dentistry3000-465	66	11	usa	usa	PROPN
dentistry3000-465	66	12	)	)	PUNCT
dentistry3000-465	66	13	was	be	AUX
dentistry3000-465	66	14	used	use	VERB
dentistry3000-465	66	15	to	to	PART
dentistry3000-465	66	16	add	add	VERB
dentistry3000-465	66	17	specific	specific	ADJ
dentistry3000-465	66	18	oligonucleotides	oligonucleotide	NOUN
dentistry3000-465	66	19	to	to	ADP
dentistry3000-465	66	20	the	the	DET
dentistry3000-465	66	21	amplicons	amplicon	NOUN
dentistry3000-465	66	22	,	,	PUNCT
dentistry3000-465	66	23	and	and	CCONJ
dentistry3000-465	66	24	then	then	ADV
dentistry3000-465	66	25	ampure	ampure	PROPN
dentistry3000-465	66	26	xp	xp	PROPN
dentistry3000-465	66	27	beads	bead	NOUN
dentistry3000-465	66	28	were	be	AUX
dentistry3000-465	66	29	used	use	VERB
dentistry3000-465	66	30	to	to	PART
dentistry3000-465	66	31	purify	purify	VERB
dentistry3000-465	66	32	the	the	DET
dentistry3000-465	66	33	amplicons	amplicon	NOUN
dentistry3000-465	66	34	(	(	PUNCT
dentistry3000-465	66	35	beckman	beckman	PROPN
dentistry3000-465	66	36	coulter	coulter	PROPN
dentistry3000-465	66	37	,	,	PUNCT
dentistry3000-465	66	38	usa	usa	PROPN
dentistry3000-465	66	39	)	)	PUNCT
dentistry3000-465	66	40	.	.	PUNCT
dentistry3000-465	67	1	the	the	DET
dentistry3000-465	67	2	quality	quality	NOUN
dentistry3000-465	67	3	and	and	CCONJ
dentistry3000-465	67	4	size	size	NOUN
dentistry3000-465	67	5	of	of	ADP
dentistry3000-465	67	6	the	the	DET
dentistry3000-465	67	7	library	library	NOUN
dentistry3000-465	67	8	were	be	AUX
dentistry3000-465	67	9	assessed	assess	VERB
dentistry3000-465	67	10	using	use	VERB
dentistry3000-465	67	11	agilent	agilent	PROPN
dentistry3000-465	67	12	2100	2100	NUM
dentistry3000-465	67	13	bioanalyzer	bioanalyzer	NOUN
dentistry3000-465	67	14	(	(	PUNCT
dentistry3000-465	67	15	agilent	agilent	PROPN
dentistry3000-465	67	16	technologies	technologies	PROPN
dentistry3000-465	67	17	,	,	PUNCT
dentistry3000-465	67	18	usa	usa	PROPN
dentistry3000-465	67	19	)	)	PUNCT
dentistry3000-465	67	20	.	.	PUNCT
dentistry3000-465	68	1	the	the	DET
dentistry3000-465	68	2	library	library	NOUN
dentistry3000-465	68	3	sequencing	sequence	VERB
dentistry3000-465	68	4	was	be	AUX
dentistry3000-465	68	5	performed	perform	VERB
dentistry3000-465	68	6	on	on	ADP
dentistry3000-465	68	7	a	a	DET
dentistry3000-465	68	8	sequencing	sequence	VERB
dentistry3000-465	68	9	platform	platform	NOUN
dentistry3000-465	68	10	(	(	PUNCT
dentistry3000-465	68	11	miseq	miseq	NOUN
dentistry3000-465	68	12	system	system	NOUN
dentistry3000-465	68	13	,	,	PUNCT
dentistry3000-465	68	14	illumina	illumina	PROPN
dentistry3000-465	68	15	,	,	PUNCT
dentistry3000-465	68	16	usa	usa	PROPN
dentistry3000-465	68	17	)	)	PUNCT
dentistry3000-465	68	18	using	use	VERB
dentistry3000-465	68	19	a	a	DET
dentistry3000-465	68	20	miseq	miseq	ADJ
dentistry3000-465	68	21	v3	v3	PROPN
dentistry3000-465	68	22	600	600	NUM
dentistry3000-465	68	23	cycles	cycle	NOUN
dentistry3000-465	68	24	kit	kit	NOUN
dentistry3000-465	68	25	(	(	PUNCT
dentistry3000-465	68	26	illumina	illumina	PROPN
dentistry3000-465	68	27	,	,	PUNCT
dentistry3000-465	68	28	usa	usa	PROPN
dentistry3000-465	68	29	)	)	PUNCT
dentistry3000-465	68	30	.	.	PUNCT
dentistry3000-465	69	1	following	follow	VERB
dentistry3000-465	69	2	sequencing	sequence	VERB
dentistry3000-465	69	3	,	,	PUNCT
dentistry3000-465	69	4	image	image	NOUN
dentistry3000-465	69	5	analysis	analysis	NOUN
dentistry3000-465	69	6	and	and	CCONJ
dentistry3000-465	69	7	base	base	NOUN
dentistry3000-465	69	8	calling	calling	NOUN
dentistry3000-465	69	9	were	be	AUX
dentistry3000-465	69	10	performed	perform	VERB
dentistry3000-465	69	11	using	use	VERB
dentistry3000-465	69	12	miseq	miseq	ADJ
dentistry3000-465	69	13	reporter	reporter	NOUN
dentistry3000-465	69	14	software	software	PROPN
dentistry3000-465	69	15	(	(	PUNCT
dentistry3000-465	69	16	illumina	illumina	PROPN
dentistry3000-465	69	17	,	,	PUNCT
dentistry3000-465	69	18	usa	usa	PROPN
dentistry3000-465	69	19	)	)	PUNCT
dentistry3000-465	69	20	,	,	PUNCT
dentistry3000-465	69	21	with	with	ADP
dentistry3000-465	69	22	raw	raw	ADJ
dentistry3000-465	69	23	sequencing	sequencing	NOUN
dentistry3000-465	69	24	data	datum	NOUN
dentistry3000-465	69	25	recorded	record	VERB
dentistry3000-465	69	26	in	in	ADP
dentistry3000-465	69	27	fastq	fastq	ADJ
dentistry3000-465	69	28	format	format	NOUN
dentistry3000-465	69	29	.	.	PUNCT
dentistry3000-465	70	1	bioinformatic	bioinformatic	ADJ
dentistry3000-465	70	2	analysis	analysis	NOUN
dentistry3000-465	70	3	the	the	DET
dentistry3000-465	70	4	processing	processing	NOUN
dentistry3000-465	70	5	for	for	ADP
dentistry3000-465	70	6	16s	16	NOUN
dentistry3000-465	70	7	sequence	sequence	NOUN
dentistry3000-465	70	8	data	datum	NOUN
dentistry3000-465	70	9	was	be	AUX
dentistry3000-465	70	10	performed	perform	VERB
dentistry3000-465	70	11	on	on	ADP
dentistry3000-465	70	12	the	the	DET
dentistry3000-465	70	13	bioinformatics	bioinformatics	NOUN
dentistry3000-465	70	14	pipeline	pipeline	NOUN
dentistry3000-465	70	15	,	,	PUNCT
dentistry3000-465	70	16	quantitative	quantitative	ADJ
dentistry3000-465	70	17	insights	insight	NOUN
dentistry3000-465	70	18	into	into	ADP
dentistry3000-465	70	19	microbial	microbial	ADJ
dentistry3000-465	70	20	ecology	ecology	NOUN
dentistry3000-465	70	21	(	(	PUNCT
dentistry3000-465	70	22	qiime	qiime	NOUN
dentistry3000-465	70	23	)	)	PUNCT
dentistry3000-465	70	24	software	software	NOUN
dentistry3000-465	70	25	v1.9.1[9	v1.9.1[9	VERB
dentistry3000-465	70	26	]	]	PUNCT
dentistry3000-465	70	27	.	.	PUNCT
dentistry3000-465	71	1	the	the	DET
dentistry3000-465	71	2	raw	raw	ADJ
dentistry3000-465	71	3	metagenomic	metagenomic	ADJ
dentistry3000-465	71	4	sequence	sequence	NOUN
dentistry3000-465	71	5	read	read	VERB
dentistry3000-465	71	6	adapters	adapter	NOUN
dentistry3000-465	71	7	were	be	AUX
dentistry3000-465	71	8	removed	remove	VERB
dentistry3000-465	71	9	using	use	VERB
dentistry3000-465	71	10	pairedend	pairedend	PROPN
dentistry3000-465	71	11	trimmer	trimmer	NOUN
dentistry3000-465	71	12	peat	peat	NOUN
dentistry3000-465	71	13	v1.2.[10	v1.2.[10	NUM
dentistry3000-465	71	14	]	]	PUNCT
dentistry3000-465	71	15	.	.	PUNCT
dentistry3000-465	72	1	the	the	DET
dentistry3000-465	72	2	forward	forward	ADJ
dentistry3000-465	72	3	and	and	CCONJ
dentistry3000-465	72	4	reverse	reverse	ADJ
dentistry3000-465	72	5	reads	read	NOUN
dentistry3000-465	72	6	were	be	AUX
dentistry3000-465	72	7	merged	merge	VERB
dentistry3000-465	72	8	with	with	ADP
dentistry3000-465	72	9	paired	pair	VERB
dentistry3000-465	72	10	read	read	NOUN
dentistry3000-465	72	11	merger	merger	NOUN
dentistry3000-465	72	12	bbmerge	bbmerge	NOUN
dentistry3000-465	72	13	v7.3	v7.3	NOUN
dentistry3000-465	73	1	[	[	X
dentistry3000-465	73	2	11	11	NUM
dentistry3000-465	73	3	]	]	PUNCT
dentistry3000-465	73	4	.	.	PUNCT
dentistry3000-465	74	1	the	the	DET
dentistry3000-465	74	2	sequence	sequence	NOUN
dentistry3000-465	74	3	shorter	short	ADJ
dentistry3000-465	74	4	than	than	ADP
dentistry3000-465	74	5	100	100	NUM
dentistry3000-465	74	6	bp	bp	NOUN
dentistry3000-465	74	7	,	,	PUNCT
dentistry3000-465	74	8	with	with	ADP
dentistry3000-465	74	9	phred	phre	VERB
dentistry3000-465	74	10	score	score	NOUN
dentistry3000-465	74	11	lower	low	ADJ
dentistry3000-465	74	12	than	than	ADP
dentistry3000-465	74	13	20	20	NUM
dentistry3000-465	74	14	were	be	AUX
dentistry3000-465	74	15	removed	remove	VERB
dentistry3000-465	74	16	by	by	ADP
dentistry3000-465	74	17	fastx	fastx	NOUN
dentistry3000-465	74	18	-	-	PUNCT
dentistry3000-465	74	19	toolkit	toolkit	NOUN
dentistry3000-465	74	20	v	v	NOUN
dentistry3000-465	74	21	0.0.13	0.0.13	NUM
dentistry3000-465	74	22	.	.	PUNCT
dentistry3000-465	75	1	the	the	DET
dentistry3000-465	75	2	remaining	remain	VERB
dentistry3000-465	75	3	sequences	sequence	NOUN
dentistry3000-465	75	4	were	be	AUX
dentistry3000-465	75	5	used	use	VERB
dentistry3000-465	75	6	for	for	ADP
dentistry3000-465	75	7	de	de	X
dentistry3000-465	75	8	novo	novo	NOUN
dentistry3000-465	75	9	binning	binning	NOUN
dentistry3000-465	75	10	of	of	ADP
dentistry3000-465	75	11	operational	operational	ADJ
dentistry3000-465	75	12	taxonomic	taxonomic	ADJ
dentistry3000-465	75	13	units	unit	NOUN
dentistry3000-465	75	14	(	(	PUNCT
dentistry3000-465	75	15	otus	otus	NOUN
dentistry3000-465	75	16	)	)	PUNCT
dentistry3000-465	75	17	based	base	VERB
dentistry3000-465	75	18	on	on	ADP
dentistry3000-465	75	19	sequence	sequence	NOUN
dentistry3000-465	75	20	similarity	similarity	NOUN
dentistry3000-465	75	21	followed	follow	VERB
dentistry3000-465	75	22	by	by	ADP
dentistry3000-465	75	23	selection	selection	NOUN
dentistry3000-465	75	24	of	of	ADP
dentistry3000-465	75	25	representative	representative	ADJ
dentistry3000-465	75	26	otus	otus	NOUN
dentistry3000-465	75	27	per	per	ADP
dentistry3000-465	75	28	bin	bin	PROPN
dentistry3000-465	75	29	.	.	PUNCT
dentistry3000-465	76	1	the	the	DET
dentistry3000-465	76	2	tags	tag	NOUN
dentistry3000-465	76	3	were	be	AUX
dentistry3000-465	76	4	clustered	cluster	VERB
dentistry3000-465	76	5	into	into	ADP
dentistry3000-465	76	6	otus	otus	NOUN
dentistry3000-465	76	7	using	use	VERB
dentistry3000-465	76	8	qiime	qiime	NOUN
dentistry3000-465	76	9	at	at	ADP
dentistry3000-465	76	10	97	97	NUM
dentistry3000-465	76	11	%	%	NOUN
dentistry3000-465	76	12	sequence	sequence	NOUN
dentistry3000-465	76	13	similarity	similarity	NOUN
dentistry3000-465	76	14	.	.	PUNCT
dentistry3000-465	77	1	the	the	DET
dentistry3000-465	77	2	16s	16	NOUN
dentistry3000-465	77	3	metagenomics	metagenomics	PROPN
dentistry3000-465	77	4	workflow	workflow	NOUN
dentistry3000-465	77	5	classified	classified	ADJ
dentistry3000-465	77	6	organisms	organism	NOUN
dentistry3000-465	77	7	based	base	VERB
dentistry3000-465	77	8	on	on	ADP
dentistry3000-465	77	9	v3	v3	PROPN
dentistry3000-465	77	10	and	and	CCONJ
dentistry3000-465	77	11	v4	v4	NOUN
dentistry3000-465	77	12	amplicons	amplicon	NOUN
dentistry3000-465	77	13	using	use	VERB
dentistry3000-465	77	14	16s	16s	PROPN
dentistry3000-465	77	15	rrna	rrna	PROPN
dentistry3000-465	77	16	data	datum	NOUN
dentistry3000-465	77	17	database	database	NOUN
dentistry3000-465	77	18	.	.	PUNCT
dentistry3000-465	78	1	the	the	DET
dentistry3000-465	78	2	taxonomic	taxonomic	ADJ
dentistry3000-465	78	3	classification	classification	NOUN
dentistry3000-465	78	4	was	be	AUX
dentistry3000-465	78	5	assigned	assign	VERB
dentistry3000-465	78	6	using	use	VERB
dentistry3000-465	78	7	the	the	DET
dentistry3000-465	78	8	greengene	greengene	NOUN
dentistry3000-465	78	9	database	database	NOUN
dentistry3000-465	78	10	version	version	NOUN
dentistry3000-465	78	11	13.8	13.8	NUM
dentistry3000-465	79	1	[	[	X
dentistry3000-465	79	2	12	12	NUM
dentistry3000-465	79	3	]	]	PUNCT
dentistry3000-465	79	4	.	.	PUNCT
dentistry3000-465	80	1	alpha	alpha	NOUN
dentistry3000-465	80	2	and	and	CCONJ
dentistry3000-465	80	3	beta	beta	NOUN
dentistry3000-465	80	4	diversity	diversity	NOUN
dentistry3000-465	80	5	were	be	AUX
dentistry3000-465	80	6	computed	compute	VERB
dentistry3000-465	80	7	on	on	ADP
dentistry3000-465	80	8	the	the	DET
dentistry3000-465	80	9	basis	basis	NOUN
dentistry3000-465	80	10	of	of	ADP
dentistry3000-465	80	11	a	a	DET
dentistry3000-465	80	12	previously	previously	ADV
dentistry3000-465	80	13	constructed	construct	VERB
dentistry3000-465	80	14	otu	otu	PROPN
dentistry3000-465	80	15	table	table	NOUN
dentistry3000-465	80	16	by	by	ADP
dentistry3000-465	80	17	qiime	qiime	NOUN
dentistry3000-465	80	18	.	.	PUNCT
dentistry3000-465	81	1	bacterial	bacterial	ADJ
dentistry3000-465	81	2	species	specie	NOUN
dentistry3000-465	81	3	with	with	ADP
dentistry3000-465	81	4	a	a	DET
dentistry3000-465	81	5	prevalence	prevalence	NOUN
dentistry3000-465	81	6	of	of	ADP
dentistry3000-465	81	7	less	less	ADJ
dentistry3000-465	81	8	than	than	ADP
dentistry3000-465	81	9	0.1	0.1	NUM
dentistry3000-465	81	10	%	%	NOUN
dentistry3000-465	81	11	were	be	AUX
dentistry3000-465	81	12	excluded	exclude	VERB
dentistry3000-465	81	13	[	[	PUNCT
dentistry3000-465	81	14	13	13	NUM
dentistry3000-465	81	15	]	]	PUNCT
dentistry3000-465	81	16	.	.	PUNCT
dentistry3000-465	82	1	bacterial	bacterial	ADJ
dentistry3000-465	82	2	species	specie	NOUN
dentistry3000-465	82	3	were	be	AUX
dentistry3000-465	82	4	ranked	rank	VERB
dentistry3000-465	82	5	in	in	ADP
dentistry3000-465	82	6	groups	group	NOUN
dentistry3000-465	82	7	to	to	PART
dentistry3000-465	82	8	obtain	obtain	VERB
dentistry3000-465	82	9	relative	relative	ADJ
dentistry3000-465	82	10	abundance	abundance	NOUN
dentistry3000-465	82	11	.	.	PUNCT
dentistry3000-465	83	1	the	the	DET
dentistry3000-465	83	2	percentage	percentage	NOUN
dentistry3000-465	83	3	of	of	ADP
dentistry3000-465	83	4	total	total	ADJ
dentistry3000-465	83	5	abundance	abundance	NOUN
dentistry3000-465	83	6	in	in	ADP
dentistry3000-465	83	7	each	each	DET
dentistry3000-465	83	8	group	group	NOUN
dentistry3000-465	83	9	was	be	AUX
dentistry3000-465	83	10	estimated	estimate	VERB
dentistry3000-465	83	11	by	by	ADP
dentistry3000-465	83	12	combining	combine	VERB
dentistry3000-465	83	13	the	the	DET
dentistry3000-465	83	14	abundance	abundance	NOUN
dentistry3000-465	83	15	of	of	ADP
dentistry3000-465	83	16	individual	individual	ADJ
dentistry3000-465	83	17	components	component	NOUN
dentistry3000-465	83	18	in	in	ADP
dentistry3000-465	83	19	each	each	DET
dentistry3000-465	83	20	taxa	taxa	NOUN
dentistry3000-465	83	21	.	.	PUNCT
dentistry3000-465	84	1	only	only	ADV
dentistry3000-465	84	2	genera	genera	NOUN
dentistry3000-465	84	3	and	and	CCONJ
dentistry3000-465	84	4	species	specie	NOUN
dentistry3000-465	84	5	were	be	AUX
dentistry3000-465	84	6	analyzed	analyze	VERB
dentistry3000-465	84	7	in	in	ADP
dentistry3000-465	84	8	this	this	DET
dentistry3000-465	84	9	paper	paper	NOUN
dentistry3000-465	84	10	.	.	PUNCT
dentistry3000-465	85	1	statistical	statistical	ADJ
dentistry3000-465	85	2	analysis	analysis	NOUN
dentistry3000-465	85	3	the	the	DET
dentistry3000-465	85	4	shapiro	shapiro	PROPN
dentistry3000-465	85	5	-	-	PUNCT
dentistry3000-465	85	6	wilk	wilk	NOUN
dentistry3000-465	85	7	test	test	NOUN
dentistry3000-465	85	8	was	be	AUX
dentistry3000-465	85	9	used	use	VERB
dentistry3000-465	85	10	to	to	PART
dentistry3000-465	85	11	analyse	analyse	VERB
dentistry3000-465	85	12	the	the	DET
dentistry3000-465	85	13	normality	normality	NOUN
dentistry3000-465	85	14	of	of	ADP
dentistry3000-465	85	15	the	the	DET
dentistry3000-465	85	16	data	datum	NOUN
dentistry3000-465	85	17	.	.	PUNCT
dentistry3000-465	86	1	the	the	DET
dentistry3000-465	86	2	independent	independent	ADJ
dentistry3000-465	86	3	sample	sample	NOUN
dentistry3000-465	86	4	t	t	NOUN
dentistry3000-465	86	5	-	-	PUNCT
dentistry3000-465	86	6	test	test	NOUN
dentistry3000-465	86	7	or	or	CCONJ
dentistry3000-465	86	8	mannwhitney	mannwhitney	NOUN
dentistry3000-465	86	9	u	u	NOUN
dentistry3000-465	86	10	test	test	NOUN
dentistry3000-465	86	11	was	be	AUX
dentistry3000-465	86	12	used	use	VERB
dentistry3000-465	86	13	to	to	PART
dentistry3000-465	86	14	identify	identify	VERB
dentistry3000-465	86	15	the	the	DET
dentistry3000-465	86	16	statistically	statistically	ADV
dentistry3000-465	86	17	significant	significant	ADJ
dentistry3000-465	86	18	differences	difference	NOUN
dentistry3000-465	86	19	between	between	ADP
dentistry3000-465	86	20	the	the	DET
dentistry3000-465	86	21	patient	patient	NOUN
dentistry3000-465	86	22	’s	’s	PART
dentistry3000-465	86	23	clinical	clinical	ADJ
dentistry3000-465	86	24	variables	variable	NOUN
dentistry3000-465	86	25	,	,	PUNCT
dentistry3000-465	86	26	age	age	NOUN
dentistry3000-465	86	27	,	,	PUNCT
dentistry3000-465	86	28	α	α	NOUN
dentistry3000-465	86	29	-	-	NOUN
dentistry3000-465	86	30	diversity	diversity	NOUN
dentistry3000-465	86	31	,	,	PUNCT
dentistry3000-465	86	32	and	and	CCONJ
dentistry3000-465	86	33	taxonomic	taxonomic	ADJ
dentistry3000-465	86	34	ranks	rank	NOUN
dentistry3000-465	86	35	.	.	PUNCT
dentistry3000-465	87	1	all	all	DET
dentistry3000-465	87	2	these	these	DET
dentistry3000-465	87	3	statistical	statistical	ADJ
dentistry3000-465	87	4	tests	test	NOUN
dentistry3000-465	87	5	were	be	AUX
dentistry3000-465	87	6	performed	perform	VERB
dentistry3000-465	87	7	using	use	VERB
dentistry3000-465	87	8	ibm	ibm	PROPN
dentistry3000-465	87	9	spss	spss	PROPN
dentistry3000-465	87	10	version	version	NOUN
dentistry3000-465	87	11	25	25	NUM
dentistry3000-465	87	12	.	.	PUNCT
dentistry3000-465	88	1	an	an	DET
dentistry3000-465	88	2	otu	otu	PROPN
dentistry3000-465	88	3	table	table	NOUN
dentistry3000-465	88	4	was	be	AUX
dentistry3000-465	88	5	used	use	VERB
dentistry3000-465	88	6	for	for	ADP
dentistry3000-465	88	7	alpha	alpha	NOUN
dentistry3000-465	88	8	diversity	diversity	NOUN
dentistry3000-465	88	9	indices	indice	VERB
dentistry3000-465	88	10	calculation	calculation	NOUN
dentistry3000-465	88	11	,	,	PUNCT
dentistry3000-465	88	12	where	where	SCONJ
dentistry3000-465	88	13	chao1	chao1	NOUN
dentistry3000-465	88	14	was	be	AUX
dentistry3000-465	88	15	used	use	VERB
dentistry3000-465	88	16	as	as	ADP
dentistry3000-465	88	17	the	the	DET
dentistry3000-465	88	18	richness	richness	ADJ
dentistry3000-465	88	19	estimator	estimator	NOUN
dentistry3000-465	88	20	,	,	PUNCT
dentistry3000-465	88	21	and	and	CCONJ
dentistry3000-465	88	22	shannon	shannon	PROPN
dentistry3000-465	88	23	was	be	AUX
dentistry3000-465	88	24	used	use	VERB
dentistry3000-465	88	25	to	to	ADP
dentistry3000-465	88	26	representing	represent	VERB
dentistry3000-465	88	27	evenness	evenness	NOUN
dentistry3000-465	88	28	and	and	CCONJ
dentistry3000-465	88	29	diversity	diversity	NOUN
dentistry3000-465	88	30	.	.	PUNCT
dentistry3000-465	89	1	beta	beta	ADJ
dentistry3000-465	89	2	diversity	diversity	NOUN
dentistry3000-465	89	3	was	be	AUX
dentistry3000-465	89	4	determined	determine	VERB
dentistry3000-465	89	5	by	by	ADP
dentistry3000-465	89	6	computing	compute	VERB
dentistry3000-465	89	7	distance	distance	NOUN
dentistry3000-465	89	8	matrices	matrix	NOUN
dentistry3000-465	89	9	,	,	PUNCT
dentistry3000-465	89	10	which	which	PRON
dentistry3000-465	89	11	were	be	AUX
dentistry3000-465	89	12	represented	represent	VERB
dentistry3000-465	89	13	by	by	ADP
dentistry3000-465	89	14	weighted	weight	VERB
dentistry3000-465	89	15	unifrac	unifrac	ADJ
dentistry3000-465	89	16	distances	distance	NOUN
dentistry3000-465	89	17	that	that	PRON
dentistry3000-465	89	18	consider	consider	VERB
dentistry3000-465	89	19	both	both	DET
dentistry3000-465	89	20	abundance	abundance	NOUN
dentistry3000-465	89	21	and	and	CCONJ
dentistry3000-465	89	22	phylogenetic	phylogenetic	ADJ
dentistry3000-465	89	23	distances	distance	NOUN
dentistry3000-465	89	24	among	among	ADP
dentistry3000-465	89	25	taxa	taxa	NOUN
dentistry3000-465	89	26	[	[	X
dentistry3000-465	89	27	14	14	NUM
dentistry3000-465	89	28	]	]	PUNCT
dentistry3000-465	89	29	.	.	PUNCT
dentistry3000-465	90	1	it	it	PRON
dentistry3000-465	90	2	was	be	AUX
dentistry3000-465	90	3	used	use	VERB
dentistry3000-465	90	4	to	to	PART
dentistry3000-465	90	5	construct	construct	VERB
dentistry3000-465	90	6	the	the	DET
dentistry3000-465	90	7	hierarchal	hierarchal	NOUN
dentistry3000-465	90	8	clustering	clustering	NOUN
dentistry3000-465	90	9	,	,	PUNCT
dentistry3000-465	90	10	which	which	PRON
dentistry3000-465	90	11	was	be	AUX
dentistry3000-465	90	12	calculated	calculate	VERB
dentistry3000-465	90	13	on	on	ADP
dentistry3000-465	90	14	qiime	qiime	NOUN
dentistry3000-465	90	15	and	and	CCONJ
dentistry3000-465	90	16	constructed	construct	VERB
dentistry3000-465	90	17	on	on	ADP
dentistry3000-465	90	18	past	past	ADJ
dentistry3000-465	90	19	software	software	NOUN
dentistry3000-465	90	20	.	.	PUNCT
dentistry3000-465	91	1	the	the	DET
dentistry3000-465	91	2	principal	principal	NOUN
dentistry3000-465	91	3	coordinates	coordinate	VERB
dentistry3000-465	91	4	analysis	analysis	NOUN
dentistry3000-465	91	5	(	(	PUNCT
dentistry3000-465	91	6	pcoa	pcoa	NOUN
dentistry3000-465	91	7	)	)	PUNCT
dentistry3000-465	91	8	was	be	AUX
dentistry3000-465	91	9	performed	perform	VERB
dentistry3000-465	91	10	on	on	ADP
dentistry3000-465	91	11	the	the	DET
dentistry3000-465	91	12	otu	otu	PROPN
dentistry3000-465	91	13	level	level	NOUN
dentistry3000-465	91	14	to	to	PART
dentistry3000-465	91	15	evaluate	evaluate	VERB
dentistry3000-465	91	16	the	the	DET
dentistry3000-465	91	17	similarity	similarity	NOUN
dentistry3000-465	91	18	of	of	ADP
dentistry3000-465	91	19	microbial	microbial	ADJ
dentistry3000-465	91	20	community	community	NOUN
dentistry3000-465	91	21	structure	structure	NOUN
dentistry3000-465	91	22	on	on	ADP
dentistry3000-465	91	23	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	91	24	bacterial	bacterial	ADJ
dentistry3000-465	91	25	community	community	NOUN
dentistry3000-465	91	26	in	in	ADP
dentistry3000-465	91	27	dental	dental	ADJ
dentistry3000-465	91	28	biofilms	biofilm	NOUN
dentistry3000-465	91	29	linked	link	VERB
dentistry3000-465	91	30	to	to	ADP
dentistry3000-465	91	31	periodontal	periodontal	ADJ
dentistry3000-465	91	32	disease	disease	NOUN
dentistry3000-465	91	33	:	:	PUNCT
dentistry3000-465	91	34	an	an	DET
dentistry3000-465	91	35	intra	intra	ADJ
dentistry3000-465	91	36	-	-	ADJ
dentistry3000-465	91	37	subject	subject	ADJ
dentistry3000-465	91	38	metagenomics	metagenomics	NOUN
dentistry3000-465	91	39	study	study	NOUN
dentistry3000-465	91	40	vol	vol	NOUN
dentistry3000-465	91	41	12	12	NUM
dentistry3000-465	91	42	no	no	PRON
dentistry3000-465	91	43	1	1	NUM
dentistry3000-465	91	44	(	(	PUNCT
dentistry3000-465	91	45	2024	2024	NUM
dentistry3000-465	91	46	)	)	PUNCT
dentistry3000-465	91	47	doi	doi	NOUN
dentistry3000-465	91	48	10.5195	10.5195	NUM
dentistry3000-465	91	49	/	/	SYM
dentistry3000-465	91	50	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	91	51	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	91	52	emperor	emperor	NOUN
dentistry3000-465	91	53	software	software	NOUN
dentistry3000-465	91	54	.	.	PUNCT
dentistry3000-465	92	1	the	the	DET
dentistry3000-465	92	2	nonparametric	nonparametric	ADJ
dentistry3000-465	92	3	permutational	permutational	ADJ
dentistry3000-465	92	4	multivariate	multivariate	NOUN
dentistry3000-465	92	5	analysis	analysis	NOUN
dentistry3000-465	92	6	of	of	ADP
dentistry3000-465	92	7	variance	variance	NOUN
dentistry3000-465	92	8	(	(	PUNCT
dentistry3000-465	92	9	permanova	permanova	PROPN
dentistry3000-465	92	10	)	)	PUNCT
dentistry3000-465	92	11	was	be	AUX
dentistry3000-465	92	12	used	use	VERB
dentistry3000-465	92	13	to	to	PART
dentistry3000-465	92	14	measure	measure	VERB
dentistry3000-465	92	15	the	the	DET
dentistry3000-465	92	16	multivariate	multivariate	NOUN
dentistry3000-465	92	17	community	community	NOUN
dentistry3000-465	92	18	-	-	PUNCT
dentistry3000-465	92	19	level	level	NOUN
dentistry3000-465	92	20	difference	difference	NOUN
dentistry3000-465	92	21	between	between	ADP
dentistry3000-465	92	22	the	the	DET
dentistry3000-465	92	23	gingivitis	gingivitis	NOUN
dentistry3000-465	92	24	and	and	CCONJ
dentistry3000-465	92	25	periodontitis	periodontitis	NOUN
dentistry3000-465	92	26	groups	group	NOUN
dentistry3000-465	92	27	[	[	X
dentistry3000-465	92	28	15	15	NUM
dentistry3000-465	92	29	]	]	PUNCT
dentistry3000-465	92	30	.	.	PUNCT
dentistry3000-465	93	1	this	this	DET
dentistry3000-465	93	2	analysis	analysis	NOUN
dentistry3000-465	93	3	was	be	AUX
dentistry3000-465	93	4	performed	perform	VERB
dentistry3000-465	93	5	using	use	VERB
dentistry3000-465	93	6	qiime	qiime	ADJ
dentistry3000-465	93	7	software	software	PROPN
dentistry3000-465	93	8	v1.9.1	v1.9.1	PROPN
dentistry3000-465	93	9	.	.	PUNCT
dentistry3000-465	94	1	results	result	VERB
dentistry3000-465	94	2	demographic	demographic	ADJ
dentistry3000-465	94	3	and	and	CCONJ
dentistry3000-465	94	4	periodontal	periodontal	ADJ
dentistry3000-465	94	5	parameters	parameter	NOUN
dentistry3000-465	94	6	of	of	ADP
dentistry3000-465	94	7	study	study	NOUN
dentistry3000-465	94	8	subjects	subject	NOUN
dentistry3000-465	94	9	the	the	DET
dentistry3000-465	94	10	study	study	NOUN
dentistry3000-465	94	11	included	include	VERB
dentistry3000-465	94	12	sixteen	sixteen	NUM
dentistry3000-465	94	13	periodontitis	periodontitis	NOUN
dentistry3000-465	94	14	patients	patient	NOUN
dentistry3000-465	94	15	,	,	PUNCT
dentistry3000-465	94	16	nine	nine	NUM
dentistry3000-465	94	17	males	male	NOUN
dentistry3000-465	94	18	and	and	CCONJ
dentistry3000-465	94	19	seven	seven	NUM
dentistry3000-465	94	20	females	female	NOUN
dentistry3000-465	94	21	.	.	PUNCT
dentistry3000-465	95	1	the	the	DET
dentistry3000-465	95	2	average	average	ADJ
dentistry3000-465	95	3	age	age	NOUN
dentistry3000-465	95	4	of	of	ADP
dentistry3000-465	95	5	the	the	DET
dentistry3000-465	95	6	subjects	subject	NOUN
dentistry3000-465	95	7	was	be	AUX
dentistry3000-465	95	8	46.3	46.3	NUM
dentistry3000-465	95	9	years	year	NOUN
dentistry3000-465	95	10	,	,	PUNCT
dentistry3000-465	95	11	ranging	range	VERB
dentistry3000-465	95	12	from	from	ADP
dentistry3000-465	95	13	31	31	NUM
dentistry3000-465	95	14	to	to	PART
dentistry3000-465	95	15	62	62	NUM
dentistry3000-465	95	16	years	year	NOUN
dentistry3000-465	95	17	.	.	PUNCT
dentistry3000-465	96	1	the	the	DET
dentistry3000-465	96	2	median	median	ADJ
dentistry3000-465	96	3	and	and	CCONJ
dentistry3000-465	96	4	interquartile	interquartile	ADJ
dentistry3000-465	96	5	range	range	NOUN
dentistry3000-465	96	6	for	for	ADP
dentistry3000-465	96	7	subjects	subject	NOUN
dentistry3000-465	96	8	'	'	PART
dentistry3000-465	96	9	ppd	ppd	PROPN
dentistry3000-465	96	10	(	(	PUNCT
dentistry3000-465	96	11	mm	mm	NOUN
dentistry3000-465	96	12	)	)	PUNCT
dentistry3000-465	96	13	and	and	CCONJ
dentistry3000-465	96	14	bop	bop	INTJ
dentistry3000-465	96	15	(	(	PUNCT
dentistry3000-465	96	16	%	%	INTJ
dentistry3000-465	96	17	)	)	PUNCT
dentistry3000-465	96	18	are	be	AUX
dentistry3000-465	96	19	5.6	5.6	NUM
dentistry3000-465	96	20	(	(	PUNCT
dentistry3000-465	96	21	0.9	0.9	NUM
dentistry3000-465	96	22	mm	mm	NOUN
dentistry3000-465	96	23	)	)	PUNCT
dentistry3000-465	96	24	and	and	CCONJ
dentistry3000-465	96	25	85	85	NUM
dentistry3000-465	96	26	(	(	PUNCT
dentistry3000-465	96	27	10	10	NUM
dentistry3000-465	96	28	%	%	NOUN
dentistry3000-465	96	29	)	)	PUNCT
dentistry3000-465	96	30	,	,	PUNCT
dentistry3000-465	96	31	respectively	respectively	ADV
dentistry3000-465	96	32	.	.	PUNCT
dentistry3000-465	97	1	the	the	DET
dentistry3000-465	97	2	periodontal	periodontal	ADJ
dentistry3000-465	97	3	parameters	parameter	NOUN
dentistry3000-465	97	4	of	of	ADP
dentistry3000-465	97	5	the	the	DET
dentistry3000-465	97	6	teeth	tooth	NOUN
dentistry3000-465	97	7	involved	involve	VERB
dentistry3000-465	97	8	in	in	ADP
dentistry3000-465	97	9	the	the	DET
dentistry3000-465	97	10	collection	collection	NOUN
dentistry3000-465	97	11	of	of	ADP
dentistry3000-465	97	12	dental	dental	ADJ
dentistry3000-465	97	13	plaque	plaque	NOUN
dentistry3000-465	97	14	samples	sample	NOUN
dentistry3000-465	97	15	are	be	AUX
dentistry3000-465	97	16	shown	show	VERB
dentistry3000-465	97	17	in	in	ADP
dentistry3000-465	97	18	table	table	NOUN
dentistry3000-465	97	19	1	1	NUM
dentistry3000-465	97	20	.	.	PUNCT
dentistry3000-465	97	21	table	table	NOUN
dentistry3000-465	97	22	1	1	NUM
dentistry3000-465	97	23	.	.	PUNCT
dentistry3000-465	98	1	periodontal	periodontal	ADJ
dentistry3000-465	98	2	parameters	parameter	NOUN
dentistry3000-465	98	3	of	of	ADP
dentistry3000-465	98	4	teeth	tooth	NOUN
dentistry3000-465	98	5	selected	select	VERB
dentistry3000-465	98	6	for	for	ADP
dentistry3000-465	98	7	dental	dental	ADJ
dentistry3000-465	98	8	plaque	plaque	NOUN
dentistry3000-465	98	9	sample	sample	NOUN
dentistry3000-465	98	10	collection	collection	NOUN
dentistry3000-465	98	11	gingivitis	gingivitis	NOUN
dentistry3000-465	98	12	(	(	PUNCT
dentistry3000-465	98	13	n	n	NOUN
dentistry3000-465	98	14	=	=	SYM
dentistry3000-465	98	15	96	96	NUM
dentistry3000-465	98	16	)	)	PUNCT
dentistry3000-465	98	17	periodontitis	periodontitis	NOUN
dentistry3000-465	98	18	(	(	PUNCT
dentistry3000-465	98	19	n	n	NOUN
dentistry3000-465	98	20	=	=	SYM
dentistry3000-465	98	21	96	96	NUM
dentistry3000-465	98	22	)	)	PUNCT
dentistry3000-465	98	23	p	p	NOUN
dentistry3000-465	98	24	value	value	NOUN
dentistry3000-465	98	25	*	*	PUNCT
dentistry3000-465	98	26	periodontal	periodontal	ADJ
dentistry3000-465	98	27	parameters	parameter	NOUN
dentistry3000-465	98	28	ppd	ppd	PROPN
dentistry3000-465	98	29	(	(	PUNCT
dentistry3000-465	98	30	mm	mm	NOUN
dentistry3000-465	98	31	)	)	PUNCT
dentistry3000-465	98	32	2.5	2.5	NUM
dentistry3000-465	98	33	(	(	PUNCT
dentistry3000-465	98	34	0.7	0.7	NUM
dentistry3000-465	98	35	)	)	PUNCT
dentistry3000-465	98	36	5.6	5.6	NUM
dentistry3000-465	98	37	(	(	PUNCT
dentistry3000-465	98	38	0.8	0.8	NUM
dentistry3000-465	98	39	)	)	PUNCT
dentistry3000-465	98	40	<	<	X
dentistry3000-465	98	41	0.001	0.001	NUM
dentistry3000-465	98	42	bop	bop	NOUN
dentistry3000-465	98	43	(	(	PUNCT
dentistry3000-465	98	44	%	%	NOUN
dentistry3000-465	98	45	)	)	PUNCT
dentistry3000-465	98	46	21	21	NUM
dentistry3000-465	98	47	(	(	PUNCT
dentistry3000-465	98	48	5	5	NUM
dentistry3000-465	98	49	)	)	PUNCT
dentistry3000-465	98	50	80	80	NUM
dentistry3000-465	98	51	(	(	PUNCT
dentistry3000-465	98	52	19	19	NUM
dentistry3000-465	98	53	)	)	PUNCT
dentistry3000-465	98	54	<	<	NOUN
dentistry3000-465	98	55	0.001	0.001	NUM
dentistry3000-465	98	56	the	the	DET
dentistry3000-465	98	57	parameters	parameter	NOUN
dentistry3000-465	98	58	are	be	AUX
dentistry3000-465	98	59	presented	present	VERB
dentistry3000-465	98	60	as	as	ADP
dentistry3000-465	98	61	median	median	NOUN
dentistry3000-465	98	62	and	and	CCONJ
dentistry3000-465	98	63	interquartile	interquartile	ADJ
dentistry3000-465	98	64	range	range	NOUN
dentistry3000-465	98	65	(	(	PUNCT
dentistry3000-465	98	66	iqr	iqr	NOUN
dentistry3000-465	98	67	)	)	PUNCT
dentistry3000-465	98	68	.	.	PUNCT
dentistry3000-465	99	1	the	the	DET
dentistry3000-465	99	2	significance	significance	NOUN
dentistry3000-465	99	3	level	level	NOUN
dentistry3000-465	99	4	was	be	AUX
dentistry3000-465	99	5	set	set	VERB
dentistry3000-465	99	6	at	at	ADP
dentistry3000-465	99	7	p	p	NOUN
dentistry3000-465	99	8	=	=	NOUN
dentistry3000-465	99	9	0.05	0.05	NUM
dentistry3000-465	99	10	,	,	PUNCT
dentistry3000-465	99	11	and	and	CCONJ
dentistry3000-465	99	12	n	n	CCONJ
dentistry3000-465	99	13	=	=	SYM
dentistry3000-465	99	14	96	96	NUM
dentistry3000-465	99	15	.	.	PUNCT
dentistry3000-465	100	1	*	*	PUNCT
dentistry3000-465	101	1	=	=	PUNCT
dentistry3000-465	101	2	mann	mann	PROPN
dentistry3000-465	101	3	-	-	PUNCT
dentistry3000-465	101	4	whitney	whitney	PROPN
dentistry3000-465	101	5	u	u	PROPN
dentistry3000-465	101	6	test	test	NOUN
dentistry3000-465	101	7	.	.	PUNCT
dentistry3000-465	102	1	16s	16s	PROPN
dentistry3000-465	102	2	rrna	rrna	PROPN
dentistry3000-465	102	3	metagenomics	metagenomic	NOUN
dentistry3000-465	102	4	this	this	DET
dentistry3000-465	102	5	study	study	NOUN
dentistry3000-465	102	6	used	use	VERB
dentistry3000-465	102	7	16s	16	NOUN
dentistry3000-465	102	8	rna	rna	NOUN
dentistry3000-465	102	9	metagenomics	metagenomic	NOUN
dentistry3000-465	102	10	to	to	PART
dentistry3000-465	102	11	analyze	analyze	VERB
dentistry3000-465	102	12	the	the	DET
dentistry3000-465	102	13	microbiome	microbiome	NOUN
dentistry3000-465	102	14	within	within	ADP
dentistry3000-465	102	15	the	the	DET
dentistry3000-465	102	16	gingivitis	gingivitis	NOUN
dentistry3000-465	102	17	and	and	CCONJ
dentistry3000-465	102	18	periodontitis	periodontitis	NOUN
dentistry3000-465	102	19	sites	site	NOUN
dentistry3000-465	102	20	of	of	ADP
dentistry3000-465	102	21	the	the	DET
dentistry3000-465	102	22	subjects	subject	NOUN
dentistry3000-465	102	23	.	.	PUNCT
dentistry3000-465	103	1	each	each	DET
dentistry3000-465	103	2	sample	sample	NOUN
dentistry3000-465	103	3	from	from	ADP
dentistry3000-465	103	4	gingivitis	gingivitis	NOUN
dentistry3000-465	103	5	and	and	CCONJ
dentistry3000-465	103	6	periodontitis	periodontitis	NOUN
dentistry3000-465	103	7	sites	site	NOUN
dentistry3000-465	103	8	yielded	yield	VERB
dentistry3000-465	103	9	50k	50k	ADJ
dentistry3000-465	103	10	sequences	sequence	NOUN
dentistry3000-465	103	11	in	in	ADP
dentistry3000-465	103	12	total	total	NOUN
dentistry3000-465	103	13	.	.	PUNCT
dentistry3000-465	104	1	after	after	ADP
dentistry3000-465	104	2	merging	merge	VERB
dentistry3000-465	104	3	,	,	PUNCT
dentistry3000-465	104	4	filtering	filtering	NOUN
dentistry3000-465	104	5	,	,	PUNCT
dentistry3000-465	104	6	and	and	CCONJ
dentistry3000-465	104	7	deleting	delete	VERB
dentistry3000-465	104	8	chimaeras	chimaera	NOUN
dentistry3000-465	104	9	,	,	PUNCT
dentistry3000-465	104	10	a	a	DET
dentistry3000-465	104	11	total	total	NOUN
dentistry3000-465	104	12	of	of	ADP
dentistry3000-465	104	13	313480	313480	NUM
dentistry3000-465	104	14	sequences	sequence	NOUN
dentistry3000-465	104	15	were	be	AUX
dentistry3000-465	104	16	retrieved	retrieve	VERB
dentistry3000-465	104	17	.	.	PUNCT
dentistry3000-465	105	1	alpha	alpha	NOUN
dentistry3000-465	105	2	diversity	diversity	NOUN
dentistry3000-465	105	3	rarefaction	rarefaction	NOUN
dentistry3000-465	105	4	curves	curve	NOUN
dentistry3000-465	105	5	were	be	AUX
dentistry3000-465	105	6	generated	generate	VERB
dentistry3000-465	105	7	for	for	ADP
dentistry3000-465	105	8	the	the	DET
dentistry3000-465	105	9	chao1	chao1	NOUN
dentistry3000-465	105	10	index	index	NOUN
dentistry3000-465	105	11	(	(	PUNCT
dentistry3000-465	105	12	species	species	NOUN
dentistry3000-465	105	13	richness	richness	NOUN
dentistry3000-465	105	14	)	)	PUNCT
dentistry3000-465	105	15	and	and	CCONJ
dentistry3000-465	105	16	the	the	DET
dentistry3000-465	105	17	shannon	shannon	PROPN
dentistry3000-465	105	18	index	index	PROPN
dentistry3000-465	105	19	(	(	PUNCT
dentistry3000-465	105	20	species	species	NOUN
dentistry3000-465	105	21	evenness	evenness	NOUN
dentistry3000-465	105	22	)	)	PUNCT
dentistry3000-465	105	23	,	,	PUNCT
dentistry3000-465	105	24	with	with	ADP
dentistry3000-465	105	25	their	their	PRON
dentistry3000-465	105	26	values	value	NOUN
dentistry3000-465	105	27	plotting	plot	VERB
dentistry3000-465	105	28	to	to	ADP
dentistry3000-465	105	29	a	a	DET
dentistry3000-465	105	30	plateau	plateau	NOUN
dentistry3000-465	105	31	,	,	PUNCT
dentistry3000-465	105	32	indicating	indicate	VERB
dentistry3000-465	105	33	that	that	SCONJ
dentistry3000-465	105	34	sufficient	sufficient	ADJ
dentistry3000-465	105	35	sequencing	sequencing	NOUN
dentistry3000-465	105	36	was	be	AUX
dentistry3000-465	105	37	performed	perform	VERB
dentistry3000-465	105	38	to	to	PART
dentistry3000-465	105	39	reveal	reveal	VERB
dentistry3000-465	105	40	an	an	DET
dentistry3000-465	105	41	excellent	excellent	ADJ
dentistry3000-465	105	42	representation	representation	NOUN
dentistry3000-465	105	43	of	of	ADP
dentistry3000-465	105	44	microbial	microbial	ADJ
dentistry3000-465	105	45	community	community	NOUN
dentistry3000-465	105	46	diversity	diversity	NOUN
dentistry3000-465	105	47	and	and	CCONJ
dentistry3000-465	105	48	richness	richness	NOUN
dentistry3000-465	105	49	(	(	PUNCT
dentistry3000-465	105	50	figure	figure	NOUN
dentistry3000-465	105	51	1	1	NUM
dentistry3000-465	105	52	)	)	PUNCT
dentistry3000-465	105	53	.	.	PUNCT
dentistry3000-465	106	1	the	the	DET
dentistry3000-465	106	2	chao1	chao1	PROPN
dentistry3000-465	106	3	and	and	CCONJ
dentistry3000-465	106	4	shannon	shannon	PROPN
dentistry3000-465	106	5	index	index	NOUN
dentistry3000-465	106	6	values	value	NOUN
dentistry3000-465	106	7	were	be	AUX
dentistry3000-465	106	8	higher	high	ADJ
dentistry3000-465	106	9	in	in	ADP
dentistry3000-465	106	10	the	the	DET
dentistry3000-465	106	11	periodontitis	periodontitis	NOUN
dentistry3000-465	106	12	group	group	NOUN
dentistry3000-465	106	13	than	than	ADP
dentistry3000-465	106	14	in	in	ADP
dentistry3000-465	106	15	the	the	DET
dentistry3000-465	106	16	gingivitis	gingivitis	NOUN
dentistry3000-465	106	17	group	group	NOUN
dentistry3000-465	106	18	,	,	PUNCT
dentistry3000-465	106	19	indicating	indicate	VERB
dentistry3000-465	106	20	a	a	DET
dentistry3000-465	106	21	more	more	ADV
dentistry3000-465	106	22	diverse	diverse	ADJ
dentistry3000-465	106	23	and	and	CCONJ
dentistry3000-465	106	24	balanced	balanced	ADJ
dentistry3000-465	106	25	microbial	microbial	ADJ
dentistry3000-465	106	26	community	community	NOUN
dentistry3000-465	106	27	in	in	ADP
dentistry3000-465	106	28	the	the	DET
dentistry3000-465	106	29	periodontitis	periodontitis	NOUN
dentistry3000-465	106	30	group	group	NOUN
dentistry3000-465	106	31	.	.	PUNCT
dentistry3000-465	107	1	however	however	ADV
dentistry3000-465	107	2	,	,	PUNCT
dentistry3000-465	107	3	these	these	DET
dentistry3000-465	107	4	differences	difference	NOUN
dentistry3000-465	107	5	were	be	AUX
dentistry3000-465	107	6	not	not	PART
dentistry3000-465	107	7	statistically	statistically	ADV
dentistry3000-465	107	8	significant	significant	ADJ
dentistry3000-465	107	9	.	.	PUNCT
dentistry3000-465	108	1	beta	beta	ADJ
dentistry3000-465	108	2	diversity	diversity	NOUN
dentistry3000-465	108	3	the	the	DET
dentistry3000-465	108	4	principal	principal	NOUN
dentistry3000-465	108	5	coordinates	coordinate	VERB
dentistry3000-465	108	6	analysis	analysis	NOUN
dentistry3000-465	108	7	(	(	PUNCT
dentistry3000-465	108	8	pcoa	pcoa	NOUN
dentistry3000-465	108	9	)	)	PUNCT
dentistry3000-465	108	10	revealed	reveal	VERB
dentistry3000-465	108	11	that	that	SCONJ
dentistry3000-465	108	12	the	the	DET
dentistry3000-465	108	13	microbial	microbial	ADJ
dentistry3000-465	108	14	compositions	composition	NOUN
dentistry3000-465	108	15	of	of	ADP
dentistry3000-465	108	16	gingivitis	gingivitis	NOUN
dentistry3000-465	108	17	and	and	CCONJ
dentistry3000-465	108	18	periodontitis	periodontitis	NOUN
dentistry3000-465	108	19	sites	site	NOUN
dentistry3000-465	108	20	do	do	AUX
dentistry3000-465	108	21	not	not	PART
dentistry3000-465	108	22	cluster	cluster	VERB
dentistry3000-465	108	23	distinctively	distinctively	ADV
dentistry3000-465	108	24	(	(	PUNCT
dentistry3000-465	108	25	figure	figure	NOUN
dentistry3000-465	108	26	2	2	NUM
dentistry3000-465	108	27	)	)	PUNCT
dentistry3000-465	108	28	.	.	PUNCT
dentistry3000-465	109	1	however	however	ADV
dentistry3000-465	109	2	,	,	PUNCT
dentistry3000-465	109	3	a	a	DET
dentistry3000-465	109	4	closer	close	ADJ
dentistry3000-465	109	5	examination	examination	NOUN
dentistry3000-465	109	6	of	of	ADP
dentistry3000-465	109	7	the	the	DET
dentistry3000-465	109	8	gingivitis	gingivitis	NOUN
dentistry3000-465	109	9	and	and	CCONJ
dentistry3000-465	109	10	periodontitis	periodontitis	NOUN
dentistry3000-465	109	11	samples	sample	NOUN
dentistry3000-465	109	12	using	use	VERB
dentistry3000-465	109	13	a	a	DET
dentistry3000-465	109	14	hierarchical	hierarchical	ADJ
dentistry3000-465	109	15	clustering	clustering	NOUN
dentistry3000-465	109	16	plot	plot	NOUN
dentistry3000-465	109	17	indicated	indicate	VERB
dentistry3000-465	109	18	a	a	DET
dentistry3000-465	109	19	taxonomic	taxonomic	ADJ
dentistry3000-465	109	20	cluster	cluster	NOUN
dentistry3000-465	109	21	link	link	NOUN
dentistry3000-465	109	22	(	(	PUNCT
dentistry3000-465	109	23	figure	figure	NOUN
dentistry3000-465	109	24	3	3	NUM
dentistry3000-465	109	25	)	)	PUNCT
dentistry3000-465	109	26	.	.	PUNCT
dentistry3000-465	110	1	not	not	PART
dentistry3000-465	110	2	only	only	ADV
dentistry3000-465	110	3	is	be	AUX
dentistry3000-465	110	4	the	the	DET
dentistry3000-465	110	5	microbial	microbial	ADJ
dentistry3000-465	110	6	composition	composition	NOUN
dentistry3000-465	110	7	of	of	ADP
dentistry3000-465	110	8	gingivitis	gingivitis	NOUN
dentistry3000-465	110	9	and	and	CCONJ
dentistry3000-465	110	10	periodontitis	periodontitis	NOUN
dentistry3000-465	110	11	samples	sample	NOUN
dentistry3000-465	110	12	clustered	cluster	VERB
dentistry3000-465	110	13	,	,	PUNCT
dentistry3000-465	110	14	but	but	CCONJ
dentistry3000-465	110	15	some	some	DET
dentistry3000-465	110	16	gingivitis	gingivitis	NOUN
dentistry3000-465	110	17	and	and	CCONJ
dentistry3000-465	110	18	periodontitis	periodontitis	NOUN
dentistry3000-465	110	19	samples	sample	NOUN
dentistry3000-465	110	20	have	have	VERB
dentistry3000-465	110	21	notable	notable	ADJ
dentistry3000-465	110	22	similarities	similarity	NOUN
dentistry3000-465	110	23	.	.	PUNCT
dentistry3000-465	111	1	however	however	ADV
dentistry3000-465	111	2	,	,	PUNCT
dentistry3000-465	111	3	in	in	ADP
dentistry3000-465	111	4	hierarchical	hierarchical	ADJ
dentistry3000-465	111	5	clustering	clustering	NOUN
dentistry3000-465	111	6	,	,	PUNCT
dentistry3000-465	111	7	the	the	DET
dentistry3000-465	111	8	majority	majority	NOUN
dentistry3000-465	111	9	of	of	ADP
dentistry3000-465	111	10	gingivitis	gingivitis	NOUN
dentistry3000-465	111	11	and	and	CCONJ
dentistry3000-465	111	12	periodontitis	periodontitis	NOUN
dentistry3000-465	111	13	samples	sample	NOUN
dentistry3000-465	111	14	from	from	ADP
dentistry3000-465	111	15	single	single	ADJ
dentistry3000-465	111	16	subjects	subject	NOUN
dentistry3000-465	111	17	exhibit	exhibit	VERB
dentistry3000-465	111	18	a	a	DET
dentistry3000-465	111	19	distance	distance	NOUN
dentistry3000-465	111	20	in	in	ADP
dentistry3000-465	111	21	similarity	similarity	NOUN
dentistry3000-465	111	22	.	.	PUNCT
dentistry3000-465	112	1	the	the	DET
dentistry3000-465	112	2	statistical	statistical	ADJ
dentistry3000-465	112	3	analysis	analysis	NOUN
dentistry3000-465	112	4	permanova	permanova	PROPN
dentistry3000-465	112	5	,	,	PUNCT
dentistry3000-465	112	6	using	use	VERB
dentistry3000-465	112	7	weighted	weight	VERB
dentistry3000-465	112	8	unifrac	unifrac	ADJ
dentistry3000-465	112	9	distances	distance	NOUN
dentistry3000-465	112	10	,	,	PUNCT
dentistry3000-465	112	11	revealed	reveal	VERB
dentistry3000-465	112	12	that	that	SCONJ
dentistry3000-465	112	13	the	the	DET
dentistry3000-465	112	14	difference	difference	NOUN
dentistry3000-465	112	15	between	between	ADP
dentistry3000-465	112	16	the	the	DET
dentistry3000-465	112	17	abundance	abundance	NOUN
dentistry3000-465	112	18	of	of	ADP
dentistry3000-465	112	19	otu	otu	PROPN
dentistry3000-465	112	20	in	in	ADP
dentistry3000-465	112	21	the	the	DET
dentistry3000-465	112	22	gingivitis	gingivitis	NOUN
dentistry3000-465	112	23	and	and	CCONJ
dentistry3000-465	112	24	periodontitis	periodontitis	NOUN
dentistry3000-465	112	25	group	group	NOUN
dentistry3000-465	112	26	was	be	AUX
dentistry3000-465	112	27	not	not	PART
dentistry3000-465	112	28	statistically	statistically	ADV
dentistry3000-465	112	29	significant	significant	ADJ
dentistry3000-465	112	30	(	(	PUNCT
dentistry3000-465	112	31	permutations	permutation	NOUN
dentistry3000-465	112	32	=	=	SYM
dentistry3000-465	112	33	999	999	NUM
dentistry3000-465	112	34	,	,	PUNCT
dentistry3000-465	112	35	p	p	NOUN
dentistry3000-465	112	36	-	-	PUNCT
dentistry3000-465	112	37	value	value	NOUN
dentistry3000-465	112	38	=	=	NOUN
dentistry3000-465	112	39	0.219	0.219	NUM
dentistry3000-465	112	40	)	)	PUNCT
dentistry3000-465	112	41	.	.	PUNCT
dentistry3000-465	113	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	113	2	bacterial	bacterial	ADJ
dentistry3000-465	113	3	community	community	NOUN
dentistry3000-465	113	4	in	in	ADP
dentistry3000-465	113	5	dental	dental	ADJ
dentistry3000-465	113	6	biofilms	biofilm	NOUN
dentistry3000-465	113	7	linked	link	VERB
dentistry3000-465	113	8	to	to	ADP
dentistry3000-465	113	9	periodontal	periodontal	ADJ
dentistry3000-465	113	10	disease	disease	NOUN
dentistry3000-465	113	11	:	:	PUNCT
dentistry3000-465	113	12	an	an	DET
dentistry3000-465	113	13	intra	intra	ADJ
dentistry3000-465	113	14	-	-	ADJ
dentistry3000-465	113	15	subject	subject	ADJ
dentistry3000-465	113	16	metagenomics	metagenomics	NOUN
dentistry3000-465	113	17	study	study	NOUN
dentistry3000-465	113	18	vol	vol	NOUN
dentistry3000-465	113	19	12	12	NUM
dentistry3000-465	113	20	no	no	PRON
dentistry3000-465	113	21	1	1	NUM
dentistry3000-465	113	22	(	(	PUNCT
dentistry3000-465	113	23	2024	2024	NUM
dentistry3000-465	113	24	)	)	PUNCT
dentistry3000-465	113	25	doi	doi	NOUN
dentistry3000-465	113	26	10.5195	10.5195	NUM
dentistry3000-465	113	27	/	/	SYM
dentistry3000-465	113	28	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	113	29	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	113	30	figure	figure	NOUN
dentistry3000-465	113	31	1	1	NUM
dentistry3000-465	113	32	.	.	PUNCT
dentistry3000-465	113	33	rarefaction	rarefaction	NOUN
dentistry3000-465	113	34	curve	curve	NOUN
dentistry3000-465	113	35	of	of	ADP
dentistry3000-465	113	36	chao1	chao1	NOUN
dentistry3000-465	113	37	(	(	PUNCT
dentistry3000-465	113	38	a	a	X
dentistry3000-465	113	39	)	)	PUNCT
dentistry3000-465	113	40	and	and	CCONJ
dentistry3000-465	113	41	shannon	shannon	PROPN
dentistry3000-465	113	42	(	(	PUNCT
dentistry3000-465	113	43	b	b	NOUN
dentistry3000-465	113	44	)	)	PUNCT
dentistry3000-465	113	45	of	of	ADP
dentistry3000-465	113	46	gingivitis	gingivitis	NOUN
dentistry3000-465	113	47	and	and	CCONJ
dentistry3000-465	113	48	periodontitis	periodontitis	NOUN
dentistry3000-465	113	49	samples	sample	NOUN
dentistry3000-465	113	50	.	.	PUNCT
dentistry3000-465	114	1	10	10	NUM
dentistry3000-465	114	2	31	31	NUM
dentistry3000-465	114	3	39	39	NUM
dentistry3000-465	114	4	3	3	NUM
dentistry3000-465	114	5	62	62	NUM
dentistry3000-465	114	6	77	77	NUM
dentistry3000-465	114	7	6	6	NUM
dentistry3000-465	114	8	94	94	NUM
dentistry3000-465	114	9	15	15	NUM
dentistry3000-465	114	10	9	9	NUM
dentistry3000-465	114	11	12	12	NUM
dentistry3000-465	114	12	55	55	NUM
dentistry3000-465	114	13	42	42	NUM
dentistry3000-465	114	14	15	15	NUM
dentistry3000-465	114	15	69	69	NUM
dentistry3000-465	114	16	25	25	NUM
dentistry3000-465	114	17	18	18	NUM
dentistry3000-465	114	18	83	83	NUM
dentistry3000-465	114	19	08	08	NUM
dentistry3000-465	114	20	21	21	NUM
dentistry3000-465	114	21	96	96	NUM
dentistry3000-465	114	22	91	91	NUM
dentistry3000-465	114	23	25	25	NUM
dentistry3000-465	114	24	10	10	NUM
dentistry3000-465	114	25	74	74	NUM
dentistry3000-465	114	26	28	28	NUM
dentistry3000-465	114	27	24	24	NUM
dentistry3000-465	114	28	57	57	NUM
dentistry3000-465	114	29	31	31	NUM
dentistry3000-465	114	30	38	38	NUM
dentistry3000-465	114	31	40	40	NUM
dentistry3000-465	114	32	0	0	NUM
dentistry3000-465	114	33	500	500	NUM
dentistry3000-465	114	34	1000	1000	NUM
dentistry3000-465	114	35	1500	1500	NUM
dentistry3000-465	114	36	2000	2000	NUM
dentistry3000-465	114	37	2500	2500	NUM
dentistry3000-465	114	38	sequences	sequence	NOUN
dentistry3000-465	114	39	per	per	ADP
dentistry3000-465	114	40	sample	sample	NOUN
dentistry3000-465	114	41	r	r	PROPN
dentistry3000-465	114	42	ar	ar	PROPN
dentistry3000-465	114	43	ef	ef	PROPN
dentistry3000-465	115	1	ra	ra	PROPN
dentistry3000-465	116	1	ct	ct	PROPN
dentistry3000-465	116	2	io	io	PROPN
dentistry3000-465	116	3	n	n	PROPN
dentistry3000-465	116	4	m	m	PROPN
dentistry3000-465	116	5	ea	ea	X
dentistry3000-465	116	6	su	su	PROPN
dentistry3000-465	116	7	re	re	ADP
dentistry3000-465	116	8	:	:	PUNCT
dentistry3000-465	117	1	c	c	X
dentistry3000-465	117	2	ha	ha	INTJ
dentistry3000-465	117	3	o	o	X
dentistry3000-465	117	4	1	1	NUM
dentistry3000-465	117	5	gingivitis	gingivitis	NOUN
dentistry3000-465	117	6	periodontitis	periodontitis	NOUN
dentistry3000-465	117	7	a	a	DET
dentistry3000-465	117	8	10	10	NUM
dentistry3000-465	117	9	31	31	NUM
dentistry3000-465	117	10	39	39	NUM
dentistry3000-465	117	11	3	3	NUM
dentistry3000-465	117	12	62	62	NUM
dentistry3000-465	117	13	77	77	NUM
dentistry3000-465	117	14	6	6	NUM
dentistry3000-465	117	15	94	94	NUM
dentistry3000-465	117	16	15	15	NUM
dentistry3000-465	117	17	9	9	NUM
dentistry3000-465	117	18	12	12	NUM
dentistry3000-465	117	19	55	55	NUM
dentistry3000-465	117	20	42	42	NUM
dentistry3000-465	117	21	15	15	NUM
dentistry3000-465	117	22	69	69	NUM
dentistry3000-465	117	23	25	25	NUM
dentistry3000-465	117	24	18	18	NUM
dentistry3000-465	117	25	83	83	NUM
dentistry3000-465	117	26	08	08	NUM
dentistry3000-465	117	27	21	21	NUM
dentistry3000-465	117	28	96	96	NUM
dentistry3000-465	117	29	91	91	NUM
dentistry3000-465	117	30	25	25	NUM
dentistry3000-465	117	31	10	10	NUM
dentistry3000-465	117	32	74	74	NUM
dentistry3000-465	117	33	28	28	NUM
dentistry3000-465	117	34	24	24	NUM
dentistry3000-465	117	35	57	57	NUM
dentistry3000-465	117	36	31	31	NUM
dentistry3000-465	117	37	38	38	NUM
dentistry3000-465	117	38	40	40	NUM
dentistry3000-465	117	39	0	0	NUM
dentistry3000-465	117	40	1	1	NUM
dentistry3000-465	117	41	2	2	NUM
dentistry3000-465	117	42	3	3	NUM
dentistry3000-465	117	43	4	4	NUM
dentistry3000-465	117	44	5	5	NUM
dentistry3000-465	117	45	6	6	NUM
dentistry3000-465	117	46	7	7	NUM
dentistry3000-465	117	47	8	8	NUM
dentistry3000-465	117	48	sequences	sequence	NOUN
dentistry3000-465	117	49	per	per	ADP
dentistry3000-465	117	50	sample	sample	NOUN
dentistry3000-465	117	51	r	r	PROPN
dentistry3000-465	117	52	ar	ar	PROPN
dentistry3000-465	117	53	ef	ef	PROPN
dentistry3000-465	117	54	ra	ra	PROPN
dentistry3000-465	117	55	ct	ct	PROPN
dentistry3000-465	117	56	io	io	PROPN
dentistry3000-465	117	57	n	n	PROPN
dentistry3000-465	117	58	m	m	PROPN
dentistry3000-465	117	59	ea	ea	X
dentistry3000-465	117	60	su	su	PROPN
dentistry3000-465	117	61	re	re	ADP
dentistry3000-465	117	62	:	:	PUNCT
dentistry3000-465	117	63	s	s	VERB
dentistry3000-465	117	64	ha	ha	INTJ
dentistry3000-465	117	65	nn	nn	INTJ
dentistry3000-465	117	66	on	on	ADP
dentistry3000-465	117	67	gingivitis	gingivitis	NOUN
dentistry3000-465	117	68	periodontitis	periodontitis	NOUN
dentistry3000-465	117	69	b	b	PROPN
dentistry3000-465	117	70	figure	figure	NOUN
dentistry3000-465	117	71	2	2	NUM
dentistry3000-465	117	72	.	.	PUNCT
dentistry3000-465	118	1	a	a	DET
dentistry3000-465	118	2	3d	3d	PROPN
dentistry3000-465	118	3	pcoa	pcoa	NOUN
dentistry3000-465	118	4	plot	plot	NOUN
dentistry3000-465	118	5	based	base	VERB
dentistry3000-465	118	6	on	on	ADP
dentistry3000-465	118	7	the	the	DET
dentistry3000-465	118	8	weighted	weight	VERB
dentistry3000-465	118	9	unifrac	unifrac	ADJ
dentistry3000-465	118	10	distance	distance	NOUN
dentistry3000-465	118	11	in	in	ADP
dentistry3000-465	118	12	gingivitis	gingivitis	NOUN
dentistry3000-465	118	13	and	and	CCONJ
dentistry3000-465	118	14	periodontitis	periodontitis	NOUN
dentistry3000-465	118	15	samples	sample	NOUN
dentistry3000-465	118	16	.	.	PUNCT
dentistry3000-465	119	1	the	the	DET
dentistry3000-465	119	2	percentage	percentage	NOUN
dentistry3000-465	119	3	of	of	ADP
dentistry3000-465	119	4	variance	variance	NOUN
dentistry3000-465	119	5	along	along	ADP
dentistry3000-465	119	6	each	each	DET
dentistry3000-465	119	7	axis	axis	NOUN
dentistry3000-465	119	8	is	be	AUX
dentistry3000-465	119	9	indicated	indicate	VERB
dentistry3000-465	119	10	in	in	ADP
dentistry3000-465	119	11	brackets	bracket	NOUN
dentistry3000-465	119	12	to	to	PART
dentistry3000-465	119	13	illustrate	illustrate	VERB
dentistry3000-465	119	14	beta	beta	ADJ
dentistry3000-465	119	15	diversity	diversity	NOUN
dentistry3000-465	119	16	.	.	PUNCT
dentistry3000-465	120	1	periodontitis	periodontitis	NOUN
dentistry3000-465	120	2	samples	sample	NOUN
dentistry3000-465	120	3	are	be	AUX
dentistry3000-465	120	4	indicated	indicate	VERB
dentistry3000-465	120	5	by	by	ADP
dentistry3000-465	120	6	blue	blue	ADJ
dentistry3000-465	120	7	dots	dot	NOUN
dentistry3000-465	120	8	,	,	PUNCT
dentistry3000-465	120	9	while	while	SCONJ
dentistry3000-465	120	10	gingivitis	gingivitis	NOUN
dentistry3000-465	120	11	samples	sample	NOUN
dentistry3000-465	120	12	are	be	AUX
dentistry3000-465	120	13	indicated	indicate	VERB
dentistry3000-465	120	14	by	by	ADP
dentistry3000-465	120	15	red	red	ADJ
dentistry3000-465	120	16	dots	dot	NOUN
dentistry3000-465	120	17	.	.	PUNCT
dentistry3000-465	121	1	pc2	pc2	PROPN
dentistry3000-465	121	2	(	(	PUNCT
dentistry3000-465	121	3	23.09	23.09	NUM
dentistry3000-465	121	4	%	%	NOUN
dentistry3000-465	121	5	)	)	PUNCT
dentistry3000-465	121	6	pc3	pc3	PROPN
dentistry3000-465	121	7	(	(	PUNCT
dentistry3000-465	121	8	13.29	13.29	NUM
dentistry3000-465	121	9	%	%	NOUN
dentistry3000-465	121	10	)	)	PUNCT
dentistry3000-465	121	11	pc1	pc1	PROPN
dentistry3000-465	121	12	(	(	PUNCT
dentistry3000-465	121	13	27.59	27.59	NUM
dentistry3000-465	121	14	%	%	NOUN
dentistry3000-465	121	15	)	)	PUNCT
dentistry3000-465	121	16	taxa	taxa	NOUN
dentistry3000-465	121	17	abundance	abundance	NOUN
dentistry3000-465	121	18	analysis	analysis	NOUN
dentistry3000-465	121	19	the	the	DET
dentistry3000-465	121	20	taxonomic	taxonomic	ADJ
dentistry3000-465	121	21	community	community	NOUN
dentistry3000-465	121	22	analysis	analysis	NOUN
dentistry3000-465	121	23	revealed	reveal	VERB
dentistry3000-465	121	24	the	the	DET
dentistry3000-465	121	25	presence	presence	NOUN
dentistry3000-465	121	26	of	of	ADP
dentistry3000-465	121	27	287	287	NUM
dentistry3000-465	121	28	known	know	VERB
dentistry3000-465	121	29	species	specie	NOUN
dentistry3000-465	121	30	in	in	ADP
dentistry3000-465	121	31	gingivitis	gingivitis	NOUN
dentistry3000-465	121	32	and	and	CCONJ
dentistry3000-465	121	33	periodontitis	periodontitis	NOUN
dentistry3000-465	121	34	sites	site	NOUN
dentistry3000-465	121	35	.	.	PUNCT
dentistry3000-465	122	1	among	among	ADP
dentistry3000-465	122	2	them	they	PRON
dentistry3000-465	122	3	,	,	PUNCT
dentistry3000-465	122	4	56	56	NUM
dentistry3000-465	122	5	species	specie	NOUN
dentistry3000-465	122	6	were	be	AUX
dentistry3000-465	122	7	taxonomically	taxonomically	ADV
dentistry3000-465	122	8	recognised	recognise	VERB
dentistry3000-465	122	9	.	.	PUNCT
dentistry3000-465	123	1	after	after	ADP
dentistry3000-465	123	2	excluding	exclude	VERB
dentistry3000-465	123	3	those	those	PRON
dentistry3000-465	123	4	with	with	ADP
dentistry3000-465	123	5	less	less	ADJ
dentistry3000-465	123	6	than	than	ADP
dentistry3000-465	123	7	0.1	0.1	NUM
dentistry3000-465	123	8	%	%	NOUN
dentistry3000-465	123	9	relative	relative	ADJ
dentistry3000-465	123	10	abundances	abundance	NOUN
dentistry3000-465	123	11	,	,	PUNCT
dentistry3000-465	123	12	only	only	ADV
dentistry3000-465	123	13	26	26	NUM
dentistry3000-465	123	14	species	specie	NOUN
dentistry3000-465	123	15	were	be	AUX
dentistry3000-465	123	16	included	include	VERB
dentistry3000-465	123	17	in	in	ADP
dentistry3000-465	123	18	the	the	DET
dentistry3000-465	123	19	analysis	analysis	NOUN
dentistry3000-465	123	20	.	.	PUNCT
dentistry3000-465	124	1	top	top	ADJ
dentistry3000-465	124	2	abundant	abundant	ADJ
dentistry3000-465	124	3	species	specie	NOUN
dentistry3000-465	124	4	prevotella	prevotella	NOUN
dentistry3000-465	124	5	intermedia	intermedia	PROPN
dentistry3000-465	124	6	(	(	PUNCT
dentistry3000-465	124	7	p.	p.	NOUN
dentistry3000-465	124	8	intermedia	intermedia	PROPN
dentistry3000-465	124	9	)	)	PUNCT
dentistry3000-465	124	10	,	,	PUNCT
dentistry3000-465	124	11	veillonella	veillonella	NOUN
dentistry3000-465	124	12	dispar	dispar	PROPN
dentistry3000-465	124	13	(	(	PUNCT
dentistry3000-465	124	14	v.	v.	ADP
dentistry3000-465	124	15	dispar	dispar	PROPN
dentistry3000-465	124	16	)	)	PUNCT
dentistry3000-465	124	17	,	,	PUNCT
dentistry3000-465	124	18	rothia	rothia	VERB
dentistry3000-465	124	19	dentocariosa	dentocariosa	PROPN
dentistry3000-465	124	20	(	(	PUNCT
dentistry3000-465	124	21	r.	r.	PROPN
dentistry3000-465	124	22	dentocariosa	dentocariosa	PROPN
dentistry3000-465	124	23	)	)	PUNCT
dentistry3000-465	124	24	,	,	PUNCT
dentistry3000-465	124	25	and	and	CCONJ
dentistry3000-465	124	26	porphyromonas	porphyromona	NOUN
dentistry3000-465	124	27	endodontalis	endodontalis	VERB
dentistry3000-465	124	28	(	(	PUNCT
dentistry3000-465	124	29	p.	p.	NOUN
dentistry3000-465	124	30	endodontalis	endodontalis	PROPN
dentistry3000-465	124	31	)	)	PUNCT
dentistry3000-465	124	32	were	be	AUX
dentistry3000-465	124	33	the	the	DET
dentistry3000-465	124	34	most	most	ADV
dentistry3000-465	124	35	abundant	abundant	ADJ
dentistry3000-465	124	36	species	specie	NOUN
dentistry3000-465	124	37	in	in	ADP
dentistry3000-465	124	38	gingivitis	gingivitis	NOUN
dentistry3000-465	124	39	and	and	CCONJ
dentistry3000-465	124	40	periodontitis	periodontitis	NOUN
dentistry3000-465	124	41	sites	site	NOUN
dentistry3000-465	124	42	.	.	PUNCT
dentistry3000-465	125	1	among	among	ADP
dentistry3000-465	125	2	these	these	PRON
dentistry3000-465	125	3	,	,	PUNCT
dentistry3000-465	125	4	v.	v.	ADP
dentistry3000-465	125	5	dispar	dispar	PROPN
dentistry3000-465	125	6	were	be	AUX
dentistry3000-465	125	7	present	present	ADJ
dentistry3000-465	125	8	in	in	ADP
dentistry3000-465	125	9	the	the	DET
dentistry3000-465	125	10	greatest	great	ADJ
dentistry3000-465	125	11	abundance	abundance	NOUN
dentistry3000-465	125	12	(	(	PUNCT
dentistry3000-465	125	13	28.4	28.4	NUM
dentistry3000-465	125	14	%	%	NOUN
dentistry3000-465	125	15	)	)	PUNCT
dentistry3000-465	125	16	in	in	ADP
dentistry3000-465	125	17	periodontitis	periodontitis	NOUN
dentistry3000-465	125	18	sites	site	NOUN
dentistry3000-465	125	19	,	,	PUNCT
dentistry3000-465	125	20	followed	follow	VERB
dentistry3000-465	125	21	by	by	ADP
dentistry3000-465	125	22	p.	p.	PROPN
dentistry3000-465	125	23	melaninogenica	melaninogenica	PROPN
dentistry3000-465	125	24	(	(	PUNCT
dentistry3000-465	125	25	13.95	13.95	NUM
dentistry3000-465	125	26	)	)	PUNCT
dentistry3000-465	125	27	and	and	CCONJ
dentistry3000-465	125	28	p.	p.	PROPN
dentistry3000-465	125	29	intermedia	intermedia	PROPN
dentistry3000-465	125	30	(	(	PUNCT
dentistry3000-465	125	31	12.9	12.9	NUM
dentistry3000-465	125	32	%	%	NOUN
dentistry3000-465	125	33	)	)	PUNCT
dentistry3000-465	125	34	.	.	PUNCT
dentistry3000-465	126	1	p.	p.	NOUN
dentistry3000-465	126	2	intermedia	intermedia	PROPN
dentistry3000-465	126	3	were	be	AUX
dentistry3000-465	126	4	the	the	DET
dentistry3000-465	126	5	most	most	ADV
dentistry3000-465	126	6	prevalent	prevalent	ADJ
dentistry3000-465	126	7	(	(	PUNCT
dentistry3000-465	126	8	22.2	22.2	NUM
dentistry3000-465	126	9	%	%	NOUN
dentistry3000-465	126	10	)	)	PUNCT
dentistry3000-465	126	11	in	in	ADP
dentistry3000-465	126	12	gingivitis	gingivitis	NOUN
dentistry3000-465	126	13	sites	site	NOUN
dentistry3000-465	126	14	,	,	PUNCT
dentistry3000-465	126	15	followed	follow	VERB
dentistry3000-465	126	16	by	by	ADP
dentistry3000-465	126	17	v.	v.	ADP
dentistry3000-465	126	18	dispar	dispar	PROPN
dentistry3000-465	126	19	(	(	PUNCT
dentistry3000-465	126	20	16.2	16.2	NUM
dentistry3000-465	126	21	%	%	NOUN
dentistry3000-465	126	22	)	)	PUNCT
dentistry3000-465	126	23	and	and	CCONJ
dentistry3000-465	126	24	r.	r.	PROPN
dentistry3000-465	126	25	dentocariosa	dentocariosa	PROPN
dentistry3000-465	126	26	(	(	PUNCT
dentistry3000-465	126	27	15.3	15.3	NUM
dentistry3000-465	126	28	%	%	NOUN
dentistry3000-465	126	29	)	)	PUNCT
dentistry3000-465	126	30	.	.	PUNCT
dentistry3000-465	127	1	figure	figure	NOUN
dentistry3000-465	127	2	4	4	NUM
dentistry3000-465	127	3	compares	compare	VERB
dentistry3000-465	127	4	the	the	DET
dentistry3000-465	127	5	abundance	abundance	NOUN
dentistry3000-465	127	6	of	of	ADP
dentistry3000-465	127	7	26	26	NUM
dentistry3000-465	127	8	bacterial	bacterial	ADJ
dentistry3000-465	127	9	species	specie	NOUN
dentistry3000-465	127	10	in	in	ADP
dentistry3000-465	127	11	gingivitis	gingivitis	NOUN
dentistry3000-465	127	12	and	and	CCONJ
dentistry3000-465	127	13	periodontitis	periodontitis	NOUN
dentistry3000-465	127	14	sites	site	NOUN
dentistry3000-465	127	15	.	.	PUNCT
dentistry3000-465	128	1	comparing	compare	VERB
dentistry3000-465	128	2	gingivitis	gingivitis	NOUN
dentistry3000-465	128	3	and	and	CCONJ
dentistry3000-465	128	4	periodontitis	periodontitis	NOUN
dentistry3000-465	128	5	sites	site	NOUN
dentistry3000-465	128	6	reveals	reveal	VERB
dentistry3000-465	128	7	a	a	DET
dentistry3000-465	128	8	change	change	NOUN
dentistry3000-465	128	9	in	in	ADP
dentistry3000-465	128	10	bacterial	bacterial	ADJ
dentistry3000-465	128	11	species	specie	NOUN
dentistry3000-465	128	12	abundance	abundance	NOUN
dentistry3000-465	128	13	,	,	PUNCT
dentistry3000-465	128	14	either	either	CCONJ
dentistry3000-465	128	15	an	an	DET
dentistry3000-465	128	16	increase	increase	NOUN
dentistry3000-465	128	17	or	or	CCONJ
dentistry3000-465	128	18	a	a	DET
dentistry3000-465	128	19	decrease	decrease	NOUN
dentistry3000-465	128	20	.	.	PUNCT
dentistry3000-465	129	1	there	there	PRON
dentistry3000-465	129	2	was	be	VERB
dentistry3000-465	129	3	,	,	PUNCT
dentistry3000-465	129	4	however	however	ADV
dentistry3000-465	129	5	,	,	PUNCT
dentistry3000-465	129	6	no	no	DET
dentistry3000-465	129	7	statistically	statistically	ADV
dentistry3000-465	129	8	significant	significant	ADJ
dentistry3000-465	129	9	difference	difference	NOUN
dentistry3000-465	129	10	.	.	PUNCT
dentistry3000-465	130	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	130	2	bacterial	bacterial	ADJ
dentistry3000-465	130	3	community	community	NOUN
dentistry3000-465	130	4	in	in	ADP
dentistry3000-465	130	5	dental	dental	ADJ
dentistry3000-465	130	6	biofilms	biofilm	NOUN
dentistry3000-465	130	7	linked	link	VERB
dentistry3000-465	130	8	to	to	ADP
dentistry3000-465	130	9	periodontal	periodontal	ADJ
dentistry3000-465	130	10	disease	disease	NOUN
dentistry3000-465	130	11	:	:	PUNCT
dentistry3000-465	130	12	an	an	DET
dentistry3000-465	130	13	intra	intra	ADJ
dentistry3000-465	130	14	-	-	ADJ
dentistry3000-465	130	15	subject	subject	ADJ
dentistry3000-465	130	16	metagenomics	metagenomics	NOUN
dentistry3000-465	130	17	study	study	NOUN
dentistry3000-465	130	18	vol	vol	NOUN
dentistry3000-465	130	19	12	12	NUM
dentistry3000-465	130	20	no	no	PRON
dentistry3000-465	130	21	1	1	NUM
dentistry3000-465	130	22	(	(	PUNCT
dentistry3000-465	130	23	2024	2024	NUM
dentistry3000-465	130	24	)	)	PUNCT
dentistry3000-465	130	25	doi	doi	NOUN
dentistry3000-465	130	26	10.5195	10.5195	NUM
dentistry3000-465	130	27	/	/	SYM
dentistry3000-465	130	28	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	130	29	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	130	30	figure	figure	NOUN
dentistry3000-465	130	31	3	3	NUM
dentistry3000-465	130	32	.	.	NUM
dentistry3000-465	130	33	weighed	weigh	VERB
dentistry3000-465	130	34	unifrac	unifrac	ADJ
dentistry3000-465	130	35	-	-	PUNCT
dentistry3000-465	130	36	based	base	VERB
dentistry3000-465	130	37	hierarchical	hierarchical	ADJ
dentistry3000-465	130	38	clustering	clustering	NOUN
dentistry3000-465	130	39	of	of	ADP
dentistry3000-465	130	40	gingivitis	gingivitis	NOUN
dentistry3000-465	130	41	(	(	PUNCT
dentistry3000-465	130	42	g	g	NOUN
dentistry3000-465	130	43	)	)	PUNCT
dentistry3000-465	130	44	(	(	PUNCT
dentistry3000-465	130	45	n	n	NOUN
dentistry3000-465	130	46	=	=	SYM
dentistry3000-465	130	47	16	16	NUM
dentistry3000-465	130	48	)	)	PUNCT
dentistry3000-465	130	49	and	and	CCONJ
dentistry3000-465	130	50	periodontitis	periodontitis	NOUN
dentistry3000-465	130	51	(	(	PUNCT
dentistry3000-465	130	52	p	p	NOUN
dentistry3000-465	130	53	)	)	PUNCT
dentistry3000-465	130	54	(	(	PUNCT
dentistry3000-465	130	55	n	n	NOUN
dentistry3000-465	130	56	=	=	SYM
dentistry3000-465	130	57	14	14	NUM
dentistry3000-465	130	58	)	)	PUNCT
dentistry3000-465	130	59	samples	sample	NOUN
dentistry3000-465	130	60	.	.	PUNCT
dentistry3000-465	131	1	distance	distance	NOUN
dentistry3000-465	131	2	=	=	PRON
dentistry3000-465	131	3	weighted	weight	VERB
dentistry3000-465	131	4	unifrac	unifrac	ADJ
dentistry3000-465	131	5	value	value	NOUN
dentistry3000-465	131	6	.	.	PUNCT
dentistry3000-465	132	1	discussion	discussion	NOUN
dentistry3000-465	132	2	alpha	alpha	NOUN
dentistry3000-465	132	3	diversity	diversity	NOUN
dentistry3000-465	132	4	the	the	DET
dentistry3000-465	132	5	values	value	NOUN
dentistry3000-465	132	6	of	of	ADP
dentistry3000-465	132	7	alpha	alpha	NOUN
dentistry3000-465	132	8	diversity	diversity	NOUN
dentistry3000-465	132	9	(	(	PUNCT
dentistry3000-465	132	10	richness	richness	NOUN
dentistry3000-465	132	11	estimator	estimator	NOUN
dentistry3000-465	132	12	chao1	chao1	PROPN
dentistry3000-465	132	13	and	and	CCONJ
dentistry3000-465	132	14	shannon	shannon	PROPN
dentistry3000-465	132	15	)	)	PUNCT
dentistry3000-465	132	16	revealed	reveal	VERB
dentistry3000-465	132	17	a	a	DET
dentistry3000-465	132	18	trend	trend	NOUN
dentistry3000-465	132	19	of	of	ADP
dentistry3000-465	132	20	increase	increase	NOUN
dentistry3000-465	132	21	in	in	ADP
dentistry3000-465	132	22	periodontitis	periodontitis	NOUN
dentistry3000-465	132	23	samples	sample	NOUN
dentistry3000-465	132	24	compared	compare	VERB
dentistry3000-465	132	25	to	to	ADP
dentistry3000-465	132	26	gingivitis	gingivitis	NOUN
dentistry3000-465	132	27	samples	sample	NOUN
dentistry3000-465	132	28	,	,	PUNCT
dentistry3000-465	132	29	although	although	SCONJ
dentistry3000-465	132	30	the	the	DET
dentistry3000-465	132	31	difference	difference	NOUN
dentistry3000-465	132	32	was	be	AUX
dentistry3000-465	132	33	not	not	PART
dentistry3000-465	132	34	statistically	statistically	ADV
dentistry3000-465	132	35	significant	significant	ADJ
dentistry3000-465	132	36	.	.	PUNCT
dentistry3000-465	133	1	this	this	PRON
dentistry3000-465	133	2	is	be	AUX
dentistry3000-465	133	3	consistent	consistent	ADJ
dentistry3000-465	133	4	with	with	ADP
dentistry3000-465	133	5	a	a	DET
dentistry3000-465	133	6	previous	previous	ADJ
dentistry3000-465	133	7	study	study	NOUN
dentistry3000-465	133	8	which	which	PRON
dentistry3000-465	133	9	found	find	VERB
dentistry3000-465	133	10	no	no	DET
dentistry3000-465	133	11	statistically	statistically	ADV
dentistry3000-465	133	12	significant	significant	ADJ
dentistry3000-465	133	13	difference	difference	NOUN
dentistry3000-465	133	14	in	in	ADP
dentistry3000-465	133	15	shannon	shannon	PROPN
dentistry3000-465	133	16	values	value	NOUN
dentistry3000-465	133	17	between	between	ADP
dentistry3000-465	133	18	healthy	healthy	ADJ
dentistry3000-465	133	19	,	,	PUNCT
dentistry3000-465	133	20	gingivitis	gingivitis	NOUN
dentistry3000-465	133	21	,	,	PUNCT
dentistry3000-465	133	22	and	and	CCONJ
dentistry3000-465	133	23	periodontitis	periodontitis	NOUN
dentistry3000-465	133	24	sites	site	NOUN
dentistry3000-465	133	25	in	in	ADP
dentistry3000-465	133	26	the	the	DET
dentistry3000-465	133	27	same	same	ADJ
dentistry3000-465	133	28	individual	individual	NOUN
dentistry3000-465	133	29	[	[	X
dentistry3000-465	133	30	4	4	NUM
dentistry3000-465	133	31	]	]	PUNCT
dentistry3000-465	133	32	.	.	PUNCT
dentistry3000-465	134	1	even	even	ADV
dentistry3000-465	134	2	in	in	ADP
dentistry3000-465	134	3	the	the	DET
dentistry3000-465	134	4	intersubject	intersubject	ADJ
dentistry3000-465	134	5	study	study	NOUN
dentistry3000-465	134	6	,	,	PUNCT
dentistry3000-465	134	7	the	the	DET
dentistry3000-465	134	8	species	specie	NOUN
dentistry3000-465	134	9	evenness	evenness	NOUN
dentistry3000-465	134	10	between	between	ADP
dentistry3000-465	134	11	healthy	healthy	ADJ
dentistry3000-465	134	12	and	and	CCONJ
dentistry3000-465	134	13	diseased	diseased	ADJ
dentistry3000-465	134	14	periodontal	periodontal	ADJ
dentistry3000-465	134	15	sites	site	NOUN
dentistry3000-465	134	16	was	be	AUX
dentistry3000-465	134	17	reported	report	VERB
dentistry3000-465	134	18	to	to	PART
dentistry3000-465	134	19	be	be	AUX
dentistry3000-465	134	20	not	not	PART
dentistry3000-465	134	21	significantly	significantly	ADV
dentistry3000-465	134	22	different	different	ADJ
dentistry3000-465	134	23	[	[	X
dentistry3000-465	134	24	16–18	16–18	NUM
dentistry3000-465	134	25	]	]	PUNCT
dentistry3000-465	134	26	.	.	PUNCT
dentistry3000-465	135	1	however	however	ADV
dentistry3000-465	135	2	,	,	PUNCT
dentistry3000-465	135	3	previous	previous	ADJ
dentistry3000-465	135	4	studies	study	NOUN
dentistry3000-465	135	5	also	also	ADV
dentistry3000-465	135	6	revealed	reveal	VERB
dentistry3000-465	135	7	contradictory	contradictory	ADJ
dentistry3000-465	135	8	results	result	NOUN
dentistry3000-465	135	9	,	,	PUNCT
dentistry3000-465	135	10	showing	show	VERB
dentistry3000-465	135	11	that	that	SCONJ
dentistry3000-465	135	12	sites	site	NOUN
dentistry3000-465	135	13	with	with	ADP
dentistry3000-465	135	14	periodontitis	periodontitis	NOUN
dentistry3000-465	135	15	had	have	VERB
dentistry3000-465	135	16	statistically	statistically	ADV
dentistry3000-465	135	17	greater	great	ADJ
dentistry3000-465	135	18	microbial	microbial	ADJ
dentistry3000-465	135	19	diversity	diversity	NOUN
dentistry3000-465	135	20	and	and	CCONJ
dentistry3000-465	135	21	evenness	evenness	NOUN
dentistry3000-465	135	22	than	than	ADP
dentistry3000-465	135	23	healthy	healthy	ADJ
dentistry3000-465	135	24	sites	site	NOUN
dentistry3000-465	135	25	[	[	X
dentistry3000-465	135	26	3	3	NUM
dentistry3000-465	135	27	]	]	PUNCT
dentistry3000-465	135	28	.	.	PUNCT
dentistry3000-465	136	1	another	another	DET
dentistry3000-465	136	2	study	study	NOUN
dentistry3000-465	136	3	reported	report	VERB
dentistry3000-465	136	4	significantly	significantly	ADV
dentistry3000-465	136	5	higher	high	ADJ
dentistry3000-465	136	6	evenness	evenness	NOUN
dentistry3000-465	136	7	in	in	ADP
dentistry3000-465	136	8	the	the	DET
dentistry3000-465	136	9	periodontitis	periodontitis	NOUN
dentistry3000-465	136	10	group	group	NOUN
dentistry3000-465	136	11	than	than	ADP
dentistry3000-465	136	12	in	in	ADP
dentistry3000-465	136	13	the	the	DET
dentistry3000-465	136	14	healthy	healthy	ADJ
dentistry3000-465	136	15	group	group	NOUN
dentistry3000-465	136	16	.	.	PUNCT
dentistry3000-465	137	1	however	however	ADV
dentistry3000-465	137	2	bacterial	bacterial	ADJ
dentistry3000-465	137	3	community	community	NOUN
dentistry3000-465	137	4	diversity	diversity	NOUN
dentistry3000-465	137	5	was	be	AUX
dentistry3000-465	137	6	not	not	PART
dentistry3000-465	137	7	significant	significant	ADJ
dentistry3000-465	137	8	[	[	X
dentistry3000-465	137	9	19	19	NUM
dentistry3000-465	137	10	]	]	PUNCT
dentistry3000-465	137	11	.	.	PUNCT
dentistry3000-465	138	1	high	high	ADJ
dentistry3000-465	138	2	bacterial	bacterial	ADJ
dentistry3000-465	138	3	community	community	NOUN
dentistry3000-465	138	4	diversity	diversity	NOUN
dentistry3000-465	138	5	in	in	ADP
dentistry3000-465	138	6	periodontal	periodontal	ADJ
dentistry3000-465	138	7	disease	disease	NOUN
dentistry3000-465	138	8	sites	site	NOUN
dentistry3000-465	138	9	may	may	AUX
dentistry3000-465	138	10	result	result	VERB
dentistry3000-465	138	11	from	from	ADP
dentistry3000-465	138	12	a	a	DET
dentistry3000-465	138	13	nutritionally	nutritionally	ADV
dentistry3000-465	138	14	richer	rich	ADJ
dentistry3000-465	138	15	environment	environment	NOUN
dentistry3000-465	138	16	or	or	CCONJ
dentistry3000-465	138	17	a	a	DET
dentistry3000-465	138	18	diminished	diminish	VERB
dentistry3000-465	138	19	immunological	immunological	ADJ
dentistry3000-465	138	20	competence	competence	NOUN
dentistry3000-465	138	21	[	[	X
dentistry3000-465	138	22	3	3	NUM
dentistry3000-465	138	23	]	]	PUNCT
dentistry3000-465	138	24	.	.	PUNCT
dentistry3000-465	139	1	although	although	SCONJ
dentistry3000-465	139	2	alpha	alpha	NOUN
dentistry3000-465	139	3	diversity	diversity	NOUN
dentistry3000-465	139	4	can	can	AUX
dentistry3000-465	139	5	be	be	AUX
dentistry3000-465	139	6	a	a	DET
dentistry3000-465	139	7	good	good	ADJ
dentistry3000-465	139	8	predictor	predictor	NOUN
dentistry3000-465	139	9	of	of	ADP
dentistry3000-465	139	10	disease	disease	NOUN
dentistry3000-465	139	11	-	-	PUNCT
dentistry3000-465	139	12	associated	associate	VERB
dentistry3000-465	139	13	dysbiosis	dysbiosis	NOUN
dentistry3000-465	139	14	,	,	PUNCT
dentistry3000-465	139	15	which	which	PRON
dentistry3000-465	139	16	could	could	AUX
dentistry3000-465	139	17	be	be	AUX
dentistry3000-465	139	18	the	the	DET
dentistry3000-465	139	19	cause	cause	NOUN
dentistry3000-465	139	20	of	of	ADP
dentistry3000-465	139	21	periodontal	periodontal	ADJ
dentistry3000-465	139	22	disease	disease	NOUN
dentistry3000-465	139	23	[	[	X
dentistry3000-465	139	24	20	20	NUM
dentistry3000-465	139	25	]	]	PUNCT
dentistry3000-465	139	26	,	,	PUNCT
dentistry3000-465	139	27	our	our	PRON
dentistry3000-465	139	28	findings	finding	NOUN
dentistry3000-465	139	29	do	do	AUX
dentistry3000-465	139	30	not	not	PART
dentistry3000-465	139	31	appear	appear	VERB
dentistry3000-465	139	32	to	to	PART
dentistry3000-465	139	33	support	support	VERB
dentistry3000-465	139	34	the	the	DET
dentistry3000-465	139	35	role	role	NOUN
dentistry3000-465	139	36	of	of	ADP
dentistry3000-465	139	37	bacterial	bacterial	ADJ
dentistry3000-465	139	38	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	139	39	bacterial	bacterial	ADJ
dentistry3000-465	139	40	community	community	NOUN
dentistry3000-465	139	41	in	in	ADP
dentistry3000-465	139	42	dental	dental	ADJ
dentistry3000-465	139	43	biofilms	biofilm	NOUN
dentistry3000-465	139	44	linked	link	VERB
dentistry3000-465	139	45	to	to	ADP
dentistry3000-465	139	46	periodontal	periodontal	ADJ
dentistry3000-465	139	47	disease	disease	NOUN
dentistry3000-465	139	48	:	:	PUNCT
dentistry3000-465	139	49	an	an	DET
dentistry3000-465	139	50	intra	intra	ADJ
dentistry3000-465	139	51	-	-	ADJ
dentistry3000-465	139	52	subject	subject	ADJ
dentistry3000-465	139	53	metagenomics	metagenomics	NOUN
dentistry3000-465	139	54	study	study	NOUN
dentistry3000-465	139	55	vol	vol	NOUN
dentistry3000-465	139	56	12	12	NUM
dentistry3000-465	139	57	no	no	PRON
dentistry3000-465	139	58	1	1	NUM
dentistry3000-465	139	59	(	(	PUNCT
dentistry3000-465	139	60	2024	2024	NUM
dentistry3000-465	139	61	)	)	PUNCT
dentistry3000-465	139	62	doi	doi	NOUN
dentistry3000-465	139	63	10.5195	10.5195	NUM
dentistry3000-465	139	64	/	/	SYM
dentistry3000-465	139	65	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	139	66	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	139	67	0	0	NUM
dentistry3000-465	139	68	5	5	NUM
dentistry3000-465	139	69	10	10	NUM
dentistry3000-465	139	70	15	15	NUM
dentistry3000-465	139	71	20	20	NUM
dentistry3000-465	139	72	veillonella	veillonella	NOUN
dentistry3000-465	139	73	parvula	parvula	NOUN
dentistry3000-465	139	74	prevotella	prevotella	NOUN
dentistry3000-465	139	75	pallens	pallen	NOUN
dentistry3000-465	139	76	prevotella	prevotella	NOUN
dentistry3000-465	139	77	nanceinsis	nanceinsis	PROPN
dentistry3000-465	139	78	lactobacillus	lactobacillus	PROPN
dentistry3000-465	139	79	ruminis	ruminis	PROPN
dentistry3000-465	139	80	anoxybacillus	anoxybacillus	PROPN
dentistry3000-465	139	81	kestanbolensis	kestanbolensis	PROPN
dentistry3000-465	139	82	actinobacillus	actinobacillus	PROPN
dentistry3000-465	139	83	parahaemolyticus	parahaemolyticus	PROPN
dentistry3000-465	139	84	faecalibacterium	faecalibacterium	NOUN
dentistry3000-465	139	85	prausnitzii	prausnitzii	ADJ
dentistry3000-465	139	86	bacillus	bacillus	NOUN
dentistry3000-465	139	87	thermoamylovorans	thermoamylovoran	NOUN
dentistry3000-465	139	88	haemophilus	haemophilus	PROPN
dentistry3000-465	139	89	influenzae	influenzae	X
dentistry3000-465	139	90	haemophilus	haemophilus	ADJ
dentistry3000-465	139	91	parainfluenzae	parainfluenzae	VERB
dentistry3000-465	139	92	streptococcus	streptococcus	VERB
dentistry3000-465	139	93	anginosus	anginosus	PROPN
dentistry3000-465	139	94	prevotella	prevotella	NOUN
dentistry3000-465	139	95	copri	copri	PROPN
dentistry3000-465	139	96	rothia	rothia	VERB
dentistry3000-465	139	97	aeria	aeria	PROPN
dentistry3000-465	139	98	treponema	treponema	PROPN
dentistry3000-465	139	99	amylovorum	amylovorum	PROPN
dentistry3000-465	139	100	selenomonas	selenomonas	PROPN
dentistry3000-465	139	101	noxia	noxia	NOUN
dentistry3000-465	139	102	prevotella	prevotella	NOUN
dentistry3000-465	139	103	nigrescens	nigrescen	NOUN
dentistry3000-465	139	104	prevotella	prevotella	NOUN
dentistry3000-465	139	105	tannerae	tannerae	NOUN
dentistry3000-465	139	106	treponema	treponema	VERB
dentistry3000-465	139	107	socranskii	socranskii	ADJ
dentistry3000-465	139	108	prevotella	prevotella	NOUN
dentistry3000-465	139	109	melaninogenica	melaninogenica	ADJ
dentistry3000-465	139	110	rothia	rothia	PROPN
dentistry3000-465	139	111	mucilaginosa	mucilaginosa	PROPN
dentistry3000-465	139	112	aggregatibacter	aggregatibacter	PROPN
dentistry3000-465	139	113	segnis	segnis	PROPN
dentistry3000-465	139	114	capnocytophaga	capnocytophaga	PROPN
dentistry3000-465	139	115	ochracea	ochracea	PROPN
dentistry3000-465	139	116	porphyromonas	porphyromona	NOUN
dentistry3000-465	139	117	endodontalis	endodontalis	AUX
dentistry3000-465	139	118	rothia	rothia	VERB
dentistry3000-465	139	119	dentocariosa	dentocariosa	PROPN
dentistry3000-465	139	120	veillonella	veillonella	PROPN
dentistry3000-465	139	121	dispar	dispar	PROPN
dentistry3000-465	139	122	prevotella	prevotella	NOUN
dentistry3000-465	139	123	intermedia	intermedia	PROPN
dentistry3000-465	139	124	20	20	NUM
dentistry3000-465	139	125	25	25	NUM
dentistry3000-465	139	126	30	30	NUM
dentistry3000-465	139	127	35	35	NUM
dentistry3000-465	139	128	40	40	NUM
dentistry3000-465	139	129	relative	relative	ADJ
dentistry3000-465	139	130	abundance	abundance	NOUN
dentistry3000-465	139	131	(	(	PUNCT
dentistry3000-465	139	132	%	%	INTJ
dentistry3000-465	139	133	)	)	PUNCT
dentistry3000-465	139	134	sp	sp	ADP
dentistry3000-465	139	135	ec	ec	PROPN
dentistry3000-465	139	136	ie	ie	X
dentistry3000-465	139	137	s	s	PROPN
dentistry3000-465	139	138	gingivitis	gingivitis	NOUN
dentistry3000-465	139	139	periodontitis	periodontitis	NOUN
dentistry3000-465	139	140	community	community	NOUN
dentistry3000-465	139	141	diversity	diversity	NOUN
dentistry3000-465	139	142	in	in	ADP
dentistry3000-465	139	143	the	the	DET
dentistry3000-465	139	144	progression	progression	NOUN
dentistry3000-465	139	145	of	of	ADP
dentistry3000-465	139	146	gingivitis	gingivitis	NOUN
dentistry3000-465	139	147	to	to	ADP
dentistry3000-465	139	148	periodontitis	periodontitis	NOUN
dentistry3000-465	139	149	.	.	PUNCT
dentistry3000-465	140	1	beta	beta	NOUN
dentistry3000-465	140	2	diversity	diversity	NOUN
dentistry3000-465	140	3	based	base	VERB
dentistry3000-465	140	4	on	on	ADP
dentistry3000-465	140	5	weighted	weight	VERB
dentistry3000-465	140	6	unifrac	unifrac	ADJ
dentistry3000-465	140	7	distances	distance	NOUN
dentistry3000-465	140	8	,	,	PUNCT
dentistry3000-465	140	9	the	the	DET
dentistry3000-465	140	10	pcoa	pcoa	NOUN
dentistry3000-465	140	11	graph	graph	NOUN
dentistry3000-465	140	12	presented	present	VERB
dentistry3000-465	140	13	with	with	ADP
dentistry3000-465	140	14	no	no	DET
dentistry3000-465	140	15	distinctive	distinctive	ADJ
dentistry3000-465	140	16	cluster	cluster	NOUN
dentistry3000-465	140	17	of	of	ADP
dentistry3000-465	140	18	gingivitis	gingivitis	NOUN
dentistry3000-465	140	19	and	and	CCONJ
dentistry3000-465	140	20	periodontitis	periodontitis	NOUN
dentistry3000-465	140	21	samples	sample	NOUN
dentistry3000-465	140	22	.	.	PUNCT
dentistry3000-465	141	1	the	the	DET
dentistry3000-465	141	2	hierarchical	hierarchical	ADJ
dentistry3000-465	141	3	clustering	clustering	NOUN
dentistry3000-465	141	4	graph	graph	NOUN
dentistry3000-465	141	5	showed	show	VERB
dentistry3000-465	141	6	that	that	SCONJ
dentistry3000-465	141	7	certain	certain	ADJ
dentistry3000-465	141	8	samples	sample	NOUN
dentistry3000-465	141	9	from	from	ADP
dentistry3000-465	141	10	a	a	DET
dentistry3000-465	141	11	single	single	ADJ
dentistry3000-465	141	12	subject	subject	NOUN
dentistry3000-465	141	13	exhibited	exhibit	VERB
dentistry3000-465	141	14	similarity	similarity	NOUN
dentistry3000-465	141	15	,	,	PUNCT
dentistry3000-465	141	16	while	while	SCONJ
dentistry3000-465	141	17	most	most	ADJ
dentistry3000-465	141	18	samples	sample	NOUN
dentistry3000-465	141	19	exhibited	exhibit	VERB
dentistry3000-465	141	20	dissimilarity	dissimilarity	NOUN
dentistry3000-465	141	21	.	.	PUNCT
dentistry3000-465	142	1	there	there	PRON
dentistry3000-465	142	2	was	be	VERB
dentistry3000-465	142	3	no	no	DET
dentistry3000-465	142	4	study	study	NOUN
dentistry3000-465	142	5	that	that	PRON
dentistry3000-465	142	6	investigated	investigate	VERB
dentistry3000-465	142	7	the	the	DET
dentistry3000-465	142	8	beta	beta	ADJ
dentistry3000-465	142	9	diversity	diversity	NOUN
dentistry3000-465	142	10	in	in	ADP
dentistry3000-465	142	11	gingivitis	gingivitis	NOUN
dentistry3000-465	142	12	and	and	CCONJ
dentistry3000-465	142	13	periodontitis	periodontitis	NOUN
dentistry3000-465	142	14	for	for	SCONJ
dentistry3000-465	142	15	us	we	PRON
dentistry3000-465	142	16	to	to	PART
dentistry3000-465	142	17	compare	compare	VERB
dentistry3000-465	142	18	.	.	PUNCT
dentistry3000-465	143	1	however	however	ADV
dentistry3000-465	143	2	,	,	PUNCT
dentistry3000-465	143	3	a	a	DET
dentistry3000-465	143	4	study	study	NOUN
dentistry3000-465	143	5	showed	show	VERB
dentistry3000-465	143	6	no	no	DET
dentistry3000-465	143	7	significant	significant	ADJ
dentistry3000-465	143	8	difference	difference	NOUN
dentistry3000-465	143	9	in	in	ADP
dentistry3000-465	143	10	the	the	DET
dentistry3000-465	143	11	weighted	weight	VERB
dentistry3000-465	143	12	unifrac	unifrac	ADJ
dentistry3000-465	143	13	distance	distance	NOUN
dentistry3000-465	143	14	between	between	ADP
dentistry3000-465	143	15	healthy	healthy	ADJ
dentistry3000-465	143	16	and	and	CCONJ
dentistry3000-465	143	17	periodontitis	periodontitis	NOUN
dentistry3000-465	143	18	salivary	salivary	ADJ
dentistry3000-465	143	19	samples	sample	NOUN
dentistry3000-465	143	20	,	,	PUNCT
dentistry3000-465	143	21	and	and	CCONJ
dentistry3000-465	143	22	there	there	PRON
dentistry3000-465	143	23	was	be	VERB
dentistry3000-465	143	24	no	no	DET
dentistry3000-465	143	25	apparent	apparent	ADJ
dentistry3000-465	143	26	clustering	clustering	NOUN
dentistry3000-465	143	27	between	between	ADP
dentistry3000-465	143	28	the	the	DET
dentistry3000-465	143	29	two	two	NUM
dentistry3000-465	143	30	groups	group	NOUN
dentistry3000-465	143	31	[	[	X
dentistry3000-465	143	32	21	21	NUM
dentistry3000-465	143	33	]	]	PUNCT
dentistry3000-465	143	34	.	.	PUNCT
dentistry3000-465	144	1	another	another	DET
dentistry3000-465	144	2	study	study	NOUN
dentistry3000-465	144	3	also	also	ADV
dentistry3000-465	144	4	found	find	VERB
dentistry3000-465	144	5	no	no	DET
dentistry3000-465	144	6	significant	significant	ADJ
dentistry3000-465	144	7	difference	difference	NOUN
dentistry3000-465	144	8	in	in	ADP
dentistry3000-465	144	9	beta	beta	ADJ
dentistry3000-465	144	10	diversity	diversity	NOUN
dentistry3000-465	144	11	but	but	CCONJ
dentistry3000-465	144	12	did	do	AUX
dentistry3000-465	144	13	find	find	VERB
dentistry3000-465	144	14	apparent	apparent	ADJ
dentistry3000-465	144	15	clustering	clustering	NOUN
dentistry3000-465	144	16	in	in	ADP
dentistry3000-465	144	17	healthy	healthy	ADJ
dentistry3000-465	144	18	and	and	CCONJ
dentistry3000-465	144	19	periodontitis	periodontitis	NOUN
dentistry3000-465	144	20	samples	sample	NOUN
dentistry3000-465	144	21	[	[	X
dentistry3000-465	144	22	22	22	NUM
dentistry3000-465	144	23	]	]	PUNCT
dentistry3000-465	144	24	.	.	PUNCT
dentistry3000-465	145	1	there	there	PRON
dentistry3000-465	145	2	was	be	VERB
dentistry3000-465	145	3	also	also	ADV
dentistry3000-465	145	4	no	no	DET
dentistry3000-465	145	5	significant	significant	ADJ
dentistry3000-465	145	6	difference	difference	NOUN
dentistry3000-465	145	7	in	in	ADP
dentistry3000-465	145	8	beta	beta	ADJ
dentistry3000-465	145	9	diversity	diversity	NOUN
dentistry3000-465	145	10	or	or	CCONJ
dentistry3000-465	145	11	apparent	apparent	ADJ
dentistry3000-465	145	12	clustering	clustering	NOUN
dentistry3000-465	145	13	between	between	ADP
dentistry3000-465	145	14	gingivitis	gingivitis	NOUN
dentistry3000-465	145	15	subjects	subject	NOUN
dentistry3000-465	145	16	with	with	ADP
dentistry3000-465	145	17	different	different	ADJ
dentistry3000-465	145	18	oral	oral	ADJ
dentistry3000-465	145	19	hygiene	hygiene	NOUN
dentistry3000-465	145	20	statuses	status	NOUN
dentistry3000-465	145	21	[	[	X
dentistry3000-465	145	22	23	23	NUM
dentistry3000-465	145	23	]	]	PUNCT
dentistry3000-465	145	24	.	.	PUNCT
dentistry3000-465	146	1	in	in	ADP
dentistry3000-465	146	2	contrast	contrast	NOUN
dentistry3000-465	146	3	,	,	PUNCT
dentistry3000-465	146	4	another	another	DET
dentistry3000-465	146	5	researcher	researcher	NOUN
dentistry3000-465	146	6	reported	report	VERB
dentistry3000-465	146	7	apparent	apparent	ADJ
dentistry3000-465	146	8	clustering	clustering	NOUN
dentistry3000-465	146	9	of	of	ADP
dentistry3000-465	146	10	healthy	healthy	ADJ
dentistry3000-465	146	11	and	and	CCONJ
dentistry3000-465	146	12	periodontitis	periodontitis	NOUN
dentistry3000-465	146	13	samples	sample	NOUN
dentistry3000-465	146	14	in	in	ADP
dentistry3000-465	146	15	pcoa	pcoa	NOUN
dentistry3000-465	146	16	plots	plot	NOUN
dentistry3000-465	146	17	from	from	ADP
dentistry3000-465	146	18	the	the	DET
dentistry3000-465	146	19	same	same	ADJ
dentistry3000-465	146	20	individual	individual	NOUN
dentistry3000-465	146	21	[	[	X
dentistry3000-465	146	22	17	17	NUM
dentistry3000-465	146	23	]	]	PUNCT
dentistry3000-465	146	24	.	.	PUNCT
dentistry3000-465	147	1	studies	study	NOUN
dentistry3000-465	147	2	also	also	ADV
dentistry3000-465	147	3	found	find	VERB
dentistry3000-465	147	4	a	a	DET
dentistry3000-465	147	5	significant	significant	ADJ
dentistry3000-465	147	6	difference	difference	NOUN
dentistry3000-465	147	7	in	in	ADP
dentistry3000-465	147	8	the	the	DET
dentistry3000-465	147	9	weighted	weight	VERB
dentistry3000-465	147	10	unifrac	unifrac	ADJ
dentistry3000-465	147	11	distance	distance	NOUN
dentistry3000-465	147	12	of	of	ADP
dentistry3000-465	147	13	bacterial	bacterial	ADJ
dentistry3000-465	147	14	species	specie	NOUN
dentistry3000-465	147	15	when	when	SCONJ
dentistry3000-465	147	16	healthy	healthy	ADJ
dentistry3000-465	147	17	and	and	CCONJ
dentistry3000-465	147	18	periodontitis	periodontitis	NOUN
dentistry3000-465	147	19	subjects	subject	NOUN
dentistry3000-465	147	20	were	be	AUX
dentistry3000-465	147	21	compared	compare	VERB
dentistry3000-465	147	22	[	[	X
dentistry3000-465	147	23	16,24	16,24	ADJ
dentistry3000-465	147	24	]	]	X
dentistry3000-465	147	25	.	.	PUNCT
dentistry3000-465	148	1	a	a	DET
dentistry3000-465	148	2	well	well	ADV
dentistry3000-465	148	3	-	-	PUNCT
dentistry3000-465	148	4	controlled	control	VERB
dentistry3000-465	148	5	study	study	NOUN
dentistry3000-465	148	6	is	be	AUX
dentistry3000-465	148	7	required	require	VERB
dentistry3000-465	148	8	to	to	PART
dentistry3000-465	148	9	answer	answer	VERB
dentistry3000-465	148	10	the	the	DET
dentistry3000-465	148	11	question	question	NOUN
dentistry3000-465	148	12	of	of	ADP
dentistry3000-465	148	13	how	how	SCONJ
dentistry3000-465	148	14	bacterial	bacterial	ADJ
dentistry3000-465	148	15	plaque	plaque	NOUN
dentistry3000-465	148	16	distribution	distribution	NOUN
dentistry3000-465	148	17	is	be	AUX
dentistry3000-465	148	18	associated	associate	VERB
dentistry3000-465	148	19	with	with	ADP
dentistry3000-465	148	20	periodontal	periodontal	ADJ
dentistry3000-465	148	21	health	health	NOUN
dentistry3000-465	148	22	conditions	condition	NOUN
dentistry3000-465	148	23	.	.	PUNCT
dentistry3000-465	149	1	figure	figure	VERB
dentistry3000-465	149	2	4	4	NUM
dentistry3000-465	149	3	.	.	PUNCT
dentistry3000-465	150	1	mean	mean	VERB
dentistry3000-465	150	2	relative	relative	ADJ
dentistry3000-465	150	3	abundance	abundance	NOUN
dentistry3000-465	150	4	of	of	ADP
dentistry3000-465	150	5	bacteria	bacteria	NOUN
dentistry3000-465	150	6	species	specie	NOUN
dentistry3000-465	150	7	with	with	ADP
dentistry3000-465	150	8	standard	standard	ADJ
dentistry3000-465	150	9	error	error	NOUN
dentistry3000-465	150	10	of	of	ADP
dentistry3000-465	150	11	the	the	DET
dentistry3000-465	150	12	mean	mean	ADJ
dentistry3000-465	150	13	(	(	PUNCT
dentistry3000-465	150	14	sem	sem	NOUN
dentistry3000-465	150	15	)	)	PUNCT
dentistry3000-465	150	16	in	in	ADP
dentistry3000-465	150	17	gingivitis	gingivitis	NOUN
dentistry3000-465	150	18	and	and	CCONJ
dentistry3000-465	150	19	periodontitis	periodontitis	NOUN
dentistry3000-465	150	20	samples	sample	NOUN
dentistry3000-465	150	21	.	.	PUNCT
dentistry3000-465	151	1	only	only	ADV
dentistry3000-465	151	2	recognised	recognise	VERB
dentistry3000-465	151	3	species	specie	NOUN
dentistry3000-465	151	4	with	with	ADP
dentistry3000-465	151	5	a	a	DET
dentistry3000-465	151	6	relative	relative	ADJ
dentistry3000-465	151	7	abundance	abundance	NOUN
dentistry3000-465	151	8	greater	great	ADJ
dentistry3000-465	151	9	than	than	ADP
dentistry3000-465	151	10	0.1	0.1	NUM
dentistry3000-465	151	11	%	%	NOUN
dentistry3000-465	151	12	were	be	AUX
dentistry3000-465	151	13	included	include	VERB
dentistry3000-465	151	14	.	.	PUNCT
dentistry3000-465	152	1	mann	mann	PROPN
dentistry3000-465	152	2	-	-	PUNCT
dentistry3000-465	152	3	whitney	whitney	PROPN
dentistry3000-465	152	4	test	test	NOUN
dentistry3000-465	152	5	was	be	AUX
dentistry3000-465	152	6	used	use	VERB
dentistry3000-465	152	7	for	for	ADP
dentistry3000-465	152	8	statistical	statistical	ADJ
dentistry3000-465	152	9	analysis	analysis	NOUN
dentistry3000-465	152	10	,	,	PUNCT
dentistry3000-465	152	11	and	and	CCONJ
dentistry3000-465	152	12	the	the	DET
dentistry3000-465	152	13	significance	significance	NOUN
dentistry3000-465	152	14	level	level	NOUN
dentistry3000-465	152	15	was	be	AUX
dentistry3000-465	152	16	set	set	VERB
dentistry3000-465	152	17	at	at	ADP
dentistry3000-465	152	18	p	p	NOUN
dentistry3000-465	152	19	=	=	NOUN
dentistry3000-465	152	20	0.05	0.05	NUM
dentistry3000-465	152	21	.	.	PUNCT
dentistry3000-465	153	1	no	no	DET
dentistry3000-465	153	2	statistically	statistically	ADV
dentistry3000-465	153	3	significant	significant	ADJ
dentistry3000-465	153	4	were	be	AUX
dentistry3000-465	153	5	found	find	VERB
dentistry3000-465	153	6	between	between	ADP
dentistry3000-465	153	7	the	the	DET
dentistry3000-465	153	8	two	two	NUM
dentistry3000-465	153	9	groups	group	NOUN
dentistry3000-465	153	10	.	.	PUNCT
dentistry3000-465	154	1	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	154	2	bacterial	bacterial	ADJ
dentistry3000-465	154	3	community	community	NOUN
dentistry3000-465	154	4	in	in	ADP
dentistry3000-465	154	5	dental	dental	ADJ
dentistry3000-465	154	6	biofilms	biofilm	NOUN
dentistry3000-465	154	7	linked	link	VERB
dentistry3000-465	154	8	to	to	ADP
dentistry3000-465	154	9	periodontal	periodontal	ADJ
dentistry3000-465	154	10	disease	disease	NOUN
dentistry3000-465	154	11	:	:	PUNCT
dentistry3000-465	154	12	an	an	DET
dentistry3000-465	154	13	intra	intra	ADJ
dentistry3000-465	154	14	-	-	ADJ
dentistry3000-465	154	15	subject	subject	ADJ
dentistry3000-465	154	16	metagenomics	metagenomics	NOUN
dentistry3000-465	154	17	study	study	NOUN
dentistry3000-465	154	18	vol	vol	NOUN
dentistry3000-465	154	19	12	12	NUM
dentistry3000-465	154	20	no	no	PRON
dentistry3000-465	154	21	1	1	NUM
dentistry3000-465	154	22	(	(	PUNCT
dentistry3000-465	154	23	2024	2024	NUM
dentistry3000-465	154	24	)	)	PUNCT
dentistry3000-465	154	25	doi	doi	NOUN
dentistry3000-465	154	26	10.5195	10.5195	NUM
dentistry3000-465	154	27	/	/	SYM
dentistry3000-465	154	28	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	154	29	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	154	30	composition	composition	NOUN
dentistry3000-465	154	31	of	of	ADP
dentistry3000-465	154	32	bacterial	bacterial	ADJ
dentistry3000-465	154	33	species	specie	NOUN
dentistry3000-465	154	34	in	in	ADP
dentistry3000-465	154	35	the	the	DET
dentistry3000-465	154	36	dental	dental	ADJ
dentistry3000-465	154	37	plaque	plaque	NOUN
dentistry3000-465	154	38	of	of	ADP
dentistry3000-465	154	39	gingivitis	gingivitis	NOUN
dentistry3000-465	154	40	and	and	CCONJ
dentistry3000-465	154	41	periodontitis	periodontitis	NOUN
dentistry3000-465	154	42	sites	site	NOUN
dentistry3000-465	154	43	in	in	ADP
dentistry3000-465	154	44	partial	partial	ADJ
dentistry3000-465	154	45	agreement	agreement	NOUN
dentistry3000-465	154	46	with	with	ADP
dentistry3000-465	154	47	our	our	PRON
dentistry3000-465	154	48	findings	finding	NOUN
dentistry3000-465	154	49	,	,	PUNCT
dentistry3000-465	154	50	others	other	NOUN
dentistry3000-465	154	51	reported	report	VERB
dentistry3000-465	154	52	a	a	DET
dentistry3000-465	154	53	higher	high	ADJ
dentistry3000-465	154	54	abundance	abundance	NOUN
dentistry3000-465	154	55	of	of	ADP
dentistry3000-465	154	56	v.	v.	PROPN
dentistry3000-465	154	57	dispar	dispar	PROPN
dentistry3000-465	154	58	in	in	ADP
dentistry3000-465	154	59	plaque	plaque	NOUN
dentistry3000-465	154	60	samples	sample	NOUN
dentistry3000-465	154	61	of	of	ADP
dentistry3000-465	154	62	diseased	diseased	ADJ
dentistry3000-465	154	63	sites	site	NOUN
dentistry3000-465	154	64	compared	compare	VERB
dentistry3000-465	154	65	to	to	ADP
dentistry3000-465	154	66	healthy	healthy	ADJ
dentistry3000-465	154	67	sites	site	NOUN
dentistry3000-465	154	68	in	in	ADP
dentistry3000-465	154	69	periodontitis	periodontitis	NOUN
dentistry3000-465	154	70	patients	patient	NOUN
dentistry3000-465	154	71	[	[	X
dentistry3000-465	154	72	7	7	NUM
dentistry3000-465	154	73	]	]	PUNCT
dentistry3000-465	154	74	.	.	PUNCT
dentistry3000-465	155	1	in	in	ADP
dentistry3000-465	155	2	contrast	contrast	NOUN
dentistry3000-465	155	3	,	,	PUNCT
dentistry3000-465	155	4	a	a	DET
dentistry3000-465	155	5	higher	high	ADJ
dentistry3000-465	155	6	abundance	abundance	NOUN
dentistry3000-465	155	7	of	of	ADP
dentistry3000-465	155	8	v.	v.	PROPN
dentistry3000-465	155	9	dispar	dispar	PROPN
dentistry3000-465	155	10	was	be	AUX
dentistry3000-465	155	11	discovered	discover	VERB
dentistry3000-465	155	12	in	in	ADP
dentistry3000-465	155	13	healthy	healthy	ADJ
dentistry3000-465	155	14	implant	implant	ADJ
dentistry3000-465	155	15	sites	site	NOUN
dentistry3000-465	155	16	compared	compare	VERB
dentistry3000-465	155	17	to	to	ADP
dentistry3000-465	155	18	sites	site	NOUN
dentistry3000-465	155	19	with	with	ADP
dentistry3000-465	155	20	periodontitis	periodontitis	NOUN
dentistry3000-465	155	21	and	and	CCONJ
dentistry3000-465	155	22	periimplantitis	periimplantitis	NOUN
dentistry3000-465	156	1	[	[	X
dentistry3000-465	156	2	25	25	NUM
dentistry3000-465	156	3	]	]	PUNCT
dentistry3000-465	156	4	,	,	PUNCT
dentistry3000-465	156	5	and	and	CCONJ
dentistry3000-465	156	6	v.	v.	ADP
dentistry3000-465	156	7	dispar	dispar	PROPN
dentistry3000-465	156	8	was	be	AUX
dentistry3000-465	156	9	shown	show	VERB
dentistry3000-465	156	10	to	to	PART
dentistry3000-465	156	11	be	be	AUX
dentistry3000-465	156	12	more	more	ADV
dentistry3000-465	156	13	prevalent	prevalent	ADJ
dentistry3000-465	156	14	in	in	ADP
dentistry3000-465	156	15	shallow	shallow	ADJ
dentistry3000-465	156	16	pocket	pocket	NOUN
dentistry3000-465	156	17	sites	site	NOUN
dentistry3000-465	156	18	than	than	ADP
dentistry3000-465	156	19	in	in	ADP
dentistry3000-465	156	20	deeper	deep	ADJ
dentistry3000-465	156	21	places	place	NOUN
dentistry3000-465	157	1	[	[	X
dentistry3000-465	157	2	26	26	NUM
dentistry3000-465	157	3	]	]	PUNCT
dentistry3000-465	157	4	.	.	PUNCT
dentistry3000-465	158	1	in	in	ADP
dentistry3000-465	158	2	agreement	agreement	NOUN
dentistry3000-465	158	3	with	with	ADP
dentistry3000-465	158	4	our	our	PRON
dentistry3000-465	158	5	finding	finding	NOUN
dentistry3000-465	158	6	,	,	PUNCT
dentistry3000-465	158	7	p.	p.	PROPN
dentistry3000-465	158	8	melaninogenica	melaninogenica	PROPN
dentistry3000-465	158	9	was	be	AUX
dentistry3000-465	158	10	detected	detect	VERB
dentistry3000-465	158	11	in	in	ADP
dentistry3000-465	158	12	great	great	ADJ
dentistry3000-465	158	13	abundance	abundance	NOUN
dentistry3000-465	158	14	in	in	ADP
dentistry3000-465	158	15	the	the	DET
dentistry3000-465	158	16	saliva	saliva	NOUN
dentistry3000-465	158	17	of	of	ADP
dentistry3000-465	158	18	periodontitis	periodontitis	NOUN
dentistry3000-465	158	19	patients	patient	NOUN
dentistry3000-465	158	20	compared	compare	VERB
dentistry3000-465	158	21	to	to	ADP
dentistry3000-465	158	22	healthy	healthy	ADJ
dentistry3000-465	158	23	ones	one	NOUN
dentistry3000-465	158	24	[	[	X
dentistry3000-465	158	25	27	27	NUM
dentistry3000-465	158	26	]	]	PUNCT
dentistry3000-465	158	27	.	.	PUNCT
dentistry3000-465	159	1	however	however	ADV
dentistry3000-465	159	2	,	,	PUNCT
dentistry3000-465	159	3	p.	p.	PROPN
dentistry3000-465	159	4	melaninogenica	melaninogenica	PROPN
dentistry3000-465	159	5	was	be	AUX
dentistry3000-465	159	6	also	also	ADV
dentistry3000-465	159	7	found	find	VERB
dentistry3000-465	159	8	to	to	PART
dentistry3000-465	159	9	be	be	AUX
dentistry3000-465	159	10	more	more	ADV
dentistry3000-465	159	11	prevalent	prevalent	ADJ
dentistry3000-465	159	12	in	in	ADP
dentistry3000-465	159	13	plaque	plaque	NOUN
dentistry3000-465	159	14	samples	sample	NOUN
dentistry3000-465	159	15	from	from	ADP
dentistry3000-465	159	16	healthy	healthy	ADJ
dentistry3000-465	159	17	sites	site	NOUN
dentistry3000-465	159	18	than	than	ADP
dentistry3000-465	159	19	in	in	ADP
dentistry3000-465	159	20	periodontitis	periodontitis	NOUN
dentistry3000-465	159	21	sites	site	NOUN
dentistry3000-465	159	22	[	[	X
dentistry3000-465	159	23	28	28	NUM
dentistry3000-465	159	24	]	]	PUNCT
dentistry3000-465	159	25	.	.	PUNCT
dentistry3000-465	160	1	additionally	additionally	ADV
dentistry3000-465	160	2	,	,	PUNCT
dentistry3000-465	160	3	similar	similar	ADJ
dentistry3000-465	160	4	to	to	ADP
dentistry3000-465	160	5	our	our	PRON
dentistry3000-465	160	6	observation	observation	NOUN
dentistry3000-465	160	7	,	,	PUNCT
dentistry3000-465	160	8	p.	p.	PROPN
dentistry3000-465	160	9	intermedia	intermedia	PROPN
dentistry3000-465	160	10	was	be	AUX
dentistry3000-465	160	11	found	find	VERB
dentistry3000-465	160	12	abundant	abundant	ADJ
dentistry3000-465	160	13	in	in	ADP
dentistry3000-465	160	14	gingivitis	gingivitis	NOUN
dentistry3000-465	160	15	plaque	plaque	NOUN
dentistry3000-465	160	16	samples	sample	NOUN
dentistry3000-465	160	17	compared	compare	VERB
dentistry3000-465	160	18	to	to	ADP
dentistry3000-465	160	19	periodontitis	periodontitis	NOUN
dentistry3000-465	160	20	[	[	X
dentistry3000-465	160	21	29	29	NUM
dentistry3000-465	160	22	]	]	PUNCT
dentistry3000-465	160	23	.	.	PUNCT
dentistry3000-465	161	1	on	on	ADP
dentistry3000-465	161	2	the	the	DET
dentistry3000-465	161	3	other	other	ADJ
dentistry3000-465	161	4	hand	hand	NOUN
dentistry3000-465	161	5	,	,	PUNCT
dentistry3000-465	161	6	it	it	PRON
dentistry3000-465	161	7	was	be	AUX
dentistry3000-465	161	8	shown	show	VERB
dentistry3000-465	161	9	to	to	PART
dentistry3000-465	161	10	be	be	AUX
dentistry3000-465	161	11	more	more	ADV
dentistry3000-465	161	12	prevalent	prevalent	ADJ
dentistry3000-465	161	13	in	in	ADP
dentistry3000-465	161	14	the	the	DET
dentistry3000-465	161	15	subgingival	subgingival	NOUN
dentistry3000-465	161	16	plaque	plaque	NOUN
dentistry3000-465	161	17	sample	sample	NOUN
dentistry3000-465	161	18	of	of	ADP
dentistry3000-465	161	19	the	the	DET
dentistry3000-465	161	20	periodontitis	periodontitis	NOUN
dentistry3000-465	161	21	than	than	ADP
dentistry3000-465	161	22	in	in	ADP
dentistry3000-465	161	23	gingivitis	gingivitis	NOUN
dentistry3000-465	161	24	sites	site	NOUN
dentistry3000-465	161	25	[	[	X
dentistry3000-465	161	26	30	30	NUM
dentistry3000-465	161	27	]	]	PUNCT
dentistry3000-465	161	28	.	.	PUNCT
dentistry3000-465	162	1	as	as	ADP
dentistry3000-465	162	2	for	for	ADP
dentistry3000-465	162	3	r.	r.	PROPN
dentistry3000-465	162	4	dentocariosa	dentocariosa	PROPN
dentistry3000-465	162	5	,	,	PUNCT
dentistry3000-465	162	6	it	it	PRON
dentistry3000-465	162	7	was	be	AUX
dentistry3000-465	162	8	shown	show	VERB
dentistry3000-465	162	9	that	that	SCONJ
dentistry3000-465	162	10	its	its	PRON
dentistry3000-465	162	11	abundance	abundance	NOUN
dentistry3000-465	162	12	decreased	decrease	VERB
dentistry3000-465	162	13	as	as	SCONJ
dentistry3000-465	162	14	the	the	DET
dentistry3000-465	162	15	severity	severity	NOUN
dentistry3000-465	162	16	of	of	ADP
dentistry3000-465	162	17	periodontal	periodontal	ADJ
dentistry3000-465	162	18	disease	disease	NOUN
dentistry3000-465	162	19	increased	increase	VERB
dentistry3000-465	162	20	,	,	PUNCT
dentistry3000-465	162	21	which	which	PRON
dentistry3000-465	162	22	is	be	AUX
dentistry3000-465	162	23	consistent	consistent	ADJ
dentistry3000-465	162	24	with	with	ADP
dentistry3000-465	162	25	our	our	PRON
dentistry3000-465	162	26	observation	observation	NOUN
dentistry3000-465	162	27	that	that	SCONJ
dentistry3000-465	162	28	gingivitis	gingivitis	NOUN
dentistry3000-465	162	29	sites	site	NOUN
dentistry3000-465	162	30	had	have	AUX
dentistry3000-465	162	31	a	a	DET
dentistry3000-465	162	32	higher	high	ADJ
dentistry3000-465	162	33	abundance	abundance	NOUN
dentistry3000-465	163	1	[	[	X
dentistry3000-465	163	2	19,31	19,31	NUM
dentistry3000-465	163	3	]	]	PUNCT
dentistry3000-465	163	4	.	.	PUNCT
dentistry3000-465	164	1	however	however	ADV
dentistry3000-465	164	2	,	,	PUNCT
dentistry3000-465	164	3	compared	compare	VERB
dentistry3000-465	164	4	to	to	ADP
dentistry3000-465	164	5	healthy	healthy	ADJ
dentistry3000-465	164	6	sites	site	NOUN
dentistry3000-465	164	7	,	,	PUNCT
dentistry3000-465	164	8	the	the	DET
dentistry3000-465	164	9	species	specie	NOUN
dentistry3000-465	164	10	were	be	AUX
dentistry3000-465	164	11	more	more	ADV
dentistry3000-465	164	12	abundant	abundant	ADJ
dentistry3000-465	164	13	in	in	ADP
dentistry3000-465	164	14	sites	site	NOUN
dentistry3000-465	164	15	with	with	ADP
dentistry3000-465	164	16	periodontitis	periodontitis	NOUN
dentistry3000-465	164	17	[	[	X
dentistry3000-465	164	18	32	32	NUM
dentistry3000-465	164	19	]	]	PUNCT
dentistry3000-465	164	20	.	.	PUNCT
dentistry3000-465	165	1	conclusion	conclusion	NOUN
dentistry3000-465	165	2	within	within	ADP
dentistry3000-465	165	3	the	the	DET
dentistry3000-465	165	4	limitations	limitation	NOUN
dentistry3000-465	165	5	of	of	ADP
dentistry3000-465	165	6	this	this	DET
dentistry3000-465	165	7	study	study	NOUN
dentistry3000-465	165	8	,	,	PUNCT
dentistry3000-465	165	9	it	it	PRON
dentistry3000-465	165	10	may	may	AUX
dentistry3000-465	165	11	be	be	AUX
dentistry3000-465	165	12	concluded	conclude	VERB
dentistry3000-465	165	13	that	that	SCONJ
dentistry3000-465	165	14	there	there	PRON
dentistry3000-465	165	15	is	be	VERB
dentistry3000-465	165	16	no	no	DET
dentistry3000-465	165	17	apparent	apparent	ADJ
dentistry3000-465	165	18	divergence	divergence	NOUN
dentistry3000-465	165	19	of	of	ADP
dentistry3000-465	165	20	the	the	DET
dentistry3000-465	165	21	dental	dental	ADJ
dentistry3000-465	165	22	biofilm	biofilm	NOUN
dentistry3000-465	165	23	communities	community	NOUN
dentistry3000-465	165	24	in	in	ADP
dentistry3000-465	165	25	gingivitis	gingivitis	NOUN
dentistry3000-465	165	26	and	and	CCONJ
dentistry3000-465	165	27	periodontitis	periodontitis	NOUN
dentistry3000-465	165	28	.	.	PUNCT
dentistry3000-465	166	1	nevertheless	nevertheless	ADV
dentistry3000-465	166	2	,	,	PUNCT
dentistry3000-465	166	3	certain	certain	ADJ
dentistry3000-465	166	4	species	specie	NOUN
dentistry3000-465	166	5	displayed	display	VERB
dentistry3000-465	166	6	a	a	DET
dentistry3000-465	166	7	trend	trend	NOUN
dentistry3000-465	166	8	of	of	ADP
dentistry3000-465	166	9	increased	increase	VERB
dentistry3000-465	166	10	or	or	CCONJ
dentistry3000-465	166	11	decreased	decrease	VERB
dentistry3000-465	166	12	abundance	abundance	NOUN
dentistry3000-465	166	13	in	in	ADP
dentistry3000-465	166	14	gingivitis	gingivitis	NOUN
dentistry3000-465	166	15	or	or	CCONJ
dentistry3000-465	166	16	periodontitis	periodontitis	NOUN
dentistry3000-465	166	17	sites	site	NOUN
dentistry3000-465	166	18	.	.	PUNCT
dentistry3000-465	167	1	these	these	DET
dentistry3000-465	167	2	patterns	pattern	NOUN
dentistry3000-465	167	3	of	of	ADP
dentistry3000-465	167	4	species	specie	NOUN
dentistry3000-465	167	5	abundance	abundance	NOUN
dentistry3000-465	167	6	in	in	ADP
dentistry3000-465	167	7	gingivitis	gingivitis	NOUN
dentistry3000-465	167	8	and	and	CCONJ
dentistry3000-465	167	9	periodontitis	periodontitis	NOUN
dentistry3000-465	167	10	have	have	AUX
dentistry3000-465	167	11	also	also	ADV
dentistry3000-465	167	12	been	be	AUX
dentistry3000-465	167	13	reported	report	VERB
dentistry3000-465	167	14	in	in	ADP
dentistry3000-465	167	15	contradictory	contradictory	ADJ
dentistry3000-465	167	16	ways	way	NOUN
dentistry3000-465	167	17	in	in	ADP
dentistry3000-465	167	18	other	other	ADJ
dentistry3000-465	167	19	studies	study	NOUN
dentistry3000-465	167	20	,	,	PUNCT
dentistry3000-465	167	21	rendering	render	VERB
dentistry3000-465	167	22	the	the	DET
dentistry3000-465	167	23	conclusions	conclusion	NOUN
dentistry3000-465	167	24	inconclusive	inconclusive	ADJ
dentistry3000-465	167	25	.	.	PUNCT
dentistry3000-465	168	1	if	if	SCONJ
dentistry3000-465	168	2	this	this	DET
dentistry3000-465	168	3	fundamental	fundamental	ADJ
dentistry3000-465	168	4	understanding	understanding	NOUN
dentistry3000-465	168	5	is	be	AUX
dentistry3000-465	168	6	to	to	PART
dentistry3000-465	168	7	be	be	AUX
dentistry3000-465	168	8	confirmed	confirm	VERB
dentistry3000-465	168	9	,	,	PUNCT
dentistry3000-465	168	10	bigger	big	ADJ
dentistry3000-465	168	11	and	and	CCONJ
dentistry3000-465	168	12	well	well	ADV
dentistry3000-465	168	13	-	-	PUNCT
dentistry3000-465	168	14	controlled	control	VERB
dentistry3000-465	168	15	studies	study	NOUN
dentistry3000-465	168	16	are	be	AUX
dentistry3000-465	168	17	required	require	VERB
dentistry3000-465	168	18	.	.	PUNCT
dentistry3000-465	169	1	acknowledgements	acknowledgement	NOUN
dentistry3000-465	169	2	the	the	DET
dentistry3000-465	169	3	study	study	NOUN
dentistry3000-465	169	4	was	be	AUX
dentistry3000-465	169	5	supported	support	VERB
dentistry3000-465	169	6	by	by	ADP
dentistry3000-465	169	7	the	the	DET
dentistry3000-465	169	8	universiti	universiti	PROPN
dentistry3000-465	169	9	sains	sain	NOUN
dentistry3000-465	169	10	malaysia	malaysia	PROPN
dentistry3000-465	169	11	(	(	PUNCT
dentistry3000-465	169	12	usm	usm	PROPN
dentistry3000-465	169	13	)	)	PUNCT
dentistry3000-465	169	14	through	through	ADP
dentistry3000-465	169	15	the	the	DET
dentistry3000-465	169	16	usm	usm	ADJ
dentistry3000-465	169	17	research	research	NOUN
dentistry3000-465	169	18	grant	grant	NOUN
dentistry3000-465	169	19	(	(	PUNCT
dentistry3000-465	169	20	grant	grant	VERB
dentistry3000-465	169	21	no	no	PRON
dentistry3000-465	169	22	:	:	PUNCT
dentistry3000-465	169	23	1001	1001	NUM
dentistry3000-465	169	24	/	/	SYM
dentistry3000-465	169	25	ppsg/8012217	ppsg/8012217	NOUN
dentistry3000-465	169	26	)	)	PUNCT
dentistry3000-465	169	27	.	.	PUNCT
dentistry3000-465	170	1	the	the	DET
dentistry3000-465	170	2	sponsor	sponsor	NOUN
dentistry3000-465	170	3	had	have	VERB
dentistry3000-465	170	4	no	no	DET
dentistry3000-465	170	5	role	role	NOUN
dentistry3000-465	170	6	in	in	ADP
dentistry3000-465	170	7	the	the	DET
dentistry3000-465	170	8	preparation	preparation	NOUN
dentistry3000-465	170	9	and	and	CCONJ
dentistry3000-465	170	10	in	in	ADP
dentistry3000-465	170	11	the	the	DET
dentistry3000-465	170	12	decision	decision	NOUN
dentistry3000-465	170	13	of	of	ADP
dentistry3000-465	170	14	submission	submission	NOUN
dentistry3000-465	170	15	of	of	ADP
dentistry3000-465	170	16	this	this	DET
dentistry3000-465	170	17	article	article	NOUN
dentistry3000-465	170	18	.	.	PUNCT
dentistry3000-465	171	1	references	reference	NOUN
dentistry3000-465	171	2	1	1	NUM
dentistry3000-465	171	3	.	.	PUNCT
dentistry3000-465	172	1	periodontal	periodontal	ADJ
dentistry3000-465	172	2	diseases	disease	NOUN
dentistry3000-465	172	3	.	.	PUNCT
dentistry3000-465	173	1	kinane	kinane	PROPN
dentistry3000-465	173	2	df	df	PROPN
dentistry3000-465	173	3	,	,	PUNCT
dentistry3000-465	173	4	stathopoulou	stathopoulou	PROPN
dentistry3000-465	173	5	pg	pg	PROPN
dentistry3000-465	173	6	,	,	PUNCT
dentistry3000-465	173	7	papapanou	papapanou	PROPN
dentistry3000-465	173	8	pn	pn	PROPN
dentistry3000-465	173	9	.	.	PUNCT
dentistry3000-465	173	10	nat	nat	PROPN
dentistry3000-465	173	11	rev	rev	VERB
dentistry3000-465	173	12	dis	dis	PROPN
dentistry3000-465	173	13	prim	prim	PROPN
dentistry3000-465	173	14	.	.	PUNCT
dentistry3000-465	174	1	england	england	PROPN
dentistry3000-465	174	2	;	;	PUNCT
dentistry3000-465	174	3	2017;3:17038	2017;3:17038	NUM
dentistry3000-465	174	4	.	.	PUNCT
dentistry3000-465	175	1	pmid	pmid	NOUN
dentistry3000-465	175	2	:	:	PUNCT
dentistry3000-465	175	3	28805207	28805207	NUM
dentistry3000-465	175	4	2	2	X
dentistry3000-465	175	5	.	.	PUNCT
dentistry3000-465	175	6	defining	define	VERB
dentistry3000-465	175	7	metaniches	metaniche	NOUN
dentistry3000-465	175	8	in	in	ADP
dentistry3000-465	175	9	the	the	DET
dentistry3000-465	175	10	oral	oral	ADJ
dentistry3000-465	175	11	cavity	cavity	NOUN
dentistry3000-465	175	12	according	accord	VERB
dentistry3000-465	175	13	to	to	ADP
dentistry3000-465	175	14	their	their	PRON
dentistry3000-465	175	15	microbial	microbial	ADJ
dentistry3000-465	175	16	composition	composition	NOUN
dentistry3000-465	175	17	and	and	CCONJ
dentistry3000-465	175	18	cytokine	cytokine	ADJ
dentistry3000-465	175	19	profile	profile	NOUN
dentistry3000-465	175	20	.	.	PUNCT
dentistry3000-465	176	1	seidel	seidel	PROPN
dentistry3000-465	176	2	cl	cl	PROPN
dentistry3000-465	176	3	,	,	PUNCT
dentistry3000-465	176	4	gerlach	gerlach	PROPN
dentistry3000-465	176	5	rg	rg	PROPN
dentistry3000-465	176	6	,	,	PUNCT
dentistry3000-465	176	7	wiedemann	wiedemann	VERB
dentistry3000-465	176	8	p	p	X
dentistry3000-465	176	9	,	,	PUNCT
dentistry3000-465	176	10	weider	weider	NOUN
dentistry3000-465	176	11	m	m	PROPN
dentistry3000-465	176	12	,	,	PUNCT
dentistry3000-465	176	13	rodrian	rodrian	PROPN
dentistry3000-465	176	14	g	g	PROPN
dentistry3000-465	176	15	,	,	PUNCT
dentistry3000-465	176	16	hader	hader	PROPN
dentistry3000-465	176	17	m	m	PROPN
dentistry3000-465	176	18	,	,	PUNCT
dentistry3000-465	176	19	et	et	PROPN
dentistry3000-465	176	20	al	al	PROPN
dentistry3000-465	176	21	.	.	PROPN
dentistry3000-465	177	1	int	int	PROPN
dentistry3000-465	177	2	j	j	PROPN
dentistry3000-465	177	3	mol	mol	ADP
dentistry3000-465	177	4	sci	sci	PROPN
dentistry3000-465	178	1	[	[	X
dentistry3000-465	178	2	internet	internet	NOUN
dentistry3000-465	178	3	]	]	PUNCT
dentistry3000-465	178	4	.	.	PUNCT
dentistry3000-465	179	1	2020;21:8218	2020;21:8218	X
dentistry3000-465	179	2	.	.	PUNCT
dentistry3000-465	179	3	available	available	ADJ
dentistry3000-465	179	4	from	from	ADP
dentistry3000-465	179	5	:	:	PUNCT
dentistry3000-465	179	6	https://www.mdpi.com/14220067/21/21/8218pmid	https://www.mdpi.com/14220067/21/21/8218pmid	ADJ
dentistry3000-465	179	7	:	:	PUNCT
dentistry3000-465	179	8	33153049	33153049	NUM
dentistry3000-465	179	9	3	3	NUM
dentistry3000-465	179	10	.	.	PUNCT
dentistry3000-465	179	11	comparison	comparison	NOUN
dentistry3000-465	179	12	of	of	ADP
dentistry3000-465	179	13	subgingival	subgingival	NOUN
dentistry3000-465	179	14	and	and	CCONJ
dentistry3000-465	179	15	buccal	buccal	ADJ
dentistry3000-465	179	16	mucosa	mucosa	NOUN
dentistry3000-465	179	17	microbiome	microbiome	NOUN
dentistry3000-465	179	18	in	in	ADP
dentistry3000-465	179	19	chronic	chronic	ADJ
dentistry3000-465	179	20	and	and	CCONJ
dentistry3000-465	179	21	aggressive	aggressive	ADJ
dentistry3000-465	179	22	periodontitis	periodontitis	NOUN
dentistry3000-465	179	23	:	:	PUNCT
dentistry3000-465	179	24	a	a	DET
dentistry3000-465	179	25	pilot	pilot	NOUN
dentistry3000-465	179	26	study	study	NOUN
dentistry3000-465	179	27	.	.	PUNCT
dentistry3000-465	180	1	wei	wei	PROPN
dentistry3000-465	180	2	y	y	PROPN
dentistry3000-465	180	3	,	,	PUNCT
dentistry3000-465	180	4	shi	shi	PROPN
dentistry3000-465	180	5	m	m	PROPN
dentistry3000-465	180	6	,	,	PUNCT
dentistry3000-465	180	7	zhen	zhen	PROPN
dentistry3000-465	180	8	m	m	PROPN
dentistry3000-465	180	9	,	,	PUNCT
dentistry3000-465	180	10	wang	wang	PROPN
dentistry3000-465	180	11	c	c	PROPN
dentistry3000-465	180	12	,	,	PUNCT
dentistry3000-465	180	13	hu	hu	PROPN
dentistry3000-465	180	14	w	w	PROPN
dentistry3000-465	180	15	,	,	PUNCT
dentistry3000-465	180	16	nie	nie	PROPN
dentistry3000-465	180	17	y	y	PROPN
dentistry3000-465	180	18	,	,	PUNCT
dentistry3000-465	180	19	et	et	PROPN
dentistry3000-465	180	20	al	al	PROPN
dentistry3000-465	180	21	.	.	PROPN
dentistry3000-465	180	22	front	front	ADJ
dentistry3000-465	180	23	cell	cell	NOUN
dentistry3000-465	180	24	infect	infect	VERB
dentistry3000-465	180	25	microbiol	microbiol	PROPN
dentistry3000-465	180	26	.	.	PUNCT
dentistry3000-465	181	1	2019;9:1–11	2019;9:1–11	X
dentistry3000-465	181	2	.	.	PUNCT
dentistry3000-465	182	1	pmid	pmid	NOUN
dentistry3000-465	182	2	:	:	PUNCT
dentistry3000-465	182	3	30915280	30915280	NUM
dentistry3000-465	182	4	4	4	NUM
dentistry3000-465	182	5	.	.	PUNCT
dentistry3000-465	183	1	discrimination	discrimination	NOUN
dentistry3000-465	183	2	of	of	ADP
dentistry3000-465	183	3	bacterial	bacterial	ADJ
dentistry3000-465	183	4	community	community	NOUN
dentistry3000-465	183	5	structures	structure	NOUN
dentistry3000-465	183	6	among	among	ADP
dentistry3000-465	183	7	healthy	healthy	ADJ
dentistry3000-465	183	8	,	,	PUNCT
dentistry3000-465	183	9	gingivitis	gingivitis	NOUN
dentistry3000-465	183	10	,	,	PUNCT
dentistry3000-465	183	11	and	and	CCONJ
dentistry3000-465	183	12	periodontitis	periodontitis	NOUN
dentistry3000-465	183	13	statuses	status	NOUN
dentistry3000-465	183	14	through	through	ADP
dentistry3000-465	183	15	integrated	integrate	VERB
dentistry3000-465	183	16	metatranscriptomic	metatranscriptomic	NOUN
dentistry3000-465	183	17	and	and	CCONJ
dentistry3000-465	183	18	network	network	NOUN
dentistry3000-465	183	19	analyses	analysis	NOUN
dentistry3000-465	183	20	.	.	PUNCT
dentistry3000-465	184	1	nemoto	nemoto	PROPN
dentistry3000-465	184	2	t	t	PROPN
dentistry3000-465	184	3	,	,	PUNCT
dentistry3000-465	184	4	shiba	shiba	PROPN
dentistry3000-465	184	5	t	t	PROPN
dentistry3000-465	184	6	,	,	PUNCT
dentistry3000-465	184	7	komatsu	komatsu	PROPN
dentistry3000-465	184	8	k	k	PROPN
dentistry3000-465	184	9	,	,	PUNCT
dentistry3000-465	184	10	watanabe	watanabe	PROPN
dentistry3000-465	184	11	t	t	PROPN
dentistry3000-465	184	12	,	,	PUNCT
dentistry3000-465	184	13	shimogishi	shimogishi	PROPN
dentistry3000-465	184	14	m	m	PROPN
dentistry3000-465	184	15	,	,	PUNCT
dentistry3000-465	184	16	shibasaki	shibasaki	PROPN
dentistry3000-465	184	17	m	m	PROPN
dentistry3000-465	184	18	,	,	PUNCT
dentistry3000-465	184	19	et	et	PROPN
dentistry3000-465	184	20	al	al	PROPN
dentistry3000-465	184	21	.	.	PROPN
dentistry3000-465	185	1	bik	bik	PROPN
dentistry3000-465	185	2	h	h	PROPN
dentistry3000-465	185	3	,	,	PUNCT
dentistry3000-465	185	4	editor	editor	NOUN
dentistry3000-465	185	5	.	.	PUNCT
dentistry3000-465	186	1	msystems	msystem	NOUN
dentistry3000-465	187	1	[	[	X
dentistry3000-465	187	2	internet	internet	NOUN
dentistry3000-465	187	3	]	]	PUNCT
dentistry3000-465	187	4	.	.	PUNCT
dentistry3000-465	188	1	american	american	ADJ
dentistry3000-465	188	2	society	society	PROPN
dentistry3000-465	188	3	for	for	ADP
dentistry3000-465	188	4	microbiology	microbiology	NOUN
dentistry3000-465	188	5	;	;	PUNCT
dentistry3000-465	188	6	2021;6:1	2021;6:1	X
dentistry3000-465	188	7	–	–	PUNCT
dentistry3000-465	188	8	16	16	NUM
dentistry3000-465	188	9	.	.	PUNCT
dentistry3000-465	188	10	available	available	ADJ
dentistry3000-465	188	11	from	from	ADP
dentistry3000-465	188	12	:	:	PUNCT
dentistry3000-465	188	13	https://journals.asm.org/doi/10.1128	https://journals.asm.org/doi/10.1128	PROPN
dentistry3000-465	188	14	/msystems.00886	/msystems.00886	PUNCT
dentistry3000-465	188	15	-	-	PUNCT
dentistry3000-465	188	16	21	21	NUM
dentistry3000-465	188	17	5	5	NUM
dentistry3000-465	188	18	.	.	PUNCT
dentistry3000-465	188	19	periodontal	periodontal	ADJ
dentistry3000-465	188	20	microbial	microbial	ADJ
dentistry3000-465	188	21	ecology	ecology	NOUN
dentistry3000-465	188	22	.	.	PUNCT
dentistry3000-465	189	1	socransky	socransky	PROPN
dentistry3000-465	189	2	ss	ss	PROPN
dentistry3000-465	189	3	,	,	PUNCT
dentistry3000-465	189	4	haffajee	haffajee	NOUN
dentistry3000-465	189	5	ad	ad	NOUN
dentistry3000-465	189	6	.	.	PUNCT
dentistry3000-465	190	1	periodontol	periodontol	NOUN
dentistry3000-465	190	2	2000	2000	NUM
dentistry3000-465	191	1	[	[	X
dentistry3000-465	191	2	internet	internet	NOUN
dentistry3000-465	191	3	]	]	PUNCT
dentistry3000-465	191	4	.	.	PUNCT
dentistry3000-465	192	1	2005;38:135–87	2005;38:135–87	X
dentistry3000-465	192	2	.	.	PUNCT
dentistry3000-465	192	3	available	available	ADJ
dentistry3000-465	192	4	from	from	ADP
dentistry3000-465	192	5	:	:	PUNCT
dentistry3000-465	192	6	http://www.ncbi.nlm.nih.gov/pubme	http://www.ncbi.nlm.nih.gov/pubme	PROPN
dentistry3000-465	192	7	d/15853940pmid	d/15853940pmid	PROPN
dentistry3000-465	192	8	:	:	PUNCT
dentistry3000-465	192	9	15853940	15853940	NUM
dentistry3000-465	192	10	6	6	NUM
dentistry3000-465	192	11	.	.	PUNCT
dentistry3000-465	193	1	the	the	DET
dentistry3000-465	193	2	oral	oral	ADJ
dentistry3000-465	193	3	microbiome	microbiome	NOUN
dentistry3000-465	193	4	in	in	ADP
dentistry3000-465	193	5	periodontal	periodontal	ADJ
dentistry3000-465	193	6	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	193	7	bacterial	bacterial	ADJ
dentistry3000-465	193	8	community	community	NOUN
dentistry3000-465	193	9	in	in	ADP
dentistry3000-465	193	10	dental	dental	ADJ
dentistry3000-465	193	11	biofilms	biofilm	NOUN
dentistry3000-465	193	12	linked	link	VERB
dentistry3000-465	193	13	to	to	ADP
dentistry3000-465	193	14	periodontal	periodontal	ADJ
dentistry3000-465	193	15	disease	disease	NOUN
dentistry3000-465	193	16	:	:	PUNCT
dentistry3000-465	193	17	an	an	DET
dentistry3000-465	193	18	intra	intra	ADJ
dentistry3000-465	193	19	-	-	ADJ
dentistry3000-465	193	20	subject	subject	ADJ
dentistry3000-465	193	21	metagenomics	metagenomics	NOUN
dentistry3000-465	193	22	study	study	NOUN
dentistry3000-465	193	23	vol	vol	NOUN
dentistry3000-465	193	24	12	12	NUM
dentistry3000-465	193	25	no	no	PRON
dentistry3000-465	193	26	1	1	NUM
dentistry3000-465	193	27	(	(	PUNCT
dentistry3000-465	193	28	2024	2024	NUM
dentistry3000-465	193	29	)	)	PUNCT
dentistry3000-465	193	30	doi	doi	NOUN
dentistry3000-465	193	31	10.5195	10.5195	NUM
dentistry3000-465	193	32	/	/	SYM
dentistry3000-465	193	33	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	193	34	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	193	35	health	health	NOUN
dentistry3000-465	193	36	.	.	PUNCT
dentistry3000-465	194	1	lenartova	lenartova	PROPN
dentistry3000-465	194	2	m	m	PROPN
dentistry3000-465	194	3	,	,	PUNCT
dentistry3000-465	194	4	tesinska	tesinska	PROPN
dentistry3000-465	194	5	b	b	PROPN
dentistry3000-465	194	6	,	,	PUNCT
dentistry3000-465	194	7	janatova	janatova	PROPN
dentistry3000-465	194	8	t	t	PROPN
dentistry3000-465	194	9	,	,	PUNCT
dentistry3000-465	194	10	hrebicek	hrebicek	PROPN
dentistry3000-465	194	11	o	o	NOUN
dentistry3000-465	194	12	,	,	PUNCT
dentistry3000-465	194	13	mysak	mysak	PROPN
dentistry3000-465	194	14	j	j	PROPN
dentistry3000-465	194	15	,	,	PUNCT
dentistry3000-465	194	16	janata	janata	PROPN
dentistry3000-465	194	17	j	j	PROPN
dentistry3000-465	194	18	,	,	PUNCT
dentistry3000-465	194	19	et	et	PROPN
dentistry3000-465	194	20	al	al	PROPN
dentistry3000-465	194	21	.	.	PROPN
dentistry3000-465	194	22	front	front	ADJ
dentistry3000-465	194	23	cell	cell	NOUN
dentistry3000-465	194	24	infect	infect	VERB
dentistry3000-465	194	25	microbiol	microbiol	NOUN
dentistry3000-465	195	1	[	[	X
dentistry3000-465	195	2	internet	internet	NOUN
dentistry3000-465	195	3	]	]	PUNCT
dentistry3000-465	195	4	.	.	PUNCT
dentistry3000-465	196	1	2021;11:629723	2021;11:629723	X
dentistry3000-465	196	2	.	.	NOUN
dentistry3000-465	196	3	available	available	ADJ
dentistry3000-465	196	4	from	from	ADP
dentistry3000-465	196	5	:	:	PUNCT
dentistry3000-465	196	6	https://www.frontiersin.org/articles/	https://www.frontiersin.org/articles/	PROPN
dentistry3000-465	196	7	10.3389	10.3389	NUM
dentistry3000-465	196	8	/	/	SYM
dentistry3000-465	196	9	fcimb.2021.629723	fcimb.2021.629723	NOUN
dentistry3000-465	196	10	/	/	SYM
dentistry3000-465	196	11	fullpmid	fullpmid	NOUN
dentistry3000-465	196	12	:	:	PUNCT
dentistry3000-465	196	13	33828997	33828997	NUM
dentistry3000-465	196	14	7	7	NUM
dentistry3000-465	196	15	.	.	PUNCT
dentistry3000-465	196	16	subgingival	subgingival	ADJ
dentistry3000-465	196	17	microbiota	microbiota	NOUN
dentistry3000-465	196	18	and	and	CCONJ
dentistry3000-465	196	19	cytokines	cytokine	VERB
dentistry3000-465	196	20	profile	profile	VERB
dentistry3000-465	196	21	changes	change	NOUN
dentistry3000-465	196	22	in	in	ADP
dentistry3000-465	196	23	patients	patient	NOUN
dentistry3000-465	196	24	with	with	ADP
dentistry3000-465	196	25	periodontitis	periodontitis	NOUN
dentistry3000-465	196	26	:	:	PUNCT
dentistry3000-465	196	27	a	a	DET
dentistry3000-465	196	28	pilot	pilot	NOUN
dentistry3000-465	196	29	study	study	NOUN
dentistry3000-465	196	30	comparing	compare	VERB
dentistry3000-465	196	31	healthy	healthy	ADJ
dentistry3000-465	196	32	and	and	CCONJ
dentistry3000-465	196	33	diseased	diseased	ADJ
dentistry3000-465	196	34	sites	site	NOUN
dentistry3000-465	196	35	in	in	ADP
dentistry3000-465	196	36	the	the	DET
dentistry3000-465	196	37	same	same	ADJ
dentistry3000-465	196	38	oral	oral	ADJ
dentistry3000-465	196	39	cavities	cavity	NOUN
dentistry3000-465	196	40	.	.	PUNCT
dentistry3000-465	197	1	esparbès	esparbès	PROPN
dentistry3000-465	197	2	p	p	PROPN
dentistry3000-465	197	3	,	,	PUNCT
dentistry3000-465	197	4	legrand	legrand	PROPN
dentistry3000-465	197	5	a	a	X
dentistry3000-465	197	6	,	,	PUNCT
dentistry3000-465	197	7	bandiaky	bandiaky	ADV
dentistry3000-465	197	8	on	on	ADP
dentistry3000-465	197	9	,	,	PUNCT
dentistry3000-465	197	10	chéraudcarpentier	chéraudcarpentier	PROPN
dentistry3000-465	197	11	m	m	PROPN
dentistry3000-465	197	12	,	,	PUNCT
dentistry3000-465	197	13	martin	martin	PROPN
dentistry3000-465	197	14	h	h	PROPN
dentistry3000-465	197	15	,	,	PUNCT
dentistry3000-465	197	16	montassier	montassier	NOUN
dentistry3000-465	197	17	e	e	NOUN
dentistry3000-465	197	18	,	,	PUNCT
dentistry3000-465	197	19	et	et	PROPN
dentistry3000-465	197	20	al	al	PROPN
dentistry3000-465	197	21	.	.	PUNCT
dentistry3000-465	197	22	microorganisms	microorganism	NOUN
dentistry3000-465	198	1	[	[	X
dentistry3000-465	198	2	internet	internet	NOUN
dentistry3000-465	198	3	]	]	PUNCT
dentistry3000-465	198	4	.	.	PUNCT
dentistry3000-465	199	1	2021;9:2364	2021;9:2364	PROPN
dentistry3000-465	199	2	.	.	PUNCT
dentistry3000-465	199	3	available	available	ADJ
dentistry3000-465	199	4	from	from	ADP
dentistry3000-465	199	5	:	:	PUNCT
dentistry3000-465	199	6	https://www.mdpi.com/20762607/9/11/2364	https://www.mdpi.com/20762607/9/11/2364	NOUN
dentistry3000-465	199	7	8	8	NUM
dentistry3000-465	199	8	.	.	PUNCT
dentistry3000-465	200	1	the	the	DET
dentistry3000-465	200	2	prevalence	prevalence	NOUN
dentistry3000-465	200	3	of	of	ADP
dentistry3000-465	200	4	novel	novel	ADJ
dentistry3000-465	200	5	periodontal	periodontal	ADJ
dentistry3000-465	200	6	pathogens	pathogen	NOUN
dentistry3000-465	200	7	and	and	CCONJ
dentistry3000-465	200	8	bacterial	bacterial	ADJ
dentistry3000-465	200	9	complexes	complex	NOUN
dentistry3000-465	200	10	in	in	ADP
dentistry3000-465	200	11	stage	stage	NOUN
dentistry3000-465	200	12	ii	ii	PROPN
dentistry3000-465	200	13	generalized	generalize	VERB
dentistry3000-465	200	14	periodontitis	periodontitis	NOUN
dentistry3000-465	200	15	based	base	VERB
dentistry3000-465	200	16	on	on	ADP
dentistry3000-465	200	17	16s	16s	PROPN
dentistry3000-465	200	18	rrna	rrna	PROPN
dentistry3000-465	200	19	next	next	ADJ
dentistry3000-465	200	20	generation	generation	NOUN
dentistry3000-465	200	21	sequencing	sequence	VERB
dentistry3000-465	200	22	.	.	PUNCT
dentistry3000-465	201	1	abu	abu	PROPN
dentistry3000-465	201	2	fanas	fanas	PROPN
dentistry3000-465	201	3	s	s	PART
dentistry3000-465	201	4	,	,	PUNCT
dentistry3000-465	201	5	brigi	brigi	NOUN
dentistry3000-465	201	6	c	c	X
dentistry3000-465	201	7	,	,	PUNCT
dentistry3000-465	201	8	varma	varma	PROPN
dentistry3000-465	201	9	sr	sr	PROPN
dentistry3000-465	201	10	,	,	PUNCT
dentistry3000-465	201	11	desai	desai	PROPN
dentistry3000-465	201	12	v	v	PROPN
dentistry3000-465	201	13	,	,	PUNCT
dentistry3000-465	201	14	senok	senok	PROPN
dentistry3000-465	201	15	a	a	NOUN
dentistry3000-465	201	16	,	,	PUNCT
dentistry3000-465	201	17	d’souza	d’souza	PROPN
dentistry3000-465	201	18	j.	j.	PROPN
dentistry3000-465	201	19	j	j	PROPN
dentistry3000-465	201	20	appl	appl	PROPN
dentistry3000-465	201	21	oral	oral	PROPN
dentistry3000-465	201	22	sci	sci	PROPN
dentistry3000-465	202	1	[	[	X
dentistry3000-465	202	2	internet	internet	NOUN
dentistry3000-465	202	3	]	]	PUNCT
dentistry3000-465	202	4	.	.	PUNCT
dentistry3000-465	203	1	2021;29	2021;29	NUM
dentistry3000-465	203	2	:	:	PUNCT
dentistry3000-465	203	3	e20200787	e20200787	NOUN
dentistry3000-465	203	4	.	.	PROPN
dentistry3000-465	203	5	available	available	ADJ
dentistry3000-465	203	6	from	from	ADP
dentistry3000-465	203	7	:	:	PUNCT
dentistry3000-465	203	8	http://www.scielo.br/scielo.php?scrip	http://www.scielo.br/scielo.php?scrip	PROPN
dentistry3000-465	203	9	t	t	NOUN
dentistry3000-465	203	10	=	=	SYM
dentistry3000-465	203	11	sci_arttext&pid	sci_arttext&pid	NOUN
dentistry3000-465	203	12	=	=	NOUN
dentistry3000-465	203	13	s167877572021000100425&tlng	s167877572021000100425&tlng	NOUN
dentistry3000-465	203	14	=	=	X
dentistry3000-465	203	15	enpmid	enpmid	ADJ
dentistry3000-465	203	16	:	:	PUNCT
dentistry3000-465	203	17	34008792	34008792	NUM
dentistry3000-465	203	18	9	9	NUM
dentistry3000-465	203	19	.	.	PUNCT
dentistry3000-465	203	20	qiime	qiime	PROPN
dentistry3000-465	203	21	allows	allow	VERB
dentistry3000-465	203	22	analysis	analysis	NOUN
dentistry3000-465	203	23	of	of	ADP
dentistry3000-465	203	24	highthroughput	highthroughput	ADJ
dentistry3000-465	203	25	community	community	NOUN
dentistry3000-465	203	26	sequencing	sequence	VERB
dentistry3000-465	203	27	data	datum	NOUN
dentistry3000-465	203	28	.	.	PUNCT
dentistry3000-465	204	1	caporaso	caporaso	PROPN
dentistry3000-465	204	2	jg	jg	PROPN
dentistry3000-465	204	3	,	,	PUNCT
dentistry3000-465	204	4	kuczynski	kuczynski	PROPN
dentistry3000-465	204	5	j	j	PROPN
dentistry3000-465	204	6	,	,	PUNCT
dentistry3000-465	204	7	stombaugh	stombaugh	PROPN
dentistry3000-465	204	8	j	j	PROPN
dentistry3000-465	204	9	,	,	PUNCT
dentistry3000-465	204	10	bittinger	bittinger	PROPN
dentistry3000-465	204	11	k	k	PROPN
dentistry3000-465	204	12	,	,	PUNCT
dentistry3000-465	204	13	bushman	bushman	PROPN
dentistry3000-465	204	14	fd	fd	PROPN
dentistry3000-465	204	15	,	,	PUNCT
dentistry3000-465	204	16	costello	costello	PROPN
dentistry3000-465	204	17	ek	ek	PROPN
dentistry3000-465	204	18	,	,	PUNCT
dentistry3000-465	204	19	et	et	PROPN
dentistry3000-465	204	20	al	al	PROPN
dentistry3000-465	204	21	.	.	PUNCT
dentistry3000-465	205	1	nat	nat	PROPN
dentistry3000-465	205	2	methods	method	NOUN
dentistry3000-465	205	3	[	[	X
dentistry3000-465	205	4	internet	internet	NOUN
dentistry3000-465	205	5	]	]	PUNCT
dentistry3000-465	205	6	.	.	PUNCT
dentistry3000-465	206	1	2010/04/11	2010/04/11	NUM
dentistry3000-465	206	2	.	.	PUNCT
dentistry3000-465	207	1	2010;7:335–6	2010;7:335–6	ADJ
dentistry3000-465	207	2	.	.	PUNCT
dentistry3000-465	208	1	available	available	ADJ
dentistry3000-465	208	2	from	from	ADP
dentistry3000-465	208	3	:	:	PUNCT
dentistry3000-465	208	4	https://pubmed.ncbi.nlm.nih.gov/203	https://pubmed.ncbi.nlm.nih.gov/203	PROPN
dentistry3000-465	208	5	83131	83131	NUM
dentistry3000-465	208	6	10	10	NUM
dentistry3000-465	208	7	.	.	PUNCT
dentistry3000-465	209	1	peat	peat	NOUN
dentistry3000-465	209	2	:	:	PUNCT
dentistry3000-465	209	3	an	an	DET
dentistry3000-465	209	4	intelligent	intelligent	ADJ
dentistry3000-465	209	5	and	and	CCONJ
dentistry3000-465	209	6	efficient	efficient	ADJ
dentistry3000-465	209	7	paired	pair	VERB
dentistry3000-465	209	8	-	-	PUNCT
dentistry3000-465	209	9	end	end	NOUN
dentistry3000-465	209	10	sequencing	sequence	VERB
dentistry3000-465	209	11	adapter	adapter	NOUN
dentistry3000-465	209	12	trimming	trim	VERB
dentistry3000-465	209	13	algorithm	algorithm	NOUN
dentistry3000-465	209	14	.	.	PUNCT
dentistry3000-465	210	1	li	li	PROPN
dentistry3000-465	210	2	y	y	PROPN
dentistry3000-465	210	3	-	-	PUNCT
dentistry3000-465	210	4	l	l	PROPN
dentistry3000-465	210	5	,	,	PUNCT
dentistry3000-465	210	6	weng	weng	PROPN
dentistry3000-465	210	7	j	j	PROPN
dentistry3000-465	210	8	-	-	PUNCT
dentistry3000-465	210	9	c	c	PROPN
dentistry3000-465	210	10	,	,	PUNCT
dentistry3000-465	210	11	hsiao	hsiao	PROPN
dentistry3000-465	210	12	c	c	PROPN
dentistry3000-465	210	13	-	-	PUNCT
dentistry3000-465	210	14	c	c	PROPN
dentistry3000-465	210	15	,	,	PUNCT
dentistry3000-465	210	16	chou	chou	PROPN
dentistry3000-465	210	17	m	m	PROPN
dentistry3000-465	210	18	-	-	PUNCT
dentistry3000-465	210	19	t	t	PROPN
dentistry3000-465	210	20	,	,	PUNCT
dentistry3000-465	210	21	tseng	tseng	PROPN
dentistry3000-465	210	22	c	c	PROPN
dentistry3000-465	210	23	-	-	PUNCT
dentistry3000-465	210	24	w	w	PROPN
dentistry3000-465	210	25	,	,	PUNCT
dentistry3000-465	210	26	hung	hang	VERB
dentistry3000-465	210	27	j	j	PROPN
dentistry3000-465	210	28	-	-	PROPN
dentistry3000-465	210	29	h.	h.	PROPN
dentistry3000-465	210	30	bmc	bmc	PROPN
dentistry3000-465	210	31	bioinformatics	bioinformatics	PROPN
dentistry3000-465	211	1	[	[	X
dentistry3000-465	211	2	internet	internet	NOUN
dentistry3000-465	211	3	]	]	PUNCT
dentistry3000-465	211	4	.	.	PUNCT
dentistry3000-465	212	1	biomed	biome	VERB
dentistry3000-465	212	2	central	central	PROPN
dentistry3000-465	212	3	ltd	ltd	PROPN
dentistry3000-465	212	4	;	;	PUNCT
dentistry3000-465	212	5	2015;16	2015;16	NUM
dentistry3000-465	212	6	suppl	suppl	ADJ
dentistry3000-465	212	7	1	1	NUM
dentistry3000-465	212	8	:	:	PUNCT
dentistry3000-465	212	9	s2	s2	PROPN
dentistry3000-465	212	10	.	.	PUNCT
dentistry3000-465	212	11	available	available	ADJ
dentistry3000-465	212	12	from	from	ADP
dentistry3000-465	212	13	:	:	PUNCT
dentistry3000-465	212	14	http://www.biomedcentral.com/qc/1	http://www.biomedcentral.com/qc/1	PROPN
dentistry3000-465	212	15	471	471	NUM
dentistry3000-465	212	16	-	-	PUNCT
dentistry3000-465	212	17	2105/16	2105/16	NUM
dentistry3000-465	212	18	/	/	SYM
dentistry3000-465	212	19	s1	s1	PROPN
dentistry3000-465	212	20	/	/	SYM
dentistry3000-465	212	21	s2pmid	s2pmid	NOUN
dentistry3000-465	212	22	:	:	PUNCT
dentistry3000-465	212	23	25707528	25707528	NUM
dentistry3000-465	212	24	11	11	NUM
dentistry3000-465	212	25	.	.	PUNCT
dentistry3000-465	213	1	bbmerge	bbmerge	ADJ
dentistry3000-465	213	2	–	–	PUNCT
dentistry3000-465	213	3	accurate	accurate	ADJ
dentistry3000-465	213	4	paired	pair	VERB
dentistry3000-465	213	5	shotgun	shotgun	NOUN
dentistry3000-465	213	6	read	read	VERB
dentistry3000-465	213	7	merging	merge	VERB
dentistry3000-465	213	8	via	via	ADP
dentistry3000-465	213	9	overlap	overlap	NOUN
dentistry3000-465	213	10	.	.	PUNCT
dentistry3000-465	214	1	bushnell	bushnell	PROPN
dentistry3000-465	214	2	b	b	PROPN
dentistry3000-465	214	3	,	,	PUNCT
dentistry3000-465	214	4	rood	rood	PROPN
dentistry3000-465	214	5	j	j	PROPN
dentistry3000-465	214	6	,	,	PUNCT
dentistry3000-465	214	7	singer	singer	NOUN
dentistry3000-465	214	8	e.	e.	PROPN
dentistry3000-465	214	9	biggs	biggs	PROPN
dentistry3000-465	214	10	pj	pj	PROPN
dentistry3000-465	214	11	,	,	PUNCT
dentistry3000-465	214	12	editor	editor	NOUN
dentistry3000-465	214	13	.	.	PUNCT
dentistry3000-465	215	1	plos	plos	PROPN
dentistry3000-465	215	2	one	one	NUM
dentistry3000-465	216	1	[	[	X
dentistry3000-465	216	2	internet	internet	NOUN
dentistry3000-465	216	3	]	]	PUNCT
dentistry3000-465	216	4	.	.	PUNCT
dentistry3000-465	217	1	2017;12	2017;12	NOUN
dentistry3000-465	217	2	:	:	PUNCT
dentistry3000-465	217	3	e0185056	e0185056	PROPN
dentistry3000-465	217	4	.	.	PROPN
dentistry3000-465	217	5	available	available	ADJ
dentistry3000-465	217	6	from	from	ADP
dentistry3000-465	217	7	:	:	PUNCT
dentistry3000-465	217	8	https://dx.plos.org/10.1371/journal.p	https://dx.plos.org/10.1371/journal.p	NOUN
dentistry3000-465	217	9	one.0185056pmid	one.0185056pmid	PROPN
dentistry3000-465	217	10	:	:	PUNCT
dentistry3000-465	217	11	29073143	29073143	NUM
dentistry3000-465	217	12	12	12	NUM
dentistry3000-465	217	13	.	.	PUNCT
dentistry3000-465	218	1	greengenes	greengene	NOUN
dentistry3000-465	218	2	,	,	PUNCT
dentistry3000-465	218	3	a	a	DET
dentistry3000-465	218	4	chimera	chimera	NOUN
dentistry3000-465	218	5	-	-	PUNCT
dentistry3000-465	218	6	checked	check	VERB
dentistry3000-465	218	7	16s	16s	PROPN
dentistry3000-465	218	8	rrna	rrna	PROPN
dentistry3000-465	218	9	gene	gene	NOUN
dentistry3000-465	218	10	database	database	NOUN
dentistry3000-465	218	11	and	and	CCONJ
dentistry3000-465	218	12	workbench	workbench	VERB
dentistry3000-465	218	13	compatible	compatible	ADJ
dentistry3000-465	218	14	with	with	ADP
dentistry3000-465	218	15	arb	arb	PROPN
dentistry3000-465	218	16	.	.	PUNCT
dentistry3000-465	218	17	desantis	desantis	PROPN
dentistry3000-465	218	18	tz	tz	PROPN
dentistry3000-465	218	19	,	,	PUNCT
dentistry3000-465	218	20	hugenholtz	hugenholtz	NOUN
dentistry3000-465	218	21	p	p	NOUN
dentistry3000-465	218	22	,	,	PUNCT
dentistry3000-465	218	23	larsen	larsen	PROPN
dentistry3000-465	218	24	n	n	PROPN
dentistry3000-465	218	25	,	,	PUNCT
dentistry3000-465	218	26	rojas	rojas	PROPN
dentistry3000-465	218	27	m	m	PROPN
dentistry3000-465	218	28	,	,	PUNCT
dentistry3000-465	218	29	brodie	brodie	PROPN
dentistry3000-465	218	30	el	el	PROPN
dentistry3000-465	218	31	,	,	PUNCT
dentistry3000-465	218	32	keller	keller	PROPN
dentistry3000-465	218	33	k	k	PROPN
dentistry3000-465	218	34	,	,	PUNCT
dentistry3000-465	218	35	et	et	PROPN
dentistry3000-465	218	36	al	al	PROPN
dentistry3000-465	218	37	.	.	PROPN
dentistry3000-465	218	38	appl	appl	PROPN
dentistry3000-465	218	39	environ	environ	PROPN
dentistry3000-465	218	40	microbiol	microbiol	PROPN
dentistry3000-465	219	1	[	[	X
dentistry3000-465	219	2	internet	internet	NOUN
dentistry3000-465	219	3	]	]	PUNCT
dentistry3000-465	219	4	.	.	PUNCT
dentistry3000-465	220	1	american	american	ADJ
dentistry3000-465	220	2	society	society	PROPN
dentistry3000-465	220	3	for	for	ADP
dentistry3000-465	220	4	microbiology	microbiology	NOUN
dentistry3000-465	220	5	;	;	PUNCT
dentistry3000-465	220	6	2006;72:5069–72	2006;72:5069–72	NUM
dentistry3000-465	220	7	.	.	PUNCT
dentistry3000-465	220	8	available	available	ADJ
dentistry3000-465	220	9	from	from	ADP
dentistry3000-465	220	10	:	:	PUNCT
dentistry3000-465	220	11	https://pubmed.ncbi.nlm.nih.gov/168	https://pubmed.ncbi.nlm.nih.gov/168	NOUN
dentistry3000-465	220	12	20507	20507	NUM
dentistry3000-465	220	13	13	13	NUM
dentistry3000-465	220	14	.	.	PUNCT
dentistry3000-465	221	1	nasopharyngeal	nasopharyngeal	ADJ
dentistry3000-465	221	2	microbiota	microbiota	NOUN
dentistry3000-465	221	3	in	in	ADP
dentistry3000-465	221	4	children	child	NOUN
dentistry3000-465	221	5	with	with	ADP
dentistry3000-465	221	6	invasive	invasive	ADJ
dentistry3000-465	221	7	pneumococcal	pneumococcal	ADJ
dentistry3000-465	221	8	disease	disease	NOUN
dentistry3000-465	221	9	:	:	PUNCT
dentistry3000-465	221	10	identification	identification	NOUN
dentistry3000-465	221	11	of	of	ADP
dentistry3000-465	221	12	bacteria	bacteria	NOUN
dentistry3000-465	221	13	with	with	ADP
dentistry3000-465	221	14	potential	potential	ADJ
dentistry3000-465	221	15	disease	disease	NOUN
dentistry3000-465	221	16	-	-	PUNCT
dentistry3000-465	221	17	promoting	promote	VERB
dentistry3000-465	221	18	and	and	CCONJ
dentistry3000-465	221	19	protective	protective	ADJ
dentistry3000-465	221	20	effects	effect	NOUN
dentistry3000-465	221	21	.	.	PUNCT
dentistry3000-465	222	1	camelo	camelo	NOUN
dentistry3000-465	222	2	-	-	PUNCT
dentistry3000-465	222	3	castillo	castillo	PROPN
dentistry3000-465	222	4	a	a	PROPN
dentistry3000-465	222	5	,	,	PUNCT
dentistry3000-465	222	6	henares	henares	PROPN
dentistry3000-465	222	7	d	d	PROPN
dentistry3000-465	222	8	,	,	PUNCT
dentistry3000-465	222	9	brotons	broton	NOUN
dentistry3000-465	222	10	p	p	X
dentistry3000-465	222	11	,	,	PUNCT
dentistry3000-465	222	12	galiana	galiana	PROPN
dentistry3000-465	222	13	a	a	PRON
dentistry3000-465	222	14	,	,	PUNCT
dentistry3000-465	222	15	rodríguez	rodríguez	PROPN
dentistry3000-465	222	16	jc	jc	PROPN
dentistry3000-465	222	17	,	,	PUNCT
dentistry3000-465	222	18	mira	mira	PROPN
dentistry3000-465	222	19	a	a	X
dentistry3000-465	222	20	,	,	PUNCT
dentistry3000-465	222	21	et	et	PROPN
dentistry3000-465	222	22	al	al	PROPN
dentistry3000-465	222	23	.	.	PROPN
dentistry3000-465	222	24	front	front	PROPN
dentistry3000-465	222	25	microbiol	microbiol	PROPN
dentistry3000-465	222	26	.	.	PUNCT
dentistry3000-465	223	1	2019;10	2019;10	NOUN
dentistry3000-465	223	2	.	.	NOUN
dentistry3000-465	223	3	14	14	NUM
dentistry3000-465	223	4	.	.	PUNCT
dentistry3000-465	224	1	quantitative	quantitative	ADJ
dentistry3000-465	224	2	and	and	CCONJ
dentistry3000-465	224	3	qualitative	qualitative	ADJ
dentistry3000-465	224	4	β	β	NOUN
dentistry3000-465	224	5	diversity	diversity	NOUN
dentistry3000-465	224	6	measures	measure	NOUN
dentistry3000-465	224	7	lead	lead	VERB
dentistry3000-465	224	8	to	to	ADP
dentistry3000-465	224	9	different	different	ADJ
dentistry3000-465	224	10	insights	insight	NOUN
dentistry3000-465	224	11	into	into	ADP
dentistry3000-465	224	12	factors	factor	NOUN
dentistry3000-465	224	13	that	that	PRON
dentistry3000-465	224	14	structure	structure	VERB
dentistry3000-465	224	15	microbial	microbial	ADJ
dentistry3000-465	224	16	communities	community	NOUN
dentistry3000-465	224	17	.	.	PUNCT
dentistry3000-465	225	1	lozupone	lozupone	NOUN
dentistry3000-465	225	2	ca	ca	NOUN
dentistry3000-465	225	3	,	,	PUNCT
dentistry3000-465	225	4	hamady	hamady	PROPN
dentistry3000-465	225	5	m	m	PROPN
dentistry3000-465	225	6	,	,	PUNCT
dentistry3000-465	225	7	kelley	kelley	PROPN
dentistry3000-465	225	8	st	st	PROPN
dentistry3000-465	225	9	,	,	PUNCT
dentistry3000-465	225	10	knight	knight	PROPN
dentistry3000-465	225	11	r.	r.	PROPN
dentistry3000-465	225	12	appl	appl	PROPN
dentistry3000-465	225	13	environ	environ	PROPN
dentistry3000-465	225	14	microbiol	microbiol	PROPN
dentistry3000-465	226	1	[	[	X
dentistry3000-465	226	2	internet	internet	NOUN
dentistry3000-465	226	3	]	]	PUNCT
dentistry3000-465	226	4	.	.	PUNCT
dentistry3000-465	227	1	2007;73:1576–85	2007;73:1576–85	NUM
dentistry3000-465	227	2	.	.	PUNCT
dentistry3000-465	227	3	available	available	ADJ
dentistry3000-465	227	4	from	from	ADP
dentistry3000-465	227	5	:	:	PUNCT
dentistry3000-465	227	6	https://europepmc.org/articles/pmc	https://europepmc.org/articles/pmc	PROPN
dentistry3000-465	227	7	1828774	1828774	NUM
dentistry3000-465	227	8	15	15	NUM
dentistry3000-465	227	9	.	.	PUNCT
dentistry3000-465	228	1	a	a	DET
dentistry3000-465	228	2	new	new	ADJ
dentistry3000-465	228	3	method	method	NOUN
dentistry3000-465	228	4	for	for	ADP
dentistry3000-465	228	5	non	non	ADJ
dentistry3000-465	228	6	-	-	ADJ
dentistry3000-465	228	7	parametric	parametric	ADJ
dentistry3000-465	228	8	multivariate	multivariate	NOUN
dentistry3000-465	228	9	analysis	analysis	NOUN
dentistry3000-465	228	10	of	of	ADP
dentistry3000-465	228	11	variance	variance	NOUN
dentistry3000-465	228	12	.	.	PUNCT
dentistry3000-465	229	1	anderson	anderson	PROPN
dentistry3000-465	229	2	mj	mj	PROPN
dentistry3000-465	229	3	.	.	PUNCT
dentistry3000-465	230	1	austral	austral	PROPN
dentistry3000-465	230	2	ecol	ecol	PROPN
dentistry3000-465	231	1	[	[	X
dentistry3000-465	231	2	internet	internet	NOUN
dentistry3000-465	231	3	]	]	PUNCT
dentistry3000-465	231	4	.	.	PUNCT
dentistry3000-465	232	1	2001;26:32–46	2001;26:32–46	X
dentistry3000-465	232	2	.	.	PUNCT
dentistry3000-465	233	1	available	available	ADJ
dentistry3000-465	233	2	from	from	ADP
dentistry3000-465	233	3	:	:	PUNCT
dentistry3000-465	233	4	https://onlinelibrary.wiley.com/doi/a	https://onlinelibrary.wiley.com/doi/a	PROPN
dentistry3000-465	233	5	bs/10.1111	bs/10.1111	PROPN
dentistry3000-465	233	6	/	/	SYM
dentistry3000-465	233	7	j.14429993.2001.01070.pp.x	j.14429993.2001.01070.pp.x	PROPN
dentistry3000-465	233	8	16	16	NUM
dentistry3000-465	233	9	.	.	PUNCT
dentistry3000-465	234	1	substantial	substantial	ADJ
dentistry3000-465	234	2	differences	difference	NOUN
dentistry3000-465	234	3	in	in	ADP
dentistry3000-465	234	4	the	the	DET
dentistry3000-465	234	5	subgingival	subgingival	ADJ
dentistry3000-465	234	6	microbiome	microbiome	NOUN
dentistry3000-465	234	7	measured	measure	VERB
dentistry3000-465	234	8	by	by	ADP
dentistry3000-465	234	9	16s	16	NOUN
dentistry3000-465	234	10	metagenomics	metagenomic	NOUN
dentistry3000-465	234	11	according	accord	VERB
dentistry3000-465	234	12	to	to	ADP
dentistry3000-465	234	13	periodontitis	periodontitis	NOUN
dentistry3000-465	234	14	status	status	NOUN
dentistry3000-465	234	15	in	in	ADP
dentistry3000-465	234	16	older	old	ADJ
dentistry3000-465	234	17	women	woman	NOUN
dentistry3000-465	234	18	.	.	PUNCT
dentistry3000-465	235	1	lamonte	lamonte	PROPN
dentistry3000-465	235	2	mj	mj	PROPN
dentistry3000-465	235	3	,	,	PUNCT
dentistry3000-465	235	4	genco	genco	PROPN
dentistry3000-465	235	5	rj	rj	PROPN
dentistry3000-465	235	6	,	,	PUNCT
dentistry3000-465	235	7	zheng	zheng	PROPN
dentistry3000-465	235	8	w	w	PROPN
dentistry3000-465	235	9	,	,	PUNCT
dentistry3000-465	235	10	mcskimming	mcskimming	NOUN
dentistry3000-465	235	11	di	di	NOUN
dentistry3000-465	235	12	,	,	PUNCT
dentistry3000-465	235	13	andrews	andrews	PROPN
dentistry3000-465	235	14	ca	ca	PROPN
dentistry3000-465	235	15	,	,	PUNCT
dentistry3000-465	235	16	hovey	hovey	PROPN
dentistry3000-465	235	17	km	km	PROPN
dentistry3000-465	235	18	,	,	PUNCT
dentistry3000-465	235	19	et	et	PROPN
dentistry3000-465	235	20	al	al	PROPN
dentistry3000-465	235	21	.	.	PROPN
dentistry3000-465	235	22	dent	dent	PROPN
dentistry3000-465	235	23	j.	j.	PROPN
dentistry3000-465	235	24	2018;6	2018;6	PROPN
dentistry3000-465	235	25	.	.	PUNCT
dentistry3000-465	236	1	17	17	NUM
dentistry3000-465	236	2	.	.	PUNCT
dentistry3000-465	237	1	comparative	comparative	ADJ
dentistry3000-465	237	2	analyses	analysis	NOUN
dentistry3000-465	237	3	of	of	ADP
dentistry3000-465	237	4	subgingival	subgingival	ADJ
dentistry3000-465	237	5	microbiome	microbiome	NOUN
dentistry3000-465	237	6	in	in	ADP
dentistry3000-465	237	7	chronic	chronic	ADJ
dentistry3000-465	237	8	periodontitis	periodontitis	NOUN
dentistry3000-465	237	9	patients	patient	NOUN
dentistry3000-465	237	10	with	with	ADP
dentistry3000-465	237	11	and	and	CCONJ
dentistry3000-465	237	12	without	without	ADP
dentistry3000-465	237	13	iga	iga	PROPN
dentistry3000-465	237	14	nephropathy	nephropathy	NOUN
dentistry3000-465	237	15	by	by	ADP
dentistry3000-465	237	16	high	high	ADJ
dentistry3000-465	237	17	throughput	throughput	NOUN
dentistry3000-465	237	18	16s	16	NOUN
dentistry3000-465	237	19	rrna	rrna	VERB
dentistry3000-465	237	20	sequencing	sequence	VERB
dentistry3000-465	237	21	.	.	PUNCT
dentistry3000-465	238	1	cao	cao	PROPN
dentistry3000-465	238	2	y	y	PROPN
dentistry3000-465	238	3	,	,	PUNCT
dentistry3000-465	238	4	qiao	qiao	PROPN
dentistry3000-465	238	5	m	m	PROPN
dentistry3000-465	238	6	,	,	PUNCT
dentistry3000-465	238	7	tian	tian	PROPN
dentistry3000-465	238	8	z	z	PROPN
dentistry3000-465	238	9	,	,	PUNCT
dentistry3000-465	238	10	yu	yu	PROPN
dentistry3000-465	238	11	y	y	PROPN
dentistry3000-465	238	12	,	,	PUNCT
dentistry3000-465	238	13	xu	xu	PROPN
dentistry3000-465	239	1	b	b	PROPN
dentistry3000-465	239	2	,	,	PUNCT
dentistry3000-465	239	3	lao	lao	PROPN
dentistry3000-465	239	4	w	w	PROPN
dentistry3000-465	239	5	,	,	PUNCT
dentistry3000-465	239	6	et	et	PROPN
dentistry3000-465	239	7	al	al	PROPN
dentistry3000-465	239	8	.	.	PROPN
dentistry3000-465	239	9	cell	cell	PROPN
dentistry3000-465	239	10	physiol	physiol	PROPN
dentistry3000-465	239	11	biochem	biochem	PROPN
dentistry3000-465	240	1	[	[	X
dentistry3000-465	240	2	internet	internet	NOUN
dentistry3000-465	240	3	]	]	PUNCT
dentistry3000-465	240	4	.	.	PUNCT
dentistry3000-465	241	1	2018;47:774–83	2018;47:774–83	X
dentistry3000-465	241	2	.	.	PUNCT
dentistry3000-465	241	3	available	available	ADJ
dentistry3000-465	241	4	from	from	ADP
dentistry3000-465	241	5	:	:	PUNCT
dentistry3000-465	241	6	https://www.karger.com/article/full	https://www.karger.com/article/full	VERB
dentistry3000-465	241	7	text/490029pmid	text/490029pmid	ADJ
dentistry3000-465	241	8	:	:	PUNCT
dentistry3000-465	241	9	29807361	29807361	NUM
dentistry3000-465	241	10	18	18	NUM
dentistry3000-465	241	11	.	.	PUNCT
dentistry3000-465	242	1	the	the	DET
dentistry3000-465	242	2	subgingival	subgingival	ADJ
dentistry3000-465	242	3	microbiome	microbiome	NOUN
dentistry3000-465	242	4	of	of	ADP
dentistry3000-465	242	5	periodontal	periodontal	ADJ
dentistry3000-465	242	6	pockets	pocket	NOUN
dentistry3000-465	242	7	with	with	ADP
dentistry3000-465	242	8	different	different	ADJ
dentistry3000-465	242	9	probing	probe	VERB
dentistry3000-465	242	10	depths	depth	NOUN
dentistry3000-465	242	11	in	in	ADP
dentistry3000-465	242	12	chronic	chronic	ADJ
dentistry3000-465	242	13	and	and	CCONJ
dentistry3000-465	242	14	aggressive	aggressive	ADJ
dentistry3000-465	242	15	periodontitis	periodontitis	NOUN
dentistry3000-465	242	16	:	:	PUNCT
dentistry3000-465	242	17	a	a	DET
dentistry3000-465	242	18	pilot	pilot	NOUN
dentistry3000-465	242	19	study	study	NOUN
dentistry3000-465	242	20	.	.	PUNCT
dentistry3000-465	243	1	shi	shi	PROPN
dentistry3000-465	243	2	m	m	PROPN
dentistry3000-465	243	3	,	,	PUNCT
dentistry3000-465	243	4	wei	wei	PROPN
dentistry3000-465	243	5	y	y	PROPN
dentistry3000-465	243	6	,	,	PUNCT
dentistry3000-465	243	7	hu	hu	PROPN
dentistry3000-465	243	8	w	w	PROPN
dentistry3000-465	243	9	,	,	PUNCT
dentistry3000-465	243	10	nie	nie	PROPN
dentistry3000-465	243	11	y	y	PROPN
dentistry3000-465	243	12	,	,	PUNCT
dentistry3000-465	243	13	wu	wu	PROPN
dentistry3000-465	243	14	x	x	PROPN
dentistry3000-465	243	15	,	,	PUNCT
dentistry3000-465	243	16	lu	lu	PROPN
dentistry3000-465	243	17	r.	r.	PROPN
dentistry3000-465	243	18	front	front	PROPN
dentistry3000-465	243	19	cell	cell	PROPN
dentistry3000-465	243	20	infect	infect	VERB
dentistry3000-465	243	21	microbiol	microbiol	NOUN
dentistry3000-465	244	1	[	[	X
dentistry3000-465	244	2	internet	internet	NOUN
dentistry3000-465	244	3	]	]	PUNCT
dentistry3000-465	244	4	.	.	PUNCT
dentistry3000-465	245	1	2018;8:124	2018;8:124	NUM
dentistry3000-465	245	2	.	.	PUNCT
dentistry3000-465	246	1	available	available	ADJ
dentistry3000-465	246	2	from	from	ADP
dentistry3000-465	246	3	:	:	PUNCT
dentistry3000-465	246	4	https://www.frontiersin.org/article/1	https://www.frontiersin.org/article/1	PROPN
dentistry3000-465	246	5	0.3389	0.3389	NUM
dentistry3000-465	246	6	/	/	SYM
dentistry3000-465	246	7	fcimb.2018.00124	fcimb.2018.00124	NOUN
dentistry3000-465	246	8	19	19	NUM
dentistry3000-465	246	9	.	.	PUNCT
dentistry3000-465	247	1	do	do	AUX
dentistry3000-465	247	2	different	different	ADJ
dentistry3000-465	247	3	probing	probe	VERB
dentistry3000-465	247	4	depths	depth	NOUN
dentistry3000-465	247	5	exhibit	exhibit	VERB
dentistry3000-465	247	6	striking	strike	VERB
dentistry3000-465	247	7	differences	difference	NOUN
dentistry3000-465	247	8	in	in	ADP
dentistry3000-465	247	9	microbial	microbial	ADJ
dentistry3000-465	247	10	profiles	profile	NOUN
dentistry3000-465	247	11	?	?	PUNCT
dentistry3000-465	248	1	pérez	pérez	NOUN
dentistry3000-465	248	2	-	-	PUNCT
dentistry3000-465	248	3	chaparro	chaparro	PROPN
dentistry3000-465	248	4	pj	pj	PROPN
dentistry3000-465	248	5	,	,	PUNCT
dentistry3000-465	248	6	mcculloch	mcculloch	PROPN
dentistry3000-465	248	7	ja	ja	PROPN
dentistry3000-465	248	8	,	,	PUNCT
dentistry3000-465	248	9	mamizuka	mamizuka	VERB
dentistry3000-465	248	10	em	em	PRON
dentistry3000-465	248	11	,	,	PUNCT
dentistry3000-465	248	12	moraes	moraes	PROPN
dentistry3000-465	248	13	a	a	DET
dentistry3000-465	248	14	da	da	PROPN
dentistry3000-465	248	15	cl	cl	NOUN
dentistry3000-465	248	16	,	,	PUNCT
dentistry3000-465	248	17	faveri	faveri	PROPN
dentistry3000-465	248	18	m	m	PROPN
dentistry3000-465	248	19	,	,	PUNCT
dentistry3000-465	248	20	figueiredo	figueiredo	PROPN
dentistry3000-465	248	21	lc	lc	PROPN
dentistry3000-465	248	22	,	,	PUNCT
dentistry3000-465	248	23	et	et	PROPN
dentistry3000-465	248	24	al	al	PROPN
dentistry3000-465	248	25	.	.	PUNCT
dentistry3000-465	249	1	j	j	PROPN
dentistry3000-465	249	2	clin	clin	PROPN
dentistry3000-465	249	3	periodontol	periodontol	PROPN
dentistry3000-465	250	1	[	[	X
dentistry3000-465	250	2	internet	internet	NOUN
dentistry3000-465	250	3	]	]	PUNCT
dentistry3000-465	250	4	.	.	PUNCT
dentistry3000-465	251	1	2018;45:26–37	2018;45:26–37	NUM
dentistry3000-465	251	2	.	.	PUNCT
dentistry3000-465	252	1	available	available	ADJ
dentistry3000-465	252	2	from	from	ADP
dentistry3000-465	252	3	:	:	PUNCT
dentistry3000-465	252	4	http://doi.wiley.com/10.1111/jcpe.12	http://doi.wiley.com/10.1111/jcpe.12	PROPN
dentistry3000-465	252	5	811pmid	811pmid	PROPN
dentistry3000-465	252	6	:	:	PUNCT
dentistry3000-465	252	7	28871594	28871594	NUM
dentistry3000-465	252	8	20	20	NUM
dentistry3000-465	252	9	.	.	PUNCT
dentistry3000-465	253	1	toward	toward	ADP
dentistry3000-465	253	2	personalized	personalized	ADJ
dentistry3000-465	253	3	oral	oral	ADJ
dentistry3000-465	253	4	diagnosis	diagnosis	NOUN
dentistry3000-465	253	5	:	:	PUNCT
dentistry3000-465	253	6	distinct	distinct	ADJ
dentistry3000-465	253	7	microbiome	microbiome	NOUN
dentistry3000-465	253	8	clusters	cluster	NOUN
dentistry3000-465	253	9	in	in	ADP
dentistry3000-465	253	10	periodontitis	periodontitis	NOUN
dentistry3000-465	253	11	biofilms	biofilm	NOUN
dentistry3000-465	253	12	.	.	PUNCT
dentistry3000-465	254	1	wirth	wirth	ADJ
dentistry3000-465	254	2	r	r	NOUN
dentistry3000-465	254	3	,	,	PUNCT
dentistry3000-465	254	4	pap	pap	NOUN
dentistry3000-465	254	5	b	b	NOUN
dentistry3000-465	254	6	,	,	PUNCT
dentistry3000-465	254	7	maróti	maróti	PROPN
dentistry3000-465	254	8	g	g	NOUN
dentistry3000-465	254	9	,	,	PUNCT
dentistry3000-465	254	10	vályi	vályi	ADP
dentistry3000-465	254	11	p	p	PRON
dentistry3000-465	254	12	,	,	PUNCT
dentistry3000-465	254	13	komlósi	komlósi	PROPN
dentistry3000-465	254	14	l	l	PROPN
dentistry3000-465	254	15	,	,	PUNCT
dentistry3000-465	254	16	barta	barta	PROPN
dentistry3000-465	254	17	n	n	CCONJ
dentistry3000-465	254	18	,	,	PUNCT
dentistry3000-465	254	19	et	et	PROPN
dentistry3000-465	254	20	al	al	PROPN
dentistry3000-465	254	21	.	.	PROPN
dentistry3000-465	254	22	front	front	ADJ
dentistry3000-465	254	23	cell	cell	NOUN
dentistry3000-465	254	24	infect	infect	VERB
dentistry3000-465	254	25	microbiol	microbiol	NOUN
dentistry3000-465	254	26	.	.	PUNCT
dentistry3000-465	255	1	2021;11:1–13	2021;11:1–13	NUM
dentistry3000-465	255	2	.	.	PUNCT
dentistry3000-465	256	1	21	21	NUM
dentistry3000-465	256	2	.	.	PUNCT
dentistry3000-465	257	1	species	species	NOUN
dentistry3000-465	257	2	-	-	PUNCT
dentistry3000-465	257	3	level	level	NOUN
dentistry3000-465	257	4	salivary	salivary	ADJ
dentistry3000-465	257	5	microbial	microbial	ADJ
dentistry3000-465	257	6	indicators	indicator	NOUN
dentistry3000-465	257	7	of	of	ADP
dentistry3000-465	257	8	well	well	ADV
dentistry3000-465	257	9	-	-	PUNCT
dentistry3000-465	257	10	resolved	resolve	VERB
dentistry3000-465	257	11	periodontitis	periodontitis	NOUN
dentistry3000-465	257	12	:	:	PUNCT
dentistry3000-465	257	13	a	a	DET
dentistry3000-465	257	14	preliminary	preliminary	ADJ
dentistry3000-465	257	15	investigation	investigation	NOUN
dentistry3000-465	257	16	.	.	PUNCT
dentistry3000-465	258	1	acharya	acharya	PROPN
dentistry3000-465	258	2	a	a	PROPN
dentistry3000-465	258	3	,	,	PUNCT
dentistry3000-465	258	4	chen	chen	PROPN
dentistry3000-465	258	5	t	t	PROPN
dentistry3000-465	258	6	,	,	PUNCT
dentistry3000-465	258	7	chan	chan	PROPN
dentistry3000-465	258	8	y	y	PROPN
dentistry3000-465	258	9	,	,	PUNCT
dentistry3000-465	258	10	watt	watt	PROPN
dentistry3000-465	258	11	rm	rm	PROPN
dentistry3000-465	258	12	,	,	PUNCT
dentistry3000-465	258	13	jin	jin	PROPN
dentistry3000-465	258	14	l	l	PROPN
dentistry3000-465	258	15	,	,	PUNCT
dentistry3000-465	258	16	mattheos	mattheos	X
dentistry3000-465	258	17	n.	n.	PROPN
dentistry3000-465	258	18	front	front	PROPN
dentistry3000-465	258	19	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN
dentistry3000-465	258	20	bacterial	bacterial	ADJ
dentistry3000-465	258	21	community	community	NOUN
dentistry3000-465	258	22	in	in	ADP
dentistry3000-465	258	23	dental	dental	ADJ
dentistry3000-465	258	24	biofilms	biofilm	NOUN
dentistry3000-465	258	25	linked	link	VERB
dentistry3000-465	258	26	to	to	ADP
dentistry3000-465	258	27	periodontal	periodontal	ADJ
dentistry3000-465	258	28	disease	disease	NOUN
dentistry3000-465	258	29	:	:	PUNCT
dentistry3000-465	258	30	an	an	DET
dentistry3000-465	258	31	intra	intra	ADJ
dentistry3000-465	258	32	-	-	ADJ
dentistry3000-465	258	33	subject	subject	ADJ
dentistry3000-465	258	34	metagenomics	metagenomics	NOUN
dentistry3000-465	258	35	study	study	NOUN
dentistry3000-465	258	36	vol	vol	NOUN
dentistry3000-465	258	37	12	12	NUM
dentistry3000-465	258	38	no	no	PRON
dentistry3000-465	258	39	1	1	NUM
dentistry3000-465	258	40	(	(	PUNCT
dentistry3000-465	258	41	2024	2024	NUM
dentistry3000-465	258	42	)	)	PUNCT
dentistry3000-465	258	43	doi	doi	NOUN
dentistry3000-465	258	44	10.5195	10.5195	NUM
dentistry3000-465	258	45	/	/	SYM
dentistry3000-465	258	46	d3000.2024.465	d3000.2024.465	NOUN
dentistry3000-465	258	47	http://dentistry3000.pitt.edu	http://dentistry3000.pitt.edu	NOUN
dentistry3000-465	258	48	cell	cell	NOUN
dentistry3000-465	258	49	infect	infect	VERB
dentistry3000-465	258	50	microbiol	microbiol	NOUN
dentistry3000-465	258	51	.	.	PUNCT
dentistry3000-465	259	1	2019;9:1–12	2019;9:1–12	NUM
dentistry3000-465	259	2	.	.	PUNCT
dentistry3000-465	260	1	pmid	pmid	NOUN
dentistry3000-465	260	2	:	:	PUNCT
dentistry3000-465	260	3	31681625	31681625	NUM
dentistry3000-465	260	4	22	22	NUM
dentistry3000-465	260	5	.	.	PUNCT
dentistry3000-465	261	1	signature	signature	NOUN
dentistry3000-465	261	2	of	of	ADP
dentistry3000-465	261	3	microbial	microbial	ADJ
dentistry3000-465	261	4	dysbiosis	dysbiosis	NOUN
dentistry3000-465	261	5	in	in	ADP
dentistry3000-465	261	6	periodontitis	periodontitis	NOUN
dentistry3000-465	261	7	.	.	PUNCT
dentistry3000-465	262	1	meuric	meuric	PROPN
dentistry3000-465	262	2	v	v	PROPN
dentistry3000-465	262	3	,	,	PUNCT
dentistry3000-465	262	4	le	le	X
dentistry3000-465	262	5	gall	gall	PROPN
dentistry3000-465	262	6	-	-	PUNCT
dentistry3000-465	262	7	david	david	PROPN
dentistry3000-465	262	8	s	s	PROPN
dentistry3000-465	262	9	,	,	PUNCT
dentistry3000-465	262	10	boyer	boyer	PROPN
dentistry3000-465	262	11	e	e	PROPN
dentistry3000-465	262	12	,	,	PUNCT
dentistry3000-465	262	13	acuña	acuña	ADJ
dentistry3000-465	262	14	-	-	PUNCT
dentistry3000-465	262	15	amador	amador	PROPN
dentistry3000-465	262	16	l	l	PROPN
dentistry3000-465	262	17	,	,	PUNCT
dentistry3000-465	262	18	martin	martin	PROPN
dentistry3000-465	262	19	b	b	PROPN
dentistry3000-465	262	20	,	,	PUNCT
dentistry3000-465	262	21	fong	fong	PROPN
dentistry3000-465	262	22	sb	sb	PROPN
dentistry3000-465	262	23	,	,	PUNCT
dentistry3000-465	262	24	et	et	PROPN
dentistry3000-465	262	25	al	al	PROPN
dentistry3000-465	262	26	.	.	PUNCT
dentistry3000-465	263	1	mcbain	mcbain	PROPN
dentistry3000-465	263	2	aj	aj	PROPN
dentistry3000-465	263	3	,	,	PUNCT
dentistry3000-465	263	4	editor	editor	NOUN
dentistry3000-465	263	5	.	.	PUNCT
dentistry3000-465	264	1	appl	appl	PROPN
dentistry3000-465	264	2	environ	environ	PROPN
dentistry3000-465	264	3	microbiol	microbiol	PROPN
dentistry3000-465	265	1	[	[	X
dentistry3000-465	265	2	internet	internet	NOUN
dentistry3000-465	265	3	]	]	PUNCT
dentistry3000-465	265	4	.	.	PUNCT
dentistry3000-465	266	1	2017;83:1–13	2017;83:1–13	NOUN
dentistry3000-465	266	2	.	.	PUNCT
dentistry3000-465	267	1	available	available	ADJ
dentistry3000-465	267	2	from	from	ADP
dentistry3000-465	267	3	:	:	PUNCT
dentistry3000-465	267	4	https://journals.asm.org/doi/10.1128	https://journals.asm.org/doi/10.1128	ADJ
dentistry3000-465	267	5	/aem.00462	/aem.00462	NOUN
dentistry3000-465	267	6	-	-	PUNCT
dentistry3000-465	267	7	17pmid	17pmid	NUM
dentistry3000-465	267	8	:	:	PUNCT
dentistry3000-465	267	9	28476771	28476771	NUM
dentistry3000-465	267	10	23	23	NUM
dentistry3000-465	267	11	.	.	PUNCT
dentistry3000-465	268	1	microbiota	microbiota	NOUN
dentistry3000-465	268	2	and	and	CCONJ
dentistry3000-465	268	3	metatranscriptome	metatranscriptome	NOUN
dentistry3000-465	268	4	changes	change	NOUN
dentistry3000-465	268	5	accompanying	accompany	VERB
dentistry3000-465	268	6	the	the	DET
dentistry3000-465	268	7	onset	onset	NOUN
dentistry3000-465	268	8	of	of	ADP
dentistry3000-465	268	9	gingivitis	gingivitis	NOUN
dentistry3000-465	268	10	.	.	PUNCT
dentistry3000-465	269	1	nowicki	nowicki	PROPN
dentistry3000-465	269	2	em	em	PRON
dentistry3000-465	269	3	,	,	PUNCT
dentistry3000-465	269	4	shroff	shroff	PROPN
dentistry3000-465	269	5	r	r	PROPN
dentistry3000-465	269	6	,	,	PUNCT
dentistry3000-465	269	7	singleton	singleton	PROPN
dentistry3000-465	269	8	ja	ja	PROPN
dentistry3000-465	269	9	,	,	PUNCT
dentistry3000-465	269	10	renaud	renaud	PROPN
dentistry3000-465	269	11	de	de	PROPN
dentistry3000-465	269	12	,	,	PUNCT
dentistry3000-465	269	13	wallace	wallace	PROPN
dentistry3000-465	269	14	d	d	PROPN
dentistry3000-465	269	15	,	,	PUNCT
dentistry3000-465	269	16	drury	drury	PROPN
dentistry3000-465	269	17	j	j	PROPN
dentistry3000-465	269	18	,	,	PUNCT
dentistry3000-465	269	19	et	et	PROPN
dentistry3000-465	269	20	al	al	PROPN
dentistry3000-465	269	21	.	.	PROPN
dentistry3000-465	269	22	sperandio	sperandio	PROPN
dentistry3000-465	269	23	v	v	PROPN
dentistry3000-465	269	24	,	,	PUNCT
dentistry3000-465	269	25	editor	editor	NOUN
dentistry3000-465	269	26	.	.	PUNCT
dentistry3000-465	270	1	mbio	mbio	PROPN
dentistry3000-465	271	1	[	[	X
dentistry3000-465	271	2	internet	internet	NOUN
dentistry3000-465	271	3	]	]	PUNCT
dentistry3000-465	271	4	.	.	PUNCT
dentistry3000-465	272	1	american	american	ADJ
dentistry3000-465	272	2	society	society	PROPN
dentistry3000-465	272	3	for	for	ADP
dentistry3000-465	272	4	microbiology	microbiology	NOUN
dentistry3000-465	272	5	;	;	PUNCT
dentistry3000-465	272	6	2018;9	2018;9	NUM
dentistry3000-465	272	7	:	:	PUNCT
dentistry3000-465	272	8	e00575	e00575	PROPN
dentistry3000-465	272	9	-	-	PUNCT
dentistry3000-465	272	10	18	18	NUM
dentistry3000-465	272	11	.	.	PUNCT
dentistry3000-465	272	12	available	available	ADJ
dentistry3000-465	272	13	from	from	ADP
dentistry3000-465	272	14	:	:	PUNCT
dentistry3000-465	272	15	https://doi.org/10.1128/mbio.0057518	https://doi.org/10.1128/mbio.0057518	PROPN
dentistry3000-465	272	16	24	24	NUM
dentistry3000-465	272	17	.	.	PUNCT
dentistry3000-465	272	18	dysbiosis	dysbiosis	NOUN
dentistry3000-465	272	19	and	and	CCONJ
dentistry3000-465	272	20	alterations	alteration	NOUN
dentistry3000-465	272	21	in	in	ADP
dentistry3000-465	272	22	predicted	predict	VERB
dentistry3000-465	272	23	functions	function	NOUN
dentistry3000-465	272	24	of	of	ADP
dentistry3000-465	272	25	the	the	DET
dentistry3000-465	272	26	subgingival	subgingival	ADJ
dentistry3000-465	272	27	microbiome	microbiome	NOUN
dentistry3000-465	272	28	in	in	ADP
dentistry3000-465	272	29	chronic	chronic	ADJ
dentistry3000-465	272	30	periodontitis	periodontitis	NOUN
dentistry3000-465	272	31	.	.	PUNCT
dentistry3000-465	273	1	kirst	kirst	PROPN
dentistry3000-465	273	2	me	me	PROPN
dentistry3000-465	273	3	,	,	PUNCT
dentistry3000-465	273	4	li	li	PROPN
dentistry3000-465	273	5	ec	ec	PROPN
dentistry3000-465	273	6	,	,	PUNCT
dentistry3000-465	273	7	alfant	alfant	PROPN
dentistry3000-465	273	8	b	b	NOUN
dentistry3000-465	273	9	,	,	PUNCT
dentistry3000-465	273	10	chi	chi	PROPN
dentistry3000-465	273	11	y	y	PROPN
dentistry3000-465	273	12	-	-	PROPN
dentistry3000-465	273	13	y	y	PROPN
dentistry3000-465	273	14	,	,	PUNCT
dentistry3000-465	273	15	walker	walker	PROPN
dentistry3000-465	273	16	c	c	PROPN
dentistry3000-465	273	17	,	,	PUNCT
dentistry3000-465	273	18	magnusson	magnusson	PROPN
dentistry3000-465	273	19	i	i	PROPN
dentistry3000-465	273	20	,	,	PUNCT
dentistry3000-465	273	21	et	et	PROPN
dentistry3000-465	273	22	al	al	PROPN
dentistry3000-465	273	23	.	.	PROPN
dentistry3000-465	274	1	drake	drake	PROPN
dentistry3000-465	274	2	hl	hl	PROPN
dentistry3000-465	274	3	,	,	PUNCT
dentistry3000-465	274	4	editor	editor	NOUN
dentistry3000-465	274	5	.	.	PUNCT
dentistry3000-465	275	1	appl	appl	PROPN
dentistry3000-465	275	2	environ	environ	PROPN
dentistry3000-465	275	3	microbiol	microbiol	PROPN
dentistry3000-465	276	1	[	[	X
dentistry3000-465	276	2	internet	internet	NOUN
dentistry3000-465	276	3	]	]	PUNCT
dentistry3000-465	276	4	.	.	PUNCT
dentistry3000-465	277	1	united	united	PROPN
dentistry3000-465	277	2	states	states	PROPN
dentistry3000-465	277	3	:	:	PUNCT
dentistry3000-465	277	4	american	american	ADJ
dentistry3000-465	277	5	society	society	NOUN
dentistry3000-465	277	6	for	for	ADP
dentistry3000-465	277	7	microbiology	microbiology	NOUN
dentistry3000-465	277	8	;	;	PUNCT
dentistry3000-465	277	9	2015;81:783–93	2015;81:783–93	X
dentistry3000-465	277	10	.	.	PUNCT
dentistry3000-465	277	11	available	available	ADJ
dentistry3000-465	277	12	from	from	ADP
dentistry3000-465	277	13	:	:	PUNCT
dentistry3000-465	277	14	http://www.ncbi.nlm.nih.gov/pubme	http://www.ncbi.nlm.nih.gov/pubme	PROPN
dentistry3000-465	277	15	d/25398868pmid	d/25398868pmid	PROPN
dentistry3000-465	277	16	:	:	PUNCT
dentistry3000-465	277	17	25398868	25398868	NUM
dentistry3000-465	277	18	25	25	NUM
dentistry3000-465	277	19	.	.	PUNCT
dentistry3000-465	278	1	intra	intra	ADJ
dentistry3000-465	278	2	-	-	ADJ
dentistry3000-465	278	3	oral	oral	ADJ
dentistry3000-465	278	4	single	single	ADJ
dentistry3000-465	278	5	-	-	PUNCT
dentistry3000-465	278	6	site	site	NOUN
dentistry3000-465	278	7	comparisons	comparison	NOUN
dentistry3000-465	278	8	of	of	ADP
dentistry3000-465	278	9	periodontal	periodontal	ADJ
dentistry3000-465	278	10	and	and	CCONJ
dentistry3000-465	278	11	peri	peri	NOUN
dentistry3000-465	278	12	-	-	PUNCT
dentistry3000-465	278	13	implant	implant	ADJ
dentistry3000-465	278	14	microbiota	microbiota	NOUN
dentistry3000-465	278	15	in	in	ADP
dentistry3000-465	278	16	health	health	NOUN
dentistry3000-465	278	17	and	and	CCONJ
dentistry3000-465	278	18	disease	disease	NOUN
dentistry3000-465	278	19	.	.	PUNCT
dentistry3000-465	279	1	yu	yu	PROPN
dentistry3000-465	279	2	xl	xl	PROPN
dentistry3000-465	279	3	,	,	PUNCT
dentistry3000-465	279	4	chan	chan	PROPN
dentistry3000-465	279	5	y	y	PROPN
dentistry3000-465	279	6	,	,	PUNCT
dentistry3000-465	279	7	zhuang	zhuang	PROPN
dentistry3000-465	279	8	l	l	PROPN
dentistry3000-465	279	9	,	,	PUNCT
dentistry3000-465	279	10	lai	lai	PROPN
dentistry3000-465	279	11	hc	hc	PROPN
dentistry3000-465	279	12	,	,	PUNCT
dentistry3000-465	279	13	lang	lang	PROPN
dentistry3000-465	279	14	np	np	PROPN
dentistry3000-465	279	15	,	,	PUNCT
dentistry3000-465	279	16	keung	keung	PROPN
dentistry3000-465	279	17	leung	leung	PROPN
dentistry3000-465	279	18	w	w	PROPN
dentistry3000-465	279	19	,	,	PUNCT
dentistry3000-465	279	20	et	et	PROPN
dentistry3000-465	279	21	al	al	PROPN
dentistry3000-465	279	22	.	.	PROPN
dentistry3000-465	280	1	clin	clin	PROPN
dentistry3000-465	280	2	oral	oral	ADJ
dentistry3000-465	280	3	implants	implant	NOUN
dentistry3000-465	280	4	res	re	NOUN
dentistry3000-465	280	5	.	.	PUNCT
dentistry3000-465	281	1	2019;30:760–76	2019;30:760–76	X
dentistry3000-465	281	2	.	.	PUNCT
dentistry3000-465	282	1	pmid	pmid	NOUN
dentistry3000-465	282	2	:	:	PUNCT
dentistry3000-465	282	3	31102416	31102416	NUM
dentistry3000-465	282	4	26	26	NUM
dentistry3000-465	282	5	.	.	PUNCT
dentistry3000-465	283	1	oral	oral	ADJ
dentistry3000-465	283	2	microbiome	microbiome	NOUN
dentistry3000-465	283	3	of	of	ADP
dentistry3000-465	283	4	deep	deep	ADJ
dentistry3000-465	283	5	and	and	CCONJ
dentistry3000-465	283	6	shallow	shallow	ADJ
dentistry3000-465	283	7	dental	dental	ADJ
dentistry3000-465	283	8	pockets	pocket	NOUN
dentistry3000-465	283	9	in	in	ADP
dentistry3000-465	283	10	chronic	chronic	ADJ
dentistry3000-465	283	11	periodontitis	periodontitis	NOUN
dentistry3000-465	283	12	.	.	PUNCT
dentistry3000-465	284	1	ge	ge	PROPN
dentistry3000-465	284	2	x	x	PROPN
dentistry3000-465	284	3	,	,	PUNCT
dentistry3000-465	284	4	rodriguez	rodriguez	PROPN
dentistry3000-465	284	5	r	r	PROPN
dentistry3000-465	284	6	,	,	PUNCT
dentistry3000-465	284	7	trinh	trinh	PROPN
dentistry3000-465	284	8	m	m	PROPN
dentistry3000-465	284	9	,	,	PUNCT
dentistry3000-465	284	10	gunsolley	gunsolley	PROPN
dentistry3000-465	284	11	j	j	PROPN
dentistry3000-465	284	12	,	,	PUNCT
dentistry3000-465	284	13	xu	xu	PROPN
dentistry3000-465	285	1	p.	p.	PROPN
dentistry3000-465	285	2	burne	burne	PROPN
dentistry3000-465	285	3	ra	ra	PROPN
dentistry3000-465	285	4	,	,	PUNCT
dentistry3000-465	285	5	editor	editor	NOUN
dentistry3000-465	285	6	.	.	PUNCT
dentistry3000-465	286	1	plos	plos	PROPN
dentistry3000-465	286	2	one	one	NUM
dentistry3000-465	287	1	[	[	X
dentistry3000-465	287	2	internet	internet	NOUN
dentistry3000-465	287	3	]	]	PUNCT
dentistry3000-465	287	4	.	.	PUNCT
dentistry3000-465	288	1	public	public	ADJ
dentistry3000-465	288	2	library	library	NOUN
dentistry3000-465	288	3	of	of	ADP
dentistry3000-465	288	4	science	science	NOUN
dentistry3000-465	288	5	;	;	PUNCT
dentistry3000-465	288	6	2013;8	2013;8	NUM
dentistry3000-465	288	7	:	:	PUNCT
dentistry3000-465	288	8	e65520	e65520	NOUN
dentistry3000-465	288	9	.	.	PROPN
dentistry3000-465	288	10	available	available	ADJ
dentistry3000-465	288	11	from	from	ADP
dentistry3000-465	288	12	:	:	PUNCT
dentistry3000-465	288	13	https://doi.org/10.1371/journal.pone	https://doi.org/10.1371/journal.pone	X
dentistry3000-465	288	14	.0065520	.0065520	NOUN
dentistry3000-465	288	15	27	27	NUM
dentistry3000-465	288	16	.	.	PUNCT
dentistry3000-465	289	1	potential	potential	ADJ
dentistry3000-465	289	2	roles	role	NOUN
dentistry3000-465	289	3	of	of	ADP
dentistry3000-465	289	4	the	the	DET
dentistry3000-465	289	5	free	free	ADJ
dentistry3000-465	289	6	salivary	salivary	ADJ
dentistry3000-465	289	7	microbiome	microbiome	ADJ
dentistry3000-465	289	8	dysbiosis	dysbiosis	NOUN
dentistry3000-465	289	9	in	in	ADP
dentistry3000-465	289	10	periodontal	periodontal	ADJ
dentistry3000-465	289	11	diseases	disease	NOUN
dentistry3000-465	289	12	.	.	PUNCT
dentistry3000-465	290	1	diao	diao	PROPN
dentistry3000-465	290	2	j	j	PROPN
dentistry3000-465	290	3	,	,	PUNCT
dentistry3000-465	290	4	yuan	yuan	PROPN
dentistry3000-465	290	5	c	c	X
dentistry3000-465	290	6	,	,	PUNCT
dentistry3000-465	290	7	tong	tong	PROPN
dentistry3000-465	290	8	p	p	PROPN
dentistry3000-465	290	9	,	,	PUNCT
dentistry3000-465	290	10	ma	ma	PROPN
dentistry3000-465	290	11	z	z	PROPN
dentistry3000-465	290	12	,	,	PUNCT
dentistry3000-465	290	13	sun	sun	PROPN
dentistry3000-465	290	14	x.	x.	NOUN
dentistry3000-465	290	15	2021;11:1–11	2021;11:1–11	NUM
dentistry3000-465	290	16	.	.	PUNCT
dentistry3000-465	291	1	28	28	NUM
dentistry3000-465	291	2	.	.	PUNCT
dentistry3000-465	292	1	toward	toward	ADP
dentistry3000-465	292	2	personalized	personalize	VERB
dentistry3000-465	292	3	oral	oral	ADJ
dentistry3000-465	292	4	diagnosis	diagnosis	NOUN
dentistry3000-465	292	5	 	 	SPACE
dentistry3000-465	292	6	:	:	PUNCT
dentistry3000-465	292	7	distinct	distinct	ADJ
dentistry3000-465	292	8	microbiome	microbiome	NOUN
dentistry3000-465	292	9	clusters	cluster	NOUN
dentistry3000-465	292	10	in	in	ADP
dentistry3000-465	292	11	periodontitis	periodontitis	NOUN
dentistry3000-465	292	12	bio	bio	PROPN
dentistry3000-465	292	13	fi	fi	PROPN
dentistry3000-465	292	14	lms	lms	PROPN
dentistry3000-465	292	15	.	.	PUNCT
dentistry3000-465	293	1	komlo	komlo	PROPN
dentistry3000-465	293	2	l	l	PROPN
dentistry3000-465	293	3	,	,	PUNCT
dentistry3000-465	293	4	wirth	wirth	ADJ
dentistry3000-465	293	5	r	r	NOUN
dentistry3000-465	293	6	,	,	PUNCT
dentistry3000-465	293	7	pap	pap	NOUN
dentistry3000-465	293	8	b	b	NOUN
dentistry3000-465	293	9	,	,	PUNCT
dentistry3000-465	293	10	maro	maro	PROPN
dentistry3000-465	293	11	g	g	PROPN
dentistry3000-465	293	12	,	,	PUNCT
dentistry3000-465	293	13	barta	barta	PROPN
dentistry3000-465	293	14	n	n	PROPN
dentistry3000-465	293	15	,	,	PUNCT
dentistry3000-465	293	16	strang	strang	PROPN
dentistry3000-465	293	17	o.	o.	PROPN
dentistry3000-465	293	18	2021;11:1–13	2021;11:1–13	PROPN
dentistry3000-465	293	19	.	.	PUNCT
dentistry3000-465	294	1	available	available	ADJ
dentistry3000-465	294	2	from	from	ADP
dentistry3000-465	294	3	:	:	PUNCT
dentistry3000-465	294	4	https://www.frontiersin.org/articles/	https://www.frontiersin.org/articles/	PROPN
dentistry3000-465	294	5	10.3389	10.3389	NUM
dentistry3000-465	294	6	/	/	SYM
dentistry3000-465	294	7	fcimb.2021.747814	fcimb.2021.747814	NOUN
dentistry3000-465	294	8	/	/	SYM
dentistry3000-465	294	9	full	full	ADJ
dentistry3000-465	294	10	29	29	NUM
dentistry3000-465	294	11	.	.	PUNCT
dentistry3000-465	294	12	frequency	frequency	NOUN
dentistry3000-465	294	13	of	of	ADP
dentistry3000-465	294	14	periodontal	periodontal	ADJ
dentistry3000-465	294	15	pathogens	pathogen	NOUN
dentistry3000-465	294	16	in	in	ADP
dentistry3000-465	294	17	equivalent	equivalent	ADJ
dentistry3000-465	294	18	periimplant	periimplant	NOUN
dentistry3000-465	294	19	and	and	CCONJ
dentistry3000-465	294	20	periodontal	periodontal	ADJ
dentistry3000-465	294	21	clinical	clinical	ADJ
dentistry3000-465	294	22	statuses	status	NOUN
dentistry3000-465	294	23	.	.	PUNCT
dentistry3000-465	295	1	cortelli	cortelli	PROPN
dentistry3000-465	295	2	r	r	PROPN
dentistry3000-465	295	3	,	,	PUNCT
dentistry3000-465	295	4	cavalca	cavalca	PROPN
dentistry3000-465	295	5	s	s	PROPN
dentistry3000-465	295	6	,	,	PUNCT
dentistry3000-465	295	7	oliveira	oliveira	PROPN
dentistry3000-465	295	8	f	f	PROPN
dentistry3000-465	295	9	,	,	PUNCT
dentistry3000-465	295	10	romeiro	romeiro	PUNCT
dentistry3000-465	295	11	d	d	PROPN
dentistry3000-465	295	12	,	,	PUNCT
dentistry3000-465	295	13	roberto	roberto	PROPN
dentistry3000-465	295	14	p	p	X
dentistry3000-465	295	15	,	,	PUNCT
dentistry3000-465	295	16	mendes	mende	NOUN
dentistry3000-465	295	17	p	p	X
dentistry3000-465	295	18	,	,	PUNCT
dentistry3000-465	295	19	et	et	PROPN
dentistry3000-465	295	20	al	al	PROPN
dentistry3000-465	295	21	.	.	PUNCT
dentistry3000-465	296	1	2012;8:2–9	2012;8:2–9	PROPN
dentistry3000-465	296	2	.	.	PROPN
dentistry3000-465	296	3	30	30	NUM
dentistry3000-465	296	4	.	.	PUNCT
dentistry3000-465	297	1	progression	progression	NOUN
dentistry3000-465	297	2	of	of	ADP
dentistry3000-465	297	3	periodontal	periodontal	ADJ
dentistry3000-465	297	4	inflammation	inflammation	NOUN
dentistry3000-465	297	5	in	in	ADP
dentistry3000-465	297	6	adolescents	adolescent	NOUN
dentistry3000-465	297	7	is	be	AUX
dentistry3000-465	297	8	associated	associate	VERB
dentistry3000-465	297	9	with	with	ADP
dentistry3000-465	297	10	increased	increase	VERB
dentistry3000-465	297	11	number	number	NOUN
dentistry3000-465	297	12	of	of	ADP
dentistry3000-465	297	13	porphyromonas	porphyromona	NOUN
dentistry3000-465	297	14	gingivalis	gingivalis	PROPN
dentistry3000-465	297	15	,	,	PUNCT
dentistry3000-465	297	16	prevotella	prevotella	NOUN
dentistry3000-465	297	17	intermedia	intermedia	PROPN
dentistry3000-465	297	18	,	,	PUNCT
dentistry3000-465	297	19	tannerella	tannerella	NOUN
dentistry3000-465	297	20	forsythensis	forsythensis	NOUN
dentistry3000-465	297	21	,	,	PUNCT
dentistry3000-465	297	22	and	and	CCONJ
dentistry3000-465	297	23	fusobacterium	fusobacterium	NOUN
dentistry3000-465	297	24	nucleatum	nucleatum	PROPN
dentistry3000-465	297	25	.	.	PUNCT
dentistry3000-465	298	1	yang	yang	PROPN
dentistry3000-465	298	2	n	n	PROPN
dentistry3000-465	298	3	,	,	PUNCT
dentistry3000-465	298	4	zhang	zhang	PROPN
dentistry3000-465	298	5	q	q	PROPN
dentistry3000-465	298	6	,	,	PUNCT
dentistry3000-465	298	7	li	li	PROPN
dentistry3000-465	298	8	j	j	PROPN
dentistry3000-465	298	9	,	,	PUNCT
dentistry3000-465	298	10	yang	yang	PROPN
dentistry3000-465	298	11	s	s	PROPN
dentistry3000-465	298	12	,	,	PUNCT
dentistry3000-465	298	13	shi	shi	PROPN
dentistry3000-465	298	14	q.	q.	PROPN
dentistry3000-465	298	15	2013;1	2013;1	PROPN
dentistry3000-465	298	16	–	–	PUNCT
dentistry3000-465	298	17	8	8	NUM
dentistry3000-465	298	18	.	.	X
dentistry3000-465	298	19	31	31	NUM
dentistry3000-465	298	20	.	.	PUNCT
dentistry3000-465	299	1	a	a	DET
dentistry3000-465	299	2	study	study	NOUN
dentistry3000-465	299	3	of	of	ADP
dentistry3000-465	299	4	the	the	DET
dentistry3000-465	299	5	bacteria	bacteria	NOUN
dentistry3000-465	299	6	associated	associate	VERB
dentistry3000-465	299	7	with	with	ADP
dentistry3000-465	299	8	advancing	advance	VERB
dentistry3000-465	299	9	periodontitis	periodontitis	NOUN
dentistry3000-465	299	10	in	in	ADP
dentistry3000-465	299	11	man	man	NOUN
dentistry3000-465	299	12	.	.	PUNCT
dentistry3000-465	300	1	tanner	tanner	NOUN
dentistry3000-465	300	2	ac	ac	PROPN
dentistry3000-465	300	3	,	,	PUNCT
dentistry3000-465	300	4	haffer	haffer	VERB
dentistry3000-465	300	5	c	c	NOUN
dentistry3000-465	300	6	,	,	PUNCT
dentistry3000-465	300	7	bratthall	bratthall	PROPN
dentistry3000-465	300	8	gt	gt	PROPN
dentistry3000-465	300	9	,	,	PUNCT
dentistry3000-465	300	10	visconti	visconti	PROPN
dentistry3000-465	300	11	ra	ra	PROPN
dentistry3000-465	300	12	,	,	PUNCT
dentistry3000-465	300	13	socransky	socransky	PROPN
dentistry3000-465	300	14	ss	ss	PROPN
dentistry3000-465	300	15	.	.	PUNCT
dentistry3000-465	301	1	j	j	PROPN
dentistry3000-465	301	2	clin	clin	PROPN
dentistry3000-465	301	3	periodontol	periodontol	PROPN
dentistry3000-465	301	4	.	.	PUNCT
dentistry3000-465	302	1	united	united	PROPN
dentistry3000-465	302	2	states	states	PROPN
dentistry3000-465	302	3	;	;	PUNCT
dentistry3000-465	303	1	1979;6:278–307	1979;6:278–307	X
dentistry3000-465	303	2	.	.	PUNCT
dentistry3000-465	304	1	pmid	pmid	NOUN
dentistry3000-465	304	2	:	:	PUNCT
dentistry3000-465	304	3	294457	294457	NUM
dentistry3000-465	304	4	32	32	NUM
dentistry3000-465	304	5	.	.	PUNCT
dentistry3000-465	305	1	toward	toward	ADP
dentistry3000-465	305	2	personalized	personalized	ADJ
dentistry3000-465	305	3	oral	oral	ADJ
dentistry3000-465	305	4	diagnosis	diagnosis	NOUN
dentistry3000-465	305	5	:	:	PUNCT
dentistry3000-465	305	6	distinct	distinct	ADJ
dentistry3000-465	305	7	microbiome	microbiome	NOUN
dentistry3000-465	305	8	clusters	cluster	NOUN
dentistry3000-465	305	9	in	in	ADP
dentistry3000-465	305	10	periodontitis	periodontitis	NOUN
dentistry3000-465	305	11	biofilms	biofilm	NOUN
dentistry3000-465	305	12	.	.	PUNCT
dentistry3000-465	306	1	wirth	wirth	ADJ
dentistry3000-465	306	2	r	r	NOUN
dentistry3000-465	306	3	,	,	PUNCT
dentistry3000-465	306	4	pap	pap	NOUN
dentistry3000-465	306	5	b	b	NOUN
dentistry3000-465	306	6	,	,	PUNCT
dentistry3000-465	306	7	maróti	maróti	PROPN
dentistry3000-465	306	8	g	g	NOUN
dentistry3000-465	306	9	,	,	PUNCT
dentistry3000-465	306	10	vályi	vályi	ADP
dentistry3000-465	306	11	p	p	PRON
dentistry3000-465	306	12	,	,	PUNCT
dentistry3000-465	306	13	komlósi	komlósi	PROPN
dentistry3000-465	306	14	l	l	PROPN
dentistry3000-465	306	15	,	,	PUNCT
dentistry3000-465	306	16	barta	barta	PROPN
dentistry3000-465	306	17	n	n	CCONJ
dentistry3000-465	306	18	,	,	PUNCT
dentistry3000-465	306	19	et	et	PROPN
dentistry3000-465	306	20	al	al	PROPN
dentistry3000-465	306	21	.	.	PROPN
dentistry3000-465	306	22	front	front	ADJ
dentistry3000-465	306	23	cell	cell	NOUN
dentistry3000-465	306	24	infect	infect	VERB
dentistry3000-465	306	25	microbiol	microbiol	NOUN
dentistry3000-465	307	1	[	[	X
dentistry3000-465	307	2	internet	internet	NOUN
dentistry3000-465	307	3	]	]	PUNCT
dentistry3000-465	307	4	.	.	PUNCT
dentistry3000-465	308	1	2021;11:1–13	2021;11:1–13	NUM
dentistry3000-465	308	2	.	.	PUNCT
dentistry3000-465	309	1	available	available	ADJ
dentistry3000-465	309	2	from	from	ADP
dentistry3000-465	309	3	:	:	PUNCT
dentistry3000-465	309	4	https://www.frontiersin.org/articles/	https://www.frontiersin.org/articles/	PROPN
dentistry3000-465	309	5	10.3389	10.3389	NUM
dentistry3000-465	309	6	/	/	SYM
dentistry3000-465	309	7	fcimb.2021.747814	fcimb.2021.747814	NOUN
dentistry3000-465	309	8	/	/	SYM
dentistry3000-465	309	9	full	full	ADJ
dentistry3000-465	309	10	http://dentistry3000.pitt.edu/	http://dentistry3000.pitt.edu/	PROPN