id	sid	tid	token	lemma	pos
dentistry3000-784	1	1	784	784	NUM
dentistry3000-784	1	2	2025	2025	NUM
dentistry3000-784	1	3	phytochemical	phytochemical	ADJ
dentistry3000-784	1	4	analysis	analysis	NOUN
dentistry3000-784	1	5	and	and	CCONJ
dentistry3000-784	1	6	an1bacterial	an1bacterial	ADJ
dentistry3000-784	1	7	ac1vity	ac1vity	NOUN
dentistry3000-784	1	8	of	of	ADP
dentistry3000-784	1	9	stevia	stevia	NOUN
dentistry3000-784	1	10	rebaudiana	rebaudiana	PROPN
dentistry3000-784	1	11	bertoni	bertoni	PROPN
dentistry3000-784	1	12	leaves	leave	NOUN
dentistry3000-784	1	13	extract	extract	VERB
dentistry3000-784	1	14	against	against	ADP
dentistry3000-784	1	15	streptococcus	streptococcus	NOUN
dentistry3000-784	1	16	sanguis	sanguis	NOUN
dentistry3000-784	1	17	(	(	PUNCT
dentistry3000-784	1	18	a	a	DET
dentistry3000-784	1	19	primary	primary	ADJ
dentistry3000-784	1	20	inhabitant	inhabitant	NOUN
dentistry3000-784	1	21	of	of	ADP
dentistry3000-784	1	22	dental	dental	ADJ
dentistry3000-784	1	23	plaque	plaque	NOUN
dentistry3000-784	1	24	):	):	PUNCT
dentistry3000-784	1	25	in	in	ADP
dentistry3000-784	1	26	vitro	vitro	X
dentistry3000-784	1	27	study	study	NOUN
dentistry3000-784	1	28	vol	vol	NOUN
dentistry3000-784	1	29	13	13	NUM
dentistry3000-784	1	30	no	no	DET
dentistry3000-784	1	31	1	1	NUM
dentistry3000-784	1	32	(	(	PUNCT
dentistry3000-784	1	33	2025	2025	NUM
dentistry3000-784	1	34	)	)	PUNCT
dentistry3000-784	1	35	doi	doi	NOUN
dentistry3000-784	1	36	10.5195	10.5195	NUM
dentistry3000-784	1	37	/	/	SYM
dentistry3000-784	1	38	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	1	39	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	1	40	phytochemical	phytochemical	ADJ
dentistry3000-784	1	41	analysis	analysis	NOUN
dentistry3000-784	1	42	and	and	CCONJ
dentistry3000-784	1	43	antibacterial	antibacterial	ADJ
dentistry3000-784	1	44	activity	activity	NOUN
dentistry3000-784	1	45	of	of	ADP
dentistry3000-784	1	46	stevia	stevia	NOUN
dentistry3000-784	1	47	rebaudiana	rebaudiana	PROPN
dentistry3000-784	1	48	bertoni	bertoni	PROPN
dentistry3000-784	1	49	leaves	leave	NOUN
dentistry3000-784	1	50	extract	extract	VERB
dentistry3000-784	1	51	against	against	ADP
dentistry3000-784	1	52	streptococcus	streptococcus	NOUN
dentistry3000-784	1	53	sanguis	sanguis	NOUN
dentistry3000-784	1	54	(	(	PUNCT
dentistry3000-784	1	55	a	a	DET
dentistry3000-784	1	56	primary	primary	ADJ
dentistry3000-784	1	57	inhabitant	inhabitant	NOUN
dentistry3000-784	1	58	of	of	ADP
dentistry3000-784	1	59	dental	dental	ADJ
dentistry3000-784	1	60	plaque	plaque	NOUN
dentistry3000-784	1	61	):	):	PUNCT
dentistry3000-784	1	62	in	in	ADP
dentistry3000-784	1	63	vitro	vitro	X
dentistry3000-784	1	64	study	study	PROPN
dentistry3000-784	1	65	manar	manar	PROPN
dentistry3000-784	1	66	ibrahim	ibrahim	PROPN
dentistry3000-784	1	67	ahmed1	ahmed1	PROPN
dentistry3000-784	1	68	,	,	PUNCT
dentistry3000-784	1	69	safa	safa	PROPN
dentistry3000-784	1	70	ali	ali	PROPN
dentistry3000-784	1	71	hamad2	hamad2	PROPN
dentistry3000-784	1	72	,	,	PUNCT
dentistry3000-784	1	73	maha	maha	PROPN
dentistry3000-784	1	74	abdulsalam2	abdulsalam2	PROPN
dentistry3000-784	2	1	1	1	NUM
dentistry3000-784	2	2	al	al	PROPN
dentistry3000-784	2	3	-	-	PUNCT
dentistry3000-784	2	4	bayan	bayan	PROPN
dentistry3000-784	2	5	university	university	PROPN
dentistry3000-784	2	6	college	college	PROPN
dentistry3000-784	2	7	of	of	ADP
dentistry3000-784	2	8	dentistry	dentistry	PROPN
dentistry3000-784	2	9	,	,	PUNCT
dentistry3000-784	2	10	baghdad	baghdad	PROPN
dentistry3000-784	2	11	,	,	PUNCT
dentistry3000-784	2	12	iraq	iraq	PROPN
dentistry3000-784	2	13	2	2	NUM
dentistry3000-784	2	14	al	al	PROPN
dentistry3000-784	2	15	-	-	PUNCT
dentistry3000-784	2	16	hikma	hikma	PROPN
dentistry3000-784	2	17	college	college	PROPN
dentistry3000-784	2	18	university	university	PROPN
dentistry3000-784	2	19	,	,	PUNCT
dentistry3000-784	2	20	department	department	NOUN
dentistry3000-784	2	21	of	of	ADP
dentistry3000-784	2	22	dentistry	dentistry	PROPN
dentistry3000-784	2	23	,	,	PUNCT
dentistry3000-784	2	24	baghdad	baghdad	PROPN
dentistry3000-784	2	25	,	,	PUNCT
dentistry3000-784	2	26	iraq	iraq	PROPN
dentistry3000-784	2	27	abstract	abstract	PROPN
dentistry3000-784	2	28	objec&ve	objec&ve	NUM
dentistry3000-784	2	29	:	:	PUNCT
dentistry3000-784	2	30	dental	dental	ADJ
dentistry3000-784	2	31	plaque	plaque	NOUN
dentistry3000-784	2	32	is	be	AUX
dentistry3000-784	2	33	considered	consider	VERB
dentistry3000-784	2	34	the	the	DET
dentistry3000-784	2	35	primary	primary	ADJ
dentistry3000-784	2	36	causa4ve	causa4ve	PROPN
dentistry3000-784	2	37	agent	agent	NOUN
dentistry3000-784	2	38	in	in	ADP
dentistry3000-784	2	39	developing	develop	VERB
dentistry3000-784	2	40	periodontal	periodontal	ADJ
dentistry3000-784	2	41	diseases	disease	NOUN
dentistry3000-784	2	42	.	.	PUNCT
dentistry3000-784	3	1	early	early	ADJ
dentistry3000-784	3	2	colonizers	colonizer	NOUN
dentistry3000-784	3	3	of	of	ADP
dentistry3000-784	3	4	dental	dental	ADJ
dentistry3000-784	3	5	plaque	plaque	NOUN
dentistry3000-784	3	6	,	,	PUNCT
dentistry3000-784	3	7	such	such	ADJ
dentistry3000-784	3	8	as	as	ADP
dentistry3000-784	3	9	streptococcus	streptococcus	NOUN
dentistry3000-784	3	10	sanguis	sanguis	NOUN
dentistry3000-784	3	11	(	(	PUNCT
dentistry3000-784	3	12	s.sanguis	s.sanguis	NOUN
dentistry3000-784	3	13	)	)	PUNCT
dentistry3000-784	3	14	,	,	PUNCT
dentistry3000-784	3	15	are	be	AUX
dentistry3000-784	3	16	crucial	crucial	ADJ
dentistry3000-784	3	17	in	in	ADP
dentistry3000-784	3	18	the	the	DET
dentistry3000-784	3	19	succession	succession	NOUN
dentistry3000-784	3	20	steps	step	NOUN
dentistry3000-784	3	21	of	of	ADP
dentistry3000-784	3	22	biofilm	biofilm	NOUN
dentistry3000-784	3	23	forma4on	forma4on	NOUN
dentistry3000-784	3	24	.	.	PUNCT
dentistry3000-784	4	1	as	as	ADP
dentistry3000-784	4	2	an	an	DET
dentistry3000-784	4	3	alterna4ve	alterna4ve	NOUN
dentistry3000-784	4	4	to	to	ADP
dentistry3000-784	4	5	the	the	DET
dentistry3000-784	4	6	commonly	commonly	ADV
dentistry3000-784	4	7	used	use	VERB
dentistry3000-784	4	8	chlorohexidine	chlorohexidine	NOUN
dentistry3000-784	4	9	(	(	PUNCT
dentistry3000-784	4	10	chx	chx	PROPN
dentistry3000-784	4	11	)	)	PUNCT
dentistry3000-784	4	12	,	,	PUNCT
dentistry3000-784	4	13	it	it	PRON
dentistry3000-784	4	14	is	be	AUX
dentistry3000-784	4	15	of	of	ADP
dentistry3000-784	4	16	interest	interest	NOUN
dentistry3000-784	4	17	to	to	PART
dentistry3000-784	4	18	find	find	VERB
dentistry3000-784	4	19	naturally	naturally	ADV
dentistry3000-784	4	20	occurring	occur	VERB
dentistry3000-784	4	21	an4microbial	an4microbial	ADJ
dentistry3000-784	4	22	substances	substance	NOUN
dentistry3000-784	4	23	from	from	ADP
dentistry3000-784	4	24	plants	plant	NOUN
dentistry3000-784	4	25	.	.	PUNCT
dentistry3000-784	5	1	materials	material	NOUN
dentistry3000-784	5	2	and	and	CCONJ
dentistry3000-784	5	3	methods	method	NOUN
dentistry3000-784	5	4	:	:	PUNCT
dentistry3000-784	5	5	volunteers	volunteer	NOUN
dentistry3000-784	5	6	were	be	AUX
dentistry3000-784	5	7	asked	ask	VERB
dentistry3000-784	5	8	to	to	PART
dentistry3000-784	5	9	provide	provide	VERB
dentistry3000-784	5	10	plaque	plaque	NOUN
dentistry3000-784	5	11	samples	sample	NOUN
dentistry3000-784	5	12	.	.	PUNCT
dentistry3000-784	6	1	microscopic	microscopic	ADJ
dentistry3000-784	6	2	examina4on	examina4on	NOUN
dentistry3000-784	6	3	,	,	PUNCT
dentistry3000-784	6	4	gram	gram	NOUN
dentistry3000-784	6	5	stain	stain	NOUN
dentistry3000-784	6	6	,	,	PUNCT
dentistry3000-784	6	7	optochin	optochin	ADJ
dentistry3000-784	6	8	test	test	NOUN
dentistry3000-784	6	9	,	,	PUNCT
dentistry3000-784	6	10	catalase	catalase	NOUN
dentistry3000-784	6	11	test	test	NOUN
dentistry3000-784	6	12	and	and	CCONJ
dentistry3000-784	6	13	polymerase	polymerase	NOUN
dentistry3000-784	6	14	chain	chain	NOUN
dentistry3000-784	6	15	reac4on	reac4on	NOUN
dentistry3000-784	6	16	were	be	AUX
dentistry3000-784	6	17	used	use	VERB
dentistry3000-784	6	18	to	to	PART
dentistry3000-784	6	19	ensure	ensure	VERB
dentistry3000-784	6	20	the	the	DET
dentistry3000-784	6	21	iden4fica4on	iden4fica4on	NOUN
dentistry3000-784	6	22	of	of	ADP
dentistry3000-784	6	23	s.	s.	PROPN
dentistry3000-784	6	24	sanguis	sanguis	PROPN
dentistry3000-784	6	25	.	.	PUNCT
dentistry3000-784	7	1	stevia	stevia	PROPN
dentistry3000-784	7	2	rebaudiana	rebaudiana	PROPN
dentistry3000-784	7	3	bertoni	bertoni	PROPN
dentistry3000-784	7	4	leaves	leave	NOUN
dentistry3000-784	7	5	extracted	extract	VERB
dentistry3000-784	7	6	by	by	ADP
dentistry3000-784	7	7	70	70	NUM
dentistry3000-784	7	8	%	%	NOUN
dentistry3000-784	7	9	ethanol	ethanol	NOUN
dentistry3000-784	7	10	alcohol	alcohol	NOUN
dentistry3000-784	7	11	.	.	PUNCT
dentistry3000-784	8	1	four	four	NUM
dentistry3000-784	8	2	experiments	experiment	NOUN
dentistry3000-784	8	3	have	have	AUX
dentistry3000-784	8	4	been	be	AUX
dentistry3000-784	8	5	done	do	VERB
dentistry3000-784	8	6	in	in	ADP
dentistry3000-784	8	7	this	this	DET
dentistry3000-784	8	8	study	study	NOUN
dentistry3000-784	8	9	:	:	PUNCT
dentistry3000-784	8	10	the	the	DET
dentistry3000-784	8	11	suscep4bility	suscep4bility	NOUN
dentistry3000-784	8	12	of	of	ADP
dentistry3000-784	8	13	s.	s.	PROPN
dentistry3000-784	8	14	sanguis	sanguis	NOUN
dentistry3000-784	8	15	to	to	ADP
dentistry3000-784	8	16	stevia	stevia	NOUN
dentistry3000-784	8	17	extract	extract	NOUN
dentistry3000-784	8	18	,	,	PUNCT
dentistry3000-784	8	19	the	the	DET
dentistry3000-784	8	20	minimum	minimum	ADJ
dentistry3000-784	8	21	inhibitory	inhibitory	NOUN
dentistry3000-784	8	22	(	(	PUNCT
dentistry3000-784	8	23	mic	mic	NOUN
dentistry3000-784	8	24	)	)	PUNCT
dentistry3000-784	8	25	and	and	CCONJ
dentistry3000-784	8	26	the	the	DET
dentistry3000-784	8	27	minimum	minimum	ADJ
dentistry3000-784	8	28	bactericidal	bactericidal	NOUN
dentistry3000-784	8	29	(	(	PUNCT
dentistry3000-784	8	30	mbc	mbc	PROPN
dentistry3000-784	8	31	)	)	PUNCT
dentistry3000-784	8	32	concentra4ons	concentra4on	NOUN
dentistry3000-784	8	33	,	,	PUNCT
dentistry3000-784	8	34	and	and	CCONJ
dentistry3000-784	8	35	explora4on	explora4on	NOUN
dentistry3000-784	8	36	of	of	ADP
dentistry3000-784	8	37	the	the	DET
dentistry3000-784	8	38	extract	extract	NOUN
dentistry3000-784	8	39	effec4ve	effec4ve	ADP
dentistry3000-784	8	40	cons4tuents	cons4tuent	NOUN
dentistry3000-784	8	41	by	by	ADP
dentistry3000-784	8	42	using	use	VERB
dentistry3000-784	8	43	hplc	hplc	NOUN
dentistry3000-784	8	44	.	.	PUNCT
dentistry3000-784	9	1	results	result	NOUN
dentistry3000-784	9	2	:	:	PUNCT
dentistry3000-784	9	3	stevia	stevia	PROPN
dentistry3000-784	9	4	extract	extract	NOUN
dentistry3000-784	9	5	had	have	VERB
dentistry3000-784	9	6	good	good	ADJ
dentistry3000-784	9	7	an4bacterial	an4bacterial	NOUN
dentistry3000-784	9	8	ac4vity	ac4vity	NOUN
dentistry3000-784	9	9	with	with	ADP
dentistry3000-784	9	10	varying	vary	VERB
dentistry3000-784	9	11	inhibi4on	inhibi4on	NOUN
dentistry3000-784	9	12	zone	zone	NOUN
dentistry3000-784	9	13	diameters	diameter	NOUN
dentistry3000-784	9	14	that	that	PRON
dentistry3000-784	9	15	were	be	AUX
dentistry3000-784	9	16	concentra4on	concentra4on	NOUN
dentistry3000-784	9	17	dependent	dependent	ADJ
dentistry3000-784	9	18	,	,	PUNCT
dentistry3000-784	9	19	but	but	CCONJ
dentistry3000-784	9	20	0.2	0.2	NUM
dentistry3000-784	9	21	%	%	NOUN
dentistry3000-784	9	22	chx	chx	PROPN
dentistry3000-784	9	23	showed	show	VERB
dentistry3000-784	9	24	bever	bever	PROPN
dentistry3000-784	9	25	ac4vity	ac4vity	NOUN
dentistry3000-784	9	26	with	with	ADP
dentistry3000-784	9	27	a	a	DET
dentistry3000-784	9	28	sta4s4cally	sta4s4cally	ADV
dentistry3000-784	9	29	significant	significant	ADJ
dentistry3000-784	9	30	difference	difference	NOUN
dentistry3000-784	9	31	(	(	PUNCT
dentistry3000-784	9	32	p	p	X
dentistry3000-784	9	33	<	<	X
dentistry3000-784	9	34	0.05	0.05	NUM
dentistry3000-784	9	35	)	)	PUNCT
dentistry3000-784	9	36	.	.	PUNCT
dentistry3000-784	10	1	both	both	PRON
dentistry3000-784	10	2	mic	mic	ADJ
dentistry3000-784	10	3	and	and	CCONJ
dentistry3000-784	10	4	mbc	mbc	PROPN
dentistry3000-784	10	5	were	be	AUX
dentistry3000-784	10	6	at	at	ADP
dentistry3000-784	10	7	16	16	NUM
dentistry3000-784	10	8	mg	mg	NUM
dentistry3000-784	10	9	/	/	SYM
dentistry3000-784	10	10	ml	ml	NOUN
dentistry3000-784	10	11	.	.	PUNCT
dentistry3000-784	11	1	hplc	hplc	NOUN
dentistry3000-784	11	2	analysis	analysis	NOUN
dentistry3000-784	11	3	confirmed	confirm	VERB
dentistry3000-784	11	4	the	the	DET
dentistry3000-784	11	5	presence	presence	NOUN
dentistry3000-784	11	6	of	of	ADP
dentistry3000-784	11	7	an4bacterial	an4bacterial	PROPN
dentistry3000-784	11	8	cons4tuents	cons4tuent	NOUN
dentistry3000-784	11	9	:	:	PUNCT
dentistry3000-784	11	10	narigenin	narigenin	NOUN
dentistry3000-784	11	11	25.76	25.76	NUM
dentistry3000-784	11	12	ppm	ppm	NOUN
dentistry3000-784	11	13	,	,	PUNCT
dentistry3000-784	11	14	catechin	catechin	VERB
dentistry3000-784	11	15	30.25	30.25	NUM
dentistry3000-784	11	16	ppm	ppm	NOUN
dentistry3000-784	11	17	,	,	PUNCT
dentistry3000-784	11	18	coumarin	coumarin	NOUN
dentistry3000-784	11	19	25.47	25.47	NUM
dentistry3000-784	11	20	ppm	ppm	NOUN
dentistry3000-784	11	21	,	,	PUNCT
dentistry3000-784	11	22	and	and	CCONJ
dentistry3000-784	11	23	kaempferol	kaempferol	VERB
dentistry3000-784	11	24	4.59	4.59	NUM
dentistry3000-784	11	25	ppm	ppm	NOUN
dentistry3000-784	11	26	.	.	PUNCT
dentistry3000-784	12	1	conclusions	conclusion	NOUN
dentistry3000-784	12	2	:	:	PUNCT
dentistry3000-784	12	3	the	the	DET
dentistry3000-784	12	4	an4microbial	an4microbial	PROPN
dentistry3000-784	12	5	ac4vity	ac4vity	NOUN
dentistry3000-784	12	6	of	of	ADP
dentistry3000-784	12	7	the	the	DET
dentistry3000-784	12	8	alcoholic	alcoholic	NOUN
dentistry3000-784	12	9	stevia	stevia	PROPN
dentistry3000-784	12	10	rebaudiana	rebaudiana	PROPN
dentistry3000-784	12	11	bertoni	bertoni	PROPN
dentistry3000-784	12	12	leaf	leaf	NOUN
dentistry3000-784	12	13	extract	extract	NOUN
dentistry3000-784	12	14	was	be	AUX
dentistry3000-784	12	15	sa4sfactory	sa4sfactory	PROPN
dentistry3000-784	12	16	.	.	PUNCT
dentistry3000-784	13	1	the	the	DET
dentistry3000-784	13	2	study	study	NOUN
dentistry3000-784	13	3	extract	extract	NOUN
dentistry3000-784	13	4	exhibited	exhibit	VERB
dentistry3000-784	13	5	lower	low	ADJ
dentistry3000-784	13	6	an4bacterial	an4bacterial	NOUN
dentistry3000-784	13	7	ac4vity	ac4vity	NOUN
dentistry3000-784	13	8	at	at	ADP
dentistry3000-784	13	9	512	512	NUM
dentistry3000-784	13	10	mg	mg	NUM
dentistry3000-784	13	11	/	/	SYM
dentistry3000-784	13	12	ml	ml	NOUN
dentistry3000-784	13	13	of	of	ADP
dentistry3000-784	13	14	stevia	stevia	NOUN
dentistry3000-784	13	15	extract	extract	NOUN
dentistry3000-784	13	16	,	,	PUNCT
dentistry3000-784	13	17	while	while	SCONJ
dentistry3000-784	13	18	0.2	0.2	NUM
dentistry3000-784	13	19	%	%	NOUN
dentistry3000-784	13	20	chx	chx	PROPN
dentistry3000-784	13	21	had	have	VERB
dentistry3000-784	13	22	superior	superior	ADJ
dentistry3000-784	13	23	ac4vity	ac4vity	NOUN
dentistry3000-784	13	24	overall	overall	ADJ
dentistry3000-784	13	25	.	.	PUNCT
dentistry3000-784	14	1	hplc	hplc	PROPN
dentistry3000-784	14	2	showed	show	VERB
dentistry3000-784	14	3	that	that	SCONJ
dentistry3000-784	14	4	the	the	DET
dentistry3000-784	14	5	alcoholic	alcoholic	NOUN
dentistry3000-784	14	6	leaves	leave	NOUN
dentistry3000-784	14	7	extract	extract	VERB
dentistry3000-784	14	8	of	of	ADP
dentistry3000-784	14	9	stevia	stevia	PROPN
dentistry3000-784	14	10	rebaudiana	rebaudiana	PROPN
dentistry3000-784	14	11	bertoni	bertoni	PROPN
dentistry3000-784	14	12	contains	contain	VERB
dentistry3000-784	14	13	several	several	ADJ
dentistry3000-784	14	14	ac4ve	ac4ve	PROPN
dentistry3000-784	14	15	an4bacterial	an4bacterial	PROPN
dentistry3000-784	14	16	components	component	NOUN
dentistry3000-784	14	17	:	:	PUNCT
dentistry3000-784	14	18	narigenin	narigenin	PROPN
dentistry3000-784	14	19	,	,	PUNCT
dentistry3000-784	14	20	catechin	catechin	NOUN
dentistry3000-784	14	21	,	,	PUNCT
dentistry3000-784	14	22	coumarin	coumarin	NOUN
dentistry3000-784	14	23	and	and	CCONJ
dentistry3000-784	14	24	kaempferol	kaempferol	NOUN
dentistry3000-784	14	25	.	.	PUNCT
dentistry3000-784	15	1	keywords	keyword	NOUN
dentistry3000-784	15	2	:	:	PUNCT
dentistry3000-784	15	3	streptococcus	streptococcus	NOUN
dentistry3000-784	15	4	sanguis	sanguis	NOUN
dentistry3000-784	15	5	,	,	PUNCT
dentistry3000-784	15	6	stevia	stevia	VERB
dentistry3000-784	15	7	rebaudiana	rebaudiana	PROPN
dentistry3000-784	15	8	(	(	PUNCT
dentistry3000-784	15	9	bertoni	bertoni	PROPN
dentistry3000-784	15	10	)	)	PUNCT
dentistry3000-784	15	11	,	,	PUNCT
dentistry3000-784	15	12	an4bacterial	an4bacterial	PROPN
dentistry3000-784	15	13	ac4vity	ac4vity	PROPN
dentistry3000-784	15	14	,	,	PUNCT
dentistry3000-784	15	15	high	high	ADJ
dentistry3000-784	15	16	performance	performance	NOUN
dentistry3000-784	15	17	liquid	liquid	NOUN
dentistry3000-784	15	18	chromatography	chromatography	NOUN
dentistry3000-784	15	19	.	.	PUNCT
dentistry3000-784	16	1	cita;on	cita;on	NOUN
dentistry3000-784	16	2	:	:	PUNCT
dentistry3000-784	16	3	ahmed	ahmed	PROPN
dentistry3000-784	16	4	mi	mi	PROPN
dentistry3000-784	16	5	,	,	PUNCT
dentistry3000-784	16	6	et	et	PROPN
dentistry3000-784	16	7	al	al	PROPN
dentistry3000-784	16	8	.	.	PROPN
dentistry3000-784	17	1	(	(	PUNCT
dentistry3000-784	17	2	2025	2025	NUM
dentistry3000-784	17	3	)	)	PUNCT
dentistry3000-784	17	4	phytochemical	phytochemical	ADJ
dentistry3000-784	17	5	analysis	analysis	NOUN
dentistry3000-784	17	6	and	and	CCONJ
dentistry3000-784	17	7	an;bacterial	an;bacterial	NOUN
dentistry3000-784	17	8	ac;vity	ac;vity	NOUN
dentistry3000-784	17	9	of	of	ADP
dentistry3000-784	17	10	stevia	stevia	NOUN
dentistry3000-784	17	11	rebauduana	rebauduana	NOUN
dentistry3000-784	17	12	bertoni	bertoni	PROPN
dentistry3000-784	17	13	leaves	leave	NOUN
dentistry3000-784	17	14	extract	extract	VERB
dentistry3000-784	17	15	against	against	ADP
dentistry3000-784	17	16	streptococcus	streptococcus	NOUN
dentistry3000-784	17	17	sanguis	sanguis	NOUN
dentistry3000-784	17	18	(	(	PUNCT
dentistry3000-784	17	19	a	a	DET
dentistry3000-784	17	20	primary	primary	ADJ
dentistry3000-784	17	21	inhabitant	inhabitant	NOUN
dentistry3000-784	17	22	of	of	ADP
dentistry3000-784	17	23	dental	dental	ADJ
dentistry3000-784	17	24	place	place	NOUN
dentistry3000-784	17	25	):	):	PUNCT
dentistry3000-784	17	26	in	in	ADP
dentistry3000-784	17	27	vitro	vitro	X
dentistry3000-784	17	28	study	study	NOUN
dentistry3000-784	17	29	.	.	PUNCT
dentistry3000-784	18	1	den;stry	den;stry	PROPN
dentistry3000-784	18	2	3000	3000	NUM
dentistry3000-784	18	3	.	.	PUNCT
dentistry3000-784	19	1	2.a001	2.a001	NUM
dentistry3000-784	19	2	doi:10.5195	doi:10.5195	NOUN
dentistry3000-784	19	3	/	/	SYM
dentistry3000-784	19	4	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	19	5	received	receive	VERB
dentistry3000-784	19	6	:	:	PUNCT
dentistry3000-784	19	7	november	november	PROPN
dentistry3000-784	19	8	29	29	NUM
dentistry3000-784	19	9	,	,	PUNCT
dentistry3000-784	19	10	2024	2024	NUM
dentistry3000-784	19	11	accepted	accept	VERB
dentistry3000-784	19	12	:	:	PUNCT
dentistry3000-784	19	13	december	december	PROPN
dentistry3000-784	19	14	18	18	NUM
dentistry3000-784	19	15	,	,	PUNCT
dentistry3000-784	19	16	2024	2024	NUM
dentistry3000-784	19	17	published	publish	VERB
dentistry3000-784	19	18	:	:	PUNCT
dentistry3000-784	19	19	february	february	PROPN
dentistry3000-784	19	20	5	5	NUM
dentistry3000-784	19	21	.	.	PUNCT
dentistry3000-784	19	22	2025	2025	NUM
dentistry3000-784	19	23	copyright	copyright	NOUN
dentistry3000-784	19	24	:	:	PUNCT
dentistry3000-784	19	25	©	©	PROPN
dentistry3000-784	19	26	2025	2025	NUM
dentistry3000-784	19	27	ahmed	ahmed	PROPN
dentistry3000-784	19	28	mi	mi	PROPN
dentistry3000-784	19	29	,	,	PUNCT
dentistry3000-784	19	30	et	et	PROPN
dentistry3000-784	19	31	al	al	PROPN
dentistry3000-784	19	32	.	.	PUNCT
dentistry3000-784	20	1	this	this	PRON
dentistry3000-784	20	2	is	be	AUX
dentistry3000-784	20	3	an	an	DET
dentistry3000-784	20	4	open	open	ADJ
dentistry3000-784	20	5	access	access	NOUN
dentistry3000-784	20	6	ar;cle	ar;cle	NOUN
dentistry3000-784	20	7	licensed	license	VERB
dentistry3000-784	20	8	under	under	ADP
dentistry3000-784	20	9	a	a	DET
dentistry3000-784	20	10	crea;ve	crea;ve	NUM
dentistry3000-784	20	11	commons	common	NOUN
dentistry3000-784	20	12	axribu;on	axribu;on	NOUN
dentistry3000-784	20	13	work	work	NOUN
dentistry3000-784	20	14	4.0	4.0	NUM
dentistry3000-784	20	15	united	unite	VERB
dentistry3000-784	20	16	states	states	PROPN
dentistry3000-784	20	17	license	license	NOUN
dentistry3000-784	20	18	.	.	PUNCT
dentistry3000-784	21	1	email	email	NOUN
dentistry3000-784	21	2	:	:	PUNCT
dentistry3000-784	21	3	manar.i@albayan.edu.iq	manar.i@albayan.edu.iq	ADJ
dentistry3000-784	21	4	introduction	introduction	NOUN
dentistry3000-784	21	5	many	many	ADJ
dentistry3000-784	21	6	kinds	kind	NOUN
dentistry3000-784	21	7	of	of	ADP
dentistry3000-784	21	8	microbes	microbe	NOUN
dentistry3000-784	21	9	call	call	VERB
dentistry3000-784	21	10	the	the	DET
dentistry3000-784	21	11	mouth	mouth	NOUN
dentistry3000-784	21	12	and	and	CCONJ
dentistry3000-784	21	13	gums	gum	NOUN
dentistry3000-784	21	14	their	their	PRON
dentistry3000-784	21	15	home	home	NOUN
dentistry3000-784	22	1	[	[	X
dentistry3000-784	22	2	1	1	NUM
dentistry3000-784	22	3	]	]	PUNCT
dentistry3000-784	22	4	.	.	PUNCT
dentistry3000-784	23	1	the	the	DET
dentistry3000-784	23	2	mouth	mouth	NOUN
dentistry3000-784	23	3	supports	support	VERB
dentistry3000-784	23	4	distinct	distinct	ADJ
dentistry3000-784	23	5	microbial	microbial	ADJ
dentistry3000-784	23	6	communities	community	NOUN
dentistry3000-784	23	7	,	,	PUNCT
dentistry3000-784	23	8	with	with	ADP
dentistry3000-784	23	9	each	each	DET
dentistry3000-784	23	10	site	site	NOUN
dentistry3000-784	23	11	containing	contain	VERB
dentistry3000-784	23	12	an	an	DET
dentistry3000-784	23	13	average	average	NOUN
dentistry3000-784	23	14	of	of	ADP
dentistry3000-784	23	15	50	50	NUM
dentistry3000-784	23	16	species	specie	NOUN
dentistry3000-784	23	17	(	(	PUNCT
dentistry3000-784	23	18	a	a	DET
dentistry3000-784	23	19	subset	subset	NOUN
dentistry3000-784	23	20	of	of	ADP
dentistry3000-784	23	21	1,000	1,000	NUM
dentistry3000-784	23	22	species	specie	NOUN
dentistry3000-784	23	23	capable	capable	ADJ
dentistry3000-784	23	24	of	of	ADP
dentistry3000-784	23	25	oral	oral	ADJ
dentistry3000-784	23	26	colonization	colonization	NOUN
dentistry3000-784	23	27	)	)	PUNCT
dentistry3000-784	24	1	[	[	X
dentistry3000-784	24	2	2	2	NUM
dentistry3000-784	24	3	]	]	PUNCT
dentistry3000-784	24	4	.	.	PUNCT
dentistry3000-784	25	1	oral	oral	ADJ
dentistry3000-784	25	2	surfaces	surface	NOUN
dentistry3000-784	25	3	are	be	AUX
dentistry3000-784	25	4	most	most	ADV
dentistry3000-784	25	5	often	often	ADV
dentistry3000-784	25	6	colonized	colonize	VERB
dentistry3000-784	25	7	by	by	ADP
dentistry3000-784	25	8	streptococci	streptococcus	NOUN
dentistry3000-784	25	9	and	and	CCONJ
dentistry3000-784	25	10	actinomyces	actinomyce	NOUN
dentistry3000-784	25	11	species	specie	NOUN
dentistry3000-784	25	12	,	,	PUNCT
dentistry3000-784	25	13	interbacterial	interbacterial	ADJ
dentistry3000-784	25	14	streptococci	streptococci	NOUN
dentistry3000-784	25	15	binding	bind	VERB
dentistry3000-784	25	16	has	have	VERB
dentistry3000-784	25	17	major	major	ADJ
dentistry3000-784	25	18	implications	implication	NOUN
dentistry3000-784	25	19	for	for	ADP
dentistry3000-784	25	20	periodontal	periodontal	ADJ
dentistry3000-784	25	21	disease	disease	NOUN
dentistry3000-784	25	22	development	development	NOUN
dentistry3000-784	25	23	in	in	ADP
dentistry3000-784	25	24	that	that	PRON
dentistry3000-784	25	25	several	several	ADJ
dentistry3000-784	25	26	co	co	ADJ
dentistry3000-784	25	27	-	-	ADJ
dentistry3000-784	25	28	adhering	adhering	ADJ
dentistry3000-784	25	29	organisms	organism	NOUN
dentistry3000-784	25	30	are	be	AUX
dentistry3000-784	25	31	periodontal	periodontal	ADJ
dentistry3000-784	25	32	pathogens	pathogen	NOUN
dentistry3000-784	25	33	.	.	PUNCT
dentistry3000-784	26	1	decreased	decrease	VERB
dentistry3000-784	26	2	oxygen	oxygen	NOUN
dentistry3000-784	26	3	tensions	tension	NOUN
dentistry3000-784	26	4	favor	favor	VERB
dentistry3000-784	26	5	population	population	NOUN
dentistry3000-784	26	6	shifts	shift	NOUN
dentistry3000-784	26	7	,	,	PUNCT
dentistry3000-784	26	8	allowing	allow	VERB
dentistry3000-784	26	9	strict	strict	ADJ
dentistry3000-784	26	10	anaerobes	anaerobe	NOUN
dentistry3000-784	26	11	like	like	ADP
dentistry3000-784	26	12	bacteroidaceae	bacteroidaceae	PROPN
dentistry3000-784	26	13	spp	spp	PROPN
dentistry3000-784	26	14	.	.	PUNCT
dentistry3000-784	27	1	and	and	CCONJ
dentistry3000-784	27	2	spirochaetes	spirochaete	VERB
dentistry3000-784	27	3	to	to	PART
dentistry3000-784	27	4	flourish	flourish	VERB
dentistry3000-784	27	5	[	[	PUNCT
dentistry3000-784	27	6	3,4	3,4	NUM
dentistry3000-784	27	7	]	]	PUNCT
dentistry3000-784	27	8	.	.	PUNCT
dentistry3000-784	28	1	biofilm	biofilm	NOUN
dentistry3000-784	28	2	in	in	ADP
dentistry3000-784	28	3	the	the	DET
dentistry3000-784	28	4	form	form	NOUN
dentistry3000-784	28	5	of	of	ADP
dentistry3000-784	28	6	supragingival	supragingival	NOUN
dentistry3000-784	28	7	and	and	CCONJ
dentistry3000-784	28	8	subgingival	subgingival	ADJ
dentistry3000-784	28	9	plaque	plaque	NOUN
dentistry3000-784	28	10	causes	cause	VERB
dentistry3000-784	28	11	periodontal	periodontal	ADJ
dentistry3000-784	28	12	disease	disease	NOUN
dentistry3000-784	28	13	[	[	X
dentistry3000-784	28	14	5	5	NUM
dentistry3000-784	28	15	]	]	PUNCT
dentistry3000-784	28	16	.	.	PUNCT
dentistry3000-784	29	1	tamura	tamura	PROPN
dentistry3000-784	29	2	et	et	PROPN
dentistry3000-784	29	3	al	al	PROPN
dentistry3000-784	29	4	.	.	PROPN
dentistry3000-784	30	1	(	(	PUNCT
dentistry3000-784	30	2	2008	2008	NUM
dentistry3000-784	30	3	)	)	PUNCT
dentistry3000-784	31	1	[	[	X
dentistry3000-784	31	2	6	6	NUM
dentistry3000-784	31	3	]	]	PUNCT
dentistry3000-784	31	4	postulated	postulate	VERB
dentistry3000-784	31	5	that	that	SCONJ
dentistry3000-784	31	6	some	some	DET
dentistry3000-784	31	7	kinds	kind	NOUN
dentistry3000-784	31	8	of	of	ADP
dentistry3000-784	31	9	bacteria	bacteria	NOUN
dentistry3000-784	31	10	found	find	VERB
dentistry3000-784	31	11	above	above	ADP
dentistry3000-784	31	12	the	the	DET
dentistry3000-784	31	13	gum	gum	NOUN
dentistry3000-784	31	14	line	line	NOUN
dentistry3000-784	31	15	would	would	AUX
dentistry3000-784	31	16	entice	entice	VERB
dentistry3000-784	31	17	free	free	ADJ
dentistry3000-784	31	18	-	-	PUNCT
dentistry3000-784	31	19	living	live	VERB
dentistry3000-784	31	20	pathogens	pathogen	NOUN
dentistry3000-784	31	21	to	to	ADP
dentistry3000-784	31	22	the	the	DET
dentistry3000-784	31	23	subgingival	subgingival	NOUN
dentistry3000-784	31	24	plaque	plaque	NOUN
dentistry3000-784	31	25	,	,	PUNCT
dentistry3000-784	31	26	hence	hence	ADV
dentistry3000-784	31	27	exacerbating	exacerbate	VERB
dentistry3000-784	31	28	periodontal	periodontal	ADJ
dentistry3000-784	31	29	disorders	disorder	NOUN
dentistry3000-784	31	30	.	.	PUNCT
dentistry3000-784	32	1	ximenez	ximenez	PROPN
dentistry3000-784	32	2	et	et	PROPN
dentistry3000-784	32	3	al	al	PROPN
dentistry3000-784	32	4	.	.	PROPN
dentistry3000-784	33	1	(	(	PUNCT
dentistry3000-784	33	2	2000a	2000a	NOUN
dentistry3000-784	33	3	,	,	PUNCT
dentistry3000-784	33	4	b	b	NOUN
dentistry3000-784	33	5	)	)	PUNCT
dentistry3000-784	34	1	[	[	X
dentistry3000-784	34	2	7,8	7,8	NUM
dentistry3000-784	34	3	]	]	PUNCT
dentistry3000-784	34	4	discovered	discover	VERB
dentistry3000-784	34	5	that	that	SCONJ
dentistry3000-784	34	6	phytochemical	phytochemical	ADJ
dentistry3000-784	34	7	analysis	analysis	NOUN
dentistry3000-784	34	8	and	and	CCONJ
dentistry3000-784	34	9	an1bacterial	an1bacterial	ADJ
dentistry3000-784	34	10	ac1vity	ac1vity	NOUN
dentistry3000-784	34	11	of	of	ADP
dentistry3000-784	34	12	stevia	stevia	NOUN
dentistry3000-784	34	13	rebaudiana	rebaudiana	PROPN
dentistry3000-784	34	14	bertoni	bertoni	PROPN
dentistry3000-784	34	15	leaves	leave	NOUN
dentistry3000-784	34	16	extract	extract	VERB
dentistry3000-784	34	17	against	against	ADP
dentistry3000-784	34	18	streptococcus	streptococcus	NOUN
dentistry3000-784	34	19	sanguis	sanguis	NOUN
dentistry3000-784	34	20	(	(	PUNCT
dentistry3000-784	34	21	a	a	DET
dentistry3000-784	34	22	primary	primary	ADJ
dentistry3000-784	34	23	inhabitant	inhabitant	NOUN
dentistry3000-784	34	24	of	of	ADP
dentistry3000-784	34	25	dental	dental	ADJ
dentistry3000-784	34	26	plaque	plaque	NOUN
dentistry3000-784	34	27	):	):	PUNCT
dentistry3000-784	34	28	in	in	ADP
dentistry3000-784	34	29	vitro	vitro	X
dentistry3000-784	34	30	study	study	NOUN
dentistry3000-784	34	31	vol	vol	NOUN
dentistry3000-784	34	32	13	13	NUM
dentistry3000-784	34	33	no	no	DET
dentistry3000-784	34	34	1	1	NUM
dentistry3000-784	34	35	(	(	PUNCT
dentistry3000-784	34	36	2025	2025	NUM
dentistry3000-784	34	37	)	)	PUNCT
dentistry3000-784	34	38	doi	doi	NOUN
dentistry3000-784	34	39	10.5195	10.5195	NUM
dentistry3000-784	34	40	/	/	SYM
dentistry3000-784	34	41	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	34	42	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	34	43	improving	improve	VERB
dentistry3000-784	34	44	periodontal	periodontal	ADJ
dentistry3000-784	34	45	condition	condition	NOUN
dentistry3000-784	34	46	and	and	CCONJ
dentistry3000-784	34	47	reducing	reduce	VERB
dentistry3000-784	34	48	pathogenic	pathogenic	ADJ
dentistry3000-784	34	49	bacterial	bacterial	ADJ
dentistry3000-784	34	50	species	specie	NOUN
dentistry3000-784	34	51	,	,	PUNCT
dentistry3000-784	34	52	including	include	VERB
dentistry3000-784	34	53	p.	p.	PROPN
dentistry3000-784	34	54	gingivalis	gingivalis	PROPN
dentistry3000-784	34	55	,	,	PUNCT
dentistry3000-784	34	56	may	may	AUX
dentistry3000-784	34	57	be	be	AUX
dentistry3000-784	34	58	achieved	achieve	VERB
dentistry3000-784	34	59	by	by	ADP
dentistry3000-784	34	60	eliminating	eliminate	VERB
dentistry3000-784	34	61	the	the	DET
dentistry3000-784	34	62	supragingival	supragingival	NOUN
dentistry3000-784	34	63	plaque	plaque	NOUN
dentistry3000-784	34	64	from	from	ADP
dentistry3000-784	34	65	periodontal	periodontal	ADJ
dentistry3000-784	34	66	patients	patient	NOUN
dentistry3000-784	34	67	.	.	PUNCT
dentistry3000-784	35	1	biofilm	biofilm	NOUN
dentistry3000-784	35	2	bacteria	bacteria	NOUN
dentistry3000-784	35	3	produce	produce	VERB
dentistry3000-784	35	4	a	a	DET
dentistry3000-784	35	5	thin	thin	ADJ
dentistry3000-784	35	6	extracellular	extracellular	ADJ
dentistry3000-784	35	7	matrix	matrix	NOUN
dentistry3000-784	35	8	that	that	PRON
dentistry3000-784	35	9	encloses	enclose	VERB
dentistry3000-784	35	10	and	and	CCONJ
dentistry3000-784	35	11	protects	protect	VERB
dentistry3000-784	35	12	microbial	microbial	ADJ
dentistry3000-784	35	13	populations	population	NOUN
dentistry3000-784	35	14	from	from	ADP
dentistry3000-784	35	15	the	the	DET
dentistry3000-784	35	16	environment	environment	NOUN
dentistry3000-784	35	17	,	,	PUNCT
dentistry3000-784	35	18	including	include	VERB
dentistry3000-784	35	19	chemotherapy	chemotherapy	NOUN
dentistry3000-784	35	20	attacks	attack	NOUN
dentistry3000-784	35	21	[	[	X
dentistry3000-784	35	22	9	9	NUM
dentistry3000-784	35	23	]	]	PUNCT
dentistry3000-784	35	24	.	.	PUNCT
dentistry3000-784	36	1	mechanical	mechanical	ADJ
dentistry3000-784	36	2	methods	method	NOUN
dentistry3000-784	36	3	are	be	AUX
dentistry3000-784	36	4	required	require	VERB
dentistry3000-784	36	5	to	to	PART
dentistry3000-784	36	6	remove	remove	VERB
dentistry3000-784	36	7	the	the	DET
dentistry3000-784	36	8	dental	dental	ADJ
dentistry3000-784	36	9	biofilm	biofilm	NOUN
dentistry3000-784	36	10	on	on	ADP
dentistry3000-784	36	11	a	a	DET
dentistry3000-784	36	12	regular	regular	ADJ
dentistry3000-784	36	13	basis	basis	NOUN
dentistry3000-784	36	14	,	,	PUNCT
dentistry3000-784	36	15	and	and	CCONJ
dentistry3000-784	36	16	antiseptics	antiseptic	NOUN
dentistry3000-784	36	17	such	such	ADJ
dentistry3000-784	36	18	as	as	ADP
dentistry3000-784	36	19	mouth	mouth	NOUN
dentistry3000-784	36	20	rinse	rinse	NOUN
dentistry3000-784	36	21	can	can	AUX
dentistry3000-784	36	22	aid	aid	VERB
dentistry3000-784	36	23	in	in	ADP
dentistry3000-784	36	24	biofilm	biofilm	NOUN
dentistry3000-784	36	25	control	control	NOUN
dentistry3000-784	36	26	.	.	PUNCT
dentistry3000-784	37	1	medicinal	medicinal	ADJ
dentistry3000-784	37	2	plants	plant	NOUN
dentistry3000-784	37	3	are	be	AUX
dentistry3000-784	37	4	becoming	become	VERB
dentistry3000-784	37	5	increasingly	increasingly	ADV
dentistry3000-784	37	6	popular	popular	ADJ
dentistry3000-784	37	7	around	around	ADP
dentistry3000-784	37	8	the	the	DET
dentistry3000-784	37	9	globe	globe	NOUN
dentistry3000-784	37	10	to	to	PART
dentistry3000-784	37	11	treat	treat	VERB
dentistry3000-784	37	12	a	a	DET
dentistry3000-784	37	13	wide	wide	ADJ
dentistry3000-784	37	14	range	range	NOUN
dentistry3000-784	37	15	of	of	ADP
dentistry3000-784	37	16	illnesses	illness	NOUN
dentistry3000-784	37	17	[	[	X
dentistry3000-784	37	18	10	10	NUM
dentistry3000-784	37	19	]	]	PUNCT
dentistry3000-784	37	20	.	.	PUNCT
dentistry3000-784	38	1	stevia	stevia	PROPN
dentistry3000-784	38	2	rebaudiana	rebaudiana	PROPN
dentistry3000-784	38	3	(	(	PUNCT
dentistry3000-784	38	4	bertoni	bertoni	PROPN
dentistry3000-784	38	5	)	)	PUNCT
dentistry3000-784	38	6	"	"	PUNCT
dentistry3000-784	38	7	sweet	sweet	ADJ
dentistry3000-784	38	8	herb	herb	NOUN
dentistry3000-784	38	9	of	of	ADP
dentistry3000-784	38	10	paraguay	paraguay	NOUN
dentistry3000-784	38	11	"	"	PUNCT
dentistry3000-784	38	12	is	be	AUX
dentistry3000-784	38	13	a	a	DET
dentistry3000-784	38	14	zero	zero	NUM
dentistry3000-784	38	15	-	-	PUNCT
dentistry3000-784	38	16	calorie	calorie	NOUN
dentistry3000-784	38	17	sweetener	sweetener	NOUN
dentistry3000-784	38	18	native	native	ADJ
dentistry3000-784	38	19	to	to	ADP
dentistry3000-784	38	20	south	south	PROPN
dentistry3000-784	38	21	america	america	PROPN
dentistry3000-784	38	22	,	,	PUNCT
dentistry3000-784	38	23	where	where	SCONJ
dentistry3000-784	38	24	it	it	PRON
dentistry3000-784	38	25	was	be	AUX
dentistry3000-784	38	26	initially	initially	ADV
dentistry3000-784	38	27	ingested	ingest	VERB
dentistry3000-784	38	28	over	over	ADP
dentistry3000-784	38	29	200	200	NUM
dentistry3000-784	38	30	years	year	NOUN
dentistry3000-784	38	31	ago	ago	ADV
dentistry3000-784	38	32	by	by	ADP
dentistry3000-784	38	33	native	native	ADJ
dentistry3000-784	38	34	people	people	NOUN
dentistry3000-784	38	35	[	[	X
dentistry3000-784	38	36	11	11	NUM
dentistry3000-784	38	37	]	]	PUNCT
dentistry3000-784	38	38	.	.	PUNCT
dentistry3000-784	39	1	stevia	stevia	PROPN
dentistry3000-784	39	2	rebaudiana	rebaudiana	PROPN
dentistry3000-784	39	3	leaves	leave	NOUN
dentistry3000-784	39	4	contain	contain	VERB
dentistry3000-784	39	5	over	over	ADP
dentistry3000-784	39	6	100	100	NUM
dentistry3000-784	39	7	phytochemicals	phytochemical	NOUN
dentistry3000-784	39	8	,	,	PUNCT
dentistry3000-784	39	9	which	which	PRON
dentistry3000-784	39	10	are	be	AUX
dentistry3000-784	39	11	secondary	secondary	ADJ
dentistry3000-784	39	12	metabolites	metabolite	NOUN
dentistry3000-784	39	13	that	that	PRON
dentistry3000-784	39	14	plants	plant	NOUN
dentistry3000-784	39	15	accumulate	accumulate	VERB
dentistry3000-784	39	16	to	to	PART
dentistry3000-784	39	17	defend	defend	VERB
dentistry3000-784	39	18	themselves	themselves	PRON
dentistry3000-784	39	19	against	against	ADP
dentistry3000-784	39	20	microbial	microbial	ADJ
dentistry3000-784	39	21	infections	infection	NOUN
dentistry3000-784	39	22	.	.	PUNCT
dentistry3000-784	40	1	they	they	PRON
dentistry3000-784	40	2	are	be	AUX
dentistry3000-784	40	3	active	active	ADJ
dentistry3000-784	40	4	ingredients	ingredient	NOUN
dentistry3000-784	40	5	with	with	ADP
dentistry3000-784	40	6	therapeutic	therapeutic	ADJ
dentistry3000-784	40	7	properties	property	NOUN
dentistry3000-784	40	8	used	use	VERB
dentistry3000-784	40	9	to	to	PART
dentistry3000-784	40	10	make	make	VERB
dentistry3000-784	40	11	medicines	medicine	NOUN
dentistry3000-784	40	12	and	and	CCONJ
dentistry3000-784	40	13	drugs	drug	NOUN
dentistry3000-784	40	14	[	[	X
dentistry3000-784	40	15	12	12	NUM
dentistry3000-784	40	16	]	]	PUNCT
dentistry3000-784	40	17	.	.	PUNCT
dentistry3000-784	41	1	stevia	stevia	PROPN
dentistry3000-784	41	2	has	have	VERB
dentistry3000-784	41	3	anti	anti	ADJ
dentistry3000-784	41	4	-	-	ADJ
dentistry3000-784	41	5	microbial	microbial	ADJ
dentistry3000-784	41	6	,	,	PUNCT
dentistry3000-784	41	7	antihypertensive	antihypertensive	ADJ
dentistry3000-784	41	8	,	,	PUNCT
dentistry3000-784	41	9	anti	anti	ADJ
dentistry3000-784	41	10	-	-	ADJ
dentistry3000-784	41	11	cariogenic	cariogenic	ADJ
dentistry3000-784	41	12	,	,	PUNCT
dentistry3000-784	41	13	diuretic	diuretic	ADJ
dentistry3000-784	41	14	,	,	PUNCT
dentistry3000-784	41	15	anti	anti	ADJ
dentistry3000-784	41	16	-	-	ADJ
dentistry3000-784	41	17	viral	viral	ADJ
dentistry3000-784	41	18	,	,	PUNCT
dentistry3000-784	41	19	anti	anti	ADJ
dentistry3000-784	41	20	-	-	ADJ
dentistry3000-784	41	21	diarrheal	diarrheal	ADJ
dentistry3000-784	41	22	,	,	PUNCT
dentistry3000-784	41	23	immunomodulatory	immunomodulatory	ADJ
dentistry3000-784	41	24	,	,	PUNCT
dentistry3000-784	41	25	antimutagenesis	antimutagenesis	NOUN
dentistry3000-784	41	26	,	,	PUNCT
dentistry3000-784	41	27	anti	anti	ADJ
dentistry3000-784	41	28	-	-	ADJ
dentistry3000-784	41	29	teratogenesis	teratogenesis	ADJ
dentistry3000-784	41	30	and	and	CCONJ
dentistry3000-784	41	31	anti	anti	ADJ
dentistry3000-784	41	32	-	-	ADJ
dentistry3000-784	41	33	allergic	allergic	ADJ
dentistry3000-784	41	34	properties	property	NOUN
dentistry3000-784	41	35	[	[	X
dentistry3000-784	41	36	13,14	13,14	NUM
dentistry3000-784	41	37	]	]	X
dentistry3000-784	41	38	.	.	PUNCT
dentistry3000-784	42	1	as	as	ADV
dentistry3000-784	42	2	far	far	ADV
dentistry3000-784	42	3	as	as	SCONJ
dentistry3000-784	42	4	we	we	PRON
dentistry3000-784	42	5	are	be	AUX
dentistry3000-784	42	6	aware	aware	ADJ
dentistry3000-784	42	7	,	,	PUNCT
dentistry3000-784	42	8	the	the	DET
dentistry3000-784	42	9	potential	potential	ADJ
dentistry3000-784	42	10	antimicrobial	antimicrobial	ADJ
dentistry3000-784	42	11	properties	property	NOUN
dentistry3000-784	42	12	of	of	ADP
dentistry3000-784	42	13	stevia	stevia	NOUN
dentistry3000-784	42	14	extract	extract	NOUN
dentistry3000-784	42	15	against	against	ADP
dentistry3000-784	42	16	many	many	ADJ
dentistry3000-784	42	17	microorganisms	microorganism	NOUN
dentistry3000-784	42	18	have	have	AUX
dentistry3000-784	42	19	been	be	AUX
dentistry3000-784	42	20	investigated	investigate	VERB
dentistry3000-784	42	21	,	,	PUNCT
dentistry3000-784	42	22	but	but	CCONJ
dentistry3000-784	42	23	no	no	DET
dentistry3000-784	42	24	one	one	NOUN
dentistry3000-784	42	25	proved	prove	VERB
dentistry3000-784	42	26	the	the	DET
dentistry3000-784	42	27	presence	presence	NOUN
dentistry3000-784	42	28	of	of	ADP
dentistry3000-784	42	29	an	an	DET
dentistry3000-784	42	30	antibacterial	antibacterial	ADJ
dentistry3000-784	42	31	effect	effect	NOUN
dentistry3000-784	42	32	against	against	ADP
dentistry3000-784	42	33	s.	s.	PROPN
dentistry3000-784	42	34	sanguis	sanguis	PROPN
dentistry3000-784	42	35	.	.	PUNCT
dentistry3000-784	43	1	material	material	NOUN
dentistry3000-784	43	2	and	and	CCONJ
dentistry3000-784	43	3	methods	method	NOUN
dentistry3000-784	43	4	the	the	DET
dentistry3000-784	43	5	research	research	NOUN
dentistry3000-784	43	6	ethics	ethic	NOUN
dentistry3000-784	43	7	review	review	PROPN
dentistry3000-784	43	8	board	board	NOUN
dentistry3000-784	43	9	of	of	ADP
dentistry3000-784	43	10	the	the	DET
dentistry3000-784	43	11	college	college	PROPN
dentistry3000-784	43	12	of	of	ADP
dentistry3000-784	43	13	dentistry	dentistry	PROPN
dentistry3000-784	43	14	medical	medical	PROPN
dentistry3000-784	43	15	ethical	ethical	PROPN
dentistry3000-784	43	16	committee	committee	PROPN
dentistry3000-784	43	17	at	at	ADP
dentistry3000-784	43	18	baghdad	baghdad	PROPN
dentistry3000-784	43	19	university	university	PROPN
dentistry3000-784	43	20	approved	approve	VERB
dentistry3000-784	43	21	the	the	DET
dentistry3000-784	43	22	protocol	protocol	NOUN
dentistry3000-784	43	23	of	of	ADP
dentistry3000-784	43	24	this	this	DET
dentistry3000-784	43	25	study	study	NOUN
dentistry3000-784	43	26	.	.	PUNCT
dentistry3000-784	44	1	stevia	stevia	PROPN
dentistry3000-784	44	2	leaves	leave	NOUN
dentistry3000-784	44	3	were	be	AUX
dentistry3000-784	44	4	collected	collect	VERB
dentistry3000-784	44	5	and	and	CCONJ
dentistry3000-784	44	6	extracted	extract	VERB
dentistry3000-784	44	7	at	at	ADP
dentistry3000-784	44	8	university	university	PROPN
dentistry3000-784	44	9	of	of	ADP
dentistry3000-784	44	10	baghdad	baghdad	PROPN
dentistry3000-784	44	11	research	research	NOUN
dentistry3000-784	44	12	unit	unit	NOUN
dentistry3000-784	44	13	of	of	ADP
dentistry3000-784	44	14	aromatic	aromatic	ADJ
dentistry3000-784	44	15	and	and	CCONJ
dentistry3000-784	44	16	medical	medical	ADJ
dentistry3000-784	44	17	plants	plant	NOUN
dentistry3000-784	44	18	.	.	PUNCT
dentistry3000-784	45	1	by	by	ADP
dentistry3000-784	45	2	maceration	maceration	NOUN
dentistry3000-784	45	3	according	accord	VERB
dentistry3000-784	45	4	to	to	ADP
dentistry3000-784	45	5	seidel	seidel	PROPN
dentistry3000-784	45	6	,	,	PUNCT
dentistry3000-784	45	7	2012	2012	NUM
dentistry3000-784	45	8	[	[	X
dentistry3000-784	45	9	15	15	NUM
dentistry3000-784	45	10	]	]	X
dentistry3000-784	45	11	;	;	PUNCT
dentistry3000-784	45	12	stevia	stevia	PROPN
dentistry3000-784	45	13	leaves	leave	VERB
dentistry3000-784	45	14	powder	powder	NOUN
dentistry3000-784	45	15	(	(	PUNCT
dentistry3000-784	45	16	100gm	100gm	PROPN
dentistry3000-784	45	17	)	)	PUNCT
dentistry3000-784	45	18	was	be	AUX
dentistry3000-784	45	19	extracted	extract	VERB
dentistry3000-784	45	20	with	with	ADP
dentistry3000-784	45	21	1	1	NUM
dentistry3000-784	45	22	liter	liter	NOUN
dentistry3000-784	45	23	of	of	ADP
dentistry3000-784	45	24	70	70	NUM
dentistry3000-784	45	25	%	%	NOUN
dentistry3000-784	45	26	ethanol	ethanol	NOUN
dentistry3000-784	45	27	alcohol	alcohol	NOUN
dentistry3000-784	45	28	.	.	PUNCT
dentistry3000-784	46	1	using	use	VERB
dentistry3000-784	46	2	a	a	DET
dentistry3000-784	46	3	laboratory	laboratory	NOUN
dentistry3000-784	46	4	spray	spray	NOUN
dentistry3000-784	46	5	dryer	dryer	NOUN
dentistry3000-784	46	6	,	,	PUNCT
dentistry3000-784	46	7	the	the	DET
dentistry3000-784	46	8	filtered	filter	VERB
dentistry3000-784	46	9	ethanolic	ethanolic	ADJ
dentistry3000-784	46	10	extract	extract	NOUN
dentistry3000-784	46	11	was	be	AUX
dentistry3000-784	46	12	spray	spray	NOUN
dentistry3000-784	46	13	dried	dry	VERB
dentistry3000-784	46	14	to	to	PART
dentistry3000-784	46	15	yield	yield	VERB
dentistry3000-784	46	16	powder	powder	NOUN
dentistry3000-784	46	17	.	.	PUNCT
dentistry3000-784	47	1	prior	prior	ADV
dentistry3000-784	47	2	to	to	ADP
dentistry3000-784	47	3	taking	take	VERB
dentistry3000-784	47	4	plaque	plaque	NOUN
dentistry3000-784	47	5	samples	sample	NOUN
dentistry3000-784	47	6	,	,	PUNCT
dentistry3000-784	47	7	consents	consent	NOUN
dentistry3000-784	47	8	were	be	AUX
dentistry3000-784	47	9	obtained	obtain	VERB
dentistry3000-784	47	10	.	.	PUNCT
dentistry3000-784	48	1	patients	patient	NOUN
dentistry3000-784	48	2	were	be	AUX
dentistry3000-784	48	3	required	require	VERB
dentistry3000-784	48	4	to	to	PART
dentistry3000-784	48	5	refrain	refrain	VERB
dentistry3000-784	48	6	from	from	ADP
dentistry3000-784	48	7	using	use	VERB
dentistry3000-784	48	8	antibacterial	antibacterial	ADJ
dentistry3000-784	48	9	mouthwash	mouthwash	NOUN
dentistry3000-784	48	10	for	for	ADP
dentistry3000-784	48	11	a	a	DET
dentistry3000-784	48	12	minimum	minimum	NOUN
dentistry3000-784	48	13	of	of	ADP
dentistry3000-784	48	14	one	one	NUM
dentistry3000-784	48	15	month	month	NOUN
dentistry3000-784	48	16	before	before	ADP
dentistry3000-784	48	17	the	the	DET
dentistry3000-784	48	18	research	research	NOUN
dentistry3000-784	48	19	.	.	PUNCT
dentistry3000-784	49	1	brain	brain	NOUN
dentistry3000-784	49	2	heart	heart	NOUN
dentistry3000-784	49	3	infusion	infusion	NOUN
dentistry3000-784	49	4	broth	broth	NOUN
dentistry3000-784	49	5	,	,	PUNCT
dentistry3000-784	49	6	1.5	1.5	NUM
dentistry3000-784	49	7	ml	ml	NOUN
dentistry3000-784	49	8	,	,	PUNCT
dentistry3000-784	49	9	was	be	AUX
dentistry3000-784	49	10	added	add	VERB
dentistry3000-784	49	11	to	to	ADP
dentistry3000-784	49	12	sterile	sterile	ADJ
dentistry3000-784	49	13	collection	collection	NOUN
dentistry3000-784	49	14	tubes	tube	NOUN
dentistry3000-784	49	15	as	as	ADV
dentistry3000-784	49	16	soon	soon	ADV
dentistry3000-784	49	17	as	as	SCONJ
dentistry3000-784	49	18	samples	sample	NOUN
dentistry3000-784	49	19	were	be	AUX
dentistry3000-784	49	20	taken	take	VERB
dentistry3000-784	49	21	[	[	PUNCT
dentistry3000-784	49	22	16	16	NUM
dentistry3000-784	49	23	]	]	PUNCT
dentistry3000-784	49	24	.	.	PUNCT
dentistry3000-784	50	1	samples	sample	NOUN
dentistry3000-784	50	2	were	be	AUX
dentistry3000-784	50	3	cultured	cultured	ADJ
dentistry3000-784	50	4	on	on	ADP
dentistry3000-784	50	5	mitis	mitis	ADJ
dentistry3000-784	50	6	salivarious	salivarious	ADJ
dentistry3000-784	50	7	blood	blood	NOUN
dentistry3000-784	50	8	agar	agar	NOUN
dentistry3000-784	50	9	aerobically	aerobically	ADV
dentistry3000-784	50	10	for	for	ADP
dentistry3000-784	50	11	24	24	NUM
dentistry3000-784	50	12	hours	hour	NOUN
dentistry3000-784	50	13	at	at	ADP
dentistry3000-784	50	14	37	37	NUM
dentistry3000-784	50	15	°	°	NOUN
dentistry3000-784	50	16	c	c	NOUN
dentistry3000-784	50	17	.	.	PUNCT
dentistry3000-784	51	1	gram	gram	NOUN
dentistry3000-784	51	2	stain	stain	NOUN
dentistry3000-784	52	1	[	[	X
dentistry3000-784	52	2	17	17	NUM
dentistry3000-784	52	3	]	]	PUNCT
dentistry3000-784	52	4	,	,	PUNCT
dentistry3000-784	52	5	hemolysis	hemolysis	NOUN
dentistry3000-784	52	6	in	in	ADP
dentistry3000-784	52	7	blood	blood	NOUN
dentistry3000-784	52	8	agar	agar	NOUN
dentistry3000-784	52	9	[	[	X
dentistry3000-784	52	10	18	18	NUM
dentistry3000-784	52	11	]	]	PUNCT
dentistry3000-784	52	12	,	,	PUNCT
dentistry3000-784	52	13	sensitivity	sensitivity	NOUN
dentistry3000-784	52	14	to	to	ADP
dentistry3000-784	52	15	optochin	optochin	PROPN
dentistry3000-784	52	16	[	[	X
dentistry3000-784	52	17	19	19	NUM
dentistry3000-784	52	18	]	]	PUNCT
dentistry3000-784	52	19	,	,	PUNCT
dentistry3000-784	52	20	catalase	catalase	ADJ
dentistry3000-784	52	21	reaction	reaction	NOUN
dentistry3000-784	52	22	[	[	X
dentistry3000-784	52	23	20	20	NUM
dentistry3000-784	52	24	]	]	PUNCT
dentistry3000-784	52	25	,	,	PUNCT
dentistry3000-784	52	26	and	and	CCONJ
dentistry3000-784	52	27	polymerase	polymerase	NOUN
dentistry3000-784	52	28	chain	chain	NOUN
dentistry3000-784	52	29	reaction	reaction	NOUN
dentistry3000-784	52	30	[	[	X
dentistry3000-784	52	31	21	21	NUM
dentistry3000-784	52	32	]	]	PUNCT
dentistry3000-784	52	33	were	be	AUX
dentistry3000-784	52	34	all	all	PRON
dentistry3000-784	52	35	used	use	VERB
dentistry3000-784	52	36	to	to	PART
dentistry3000-784	52	37	identify	identify	VERB
dentistry3000-784	52	38	and	and	CCONJ
dentistry3000-784	52	39	characterize	characterize	VERB
dentistry3000-784	52	40	the	the	DET
dentistry3000-784	52	41	isolated	isolated	ADJ
dentistry3000-784	52	42	colonies	colony	NOUN
dentistry3000-784	52	43	.	.	PUNCT
dentistry3000-784	53	1	the	the	DET
dentistry3000-784	53	2	abiopuretm	abiopuretm	NOUN
dentistry3000-784	53	3	genomic	genomic	NOUN
dentistry3000-784	53	4	dna	dna	PROPN
dentistry3000-784	53	5	protocol	protocol	PROPN
dentistry3000-784	53	6	was	be	AUX
dentistry3000-784	53	7	used	use	VERB
dentistry3000-784	53	8	to	to	PART
dentistry3000-784	53	9	extract	extract	VERB
dentistry3000-784	53	10	the	the	DET
dentistry3000-784	53	11	dna	dna	NOUN
dentistry3000-784	53	12	from	from	ADP
dentistry3000-784	53	13	bacterial	bacterial	ADJ
dentistry3000-784	53	14	growth	growth	NOUN
dentistry3000-784	53	15	.	.	PUNCT
dentistry3000-784	54	1	the	the	DET
dentistry3000-784	54	2	concentration	concentration	NOUN
dentistry3000-784	54	3	of	of	ADP
dentistry3000-784	54	4	dna	dna	PROPN
dentistry3000-784	54	5	sample	sample	NOUN
dentistry3000-784	54	6	(	(	PUNCT
dentistry3000-784	54	7	20	20	NUM
dentistry3000-784	54	8	ng	ng	PROPN
dentistry3000-784	54	9	/	/	SYM
dentistry3000-784	54	10	μl	μl	PROPN
dentistry3000-784	54	11	)	)	PUNCT
dentistry3000-784	54	12	was	be	AUX
dentistry3000-784	54	13	measured	measure	VERB
dentistry3000-784	54	14	using	use	VERB
dentistry3000-784	54	15	a	a	DET
dentistry3000-784	54	16	quantus	quantus	NOUN
dentistry3000-784	54	17	fluorometer	fluorometer	NOUN
dentistry3000-784	54	18	device	device	NOUN
dentistry3000-784	54	19	.	.	PUNCT
dentistry3000-784	55	1	macrogen	macrogen	NOUN
dentistry3000-784	55	2	company	company	NOUN
dentistry3000-784	55	3	provided	provide	VERB
dentistry3000-784	55	4	the	the	DET
dentistry3000-784	55	5	primers	primer	NOUN
dentistry3000-784	55	6	in	in	ADP
dentistry3000-784	55	7	lyophilized	lyophilized	ADJ
dentistry3000-784	55	8	state	state	NOUN
dentistry3000-784	55	9	:	:	PUNCT
dentistry3000-784	55	10	s.	s.	PROPN
dentistry3000-784	55	11	sanguis	sanguis	PROPN
dentistry3000-784	55	12	-	-	PUNCT
dentistry3000-784	55	13	f	f	PROPN
dentistry3000-784	55	14	5`ggatagtggctcagggcagccagt	5`ggatagtggctcagggcagccagt	NUM
dentistry3000-784	55	15	t-3	t-3	NOUN
dentistry3000-784	55	16	`	`	PUNCT
dentistry3000-784	55	17	,	,	PUNCT
dentistry3000-784	55	18	s.	s.	PROPN
dentistry3000-784	55	19	sanguis	sanguis	PROPN
dentistry3000-784	55	20	-	-	PUNCT
dentistry3000-784	55	21	r	r	NOUN
dentistry3000-784	55	22	5`gaacagttgctggacttgcttgtc3	5`gaacagttgctggacttgcttgtc3	NUM
dentistry3000-784	55	23	`	`	PUNCT
dentistry3000-784	55	24	,	,	PUNCT
dentistry3000-784	55	25	annealing	anneal	VERB
dentistry3000-784	55	26	temperature	temperature	NOUN
dentistry3000-784	55	27	70˚c	70˚c	NUM
dentistry3000-784	55	28	and	and	CCONJ
dentistry3000-784	55	29	product	product	NOUN
dentistry3000-784	55	30	size	size	NOUN
dentistry3000-784	55	31	(	(	PUNCT
dentistry3000-784	55	32	pb	pb	NOUN
dentistry3000-784	55	33	)	)	PUNCT
dentistry3000-784	55	34	313	313	NUM
dentistry3000-784	56	1	[	[	X
dentistry3000-784	56	2	21	21	NUM
dentistry3000-784	56	3	]	]	PUNCT
dentistry3000-784	56	4	.	.	PUNCT
dentistry3000-784	57	1	to	to	PART
dentistry3000-784	57	2	obtain	obtain	VERB
dentistry3000-784	57	3	the	the	DET
dentistry3000-784	57	4	stock	stock	NOUN
dentistry3000-784	57	5	solution	solution	NOUN
dentistry3000-784	57	6	,	,	PUNCT
dentistry3000-784	57	7	a	a	DET
dentistry3000-784	57	8	concentration	concentration	NOUN
dentistry3000-784	57	9	of	of	ADP
dentistry3000-784	57	10	100	100	NUM
dentistry3000-784	57	11	pmol/µl	pmol/µl	NOUN
dentistry3000-784	57	12	was	be	AUX
dentistry3000-784	57	13	achieved	achieve	VERB
dentistry3000-784	57	14	by	by	ADP
dentistry3000-784	57	15	dispersing	disperse	VERB
dentistry3000-784	57	16	lyophilized	lyophilized	ADJ
dentistry3000-784	57	17	primers	primer	NOUN
dentistry3000-784	57	18	in	in	ADP
dentistry3000-784	57	19	300µl	300µl	NOUN
dentistry3000-784	57	20	of	of	ADP
dentistry3000-784	57	21	nuclease	nuclease	NOUN
dentistry3000-784	57	22	-	-	PUNCT
dentistry3000-784	57	23	free	free	ADJ
dentistry3000-784	57	24	water	water	NOUN
dentistry3000-784	57	25	.	.	PUNCT
dentistry3000-784	58	1	by	by	ADP
dentistry3000-784	58	2	mixing	mix	VERB
dentistry3000-784	58	3	10μl	10μl	ADV
dentistry3000-784	58	4	of	of	ADP
dentistry3000-784	58	5	stock	stock	NOUN
dentistry3000-784	58	6	primers	primer	NOUN
dentistry3000-784	58	7	with	with	ADP
dentistry3000-784	58	8	90μl	90μl	ADJ
dentistry3000-784	58	9	of	of	ADP
dentistry3000-784	58	10	nuclease	nuclease	NOUN
dentistry3000-784	58	11	-	-	PUNCT
dentistry3000-784	58	12	free	free	ADJ
dentistry3000-784	58	13	water	water	NOUN
dentistry3000-784	58	14	,	,	PUNCT
dentistry3000-784	58	15	a	a	DET
dentistry3000-784	58	16	solution	solution	NOUN
dentistry3000-784	58	17	with	with	ADP
dentistry3000-784	58	18	a	a	DET
dentistry3000-784	58	19	concentration	concentration	NOUN
dentistry3000-784	58	20	of	of	ADP
dentistry3000-784	58	21	10	10	NUM
dentistry3000-784	58	22	pmol	pmol	NOUN
dentistry3000-784	58	23	/	/	SYM
dentistry3000-784	58	24	μl	μl	PROPN
dentistry3000-784	58	25	was	be	AUX
dentistry3000-784	58	26	prepared	prepare	VERB
dentistry3000-784	58	27	.	.	PUNCT
dentistry3000-784	59	1	following	follow	VERB
dentistry3000-784	59	2	the	the	DET
dentistry3000-784	59	3	manufacturer	manufacturer	NOUN
dentistry3000-784	59	4	's	's	PART
dentistry3000-784	59	5	instructions	instruction	NOUN
dentistry3000-784	59	6	,	,	PUNCT
dentistry3000-784	59	7	a	a	DET
dentistry3000-784	59	8	final	final	ADJ
dentistry3000-784	59	9	solution	solution	NOUN
dentistry3000-784	59	10	of	of	ADP
dentistry3000-784	59	11	20	20	NUM
dentistry3000-784	59	12	μl	μl	NUM
dentistry3000-784	59	13	was	be	AUX
dentistry3000-784	59	14	created	create	VERB
dentistry3000-784	59	15	by	by	ADP
dentistry3000-784	59	16	mixing	mix	VERB
dentistry3000-784	59	17	10	10	NUM
dentistry3000-784	59	18	μl	μl	ADP
dentistry3000-784	59	19	of	of	ADP
dentistry3000-784	59	20	master	master	NOUN
dentistry3000-784	59	21	mix	mix	NOUN
dentistry3000-784	59	22	with	with	ADP
dentistry3000-784	59	23	1	1	NUM
dentistry3000-784	59	24	μl	μl	ADP
dentistry3000-784	59	25	each	each	PRON
dentistry3000-784	59	26	of	of	ADP
dentistry3000-784	59	27	forward	forward	ADJ
dentistry3000-784	59	28	primer	primer	NOUN
dentistry3000-784	59	29	,	,	PUNCT
dentistry3000-784	59	30	reward	reward	NOUN
dentistry3000-784	59	31	primer	primer	NOUN
dentistry3000-784	59	32	,	,	PUNCT
dentistry3000-784	59	33	6	6	NUM
dentistry3000-784	59	34	μl	μl	NOUN
dentistry3000-784	59	35	of	of	ADP
dentistry3000-784	59	36	nuclease	nuclease	NOUN
dentistry3000-784	59	37	-	-	PUNCT
dentistry3000-784	59	38	free	free	ADJ
dentistry3000-784	59	39	water	water	NOUN
dentistry3000-784	59	40	,	,	PUNCT
dentistry3000-784	59	41	and	and	CCONJ
dentistry3000-784	59	42	2	2	NUM
dentistry3000-784	59	43	μl	μl	NOUN
dentistry3000-784	59	44	of	of	ADP
dentistry3000-784	59	45	the	the	DET
dentistry3000-784	59	46	sample	sample	NOUN
dentistry3000-784	59	47	dna	dna	PROPN
dentistry3000-784	59	48	.	.	PUNCT
dentistry3000-784	60	1	phytochemical	phytochemical	ADJ
dentistry3000-784	60	2	analysis	analysis	NOUN
dentistry3000-784	60	3	and	and	CCONJ
dentistry3000-784	60	4	an1bacterial	an1bacterial	ADJ
dentistry3000-784	60	5	ac1vity	ac1vity	NOUN
dentistry3000-784	60	6	of	of	ADP
dentistry3000-784	60	7	stevia	stevia	NOUN
dentistry3000-784	60	8	rebaudiana	rebaudiana	PROPN
dentistry3000-784	60	9	bertoni	bertoni	PROPN
dentistry3000-784	60	10	leaves	leave	NOUN
dentistry3000-784	60	11	extract	extract	VERB
dentistry3000-784	60	12	against	against	ADP
dentistry3000-784	60	13	streptococcus	streptococcus	NOUN
dentistry3000-784	60	14	sanguis	sanguis	NOUN
dentistry3000-784	60	15	(	(	PUNCT
dentistry3000-784	60	16	a	a	DET
dentistry3000-784	60	17	primary	primary	ADJ
dentistry3000-784	60	18	inhabitant	inhabitant	NOUN
dentistry3000-784	60	19	of	of	ADP
dentistry3000-784	60	20	dental	dental	ADJ
dentistry3000-784	60	21	plaque	plaque	NOUN
dentistry3000-784	60	22	):	):	PUNCT
dentistry3000-784	60	23	in	in	ADP
dentistry3000-784	60	24	vitro	vitro	X
dentistry3000-784	60	25	study	study	NOUN
dentistry3000-784	60	26	vol	vol	NOUN
dentistry3000-784	60	27	13	13	NUM
dentistry3000-784	60	28	no	no	DET
dentistry3000-784	60	29	1	1	NUM
dentistry3000-784	60	30	(	(	PUNCT
dentistry3000-784	60	31	2025	2025	NUM
dentistry3000-784	60	32	)	)	PUNCT
dentistry3000-784	60	33	doi	doi	NOUN
dentistry3000-784	60	34	10.5195	10.5195	NUM
dentistry3000-784	60	35	/	/	SYM
dentistry3000-784	60	36	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	60	37	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	60	38	the	the	DET
dentistry3000-784	60	39	thermal	thermal	ADJ
dentistry3000-784	60	40	cycling	cycling	NOUN
dentistry3000-784	60	41	protocol	protocol	NOUN
dentistry3000-784	60	42	was	be	AUX
dentistry3000-784	60	43	followed	follow	VERB
dentistry3000-784	60	44	as	as	SCONJ
dentistry3000-784	60	45	directed	direct	VERB
dentistry3000-784	60	46	by	by	ADP
dentistry3000-784	60	47	the	the	DET
dentistry3000-784	60	48	manufacturer	manufacturer	NOUN
dentistry3000-784	60	49	,	,	PUNCT
dentistry3000-784	60	50	with	with	ADP
dentistry3000-784	60	51	a	a	DET
dentistry3000-784	60	52	reaction	reaction	NOUN
dentistry3000-784	60	53	volume	volume	NOUN
dentistry3000-784	60	54	per	per	ADP
dentistry3000-784	60	55	run	run	NOUN
dentistry3000-784	60	56	of	of	ADP
dentistry3000-784	60	57	20	20	NUM
dentistry3000-784	60	58	and	and	CCONJ
dentistry3000-784	60	59	a	a	DET
dentistry3000-784	60	60	total	total	NOUN
dentistry3000-784	60	61	of	of	ADP
dentistry3000-784	60	62	30	30	NUM
dentistry3000-784	60	63	pcr	pcr	ADJ
dentistry3000-784	60	64	cycles	cycle	NOUN
dentistry3000-784	60	65	.	.	PUNCT
dentistry3000-784	61	1	the	the	DET
dentistry3000-784	61	2	pcr	pcr	ADJ
dentistry3000-784	61	3	device	device	NOUN
dentistry3000-784	61	4	was	be	AUX
dentistry3000-784	61	5	used	use	VERB
dentistry3000-784	61	6	to	to	PART
dentistry3000-784	61	7	amplify	amplify	VERB
dentistry3000-784	61	8	the	the	DET
dentistry3000-784	61	9	bacterial	bacterial	ADJ
dentistry3000-784	61	10	dna	dna	NOUN
dentistry3000-784	61	11	samples	sample	NOUN
dentistry3000-784	61	12	with	with	ADP
dentistry3000-784	61	13	the	the	DET
dentistry3000-784	61	14	following	follow	VERB
dentistry3000-784	61	15	settings	setting	NOUN
dentistry3000-784	61	16	(	(	PUNCT
dentistry3000-784	61	17	table	table	NOUN
dentistry3000-784	61	18	1	1	NUM
dentistry3000-784	61	19	)	)	PUNCT
dentistry3000-784	61	20	.	.	PUNCT
dentistry3000-784	62	1	table	table	NOUN
dentistry3000-784	62	2	1	1	NUM
dentistry3000-784	62	3	.	.	PUNCT
dentistry3000-784	62	4	pcr	pcr	PROPN
dentistry3000-784	62	5	program	program	NOUN
dentistry3000-784	62	6	.	.	PUNCT
dentistry3000-784	63	1	stages	stage	NOUN
dentistry3000-784	63	2	temperature	temperature	NOUN
dentistry3000-784	63	3	(	(	PUNCT
dentistry3000-784	63	4	°	°	ADP
dentistry3000-784	63	5	f	f	NOUN
dentistry3000-784	63	6	)	)	PUNCT
dentistry3000-784	63	7	time	time	NOUN
dentistry3000-784	63	8	(	(	PUNCT
dentistry3000-784	63	9	min	min	NOUN
dentistry3000-784	63	10	.	.	PUNCT
dentistry3000-784	63	11	)	)	PUNCT
dentistry3000-784	63	12	rounds	round	VERB
dentistry3000-784	63	13	preliminary	preliminary	ADJ
dentistry3000-784	63	14	denaturation	denaturation	NOUN
dentistry3000-784	63	15	203	203	NUM
dentistry3000-784	63	16	5	5	NUM
dentistry3000-784	63	17	1	1	NUM
dentistry3000-784	63	18	denaturation	denaturation	NOUN
dentistry3000-784	63	19	203	203	NUM
dentistry3000-784	63	20	0.5	0.5	NUM
dentistry3000-784	63	21	30	30	NUM
dentistry3000-784	63	22	annealing	anneal	VERB
dentistry3000-784	63	23	158	158	NUM
dentistry3000-784	63	24	0.5	0.5	NUM
dentistry3000-784	63	25	elongation	elongation	NOUN
dentistry3000-784	63	26	161.6	161.6	NUM
dentistry3000-784	63	27	1	1	NUM
dentistry3000-784	63	28	definitive	definitive	ADJ
dentistry3000-784	63	29	extension	extension	NOUN
dentistry3000-784	63	30	161.6	161.6	NUM
dentistry3000-784	63	31	7	7	NUM
dentistry3000-784	63	32	1	1	NUM
dentistry3000-784	63	33	hold	hold	VERB
dentistry3000-784	63	34	50	50	NUM
dentistry3000-784	63	35	10	10	NUM
dentistry3000-784	63	36	to	to	PART
dentistry3000-784	63	37	verify	verify	VERB
dentistry3000-784	63	38	pcr	pcr	ADJ
dentistry3000-784	63	39	amplification	amplification	NOUN
dentistry3000-784	63	40	,	,	PUNCT
dentistry3000-784	63	41	an	an	DET
dentistry3000-784	63	42	agarose	agarose	NOUN
dentistry3000-784	63	43	gel	gel	NOUN
dentistry3000-784	63	44	electrophoresis	electrophoresis	NOUN
dentistry3000-784	63	45	was	be	AUX
dentistry3000-784	63	46	performed	perform	VERB
dentistry3000-784	63	47	.	.	PUNCT
dentistry3000-784	64	1	after	after	ADP
dentistry3000-784	64	2	sealing	seal	VERB
dentistry3000-784	64	3	the	the	DET
dentistry3000-784	64	4	edges	edge	NOUN
dentistry3000-784	64	5	of	of	ADP
dentistry3000-784	64	6	the	the	DET
dentistry3000-784	64	7	gel	gel	NOUN
dentistry3000-784	64	8	tray	tray	NOUN
dentistry3000-784	64	9	with	with	ADP
dentistry3000-784	64	10	cellophane	cellophane	NOUN
dentistry3000-784	64	11	tapes	tape	NOUN
dentistry3000-784	64	12	,	,	PUNCT
dentistry3000-784	64	13	the	the	DET
dentistry3000-784	64	14	agarose	agarose	NOUN
dentistry3000-784	64	15	was	be	AUX
dentistry3000-784	64	16	poured	pour	VERB
dentistry3000-784	64	17	into	into	ADP
dentistry3000-784	64	18	the	the	DET
dentistry3000-784	64	19	tray	tray	NOUN
dentistry3000-784	64	20	and	and	CCONJ
dentistry3000-784	64	21	allowed	allow	VERB
dentistry3000-784	64	22	to	to	PART
dentistry3000-784	64	23	solidify	solidify	VERB
dentistry3000-784	64	24	at	at	ADP
dentistry3000-784	64	25	room	room	NOUN
dentistry3000-784	64	26	temperature	temperature	NOUN
dentistry3000-784	64	27	for	for	ADP
dentistry3000-784	64	28	30	30	NUM
dentistry3000-784	64	29	minutes	minute	NOUN
dentistry3000-784	64	30	.	.	PUNCT
dentistry3000-784	65	1	then	then	ADV
dentistry3000-784	65	2	,	,	PUNCT
dentistry3000-784	65	3	the	the	DET
dentistry3000-784	65	4	tray	tray	NOUN
dentistry3000-784	65	5	was	be	AUX
dentistry3000-784	65	6	filled	fill	VERB
dentistry3000-784	65	7	with	with	ADP
dentistry3000-784	65	8	1x	1x	PROPN
dentistry3000-784	65	9	tae	tae	NOUN
dentistry3000-784	65	10	-	-	PUNCT
dentistry3000-784	65	11	electrophoresis	electrophoresis	NOUN
dentistry3000-784	65	12	buffer	buffer	NOUN
dentistry3000-784	65	13	until	until	SCONJ
dentistry3000-784	65	14	the	the	DET
dentistry3000-784	65	15	buffer	buffer	NOUN
dentistry3000-784	65	16	reached	reach	VERB
dentistry3000-784	65	17	a	a	DET
dentistry3000-784	65	18	depth	depth	NOUN
dentistry3000-784	65	19	of	of	ADP
dentistry3000-784	65	20	3	3	NUM
dentistry3000-784	65	21	-	-	SYM
dentistry3000-784	65	22	5	5	NUM
dentistry3000-784	65	23	mm	mm	NOUN
dentistry3000-784	65	24	over	over	ADP
dentistry3000-784	65	25	the	the	DET
dentistry3000-784	65	26	gel	gel	NOUN
dentistry3000-784	65	27	's	's	PART
dentistry3000-784	65	28	surface	surface	NOUN
dentistry3000-784	65	29	.	.	PUNCT
dentistry3000-784	66	1	we	we	PRON
dentistry3000-784	66	2	loaded	load	VERB
dentistry3000-784	66	3	the	the	DET
dentistry3000-784	66	4	pcr	pcr	ADJ
dentistry3000-784	66	5	products	product	NOUN
dentistry3000-784	66	6	immediately	immediately	ADV
dentistry3000-784	66	7	.	.	PUNCT
dentistry3000-784	67	1	wells	well	NOUN
dentistry3000-784	67	2	were	be	AUX
dentistry3000-784	67	3	immediately	immediately	ADV
dentistry3000-784	67	4	filled	fill	VERB
dentistry3000-784	67	5	with	with	ADP
dentistry3000-784	67	6	5μl	5μl	NOUN
dentistry3000-784	67	7	of	of	ADP
dentistry3000-784	67	8	pcr	pcr	ADJ
dentistry3000-784	67	9	product	product	NOUN
dentistry3000-784	67	10	.	.	PUNCT
dentistry3000-784	68	1	after	after	ADP
dentistry3000-784	68	2	60	60	NUM
dentistry3000-784	68	3	minutes	minute	NOUN
dentistry3000-784	68	4	,	,	PUNCT
dentistry3000-784	68	5	the	the	DET
dentistry3000-784	68	6	electricity	electricity	NOUN
dentistry3000-784	68	7	was	be	AUX
dentistry3000-784	68	8	switched	switch	VERB
dentistry3000-784	68	9	on	on	ADP
dentistry3000-784	68	10	at	at	ADP
dentistry3000-784	68	11	100	100	NUM
dentistry3000-784	68	12	volts	volt	NOUN
dentistry3000-784	68	13	per	per	ADP
dentistry3000-784	68	14	milliampere	milliampere	NOUN
dentistry3000-784	68	15	.	.	PUNCT
dentistry3000-784	69	1	the	the	DET
dentistry3000-784	69	2	dna	dna	PROPN
dentistry3000-784	69	3	molecule	molecule	NOUN
dentistry3000-784	69	4	cycles	cycle	NOUN
dentistry3000-784	69	5	between	between	ADP
dentistry3000-784	69	6	the	the	DET
dentistry3000-784	69	7	cathode	cathode	NOUN
dentistry3000-784	69	8	and	and	CCONJ
dentistry3000-784	69	9	anode	anode	NOUN
dentistry3000-784	69	10	ends	end	NOUN
dentistry3000-784	69	11	.	.	PUNCT
dentistry3000-784	70	1	gel	gel	NOUN
dentistry3000-784	70	2	imaging	imaging	NOUN
dentistry3000-784	70	3	system	system	NOUN
dentistry3000-784	70	4	was	be	AUX
dentistry3000-784	70	5	used	use	VERB
dentistry3000-784	70	6	to	to	PART
dentistry3000-784	70	7	visualize	visualize	VERB
dentistry3000-784	70	8	the	the	DET
dentistry3000-784	70	9	bands	band	NOUN
dentistry3000-784	70	10	stained	stain	VERB
dentistry3000-784	70	11	in	in	ADP
dentistry3000-784	70	12	ethidium	ethidium	ADJ
dentistry3000-784	70	13	bromide	bromide	NOUN
dentistry3000-784	70	14	.	.	PUNCT
dentistry3000-784	71	1	according	accord	VERB
dentistry3000-784	71	2	to	to	ADP
dentistry3000-784	71	3	cavalieri	cavalieri	PROPN
dentistry3000-784	71	4	et	et	PROPN
dentistry3000-784	71	5	al	al	PROPN
dentistry3000-784	71	6	,	,	PUNCT
dentistry3000-784	71	7	(	(	PUNCT
dentistry3000-784	71	8	2005	2005	NUM
dentistry3000-784	71	9	)	)	PUNCT
dentistry3000-784	72	1	[	[	X
dentistry3000-784	72	2	19	19	NUM
dentistry3000-784	72	3	]	]	PUNCT
dentistry3000-784	72	4	,	,	PUNCT
dentistry3000-784	72	5	a	a	DET
dentistry3000-784	72	6	suspension	suspension	NOUN
dentistry3000-784	72	7	of	of	ADP
dentistry3000-784	72	8	s.	s.	PROPN
dentistry3000-784	72	9	oralis	oralis	PROPN
dentistry3000-784	72	10	was	be	AUX
dentistry3000-784	72	11	prepared	prepare	VERB
dentistry3000-784	72	12	by	by	ADP
dentistry3000-784	72	13	using	use	VERB
dentistry3000-784	72	14	“	"	PUNCT
dentistry3000-784	72	15	direct	direct	ADJ
dentistry3000-784	72	16	colony	colony	NOUN
dentistry3000-784	72	17	suspension	suspension	NOUN
dentistry3000-784	72	18	method	method	NOUN
dentistry3000-784	72	19	”	"	PUNCT
dentistry3000-784	72	20	,	,	PUNCT
dentistry3000-784	72	21	confined	confine	VERB
dentistry3000-784	72	22	colonies	colony	NOUN
dentistry3000-784	72	23	were	be	AUX
dentistry3000-784	72	24	picked	pick	VERB
dentistry3000-784	72	25	from	from	ADP
dentistry3000-784	72	26	the	the	DET
dentistry3000-784	72	27	agar	agar	NOUN
dentistry3000-784	72	28	media	medium	NOUN
dentistry3000-784	72	29	and	and	CCONJ
dentistry3000-784	72	30	grown	grow	VERB
dentistry3000-784	72	31	in	in	ADP
dentistry3000-784	72	32	1	1	NUM
dentistry3000-784	72	33	ml	ml	NOUN
dentistry3000-784	72	34	muellerhinton	muellerhinton	PROPN
dentistry3000-784	72	35	broth	broth	NOUN
dentistry3000-784	72	36	(	(	PUNCT
dentistry3000-784	72	37	mhb	mhb	PROPN
dentistry3000-784	72	38	)	)	PUNCT
dentistry3000-784	72	39	.	.	PUNCT
dentistry3000-784	73	1	the	the	DET
dentistry3000-784	73	2	suspension	suspension	NOUN
dentistry3000-784	73	3	was	be	AUX
dentistry3000-784	73	4	vortexed	vortexe	VERB
dentistry3000-784	73	5	and	and	CCONJ
dentistry3000-784	73	6	adapted	adapt	VERB
dentistry3000-784	73	7	to	to	ADP
dentistry3000-784	73	8	a	a	DET
dentistry3000-784	73	9	0.600	0.600	NUM
dentistry3000-784	73	10	absorbance	absorbance	NOUN
dentistry3000-784	73	11	at	at	ADP
dentistry3000-784	73	12	600	600	NUM
dentistry3000-784	73	13	nm	nm	NOUN
dentistry3000-784	73	14	,	,	PUNCT
dentistry3000-784	73	15	which	which	PRON
dentistry3000-784	73	16	corresponds	correspond	VERB
dentistry3000-784	73	17	to	to	ADP
dentistry3000-784	73	18	0.5	0.5	NUM
dentistry3000-784	73	19	mcfarland	mcfarland	NOUN
dentistry3000-784	73	20	using	use	VERB
dentistry3000-784	73	21	an	an	DET
dentistry3000-784	73	22	absorbance	absorbance	NOUN
dentistry3000-784	73	23	plate	plate	NOUN
dentistry3000-784	73	24	reader	reader	NOUN
dentistry3000-784	74	1	[	[	X
dentistry3000-784	74	2	22	22	NUM
dentistry3000-784	74	3	]	]	PUNCT
dentistry3000-784	74	4	.	.	PUNCT
dentistry3000-784	75	1	method	method	NOUN
dentistry3000-784	75	2	for	for	ADP
dentistry3000-784	75	3	dispersing	disperse	VERB
dentistry3000-784	75	4	agar	agar	NOUN
dentistry3000-784	75	5	drops	drop	NOUN
dentistry3000-784	75	6	,	,	PUNCT
dentistry3000-784	75	7	as	as	SCONJ
dentistry3000-784	75	8	described	describe	VERB
dentistry3000-784	75	9	by	by	ADP
dentistry3000-784	75	10	cavalieri	cavalieri	PROPN
dentistry3000-784	75	11	et	et	PROPN
dentistry3000-784	75	12	al	al	PROPN
dentistry3000-784	75	13	,	,	PUNCT
dentistry3000-784	75	14	2005	2005	NUM
dentistry3000-784	76	1	[	[	X
dentistry3000-784	76	2	22	22	NUM
dentistry3000-784	76	3	]	]	PUNCT
dentistry3000-784	76	4	was	be	AUX
dentistry3000-784	76	5	used	use	VERB
dentistry3000-784	76	6	to	to	PART
dentistry3000-784	76	7	test	test	VERB
dentistry3000-784	76	8	the	the	DET
dentistry3000-784	76	9	activity	activity	NOUN
dentistry3000-784	76	10	of	of	ADP
dentistry3000-784	76	11	the	the	DET
dentistry3000-784	76	12	study	study	NOUN
dentistry3000-784	76	13	extract	extract	NOUN
dentistry3000-784	76	14	against	against	ADP
dentistry3000-784	76	15	s.	s.	PROPN
dentistry3000-784	76	16	sanguis	sanguis	PROPN
dentistry3000-784	76	17	.	.	PUNCT
dentistry3000-784	77	1	using	use	VERB
dentistry3000-784	77	2	a	a	DET
dentistry3000-784	77	3	pasteur	pasteur	NOUN
dentistry3000-784	77	4	pipette	pipette	NOUN
dentistry3000-784	77	5	under	under	ADP
dentistry3000-784	77	6	aseptic	aseptic	ADJ
dentistry3000-784	77	7	conditions	condition	NOUN
dentistry3000-784	77	8	,	,	PUNCT
dentistry3000-784	77	9	6	6	NUM
dentistry3000-784	77	10	mm	mm	NOUN
dentistry3000-784	77	11	wells	well	NOUN
dentistry3000-784	77	12	of	of	ADP
dentistry3000-784	77	13	similar	similar	ADJ
dentistry3000-784	77	14	depth	depth	NOUN
dentistry3000-784	77	15	were	be	AUX
dentistry3000-784	77	16	created	create	VERB
dentistry3000-784	77	17	in	in	ADP
dentistry3000-784	77	18	each	each	DET
dentistry3000-784	77	19	mueller	mueller	PROPN
dentistry3000-784	77	20	hinton	hinton	PROPN
dentistry3000-784	77	21	agar	agar	NOUN
dentistry3000-784	77	22	plate	plate	NOUN
dentistry3000-784	77	23	.	.	PUNCT
dentistry3000-784	78	1	50	50	NUM
dentistry3000-784	78	2	μl	μl	ADV
dentistry3000-784	78	3	from	from	ADP
dentistry3000-784	78	4	each	each	PRON
dentistry3000-784	78	5	of	of	ADP
dentistry3000-784	78	6	stevia	stevia	NOUN
dentistry3000-784	78	7	extract	extract	VERB
dentistry3000-784	78	8	concentrations	concentration	NOUN
dentistry3000-784	78	9	(	(	PUNCT
dentistry3000-784	78	10	512mg	512mg	PROPN
dentistry3000-784	78	11	/	/	SYM
dentistry3000-784	78	12	ml	ml	NOUN
dentistry3000-784	78	13	,	,	PUNCT
dentistry3000-784	78	14	256mg	256mg	NOUN
dentistry3000-784	78	15	/	/	SYM
dentistry3000-784	78	16	ml	ml	NOUN
dentistry3000-784	78	17	,	,	PUNCT
dentistry3000-784	78	18	128mg	128mg	ADJ
dentistry3000-784	78	19	/	/	SYM
dentistry3000-784	78	20	ml	ml	NOUN
dentistry3000-784	78	21	,	,	PUNCT
dentistry3000-784	78	22	64mg	64mg	ADJ
dentistry3000-784	78	23	/	/	SYM
dentistry3000-784	78	24	ml	ml	NOUN
dentistry3000-784	78	25	,	,	PUNCT
dentistry3000-784	78	26	32mg	32mg	ADJ
dentistry3000-784	78	27	/	/	SYM
dentistry3000-784	78	28	ml	ml	NOUN
dentistry3000-784	78	29	and16mg	and16mg	NOUN
dentistry3000-784	78	30	/	/	SYM
dentistry3000-784	78	31	ml	ml	NOUN
dentistry3000-784	78	32	)	)	PUNCT
dentistry3000-784	78	33	were	be	AUX
dentistry3000-784	78	34	added	add	VERB
dentistry3000-784	78	35	to	to	ADP
dentistry3000-784	78	36	each	each	DET
dentistry3000-784	78	37	well	well	ADV
dentistry3000-784	78	38	.	.	PUNCT
dentistry3000-784	79	1	the	the	DET
dentistry3000-784	79	2	positive	positive	ADJ
dentistry3000-784	79	3	control	control	NOUN
dentistry3000-784	79	4	was	be	AUX
dentistry3000-784	79	5	0.2	0.2	NUM
dentistry3000-784	79	6	%	%	NOUN
dentistry3000-784	79	7	chlorhexidine	chlorhexidine	NOUN
dentistry3000-784	79	8	gluconate	gluconate	NOUN
dentistry3000-784	79	9	(	(	PUNCT
dentistry3000-784	79	10	non	non	ADJ
dentistry3000-784	79	11	-	-	ADJ
dentistry3000-784	79	12	alcoholic	alcoholic	ADJ
dentistry3000-784	79	13	)	)	PUNCT
dentistry3000-784	79	14	,	,	PUNCT
dentistry3000-784	79	15	and	and	CCONJ
dentistry3000-784	79	16	the	the	DET
dentistry3000-784	79	17	negative	negative	ADJ
dentistry3000-784	79	18	control	control	NOUN
dentistry3000-784	79	19	was	be	AUX
dentistry3000-784	79	20	sterile	sterile	ADJ
dentistry3000-784	79	21	distilled	distil	VERB
dentistry3000-784	79	22	water	water	NOUN
dentistry3000-784	79	23	.	.	PUNCT
dentistry3000-784	80	1	for	for	ADP
dentistry3000-784	80	2	24	24	NUM
dentistry3000-784	80	3	hours	hour	NOUN
dentistry3000-784	80	4	,	,	PUNCT
dentistry3000-784	80	5	the	the	DET
dentistry3000-784	80	6	plates	plate	NOUN
dentistry3000-784	80	7	were	be	AUX
dentistry3000-784	80	8	maintained	maintain	VERB
dentistry3000-784	80	9	in	in	ADP
dentistry3000-784	80	10	an	an	DET
dentistry3000-784	80	11	aerobic	aerobic	ADJ
dentistry3000-784	80	12	atmosphere	atmosphere	NOUN
dentistry3000-784	80	13	at	at	ADP
dentistry3000-784	80	14	37	37	NUM
dentistry3000-784	80	15	°	°	NOUN
dentistry3000-784	80	16	c	c	NOUN
dentistry3000-784	80	17	.	.	PUNCT
dentistry3000-784	81	1	each	each	DET
dentistry3000-784	81	2	well	well	NOUN
dentistry3000-784	81	3	's	's	PART
dentistry3000-784	81	4	inhibition	inhibition	NOUN
dentistry3000-784	81	5	zone	zone	NOUN
dentistry3000-784	81	6	was	be	AUX
dentistry3000-784	81	7	measured	measure	VERB
dentistry3000-784	81	8	in	in	ADP
dentistry3000-784	81	9	(	(	PUNCT
dentistry3000-784	81	10	mm	mm	INTJ
dentistry3000-784	81	11	)	)	PUNCT
dentistry3000-784	81	12	using	use	VERB
dentistry3000-784	81	13	a	a	DET
dentistry3000-784	81	14	ruler	ruler	NOUN
dentistry3000-784	81	15	.	.	PUNCT
dentistry3000-784	82	1	in	in	ADP
dentistry3000-784	82	2	order	order	NOUN
dentistry3000-784	82	3	to	to	PART
dentistry3000-784	82	4	determine	determine	VERB
dentistry3000-784	82	5	the	the	DET
dentistry3000-784	82	6	minimum	minimum	ADJ
dentistry3000-784	82	7	inhibitory	inhibitory	ADJ
dentistry3000-784	82	8	concentration	concentration	NOUN
dentistry3000-784	82	9	(	(	PUNCT
dentistry3000-784	82	10	mic	mic	NOUN
dentistry3000-784	82	11	)	)	PUNCT
dentistry3000-784	82	12	,	,	PUNCT
dentistry3000-784	82	13	the	the	DET
dentistry3000-784	82	14	experiment	experiment	NOUN
dentistry3000-784	82	15	used	use	VERB
dentistry3000-784	82	16	twofold	twofold	ADP
dentistry3000-784	82	17	serial	serial	ADJ
dentistry3000-784	82	18	broth	broth	ADJ
dentistry3000-784	82	19	micro	micro	NOUN
dentistry3000-784	82	20	-	-	NOUN
dentistry3000-784	82	21	dilutions	dilution	NOUN
dentistry3000-784	82	22	[	[	X
dentistry3000-784	82	23	19,22	19,22	X
dentistry3000-784	82	24	]	]	X
dentistry3000-784	82	25	.	.	PUNCT
dentistry3000-784	83	1	between	between	ADP
dentistry3000-784	83	2	wells	wells	PROPN
dentistry3000-784	83	3	1	1	NUM
dentistry3000-784	83	4	and	and	CCONJ
dentistry3000-784	83	5	9	9	NUM
dentistry3000-784	83	6	,	,	PUNCT
dentistry3000-784	83	7	100	100	NUM
dentistry3000-784	83	8	μl	μl	ADP
dentistry3000-784	83	9	of	of	ADP
dentistry3000-784	83	10	brain	brain	NOUN
dentistry3000-784	83	11	-	-	PUNCT
dentistry3000-784	83	12	heart	heart	NOUN
dentistry3000-784	83	13	infusion	infusion	NOUN
dentistry3000-784	83	14	broth	broth	NOUN
dentistry3000-784	83	15	(	(	PUNCT
dentistry3000-784	83	16	bhi	bhi	PROPN
dentistry3000-784	83	17	)	)	PUNCT
dentistry3000-784	83	18	was	be	AUX
dentistry3000-784	83	19	added	add	VERB
dentistry3000-784	83	20	to	to	ADP
dentistry3000-784	83	21	two	two	NUM
dentistry3000-784	83	22	rows	row	NOUN
dentistry3000-784	83	23	of	of	ADP
dentistry3000-784	83	24	a	a	DET
dentistry3000-784	83	25	96	96	NUM
dentistry3000-784	83	26	-	-	PUNCT
dentistry3000-784	83	27	well	well	NOUN
dentistry3000-784	83	28	microplate	microplate	NOUN
dentistry3000-784	83	29	.	.	PUNCT
dentistry3000-784	84	1	there	there	PRON
dentistry3000-784	84	2	was	be	VERB
dentistry3000-784	84	3	a	a	DET
dentistry3000-784	84	4	two	two	NUM
dentistry3000-784	84	5	-	-	PUNCT
dentistry3000-784	84	6	fold	fold	ADJ
dentistry3000-784	84	7	serial	serial	ADJ
dentistry3000-784	84	8	dilution	dilution	NOUN
dentistry3000-784	84	9	process	process	NOUN
dentistry3000-784	84	10	starting	start	VERB
dentistry3000-784	84	11	from	from	ADP
dentistry3000-784	84	12	well	well	ADV
dentistry3000-784	84	13	1	1	NUM
dentistry3000-784	84	14	and	and	CCONJ
dentistry3000-784	84	15	continuing	continue	VERB
dentistry3000-784	84	16	until	until	ADP
dentistry3000-784	84	17	well	well	ADV
dentistry3000-784	84	18	9	9	NUM
dentistry3000-784	84	19	,	,	PUNCT
dentistry3000-784	84	20	after	after	ADP
dentistry3000-784	84	21	which	which	PRON
dentistry3000-784	84	22	100	100	NUM
dentistry3000-784	84	23	μl	μl	ADP
dentistry3000-784	84	24	of	of	ADP
dentistry3000-784	84	25	the	the	DET
dentistry3000-784	84	26	512	512	NUM
dentistry3000-784	84	27	mg	mg	NUM
dentistry3000-784	84	28	/	/	SYM
dentistry3000-784	84	29	ml	ml	NOUN
dentistry3000-784	84	30	alcoholic	alcoholic	ADJ
dentistry3000-784	84	31	stevia	stevia	NOUN
dentistry3000-784	84	32	extract	extract	NOUN
dentistry3000-784	84	33	was	be	AUX
dentistry3000-784	84	34	added	add	VERB
dentistry3000-784	84	35	to	to	ADP
dentistry3000-784	84	36	each	each	DET
dentistry3000-784	84	37	well	well	NOUN
dentistry3000-784	84	38	in	in	ADP
dentistry3000-784	84	39	the	the	DET
dentistry3000-784	84	40	appropriate	appropriate	ADJ
dentistry3000-784	84	41	row	row	NOUN
dentistry3000-784	84	42	.	.	PUNCT
dentistry3000-784	85	1	well	well	INTJ
dentistry3000-784	85	2	10	10	NUM
dentistry3000-784	85	3	in	in	ADP
dentistry3000-784	85	4	the	the	DET
dentistry3000-784	85	5	first	first	ADJ
dentistry3000-784	85	6	row	row	NOUN
dentistry3000-784	85	7	had	have	VERB
dentistry3000-784	85	8	100	100	NUM
dentistry3000-784	85	9	μl	μl	ADP
dentistry3000-784	85	10	of	of	ADP
dentistry3000-784	85	11	broth	broth	NOUN
dentistry3000-784	85	12	and	and	CCONJ
dentistry3000-784	85	13	100	100	NUM
dentistry3000-784	85	14	μl	μl	ADP
dentistry3000-784	85	15	of	of	ADP
dentistry3000-784	85	16	0.2	0.2	NUM
dentistry3000-784	85	17	%	%	NOUN
dentistry3000-784	85	18	chx	chx	NOUN
dentistry3000-784	85	19	,	,	PUNCT
dentistry3000-784	85	20	whereas	whereas	SCONJ
dentistry3000-784	85	21	wells	well	NOUN
dentistry3000-784	85	22	11	11	NUM
dentistry3000-784	85	23	and	and	CCONJ
dentistry3000-784	85	24	12	12	NUM
dentistry3000-784	85	25	had	have	VERB
dentistry3000-784	85	26	100	100	NUM
dentistry3000-784	85	27	μl	μl	ADP
dentistry3000-784	85	28	of	of	ADP
dentistry3000-784	85	29	mhb	mhb	PROPN
dentistry3000-784	85	30	alone	alone	ADV
dentistry3000-784	85	31	;	;	PUNCT
dentistry3000-784	85	32	the	the	DET
dentistry3000-784	85	33	whole	whole	ADJ
dentistry3000-784	85	34	first	first	ADJ
dentistry3000-784	85	35	row	row	NOUN
dentistry3000-784	85	36	was	be	AUX
dentistry3000-784	85	37	regarded	regard	VERB
dentistry3000-784	85	38	as	as	ADP
dentistry3000-784	85	39	plain	plain	ADJ
dentistry3000-784	85	40	,	,	PUNCT
dentistry3000-784	85	41	devoid	devoid	ADJ
dentistry3000-784	85	42	of	of	ADP
dentistry3000-784	85	43	bacteria	bacteria	NOUN
dentistry3000-784	85	44	.	.	PUNCT
dentistry3000-784	86	1	one	one	NUM
dentistry3000-784	86	2	hundred	hundred	NUM
dentistry3000-784	86	3	microliters	microliter	NOUN
dentistry3000-784	86	4	of	of	ADP
dentistry3000-784	86	5	the	the	DET
dentistry3000-784	86	6	test	test	NOUN
dentistry3000-784	86	7	organism	organism	NOUN
dentistry3000-784	86	8	were	be	AUX
dentistry3000-784	86	9	added	add	VERB
dentistry3000-784	86	10	to	to	ADP
dentistry3000-784	86	11	each	each	DET
dentistry3000-784	86	12	well	well	NOUN
dentistry3000-784	86	13	in	in	ADP
dentistry3000-784	86	14	the	the	DET
dentistry3000-784	86	15	second	second	ADJ
dentistry3000-784	86	16	row	row	NOUN
dentistry3000-784	86	17	.	.	PUNCT
dentistry3000-784	87	1	well	well	INTJ
dentistry3000-784	87	2	10	10	NUM
dentistry3000-784	87	3	in	in	ADP
dentistry3000-784	87	4	the	the	DET
dentistry3000-784	87	5	second	second	ADJ
dentistry3000-784	87	6	row	row	NOUN
dentistry3000-784	87	7	served	serve	VERB
dentistry3000-784	87	8	as	as	ADP
dentistry3000-784	87	9	the	the	DET
dentistry3000-784	87	10	positive	positive	ADJ
dentistry3000-784	87	11	control	control	NOUN
dentistry3000-784	87	12	,	,	PUNCT
dentistry3000-784	87	13	with	with	ADP
dentistry3000-784	87	14	100	100	NUM
dentistry3000-784	87	15	μl	μl	ADP
dentistry3000-784	87	16	of	of	ADP
dentistry3000-784	87	17	0.2	0.2	NUM
dentistry3000-784	87	18	%	%	NOUN
dentistry3000-784	87	19	chx	chx	NOUN
dentistry3000-784	87	20	in	in	ADP
dentistry3000-784	87	21	broth	broth	NOUN
dentistry3000-784	87	22	and	and	CCONJ
dentistry3000-784	87	23	100	100	NUM
dentistry3000-784	87	24	μl	μl	ADP
dentistry3000-784	87	25	of	of	ADP
dentistry3000-784	87	26	bacterial	bacterial	ADJ
dentistry3000-784	87	27	suspension	suspension	NOUN
dentistry3000-784	87	28	;	;	PUNCT
dentistry3000-784	87	29	in	in	ADP
dentistry3000-784	87	30	contrast	contrast	NOUN
dentistry3000-784	87	31	,	,	PUNCT
dentistry3000-784	87	32	wells	wells	PROPN
dentistry3000-784	87	33	11	11	NUM
dentistry3000-784	87	34	and	and	CCONJ
dentistry3000-784	87	35	12	12	NUM
dentistry3000-784	87	36	in	in	ADP
dentistry3000-784	87	37	the	the	DET
dentistry3000-784	87	38	negative	negative	ADJ
dentistry3000-784	87	39	control	control	PROPN
dentistry3000-784	87	40	group	group	NOUN
dentistry3000-784	87	41	contained	contain	VERB
dentistry3000-784	87	42	100	100	NUM
dentistry3000-784	87	43	μl	μl	ADP
dentistry3000-784	87	44	of	of	ADP
dentistry3000-784	87	45	mhb	mhb	PROPN
dentistry3000-784	87	46	and	and	CCONJ
dentistry3000-784	87	47	100	100	NUM
dentistry3000-784	87	48	μl	μl	ADP
dentistry3000-784	87	49	of	of	ADP
dentistry3000-784	87	50	bacterial	bacterial	ADJ
dentistry3000-784	87	51	suspension	suspension	NOUN
dentistry3000-784	87	52	,	,	PUNCT
dentistry3000-784	87	53	respectively	respectively	ADV
dentistry3000-784	87	54	.	.	PUNCT
dentistry3000-784	88	1	overnight	overnight	ADV
dentistry3000-784	88	2	,	,	PUNCT
dentistry3000-784	88	3	the	the	DET
dentistry3000-784	88	4	microtiter	microtiter	NOUN
dentistry3000-784	88	5	plate	plate	NOUN
dentistry3000-784	88	6	was	be	AUX
dentistry3000-784	88	7	incubated	incubate	VERB
dentistry3000-784	88	8	at	at	ADP
dentistry3000-784	88	9	37	37	NUM
dentistry3000-784	88	10	˚c	˚c	NOUN
dentistry3000-784	88	11	in	in	ADP
dentistry3000-784	88	12	an	an	DET
dentistry3000-784	88	13	aerobic	aerobic	ADJ
dentistry3000-784	88	14	environment	environment	NOUN
dentistry3000-784	88	15	.	.	PUNCT
dentistry3000-784	89	1	an	an	DET
dentistry3000-784	89	2	"	"	PUNCT
dentistry3000-784	89	3	absorbance	absorbance	NOUN
dentistry3000-784	89	4	micro	micro	ADJ
dentistry3000-784	89	5	plate	plate	NOUN
dentistry3000-784	89	6	reader	reader	NOUN
dentistry3000-784	89	7	"	"	PUNCT
dentistry3000-784	89	8	calibrated	calibrate	VERB
dentistry3000-784	89	9	to	to	ADP
dentistry3000-784	89	10	a	a	DET
dentistry3000-784	89	11	wavelength	wavelength	NOUN
dentistry3000-784	89	12	of	of	ADP
dentistry3000-784	89	13	600	600	NUM
dentistry3000-784	89	14	nm	nm	NOUN
dentistry3000-784	89	15	was	be	AUX
dentistry3000-784	89	16	used	use	VERB
dentistry3000-784	89	17	to	to	PART
dentistry3000-784	89	18	assess	assess	VERB
dentistry3000-784	89	19	the	the	DET
dentistry3000-784	89	20	turbidity	turbidity	NOUN
dentistry3000-784	89	21	of	of	ADP
dentistry3000-784	89	22	the	the	DET
dentistry3000-784	89	23	wells	well	NOUN
dentistry3000-784	89	24	after	after	ADP
dentistry3000-784	89	25	incubation	incubation	NOUN
dentistry3000-784	89	26	.	.	PUNCT
dentistry3000-784	90	1	minimum	minimum	ADJ
dentistry3000-784	90	2	bactericidal	bactericidal	ADJ
dentistry3000-784	90	3	concentration	concentration	NOUN
dentistry3000-784	90	4	(	(	PUNCT
dentistry3000-784	90	5	mbc	mbc	PROPN
dentistry3000-784	90	6	)	)	PUNCT
dentistry3000-784	90	7	was	be	AUX
dentistry3000-784	90	8	established	establish	VERB
dentistry3000-784	90	9	by	by	ADP
dentistry3000-784	90	10	placing	place	VERB
dentistry3000-784	90	11	50	50	NUM
dentistry3000-784	90	12	μl	μl	ADP
dentistry3000-784	90	13	phytochemical	phytochemical	ADJ
dentistry3000-784	90	14	analysis	analysis	NOUN
dentistry3000-784	90	15	and	and	CCONJ
dentistry3000-784	90	16	an1bacterial	an1bacterial	ADJ
dentistry3000-784	90	17	ac1vity	ac1vity	NOUN
dentistry3000-784	90	18	of	of	ADP
dentistry3000-784	90	19	stevia	stevia	NOUN
dentistry3000-784	90	20	rebaudiana	rebaudiana	PROPN
dentistry3000-784	90	21	bertoni	bertoni	PROPN
dentistry3000-784	90	22	leaves	leave	NOUN
dentistry3000-784	90	23	extract	extract	VERB
dentistry3000-784	90	24	against	against	ADP
dentistry3000-784	90	25	streptococcus	streptococcus	NOUN
dentistry3000-784	90	26	sanguis	sanguis	NOUN
dentistry3000-784	90	27	(	(	PUNCT
dentistry3000-784	90	28	a	a	DET
dentistry3000-784	90	29	primary	primary	ADJ
dentistry3000-784	90	30	inhabitant	inhabitant	NOUN
dentistry3000-784	90	31	of	of	ADP
dentistry3000-784	90	32	dental	dental	ADJ
dentistry3000-784	90	33	plaque	plaque	NOUN
dentistry3000-784	90	34	):	):	PUNCT
dentistry3000-784	90	35	in	in	ADP
dentistry3000-784	90	36	vitro	vitro	X
dentistry3000-784	90	37	study	study	NOUN
dentistry3000-784	90	38	vol	vol	NOUN
dentistry3000-784	90	39	13	13	NUM
dentistry3000-784	90	40	no	no	DET
dentistry3000-784	90	41	1	1	NUM
dentistry3000-784	90	42	(	(	PUNCT
dentistry3000-784	90	43	2025	2025	NUM
dentistry3000-784	90	44	)	)	PUNCT
dentistry3000-784	90	45	doi	doi	NOUN
dentistry3000-784	90	46	10.5195	10.5195	NUM
dentistry3000-784	90	47	/	/	SYM
dentistry3000-784	90	48	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	90	49	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	90	50	portions	portion	NOUN
dentistry3000-784	90	51	from	from	ADP
dentistry3000-784	90	52	the	the	DET
dentistry3000-784	90	53	minimum	minimum	ADJ
dentistry3000-784	90	54	inhibitory	inhibitory	ADJ
dentistry3000-784	90	55	concentration	concentration	NOUN
dentistry3000-784	90	56	(	(	PUNCT
dentistry3000-784	90	57	mic	mic	ADJ
dentistry3000-784	90	58	)	)	PUNCT
dentistry3000-784	90	59	well	well	NOUN
dentistry3000-784	90	60	and	and	CCONJ
dentistry3000-784	90	61	the	the	DET
dentistry3000-784	90	62	well	well	ADV
dentistry3000-784	90	63	immediately	immediately	ADV
dentistry3000-784	90	64	above	above	ADP
dentistry3000-784	90	65	it	it	PRON
dentistry3000-784	90	66	onto	onto	ADP
dentistry3000-784	90	67	brain	brain	NOUN
dentistry3000-784	90	68	-	-	PUNCT
dentistry3000-784	90	69	heart	heart	NOUN
dentistry3000-784	90	70	agar	agar	NOUN
dentistry3000-784	90	71	plates	plate	NOUN
dentistry3000-784	90	72	and	and	CCONJ
dentistry3000-784	90	73	leaving	leave	VERB
dentistry3000-784	90	74	them	they	PRON
dentistry3000-784	90	75	to	to	PART
dentistry3000-784	90	76	incubate	incubate	VERB
dentistry3000-784	90	77	at	at	ADP
dentistry3000-784	90	78	37	37	NUM
dentistry3000-784	90	79	°	°	NOUN
dentistry3000-784	90	80	c	c	NOUN
dentistry3000-784	90	81	for	for	ADP
dentistry3000-784	90	82	24	24	NUM
dentistry3000-784	90	83	hours	hour	NOUN
dentistry3000-784	90	84	.	.	PUNCT
dentistry3000-784	91	1	the	the	DET
dentistry3000-784	91	2	appearance	appearance	NOUN
dentistry3000-784	91	3	of	of	ADP
dentistry3000-784	91	4	bacteria	bacteria	NOUN
dentistry3000-784	91	5	was	be	AUX
dentistry3000-784	91	6	then	then	ADV
dentistry3000-784	91	7	determined	determine	VERB
dentistry3000-784	91	8	by	by	ADP
dentistry3000-784	91	9	looking	look	VERB
dentistry3000-784	91	10	at	at	ADP
dentistry3000-784	91	11	the	the	DET
dentistry3000-784	91	12	agar	agar	NOUN
dentistry3000-784	91	13	plates	plate	NOUN
dentistry3000-784	91	14	[	[	X
dentistry3000-784	91	15	23	23	NUM
dentistry3000-784	91	16	]	]	PUNCT
dentistry3000-784	91	17	.	.	PUNCT
dentistry3000-784	92	1	an	an	DET
dentistry3000-784	92	2	hplc	hplc	NOUN
dentistry3000-784	92	3	analysis	analysis	NOUN
dentistry3000-784	92	4	was	be	AUX
dentistry3000-784	92	5	used	use	VERB
dentistry3000-784	92	6	to	to	PART
dentistry3000-784	92	7	determine	determine	VERB
dentistry3000-784	92	8	the	the	DET
dentistry3000-784	92	9	concentrations	concentration	NOUN
dentistry3000-784	92	10	of	of	ADP
dentistry3000-784	92	11	the	the	DET
dentistry3000-784	92	12	active	active	ADJ
dentistry3000-784	92	13	ingredients	ingredient	NOUN
dentistry3000-784	92	14	in	in	ADP
dentistry3000-784	92	15	an	an	DET
dentistry3000-784	92	16	alcohol	alcohol	NOUN
dentistry3000-784	92	17	-	-	PUNCT
dentistry3000-784	92	18	based	base	VERB
dentistry3000-784	92	19	stevia	stevia	NOUN
dentistry3000-784	92	20	rebaudiana	rebaudiana	PROPN
dentistry3000-784	92	21	leaf	leaf	NOUN
dentistry3000-784	92	22	extract	extract	NOUN
dentistry3000-784	92	23	[	[	X
dentistry3000-784	92	24	24	24	NUM
dentistry3000-784	92	25	]	]	PUNCT
dentistry3000-784	92	26	.	.	PUNCT
dentistry3000-784	93	1	this	this	DET
dentistry3000-784	93	2	test	test	NOUN
dentistry3000-784	93	3	was	be	AUX
dentistry3000-784	93	4	carried	carry	VERB
dentistry3000-784	93	5	out	out	ADP
dentistry3000-784	93	6	at	at	ADP
dentistry3000-784	93	7	the	the	DET
dentistry3000-784	93	8	ministry	ministry	PROPN
dentistry3000-784	93	9	of	of	ADP
dentistry3000-784	93	10	science	science	PROPN
dentistry3000-784	93	11	and	and	CCONJ
dentistry3000-784	93	12	technology/	technology/	NUM
dentistry3000-784	93	13	material	material	NOUN
dentistry3000-784	93	14	's	's	PART
dentistry3000-784	93	15	research	research	NOUN
dentistry3000-784	93	16	department	department	NOUN
dentistry3000-784	93	17	.	.	PUNCT
dentistry3000-784	94	1	to	to	PART
dentistry3000-784	94	2	detect	detect	VERB
dentistry3000-784	94	3	and	and	CCONJ
dentistry3000-784	94	4	quantify	quantify	VERB
dentistry3000-784	94	5	narigenin	narigenin	NOUN
dentistry3000-784	94	6	,	,	PUNCT
dentistry3000-784	94	7	catechin	catechin	NOUN
dentistry3000-784	94	8	,	,	PUNCT
dentistry3000-784	94	9	coumarin	coumarin	NOUN
dentistry3000-784	94	10	and	and	CCONJ
dentistry3000-784	94	11	kaempferol	kaempferol	NOUN
dentistry3000-784	94	12	,	,	PUNCT
dentistry3000-784	94	13	a	a	DET
dentistry3000-784	94	14	stevia	stevia	NOUN
dentistry3000-784	94	15	alcoholic	alcoholic	ADJ
dentistry3000-784	94	16	extract	extract	NOUN
dentistry3000-784	94	17	was	be	AUX
dentistry3000-784	94	18	prepared	prepare	VERB
dentistry3000-784	94	19	for	for	ADP
dentistry3000-784	94	20	hplc	hplc	NOUN
dentistry3000-784	94	21	testing	testing	NOUN
dentistry3000-784	94	22	.	.	PUNCT
dentistry3000-784	95	1	blend	blend	VERB
dentistry3000-784	95	2	1	1	NUM
dentistry3000-784	95	3	gram	gram	NOUN
dentistry3000-784	95	4	of	of	ADP
dentistry3000-784	95	5	stevia	stevia	NOUN
dentistry3000-784	95	6	extract	extract	NOUN
dentistry3000-784	95	7	with	with	ADP
dentistry3000-784	95	8	5	5	NUM
dentistry3000-784	95	9	milliliters	milliliter	NOUN
dentistry3000-784	95	10	of	of	ADP
dentistry3000-784	95	11	hplcgrade	hplcgrade	ADJ
dentistry3000-784	95	12	acetonitrile	acetonitrile	NOUN
dentistry3000-784	95	13	in	in	ADP
dentistry3000-784	95	14	a	a	DET
dentistry3000-784	95	15	glass	glass	NOUN
dentistry3000-784	95	16	vial	vial	NOUN
dentistry3000-784	95	17	;	;	PUNCT
dentistry3000-784	95	18	cover	cover	VERB
dentistry3000-784	95	19	with	with	ADP
dentistry3000-784	95	20	paraffin	paraffin	NOUN
dentistry3000-784	95	21	wax	wax	NOUN
dentistry3000-784	95	22	;	;	PUNCT
dentistry3000-784	95	23	vortex	vortex	NOUN
dentistry3000-784	95	24	well	well	ADV
dentistry3000-784	95	25	;	;	PUNCT
dentistry3000-784	95	26	and	and	CCONJ
dentistry3000-784	95	27	subject	subject	VERB
dentistry3000-784	95	28	to	to	ADP
dentistry3000-784	95	29	an	an	DET
dentistry3000-784	95	30	ultrasonic	ultrasonic	ADJ
dentistry3000-784	95	31	bath	bath	NOUN
dentistry3000-784	95	32	set	set	VERB
dentistry3000-784	95	33	at	at	ADP
dentistry3000-784	95	34	35	35	NUM
dentistry3000-784	95	35	degrees	degree	NOUN
dentistry3000-784	95	36	celsius	celsius	NOUN
dentistry3000-784	95	37	for	for	ADP
dentistry3000-784	95	38	15	15	NUM
dentistry3000-784	95	39	minutes	minute	NOUN
dentistry3000-784	95	40	.	.	PUNCT
dentistry3000-784	96	1	the	the	DET
dentistry3000-784	96	2	standards	standard	NOUN
dentistry3000-784	96	3	concentration	concentration	NOUN
dentistry3000-784	96	4	was	be	AUX
dentistry3000-784	96	5	set	set	VERB
dentistry3000-784	96	6	to	to	ADP
dentistry3000-784	96	7	5	5	NUM
dentistry3000-784	96	8	part	part	NOUN
dentistry3000-784	96	9	per	per	ADP
dentistry3000-784	96	10	million	million	NUM
dentistry3000-784	96	11	(	(	PUNCT
dentistry3000-784	96	12	ppm	ppm	NOUN
dentistry3000-784	96	13	)	)	PUNCT
dentistry3000-784	96	14	.	.	PUNCT
dentistry3000-784	97	1	after	after	ADP
dentistry3000-784	97	2	filtering	filter	VERB
dentistry3000-784	97	3	the	the	DET
dentistry3000-784	97	4	solution	solution	NOUN
dentistry3000-784	97	5	with	with	ADP
dentistry3000-784	97	6	a	a	DET
dentistry3000-784	97	7	0.45	0.45	NUM
dentistry3000-784	97	8	micro	micro	NOUN
dentistry3000-784	97	9	filter	filter	NOUN
dentistry3000-784	97	10	,	,	PUNCT
dentistry3000-784	97	11	20	20	NUM
dentistry3000-784	97	12	l	l	NOUN
dentistry3000-784	97	13	of	of	ADP
dentistry3000-784	97	14	the	the	DET
dentistry3000-784	97	15	solution	solution	NOUN
dentistry3000-784	97	16	was	be	AUX
dentistry3000-784	97	17	injected	inject	VERB
dentistry3000-784	97	18	into	into	ADP
dentistry3000-784	97	19	an	an	DET
dentistry3000-784	97	20	hplc	hplc	NOUN
dentistry3000-784	97	21	binary	binary	NOUN
dentistry3000-784	97	22	pump	pump	PROPN
dentistry3000-784	97	23	machine	machine	NOUN
dentistry3000-784	97	24	.	.	PUNCT
dentistry3000-784	98	1	to	to	PART
dentistry3000-784	98	2	calculate	calculate	VERB
dentistry3000-784	98	3	the	the	DET
dentistry3000-784	98	4	sample	sample	NOUN
dentistry3000-784	98	5	's	's	PART
dentistry3000-784	98	6	concentration	concentration	NOUN
dentistry3000-784	98	7	,	,	PUNCT
dentistry3000-784	98	8	the	the	DET
dentistry3000-784	98	9	following	follow	VERB
dentistry3000-784	98	10	formula	formula	NOUN
dentistry3000-784	98	11	was	be	AUX
dentistry3000-784	98	12	used	use	VERB
dentistry3000-784	98	13	:	:	PUNCT
dentistry3000-784	98	14	“	"	PUNCT
dentistry3000-784	98	15	conc	conc	ADJ
dentistry3000-784	98	16	.	.	PUNCT
dentistry3000-784	99	1	of	of	ADP
dentistry3000-784	99	2	sample	sample	NOUN
dentistry3000-784	99	3	=	=	SYM
dentistry3000-784	99	4	(	(	PUNCT
dentistry3000-784	99	5	conc.of	conc.of	X
dentistry3000-784	99	6	standard	standard	NOUN
dentistry3000-784	99	7	×area	×area	NOUN
dentistry3000-784	99	8	of	of	ADP
dentistry3000-784	99	9	sample)/(area	sample)/(area	PROPN
dentistry3000-784	99	10	of	of	ADP
dentistry3000-784	99	11	standard	standard	ADJ
dentistry3000-784	99	12	)	)	PUNCT
dentistry3000-784	99	13	×dilution	×dilution	NOUN
dentistry3000-784	99	14	factor	factor	NOUN
dentistry3000-784	99	15	”	"	PUNCT
dentistry3000-784	99	16	the	the	DET
dentistry3000-784	99	17	data	datum	NOUN
dentistry3000-784	99	18	were	be	AUX
dentistry3000-784	99	19	summarized	summarize	VERB
dentistry3000-784	99	20	by	by	ADP
dentistry3000-784	99	21	maximum	maximum	ADJ
dentistry3000-784	99	22	,	,	PUNCT
dentistry3000-784	99	23	minimum	minimum	ADJ
dentistry3000-784	99	24	,	,	PUNCT
dentistry3000-784	99	25	standard	standard	ADJ
dentistry3000-784	99	26	deviation	deviation	NOUN
dentistry3000-784	99	27	(	(	PUNCT
dentistry3000-784	99	28	sd	sd	NOUN
dentistry3000-784	99	29	)	)	PUNCT
dentistry3000-784	99	30	,	,	PUNCT
dentistry3000-784	99	31	standard	standard	ADJ
dentistry3000-784	99	32	error	error	NOUN
dentistry3000-784	99	33	(	(	PUNCT
dentistry3000-784	99	34	se	se	ADJ
dentistry3000-784	99	35	)	)	PUNCT
dentistry3000-784	99	36	,	,	PUNCT
dentistry3000-784	99	37	and	and	CCONJ
dentistry3000-784	99	38	mean	mean	ADJ
dentistry3000-784	99	39	values	value	NOUN
dentistry3000-784	99	40	.	.	PUNCT
dentistry3000-784	100	1	levene	levene	NOUN
dentistry3000-784	100	2	test	test	NOUN
dentistry3000-784	100	3	,	,	PUNCT
dentistry3000-784	100	4	one	one	NUM
dentistry3000-784	100	5	way	way	NOUN
dentistry3000-784	100	6	analysis	analysis	NOUN
dentistry3000-784	100	7	of	of	ADP
dentistry3000-784	100	8	variance	variance	NOUN
dentistry3000-784	100	9	(	(	PUNCT
dentistry3000-784	100	10	anova	anova	PROPN
dentistry3000-784	100	11	)	)	PUNCT
dentistry3000-784	100	12	,	,	PUNCT
dentistry3000-784	100	13	and	and	CCONJ
dentistry3000-784	100	14	shapiro	shapiro	PROPN
dentistry3000-784	100	15	wilk	wilk	PROPN
dentistry3000-784	100	16	test	test	PROPN
dentistry3000-784	100	17	were	be	AUX
dentistry3000-784	100	18	used	use	VERB
dentistry3000-784	100	19	.	.	PUNCT
dentistry3000-784	101	1	these	these	DET
dentistry3000-784	101	2	tools	tool	NOUN
dentistry3000-784	101	3	were	be	AUX
dentistry3000-784	101	4	part	part	NOUN
dentistry3000-784	101	5	of	of	ADP
dentistry3000-784	101	6	the	the	DET
dentistry3000-784	101	7	statistical	statistical	ADJ
dentistry3000-784	101	8	package	package	NOUN
dentistry3000-784	101	9	for	for	ADP
dentistry3000-784	101	10	the	the	DET
dentistry3000-784	101	11	social	social	ADJ
dentistry3000-784	101	12	sciences	science	NOUN
dentistry3000-784	101	13	(	(	PUNCT
dentistry3000-784	101	14	spss	spss	PROPN
dentistry3000-784	101	15	version	version	PROPN
dentistry3000-784	101	16	-22	-22	PROPN
dentistry3000-784	101	17	,	,	PUNCT
dentistry3000-784	101	18	chicago	chicago	PROPN
dentistry3000-784	101	19	,	,	PUNCT
dentistry3000-784	101	20	illinois	illinois	PROPN
dentistry3000-784	101	21	,	,	PUNCT
dentistry3000-784	101	22	usa	usa	PROPN
dentistry3000-784	101	23	)	)	PUNCT
dentistry3000-784	101	24	.	.	PUNCT
dentistry3000-784	102	1	p>0.05	p>0.05	PROPN
dentistry3000-784	102	2	was	be	AUX
dentistry3000-784	102	3	considered	consider	VERB
dentistry3000-784	102	4	not	not	PART
dentistry3000-784	102	5	significant	significant	ADJ
dentistry3000-784	102	6	,	,	PUNCT
dentistry3000-784	102	7	whereas	whereas	SCONJ
dentistry3000-784	102	8	p<0.05	p<0.05	NOUN
dentistry3000-784	102	9	was	be	AUX
dentistry3000-784	102	10	considered	consider	VERB
dentistry3000-784	102	11	significant	significant	ADJ
dentistry3000-784	102	12	.	.	PUNCT
dentistry3000-784	103	1	results	result	VERB
dentistry3000-784	103	2	identification	identification	NOUN
dentistry3000-784	103	3	of	of	ADP
dentistry3000-784	103	4	s.	s.	PROPN
dentistry3000-784	103	5	sanguis	sanguis	PROPN
dentistry3000-784	103	6	:	:	PUNCT
dentistry3000-784	103	7	on	on	ADP
dentistry3000-784	103	8	msa	msa	PROPN
dentistry3000-784	103	9	,	,	PUNCT
dentistry3000-784	103	10	s.	s.	PROPN
dentistry3000-784	103	11	sanguis	sanguis	PROPN
dentistry3000-784	103	12	colonies	colony	NOUN
dentistry3000-784	103	13	were	be	AUX
dentistry3000-784	103	14	small	small	ADJ
dentistry3000-784	103	15	spherical	spherical	ADJ
dentistry3000-784	103	16	colonies	colony	NOUN
dentistry3000-784	103	17	,	,	PUNCT
dentistry3000-784	103	18	blue	blue	ADJ
dentistry3000-784	103	19	in	in	ADP
dentistry3000-784	103	20	color	color	NOUN
dentistry3000-784	103	21	with	with	ADP
dentistry3000-784	103	22	slightly	slightly	ADV
dentistry3000-784	103	23	raised	raise	VERB
dentistry3000-784	103	24	surfaces	surface	NOUN
dentistry3000-784	103	25	and	and	CCONJ
dentistry3000-784	103	26	greatly	greatly	ADV
dentistry3000-784	103	27	adhere	adhere	VERB
dentistry3000-784	103	28	to	to	ADP
dentistry3000-784	103	29	the	the	DET
dentistry3000-784	103	30	agar	agar	NOUN
dentistry3000-784	103	31	surface	surface	NOUN
dentistry3000-784	103	32	.	.	PUNCT
dentistry3000-784	104	1	on	on	ADP
dentistry3000-784	104	2	40x	40x	NOUN
dentistry3000-784	104	3	magnification	magnification	NOUN
dentistry3000-784	104	4	,	,	PUNCT
dentistry3000-784	104	5	cells	cell	NOUN
dentistry3000-784	104	6	of	of	ADP
dentistry3000-784	104	7	s.	s.	PROPN
dentistry3000-784	104	8	sanguis	sanguis	PROPN
dentistry3000-784	104	9	appeared	appear	VERB
dentistry3000-784	104	10	as	as	ADP
dentistry3000-784	104	11	spherical	spherical	ADJ
dentistry3000-784	104	12	purple	purple	ADJ
dentistry3000-784	104	13	cocci	cocci	NOUN
dentistry3000-784	104	14	(	(	PUNCT
dentistry3000-784	104	15	grampositive	grampositive	NOUN
dentistry3000-784	104	16	)	)	PUNCT
dentistry3000-784	104	17	and	and	CCONJ
dentistry3000-784	104	18	they	they	PRON
dentistry3000-784	104	19	were	be	AUX
dentistry3000-784	104	20	arranged	arrange	VERB
dentistry3000-784	104	21	in	in	ADP
dentistry3000-784	104	22	medium	medium	NOUN
dentistry3000-784	104	23	to	to	ADP
dentistry3000-784	104	24	long	long	ADJ
dentistry3000-784	104	25	chains	chain	NOUN
dentistry3000-784	104	26	.	.	PUNCT
dentistry3000-784	105	1	results	result	NOUN
dentistry3000-784	105	2	from	from	ADP
dentistry3000-784	105	3	biochemical	biochemical	ADJ
dentistry3000-784	105	4	tests	test	NOUN
dentistry3000-784	105	5	confirmed	confirm	VERB
dentistry3000-784	105	6	that	that	SCONJ
dentistry3000-784	105	7	the	the	DET
dentistry3000-784	105	8	study	study	NOUN
dentistry3000-784	105	9	organism	organism	NOUN
dentistry3000-784	105	10	is	be	AUX
dentistry3000-784	105	11	an	an	DET
dentistry3000-784	105	12	alpha	alpha	NOUN
dentistry3000-784	105	13	hemolytic	hemolytic	NOUN
dentistry3000-784	105	14	,	,	PUNCT
dentistry3000-784	105	15	gram	gram	PROPN
dentistry3000-784	105	16	positive	positive	ADJ
dentistry3000-784	105	17	,	,	PUNCT
dentistry3000-784	105	18	catalase	catalase	NOUN
dentistry3000-784	105	19	negative	negative	ADJ
dentistry3000-784	105	20	and	and	CCONJ
dentistry3000-784	105	21	optochin	optochin	ADJ
dentistry3000-784	105	22	resistant	resistant	ADJ
dentistry3000-784	105	23	streptococci	streptococci	NOUN
dentistry3000-784	105	24	.	.	PUNCT
dentistry3000-784	106	1	the	the	DET
dentistry3000-784	106	2	pcr	pcr	PROPN
dentistry3000-784	106	3	results	result	NOUN
dentistry3000-784	106	4	validated	validate	VERB
dentistry3000-784	106	5	the	the	DET
dentistry3000-784	106	6	diagnosis	diagnosis	NOUN
dentistry3000-784	106	7	of	of	ADP
dentistry3000-784	106	8	s.	s.	PROPN
dentistry3000-784	106	9	sanguis	sanguis	PROPN
dentistry3000-784	106	10	,	,	PUNCT
dentistry3000-784	106	11	the	the	DET
dentistry3000-784	106	12	identification	identification	NOUN
dentistry3000-784	106	13	of	of	ADP
dentistry3000-784	106	14	s.	s.	PROPN
dentistry3000-784	106	15	sanguis	sanguis	PROPN
dentistry3000-784	106	16	was	be	AUX
dentistry3000-784	106	17	clarified	clarify	VERB
dentistry3000-784	106	18	by	by	ADP
dentistry3000-784	106	19	pcr	pcr	PROPN
dentistry3000-784	106	20	findings	finding	NOUN
dentistry3000-784	106	21	(	(	PUNCT
dentistry3000-784	106	22	figure1	figure1	PROPN
dentistry3000-784	106	23	)	)	PUNCT
dentistry3000-784	106	24	.	.	PUNCT
dentistry3000-784	107	1	figure	figure	NOUN
dentistry3000-784	107	2	1	1	NUM
dentistry3000-784	107	3	.	.	PUNCT
dentistry3000-784	108	1	s.	s.	PROPN
dentistry3000-784	108	2	sanguis	sanguis	PROPN
dentistry3000-784	108	3	dna	dna	NOUN
dentistry3000-784	108	4	amplification	amplification	NOUN
dentistry3000-784	108	5	results	result	NOUN
dentistry3000-784	108	6	.	.	PUNCT
dentistry3000-784	109	1	m	m	VERB
dentistry3000-784	109	2	stands	stand	VERB
dentistry3000-784	109	3	for	for	ADP
dentistry3000-784	109	4	100bp	100bp	ADJ
dentistry3000-784	109	5	ladder	ladder	NOUN
dentistry3000-784	109	6	marker	marker	NOUN
dentistry3000-784	109	7	,	,	PUNCT
dentistry3000-784	109	8	and	and	CCONJ
dentistry3000-784	109	9	bp	bp	PROPN
dentistry3000-784	109	10	stands	stand	VERB
dentistry3000-784	109	11	for	for	ADP
dentistry3000-784	109	12	base	base	NOUN
dentistry3000-784	109	13	pair	pair	NOUN
dentistry3000-784	109	14	.	.	PUNCT
dentistry3000-784	110	1	the	the	DET
dentistry3000-784	110	2	zones	zone	NOUN
dentistry3000-784	110	3	of	of	ADP
dentistry3000-784	110	4	inhibition	inhibition	NOUN
dentistry3000-784	110	5	for	for	ADP
dentistry3000-784	110	6	s.	s.	PROPN
dentistry3000-784	110	7	sanguis	sanguis	NOUN
dentistry3000-784	110	8	grew	grow	VERB
dentistry3000-784	110	9	in	in	ADP
dentistry3000-784	110	10	diameter	diameter	NOUN
dentistry3000-784	110	11	with	with	ADP
dentistry3000-784	110	12	increasing	increase	VERB
dentistry3000-784	110	13	concentrations	concentration	NOUN
dentistry3000-784	110	14	of	of	ADP
dentistry3000-784	110	15	the	the	DET
dentistry3000-784	110	16	study	study	NOUN
dentistry3000-784	110	17	extract	extract	NOUN
dentistry3000-784	110	18	;	;	PUNCT
dentistry3000-784	110	19	the	the	DET
dentistry3000-784	110	20	greatest	great	ADJ
dentistry3000-784	110	21	one	one	NOUN
dentistry3000-784	110	22	was	be	AUX
dentistry3000-784	110	23	in	in	ADP
dentistry3000-784	110	24	chlorohexidine	chlorohexidine	NOUN
dentistry3000-784	110	25	,	,	PUNCT
dentistry3000-784	110	26	and	and	CCONJ
dentistry3000-784	110	27	this	this	DET
dentistry3000-784	110	28	difference	difference	NOUN
dentistry3000-784	110	29	was	be	AUX
dentistry3000-784	110	30	statistically	statistically	ADV
dentistry3000-784	110	31	significant	significant	ADJ
dentistry3000-784	110	32	(	(	PUNCT
dentistry3000-784	110	33	p	p	X
dentistry3000-784	110	34	>	>	X
dentistry3000-784	110	35	0.05	0.05	NUM
dentistry3000-784	110	36	)	)	PUNCT
dentistry3000-784	110	37	.	.	PUNCT
dentistry3000-784	111	1	also	also	ADV
dentistry3000-784	111	2	,	,	PUNCT
dentistry3000-784	111	3	when	when	SCONJ
dentistry3000-784	111	4	comparing	compare	VERB
dentistry3000-784	111	5	each	each	DET
dentistry3000-784	111	6	group	group	NOUN
dentistry3000-784	111	7	to	to	ADP
dentistry3000-784	111	8	each	each	DET
dentistry3000-784	111	9	other	other	ADJ
dentistry3000-784	111	10	and	and	CCONJ
dentistry3000-784	111	11	to	to	PART
dentistry3000-784	111	12	chlorohexidine	chlorohexidine	VERB
dentistry3000-784	111	13	,	,	PUNCT
dentistry3000-784	111	14	the	the	DET
dentistry3000-784	111	15	results	result	NOUN
dentistry3000-784	111	16	demonstrated	demonstrate	VERB
dentistry3000-784	111	17	a	a	DET
dentistry3000-784	111	18	significant	significant	ADJ
dentistry3000-784	111	19	difference	difference	NOUN
dentistry3000-784	111	20	using	use	VERB
dentistry3000-784	111	21	multiple	multiple	ADJ
dentistry3000-784	111	22	comparisons	comparison	NOUN
dentistry3000-784	111	23	among	among	ADP
dentistry3000-784	111	24	groups	group	NOUN
dentistry3000-784	111	25	by	by	ADP
dentistry3000-784	111	26	tukey	tukey	PROPN
dentistry3000-784	111	27	's	's	PART
dentistry3000-784	111	28	hsd	hsd	NOUN
dentistry3000-784	111	29	(	(	PUNCT
dentistry3000-784	111	30	p	p	X
dentistry3000-784	111	31	more	more	ADJ
dentistry3000-784	111	32	than	than	ADP
dentistry3000-784	111	33	0.05	0.05	NUM
dentistry3000-784	111	34	)	)	PUNCT
dentistry3000-784	111	35	.	.	PUNCT
dentistry3000-784	112	1	tables	table	NOUN
dentistry3000-784	112	2	2	2	NUM
dentistry3000-784	112	3	,	,	PUNCT
dentistry3000-784	112	4	3	3	NUM
dentistry3000-784	112	5	,	,	PUNCT
dentistry3000-784	112	6	and	and	CCONJ
dentistry3000-784	112	7	4	4	NUM
dentistry3000-784	112	8	show	show	VERB
dentistry3000-784	112	9	the	the	DET
dentistry3000-784	112	10	results	result	NOUN
dentistry3000-784	112	11	.	.	PUNCT
dentistry3000-784	113	1	according	accord	VERB
dentistry3000-784	113	2	to	to	ADP
dentistry3000-784	113	3	an	an	DET
dentistry3000-784	113	4	“	"	PUNCT
dentistry3000-784	113	5	absorbance	absorbance	NOUN
dentistry3000-784	113	6	microplate	microplate	NOUN
dentistry3000-784	113	7	reader	reader	NOUN
dentistry3000-784	113	8	”	"	PUNCT
dentistry3000-784	113	9	,	,	PUNCT
dentistry3000-784	113	10	mic	mic	NOUN
dentistry3000-784	113	11	and	and	CCONJ
dentistry3000-784	113	12	mbc	mbc	PROPN
dentistry3000-784	113	13	of	of	ADP
dentistry3000-784	113	14	the	the	DET
dentistry3000-784	113	15	study	study	NOUN
dentistry3000-784	113	16	extract	extract	NOUN
dentistry3000-784	113	17	against	against	ADP
dentistry3000-784	113	18	s.	s.	PROPN
dentistry3000-784	113	19	sanguis	sanguis	PROPN
dentistry3000-784	113	20	both	both	PRON
dentistry3000-784	113	21	were	be	AUX
dentistry3000-784	113	22	16	16	NUM
dentistry3000-784	113	23	mg	mg	NUM
dentistry3000-784	113	24	/	/	SYM
dentistry3000-784	113	25	ml	ml	NOUN
dentistry3000-784	113	26	.	.	PUNCT
dentistry3000-784	114	1	bacteriostatic	bacteriostatic	ADJ
dentistry3000-784	114	2	activity	activity	NOUN
dentistry3000-784	114	3	has	have	AUX
dentistry3000-784	114	4	been	be	AUX
dentistry3000-784	114	5	observed	observe	VERB
dentistry3000-784	114	6	with	with	ADP
dentistry3000-784	114	7	0.2	0.2	NUM
dentistry3000-784	114	8	%	%	NOUN
dentistry3000-784	114	9	chx	chx	NOUN
dentistry3000-784	114	10	(	(	PUNCT
dentistry3000-784	114	11	0.1	0.1	NUM
dentistry3000-784	114	12	percent	percent	NOUN
dentistry3000-784	114	13	in	in	ADP
dentistry3000-784	114	14	broth	broth	NOUN
dentistry3000-784	114	15	)	)	PUNCT
dentistry3000-784	114	16	.	.	PUNCT
dentistry3000-784	115	1	phytochemical	phytochemical	ADJ
dentistry3000-784	115	2	analysis	analysis	NOUN
dentistry3000-784	115	3	and	and	CCONJ
dentistry3000-784	115	4	an1bacterial	an1bacterial	ADJ
dentistry3000-784	115	5	ac1vity	ac1vity	NOUN
dentistry3000-784	115	6	of	of	ADP
dentistry3000-784	115	7	stevia	stevia	NOUN
dentistry3000-784	115	8	rebaudiana	rebaudiana	PROPN
dentistry3000-784	115	9	bertoni	bertoni	PROPN
dentistry3000-784	115	10	leaves	leave	NOUN
dentistry3000-784	115	11	extract	extract	VERB
dentistry3000-784	115	12	against	against	ADP
dentistry3000-784	115	13	streptococcus	streptococcus	NOUN
dentistry3000-784	115	14	sanguis	sanguis	NOUN
dentistry3000-784	115	15	(	(	PUNCT
dentistry3000-784	115	16	a	a	DET
dentistry3000-784	115	17	primary	primary	ADJ
dentistry3000-784	115	18	inhabitant	inhabitant	NOUN
dentistry3000-784	115	19	of	of	ADP
dentistry3000-784	115	20	dental	dental	ADJ
dentistry3000-784	115	21	plaque	plaque	NOUN
dentistry3000-784	115	22	):	):	PUNCT
dentistry3000-784	115	23	in	in	ADP
dentistry3000-784	115	24	vitro	vitro	X
dentistry3000-784	115	25	study	study	NOUN
dentistry3000-784	115	26	vol	vol	NOUN
dentistry3000-784	115	27	13	13	NUM
dentistry3000-784	115	28	no	no	DET
dentistry3000-784	115	29	1	1	NUM
dentistry3000-784	115	30	(	(	PUNCT
dentistry3000-784	115	31	2025	2025	NUM
dentistry3000-784	115	32	)	)	PUNCT
dentistry3000-784	115	33	doi	doi	NOUN
dentistry3000-784	115	34	10.5195	10.5195	NUM
dentistry3000-784	115	35	/	/	SYM
dentistry3000-784	115	36	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	115	37	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	115	38	table	table	NOUN
dentistry3000-784	115	39	2	2	NUM
dentistry3000-784	115	40	.	.	PUNCT
dentistry3000-784	115	41	descriptive	descriptive	ADJ
dentistry3000-784	115	42	statistics	statistic	NOUN
dentistry3000-784	115	43	for	for	ADP
dentistry3000-784	115	44	the	the	DET
dentistry3000-784	115	45	diameter	diameter	NOUN
dentistry3000-784	115	46	of	of	ADP
dentistry3000-784	115	47	the	the	DET
dentistry3000-784	115	48	s.	s.	PROPN
dentistry3000-784	115	49	sanguis	sanguis	NOUN
dentistry3000-784	115	50	inhibition	inhibition	NOUN
dentistry3000-784	115	51	zone	zone	NOUN
dentistry3000-784	115	52	in	in	ADP
dentistry3000-784	115	53	different	different	ADJ
dentistry3000-784	115	54	groups	group	NOUN
dentistry3000-784	115	55	(	(	PUNCT
dentistry3000-784	115	56	levene	levene	NOUN
dentistry3000-784	115	57	test=	test=	PROPN
dentistry3000-784	115	58	0.829	0.829	NUM
dentistry3000-784	115	59	,	,	PUNCT
dentistry3000-784	115	60	p	p	PROPN
dentistry3000-784	115	61	value=	value=	NOUN
dentistry3000-784	115	62	0.558	0.558	NUM
dentistry3000-784	115	63	)	)	PUNCT
dentistry3000-784	115	64	.	.	PUNCT
dentistry3000-784	116	1	groups/	groups/	PROPN
dentistry3000-784	116	2	(	(	PUNCT
dentistry3000-784	116	3	mg	mg	PROPN
dentistry3000-784	116	4	/	/	SYM
dentistry3000-784	116	5	ml	ml	NOUN
dentistry3000-784	116	6	)	)	PUNCT
dentistry3000-784	116	7	mean	mean	NOUN
dentistry3000-784	116	8	(	(	PUNCT
dentistry3000-784	116	9	±sd	±sd	NOUN
dentistry3000-784	116	10	)	)	PUNCT
dentistry3000-784	116	11	(	(	PUNCT
dentistry3000-784	116	12	±se	±se	PROPN
dentistry3000-784	116	13	)	)	PUNCT
dentistry3000-784	116	14	min	min	PROPN
dentistry3000-784	116	15	.	.	PROPN
dentistry3000-784	116	16	max	max	PROPN
dentistry3000-784	116	17	.	.	PROPN
dentistry3000-784	117	1	16	16	NUM
dentistry3000-784	117	2	12.4	12.4	NUM
dentistry3000-784	117	3	0.418	0.418	NUM
dentistry3000-784	117	4	0.187	0.187	NUM
dentistry3000-784	117	5	12.000	12.000	NUM
dentistry3000-784	117	6	13.000	13.000	NUM
dentistry3000-784	117	7	32	32	NUM
dentistry3000-784	117	8	15.1	15.1	NUM
dentistry3000-784	117	9	0.418	0.418	NUM
dentistry3000-784	117	10	0.187	0.187	NUM
dentistry3000-784	117	11	14.500	14.500	NUM
dentistry3000-784	117	12	15.500	15.500	NUM
dentistry3000-784	117	13	64	64	NUM
dentistry3000-784	117	14	17.3	17.3	NUM
dentistry3000-784	117	15	0.447	0.447	NUM
dentistry3000-784	117	16	0.200	0.200	NUM
dentistry3000-784	117	17	17.000	17.000	NUM
dentistry3000-784	117	18	18.000	18.000	NUM
dentistry3000-784	117	19	128	128	NUM
dentistry3000-784	117	20	19.8	19.8	NUM
dentistry3000-784	117	21	0.570	0.570	NUM
dentistry3000-784	117	22	0.255	0.255	NUM
dentistry3000-784	117	23	19.000	19.000	NUM
dentistry3000-784	117	24	20.500	20.500	NUM
dentistry3000-784	117	25	256	256	NUM
dentistry3000-784	117	26	22.6	22.6	NUM
dentistry3000-784	117	27	0.548	0.548	NUM
dentistry3000-784	117	28	0.245	0.245	NUM
dentistry3000-784	117	29	22.000	22.000	NUM
dentistry3000-784	117	30	23.000	23.000	NUM
dentistry3000-784	117	31	512	512	NUM
dentistry3000-784	117	32	26.3	26.3	NUM
dentistry3000-784	117	33	0.274	0.274	NUM
dentistry3000-784	117	34	0.122	0.122	NUM
dentistry3000-784	117	35	26.000	26.000	NUM
dentistry3000-784	117	36	26.500	26.500	NUM
dentistry3000-784	117	37	chx	chx	PROPN
dentistry3000-784	117	38	28	28	NUM
dentistry3000-784	117	39	0.500	0.500	NUM
dentistry3000-784	117	40	0.224	0.224	NUM
dentistry3000-784	117	41	27.500	27.500	NUM
dentistry3000-784	117	42	28.500	28.500	NUM
dentistry3000-784	117	43	table	table	NOUN
dentistry3000-784	117	44	3	3	NUM
dentistry3000-784	117	45	.	.	PUNCT
dentistry3000-784	118	1	a	a	DET
dentistry3000-784	118	2	one	one	NUM
dentistry3000-784	118	3	-	-	PUNCT
dentistry3000-784	118	4	way	way	NOUN
dentistry3000-784	118	5	analysis	analysis	NOUN
dentistry3000-784	118	6	of	of	ADP
dentistry3000-784	118	7	variance	variance	NOUN
dentistry3000-784	118	8	(	(	PUNCT
dentistry3000-784	118	9	anova	anova	PROPN
dentistry3000-784	118	10	)	)	PUNCT
dentistry3000-784	118	11	was	be	AUX
dentistry3000-784	118	12	used	use	VERB
dentistry3000-784	118	13	to	to	PART
dentistry3000-784	118	14	compare	compare	VERB
dentistry3000-784	118	15	the	the	DET
dentistry3000-784	118	16	groups	group	NOUN
dentistry3000-784	118	17	'	'	PART
dentistry3000-784	118	18	inhibitory	inhibitory	ADJ
dentistry3000-784	118	19	zone	zone	NOUN
dentistry3000-784	118	20	diameters	diameter	NOUN
dentistry3000-784	118	21	for	for	ADP
dentistry3000-784	118	22	s.	s.	PROPN
dentistry3000-784	118	23	sanguis	sanguis	PROPN
dentistry3000-784	118	24	.	.	PUNCT
dentistry3000-784	119	1	a	a	DET
dentistry3000-784	119	2	p	p	NOUN
dentistry3000-784	119	3	-	-	PUNCT
dentistry3000-784	119	4	value	value	NOUN
dentistry3000-784	119	5	less	less	ADJ
dentistry3000-784	119	6	than	than	ADP
dentistry3000-784	119	7	0.05	0.05	NUM
dentistry3000-784	119	8	is	be	AUX
dentistry3000-784	119	9	considered	consider	VERB
dentistry3000-784	119	10	statistically	statistically	ADV
dentistry3000-784	119	11	significant	significant	ADJ
dentistry3000-784	119	12	.	.	PUNCT
dentistry3000-784	120	1	anova	anova	PROPN
dentistry3000-784	120	2	sum	sum	PROPN
dentistry3000-784	120	3	of	of	ADP
dentistry3000-784	120	4	squares	square	NOUN
dentistry3000-784	120	5	df	df	PROPN
dentistry3000-784	120	6	mean	mean	VERB
dentistry3000-784	120	7	square	square	PROPN
dentistry3000-784	120	8	f	f	PROPN
dentistry3000-784	121	1	p	p	NOUN
dentistry3000-784	121	2	value	value	NOUN
dentistry3000-784	121	3	between	between	ADP
dentistry3000-784	121	4	groups	group	NOUN
dentistry3000-784	121	5	996.143	996.143	NUM
dentistry3000-784	121	6	6	6	NUM
dentistry3000-784	121	7	166.024	166.024	NUM
dentistry3000-784	121	8	774.778	774.778	NUM
dentistry3000-784	121	9	0.000	0.000	NUM
dentistry3000-784	121	10	sig	sig	NOUN
dentistry3000-784	121	11	.	.	PUNCT
dentistry3000-784	122	1	within	within	ADP
dentistry3000-784	122	2	groups	group	NOUN
dentistry3000-784	122	3	6.000	6.000	NUM
dentistry3000-784	122	4	28	28	NUM
dentistry3000-784	122	5	0.214	0.214	NUM
dentistry3000-784	122	6	total	total	ADJ
dentistry3000-784	122	7	1002.143	1002.143	NUM
dentistry3000-784	122	8	34	34	NUM
dentistry3000-784	122	9	table	table	NOUN
dentistry3000-784	122	10	4	4	NUM
dentistry3000-784	122	11	.	.	X
dentistry3000-784	122	12	tukey	tukey	NOUN
dentistry3000-784	122	13	hsd	hsd	VERB
dentistry3000-784	122	14	analysis	analysis	NOUN
dentistry3000-784	122	15	of	of	ADP
dentistry3000-784	122	16	multiple	multiple	ADJ
dentistry3000-784	122	17	comparisons	comparison	NOUN
dentistry3000-784	122	18	of	of	ADP
dentistry3000-784	122	19	s.	s.	PROPN
dentistry3000-784	122	20	sanguis	sanguis	NOUN
dentistry3000-784	122	21	inhibition	inhibition	NOUN
dentistry3000-784	122	22	zone	zone	NOUN
dentistry3000-784	122	23	diameter	diameter	NOUN
dentistry3000-784	122	24	between	between	ADP
dentistry3000-784	122	25	groups	group	NOUN
dentistry3000-784	122	26	.	.	PUNCT
dentistry3000-784	123	1	groups/	groups/	PROPN
dentistry3000-784	123	2	(	(	PUNCT
dentistry3000-784	123	3	mg\ml	mg\ml	PROPN
dentistry3000-784	123	4	)	)	PUNCT
dentistry3000-784	123	5	(	(	PUNCT
dentistry3000-784	123	6	mean	mean	INTJ
dentistry3000-784	123	7	differenc	differenc	PROPN
dentistry3000-784	123	8	e	e	NOUN
dentistry3000-784	123	9	)	)	PUNCT
dentistry3000-784	123	10	(	(	PUNCT
dentistry3000-784	123	11	pvalue	pvalue	NOUN
dentistry3000-784	123	12	)	)	PUNCT
dentistry3000-784	123	13	16	16	NUM
dentistry3000-784	123	14	32	32	NUM
dentistry3000-784	123	15	-2.700	-2.700	NUM
dentistry3000-784	123	16	0.00000	0.00000	NUM
dentistry3000-784	123	17	significant	significant	ADJ
dentistry3000-784	123	18	64	64	NUM
dentistry3000-784	123	19	-4.900	-4.900	ADJ
dentistry3000-784	123	20	0.00000	0.00000	NUM
dentistry3000-784	123	21	128	128	NUM
dentistry3000-784	123	22	-7.400	-7.400	NOUN
dentistry3000-784	123	23	0.00000	0.00000	NUM
dentistry3000-784	123	24	256	256	NUM
dentistry3000-784	123	25	-10.200	-10.200	NUM
dentistry3000-784	123	26	0.00000	0.00000	NUM
dentistry3000-784	123	27	512	512	NUM
dentistry3000-784	123	28	-13.900	-13.900	PROPN
dentistry3000-784	123	29	0.00000	0.00000	NUM
dentistry3000-784	123	30	chx	chx	NOUN
dentistry3000-784	123	31	-15.600	-15.600	PUNCT
dentistry3000-784	123	32	0.00000	0.00000	NUM
dentistry3000-784	123	33	32	32	NUM
dentistry3000-784	123	34	64	64	NUM
dentistry3000-784	123	35	-2.200	-2.200	NUM
dentistry3000-784	123	36	0.00000	0.00000	NUM
dentistry3000-784	123	37	128	128	NUM
dentistry3000-784	123	38	-4.700	-4.700	SYM
dentistry3000-784	123	39	0.00000	0.00000	NUM
dentistry3000-784	123	40	256	256	NUM
dentistry3000-784	123	41	-7.500	-7.500	NUM
dentistry3000-784	123	42	0.00000	0.00000	NUM
dentistry3000-784	123	43	512	512	NUM
dentistry3000-784	123	44	-11.200	-11.200	NUM
dentistry3000-784	123	45	0.00000	0.00000	NUM
dentistry3000-784	123	46	chx	chx	PROPN
dentistry3000-784	123	47	-12.900	-12.900	PROPN
dentistry3000-784	123	48	0.00000	0.00000	NUM
dentistry3000-784	123	49	64	64	NUM
dentistry3000-784	123	50	128	128	NUM
dentistry3000-784	123	51	-2.500	-2.500	NUM
dentistry3000-784	123	52	0.00000	0.00000	NUM
dentistry3000-784	123	53	256	256	NUM
dentistry3000-784	123	54	-5.300	-5.300	NUM
dentistry3000-784	123	55	0.00000	0.00000	NUM
dentistry3000-784	123	56	512	512	NUM
dentistry3000-784	123	57	-9.000	-9.000	NUM
dentistry3000-784	123	58	0.00000	0.00000	NUM
dentistry3000-784	123	59	chx	chx	NOUN
dentistry3000-784	123	60	-10.700	-10.700	PROPN
dentistry3000-784	123	61	0.00000	0.00000	NUM
dentistry3000-784	123	62	128	128	NUM
dentistry3000-784	123	63	256	256	NUM
dentistry3000-784	123	64	-2.800	-2.800	NUM
dentistry3000-784	123	65	0.00000	0.00000	NUM
dentistry3000-784	123	66	512	512	NUM
dentistry3000-784	123	67	-6.500	-6.500	PUNCT
dentistry3000-784	123	68	0.00000	0.00000	NUM
dentistry3000-784	123	69	chx	chx	NOUN
dentistry3000-784	123	70	-8.200	-8.200	PUNCT
dentistry3000-784	124	1	0.00000	0.00000	NUM
dentistry3000-784	124	2	256	256	NUM
dentistry3000-784	124	3	512	512	NUM
dentistry3000-784	124	4	-3.700	-3.700	NUM
dentistry3000-784	124	5	0.00000	0.00000	NUM
dentistry3000-784	124	6	chx	chx	NOUN
dentistry3000-784	124	7	-5.400	-5.400	NOUN
dentistry3000-784	124	8	0.00000	0.00000	NUM
dentistry3000-784	124	9	512	512	NUM
dentistry3000-784	124	10	chx	chx	PROPN
dentistry3000-784	124	11	-1.700	-1.700	PROPN
dentistry3000-784	124	12	0.00006	0.00006	NUM
dentistry3000-784	124	13	using	use	VERB
dentistry3000-784	124	14	high	high	ADJ
dentistry3000-784	124	15	-	-	PUNCT
dentistry3000-784	124	16	performance	performance	NOUN
dentistry3000-784	124	17	liquid	liquid	ADJ
dentistry3000-784	124	18	chromatography	chromatography	NOUN
dentistry3000-784	124	19	,	,	PUNCT
dentistry3000-784	124	20	the	the	DET
dentistry3000-784	124	21	presence	presence	NOUN
dentistry3000-784	124	22	of	of	ADP
dentistry3000-784	124	23	effective	effective	ADJ
dentistry3000-784	124	24	antibacterial	antibacterial	ADJ
dentistry3000-784	124	25	phytochemical	phytochemical	ADJ
dentistry3000-784	124	26	compounds	compound	NOUN
dentistry3000-784	124	27	was	be	AUX
dentistry3000-784	124	28	encountered	encounter	VERB
dentistry3000-784	124	29	at	at	ADP
dentistry3000-784	124	30	the	the	DET
dentistry3000-784	124	31	following	follow	VERB
dentistry3000-784	124	32	concentrations	concentration	NOUN
dentistry3000-784	124	33	:	:	PUNCT
dentistry3000-784	124	34	narigenin	narigenin	PROPN
dentistry3000-784	124	35	(	(	PUNCT
dentistry3000-784	124	36	25.76	25.76	NUM
dentistry3000-784	124	37	ppm	ppm	NOUN
dentistry3000-784	124	38	)	)	PUNCT
dentistry3000-784	124	39	,	,	PUNCT
dentistry3000-784	124	40	catechin	catechin	NOUN
dentistry3000-784	124	41	(	(	PUNCT
dentistry3000-784	124	42	30.25	30.25	NUM
dentistry3000-784	124	43	ppm	ppm	NOUN
dentistry3000-784	124	44	)	)	PUNCT
dentistry3000-784	124	45	,	,	PUNCT
dentistry3000-784	124	46	coumarin	coumarin	NOUN
dentistry3000-784	124	47	(	(	PUNCT
dentistry3000-784	124	48	25.47	25.47	NUM
dentistry3000-784	124	49	ppm	ppm	NOUN
dentistry3000-784	124	50	)	)	PUNCT
dentistry3000-784	124	51	,	,	PUNCT
dentistry3000-784	124	52	and	and	CCONJ
dentistry3000-784	124	53	kaempferol	kaempferol	NOUN
dentistry3000-784	124	54	(	(	PUNCT
dentistry3000-784	124	55	4.59	4.59	NUM
dentistry3000-784	124	56	ppm	ppm	NOUN
dentistry3000-784	124	57	)	)	PUNCT
dentistry3000-784	124	58	(	(	PUNCT
dentistry3000-784	124	59	figure	figure	NOUN
dentistry3000-784	124	60	2	2	NUM
dentistry3000-784	124	61	)	)	PUNCT
dentistry3000-784	124	62	.	.	PUNCT
dentistry3000-784	125	1	figure	figure	NOUN
dentistry3000-784	125	2	2	2	NUM
dentistry3000-784	125	3	.	.	PUNCT
dentistry3000-784	126	1	narigenin	narigenin	PROPN
dentistry3000-784	126	2	,	,	PUNCT
dentistry3000-784	126	3	catechin	catechin	NOUN
dentistry3000-784	126	4	,	,	PUNCT
dentistry3000-784	126	5	coumarin	coumarin	NOUN
dentistry3000-784	126	6	,	,	PUNCT
dentistry3000-784	126	7	and	and	CCONJ
dentistry3000-784	126	8	kaempferol	kaempferol	NOUN
dentistry3000-784	126	9	were	be	AUX
dentistry3000-784	126	10	found	find	VERB
dentistry3000-784	126	11	in	in	ADP
dentistry3000-784	126	12	the	the	DET
dentistry3000-784	126	13	study	study	NOUN
dentistry3000-784	126	14	extract	extract	NOUN
dentistry3000-784	126	15	using	use	VERB
dentistry3000-784	126	16	hplc	hplc	NOUN
dentistry3000-784	126	17	.	.	PUNCT
dentistry3000-784	127	1	rt	rt	NOUN
dentistry3000-784	127	2	:	:	PUNCT
dentistry3000-784	127	3	retention	retention	NOUN
dentistry3000-784	127	4	time	time	NOUN
dentistry3000-784	127	5	.	.	PUNCT
dentistry3000-784	128	1	discussion	discussion	NOUN
dentistry3000-784	128	2	more	more	ADJ
dentistry3000-784	128	3	and	and	CCONJ
dentistry3000-784	128	4	more	more	ADJ
dentistry3000-784	128	5	studies	study	NOUN
dentistry3000-784	128	6	are	be	AUX
dentistry3000-784	128	7	being	be	AUX
dentistry3000-784	128	8	conducted	conduct	VERB
dentistry3000-784	128	9	on	on	ADP
dentistry3000-784	128	10	plant	plant	NOUN
dentistry3000-784	128	11	extracts	extract	NOUN
dentistry3000-784	128	12	and	and	CCONJ
dentistry3000-784	128	13	the	the	DET
dentistry3000-784	128	14	active	active	ADJ
dentistry3000-784	128	15	ingredients	ingredient	NOUN
dentistry3000-784	128	16	in	in	ADP
dentistry3000-784	128	17	them	they	PRON
dentistry3000-784	128	18	from	from	ADP
dentistry3000-784	128	19	various	various	ADJ
dentistry3000-784	128	20	parts	part	NOUN
dentistry3000-784	128	21	of	of	ADP
dentistry3000-784	128	22	the	the	DET
dentistry3000-784	128	23	world	world	NOUN
dentistry3000-784	128	24	for	for	ADP
dentistry3000-784	128	25	their	their	PRON
dentistry3000-784	128	26	antibacterial	antibacterial	ADJ
dentistry3000-784	128	27	activity	activity	NOUN
dentistry3000-784	128	28	[	[	X
dentistry3000-784	128	29	25	25	NUM
dentistry3000-784	128	30	]	]	PUNCT
dentistry3000-784	128	31	.	.	PUNCT
dentistry3000-784	129	1	bacteria	bacteria	NOUN
dentistry3000-784	129	2	phytochemical	phytochemical	ADJ
dentistry3000-784	129	3	analysis	analysis	NOUN
dentistry3000-784	129	4	and	and	CCONJ
dentistry3000-784	129	5	an1bacterial	an1bacterial	ADJ
dentistry3000-784	129	6	ac1vity	ac1vity	NOUN
dentistry3000-784	129	7	of	of	ADP
dentistry3000-784	129	8	stevia	stevia	NOUN
dentistry3000-784	129	9	rebaudiana	rebaudiana	PROPN
dentistry3000-784	129	10	bertoni	bertoni	PROPN
dentistry3000-784	129	11	leaves	leave	NOUN
dentistry3000-784	129	12	extract	extract	VERB
dentistry3000-784	129	13	against	against	ADP
dentistry3000-784	129	14	streptococcus	streptococcus	NOUN
dentistry3000-784	129	15	sanguis	sanguis	NOUN
dentistry3000-784	129	16	(	(	PUNCT
dentistry3000-784	129	17	a	a	DET
dentistry3000-784	129	18	primary	primary	ADJ
dentistry3000-784	129	19	inhabitant	inhabitant	NOUN
dentistry3000-784	129	20	of	of	ADP
dentistry3000-784	129	21	dental	dental	ADJ
dentistry3000-784	129	22	plaque	plaque	NOUN
dentistry3000-784	129	23	):	):	PUNCT
dentistry3000-784	129	24	in	in	ADP
dentistry3000-784	129	25	vitro	vitro	X
dentistry3000-784	129	26	study	study	NOUN
dentistry3000-784	129	27	vol	vol	NOUN
dentistry3000-784	129	28	13	13	NUM
dentistry3000-784	129	29	no	no	DET
dentistry3000-784	129	30	1	1	NUM
dentistry3000-784	129	31	(	(	PUNCT
dentistry3000-784	129	32	2025	2025	NUM
dentistry3000-784	129	33	)	)	PUNCT
dentistry3000-784	129	34	doi	doi	NOUN
dentistry3000-784	129	35	10.5195	10.5195	NUM
dentistry3000-784	129	36	/	/	SYM
dentistry3000-784	129	37	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	129	38	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	NOUN
dentistry3000-784	129	39	can	can	AUX
dentistry3000-784	129	40	not	not	PART
dentistry3000-784	129	41	develop	develop	VERB
dentistry3000-784	129	42	resistance	resistance	NOUN
dentistry3000-784	129	43	to	to	PART
dentistry3000-784	129	44	plant	plant	VERB
dentistry3000-784	129	45	extracts	extract	NOUN
dentistry3000-784	129	46	because	because	SCONJ
dentistry3000-784	129	47	they	they	PRON
dentistry3000-784	129	48	are	be	AUX
dentistry3000-784	129	49	chemicaly	chemicaly	VERB
dentistry3000-784	129	50	complicated	complicated	ADJ
dentistry3000-784	129	51	in	in	ADP
dentistry3000-784	129	52	structure	structure	NOUN
dentistry3000-784	129	53	,	,	PUNCT
dentistry3000-784	129	54	and	and	CCONJ
dentistry3000-784	129	55	any	any	PRON
dentistry3000-784	129	56	of	of	ADP
dentistry3000-784	129	57	its	its	PRON
dentistry3000-784	129	58	constituents	constituent	NOUN
dentistry3000-784	129	59	may	may	AUX
dentistry3000-784	129	60	have	have	VERB
dentistry3000-784	129	61	an	an	DET
dentistry3000-784	129	62	antimicrobial	antimicrobial	ADJ
dentistry3000-784	129	63	role	role	NOUN
dentistry3000-784	130	1	[	[	X
dentistry3000-784	130	2	26	26	NUM
dentistry3000-784	130	3	]	]	PUNCT
dentistry3000-784	130	4	.	.	PUNCT
dentistry3000-784	131	1	according	accord	VERB
dentistry3000-784	131	2	to	to	ADP
dentistry3000-784	131	3	studies	study	NOUN
dentistry3000-784	131	4	,	,	PUNCT
dentistry3000-784	131	5	stevia	stevia	VERB
dentistry3000-784	131	6	rebaudiana	rebaudiana	PROPN
dentistry3000-784	131	7	(	(	PUNCT
dentistry3000-784	131	8	bertoni	bertoni	PROPN
dentistry3000-784	131	9	)	)	PUNCT
dentistry3000-784	131	10	is	be	AUX
dentistry3000-784	131	11	a	a	DET
dentistry3000-784	131	12	possible	possible	ADJ
dentistry3000-784	131	13	drug	drug	NOUN
dentistry3000-784	131	14	candidate	candidate	NOUN
dentistry3000-784	131	15	with	with	ADP
dentistry3000-784	131	16	numerous	numerous	ADJ
dentistry3000-784	131	17	nutritional	nutritional	ADJ
dentistry3000-784	131	18	and	and	CCONJ
dentistry3000-784	131	19	medicinal	medicinal	ADJ
dentistry3000-784	131	20	properties	property	NOUN
dentistry3000-784	131	21	.	.	PUNCT
dentistry3000-784	132	1	it	it	PRON
dentistry3000-784	132	2	has	have	AUX
dentistry3000-784	132	3	been	be	AUX
dentistry3000-784	132	4	found	find	VERB
dentistry3000-784	132	5	to	to	PART
dentistry3000-784	132	6	have	have	VERB
dentistry3000-784	132	7	anti	anti	ADJ
dentistry3000-784	132	8	-	-	ADJ
dentistry3000-784	132	9	inflammatory	inflammatory	ADJ
dentistry3000-784	132	10	,	,	PUNCT
dentistry3000-784	132	11	antigingivitis	antigingivitis	ADJ
dentistry3000-784	132	12	,	,	PUNCT
dentistry3000-784	132	13	anti	anti	ADJ
dentistry3000-784	132	14	-	-	ADJ
dentistry3000-784	132	15	plaque	plaque	ADJ
dentistry3000-784	132	16	,	,	PUNCT
dentistry3000-784	132	17	anticariogenic	anticariogenic	ADJ
dentistry3000-784	132	18	and	and	CCONJ
dentistry3000-784	132	19	health	health	NOUN
dentistry3000-784	132	20	-	-	PUNCT
dentistry3000-784	132	21	promoting	promote	VERB
dentistry3000-784	132	22	characteristics	characteristic	NOUN
dentistry3000-784	132	23	[	[	X
dentistry3000-784	132	24	27	27	NUM
dentistry3000-784	132	25	,	,	PUNCT
dentistry3000-784	132	26	28	28	NUM
dentistry3000-784	132	27	]	]	PUNCT
dentistry3000-784	132	28	.	.	PUNCT
dentistry3000-784	133	1	the	the	DET
dentistry3000-784	133	2	current	current	ADJ
dentistry3000-784	133	3	study	study	NOUN
dentistry3000-784	133	4	has	have	AUX
dentistry3000-784	133	5	been	be	AUX
dentistry3000-784	133	6	conducted	conduct	VERB
dentistry3000-784	133	7	and	and	CCONJ
dentistry3000-784	133	8	may	may	AUX
dentistry3000-784	133	9	be	be	AUX
dentistry3000-784	133	10	regarded	regard	VERB
dentistry3000-784	133	11	the	the	DET
dentistry3000-784	133	12	first	first	ADJ
dentistry3000-784	133	13	report	report	NOUN
dentistry3000-784	133	14	because	because	SCONJ
dentistry3000-784	133	15	of	of	ADP
dentistry3000-784	133	16	the	the	DET
dentistry3000-784	133	17	previously	previously	ADV
dentistry3000-784	133	18	stated	state	VERB
dentistry3000-784	133	19	characteristics	characteristic	NOUN
dentistry3000-784	133	20	and	and	CCONJ
dentistry3000-784	133	21	because	because	SCONJ
dentistry3000-784	133	22	stevia	stevia	NOUN
dentistry3000-784	133	23	has	have	VERB
dentistry3000-784	133	24	no	no	DET
dentistry3000-784	133	25	proven	prove	VERB
dentistry3000-784	133	26	antibacterial	antibacterial	ADJ
dentistry3000-784	133	27	activity	activity	NOUN
dentistry3000-784	133	28	on	on	ADP
dentistry3000-784	133	29	s.	s.	PROPN
dentistry3000-784	133	30	sanguis	sanguis	PROPN
dentistry3000-784	133	31	.	.	PUNCT
dentistry3000-784	134	1	the	the	DET
dentistry3000-784	134	2	antibacterial	antibacterial	ADJ
dentistry3000-784	134	3	effect	effect	NOUN
dentistry3000-784	134	4	of	of	ADP
dentistry3000-784	134	5	the	the	DET
dentistry3000-784	134	6	study	study	NOUN
dentistry3000-784	134	7	extract	extract	NOUN
dentistry3000-784	134	8	against	against	ADP
dentistry3000-784	134	9	s.	s.	PROPN
dentistry3000-784	134	10	sanguis	sanguis	PROPN
dentistry3000-784	134	11	was	be	AUX
dentistry3000-784	134	12	found	find	VERB
dentistry3000-784	134	13	to	to	PART
dentistry3000-784	134	14	be	be	AUX
dentistry3000-784	134	15	concentration	concentration	NOUN
dentistry3000-784	134	16	dependent	dependent	ADJ
dentistry3000-784	134	17	,	,	PUNCT
dentistry3000-784	134	18	as	as	SCONJ
dentistry3000-784	134	19	the	the	DET
dentistry3000-784	134	20	concentration	concentration	NOUN
dentistry3000-784	134	21	of	of	ADP
dentistry3000-784	134	22	the	the	DET
dentistry3000-784	134	23	extract	extract	NOUN
dentistry3000-784	134	24	rose	rise	VERB
dentistry3000-784	134	25	,	,	PUNCT
dentistry3000-784	134	26	the	the	DET
dentistry3000-784	134	27	inhibition	inhibition	NOUN
dentistry3000-784	134	28	zone	zone	NOUN
dentistry3000-784	134	29	widened	widen	VERB
dentistry3000-784	134	30	,	,	PUNCT
dentistry3000-784	134	31	suggesting	suggest	VERB
dentistry3000-784	134	32	that	that	SCONJ
dentistry3000-784	134	33	the	the	DET
dentistry3000-784	134	34	quantity	quantity	NOUN
dentistry3000-784	134	35	of	of	ADP
dentistry3000-784	134	36	soluble	soluble	ADJ
dentistry3000-784	134	37	active	active	ADJ
dentistry3000-784	134	38	chemicals	chemical	NOUN
dentistry3000-784	134	39	in	in	ADP
dentistry3000-784	134	40	the	the	DET
dentistry3000-784	134	41	extract	extract	NOUN
dentistry3000-784	134	42	was	be	AUX
dentistry3000-784	134	43	also	also	ADV
dentistry3000-784	134	44	rising	rise	VERB
dentistry3000-784	134	45	.	.	PUNCT
dentistry3000-784	135	1	after	after	ADP
dentistry3000-784	135	2	comparing	compare	VERB
dentistry3000-784	135	3	the	the	DET
dentistry3000-784	135	4	advantages	advantage	NOUN
dentistry3000-784	135	5	of	of	ADP
dentistry3000-784	135	6	stevia	stevia	NOUN
dentistry3000-784	135	7	with	with	ADP
dentistry3000-784	135	8	the	the	DET
dentistry3000-784	135	9	disadvantages	disadvantage	NOUN
dentistry3000-784	135	10	of	of	ADP
dentistry3000-784	135	11	chx	chx	PROPN
dentistry3000-784	135	12	,	,	PUNCT
dentistry3000-784	135	13	the	the	DET
dentistry3000-784	135	14	research	research	NOUN
dentistry3000-784	135	15	extract	extract	NOUN
dentistry3000-784	135	16	showed	show	VERB
dentistry3000-784	135	17	impressive	impressive	ADJ
dentistry3000-784	135	18	results	result	NOUN
dentistry3000-784	135	19	,	,	PUNCT
dentistry3000-784	135	20	with	with	ADP
dentistry3000-784	135	21	an	an	DET
dentistry3000-784	135	22	average	average	ADJ
dentistry3000-784	135	23	inhibitory	inhibitory	ADJ
dentistry3000-784	135	24	zone	zone	NOUN
dentistry3000-784	135	25	width	width	NOUN
dentistry3000-784	135	26	of	of	ADP
dentistry3000-784	135	27	26.3	26.3	NUM
dentistry3000-784	135	28	mm	mm	NOUN
dentistry3000-784	135	29	against	against	ADP
dentistry3000-784	135	30	s.	s.	PROPN
dentistry3000-784	135	31	sanguis	sanguis	PROPN
dentistry3000-784	135	32	at	at	ADP
dentistry3000-784	135	33	512	512	NUM
dentistry3000-784	135	34	mg	mg	NUM
dentistry3000-784	135	35	/	/	SYM
dentistry3000-784	135	36	ml	ml	NOUN
dentistry3000-784	135	37	,	,	PUNCT
dentistry3000-784	135	38	which	which	PRON
dentistry3000-784	135	39	is	be	AUX
dentistry3000-784	135	40	comparable	comparable	ADJ
dentistry3000-784	135	41	to	to	ADP
dentistry3000-784	135	42	the	the	DET
dentistry3000-784	135	43	28	28	NUM
dentistry3000-784	135	44	mm	mm	NOUN
dentistry3000-784	135	45	seen	see	VERB
dentistry3000-784	135	46	at	at	ADP
dentistry3000-784	135	47	0.2	0.2	NUM
dentistry3000-784	135	48	%	%	NOUN
dentistry3000-784	135	49	chx	chx	NOUN
dentistry3000-784	135	50	,	,	PUNCT
dentistry3000-784	135	51	we	we	PRON
dentistry3000-784	135	52	might	might	AUX
dentistry3000-784	135	53	come	come	VERB
dentistry3000-784	135	54	up	up	ADP
dentistry3000-784	135	55	with	with	ADP
dentistry3000-784	135	56	a	a	DET
dentistry3000-784	135	57	satisfactory	satisfactory	ADJ
dentistry3000-784	135	58	result	result	NOUN
dentistry3000-784	135	59	.	.	PUNCT
dentistry3000-784	136	1	the	the	DET
dentistry3000-784	136	2	extract	extract	NOUN
dentistry3000-784	136	3	's	's	PART
dentistry3000-784	136	4	mic	mic	ADJ
dentistry3000-784	136	5	and	and	CCONJ
dentistry3000-784	136	6	mbc	mbc	PROPN
dentistry3000-784	136	7	were	be	AUX
dentistry3000-784	136	8	both	both	PRON
dentistry3000-784	136	9	found	find	VERB
dentistry3000-784	136	10	to	to	PART
dentistry3000-784	136	11	be	be	AUX
dentistry3000-784	136	12	16	16	NUM
dentistry3000-784	136	13	mg	mg	NUM
dentistry3000-784	136	14	/	/	SYM
dentistry3000-784	136	15	ml	ml	NOUN
dentistry3000-784	136	16	,	,	PUNCT
dentistry3000-784	136	17	showing	show	VERB
dentistry3000-784	136	18	that	that	SCONJ
dentistry3000-784	136	19	it	it	PRON
dentistry3000-784	136	20	exhibits	exhibit	VERB
dentistry3000-784	136	21	bactericidal	bactericidal	ADJ
dentistry3000-784	136	22	activity	activity	NOUN
dentistry3000-784	136	23	.	.	PUNCT
dentistry3000-784	137	1	levison	levison	NOUN
dentistry3000-784	137	2	,	,	PUNCT
dentistry3000-784	137	3	(	(	PUNCT
dentistry3000-784	137	4	2004	2004	NUM
dentistry3000-784	137	5	)	)	PUNCT
dentistry3000-784	137	6	,	,	PUNCT
dentistry3000-784	137	7	as	as	SCONJ
dentistry3000-784	137	8	cited	cite	VERB
dentistry3000-784	137	9	by	by	ADP
dentistry3000-784	137	10	mogana	mogana	PROPN
dentistry3000-784	137	11	et	et	PROPN
dentistry3000-784	137	12	al	al	PROPN
dentistry3000-784	137	13	.	.	PROPN
dentistry3000-784	137	14	,	,	PUNCT
dentistry3000-784	137	15	(	(	PUNCT
dentistry3000-784	137	16	2020	2020	NUM
dentistry3000-784	137	17	)	)	PUNCT
dentistry3000-784	137	18	(	(	PUNCT
dentistry3000-784	137	19	29	29	NUM
dentistry3000-784	137	20	)	)	PUNCT
dentistry3000-784	137	21	,	,	PUNCT
dentistry3000-784	137	22	said	say	VERB
dentistry3000-784	137	23	that	that	SCONJ
dentistry3000-784	137	24	if	if	SCONJ
dentistry3000-784	137	25	the	the	DET
dentistry3000-784	137	26	mbc	mbc	PROPN
dentistry3000-784	137	27	/	/	SYM
dentistry3000-784	137	28	mic	mic	ADJ
dentistry3000-784	137	29	ratio	ratio	NOUN
dentistry3000-784	137	30	is	be	AUX
dentistry3000-784	137	31	less	less	ADJ
dentistry3000-784	137	32	than	than	ADP
dentistry3000-784	137	33	4	4	NUM
dentistry3000-784	137	34	,	,	PUNCT
dentistry3000-784	137	35	the	the	DET
dentistry3000-784	137	36	agent	agent	NOUN
dentistry3000-784	137	37	is	be	AUX
dentistry3000-784	137	38	bactericidal	bactericidal	ADJ
dentistry3000-784	137	39	.	.	PUNCT
dentistry3000-784	138	1	the	the	DET
dentistry3000-784	138	2	similar	similar	ADJ
dentistry3000-784	138	3	outcome	outcome	NOUN
dentistry3000-784	138	4	was	be	AUX
dentistry3000-784	138	5	reached	reach	VERB
dentistry3000-784	138	6	by	by	ADP
dentistry3000-784	138	7	parvekar	parvekar	PROPN
dentistry3000-784	138	8	et	et	PROPN
dentistry3000-784	138	9	al	al	PROPN
dentistry3000-784	138	10	.	.	PROPN
dentistry3000-784	138	11	,	,	PUNCT
dentistry3000-784	138	12	2020	2020	NUM
dentistry3000-784	139	1	[	[	X
dentistry3000-784	139	2	30	30	NUM
dentistry3000-784	139	3	]	]	PUNCT
dentistry3000-784	139	4	,	,	PUNCT
dentistry3000-784	139	5	who	who	PRON
dentistry3000-784	139	6	investigated	investigate	VERB
dentistry3000-784	139	7	the	the	DET
dentistry3000-784	139	8	mic	mic	ADJ
dentistry3000-784	139	9	/	/	SYM
dentistry3000-784	139	10	mbc	mbc	PROPN
dentistry3000-784	139	11	for	for	ADP
dentistry3000-784	139	12	silver	silver	ADJ
dentistry3000-784	139	13	nanoparticles	nanoparticle	NOUN
dentistry3000-784	139	14	on	on	ADP
dentistry3000-784	139	15	staph	staph	NOUN
dentistry3000-784	139	16	.	.	PUNCT
dentistry3000-784	140	1	aureus	aureus	PROPN
dentistry3000-784	140	2	.	.	PUNCT
dentistry3000-784	141	1	the	the	DET
dentistry3000-784	141	2	exact	exact	ADJ
dentistry3000-784	141	3	mechanism	mechanism	NOUN
dentistry3000-784	141	4	of	of	ADP
dentistry3000-784	141	5	stevia	stevia	NOUN
dentistry3000-784	141	6	's	's	PART
dentistry3000-784	141	7	antibacterial	antibacterial	ADJ
dentistry3000-784	141	8	action	action	NOUN
dentistry3000-784	141	9	is	be	AUX
dentistry3000-784	141	10	unknown	unknown	ADJ
dentistry3000-784	141	11	,	,	PUNCT
dentistry3000-784	141	12	although	although	SCONJ
dentistry3000-784	141	13	it	it	PRON
dentistry3000-784	141	14	could	could	AUX
dentistry3000-784	141	15	be	be	AUX
dentistry3000-784	141	16	linked	link	VERB
dentistry3000-784	141	17	to	to	ADP
dentistry3000-784	141	18	the	the	DET
dentistry3000-784	141	19	existence	existence	NOUN
dentistry3000-784	141	20	of	of	ADP
dentistry3000-784	141	21	antimicrobial	antimicrobial	ADJ
dentistry3000-784	141	22	compounds	compound	NOUN
dentistry3000-784	141	23	such	such	ADJ
dentistry3000-784	141	24	as	as	ADP
dentistry3000-784	141	25	:	:	PUNCT
dentistry3000-784	141	26	dihydrodeoxy	dihydrodeoxy	NOUN
dentistry3000-784	141	27	-	-	PUNCT
dentistry3000-784	141	28	streptomycin	streptomycin	PROPN
dentistry3000-784	141	29	,	,	PUNCT
dentistry3000-784	141	30	diterpene	diterpene	NOUN
dentistry3000-784	141	31	glycosides	glycoside	NOUN
dentistry3000-784	141	32	,	,	PUNCT
dentistry3000-784	141	33	tannins	tannin	NOUN
dentistry3000-784	141	34	,	,	PUNCT
dentistry3000-784	141	35	flavonoids	flavonoid	NOUN
dentistry3000-784	141	36	,	,	PUNCT
dentistry3000-784	141	37	polyphenols	polyphenol	NOUN
dentistry3000-784	141	38	and	and	CCONJ
dentistry3000-784	141	39	saponins	saponin	NOUN
dentistry3000-784	141	40	[	[	PUNCT
dentistry3000-784	141	41	31	31	NUM
dentistry3000-784	141	42	-	-	SYM
dentistry3000-784	141	43	35	35	NUM
dentistry3000-784	141	44	]	]	PUNCT
dentistry3000-784	141	45	;	;	PUNCT
dentistry3000-784	141	46	and	and	CCONJ
dentistry3000-784	141	47	the	the	DET
dentistry3000-784	141	48	extract	extract	NOUN
dentistry3000-784	141	49	's	's	PART
dentistry3000-784	141	50	phytochemical	phytochemical	ADJ
dentistry3000-784	141	51	components	component	NOUN
dentistry3000-784	141	52	'	'	PART
dentistry3000-784	141	53	synergism	synergism	NOUN
dentistry3000-784	141	54	.	.	PUNCT
dentistry3000-784	142	1	due	due	ADP
dentistry3000-784	142	2	to	to	ADP
dentistry3000-784	142	3	the	the	DET
dentistry3000-784	142	4	interaction	interaction	NOUN
dentistry3000-784	142	5	of	of	ADP
dentistry3000-784	142	6	multiple	multiple	ADJ
dentistry3000-784	142	7	distinct	distinct	ADJ
dentistry3000-784	142	8	chemicals	chemical	NOUN
dentistry3000-784	142	9	in	in	ADP
dentistry3000-784	142	10	plant	plant	NOUN
dentistry3000-784	142	11	extracts	extract	NOUN
dentistry3000-784	142	12	,	,	PUNCT
dentistry3000-784	142	13	developing	develop	VERB
dentistry3000-784	142	14	microbial	microbial	ADJ
dentistry3000-784	142	15	resistance	resistance	NOUN
dentistry3000-784	142	16	through	through	ADP
dentistry3000-784	142	17	genetic	genetic	ADJ
dentistry3000-784	142	18	alterations	alteration	NOUN
dentistry3000-784	142	19	driven	drive	VERB
dentistry3000-784	142	20	by	by	ADP
dentistry3000-784	142	21	external	external	ADJ
dentistry3000-784	142	22	stimuli	stimulus	NOUN
dentistry3000-784	142	23	is	be	AUX
dentistry3000-784	142	24	more	more	ADV
dentistry3000-784	142	25	challenging	challenging	ADJ
dentistry3000-784	142	26	[	[	X
dentistry3000-784	142	27	36	36	NUM
dentistry3000-784	142	28	]	]	PUNCT
dentistry3000-784	142	29	.	.	PUNCT
dentistry3000-784	143	1	many	many	ADJ
dentistry3000-784	143	2	active	active	ADJ
dentistry3000-784	143	3	compounds	compound	NOUN
dentistry3000-784	143	4	were	be	AUX
dentistry3000-784	143	5	found	find	VERB
dentistry3000-784	143	6	in	in	ADP
dentistry3000-784	143	7	alcoholic	alcoholic	ADJ
dentistry3000-784	143	8	stevia	stevia	NOUN
dentistry3000-784	143	9	extract	extract	NOUN
dentistry3000-784	143	10	by	by	ADP
dentistry3000-784	143	11	hplc	hplc	NOUN
dentistry3000-784	143	12	analysis	analysis	NOUN
dentistry3000-784	143	13	,	,	PUNCT
dentistry3000-784	143	14	including	include	VERB
dentistry3000-784	143	15	narigenin	narigenin	NOUN
dentistry3000-784	143	16	,	,	PUNCT
dentistry3000-784	143	17	catechin	catechin	NOUN
dentistry3000-784	143	18	,	,	PUNCT
dentistry3000-784	143	19	coumarin	coumarin	NOUN
dentistry3000-784	143	20	,	,	PUNCT
dentistry3000-784	143	21	and	and	CCONJ
dentistry3000-784	143	22	kaempferol	kaempferol	NOUN
dentistry3000-784	143	23	.	.	PUNCT
dentistry3000-784	144	1	narigenin	narigenin	PROPN
dentistry3000-784	144	2	is	be	AUX
dentistry3000-784	144	3	a	a	DET
dentistry3000-784	144	4	bioactive	bioactive	ADJ
dentistry3000-784	144	5	flavonoid	flavonoid	NOUN
dentistry3000-784	144	6	with	with	ADP
dentistry3000-784	144	7	good	good	ADJ
dentistry3000-784	144	8	antibacterial	antibacterial	ADJ
dentistry3000-784	144	9	properties	property	NOUN
dentistry3000-784	144	10	,	,	PUNCT
dentistry3000-784	144	11	its	its	PRON
dentistry3000-784	144	12	concentration	concentration	NOUN
dentistry3000-784	144	13	in	in	ADP
dentistry3000-784	144	14	the	the	DET
dentistry3000-784	144	15	study	study	NOUN
dentistry3000-784	144	16	extract	extract	NOUN
dentistry3000-784	144	17	was	be	AUX
dentistry3000-784	144	18	(	(	PUNCT
dentistry3000-784	144	19	25.76	25.76	NUM
dentistry3000-784	144	20	ppm	ppm	NOUN
dentistry3000-784	144	21	)	)	PUNCT
dentistry3000-784	144	22	.	.	PUNCT
dentistry3000-784	145	1	studies	study	NOUN
dentistry3000-784	145	2	have	have	AUX
dentistry3000-784	145	3	reported	report	VERB
dentistry3000-784	145	4	its	its	PRON
dentistry3000-784	145	5	inhibitory	inhibitory	ADJ
dentistry3000-784	145	6	action	action	NOUN
dentistry3000-784	145	7	against	against	ADP
dentistry3000-784	145	8	:	:	PUNCT
dentistry3000-784	145	9	escherichia	escherichia	NOUN
dentistry3000-784	145	10	coli	coli	NOUN
dentistry3000-784	145	11	,	,	PUNCT
dentistry3000-784	145	12	staphylococcus	staphylococcus	NOUN
dentistry3000-784	145	13	aureus	aureus	NOUN
dentistry3000-784	145	14	,	,	PUNCT
dentistry3000-784	145	15	lactobacillus	lactobacillus	X
dentistry3000-784	145	16	rhamnosus	rhamnosus	NOUN
dentistry3000-784	145	17	and	and	CCONJ
dentistry3000-784	145	18	salmonella	salmonella	NOUN
dentistry3000-784	145	19	typhimurium	typhimurium	NOUN
dentistry3000-784	146	1	[	[	X
dentistry3000-784	146	2	37	37	NUM
dentistry3000-784	146	3	,	,	PUNCT
dentistry3000-784	146	4	38	38	NUM
dentistry3000-784	146	5	]	]	PUNCT
dentistry3000-784	146	6	.	.	PUNCT
dentistry3000-784	147	1	after	after	ADP
dentistry3000-784	147	2	being	be	AUX
dentistry3000-784	147	3	exposed	expose	VERB
dentistry3000-784	147	4	to	to	ADP
dentistry3000-784	147	5	narigenin	narigenin	NOUN
dentistry3000-784	147	6	,	,	PUNCT
dentistry3000-784	147	7	by	by	ADP
dentistry3000-784	147	8	altering	alter	VERB
dentistry3000-784	147	9	the	the	DET
dentistry3000-784	147	10	ratio	ratio	NOUN
dentistry3000-784	147	11	of	of	ADP
dentistry3000-784	147	12	certain	certain	ADJ
dentistry3000-784	147	13	fatty	fatty	NOUN
dentistry3000-784	147	14	acids	acid	NOUN
dentistry3000-784	147	15	in	in	ADP
dentistry3000-784	147	16	their	their	PRON
dentistry3000-784	147	17	membranes	membrane	NOUN
dentistry3000-784	147	18	,	,	PUNCT
dentistry3000-784	147	19	e.	e.	PROPN
dentistry3000-784	147	20	coli	coli	PROPN
dentistry3000-784	147	21	and	and	CCONJ
dentistry3000-784	147	22	staphylococcus	staphylococcus	NOUN
dentistry3000-784	147	23	aureus	aureus	NOUN
dentistry3000-784	147	24	cells	cell	NOUN
dentistry3000-784	147	25	demonstrated	demonstrate	VERB
dentistry3000-784	147	26	an	an	DET
dentistry3000-784	147	27	increase	increase	NOUN
dentistry3000-784	147	28	in	in	ADP
dentistry3000-784	147	29	membrane	membrane	NOUN
dentistry3000-784	147	30	fluidity	fluidity	NOUN
dentistry3000-784	147	31	.	.	PUNCT
dentistry3000-784	148	1	narigenin	narigenin	PROPN
dentistry3000-784	148	2	also	also	ADV
dentistry3000-784	148	3	significantly	significantly	ADV
dentistry3000-784	148	4	down	down	ADV
dentistry3000-784	148	5	-	-	PUNCT
dentistry3000-784	148	6	regulated	regulate	VERB
dentistry3000-784	148	7	genes	gene	NOUN
dentistry3000-784	148	8	in	in	ADP
dentistry3000-784	148	9	bacteria	bacteria	NOUN
dentistry3000-784	148	10	involved	involve	VERB
dentistry3000-784	148	11	in	in	ADP
dentistry3000-784	148	12	fatty	fatty	NOUN
dentistry3000-784	148	13	acid	acid	NOUN
dentistry3000-784	148	14	production	production	NOUN
dentistry3000-784	148	15	at	at	ADP
dentistry3000-784	148	16	higher	high	ADJ
dentistry3000-784	148	17	doses	dose	NOUN
dentistry3000-784	148	18	[	[	X
dentistry3000-784	148	19	39	39	NUM
dentistry3000-784	148	20	]	]	PUNCT
dentistry3000-784	148	21	.	.	PUNCT
dentistry3000-784	149	1	catechin	catechin	PROPN
dentistry3000-784	149	2	is	be	AUX
dentistry3000-784	149	3	a	a	DET
dentistry3000-784	149	4	polyphenol	polyphenol	NOUN
dentistry3000-784	149	5	found	find	VERB
dentistry3000-784	149	6	in	in	ADP
dentistry3000-784	149	7	high	high	ADJ
dentistry3000-784	149	8	concentration	concentration	NOUN
dentistry3000-784	149	9	)	)	PUNCT
dentistry3000-784	149	10	30.25	30.25	NUM
dentistry3000-784	149	11	ppm	ppm	NOUN
dentistry3000-784	149	12	)	)	PUNCT
dentistry3000-784	149	13	in	in	ADP
dentistry3000-784	149	14	the	the	DET
dentistry3000-784	149	15	study	study	NOUN
dentistry3000-784	149	16	extract	extract	NOUN
dentistry3000-784	149	17	,	,	PUNCT
dentistry3000-784	149	18	it	it	PRON
dentistry3000-784	149	19	has	have	VERB
dentistry3000-784	149	20	antibacterial	antibacterial	ADJ
dentistry3000-784	149	21	activity	activity	NOUN
dentistry3000-784	149	22	[	[	X
dentistry3000-784	149	23	40	40	NUM
dentistry3000-784	149	24	]	]	PUNCT
dentistry3000-784	149	25	.	.	PUNCT
dentistry3000-784	150	1	the	the	DET
dentistry3000-784	150	2	mechanism	mechanism	NOUN
dentistry3000-784	150	3	of	of	ADP
dentistry3000-784	150	4	catechin	catechin	ADJ
dentistry3000-784	150	5	action	action	NOUN
dentistry3000-784	150	6	propose	propose	VERB
dentistry3000-784	150	7	that	that	SCONJ
dentistry3000-784	150	8	the	the	DET
dentistry3000-784	150	9	catechins	catechin	NOUN
dentistry3000-784	150	10	influence	influence	VERB
dentistry3000-784	150	11	the	the	DET
dentistry3000-784	150	12	microbial	microbial	ADJ
dentistry3000-784	150	13	membrane	membrane	NOUN
dentistry3000-784	150	14	,	,	PUNCT
dentistry3000-784	150	15	altering	alter	VERB
dentistry3000-784	150	16	its	its	PRON
dentistry3000-784	150	17	fluidity	fluidity	NOUN
dentistry3000-784	150	18	and	and	CCONJ
dentistry3000-784	150	19	lowering	lower	VERB
dentistry3000-784	150	20	thiourea	thiourea	NOUN
dentistry3000-784	150	21	and	and	CCONJ
dentistry3000-784	150	22	cycloleucine	cycloleucine	PROPN
dentistry3000-784	150	23	flux	flux	NOUN
dentistry3000-784	151	1	[	[	X
dentistry3000-784	151	2	41	41	NUM
dentistry3000-784	151	3	]	]	PUNCT
dentistry3000-784	151	4	.	.	PUNCT
dentistry3000-784	152	1	the	the	DET
dentistry3000-784	152	2	presence	presence	NOUN
dentistry3000-784	152	3	of	of	ADP
dentistry3000-784	152	4	the	the	DET
dentistry3000-784	152	5	negatively	negatively	ADV
dentistry3000-784	152	6	charged	charge	VERB
dentistry3000-784	152	7	lipopolysaccharide	lipopolysaccharide	NOUN
dentistry3000-784	152	8	may	may	AUX
dentistry3000-784	152	9	explain	explain	VERB
dentistry3000-784	152	10	why	why	SCONJ
dentistry3000-784	152	11	it	it	PRON
dentistry3000-784	152	12	is	be	AUX
dentistry3000-784	152	13	more	more	ADV
dentistry3000-784	152	14	effective	effective	ADJ
dentistry3000-784	152	15	against	against	ADP
dentistry3000-784	152	16	gram	gram	NOUN
dentistry3000-784	152	17	positive	positive	ADJ
dentistry3000-784	152	18	bacteria	bacteria	NOUN
dentistry3000-784	152	19	than	than	ADP
dentistry3000-784	152	20	gram	gram	NOUN
dentistry3000-784	152	21	negative	negative	ADJ
dentistry3000-784	152	22	bacteria	bacteria	NOUN
dentistry3000-784	152	23	,	,	PUNCT
dentistry3000-784	152	24	since	since	SCONJ
dentistry3000-784	152	25	it	it	PRON
dentistry3000-784	152	26	alters	alter	VERB
dentistry3000-784	152	27	the	the	DET
dentistry3000-784	152	28	structure	structure	NOUN
dentistry3000-784	152	29	of	of	ADP
dentistry3000-784	152	30	the	the	DET
dentistry3000-784	152	31	membrane	membrane	NOUN
dentistry3000-784	152	32	and	and	CCONJ
dentistry3000-784	152	33	damages	damage	VERB
dentistry3000-784	152	34	the	the	DET
dentistry3000-784	152	35	lipid	lipid	ADJ
dentistry3000-784	152	36	bilayer	bilayer	NOUN
dentistry3000-784	152	37	[	[	X
dentistry3000-784	152	38	42,43	42,43	NOUN
dentistry3000-784	152	39	]	]	PUNCT
dentistry3000-784	152	40	.	.	PUNCT
dentistry3000-784	153	1	coumarin	coumarin	NOUN
dentistry3000-784	153	2	concentration	concentration	NOUN
dentistry3000-784	153	3	in	in	ADP
dentistry3000-784	153	4	the	the	DET
dentistry3000-784	153	5	study	study	NOUN
dentistry3000-784	153	6	extract	extract	NOUN
dentistry3000-784	153	7	was	be	AUX
dentistry3000-784	153	8	(	(	PUNCT
dentistry3000-784	153	9	25.47ppm	25.47ppm	NUM
dentistry3000-784	153	10	)	)	PUNCT
dentistry3000-784	153	11	.	.	PUNCT
dentistry3000-784	154	1	coumarin	coumarin	NOUN
dentistry3000-784	154	2	is	be	AUX
dentistry3000-784	154	3	a	a	DET
dentistry3000-784	154	4	naturally	naturally	ADV
dentistry3000-784	154	5	occurring	occur	VERB
dentistry3000-784	154	6	benzopyrone	benzopyrone	NOUN
dentistry3000-784	154	7	which	which	PRON
dentistry3000-784	154	8	is	be	AUX
dentistry3000-784	154	9	a	a	DET
dentistry3000-784	154	10	potent	potent	ADJ
dentistry3000-784	154	11	inhibitor	inhibitor	NOUN
dentistry3000-784	154	12	of	of	ADP
dentistry3000-784	154	13	dnagyrase	dnagyrase	NOUN
dentistry3000-784	154	14	,	,	PUNCT
dentistry3000-784	154	15	its	its	PRON
dentistry3000-784	154	16	derivatives	derivative	NOUN
dentistry3000-784	154	17	exhibit	exhibit	VERB
dentistry3000-784	154	18	antibacterial	antibacterial	ADJ
dentistry3000-784	154	19	effect	effect	NOUN
dentistry3000-784	154	20	against	against	ADP
dentistry3000-784	154	21	both	both	PRON
dentistry3000-784	154	22	gram	gram	NOUN
dentistry3000-784	154	23	negative	negative	ADJ
dentistry3000-784	154	24	phytochemical	phytochemical	ADJ
dentistry3000-784	154	25	analysis	analysis	NOUN
dentistry3000-784	154	26	and	and	CCONJ
dentistry3000-784	154	27	an1bacterial	an1bacterial	ADJ
dentistry3000-784	154	28	ac1vity	ac1vity	NOUN
dentistry3000-784	154	29	of	of	ADP
dentistry3000-784	154	30	stevia	stevia	NOUN
dentistry3000-784	154	31	rebaudiana	rebaudiana	PROPN
dentistry3000-784	154	32	bertoni	bertoni	PROPN
dentistry3000-784	154	33	leaves	leave	NOUN
dentistry3000-784	154	34	extract	extract	VERB
dentistry3000-784	154	35	against	against	ADP
dentistry3000-784	154	36	streptococcus	streptococcus	NOUN
dentistry3000-784	154	37	sanguis	sanguis	NOUN
dentistry3000-784	154	38	(	(	PUNCT
dentistry3000-784	154	39	a	a	DET
dentistry3000-784	154	40	primary	primary	ADJ
dentistry3000-784	154	41	inhabitant	inhabitant	NOUN
dentistry3000-784	154	42	of	of	ADP
dentistry3000-784	154	43	dental	dental	ADJ
dentistry3000-784	154	44	plaque	plaque	NOUN
dentistry3000-784	154	45	):	):	PUNCT
dentistry3000-784	154	46	in	in	ADP
dentistry3000-784	154	47	vitro	vitro	X
dentistry3000-784	154	48	study	study	NOUN
dentistry3000-784	154	49	vol	vol	NOUN
dentistry3000-784	154	50	13	13	NUM
dentistry3000-784	154	51	no	no	DET
dentistry3000-784	154	52	1	1	NUM
dentistry3000-784	154	53	(	(	PUNCT
dentistry3000-784	154	54	2025	2025	NUM
dentistry3000-784	154	55	)	)	PUNCT
dentistry3000-784	154	56	doi	doi	NOUN
dentistry3000-784	154	57	10.5195	10.5195	NUM
dentistry3000-784	154	58	/	/	SYM
dentistry3000-784	154	59	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	154	60	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	154	61	and	and	CCONJ
dentistry3000-784	154	62	methicillin	methicillin	NOUN
dentistry3000-784	154	63	-	-	PUNCT
dentistry3000-784	154	64	resistant	resistant	ADJ
dentistry3000-784	154	65	staphylococcus	staphylococcus	NOUN
dentistry3000-784	154	66	aureus	aureus	NOUN
dentistry3000-784	154	67	(	(	PUNCT
dentistry3000-784	154	68	mrsa	mrsa	NOUN
dentistry3000-784	154	69	)	)	PUNCT
dentistry3000-784	154	70	,	,	PUNCT
dentistry3000-784	154	71	novobiocin	novobiocin	PROPN
dentistry3000-784	154	72	,	,	PUNCT
dentistry3000-784	154	73	vancomycin	vancomycin	PROPN
dentistry3000-784	154	74	,	,	PUNCT
dentistry3000-784	154	75	and	and	CCONJ
dentistry3000-784	154	76	teicoplanin	teicoplanin	ADJ
dentistry3000-784	154	77	-	-	PUNCT
dentistry3000-784	154	78	resistant	resistant	ADJ
dentistry3000-784	154	79	enterococci	enterococci	NOUN
dentistry3000-784	154	80	species	specie	NOUN
dentistry3000-784	154	81	are	be	AUX
dentistry3000-784	154	82	among	among	ADP
dentistry3000-784	154	83	the	the	DET
dentistry3000-784	154	84	grampositive	grampositive	ADJ
dentistry3000-784	154	85	bacteria	bacteria	NOUN
dentistry3000-784	154	86	that	that	PRON
dentistry3000-784	154	87	are	be	AUX
dentistry3000-784	154	88	most	most	ADV
dentistry3000-784	154	89	often	often	ADV
dentistry3000-784	154	90	seen	see	VERB
dentistry3000-784	154	91	[	[	X
dentistry3000-784	154	92	44,45	44,45	X
dentistry3000-784	154	93	]	]	X
dentistry3000-784	154	94	.	.	PUNCT
dentistry3000-784	155	1	the	the	DET
dentistry3000-784	155	2	concentration	concentration	NOUN
dentistry3000-784	155	3	of	of	ADP
dentistry3000-784	155	4	kaempferol	kaempferol	NOUN
dentistry3000-784	155	5	in	in	ADP
dentistry3000-784	155	6	the	the	DET
dentistry3000-784	155	7	study	study	NOUN
dentistry3000-784	155	8	extract	extract	NOUN
dentistry3000-784	155	9	was	be	AUX
dentistry3000-784	155	10	(	(	PUNCT
dentistry3000-784	155	11	4.59	4.59	NUM
dentistry3000-784	155	12	ppm	ppm	NOUN
dentistry3000-784	155	13	)	)	PUNCT
dentistry3000-784	155	14	.	.	PUNCT
dentistry3000-784	156	1	kaempferol	kaempferol	NOUN
dentistry3000-784	156	2	separated	separate	VERB
dentistry3000-784	156	3	from	from	ADP
dentistry3000-784	156	4	camellia	camellia	NOUN
dentistry3000-784	156	5	oleifera	oleifera	NOUN
dentistry3000-784	156	6	demonstrated	demonstrate	VERB
dentistry3000-784	156	7	broad	broad	ADJ
dentistry3000-784	156	8	antibacterial	antibacterial	ADJ
dentistry3000-784	156	9	activity	activity	NOUN
dentistry3000-784	156	10	against	against	ADP
dentistry3000-784	156	11	staphylococcus	staphylococcus	NOUN
dentistry3000-784	156	12	aureus	aureus	NOUN
dentistry3000-784	156	13	,	,	PUNCT
dentistry3000-784	156	14	e.	e.	PROPN
dentistry3000-784	156	15	coli	coli	PROPN
dentistry3000-784	156	16	,	,	PUNCT
dentistry3000-784	156	17	salmonella	salmonella	PROPN
dentistry3000-784	156	18	enteriditis	enteriditis	PROPN
dentistry3000-784	156	19	,	,	PUNCT
dentistry3000-784	156	20	aspergillus	aspergillus	NOUN
dentistry3000-784	156	21	niger	niger	NOUN
dentistry3000-784	156	22	,	,	PUNCT
dentistry3000-784	156	23	bacillus	bacillus	NOUN
dentistry3000-784	156	24	thuringiensis	thuringiensis	NOUN
dentistry3000-784	156	25	and	and	CCONJ
dentistry3000-784	156	26	rhizopus	rhizopus	PROPN
dentistry3000-784	156	27	nigricans	nigrican	NOUN
dentistry3000-784	157	1	[	[	X
dentistry3000-784	157	2	46	46	NUM
dentistry3000-784	157	3	]	]	PUNCT
dentistry3000-784	157	4	.	.	PUNCT
dentistry3000-784	158	1	conclusion	conclusion	NOUN
dentistry3000-784	158	2	the	the	DET
dentistry3000-784	158	3	results	result	NOUN
dentistry3000-784	158	4	of	of	ADP
dentistry3000-784	158	5	this	this	DET
dentistry3000-784	158	6	study	study	NOUN
dentistry3000-784	158	7	demonstrate	demonstrate	VERB
dentistry3000-784	158	8	that	that	SCONJ
dentistry3000-784	158	9	the	the	DET
dentistry3000-784	158	10	extract	extract	NOUN
dentistry3000-784	158	11	has	have	VERB
dentistry3000-784	158	12	an	an	DET
dentistry3000-784	158	13	antibacterial	antibacterial	ADJ
dentistry3000-784	158	14	effect	effect	NOUN
dentistry3000-784	158	15	and	and	CCONJ
dentistry3000-784	158	16	contains	contain	VERB
dentistry3000-784	158	17	abundant	abundant	ADJ
dentistry3000-784	158	18	antibacterial	antibacterial	ADJ
dentistry3000-784	158	19	components	component	NOUN
dentistry3000-784	158	20	;	;	PUNCT
dentistry3000-784	158	21	this	this	PRON
dentistry3000-784	158	22	might	might	AUX
dentistry3000-784	158	23	pave	pave	VERB
dentistry3000-784	158	24	the	the	DET
dentistry3000-784	158	25	way	way	NOUN
dentistry3000-784	158	26	for	for	ADP
dentistry3000-784	158	27	further	further	ADJ
dentistry3000-784	158	28	studies	study	NOUN
dentistry3000-784	158	29	into	into	ADP
dentistry3000-784	158	30	its	its	PRON
dentistry3000-784	158	31	potential	potential	ADJ
dentistry3000-784	158	32	usage	usage	NOUN
dentistry3000-784	158	33	in	in	ADP
dentistry3000-784	158	34	oral	oral	ADJ
dentistry3000-784	158	35	hygiene	hygiene	NOUN
dentistry3000-784	158	36	products	product	NOUN
dentistry3000-784	158	37	.	.	PUNCT
dentistry3000-784	159	1	additional	additional	ADJ
dentistry3000-784	159	2	studies	study	NOUN
dentistry3000-784	159	3	examining	examine	VERB
dentistry3000-784	159	4	its	its	PRON
dentistry3000-784	159	5	toxicity	toxicity	NOUN
dentistry3000-784	159	6	and	and	CCONJ
dentistry3000-784	159	7	antibacterial	antibacterial	ADJ
dentistry3000-784	159	8	effects	effect	NOUN
dentistry3000-784	159	9	on	on	ADP
dentistry3000-784	159	10	periodontal	periodontal	ADJ
dentistry3000-784	159	11	diseases	disease	NOUN
dentistry3000-784	159	12	are	be	AUX
dentistry3000-784	159	13	necessary	necessary	ADJ
dentistry3000-784	159	14	to	to	PART
dentistry3000-784	159	15	validate	validate	VERB
dentistry3000-784	159	16	its	its	PRON
dentistry3000-784	159	17	use	use	NOUN
dentistry3000-784	159	18	as	as	ADP
dentistry3000-784	159	19	a	a	DET
dentistry3000-784	159	20	preventive	preventive	ADJ
dentistry3000-784	159	21	intervention	intervention	NOUN
dentistry3000-784	159	22	for	for	ADP
dentistry3000-784	159	23	oral	oral	ADJ
dentistry3000-784	159	24	health	health	NOUN
dentistry3000-784	159	25	.	.	PUNCT
dentistry3000-784	160	1	references	reference	NOUN
dentistry3000-784	160	2	1abusleme	1abusleme	NUM
dentistry3000-784	160	3	,	,	PUNCT
dentistry3000-784	160	4	l.	l.	PROPN
dentistry3000-784	160	5	,	,	PUNCT
dentistry3000-784	160	6	dupuy	dupuy	PROPN
dentistry3000-784	160	7	,	,	PUNCT
dentistry3000-784	160	8	a.	a.	PROPN
dentistry3000-784	160	9	k.	k.	PROPN
dentistry3000-784	160	10	,	,	PUNCT
dentistry3000-784	160	11	dutzan	dutzan	PROPN
dentistry3000-784	160	12	,	,	PUNCT
dentistry3000-784	160	13	n.	n.	NOUN
dentistry3000-784	160	14	,	,	PUNCT
dentistry3000-784	160	15	silva	silva	PROPN
dentistry3000-784	160	16	,	,	PUNCT
dentistry3000-784	160	17	n.	n.	PROPN
dentistry3000-784	160	18	,	,	PUNCT
dentistry3000-784	160	19	burleson	burleson	PROPN
dentistry3000-784	160	20	,	,	PUNCT
dentistry3000-784	160	21	j.	j.	PROPN
dentistry3000-784	160	22	a.	a.	PROPN
dentistry3000-784	160	23	,	,	PUNCT
dentistry3000-784	160	24	strausbaugh	strausbaugh	PROPN
dentistry3000-784	160	25	,	,	PUNCT
dentistry3000-784	160	26	l.	l.	PROPN
dentistry3000-784	160	27	d.	d.	PROPN
dentistry3000-784	160	28	,	,	PUNCT
dentistry3000-784	160	29	gamonal	gamonal	PROPN
dentistry3000-784	160	30	,	,	PUNCT
dentistry3000-784	160	31	j.	j.	PROPN
dentistry3000-784	160	32	,	,	PUNCT
dentistry3000-784	160	33	&	&	CCONJ
dentistry3000-784	160	34	diaz	diaz	PROPN
dentistry3000-784	160	35	,	,	PUNCT
dentistry3000-784	160	36	p.	p.	PROPN
dentistry3000-784	160	37	i.	i.	PROPN
dentistry3000-784	160	38	(	(	PUNCT
dentistry3000-784	160	39	2013	2013	NUM
dentistry3000-784	160	40	)	)	PUNCT
dentistry3000-784	160	41	.	.	PUNCT
dentistry3000-784	161	1	the	the	DET
dentistry3000-784	161	2	subgingival	subgingival	PROPN
dentistry3000-784	161	3	microbiome	microbiome	NOUN
dentistry3000-784	161	4	in	in	ADP
dentistry3000-784	161	5	health	health	NOUN
dentistry3000-784	161	6	and	and	CCONJ
dentistry3000-784	161	7	periodontitis	periodontitis	NOUN
dentistry3000-784	161	8	and	and	CCONJ
dentistry3000-784	161	9	its	its	PRON
dentistry3000-784	161	10	relationship	relationship	NOUN
dentistry3000-784	161	11	with	with	ADP
dentistry3000-784	161	12	community	community	NOUN
dentistry3000-784	161	13	biomass	biomass	NOUN
dentistry3000-784	161	14	and	and	CCONJ
dentistry3000-784	161	15	inflammation	inflammation	NOUN
dentistry3000-784	161	16	.	.	PUNCT
dentistry3000-784	162	1	the	the	DET
dentistry3000-784	162	2	isme	isme	PROPN
dentistry3000-784	162	3	journal	journal	PROPN
dentistry3000-784	162	4	,	,	PUNCT
dentistry3000-784	162	5	7(5	7(5	NUM
dentistry3000-784	162	6	)	)	PUNCT
dentistry3000-784	162	7	,	,	PUNCT
dentistry3000-784	162	8	1016–1025	1016–1025	NUM
dentistry3000-784	162	9	.	.	PUNCT
dentistry3000-784	162	10	2griffen	2griffen	NUM
dentistry3000-784	162	11	,	,	PUNCT
dentistry3000-784	162	12	a.	a.	PROPN
dentistry3000-784	162	13	l.	l.	PROPN
dentistry3000-784	162	14	,	,	PUNCT
dentistry3000-784	162	15	beall	beall	PROPN
dentistry3000-784	162	16	,	,	PUNCT
dentistry3000-784	162	17	c.	c.	PROPN
dentistry3000-784	162	18	j.	j.	PROPN
dentistry3000-784	162	19	,	,	PUNCT
dentistry3000-784	162	20	campbell	campbell	PROPN
dentistry3000-784	162	21	,	,	PUNCT
dentistry3000-784	162	22	j.	j.	PROPN
dentistry3000-784	162	23	h.	h.	PROPN
dentistry3000-784	162	24	,	,	PUNCT
dentistry3000-784	162	25	firestone	firestone	PROPN
dentistry3000-784	162	26	,	,	PUNCT
dentistry3000-784	162	27	n.	n.	PROPN
dentistry3000-784	162	28	d.	d.	PROPN
dentistry3000-784	162	29	,	,	PUNCT
dentistry3000-784	162	30	kumar	kumar	PROPN
dentistry3000-784	162	31	,	,	PUNCT
dentistry3000-784	162	32	p.	p.	PROPN
dentistry3000-784	162	33	s.	s.	PROPN
dentistry3000-784	162	34	,	,	PUNCT
dentistry3000-784	162	35	yang	yang	PROPN
dentistry3000-784	162	36	,	,	PUNCT
dentistry3000-784	162	37	z.	z.	PROPN
dentistry3000-784	162	38	k.	k.	PROPN
dentistry3000-784	162	39	,	,	PUNCT
dentistry3000-784	162	40	podar	podar	NOUN
dentistry3000-784	162	41	,	,	PUNCT
dentistry3000-784	162	42	m.	m.	NOUN
dentistry3000-784	162	43	,	,	PUNCT
dentistry3000-784	162	44	&	&	CCONJ
dentistry3000-784	162	45	leys	leys	PROPN
dentistry3000-784	162	46	,	,	PUNCT
dentistry3000-784	162	47	e.	e.	PROPN
dentistry3000-784	162	48	j.	j.	PROPN
dentistry3000-784	162	49	(	(	PUNCT
dentistry3000-784	162	50	2012	2012	NUM
dentistry3000-784	162	51	)	)	PUNCT
dentistry3000-784	162	52	.	.	PUNCT
dentistry3000-784	163	1	distinct	distinct	ADJ
dentistry3000-784	163	2	and	and	CCONJ
dentistry3000-784	163	3	complex	complex	ADJ
dentistry3000-784	163	4	bacterial	bacterial	ADJ
dentistry3000-784	163	5	profiles	profile	NOUN
dentistry3000-784	163	6	in	in	ADP
dentistry3000-784	163	7	human	human	ADJ
dentistry3000-784	163	8	periodontitis	periodontitis	NOUN
dentistry3000-784	163	9	and	and	CCONJ
dentistry3000-784	163	10	health	health	NOUN
dentistry3000-784	163	11	revealed	reveal	VERB
dentistry3000-784	163	12	by	by	ADP
dentistry3000-784	163	13	16s	16	NOUN
dentistry3000-784	163	14	pyrosequencing	pyrosequencing	NOUN
dentistry3000-784	163	15	.	.	PUNCT
dentistry3000-784	164	1	the	the	DET
dentistry3000-784	164	2	isme	isme	PROPN
dentistry3000-784	164	3	journal	journal	NOUN
dentistry3000-784	164	4	,	,	PUNCT
dentistry3000-784	164	5	6(6	6(6	ADJ
dentistry3000-784	164	6	)	)	PUNCT
dentistry3000-784	164	7	,	,	PUNCT
dentistry3000-784	164	8	1176–1185	1176–1185	NUM
dentistry3000-784	164	9	.	.	PUNCT
dentistry3000-784	164	10	3aas	3aas	NUM
dentistry3000-784	164	11	,	,	PUNCT
dentistry3000-784	164	12	j.	j.	PROPN
dentistry3000-784	164	13	a.	a.	PROPN
dentistry3000-784	164	14	,	,	PUNCT
dentistry3000-784	164	15	paster	paster	NOUN
dentistry3000-784	164	16	,	,	PUNCT
dentistry3000-784	164	17	b.	b.	PROPN
dentistry3000-784	164	18	j.	j.	PROPN
dentistry3000-784	164	19	,	,	PUNCT
dentistry3000-784	164	20	stokes	stokes	PROPN
dentistry3000-784	164	21	,	,	PUNCT
dentistry3000-784	164	22	l.	l.	PROPN
dentistry3000-784	164	23	n.	n.	PROPN
dentistry3000-784	164	24	,	,	PUNCT
dentistry3000-784	164	25	olsen	olsen	PROPN
dentistry3000-784	164	26	,	,	PUNCT
dentistry3000-784	164	27	i.	i.	PROPN
dentistry3000-784	164	28	,	,	PUNCT
dentistry3000-784	164	29	&	&	CCONJ
dentistry3000-784	164	30	dewhirst	dewhirst	PROPN
dentistry3000-784	164	31	,	,	PUNCT
dentistry3000-784	164	32	f.	f.	PROPN
dentistry3000-784	164	33	e.	e.	PROPN
dentistry3000-784	164	34	(	(	PUNCT
dentistry3000-784	164	35	2005	2005	NUM
dentistry3000-784	164	36	)	)	PUNCT
dentistry3000-784	164	37	.	.	PUNCT
dentistry3000-784	165	1	defining	define	VERB
dentistry3000-784	165	2	the	the	DET
dentistry3000-784	165	3	normal	normal	ADJ
dentistry3000-784	165	4	bacterial	bacterial	ADJ
dentistry3000-784	165	5	flora	flora	NOUN
dentistry3000-784	165	6	of	of	ADP
dentistry3000-784	165	7	the	the	DET
dentistry3000-784	165	8	oral	oral	ADJ
dentistry3000-784	165	9	cavity	cavity	NOUN
dentistry3000-784	165	10	.	.	PUNCT
dentistry3000-784	166	1	journal	journal	NOUN
dentistry3000-784	166	2	of	of	ADP
dentistry3000-784	166	3	clinical	clinical	ADJ
dentistry3000-784	166	4	microbiology	microbiology	NOUN
dentistry3000-784	166	5	,	,	PUNCT
dentistry3000-784	166	6	43(11	43(11	NUM
dentistry3000-784	166	7	)	)	PUNCT
dentistry3000-784	166	8	,	,	PUNCT
dentistry3000-784	166	9	5721–5732	5721–5732	NUM
dentistry3000-784	166	10	.	.	PUNCT
dentistry3000-784	167	1	4dewhirst	4dewhirst	NUM
dentistry3000-784	167	2	,	,	PUNCT
dentistry3000-784	167	3	f.	f.	PROPN
dentistry3000-784	167	4	e.	e.	PROPN
dentistry3000-784	167	5	,	,	PUNCT
dentistry3000-784	167	6	chen	chen	PROPN
dentistry3000-784	167	7	,	,	PUNCT
dentistry3000-784	167	8	t.	t.	PROPN
dentistry3000-784	167	9	,	,	PUNCT
dentistry3000-784	167	10	izard	izard	PROPN
dentistry3000-784	167	11	,	,	PUNCT
dentistry3000-784	167	12	j.	j.	PROPN
dentistry3000-784	167	13	,	,	PUNCT
dentistry3000-784	167	14	paster	paster	NOUN
dentistry3000-784	167	15	,	,	PUNCT
dentistry3000-784	167	16	b.	b.	PROPN
dentistry3000-784	167	17	j.	j.	PROPN
dentistry3000-784	167	18	,	,	PUNCT
dentistry3000-784	167	19	tanner	tanner	NOUN
dentistry3000-784	167	20	,	,	PUNCT
dentistry3000-784	167	21	a.	a.	PROPN
dentistry3000-784	167	22	c.	c.	PROPN
dentistry3000-784	167	23	,	,	PUNCT
dentistry3000-784	167	24	yu	yu	PROPN
dentistry3000-784	167	25	,	,	PUNCT
dentistry3000-784	167	26	w.	w.	PROPN
dentistry3000-784	167	27	h.	h.	PROPN
dentistry3000-784	167	28	,	,	PUNCT
dentistry3000-784	167	29	lakshmanan	lakshmanan	PROPN
dentistry3000-784	167	30	,	,	PUNCT
dentistry3000-784	167	31	a.	a.	PROPN
dentistry3000-784	167	32	,	,	PUNCT
dentistry3000-784	167	33	&	&	CCONJ
dentistry3000-784	167	34	wade	wade	PROPN
dentistry3000-784	167	35	,	,	PUNCT
dentistry3000-784	167	36	w.	w.	PROPN
dentistry3000-784	167	37	g.	g.	PROPN
dentistry3000-784	167	38	(	(	PUNCT
dentistry3000-784	167	39	2010	2010	NUM
dentistry3000-784	167	40	)	)	PUNCT
dentistry3000-784	167	41	.	.	PUNCT
dentistry3000-784	168	1	the	the	DET
dentistry3000-784	168	2	human	human	ADJ
dentistry3000-784	168	3	oral	oral	ADJ
dentistry3000-784	168	4	microbiome	microbiome	NOUN
dentistry3000-784	168	5	.	.	PUNCT
dentistry3000-784	169	1	journal	journal	NOUN
dentistry3000-784	169	2	of	of	ADP
dentistry3000-784	169	3	bacteriology	bacteriology	NOUN
dentistry3000-784	169	4	,	,	PUNCT
dentistry3000-784	169	5	192(19	192(19	NUM
dentistry3000-784	169	6	)	)	PUNCT
dentistry3000-784	169	7	,	,	PUNCT
dentistry3000-784	169	8	5002	5002	NUM
dentistry3000-784	169	9	–	–	PUNCT
dentistry3000-784	169	10	5017	5017	NUM
dentistry3000-784	169	11	.	.	PUNCT
dentistry3000-784	170	1	5haffajee	5haffajee	NUM
dentistry3000-784	170	2	,	,	PUNCT
dentistry3000-784	170	3	a.	a.	PROPN
dentistry3000-784	170	4	d.	d.	PROPN
dentistry3000-784	170	5	,	,	PUNCT
dentistry3000-784	170	6	dibart	dibart	PROPN
dentistry3000-784	170	7	,	,	PUNCT
dentistry3000-784	170	8	s.	s.	PROPN
dentistry3000-784	170	9	,	,	PUNCT
dentistry3000-784	170	10	kent	kent	PROPN
dentistry3000-784	170	11	,	,	PUNCT
dentistry3000-784	170	12	r.	r.	PROPN
dentistry3000-784	170	13	l.	l.	PROPN
dentistry3000-784	170	14	,	,	PUNCT
dentistry3000-784	170	15	jr	jr	PROPN
dentistry3000-784	170	16	,	,	PUNCT
dentistry3000-784	170	17	&	&	CCONJ
dentistry3000-784	170	18	socransky	socransky	PROPN
dentistry3000-784	170	19	,	,	PUNCT
dentistry3000-784	170	20	s.	s.	PROPN
dentistry3000-784	170	21	s.	s.	PROPN
dentistry3000-784	170	22	(	(	PUNCT
dentistry3000-784	170	23	1995	1995	NUM
dentistry3000-784	170	24	)	)	PUNCT
dentistry3000-784	170	25	.	.	PUNCT
dentistry3000-784	171	1	factors	factor	NOUN
dentistry3000-784	171	2	associated	associate	VERB
dentistry3000-784	171	3	with	with	ADP
dentistry3000-784	171	4	different	different	ADJ
dentistry3000-784	171	5	responses	response	NOUN
dentistry3000-784	171	6	to	to	ADP
dentistry3000-784	171	7	periodontal	periodontal	ADJ
dentistry3000-784	171	8	therapy	therapy	NOUN
dentistry3000-784	171	9	.	.	PUNCT
dentistry3000-784	172	1	journal	journal	NOUN
dentistry3000-784	172	2	of	of	ADP
dentistry3000-784	172	3	clinical	clinical	ADJ
dentistry3000-784	172	4	periodontology	periodontology	NOUN
dentistry3000-784	172	5	,	,	PUNCT
dentistry3000-784	172	6	22(8	22(8	NUM
dentistry3000-784	172	7	)	)	PUNCT
dentistry3000-784	172	8	,	,	PUNCT
dentistry3000-784	172	9	628–636	628–636	NUM
dentistry3000-784	172	10	.	.	PUNCT
dentistry3000-784	173	1	6tamura	6tamura	NUM
dentistry3000-784	173	2	,	,	PUNCT
dentistry3000-784	173	3	a.	a.	NOUN
dentistry3000-784	173	4	,	,	PUNCT
dentistry3000-784	173	5	ara	ara	PROPN
dentistry3000-784	173	6	,	,	PUNCT
dentistry3000-784	173	7	t.	t.	PROPN
dentistry3000-784	173	8	,	,	PUNCT
dentistry3000-784	173	9	imamura	imamura	PROPN
dentistry3000-784	173	10	,	,	PUNCT
dentistry3000-784	173	11	y.	y.	PROPN
dentistry3000-784	173	12	,	,	PUNCT
dentistry3000-784	173	13	fujii	fujii	PROPN
dentistry3000-784	173	14	,	,	PUNCT
dentistry3000-784	173	15	t.	t.	PROPN
dentistry3000-784	173	16	&	&	CCONJ
dentistry3000-784	173	17	wang	wang	PROPN
dentistry3000-784	173	18	,	,	PUNCT
dentistry3000-784	173	19	p.	p.	NOUN
dentistry3000-784	173	20	(	(	PUNCT
dentistry3000-784	173	21	2008	2008	NUM
dentistry3000-784	173	22	)	)	PUNCT
dentistry3000-784	173	23	.	.	PUNCT
dentistry3000-784	174	1	the	the	DET
dentistry3000-784	174	2	effects	effect	NOUN
dentistry3000-784	174	3	of	of	ADP
dentistry3000-784	174	4	antibiotics	antibiotic	NOUN
dentistry3000-784	174	5	on	on	ADP
dentistry3000-784	174	6	in	in	ADP
dentistry3000-784	174	7	vitro	vitro	X
dentistry3000-784	174	8	biofilm	biofilm	NOUN
dentistry3000-784	174	9	model	model	NOUN
dentistry3000-784	174	10	of	of	ADP
dentistry3000-784	174	11	periodontal	periodontal	ADJ
dentistry3000-784	174	12	disease	disease	NOUN
dentistry3000-784	174	13	.	.	PUNCT
dentistry3000-784	175	1	eur	eur	PROPN
dentistry3000-784	175	2	j	j	PROPN
dentistry3000-784	175	3	med	med	PROPN
dentistry3000-784	175	4	res	re	NOUN
dentistry3000-784	175	5	,	,	PUNCT
dentistry3000-784	175	6	13	13	NUM
dentistry3000-784	175	7	,	,	PUNCT
dentistry3000-784	175	8	439445	439445	NUM
dentistry3000-784	175	9	.	.	PUNCT
dentistry3000-784	176	1	7ximénez	7ximénez	X
dentistry3000-784	176	2	-	-	PUNCT
dentistry3000-784	176	3	fyvie	fyvie	PROPN
dentistry3000-784	176	4	,	,	PUNCT
dentistry3000-784	176	5	l.	l.	PROPN
dentistry3000-784	176	6	a.	a.	PROPN
dentistry3000-784	176	7	,	,	PUNCT
dentistry3000-784	176	8	haffajee	haffajee	PROPN
dentistry3000-784	176	9	,	,	PUNCT
dentistry3000-784	176	10	a.	a.	PROPN
dentistry3000-784	176	11	d.	d.	PROPN
dentistry3000-784	176	12	&	&	CCONJ
dentistry3000-784	176	13	socransky	socransky	PROPN
dentistry3000-784	176	14	,	,	PUNCT
dentistry3000-784	176	15	s.	s.	PROPN
dentistry3000-784	176	16	s.	s.	PROPN
dentistry3000-784	176	17	(	(	PUNCT
dentistry3000-784	176	18	2000a	2000a	NUM
dentistry3000-784	176	19	)	)	PUNCT
dentistry3000-784	176	20	.	.	PUNCT
dentistry3000-784	177	1	comparison	comparison	NOUN
dentistry3000-784	177	2	of	of	ADP
dentistry3000-784	177	3	the	the	DET
dentistry3000-784	177	4	microbiota	microbiota	NOUN
dentistry3000-784	177	5	of	of	ADP
dentistry3000-784	177	6	supraand	supraand	NOUN
dentistry3000-784	177	7	subgingival	subgingival	ADJ
dentistry3000-784	177	8	plaque	plaque	NOUN
dentistry3000-784	177	9	in	in	ADP
dentistry3000-784	177	10	health	health	NOUN
dentistry3000-784	177	11	and	and	CCONJ
dentistry3000-784	177	12	periodontitis	periodontitis	NOUN
dentistry3000-784	177	13	.	.	PUNCT
dentistry3000-784	178	1	j	j	PROPN
dentistry3000-784	178	2	clin	clin	PROPN
dentistry3000-784	178	3	periodontol	periodontol	PROPN
dentistry3000-784	178	4	,	,	PUNCT
dentistry3000-784	178	5	27	27	NUM
dentistry3000-784	178	6	,	,	PUNCT
dentistry3000-784	178	7	648	648	NUM
dentistry3000-784	178	8	-	-	SYM
dentistry3000-784	178	9	57	57	NUM
dentistry3000-784	178	10	.	.	PUNCT
dentistry3000-784	179	1	8ximénez	8ximénez	NUM
dentistry3000-784	179	2	-	-	NOUN
dentistry3000-784	179	3	fyvie	fyvie	ADJ
dentistry3000-784	179	4	,	,	PUNCT
dentistry3000-784	179	5	l.	l.	PROPN
dentistry3000-784	179	6	a.	a.	PROPN
dentistry3000-784	179	7	,	,	PUNCT
dentistry3000-784	179	8	haffajee	haffajee	PROPN
dentistry3000-784	179	9	,	,	PUNCT
dentistry3000-784	179	10	a.	a.	PROPN
dentistry3000-784	179	11	d.	d.	PROPN
dentistry3000-784	179	12	,	,	PUNCT
dentistry3000-784	179	13	som	som	PROPN
dentistry3000-784	179	14	,	,	PUNCT
dentistry3000-784	179	15	s.	s.	PROPN
dentistry3000-784	179	16	,	,	PUNCT
dentistry3000-784	179	17	thompson	thompson	PROPN
dentistry3000-784	179	18	,	,	PUNCT
dentistry3000-784	179	19	m.	m.	NOUN
dentistry3000-784	179	20	,	,	PUNCT
dentistry3000-784	179	21	torresyap	torresyap	PROPN
dentistry3000-784	179	22	,	,	PUNCT
dentistry3000-784	179	23	g.	g.	PROPN
dentistry3000-784	179	24	&	&	CCONJ
dentistry3000-784	179	25	socransky	socransky	PROPN
dentistry3000-784	179	26	,	,	PUNCT
dentistry3000-784	179	27	s.	s.	PROPN
dentistry3000-784	179	28	s.	s.	PROPN
dentistry3000-784	179	29	(	(	PUNCT
dentistry3000-784	179	30	2000b	2000b	NUM
dentistry3000-784	179	31	)	)	PUNCT
dentistry3000-784	179	32	.	.	PUNCT
dentistry3000-784	180	1	the	the	DET
dentistry3000-784	180	2	effect	effect	NOUN
dentistry3000-784	180	3	of	of	ADP
dentistry3000-784	180	4	repeated	repeat	VERB
dentistry3000-784	180	5	professional	professional	ADJ
dentistry3000-784	180	6	supragingival	supragingival	NOUN
dentistry3000-784	180	7	plaque	plaque	NOUN
dentistry3000-784	180	8	removal	removal	NOUN
dentistry3000-784	180	9	on	on	ADP
dentistry3000-784	180	10	the	the	DET
dentistry3000-784	180	11	composition	composition	NOUN
dentistry3000-784	180	12	of	of	ADP
dentistry3000-784	180	13	the	the	DET
dentistry3000-784	180	14	supraand	supraand	NOUN
dentistry3000-784	180	15	subgingival	subgingival	ADJ
dentistry3000-784	180	16	microbiota	microbiota	NOUN
dentistry3000-784	180	17	.	.	PUNCT
dentistry3000-784	181	1	j	j	PROPN
dentistry3000-784	181	2	clin	clin	PROPN
dentistry3000-784	181	3	periodontol	periodontol	PROPN
dentistry3000-784	181	4	,	,	PUNCT
dentistry3000-784	181	5	27	27	NUM
dentistry3000-784	181	6	,	,	PUNCT
dentistry3000-784	181	7	637	637	NUM
dentistry3000-784	181	8	-	-	SYM
dentistry3000-784	181	9	47	47	NUM
dentistry3000-784	181	10	.	.	PUNCT
dentistry3000-784	182	1	9saini	9saini	NUM
dentistry3000-784	182	2	,	,	PUNCT
dentistry3000-784	182	3	r.	r.	PROPN
dentistry3000-784	182	4	,	,	PUNCT
dentistry3000-784	182	5	saini	saini	PROPN
dentistry3000-784	182	6	,	,	PUNCT
dentistry3000-784	182	7	s.	s.	PROPN
dentistry3000-784	182	8	&	&	CCONJ
dentistry3000-784	182	9	sharma	sharma	PROPN
dentistry3000-784	182	10	,	,	PUNCT
dentistry3000-784	182	11	s.	s.	PROPN
dentistry3000-784	182	12	(	(	PUNCT
dentistry3000-784	182	13	2011	2011	NUM
dentistry3000-784	182	14	)	)	PUNCT
dentistry3000-784	182	15	.	.	PUNCT
dentistry3000-784	183	1	biofilm	biofilm	NOUN
dentistry3000-784	183	2	:	:	PUNCT
dentistry3000-784	183	3	a	a	DET
dentistry3000-784	183	4	dental	dental	ADJ
dentistry3000-784	183	5	microbial	microbial	ADJ
dentistry3000-784	183	6	infection	infection	NOUN
dentistry3000-784	183	7	.	.	PUNCT
dentistry3000-784	184	1	journal	journal	NOUN
dentistry3000-784	184	2	of	of	ADP
dentistry3000-784	184	3	natural	natural	ADJ
dentistry3000-784	184	4	science	science	NOUN
dentistry3000-784	184	5	,	,	PUNCT
dentistry3000-784	184	6	biology	biology	NOUN
dentistry3000-784	184	7	,	,	PUNCT
dentistry3000-784	184	8	and	and	CCONJ
dentistry3000-784	184	9	medicine	medicine	NOUN
dentistry3000-784	184	10	,	,	PUNCT
dentistry3000-784	184	11	2	2	NUM
dentistry3000-784	184	12	,	,	PUNCT
dentistry3000-784	184	13	71	71	NUM
dentistry3000-784	184	14	-	-	SYM
dentistry3000-784	184	15	75	75	NUM
dentistry3000-784	184	16	.	.	PUNCT
dentistry3000-784	185	1	10rafiq	10rafiq	NUM
dentistry3000-784	185	2	,	,	PUNCT
dentistry3000-784	185	3	k.	k.	PROPN
dentistry3000-784	185	4	,	,	PUNCT
dentistry3000-784	185	5	sherajee	sherajee	PROPN
dentistry3000-784	185	6	,	,	PUNCT
dentistry3000-784	185	7	s.	s.	PROPN
dentistry3000-784	185	8	j.	j.	PROPN
dentistry3000-784	185	9	,	,	PUNCT
dentistry3000-784	185	10	sufiun	sufiun	PROPN
dentistry3000-784	185	11	,	,	PUNCT
dentistry3000-784	185	12	m.	m.	NOUN
dentistry3000-784	185	13	,	,	PUNCT
dentistry3000-784	185	14	mostofa	mostofa	PROPN
dentistry3000-784	185	15	,	,	PUNCT
dentistry3000-784	185	16	m.	m.	NOUN
dentistry3000-784	185	17	,	,	PUNCT
dentistry3000-784	185	18	alam	alam	PROPN
dentistry3000-784	185	19	,	,	PUNCT
dentistry3000-784	185	20	a.	a.	PROPN
dentistry3000-784	185	21	&	&	CCONJ
dentistry3000-784	185	22	barman	barman	PROPN
dentistry3000-784	185	23	,	,	PUNCT
dentistry3000-784	185	24	b.	b.	PROPN
dentistry3000-784	185	25	(	(	PUNCT
dentistry3000-784	185	26	2011	2011	NUM
dentistry3000-784	185	27	)	)	PUNCT
dentistry3000-784	185	28	.	.	PUNCT
dentistry3000-784	186	1	comparative	comparative	ADJ
dentistry3000-784	186	2	efficacy	efficacy	NOUN
dentistry3000-784	186	3	of	of	ADP
dentistry3000-784	186	4	stevia	stevia	NOUN
dentistry3000-784	186	5	leaf	leaf	NOUN
dentistry3000-784	186	6	(	(	PUNCT
dentistry3000-784	186	7	stevia	stevia	PROPN
dentistry3000-784	186	8	rebaudiana	rebaudiana	PROPN
dentistry3000-784	186	9	bertoni	bertoni	PROPN
dentistry3000-784	186	10	)	)	PUNCT
dentistry3000-784	186	11	,	,	PUNCT
dentistry3000-784	186	12	methi	methi	NOUN
dentistry3000-784	186	13	seeds	seed	NOUN
dentistry3000-784	186	14	(	(	PUNCT
dentistry3000-784	186	15	trigonella	trigonella	NOUN
dentistry3000-784	186	16	foenumgraecum	foenumgraecum	NOUN
dentistry3000-784	186	17	)	)	PUNCT
dentistry3000-784	186	18	and	and	CCONJ
dentistry3000-784	186	19	glimepiride	glimepiride	NOUN
dentistry3000-784	186	20	in	in	ADP
dentistry3000-784	186	21	streptozotocin	streptozotocin	NOUN
dentistry3000-784	186	22	induced	induce	VERB
dentistry3000-784	186	23	rats	rat	NOUN
dentistry3000-784	186	24	.	.	PUNCT
dentistry3000-784	187	1	international	international	ADJ
dentistry3000-784	187	2	journal	journal	NOUN
dentistry3000-784	187	3	,	,	PUNCT
dentistry3000-784	187	4	2229	2229	NUM
dentistry3000-784	187	5	,	,	PUNCT
dentistry3000-784	187	6	7472	7472	NUM
dentistry3000-784	187	7	.	.	PUNCT
dentistry3000-784	188	1	phytochemical	phytochemical	ADJ
dentistry3000-784	188	2	analysis	analysis	NOUN
dentistry3000-784	188	3	and	and	CCONJ
dentistry3000-784	188	4	an1bacterial	an1bacterial	ADJ
dentistry3000-784	188	5	ac1vity	ac1vity	NOUN
dentistry3000-784	188	6	of	of	ADP
dentistry3000-784	188	7	stevia	stevia	NOUN
dentistry3000-784	188	8	rebaudiana	rebaudiana	PROPN
dentistry3000-784	188	9	bertoni	bertoni	PROPN
dentistry3000-784	188	10	leaves	leave	NOUN
dentistry3000-784	188	11	extract	extract	VERB
dentistry3000-784	188	12	against	against	ADP
dentistry3000-784	188	13	streptococcus	streptococcus	NOUN
dentistry3000-784	188	14	sanguis	sanguis	NOUN
dentistry3000-784	188	15	(	(	PUNCT
dentistry3000-784	188	16	a	a	DET
dentistry3000-784	188	17	primary	primary	ADJ
dentistry3000-784	188	18	inhabitant	inhabitant	NOUN
dentistry3000-784	188	19	of	of	ADP
dentistry3000-784	188	20	dental	dental	ADJ
dentistry3000-784	188	21	plaque	plaque	NOUN
dentistry3000-784	188	22	):	):	PUNCT
dentistry3000-784	188	23	in	in	ADP
dentistry3000-784	188	24	vitro	vitro	X
dentistry3000-784	188	25	study	study	NOUN
dentistry3000-784	188	26	vol	vol	NOUN
dentistry3000-784	188	27	13	13	NUM
dentistry3000-784	188	28	no	no	DET
dentistry3000-784	188	29	1	1	NUM
dentistry3000-784	188	30	(	(	PUNCT
dentistry3000-784	188	31	2025	2025	NUM
dentistry3000-784	188	32	)	)	PUNCT
dentistry3000-784	188	33	doi	doi	NOUN
dentistry3000-784	188	34	10.5195	10.5195	NUM
dentistry3000-784	188	35	/	/	SYM
dentistry3000-784	188	36	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	188	37	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	188	38	11ashwell	11ashwell	PROPN
dentistry3000-784	188	39	,	,	PUNCT
dentistry3000-784	188	40	m.)2015	m.)2015	PROPN
dentistry3000-784	188	41	(	(	PUNCT
dentistry3000-784	188	42	.	.	PUNCT
dentistry3000-784	188	43	stevia	stevia	PROPN
dentistry3000-784	188	44	,	,	PUNCT
dentistry3000-784	188	45	nature	nature	NOUN
dentistry3000-784	188	46	’s	’s	PART
dentistry3000-784	188	47	zero	zero	NUM
dentistry3000-784	188	48	-	-	PUNCT
dentistry3000-784	188	49	calorie	calorie	NOUN
dentistry3000-784	188	50	sustainable	sustainable	ADJ
dentistry3000-784	188	51	sweetener	sweetener	NOUN
dentistry3000-784	188	52	:	:	PUNCT
dentistry3000-784	188	53	a	a	DET
dentistry3000-784	188	54	new	new	ADJ
dentistry3000-784	188	55	player	player	NOUN
dentistry3000-784	188	56	in	in	ADP
dentistry3000-784	188	57	the	the	DET
dentistry3000-784	188	58	fight	fight	NOUN
dentistry3000-784	188	59	against	against	ADP
dentistry3000-784	188	60	obesity	obesity	NOUN
dentistry3000-784	188	61	.	.	PUNCT
dentistry3000-784	189	1	nutrition	nutrition	NOUN
dentistry3000-784	189	2	today	today	NOUN
dentistry3000-784	189	3	,	,	PUNCT
dentistry3000-784	189	4	50	50	NUM
dentistry3000-784	189	5	,	,	PUNCT
dentistry3000-784	189	6	129	129	NUM
dentistry3000-784	189	7	.	.	PUNCT
dentistry3000-784	190	1	12shakya	12shakya	NUM
dentistry3000-784	190	2	,	,	PUNCT
dentistry3000-784	190	3	a.	a.	PROPN
dentistry3000-784	190	4	k.	k.	PROPN
dentistry3000-784	190	5	(	(	PUNCT
dentistry3000-784	190	6	2016	2016	NUM
dentistry3000-784	190	7	)	)	PUNCT
dentistry3000-784	190	8	.	.	PUNCT
dentistry3000-784	191	1	medicinal	medicinal	ADJ
dentistry3000-784	191	2	plants	plant	NOUN
dentistry3000-784	191	3	:	:	PUNCT
dentistry3000-784	191	4	future	future	ADJ
dentistry3000-784	191	5	source	source	NOUN
dentistry3000-784	191	6	of	of	ADP
dentistry3000-784	191	7	new	new	ADJ
dentistry3000-784	191	8	drugs	drug	NOUN
dentistry3000-784	191	9	.	.	PUNCT
dentistry3000-784	192	1	international	international	ADJ
dentistry3000-784	192	2	journal	journal	NOUN
dentistry3000-784	192	3	of	of	ADP
dentistry3000-784	192	4	herbal	herbal	ADJ
dentistry3000-784	192	5	medicine	medicine	NOUN
dentistry3000-784	192	6	,	,	PUNCT
dentistry3000-784	192	7	4	4	NUM
dentistry3000-784	192	8	,	,	PUNCT
dentistry3000-784	192	9	59	59	NUM
dentistry3000-784	192	10	-	-	SYM
dentistry3000-784	192	11	64	64	NUM
dentistry3000-784	192	12	.	.	PUNCT
dentistry3000-784	193	1	13abou	13abou	PROPN
dentistry3000-784	193	2	-	-	PUNCT
dentistry3000-784	193	3	arab	arab	PROPN
dentistry3000-784	193	4	,	,	PUNCT
dentistry3000-784	193	5	a.	a.	PROPN
dentistry3000-784	193	6	e.	e.	PROPN
dentistry3000-784	193	7	,	,	PUNCT
dentistry3000-784	193	8	abouarab	abouarab	NOUN
dentistry3000-784	193	9	,	,	PUNCT
dentistry3000-784	193	10	a.	a.	NOUN
dentistry3000-784	193	11	a.	a.	PROPN
dentistry3000-784	193	12	&	&	CCONJ
dentistry3000-784	193	13	abu	abu	PROPN
dentistry3000-784	193	14	-	-	PUNCT
dentistry3000-784	193	15	salem	salem	PROPN
dentistry3000-784	193	16	,	,	PUNCT
dentistry3000-784	193	17	m.	m.	NOUN
dentistry3000-784	193	18	f.	f.	PROPN
dentistry3000-784	193	19	(	(	PUNCT
dentistry3000-784	193	20	2010	2010	NUM
dentistry3000-784	193	21	)	)	PUNCT
dentistry3000-784	193	22	.	.	PUNCT
dentistry3000-784	194	1	physico	physico	NOUN
dentistry3000-784	194	2	-	-	PUNCT
dentistry3000-784	194	3	chemical	chemical	NOUN
dentistry3000-784	194	4	assessment	assessment	NOUN
dentistry3000-784	194	5	of	of	ADP
dentistry3000-784	194	6	natural	natural	ADJ
dentistry3000-784	194	7	sweeteners	sweetener	NOUN
dentistry3000-784	194	8	steviosides	stevioside	NOUN
dentistry3000-784	194	9	produced	produce	VERB
dentistry3000-784	194	10	from	from	ADP
dentistry3000-784	194	11	stevia	stevia	PROPN
dentistry3000-784	194	12	rebaudiana	rebaudiana	PROPN
dentistry3000-784	194	13	bertoni	bertoni	PROPN
dentistry3000-784	194	14	plant	plant	NOUN
dentistry3000-784	194	15	.	.	PUNCT
dentistry3000-784	195	1	african	african	ADJ
dentistry3000-784	195	2	journal	journal	PROPN
dentistry3000-784	195	3	of	of	ADP
dentistry3000-784	195	4	food	food	NOUN
dentistry3000-784	195	5	science	science	NOUN
dentistry3000-784	195	6	,	,	PUNCT
dentistry3000-784	195	7	4	4	NUM
dentistry3000-784	195	8	,	,	PUNCT
dentistry3000-784	195	9	269	269	NUM
dentistry3000-784	195	10	-	-	SYM
dentistry3000-784	195	11	281	281	NUM
dentistry3000-784	195	12	.	.	PUNCT
dentistry3000-784	196	1	14	14	NUM
dentistry3000-784	196	2	yildiz	yildiz	NOUN
dentistry3000-784	196	3	-	-	PUNCT
dentistry3000-784	196	4	ozturk	ozturk	NOUN
dentistry3000-784	196	5	,	,	PUNCT
dentistry3000-784	196	6	e.	e.	PROPN
dentistry3000-784	196	7	,	,	PUNCT
dentistry3000-784	196	8	nalbantsoy	nalbantsoy	PROPN
dentistry3000-784	196	9	,	,	PUNCT
dentistry3000-784	196	10	a.	a.	NOUN
dentistry3000-784	196	11	,	,	PUNCT
dentistry3000-784	196	12	tag	tag	NOUN
dentistry3000-784	196	13	,	,	PUNCT
dentistry3000-784	196	14	o.	o.	PROPN
dentistry3000-784	196	15	&	&	CCONJ
dentistry3000-784	196	16	yesilceliktas	yesilcelikta	NOUN
dentistry3000-784	196	17	,	,	PUNCT
dentistry3000-784	196	18	o.	o.	NOUN
dentistry3000-784	196	19	(	(	PUNCT
dentistry3000-784	196	20	2015	2015	NUM
dentistry3000-784	196	21	)	)	PUNCT
dentistry3000-784	196	22	.	.	PUNCT
dentistry3000-784	197	1	a	a	DET
dentistry3000-784	197	2	comparative	comparative	ADJ
dentistry3000-784	197	3	study	study	NOUN
dentistry3000-784	197	4	on	on	ADP
dentistry3000-784	197	5	extraction	extraction	NOUN
dentistry3000-784	197	6	processes	process	NOUN
dentistry3000-784	197	7	of	of	ADP
dentistry3000-784	197	8	stevia	stevia	NOUN
dentistry3000-784	197	9	rebaudiana	rebaudiana	PROPN
dentistry3000-784	197	10	leaves	leave	NOUN
dentistry3000-784	197	11	with	with	ADP
dentistry3000-784	197	12	emphasis	emphasis	NOUN
dentistry3000-784	197	13	on	on	ADP
dentistry3000-784	197	14	antioxidant	antioxidant	ADJ
dentistry3000-784	197	15	,	,	PUNCT
dentistry3000-784	197	16	cytotoxic	cytotoxic	ADJ
dentistry3000-784	197	17	and	and	CCONJ
dentistry3000-784	197	18	nitric	nitric	ADJ
dentistry3000-784	197	19	oxide	oxide	NOUN
dentistry3000-784	197	20	inhibition	inhibition	NOUN
dentistry3000-784	197	21	activities	activity	NOUN
dentistry3000-784	197	22	.	.	PUNCT
dentistry3000-784	198	1	industrial	industrial	ADJ
dentistry3000-784	198	2	crops	crop	NOUN
dentistry3000-784	198	3	and	and	CCONJ
dentistry3000-784	198	4	products	product	NOUN
dentistry3000-784	198	5	,	,	PUNCT
dentistry3000-784	198	6	77	77	NUM
dentistry3000-784	198	7	,	,	PUNCT
dentistry3000-784	198	8	961971	961971	NUM
dentistry3000-784	198	9	.	.	PUNCT
dentistry3000-784	199	1	15	15	NUM
dentistry3000-784	199	2	seidel	seidel	NOUN
dentistry3000-784	199	3	,	,	PUNCT
dentistry3000-784	199	4	v.	v.	PROPN
dentistry3000-784	199	5	(	(	PUNCT
dentistry3000-784	199	6	2012	2012	NUM
dentistry3000-784	199	7	)	)	PUNCT
dentistry3000-784	199	8	.	.	PUNCT
dentistry3000-784	200	1	initial	initial	ADJ
dentistry3000-784	200	2	and	and	CCONJ
dentistry3000-784	200	3	bulk	bulk	ADJ
dentistry3000-784	200	4	extraction	extraction	NOUN
dentistry3000-784	200	5	of	of	ADP
dentistry3000-784	200	6	natural	natural	ADJ
dentistry3000-784	200	7	products	product	NOUN
dentistry3000-784	200	8	isolation	isolation	NOUN
dentistry3000-784	200	9	.	.	PUNCT
dentistry3000-784	201	1	natural	natural	ADJ
dentistry3000-784	201	2	products	product	NOUN
dentistry3000-784	201	3	isolation	isolation	NOUN
dentistry3000-784	201	4	,	,	PUNCT
dentistry3000-784	201	5	27	27	NUM
dentistry3000-784	201	6	-	-	SYM
dentistry3000-784	201	7	41	41	NUM
dentistry3000-784	201	8	.	.	PUNCT
dentistry3000-784	202	1	16	16	NUM
dentistry3000-784	202	2	abd	abd	PROPN
dentistry3000-784	202	3	noor	noor	PROPN
dentistry3000-784	202	4	,	,	PUNCT
dentistry3000-784	202	5	h.j	h.j	PROPN
dentistry3000-784	202	6	,	,	PUNCT
dentistry3000-784	202	7	2020	2020	NUM
dentistry3000-784	202	8	.	.	PUNCT
dentistry3000-784	203	1	potential	potential	ADJ
dentistry3000-784	203	2	effect	effect	NOUN
dentistry3000-784	203	3	of	of	ADP
dentistry3000-784	203	4	gold	gold	ADJ
dentistry3000-784	203	5	nanoparticles	nanoparticle	NOUN
dentistry3000-784	203	6	against	against	ADP
dentistry3000-784	203	7	streptococcus	streptococcus	NOUN
dentistry3000-784	203	8	mitis	mitis	NOUN
dentistry3000-784	203	9	and	and	CCONJ
dentistry3000-784	203	10	streptococcus	streptococcus	NOUN
dentistry3000-784	203	11	oralis	orali	NOUN
dentistry3000-784	203	12	(	(	PUNCT
dentistry3000-784	203	13	primary	primary	ADJ
dentistry3000-784	203	14	periodontal	periodontal	ADJ
dentistry3000-784	203	15	colonizeres	colonizere	NOUN
dentistry3000-784	203	16	)	)	PUNCT
dentistry3000-784	203	17	(	(	PUNCT
dentistry3000-784	203	18	doctoral	doctoral	ADJ
dentistry3000-784	203	19	dissertation	dissertation	NOUN
dentistry3000-784	203	20	,	,	PUNCT
dentistry3000-784	203	21	university	university	NOUN
dentistry3000-784	203	22	of	of	ADP
dentistry3000-784	203	23	baghdad	baghdad	PROPN
dentistry3000-784	203	24	)	)	PUNCT
dentistry3000-784	203	25	.	.	PUNCT
dentistry3000-784	204	1	17koneman	17koneman	NUM
dentistry3000-784	204	2	e	e	NOUN
dentistry3000-784	204	3	,	,	PUNCT
dentistry3000-784	204	4	schreckenberge	schreckenberge	NOUN
dentistry3000-784	204	5	p	p	NOUN
dentistry3000-784	204	6	,	,	PUNCT
dentistry3000-784	204	7	allens	allens	PROPN
dentistry3000-784	204	8	s	s	PART
dentistry3000-784	204	9	,	,	PUNCT
dentistry3000-784	204	10	et	et	PROPN
dentistry3000-784	204	11	al	al	PROPN
dentistry3000-784	204	12	.	.	PUNCT
dentistry3000-784	204	13	diagnostic	diagnostic	ADJ
dentistry3000-784	204	14	microbiology	microbiology	NOUN
dentistry3000-784	204	15	.	.	PUNCT
dentistry3000-784	205	1	4th	4th	ADJ
dentistry3000-784	205	2	edn	edn	NOUN
dentistry3000-784	205	3	.	.	PUNCT
dentistry3000-784	206	1	j.b	j.b	PROPN
dentistry3000-784	206	2	.	.	PUNCT
dentistry3000-784	207	1	lippincott	lippincott	PROPN
dentistry3000-784	207	2	co.usa	co.usa	PROPN
dentistry3000-784	207	3	.	.	PUNCT
dentistry3000-784	207	4	1992	1992	NUM
dentistry3000-784	207	5	.	.	PUNCT
dentistry3000-784	208	1	18buxton	18buxton	PROPN
dentistry3000-784	208	2	r.	r.	PROPN
dentistry3000-784	208	3	blood	blood	NOUN
dentistry3000-784	208	4	agar	agar	NOUN
dentistry3000-784	208	5	plates	plate	NOUN
dentistry3000-784	208	6	and	and	CCONJ
dentistry3000-784	208	7	hemolysis	hemolysis	NOUN
dentistry3000-784	208	8	protocols	protocol	NOUN
dentistry3000-784	208	9	.	.	PUNCT
dentistry3000-784	209	1	asm	asm	NOUN
dentistry3000-784	209	2	micro	micro	PROPN
dentistry3000-784	209	3	library	library	PROPN
dentistry3000-784	209	4	2013	2013	NUM
dentistry3000-784	209	5	.	.	PUNCT
dentistry3000-784	210	1	19cavalieri	19cavalieri	NUM
dentistry3000-784	210	2	,	,	PUNCT
dentistry3000-784	210	3	s.	s.	PROPN
dentistry3000-784	210	4	,	,	PUNCT
dentistry3000-784	210	5	harbeck	harbeck	PROPN
dentistry3000-784	210	6	,	,	PUNCT
dentistry3000-784	210	7	r.	r.	PROPN
dentistry3000-784	210	8	,	,	PUNCT
dentistry3000-784	210	9	mccarter	mccarter	PROPN
dentistry3000-784	210	10	,	,	PUNCT
dentistry3000-784	210	11	y.	y.	PROPN
dentistry3000-784	210	12	,	,	PUNCT
dentistry3000-784	210	13	ortez	ortez	PROPN
dentistry3000-784	210	14	,	,	PUNCT
dentistry3000-784	210	15	j.	j.	PROPN
dentistry3000-784	210	16	,	,	PUNCT
dentistry3000-784	210	17	rankin	rankin	PROPN
dentistry3000-784	210	18	,	,	PUNCT
dentistry3000-784	210	19	i.	i.	PROPN
dentistry3000-784	210	20	,	,	PUNCT
dentistry3000-784	210	21	sautter	sautter	PROPN
dentistry3000-784	210	22	,	,	PUNCT
dentistry3000-784	210	23	r.	r.	PROPN
dentistry3000-784	210	24	,	,	PUNCT
dentistry3000-784	210	25	sharp	sharp	ADJ
dentistry3000-784	210	26	,	,	PUNCT
dentistry3000-784	210	27	s.	s.	PROPN
dentistry3000-784	210	28	&	&	CCONJ
dentistry3000-784	210	29	spiegel	spiegel	PROPN
dentistry3000-784	210	30	,	,	PUNCT
dentistry3000-784	210	31	c.	c.	PROPN
dentistry3000-784	210	32	(	(	PUNCT
dentistry3000-784	210	33	2005	2005	NUM
dentistry3000-784	210	34	)	)	PUNCT
dentistry3000-784	210	35	.	.	PUNCT
dentistry3000-784	211	1	manual	manual	NOUN
dentistry3000-784	211	2	of	of	ADP
dentistry3000-784	211	3	antimicrobial	antimicrobial	ADJ
dentistry3000-784	211	4	susceptibility	susceptibility	NOUN
dentistry3000-784	211	5	testing	testing	NOUN
dentistry3000-784	211	6	.	.	PUNCT
dentistry3000-784	212	1	american	american	ADJ
dentistry3000-784	212	2	society	society	PROPN
dentistry3000-784	212	3	for	for	ADP
dentistry3000-784	212	4	microbiology	microbiology	NOUN
dentistry3000-784	212	5	.	.	PUNCT
dentistry3000-784	213	1	pan	pan	PROPN
dentistry3000-784	213	2	american	american	PROPN
dentistry3000-784	213	3	health	health	PROPN
dentistry3000-784	213	4	organization	organization	PROPN
dentistry3000-784	213	5	:	:	PUNCT
dentistry3000-784	213	6	washington	washington	PROPN
dentistry3000-784	213	7	,	,	PUNCT
dentistry3000-784	213	8	dc	dc	PROPN
dentistry3000-784	213	9	,	,	PUNCT
dentistry3000-784	213	10	usa	usa	PROPN
dentistry3000-784	213	11	.	.	PROPN
dentistry3000-784	213	12	20reiner	20reiner	PUNCT
dentistry3000-784	214	1	k.	k.	PROPN
dentistry3000-784	214	2	catalases	catalases	PROPN
dentistry3000-784	214	3	test	test	NOUN
dentistry3000-784	214	4	protocol	protocol	NOUN
dentistry3000-784	214	5	.	.	PUNCT
dentistry3000-784	215	1	asm	asm	NOUN
dentistry3000-784	215	2	micro	micro	PROPN
dentistry3000-784	215	3	library	library	PROPN
dentistry3000-784	215	4	2013	2013	NUM
dentistry3000-784	215	5	.	.	PUNCT
dentistry3000-784	216	1	21hoshino	21hoshino	NOUN
dentistry3000-784	216	2	,	,	PUNCT
dentistry3000-784	216	3	t.	t.	PROPN
dentistry3000-784	216	4	,	,	PUNCT
dentistry3000-784	216	5	kawaguchi	kawaguchi	PROPN
dentistry3000-784	216	6	,	,	PUNCT
dentistry3000-784	216	7	m.	m.	NOUN
dentistry3000-784	216	8	,	,	PUNCT
dentistry3000-784	216	9	shimizu	shimizu	PROPN
dentistry3000-784	216	10	,	,	PUNCT
dentistry3000-784	216	11	n.	n.	PROPN
dentistry3000-784	216	12	,	,	PUNCT
dentistry3000-784	216	13	hoshino	hoshino	PROPN
dentistry3000-784	216	14	,	,	PUNCT
dentistry3000-784	216	15	n.	n.	PROPN
dentistry3000-784	216	16	,	,	PUNCT
dentistry3000-784	216	17	ooshima	ooshima	PROPN
dentistry3000-784	216	18	,	,	PUNCT
dentistry3000-784	216	19	t.	t.	PROPN
dentistry3000-784	216	20	&	&	CCONJ
dentistry3000-784	216	21	fujiwara	fujiwara	PROPN
dentistry3000-784	216	22	,	,	PUNCT
dentistry3000-784	216	23	t.	t.	PROPN
dentistry3000-784	216	24	(	(	PUNCT
dentistry3000-784	216	25	2004	2004	NUM
dentistry3000-784	216	26	)	)	PUNCT
dentistry3000-784	216	27	.	.	PUNCT
dentistry3000-784	217	1	pcr	pcr	ADJ
dentistry3000-784	217	2	detection	detection	NOUN
dentistry3000-784	217	3	and	and	CCONJ
dentistry3000-784	217	4	identification	identification	NOUN
dentistry3000-784	217	5	of	of	ADP
dentistry3000-784	217	6	oral	oral	ADJ
dentistry3000-784	217	7	streptococci	streptococci	NOUN
dentistry3000-784	217	8	in	in	ADP
dentistry3000-784	217	9	saliva	saliva	NOUN
dentistry3000-784	217	10	samples	sample	NOUN
dentistry3000-784	217	11	using	use	VERB
dentistry3000-784	217	12	gtf	gtf	NOUN
dentistry3000-784	217	13	genes	gene	NOUN
dentistry3000-784	217	14	.	.	PUNCT
dentistry3000-784	218	1	diagn	diagn	PROPN
dentistry3000-784	218	2	microbiol	microbiol	PROPN
dentistry3000-784	218	3	infect	infect	VERB
dentistry3000-784	218	4	dis	dis	PROPN
dentistry3000-784	218	5	,	,	PUNCT
dentistry3000-784	218	6	48	48	NUM
dentistry3000-784	218	7	,	,	PUNCT
dentistry3000-784	218	8	195	195	NUM
dentistry3000-784	218	9	-	-	SYM
dentistry3000-784	218	10	9	9	NUM
dentistry3000-784	218	11	.	.	PUNCT
dentistry3000-784	219	1	22abdulbaqia	22abdulbaqia	NUM
dentistry3000-784	219	2	,	,	PUNCT
dentistry3000-784	219	3	h.	h.	PROPN
dentistry3000-784	219	4	r.	r.	PROPN
dentistry3000-784	219	5	,	,	PUNCT
dentistry3000-784	219	6	himratulaznita	himratulaznita	PROPN
dentistry3000-784	219	7	,	,	PUNCT
dentistry3000-784	219	8	w.	w.	PROPN
dentistry3000-784	219	9	h.	h.	PROPN
dentistry3000-784	219	10	&	&	CCONJ
dentistry3000-784	219	11	baharuddin	baharuddin	PROPN
dentistry3000-784	219	12	,	,	PUNCT
dentistry3000-784	219	13	n.	n.	NOUN
dentistry3000-784	219	14	a.	a.	PROPN
dentistry3000-784	219	15	(	(	PUNCT
dentistry3000-784	219	16	2016	2016	NUM
dentistry3000-784	219	17	)	)	PUNCT
dentistry3000-784	219	18	.	.	PUNCT
dentistry3000-784	220	1	anti	anti	ADJ
dentistry3000-784	220	2	-	-	ADJ
dentistry3000-784	220	3	plaque	plaque	ADJ
dentistry3000-784	220	4	effect	effect	NOUN
dentistry3000-784	220	5	of	of	ADP
dentistry3000-784	220	6	a	a	DET
dentistry3000-784	220	7	synergistic	synergistic	ADJ
dentistry3000-784	220	8	combination	combination	NOUN
dentistry3000-784	220	9	of	of	ADP
dentistry3000-784	220	10	green	green	ADJ
dentistry3000-784	220	11	tea	tea	NOUN
dentistry3000-784	220	12	and	and	CCONJ
dentistry3000-784	220	13	salvadora	salvadora	PROPN
dentistry3000-784	220	14	persica	persica	PROPN
dentistry3000-784	220	15	l.	l.	PROPN
dentistry3000-784	220	16	against	against	ADP
dentistry3000-784	220	17	primary	primary	ADJ
dentistry3000-784	220	18	colonizers	colonizer	NOUN
dentistry3000-784	220	19	of	of	ADP
dentistry3000-784	220	20	dental	dental	ADJ
dentistry3000-784	220	21	plaque	plaque	NOUN
dentistry3000-784	220	22	.	.	PUNCT
dentistry3000-784	221	1	archives	archive	NOUN
dentistry3000-784	221	2	of	of	ADP
dentistry3000-784	221	3	oral	oral	ADJ
dentistry3000-784	221	4	biology	biology	NOUN
dentistry3000-784	221	5	,	,	PUNCT
dentistry3000-784	221	6	70	70	NUM
dentistry3000-784	221	7	,	,	PUNCT
dentistry3000-784	221	8	117	117	NUM
dentistry3000-784	221	9	-	-	SYM
dentistry3000-784	221	10	124	124	NUM
dentistry3000-784	221	11	.	.	PUNCT
dentistry3000-784	222	1	23parvekar	23parvekar	NUM
dentistry3000-784	222	2	,	,	PUNCT
dentistry3000-784	222	3	p.	p.	NOUN
dentistry3000-784	222	4	,	,	PUNCT
dentistry3000-784	222	5	palaskar	palaskar	PROPN
dentistry3000-784	222	6	,	,	PUNCT
dentistry3000-784	222	7	j.	j.	PROPN
dentistry3000-784	222	8	,	,	PUNCT
dentistry3000-784	222	9	metgud	metgud	PROPN
dentistry3000-784	222	10	,	,	PUNCT
dentistry3000-784	222	11	s.	s.	PROPN
dentistry3000-784	222	12	,	,	PUNCT
dentistry3000-784	222	13	maria	maria	PROPN
dentistry3000-784	222	14	,	,	PUNCT
dentistry3000-784	222	15	r.	r.	PROPN
dentistry3000-784	222	16	&	&	CCONJ
dentistry3000-784	222	17	dutta	dutta	PROPN
dentistry3000-784	222	18	,	,	PUNCT
dentistry3000-784	222	19	s.	s.	PROPN
dentistry3000-784	222	20	2020	2020	NUM
dentistry3000-784	222	21	.	.	PUNCT
dentistry3000-784	223	1	the	the	DET
dentistry3000-784	223	2	minimum	minimum	ADJ
dentistry3000-784	223	3	inhibitory	inhibitory	ADJ
dentistry3000-784	223	4	concentration	concentration	NOUN
dentistry3000-784	223	5	(	(	PUNCT
dentistry3000-784	223	6	mic	mic	ADJ
dentistry3000-784	223	7	)	)	PUNCT
dentistry3000-784	223	8	and	and	CCONJ
dentistry3000-784	223	9	minimum	minimum	ADJ
dentistry3000-784	223	10	bactericidal	bactericidal	ADJ
dentistry3000-784	223	11	concentration	concentration	NOUN
dentistry3000-784	223	12	(	(	PUNCT
dentistry3000-784	223	13	mbc	mbc	PROPN
dentistry3000-784	223	14	)	)	PUNCT
dentistry3000-784	223	15	of	of	ADP
dentistry3000-784	223	16	silver	silver	ADJ
dentistry3000-784	223	17	nanoparticles	nanoparticle	NOUN
dentistry3000-784	223	18	against	against	ADP
dentistry3000-784	223	19	staphylococcus	staphylococcus	NOUN
dentistry3000-784	223	20	aureus	aureus	NOUN
dentistry3000-784	223	21	.	.	PUNCT
dentistry3000-784	224	1	biomaterial	biomaterial	ADJ
dentistry3000-784	224	2	investigations	investigation	NOUN
dentistry3000-784	224	3	in	in	ADP
dentistry3000-784	224	4	dentistry	dentistry	NOUN
dentistry3000-784	224	5	,	,	PUNCT
dentistry3000-784	224	6	7	7	NUM
dentistry3000-784	224	7	,	,	PUNCT
dentistry3000-784	224	8	105	105	NUM
dentistry3000-784	224	9	-	-	SYM
dentistry3000-784	224	10	109	109	NUM
dentistry3000-784	224	11	.	.	PUNCT
dentistry3000-784	224	12	24gini	24gini	NUM
dentistry3000-784	224	13	,	,	PUNCT
dentistry3000-784	224	14	t.	t.	PROPN
dentistry3000-784	224	15	g.	g.	PROPN
dentistry3000-784	224	16	&	&	CCONJ
dentistry3000-784	224	17	jeya	jeya	PROPN
dentistry3000-784	224	18	jothi	jothi	PROPN
dentistry3000-784	224	19	,	,	PUNCT
dentistry3000-784	224	20	g.	g.	PROPN
dentistry3000-784	224	21	(	(	PUNCT
dentistry3000-784	224	22	2018	2018	NUM
dentistry3000-784	224	23	)	)	PUNCT
dentistry3000-784	224	24	.	.	PUNCT
dentistry3000-784	225	1	column	column	NOUN
dentistry3000-784	225	2	chromatography	chromatography	NOUN
dentistry3000-784	225	3	and	and	CCONJ
dentistry3000-784	225	4	hplc	hplc	NOUN
dentistry3000-784	225	5	analysis	analysis	NOUN
dentistry3000-784	225	6	of	of	ADP
dentistry3000-784	225	7	phenolic	phenolic	ADJ
dentistry3000-784	225	8	compounds	compound	NOUN
dentistry3000-784	225	9	in	in	ADP
dentistry3000-784	225	10	the	the	DET
dentistry3000-784	225	11	fractions	fraction	NOUN
dentistry3000-784	225	12	of	of	ADP
dentistry3000-784	225	13	salvinia	salvinia	PROPN
dentistry3000-784	225	14	molesta	molesta	PROPN
dentistry3000-784	225	15	mitchell	mitchell	PROPN
dentistry3000-784	225	16	.	.	PUNCT
dentistry3000-784	226	1	egyptian	egyptian	PROPN
dentistry3000-784	226	2	journal	journal	PROPN
dentistry3000-784	226	3	of	of	ADP
dentistry3000-784	226	4	basic	basic	ADJ
dentistry3000-784	226	5	and	and	CCONJ
dentistry3000-784	226	6	applied	applied	ADJ
dentistry3000-784	226	7	sciences	science	NOUN
dentistry3000-784	226	8	,	,	PUNCT
dentistry3000-784	226	9	5	5	NUM
dentistry3000-784	226	10	,	,	PUNCT
dentistry3000-784	226	11	197	197	NUM
dentistry3000-784	226	12	-	-	SYM
dentistry3000-784	226	13	203	203	NUM
dentistry3000-784	226	14	.	.	PUNCT
dentistry3000-784	227	1	25nayan	25nayan	NUM
dentistry3000-784	227	2	,	,	PUNCT
dentistry3000-784	227	3	r.b	r.b	PROPN
dentistry3000-784	227	4	.	.	PROPN
dentistry3000-784	227	5	and	and	CCONJ
dentistry3000-784	227	6	shukla	shukla	PROPN
dentistry3000-784	227	7	,	,	PUNCT
dentistry3000-784	227	8	v.j	v.j	PROPN
dentistry3000-784	227	9	.	.	PROPN
dentistry3000-784	227	10	2011	2011	NUM
dentistry3000-784	227	11	.	.	PUNCT
dentistry3000-784	228	1	antibacterial	antibacterial	ADJ
dentistry3000-784	228	2	and	and	CCONJ
dentistry3000-784	228	3	antifungal	antifungal	ADJ
dentistry3000-784	228	4	activities	activity	NOUN
dentistry3000-784	228	5	from	from	ADP
dentistry3000-784	228	6	leaf	leaf	NOUN
dentistry3000-784	228	7	extracts	extract	NOUN
dentistry3000-784	228	8	of	of	ADP
dentistry3000-784	228	9	cassia	cassia	NOUN
dentistry3000-784	228	10	fistulal	fistulal	PROPN
dentistry3000-784	228	11	:	:	PUNCT
dentistry3000-784	228	12	an	an	DET
dentistry3000-784	228	13	ethnomedicinal	ethnomedicinal	ADJ
dentistry3000-784	228	14	plant	plant	NOUN
dentistry3000-784	228	15	.	.	PUNCT
dentistry3000-784	229	1	j	j	PROPN
dentistry3000-784	229	2	adv	adv	PROPN
dentistry3000-784	229	3	pharm	pharm	PROPN
dentistry3000-784	229	4	technol	technol	PROPN
dentistry3000-784	229	5	res.2(2	res.2(2	NOUN
dentistry3000-784	229	6	):	):	PUNCT
dentistry3000-784	229	7	104	104	NUM
dentistry3000-784	229	8	–	–	SYM
dentistry3000-784	229	9	109	109	NUM
dentistry3000-784	229	10	26tariq	26tariq	NUM
dentistry3000-784	229	11	,	,	PUNCT
dentistry3000-784	229	12	m.	m.	NOUN
dentistry3000-784	229	13	,	,	PUNCT
dentistry3000-784	229	14	gore	gore	PROPN
dentistry3000-784	229	15	,	,	PUNCT
dentistry3000-784	229	16	m.	m.	NOUN
dentistry3000-784	229	17	&	&	CCONJ
dentistry3000-784	229	18	aruna	aruna	PROPN
dentistry3000-784	229	19	,	,	PUNCT
dentistry3000-784	229	20	k.	k.	PROPN
dentistry3000-784	229	21	(	(	PUNCT
dentistry3000-784	229	22	2014	2014	NUM
dentistry3000-784	229	23	)	)	PUNCT
dentistry3000-784	229	24	.	.	PUNCT
dentistry3000-784	230	1	antibacterial	antibacterial	ADJ
dentistry3000-784	230	2	and	and	CCONJ
dentistry3000-784	230	3	synergistic	synergistic	ADJ
dentistry3000-784	230	4	activity	activity	NOUN
dentistry3000-784	230	5	of	of	ADP
dentistry3000-784	230	6	phytochemical	phytochemical	ADJ
dentistry3000-784	230	7	analysis	analysis	NOUN
dentistry3000-784	230	8	and	and	CCONJ
dentistry3000-784	230	9	an1bacterial	an1bacterial	ADJ
dentistry3000-784	230	10	ac1vity	ac1vity	NOUN
dentistry3000-784	230	11	of	of	ADP
dentistry3000-784	230	12	stevia	stevia	NOUN
dentistry3000-784	230	13	rebaudiana	rebaudiana	PROPN
dentistry3000-784	230	14	bertoni	bertoni	PROPN
dentistry3000-784	230	15	leaves	leave	NOUN
dentistry3000-784	230	16	extract	extract	VERB
dentistry3000-784	230	17	against	against	ADP
dentistry3000-784	230	18	streptococcus	streptococcus	NOUN
dentistry3000-784	230	19	sanguis	sanguis	NOUN
dentistry3000-784	230	20	(	(	PUNCT
dentistry3000-784	230	21	a	a	DET
dentistry3000-784	230	22	primary	primary	ADJ
dentistry3000-784	230	23	inhabitant	inhabitant	NOUN
dentistry3000-784	230	24	of	of	ADP
dentistry3000-784	230	25	dental	dental	ADJ
dentistry3000-784	230	26	plaque	plaque	NOUN
dentistry3000-784	230	27	):	):	PUNCT
dentistry3000-784	230	28	in	in	ADP
dentistry3000-784	230	29	vitro	vitro	X
dentistry3000-784	230	30	study	study	NOUN
dentistry3000-784	230	31	vol	vol	NOUN
dentistry3000-784	230	32	13	13	NUM
dentistry3000-784	230	33	no	no	DET
dentistry3000-784	230	34	1	1	NUM
dentistry3000-784	230	35	(	(	PUNCT
dentistry3000-784	230	36	2025	2025	NUM
dentistry3000-784	230	37	)	)	PUNCT
dentistry3000-784	230	38	doi	doi	NOUN
dentistry3000-784	230	39	10.5195	10.5195	NUM
dentistry3000-784	230	40	/	/	SYM
dentistry3000-784	230	41	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	230	42	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-784	230	43	ethanolic	ethanolic	ADJ
dentistry3000-784	230	44	ajwain	ajwain	NOUN
dentistry3000-784	230	45	(	(	PUNCT
dentistry3000-784	230	46	trachyspermum	trachyspermum	NOUN
dentistry3000-784	230	47	ammi	ammi	NOUN
dentistry3000-784	230	48	)	)	PUNCT
dentistry3000-784	230	49	extract	extract	NOUN
dentistry3000-784	230	50	on	on	ADP
dentistry3000-784	230	51	esbl	esbl	PROPN
dentistry3000-784	230	52	and	and	CCONJ
dentistry3000-784	230	53	mbl	mbl	NOUN
dentistry3000-784	230	54	producing	produce	VERB
dentistry3000-784	230	55	uropathogens	uropathogen	NOUN
dentistry3000-784	230	56	.	.	PUNCT
dentistry3000-784	231	1	int	int	PROPN
dentistry3000-784	231	2	j	j	PROPN
dentistry3000-784	231	3	pharm	pharm	PROPN
dentistry3000-784	231	4	pharm	pharm	PROPN
dentistry3000-784	231	5	sci	sci	PROPN
dentistry3000-784	231	6	,	,	PUNCT
dentistry3000-784	231	7	6	6	NUM
dentistry3000-784	231	8	,	,	PUNCT
dentistry3000-784	231	9	278	278	NUM
dentistry3000-784	231	10	-	-	SYM
dentistry3000-784	231	11	84	84	NUM
dentistry3000-784	231	12	.	.	PUNCT
dentistry3000-784	232	1	27de	27de	PROPN
dentistry3000-784	232	2	slavutzky	slavutzky	PROPN
dentistry3000-784	232	3	,	,	PUNCT
dentistry3000-784	232	4	s.	s.	PROPN
dentistry3000-784	232	5	m.	m.	PROPN
dentistry3000-784	232	6	b.	b.	PROPN
dentistry3000-784	232	7	(	(	PUNCT
dentistry3000-784	232	8	2010	2010	NUM
dentistry3000-784	232	9	)	)	PUNCT
dentistry3000-784	232	10	.	.	PUNCT
dentistry3000-784	233	1	stevia	stevia	PROPN
dentistry3000-784	233	2	and	and	CCONJ
dentistry3000-784	233	3	sucrose	sucrose	VERB
dentistry3000-784	233	4	effect	effect	NOUN
dentistry3000-784	233	5	on	on	ADP
dentistry3000-784	233	6	plaque	plaque	NOUN
dentistry3000-784	233	7	formation	formation	NOUN
dentistry3000-784	233	8	.	.	PUNCT
dentistry3000-784	234	1	journal	journal	PROPN
dentistry3000-784	234	2	für	für	PROPN
dentistry3000-784	234	3	verbraucherschutz	verbraucherschutz	PROPN
dentistry3000-784	234	4	und	und	PROPN
dentistry3000-784	234	5	lebensmittelsicherheit	lebensmittelsicherheit	NOUN
dentistry3000-784	234	6	,	,	PUNCT
dentistry3000-784	234	7	5	5	NUM
dentistry3000-784	234	8	,	,	PUNCT
dentistry3000-784	234	9	213216	213216	NUM
dentistry3000-784	234	10	.	.	PUNCT
dentistry3000-784	235	1	28contreras	28contreras	NUM
dentistry3000-784	235	2	,	,	PUNCT
dentistry3000-784	235	3	m.	m.	NOUN
dentistry3000-784	235	4	2013	2013	NUM
dentistry3000-784	235	5	.	.	PUNCT
dentistry3000-784	236	1	anticariogenic	anticariogenic	ADJ
dentistry3000-784	236	2	properties	property	NOUN
dentistry3000-784	236	3	and	and	CCONJ
dentistry3000-784	236	4	effects	effect	NOUN
dentistry3000-784	236	5	on	on	ADP
dentistry3000-784	236	6	periodontal	periodontal	ADJ
dentistry3000-784	236	7	structures	structure	NOUN
dentistry3000-784	236	8	of	of	ADP
dentistry3000-784	236	9	stevia	stevia	PROPN
dentistry3000-784	236	10	rebaudiana	rebaudiana	PROPN
dentistry3000-784	236	11	bertoni	bertoni	PROPN
dentistry3000-784	236	12	.	.	PUNCT
dentistry3000-784	237	1	narrative	narrative	PROPN
dentistry3000-784	237	2	review	review	PROPN
dentistry3000-784	237	3	.	.	PUNCT
dentistry3000-784	238	1	journal	journal	PROPN
dentistry3000-784	238	2	of	of	ADP
dentistry3000-784	238	3	oral	oral	ADJ
dentistry3000-784	238	4	research	research	NOUN
dentistry3000-784	238	5	,	,	PUNCT
dentistry3000-784	238	6	2	2	NUM
dentistry3000-784	238	7	,	,	PUNCT
dentistry3000-784	238	8	158166	158166	NUM
dentistry3000-784	238	9	.	.	PUNCT
dentistry3000-784	239	1	29mogana	29mogana	NUM
dentistry3000-784	239	2	,	,	PUNCT
dentistry3000-784	239	3	r.	r.	PROPN
dentistry3000-784	239	4	,	,	PUNCT
dentistry3000-784	239	5	adhikari	adhikari	PROPN
dentistry3000-784	239	6	,	,	PUNCT
dentistry3000-784	239	7	a.	a.	PROPN
dentistry3000-784	239	8	,	,	PUNCT
dentistry3000-784	239	9	tzar	tzar	PROPN
dentistry3000-784	239	10	,	,	PUNCT
dentistry3000-784	239	11	m.	m.	NOUN
dentistry3000-784	239	12	n.	n.	PROPN
dentistry3000-784	239	13	,	,	PUNCT
dentistry3000-784	239	14	ramliza	ramliza	PROPN
dentistry3000-784	239	15	,	,	PUNCT
dentistry3000-784	239	16	r.	r.	PROPN
dentistry3000-784	239	17	&	&	CCONJ
dentistry3000-784	239	18	wiart	wiart	PROPN
dentistry3000-784	239	19	,	,	PUNCT
dentistry3000-784	239	20	c.	c.	PROPN
dentistry3000-784	239	21	2020	2020	NUM
dentistry3000-784	239	22	.	.	PUNCT
dentistry3000-784	240	1	antibacterial	antibacterial	ADJ
dentistry3000-784	240	2	activities	activity	NOUN
dentistry3000-784	240	3	of	of	ADP
dentistry3000-784	240	4	the	the	DET
dentistry3000-784	240	5	extracts	extract	NOUN
dentistry3000-784	240	6	,	,	PUNCT
dentistry3000-784	240	7	fractions	fraction	NOUN
dentistry3000-784	240	8	and	and	CCONJ
dentistry3000-784	240	9	isolated	isolated	ADJ
dentistry3000-784	240	10	compounds	compound	NOUN
dentistry3000-784	240	11	from	from	ADP
dentistry3000-784	240	12	canarium	canarium	NOUN
dentistry3000-784	240	13	patentinervium	patentinervium	NOUN
dentistry3000-784	240	14	miq	miq	PROPN
dentistry3000-784	240	15	.	.	PROPN
dentistry3000-784	240	16	against	against	ADP
dentistry3000-784	240	17	bacterial	bacterial	ADJ
dentistry3000-784	240	18	clinical	clinical	ADJ
dentistry3000-784	240	19	isolates	isolate	NOUN
dentistry3000-784	240	20	.	.	PUNCT
dentistry3000-784	241	1	bmc	bmc	ADJ
dentistry3000-784	241	2	complementary	complementary	ADJ
dentistry3000-784	241	3	medicine	medicine	NOUN
dentistry3000-784	241	4	and	and	CCONJ
dentistry3000-784	241	5	therapies	therapy	NOUN
dentistry3000-784	241	6	,	,	PUNCT
dentistry3000-784	241	7	20	20	NUM
dentistry3000-784	241	8	,	,	PUNCT
dentistry3000-784	241	9	55	55	NUM
dentistry3000-784	241	10	.	.	PUNCT
dentistry3000-784	242	1	30parvekar	30parvekar	NUM
dentistry3000-784	242	2	,	,	PUNCT
dentistry3000-784	242	3	p.	p.	NOUN
dentistry3000-784	242	4	,	,	PUNCT
dentistry3000-784	242	5	palaskar	palaskar	PROPN
dentistry3000-784	242	6	,	,	PUNCT
dentistry3000-784	242	7	j.	j.	PROPN
dentistry3000-784	242	8	,	,	PUNCT
dentistry3000-784	242	9	metgud	metgud	PROPN
dentistry3000-784	242	10	,	,	PUNCT
dentistry3000-784	242	11	s.	s.	PROPN
dentistry3000-784	242	12	,	,	PUNCT
dentistry3000-784	242	13	maria	maria	PROPN
dentistry3000-784	242	14	,	,	PUNCT
dentistry3000-784	242	15	r.	r.	PROPN
dentistry3000-784	242	16	&	&	CCONJ
dentistry3000-784	242	17	dutta	dutta	PROPN
dentistry3000-784	242	18	,	,	PUNCT
dentistry3000-784	242	19	s.	s.	PROPN
dentistry3000-784	242	20	2020	2020	NUM
dentistry3000-784	242	21	.	.	PUNCT
dentistry3000-784	243	1	the	the	DET
dentistry3000-784	243	2	minimum	minimum	ADJ
dentistry3000-784	243	3	inhibitory	inhibitory	ADJ
dentistry3000-784	243	4	concentration	concentration	NOUN
dentistry3000-784	243	5	(	(	PUNCT
dentistry3000-784	243	6	mic	mic	ADJ
dentistry3000-784	243	7	)	)	PUNCT
dentistry3000-784	243	8	and	and	CCONJ
dentistry3000-784	243	9	minimum	minimum	ADJ
dentistry3000-784	243	10	bactericidal	bactericidal	ADJ
dentistry3000-784	243	11	concentration	concentration	NOUN
dentistry3000-784	243	12	(	(	PUNCT
dentistry3000-784	243	13	mbc	mbc	PROPN
dentistry3000-784	243	14	)	)	PUNCT
dentistry3000-784	243	15	of	of	ADP
dentistry3000-784	243	16	silver	silver	ADJ
dentistry3000-784	243	17	nanoparticles	nanoparticle	NOUN
dentistry3000-784	243	18	against	against	ADP
dentistry3000-784	243	19	staphylococcus	staphylococcus	NOUN
dentistry3000-784	243	20	aureus	aureus	NOUN
dentistry3000-784	243	21	.	.	PUNCT
dentistry3000-784	244	1	biomaterial	biomaterial	ADJ
dentistry3000-784	244	2	investigations	investigation	NOUN
dentistry3000-784	244	3	in	in	ADP
dentistry3000-784	244	4	dentistry	dentistry	NOUN
dentistry3000-784	244	5	,	,	PUNCT
dentistry3000-784	244	6	7	7	NUM
dentistry3000-784	244	7	,	,	PUNCT
dentistry3000-784	244	8	105	105	NUM
dentistry3000-784	244	9	-	-	SYM
dentistry3000-784	244	10	109	109	NUM
dentistry3000-784	244	11	.	.	PUNCT
dentistry3000-784	245	1	31brambilla	31brambilla	NUM
dentistry3000-784	245	2	,	,	PUNCT
dentistry3000-784	245	3	e.	e.	PROPN
dentistry3000-784	245	4	,	,	PUNCT
dentistry3000-784	245	5	cagetti	cagetti	PROPN
dentistry3000-784	245	6	,	,	PUNCT
dentistry3000-784	245	7	m.	m.	NOUN
dentistry3000-784	245	8	g.	g.	PROPN
dentistry3000-784	245	9	,	,	PUNCT
dentistry3000-784	245	10	ionescu	ionescu	PROPN
dentistry3000-784	245	11	,	,	PUNCT
dentistry3000-784	245	12	a.	a.	NOUN
dentistry3000-784	245	13	,	,	PUNCT
dentistry3000-784	245	14	campus	campus	PROPN
dentistry3000-784	245	15	,	,	PUNCT
dentistry3000-784	245	16	g.	g.	PROPN
dentistry3000-784	245	17	&	&	CCONJ
dentistry3000-784	245	18	lingström	lingström	PROPN
dentistry3000-784	245	19	,	,	PUNCT
dentistry3000-784	245	20	p.	p.	NOUN
dentistry3000-784	245	21	(	(	PUNCT
dentistry3000-784	245	22	2014	2014	NUM
dentistry3000-784	245	23	)	)	PUNCT
dentistry3000-784	245	24	.	.	PUNCT
dentistry3000-784	246	1	an	an	DET
dentistry3000-784	246	2	in	in	ADP
dentistry3000-784	246	3	vitro	vitro	X
dentistry3000-784	246	4	and	and	CCONJ
dentistry3000-784	246	5	in	in	ADP
dentistry3000-784	246	6	vivo	vivo	ADJ
dentistry3000-784	246	7	comparison	comparison	NOUN
dentistry3000-784	246	8	of	of	ADP
dentistry3000-784	246	9	the	the	DET
dentistry3000-784	246	10	effect	effect	NOUN
dentistry3000-784	246	11	of	of	ADP
dentistry3000-784	246	12	stevia	stevia	NOUN
dentistry3000-784	246	13	rebaudiana	rebaudiana	NOUN
dentistry3000-784	246	14	extracts	extract	NOUN
dentistry3000-784	246	15	on	on	ADP
dentistry3000-784	246	16	different	different	ADJ
dentistry3000-784	246	17	cariesrelated	cariesrelated	ADJ
dentistry3000-784	246	18	variables	variable	NOUN
dentistry3000-784	246	19	:	:	PUNCT
dentistry3000-784	246	20	a	a	DET
dentistry3000-784	246	21	randomized	randomized	ADJ
dentistry3000-784	246	22	controlled	control	VERB
dentistry3000-784	246	23	trial	trial	NOUN
dentistry3000-784	246	24	pilot	pilot	NOUN
dentistry3000-784	246	25	study	study	NOUN
dentistry3000-784	246	26	.	.	PUNCT
dentistry3000-784	247	1	caries	carie	NOUN
dentistry3000-784	247	2	research	research	NOUN
dentistry3000-784	247	3	,	,	PUNCT
dentistry3000-784	247	4	48	48	NUM
dentistry3000-784	247	5	,	,	PUNCT
dentistry3000-784	247	6	19	19	NUM
dentistry3000-784	247	7	-	-	SYM
dentistry3000-784	247	8	23	23	NUM
dentistry3000-784	247	9	.	.	PUNCT
dentistry3000-784	248	1	32fasiha	32fasiha	NUM
dentistry3000-784	248	2	a	a	PRON
dentistry3000-784	248	3	,	,	PUNCT
dentistry3000-784	248	4	shahid	shahid	PROPN
dentistry3000-784	248	5	b	b	PROPN
dentistry3000-784	248	6	,	,	PUNCT
dentistry3000-784	248	7	faiz	faiz	ADJ
dentistry3000-784	248	8	-	-	ADJ
dentistry3000-784	248	9	ulhassan	ulhassan	ADJ
dentistry3000-784	248	10	s.	s.	PROPN
dentistry3000-784	248	11	nutritional	nutritional	PROPN
dentistry3000-784	248	12	and	and	CCONJ
dentistry3000-784	248	13	medicinal	medicinal	ADJ
dentistry3000-784	248	14	properties	property	NOUN
dentistry3000-784	248	15	of	of	ADP
dentistry3000-784	248	16	stevia	stevia	PROPN
dentistry3000-784	248	17	rebaudiana	rebaudiana	PROPN
dentistry3000-784	248	18	.	.	PUNCT
dentistry3000-784	249	1	curre	curre	PROPN
dentistry3000-784	249	2	res	re	NOUN
dentistry3000-784	249	3	diabetes	diabetes	PROPN
dentistry3000-784	249	4	&	&	CCONJ
dentistry3000-784	249	5	obes	obes	PROPN
dentistry3000-784	249	6	j	j	PROPN
dentistry3000-784	249	7	(	(	PUNCT
dentistry3000-784	249	8	2020	2020	NUM
dentistry3000-784	249	9	)	)	PUNCT
dentistry3000-784	249	10	;	;	PUNCT
dentistry3000-784	249	11	13(4	13(4	NUM
dentistry3000-784	249	12	):	):	PUNCT
dentistry3000-784	249	13	555867	555867	NUM
dentistry3000-784	249	14	.	.	PUNCT
dentistry3000-784	250	1	33shakya	33shakya	NUM
dentistry3000-784	250	2	,	,	PUNCT
dentistry3000-784	250	3	a.	a.	PROPN
dentistry3000-784	250	4	k.	k.	PROPN
dentistry3000-784	250	5	(	(	PUNCT
dentistry3000-784	250	6	2016	2016	NUM
dentistry3000-784	250	7	)	)	PUNCT
dentistry3000-784	250	8	.	.	PUNCT
dentistry3000-784	251	1	medicinal	medicinal	ADJ
dentistry3000-784	251	2	plants	plant	NOUN
dentistry3000-784	251	3	:	:	PUNCT
dentistry3000-784	251	4	future	future	ADJ
dentistry3000-784	251	5	source	source	NOUN
dentistry3000-784	251	6	of	of	ADP
dentistry3000-784	251	7	new	new	ADJ
dentistry3000-784	251	8	drugs	drug	NOUN
dentistry3000-784	251	9	.	.	PUNCT
dentistry3000-784	252	1	international	international	ADJ
dentistry3000-784	252	2	journal	journal	NOUN
dentistry3000-784	252	3	of	of	ADP
dentistry3000-784	252	4	herbal	herbal	ADJ
dentistry3000-784	252	5	medicine	medicine	NOUN
dentistry3000-784	252	6	,	,	PUNCT
dentistry3000-784	252	7	4	4	NUM
dentistry3000-784	252	8	,	,	PUNCT
dentistry3000-784	252	9	59	59	NUM
dentistry3000-784	252	10	-	-	SYM
dentistry3000-784	252	11	64	64	NUM
dentistry3000-784	252	12	.	.	PUNCT
dentistry3000-784	253	1	34raut	34raut	PROPN
dentistry3000-784	253	2	,	,	PUNCT
dentistry3000-784	253	3	d.	d.	PROPN
dentistry3000-784	253	4	&	&	CCONJ
dentistry3000-784	253	5	aruna	aruna	PROPN
dentistry3000-784	253	6	,	,	PUNCT
dentistry3000-784	253	7	k.	k.	PROPN
dentistry3000-784	253	8	(	(	PUNCT
dentistry3000-784	253	9	2017	2017	NUM
dentistry3000-784	253	10	)	)	PUNCT
dentistry3000-784	253	11	.	.	PUNCT
dentistry3000-784	254	1	antimicrobial	antimicrobial	ADJ
dentistry3000-784	254	2	activity	activity	NOUN
dentistry3000-784	254	3	of	of	ADP
dentistry3000-784	254	4	stevia	stevia	NOUN
dentistry3000-784	254	5	rebaudiana	rebaudiana	PROPN
dentistry3000-784	254	6	against	against	ADP
dentistry3000-784	254	7	antibiotic	antibiotic	ADJ
dentistry3000-784	254	8	resistant	resistant	ADJ
dentistry3000-784	254	9	esbl	esbl	NOUN
dentistry3000-784	254	10	producing	produce	VERB
dentistry3000-784	254	11	uropathogens	uropathogen	NOUN
dentistry3000-784	254	12	and	and	CCONJ
dentistry3000-784	254	13	evaluation	evaluation	NOUN
dentistry3000-784	254	14	of	of	ADP
dentistry3000-784	254	15	its	its	PRON
dentistry3000-784	254	16	antioxidant	antioxidant	ADJ
dentistry3000-784	254	17	activity	activity	NOUN
dentistry3000-784	254	18	.	.	PUNCT
dentistry3000-784	255	1	int	int	NOUN
dentistry3000-784	255	2	.	.	PUNCT
dentistry3000-784	256	1	j.	j.	PROPN
dentistry3000-784	256	2	adv	adv	PROPN
dentistry3000-784	256	3	.	.	PUNCT
dentistry3000-784	257	1	res	re	NOUN
dentistry3000-784	257	2	.	.	PUNCT
dentistry3000-784	258	1	biol	biol	PROPN
dentistry3000-784	258	2	.	.	PUNCT
dentistry3000-784	259	1	sci	sci	PROPN
dentistry3000-784	259	2	,	,	PUNCT
dentistry3000-784	259	3	4	4	NUM
dentistry3000-784	259	4	,	,	PUNCT
dentistry3000-784	259	5	110	110	NUM
dentistry3000-784	259	6	-	-	SYM
dentistry3000-784	259	7	118	118	NUM
dentistry3000-784	259	8	.	.	PUNCT
dentistry3000-784	260	1	35lemus	35lemus	NUM
dentistry3000-784	260	2	-	-	PUNCT
dentistry3000-784	260	3	mondaca	mondaca	PROPN
dentistry3000-784	260	4	,	,	PUNCT
dentistry3000-784	260	5	r.	r.	PROPN
dentistry3000-784	260	6	,	,	PUNCT
dentistry3000-784	260	7	vegagálvez	vegagálvez	PROPN
dentistry3000-784	260	8	,	,	PUNCT
dentistry3000-784	260	9	a.	a.	PROPN
dentistry3000-784	260	10	,	,	PUNCT
dentistry3000-784	260	11	rojas	rojas	PROPN
dentistry3000-784	260	12	,	,	PUNCT
dentistry3000-784	260	13	p.	p.	PROPN
dentistry3000-784	260	14	,	,	PUNCT
dentistry3000-784	260	15	stucken	stucken	PROPN
dentistry3000-784	260	16	,	,	PUNCT
dentistry3000-784	260	17	k.	k.	PROPN
dentistry3000-784	260	18	,	,	PUNCT
dentistry3000-784	260	19	delporte	delporte	PROPN
dentistry3000-784	260	20	,	,	PUNCT
dentistry3000-784	260	21	c.	c.	PROPN
dentistry3000-784	260	22	,	,	PUNCT
dentistry3000-784	260	23	valenzuela	valenzuela	PROPN
dentistry3000-784	260	24	-	-	PUNCT
dentistry3000-784	260	25	barra	barra	PROPN
dentistry3000-784	260	26	,	,	PUNCT
dentistry3000-784	260	27	g.	g.	PROPN
dentistry3000-784	260	28	,	,	PUNCT
dentistry3000-784	260	29	jagus	jagus	PROPN
dentistry3000-784	260	30	,	,	PUNCT
dentistry3000-784	260	31	r.	r.	PROPN
dentistry3000-784	260	32	j.	j.	PROPN
dentistry3000-784	260	33	,	,	PUNCT
dentistry3000-784	260	34	agüero	agüero	NOUN
dentistry3000-784	260	35	,	,	PUNCT
dentistry3000-784	260	36	m.	m.	NOUN
dentistry3000-784	260	37	v.	v.	PROPN
dentistry3000-784	260	38	&	&	CCONJ
dentistry3000-784	260	39	pasten	pasten	VERB
dentistry3000-784	260	40	,	,	PUNCT
dentistry3000-784	260	41	a.	a.	NOUN
dentistry3000-784	260	42	(	(	PUNCT
dentistry3000-784	260	43	2018	2018	NUM
dentistry3000-784	260	44	)	)	PUNCT
dentistry3000-784	260	45	.	.	PUNCT
dentistry3000-784	261	1	antioxidant	antioxidant	ADJ
dentistry3000-784	261	2	,	,	PUNCT
dentistry3000-784	261	3	antimicrobial	antimicrobial	ADJ
dentistry3000-784	261	4	and	and	CCONJ
dentistry3000-784	261	5	antiinflammatory	antiinflammatory	NOUN
dentistry3000-784	261	6	potential	potential	NOUN
dentistry3000-784	261	7	of	of	ADP
dentistry3000-784	261	8	stevia	stevia	PROPN
dentistry3000-784	261	9	rebaudiana	rebaudiana	PROPN
dentistry3000-784	261	10	leaves	leave	NOUN
dentistry3000-784	261	11	:	:	PUNCT
dentistry3000-784	261	12	effect	effect	NOUN
dentistry3000-784	261	13	of	of	ADP
dentistry3000-784	261	14	different	different	ADJ
dentistry3000-784	261	15	drying	dry	VERB
dentistry3000-784	261	16	methods	method	NOUN
dentistry3000-784	261	17	.	.	PUNCT
dentistry3000-784	262	1	journal	journal	NOUN
dentistry3000-784	262	2	of	of	ADP
dentistry3000-784	262	3	applied	apply	VERB
dentistry3000-784	262	4	research	research	NOUN
dentistry3000-784	262	5	on	on	ADP
dentistry3000-784	262	6	medicinal	medicinal	ADJ
dentistry3000-784	262	7	and	and	CCONJ
dentistry3000-784	262	8	aromatic	aromatic	ADJ
dentistry3000-784	262	9	plants	plant	NOUN
dentistry3000-784	262	10	,	,	PUNCT
dentistry3000-784	262	11	11	11	NUM
dentistry3000-784	262	12	,	,	PUNCT
dentistry3000-784	262	13	37	37	NUM
dentistry3000-784	262	14	-	-	SYM
dentistry3000-784	262	15	46	46	NUM
dentistry3000-784	262	16	.	.	PUNCT
dentistry3000-784	263	1	36moussaoui	36moussaoui	NUM
dentistry3000-784	263	2	,	,	PUNCT
dentistry3000-784	263	3	f.	f.	PROPN
dentistry3000-784	263	4	&	&	CCONJ
dentistry3000-784	263	5	alaoui	alaoui	PROPN
dentistry3000-784	263	6	,	,	PUNCT
dentistry3000-784	263	7	t.	t.	PROPN
dentistry3000-784	263	8	(	(	PUNCT
dentistry3000-784	263	9	2016	2016	NUM
dentistry3000-784	263	10	)	)	PUNCT
dentistry3000-784	263	11	.	.	PUNCT
dentistry3000-784	264	1	evaluation	evaluation	NOUN
dentistry3000-784	264	2	of	of	ADP
dentistry3000-784	264	3	antibacterial	antibacterial	ADJ
dentistry3000-784	264	4	activity	activity	NOUN
dentistry3000-784	264	5	and	and	CCONJ
dentistry3000-784	264	6	synergistic	synergistic	ADJ
dentistry3000-784	264	7	effect	effect	NOUN
dentistry3000-784	264	8	between	between	ADP
dentistry3000-784	264	9	antibiotic	antibiotic	NOUN
dentistry3000-784	264	10	and	and	CCONJ
dentistry3000-784	264	11	the	the	DET
dentistry3000-784	264	12	essential	essential	ADJ
dentistry3000-784	264	13	oils	oil	NOUN
dentistry3000-784	264	14	of	of	ADP
dentistry3000-784	264	15	some	some	DET
dentistry3000-784	264	16	medicinal	medicinal	ADJ
dentistry3000-784	264	17	plants	plant	NOUN
dentistry3000-784	264	18	.	.	PUNCT
dentistry3000-784	265	1	asian	asian	PROPN
dentistry3000-784	265	2	pacific	pacific	PROPN
dentistry3000-784	265	3	journal	journal	PROPN
dentistry3000-784	265	4	of	of	ADP
dentistry3000-784	265	5	tropical	tropical	ADJ
dentistry3000-784	265	6	biomedicine	biomedicine	NOUN
dentistry3000-784	265	7	,	,	PUNCT
dentistry3000-784	265	8	6	6	NUM
dentistry3000-784	265	9	,	,	PUNCT
dentistry3000-784	265	10	32	32	NUM
dentistry3000-784	265	11	-	-	SYM
dentistry3000-784	265	12	37	37	NUM
dentistry3000-784	265	13	.	.	PUNCT
dentistry3000-784	266	1	37parkar	37parkar	NUM
dentistry3000-784	266	2	,	,	PUNCT
dentistry3000-784	266	3	s.	s.	PROPN
dentistry3000-784	266	4	g.	g.	PROPN
dentistry3000-784	266	5	,	,	PUNCT
dentistry3000-784	266	6	stevenson	stevenson	PROPN
dentistry3000-784	266	7	,	,	PUNCT
dentistry3000-784	266	8	d.	d.	PROPN
dentistry3000-784	266	9	e.	e.	PROPN
dentistry3000-784	266	10	,	,	PUNCT
dentistry3000-784	266	11	&	&	CCONJ
dentistry3000-784	266	12	skinner	skinner	PROPN
dentistry3000-784	266	13	,	,	PUNCT
dentistry3000-784	266	14	m.	m.	NOUN
dentistry3000-784	266	15	a.	a.	NOUN
dentistry3000-784	266	16	(	(	PUNCT
dentistry3000-784	266	17	2008	2008	NUM
dentistry3000-784	266	18	)	)	PUNCT
dentistry3000-784	266	19	.	.	PUNCT
dentistry3000-784	267	1	the	the	DET
dentistry3000-784	267	2	potential	potential	ADJ
dentistry3000-784	267	3	influence	influence	NOUN
dentistry3000-784	267	4	of	of	ADP
dentistry3000-784	267	5	fruit	fruit	NOUN
dentistry3000-784	267	6	polyphenols	polyphenol	NOUN
dentistry3000-784	267	7	on	on	ADP
dentistry3000-784	267	8	colonic	colonic	ADJ
dentistry3000-784	267	9	microflora	microflora	NOUN
dentistry3000-784	267	10	and	and	CCONJ
dentistry3000-784	267	11	human	human	ADJ
dentistry3000-784	267	12	gut	gut	NOUN
dentistry3000-784	267	13	health	health	NOUN
dentistry3000-784	267	14	.	.	PUNCT
dentistry3000-784	268	1	international	international	ADJ
dentistry3000-784	268	2	journal	journal	PROPN
dentistry3000-784	268	3	of	of	ADP
dentistry3000-784	268	4	food	food	NOUN
dentistry3000-784	268	5	microbiology	microbiology	NOUN
dentistry3000-784	268	6	,	,	PUNCT
dentistry3000-784	268	7	124(3	124(3	NUM
dentistry3000-784	268	8	)	)	PUNCT
dentistry3000-784	268	9	,	,	PUNCT
dentistry3000-784	268	10	295	295	NUM
dentistry3000-784	268	11	–	–	PUNCT
dentistry3000-784	268	12	298	298	NUM
dentistry3000-784	268	13	.	.	PUNCT
dentistry3000-784	269	1	38zhang	38zhang	NUM
dentistry3000-784	269	2	,	,	PUNCT
dentistry3000-784	269	3	y.	y.	PROPN
dentistry3000-784	269	4	,	,	PUNCT
dentistry3000-784	269	5	wang	wang	PROPN
dentistry3000-784	269	6	,	,	PUNCT
dentistry3000-784	269	7	j.	j.	PROPN
dentistry3000-784	269	8	f.	f.	PROPN
dentistry3000-784	269	9	,	,	PUNCT
dentistry3000-784	269	10	dong	dong	PROPN
dentistry3000-784	269	11	,	,	PUNCT
dentistry3000-784	269	12	j.	j.	PROPN
dentistry3000-784	269	13	,	,	PUNCT
dentistry3000-784	269	14	wei	wei	PROPN
dentistry3000-784	269	15	,	,	PUNCT
dentistry3000-784	269	16	j.	j.	PROPN
dentistry3000-784	269	17	y.	y.	PROPN
dentistry3000-784	269	18	,	,	PUNCT
dentistry3000-784	269	19	wang	wang	PROPN
dentistry3000-784	269	20	,	,	PUNCT
dentistry3000-784	269	21	y.	y.	PROPN
dentistry3000-784	269	22	n.	n.	PROPN
dentistry3000-784	269	23	,	,	PUNCT
dentistry3000-784	269	24	dai	dai	PROPN
dentistry3000-784	269	25	,	,	PUNCT
dentistry3000-784	269	26	x.	x.	PROPN
dentistry3000-784	269	27	h.	h.	PROPN
dentistry3000-784	269	28	,	,	PUNCT
dentistry3000-784	269	29	&	&	CCONJ
dentistry3000-784	269	30	deng	deng	PROPN
dentistry3000-784	269	31	,	,	PUNCT
dentistry3000-784	269	32	x.	x.	PROPN
dentistry3000-784	269	33	m.	m.	NOUN
dentistry3000-784	269	34	(	(	PUNCT
dentistry3000-784	269	35	2013	2013	NUM
dentistry3000-784	269	36	)	)	PUNCT
dentistry3000-784	269	37	.	.	PUNCT
dentistry3000-784	270	1	inhibition	inhibition	NOUN
dentistry3000-784	270	2	of	of	ADP
dentistry3000-784	270	3	α	α	NOUN
dentistry3000-784	270	4	-	-	ADJ
dentistry3000-784	270	5	toxin	toxin	NOUN
dentistry3000-784	270	6	production	production	NOUN
dentistry3000-784	270	7	by	by	ADP
dentistry3000-784	270	8	subinhibitory	subinhibitory	ADJ
dentistry3000-784	270	9	concentrations	concentration	NOUN
dentistry3000-784	270	10	of	of	ADP
dentistry3000-784	270	11	naringenin	naringenin	PROPN
dentistry3000-784	270	12	controls	control	NOUN
dentistry3000-784	270	13	staphylococcus	staphylococcus	NOUN
dentistry3000-784	270	14	aureus	aureus	NOUN
dentistry3000-784	270	15	pneumonia	pneumonia	NOUN
dentistry3000-784	270	16	.	.	PUNCT
dentistry3000-784	271	1	fitoterapia	fitoterapia	PROPN
dentistry3000-784	271	2	,	,	PUNCT
dentistry3000-784	271	3	86	86	NUM
dentistry3000-784	271	4	,	,	PUNCT
dentistry3000-784	271	5	9299	9299	NUM
dentistry3000-784	271	6	.	.	PUNCT
dentistry3000-784	272	1	39wang	39wang	NUM
dentistry3000-784	272	2	,	,	PUNCT
dentistry3000-784	272	3	l.	l.	PROPN
dentistry3000-784	272	4	h.	h.	PROPN
dentistry3000-784	272	5	,	,	PUNCT
dentistry3000-784	272	6	zeng	zeng	PROPN
dentistry3000-784	272	7	,	,	PUNCT
dentistry3000-784	272	8	x.	x.	PROPN
dentistry3000-784	272	9	a.	a.	PROPN
dentistry3000-784	272	10	,	,	PUNCT
dentistry3000-784	272	11	wang	wang	PROPN
dentistry3000-784	272	12	,	,	PUNCT
dentistry3000-784	272	13	m.	m.	PROPN
dentistry3000-784	272	14	s.	s.	PROPN
dentistry3000-784	272	15	,	,	PUNCT
dentistry3000-784	272	16	brennan	brennan	PROPN
dentistry3000-784	272	17	,	,	PUNCT
dentistry3000-784	272	18	c.	c.	PROPN
dentistry3000-784	272	19	s.	s.	PROPN
dentistry3000-784	272	20	,	,	PUNCT
dentistry3000-784	272	21	&	&	CCONJ
dentistry3000-784	272	22	gong	gong	PROPN
dentistry3000-784	272	23	,	,	PUNCT
dentistry3000-784	272	24	d.	d.	PROPN
dentistry3000-784	272	25	(	(	PUNCT
dentistry3000-784	272	26	2018	2018	NUM
dentistry3000-784	272	27	)	)	PUNCT
dentistry3000-784	272	28	.	.	PUNCT
dentistry3000-784	273	1	modification	modification	NOUN
dentistry3000-784	273	2	of	of	ADP
dentistry3000-784	273	3	membrane	membrane	NOUN
dentistry3000-784	273	4	properties	property	NOUN
dentistry3000-784	273	5	and	and	CCONJ
dentistry3000-784	273	6	fatty	fatty	NOUN
dentistry3000-784	273	7	acids	acid	NOUN
dentistry3000-784	273	8	biosynthesis	biosynthesis	NOUN
dentistry3000-784	273	9	-	-	PUNCT
dentistry3000-784	273	10	related	relate	VERB
dentistry3000-784	273	11	genes	gene	NOUN
dentistry3000-784	273	12	in	in	ADP
dentistry3000-784	273	13	escherichia	escherichia	NOUN
dentistry3000-784	273	14	coli	coli	NOUN
dentistry3000-784	273	15	and	and	CCONJ
dentistry3000-784	273	16	staphylococcus	staphylococcus	NOUN
dentistry3000-784	273	17	aureus	aureus	NOUN
dentistry3000-784	273	18	:	:	PUNCT
dentistry3000-784	273	19	phytochemical	phytochemical	ADJ
dentistry3000-784	273	20	analysis	analysis	NOUN
dentistry3000-784	273	21	and	and	CCONJ
dentistry3000-784	273	22	an1bacterial	an1bacterial	ADJ
dentistry3000-784	273	23	ac1vity	ac1vity	NOUN
dentistry3000-784	273	24	of	of	ADP
dentistry3000-784	273	25	stevia	stevia	NOUN
dentistry3000-784	273	26	rebaudiana	rebaudiana	PROPN
dentistry3000-784	273	27	bertoni	bertoni	PROPN
dentistry3000-784	273	28	leaves	leave	NOUN
dentistry3000-784	273	29	extract	extract	VERB
dentistry3000-784	273	30	against	against	ADP
dentistry3000-784	273	31	streptococcus	streptococcus	NOUN
dentistry3000-784	273	32	sanguis	sanguis	NOUN
dentistry3000-784	273	33	(	(	PUNCT
dentistry3000-784	273	34	a	a	DET
dentistry3000-784	273	35	primary	primary	ADJ
dentistry3000-784	273	36	inhabitant	inhabitant	NOUN
dentistry3000-784	273	37	of	of	ADP
dentistry3000-784	273	38	dental	dental	ADJ
dentistry3000-784	273	39	plaque	plaque	NOUN
dentistry3000-784	273	40	):	):	PUNCT
dentistry3000-784	273	41	in	in	ADP
dentistry3000-784	273	42	vitro	vitro	X
dentistry3000-784	273	43	study	study	NOUN
dentistry3000-784	273	44	vol	vol	NOUN
dentistry3000-784	273	45	13	13	NUM
dentistry3000-784	273	46	no	no	DET
dentistry3000-784	273	47	1	1	NUM
dentistry3000-784	273	48	(	(	PUNCT
dentistry3000-784	273	49	2025	2025	NUM
dentistry3000-784	273	50	)	)	PUNCT
dentistry3000-784	273	51	doi	doi	NOUN
dentistry3000-784	273	52	10.5195	10.5195	NUM
dentistry3000-784	273	53	/	/	SYM
dentistry3000-784	273	54	d3000.2025.784	d3000.2025.784	NOUN
dentistry3000-784	273	55	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	NOUN
dentistry3000-784	273	56	implications	implication	NOUN
dentistry3000-784	273	57	for	for	ADP
dentistry3000-784	273	58	the	the	DET
dentistry3000-784	273	59	antibacterial	antibacterial	ADJ
dentistry3000-784	273	60	mechanism	mechanism	NOUN
dentistry3000-784	273	61	of	of	ADP
dentistry3000-784	273	62	naringenin	naringenin	NOUN
dentistry3000-784	273	63	.	.	PUNCT
dentistry3000-784	274	1	biochimica	biochimica	PROPN
dentistry3000-784	274	2	et	et	PROPN
dentistry3000-784	274	3	biophysica	biophysica	PROPN
dentistry3000-784	274	4	acta	acta	PROPN
dentistry3000-784	274	5	.	.	PUNCT
dentistry3000-784	275	1	biomembranes	biomembranes	PROPN
dentistry3000-784	275	2	,	,	PUNCT
dentistry3000-784	275	3	1860(2	1860(2	NUM
dentistry3000-784	275	4	)	)	PUNCT
dentistry3000-784	275	5	,	,	PUNCT
dentistry3000-784	275	6	481	481	NUM
dentistry3000-784	275	7	–	–	PUNCT
dentistry3000-784	275	8	490	490	NUM
dentistry3000-784	275	9	.	.	PUNCT
dentistry3000-784	276	1	40toda	40toda	NUM
dentistry3000-784	276	2	,	,	PUNCT
dentistry3000-784	276	3	m.	m.	NOUN
dentistry3000-784	276	4	,	,	PUNCT
dentistry3000-784	276	5	okubo	okubo	PROPN
dentistry3000-784	276	6	,	,	PUNCT
dentistry3000-784	276	7	s.	s.	PROPN
dentistry3000-784	276	8	,	,	PUNCT
dentistry3000-784	276	9	ikigai	ikigai	PROPN
dentistry3000-784	276	10	,	,	PUNCT
dentistry3000-784	276	11	h.	h.	PROPN
dentistry3000-784	276	12	,	,	PUNCT
dentistry3000-784	276	13	suzuki	suzuki	PROPN
dentistry3000-784	276	14	,	,	PUNCT
dentistry3000-784	276	15	t.	t.	PROPN
dentistry3000-784	276	16	,	,	PUNCT
dentistry3000-784	276	17	suzuki	suzuki	PROPN
dentistry3000-784	276	18	,	,	PUNCT
dentistry3000-784	276	19	y.	y.	PROPN
dentistry3000-784	276	20	,	,	PUNCT
dentistry3000-784	276	21	hara	hara	PROPN
dentistry3000-784	276	22	,	,	PUNCT
dentistry3000-784	276	23	y.	y.	NOUN
dentistry3000-784	276	24	and	and	CCONJ
dentistry3000-784	276	25	shimamura	shimamura	NOUN
dentistry3000-784	276	26	,	,	PUNCT
dentistry3000-784	276	27	t.	t.	PROPN
dentistry3000-784	276	28	(	(	PUNCT
dentistry3000-784	276	29	1992	1992	NUM
dentistry3000-784	276	30	)	)	PUNCT
dentistry3000-784	276	31	microbiol	microbiol	NOUN
dentistry3000-784	276	32	.	.	PUNCT
dentistry3000-784	277	1	immunol	immunol	NOUN
dentistry3000-784	277	2	.	.	PUNCT
dentistry3000-784	278	1	36	36	NUM
dentistry3000-784	278	2	,	,	PUNCT
dentistry3000-784	278	3	9991001	9991001	NUM
dentistry3000-784	278	4	.	.	PUNCT
dentistry3000-784	279	1	41ring	41ring	NUM
dentistry3000-784	279	2	,	,	PUNCT
dentistry3000-784	279	3	k.	k.	PROPN
dentistry3000-784	279	4	,	,	PUNCT
dentistry3000-784	279	5	ehle	ehle	PROPN
dentistry3000-784	279	6	,	,	PUNCT
dentistry3000-784	279	7	h.	h.	PROPN
dentistry3000-784	279	8	,	,	PUNCT
dentistry3000-784	279	9	foit	foit	PROPN
dentistry3000-784	279	10	,	,	PUNCT
dentistry3000-784	279	11	b.	b.	PROPN
dentistry3000-784	279	12	and	and	CCONJ
dentistry3000-784	279	13	schwarz	schwarz	PROPN
dentistry3000-784	279	14	,	,	PUNCT
dentistry3000-784	279	15	m.	m.	NOUN
dentistry3000-784	279	16	(	(	PUNCT
dentistry3000-784	279	17	1977	1977	NUM
dentistry3000-784	279	18	)	)	PUNCT
dentistry3000-784	279	19	flavonoids	flavonoid	NOUN
dentistry3000-784	279	20	and	and	CCONJ
dentistry3000-784	279	21	bioflavonoids	bioflavonoid	NOUN
dentistry3000-784	279	22	,	,	PUNCT
dentistry3000-784	279	23	proc	proc	NOUN
dentistry3000-784	279	24	.	.	PUNCT
dentistry3000-784	280	1	5th	5th	ADJ
dentistry3000-784	280	2	symp	symp	NOUN
dentistry3000-784	280	3	.	.	PUNCT
dentistry3000-784	281	1	(	(	PUNCT
dentistry3000-784	281	2	farkas	farkas	PROPN
dentistry3000-784	281	3	,	,	PUNCT
dentistry3000-784	281	4	l.	l.	PROPN
dentistry3000-784	281	5	,	,	PUNCT
dentistry3000-784	281	6	abor	abor	PROPN
dentistry3000-784	281	7	,	,	PUNCT
dentistry3000-784	281	8	h.	h.	PROPN
dentistry3000-784	281	9	and	and	CCONJ
dentistry3000-784	281	10	kally	kally	PROPN
dentistry3000-784	281	11	,	,	PUNCT
dentistry3000-784	281	12	f.	f.	PROPN
dentistry3000-784	281	13	,	,	PUNCT
dentistry3000-784	281	14	eds	eds	PROPN
dentistry3000-784	281	15	.	.	PUNCT
dentistry3000-784	281	16	)	)	PUNCT
dentistry3000-784	281	17	,	,	PUNCT
dentistry3000-784	281	18	pp	pp	ADP
dentistry3000-784	281	19	.	.	PUNCT
dentistry3000-784	282	1	427	427	NUM
dentistry3000-784	282	2	-	-	SYM
dentistry3000-784	282	3	437	437	NUM
dentistry3000-784	282	4	.	.	PUNCT
dentistry3000-784	282	5	18	18	NUM
dentistry3000-784	282	6	42perrissoud	42perrissoud	PROPN
dentistry3000-784	282	7	,	,	PUNCT
dentistry3000-784	282	8	d.	d.	PROPN
dentistry3000-784	282	9	,	,	PUNCT
dentistry3000-784	282	10	maignan	maignan	PROPN
dentistry3000-784	282	11	,	,	PUNCT
dentistry3000-784	282	12	m.f	m.f	PROPN
dentistry3000-784	282	13	.	.	PROPN
dentistry3000-784	282	14	and	and	CCONJ
dentistry3000-784	282	15	anderset	anderset	PROPN
dentistry3000-784	282	16	,	,	PUNCT
dentistry3000-784	282	17	g.	g.	PROPN
dentistry3000-784	282	18	(	(	PUNCT
dentistry3000-784	282	19	1981	1981	NUM
dentistry3000-784	282	20	)	)	PUNCT
dentistry3000-784	282	21	int	int	NOUN
dentistry3000-784	282	22	.	.	PUNCT
dentistry3000-784	283	1	cong	cong	PROPN
dentistry3000-784	283	2	.	.	PUNCT
dentistry3000-784	284	1	symp	symp	PROPN
dentistry3000-784	284	2	.	.	PUNCT
dentistry3000-784	285	1	ser.-r	ser.-r	X
dentistry3000-784	285	2	.	.	PUNCT
dentistry3000-784	286	1	soc	soc	PROPN
dentistry3000-784	286	2	.	.	PUNCT
dentistry3000-784	287	1	med	med	PROPN
dentistry3000-784	287	2	.	.	PUNCT
dentistry3000-784	288	1	47	47	NUM
dentistry3000-784	288	2	,	,	PUNCT
dentistry3000-784	288	3	21	21	NUM
dentistry3000-784	288	4	-	-	SYM
dentistry3000-784	288	5	25	25	NUM
dentistry3000-784	288	6	.	.	PUNCT
dentistry3000-784	289	1	43hajime	43hajime	NOUN
dentistry3000-784	289	2	ikigai	ikigai	PROPN
dentistry3000-784	289	3	,	,	PUNCT
dentistry3000-784	289	4	taiji	taiji	NOUN
dentistry3000-784	289	5	nakae	nakae	ADJ
dentistry3000-784	289	6	,	,	PUNCT
dentistry3000-784	289	7	yukihiko	yukihiko	NOUN
dentistry3000-784	289	8	hara	hara	NOUN
dentistry3000-784	289	9	,	,	PUNCT
dentistry3000-784	289	10	tadakatsu	tadakatsu	NOUN
dentistry3000-784	289	11	shimamura	shimamura	NOUN
dentistry3000-784	289	12	,	,	PUNCT
dentistry3000-784	289	13	(	(	PUNCT
dentistry3000-784	289	14	1993	1993	NUM
dentistry3000-784	289	15	)	)	PUNCT
dentistry3000-784	289	16	.	.	PUNCT
dentistry3000-784	290	1	bactericidal	bactericidal	ADJ
dentistry3000-784	290	2	catechins	catechin	NOUN
dentistry3000-784	290	3	damage	damage	VERB
dentistry3000-784	290	4	the	the	DET
dentistry3000-784	290	5	lipid	lipid	NOUN
dentistry3000-784	290	6	bilayer	bilayer	NOUN
dentistry3000-784	290	7	,	,	PUNCT
dentistry3000-784	291	1	biochimica	biochimica	PROPN
dentistry3000-784	291	2	et	et	PROPN
dentistry3000-784	291	3	biophysica	biophysica	PROPN
dentistry3000-784	291	4	acta	acta	PROPN
dentistry3000-784	291	5	(	(	PUNCT
dentistry3000-784	291	6	bba	bba	NOUN
dentistry3000-784	291	7	)	)	PUNCT
dentistry3000-784	291	8	biomembranes	biomembrane	NOUN
dentistry3000-784	291	9	,	,	PUNCT
dentistry3000-784	291	10	1147	1147	NUM
dentistry3000-784	291	11	,	,	PUNCT
dentistry3000-784	291	12	132	132	NUM
dentistry3000-784	291	13	-	-	SYM
dentistry3000-784	291	14	136	136	NUM
dentistry3000-784	291	15	.	.	PUNCT
dentistry3000-784	292	1	44thati	44thati	NUM
dentistry3000-784	292	2	,	,	PUNCT
dentistry3000-784	292	3	b.	b.	PROPN
dentistry3000-784	292	4	,	,	PUNCT
dentistry3000-784	292	5	noble	noble	ADJ
dentistry3000-784	292	6	,	,	PUNCT
dentistry3000-784	292	7	a.	a.	PROPN
dentistry3000-784	292	8	,	,	PUNCT
dentistry3000-784	292	9	rowan	rowan	PROPN
dentistry3000-784	292	10	,	,	PUNCT
dentistry3000-784	292	11	r.	r.	PROPN
dentistry3000-784	292	12	,	,	PUNCT
dentistry3000-784	292	13	creaven	creaven	ADJ
dentistry3000-784	292	14	,	,	PUNCT
dentistry3000-784	292	15	b.	b.	PROPN
dentistry3000-784	292	16	s.	s.	PROPN
dentistry3000-784	292	17	,	,	PUNCT
dentistry3000-784	292	18	walsh	walsh	NOUN
dentistry3000-784	292	19	,	,	PUNCT
dentistry3000-784	292	20	m.	m.	NOUN
dentistry3000-784	292	21	,	,	PUNCT
dentistry3000-784	292	22	mccan	mccan	NOUN
dentistry3000-784	292	23	,	,	PUNCT
dentistry3000-784	292	24	m.	m.	NOUN
dentistry3000-784	292	25	,	,	PUNCT
dentistry3000-784	292	26	egan	egan	PROPN
dentistry3000-784	292	27	,	,	PUNCT
dentistry3000-784	292	28	d.	d.	PROPN
dentistry3000-784	292	29	&	&	CCONJ
dentistry3000-784	292	30	kavanagh	kavanagh	PROPN
dentistry3000-784	292	31	,	,	PUNCT
dentistry3000-784	292	32	k.	k.	PROPN
dentistry3000-784	292	33	2007	2007	NUM
dentistry3000-784	292	34	.	.	PUNCT
dentistry3000-784	293	1	mechanism	mechanism	NOUN
dentistry3000-784	293	2	of	of	ADP
dentistry3000-784	293	3	action	action	NOUN
dentistry3000-784	293	4	of	of	ADP
dentistry3000-784	293	5	coumarin	coumarin	NOUN
dentistry3000-784	293	6	and	and	CCONJ
dentistry3000-784	293	7	silver	silver	NOUN
dentistry3000-784	293	8	(	(	PUNCT
dentistry3000-784	293	9	i)–coumarin	i)–coumarin	NOUN
dentistry3000-784	293	10	complexes	complex	NOUN
dentistry3000-784	293	11	against	against	ADP
dentistry3000-784	293	12	the	the	DET
dentistry3000-784	293	13	pathogenic	pathogenic	ADJ
dentistry3000-784	293	14	yeast	yeast	NOUN
dentistry3000-784	293	15	candida	candida	NOUN
dentistry3000-784	293	16	albicans	albican	NOUN
dentistry3000-784	293	17	.	.	PUNCT
dentistry3000-784	294	1	toxicology	toxicology	NOUN
dentistry3000-784	294	2	in	in	ADP
dentistry3000-784	294	3	vitro	vitro	X
dentistry3000-784	294	4	,	,	PUNCT
dentistry3000-784	294	5	21	21	NUM
dentistry3000-784	294	6	,	,	PUNCT
dentistry3000-784	294	7	801	801	NUM
dentistry3000-784	294	8	-	-	SYM
dentistry3000-784	294	9	808	808	NUM
dentistry3000-784	294	10	.	.	PUNCT
dentistry3000-784	294	11	45qin	45qin	NOUN
dentistry3000-784	294	12	,	,	PUNCT
dentistry3000-784	294	13	h.-l	h.-l	PROPN
dentistry3000-784	294	14	.	.	PUNCT
dentistry3000-784	294	15	,	,	PUNCT
dentistry3000-784	294	16	zhang	zhang	PROPN
dentistry3000-784	294	17	,	,	PUNCT
dentistry3000-784	294	18	z.-w	z.-w	PROPN
dentistry3000-784	294	19	.	.	PROPN
dentistry3000-784	294	20	,	,	PUNCT
dentistry3000-784	294	21	ravindar	ravindar	NOUN
dentistry3000-784	294	22	,	,	PUNCT
dentistry3000-784	294	23	l.	l.	PROPN
dentistry3000-784	294	24	&	&	CCONJ
dentistry3000-784	294	25	rakesh	rakesh	PROPN
dentistry3000-784	294	26	,	,	PUNCT
dentistry3000-784	294	27	k.	k.	PROPN
dentistry3000-784	294	28	2020	2020	NUM
dentistry3000-784	294	29	.	.	PUNCT
dentistry3000-784	295	1	antibacterial	antibacterial	ADJ
dentistry3000-784	295	2	activities	activity	NOUN
dentistry3000-784	295	3	with	with	ADP
dentistry3000-784	295	4	the	the	DET
dentistry3000-784	295	5	structure	structure	NOUN
dentistry3000-784	295	6	-	-	PUNCT
dentistry3000-784	295	7	activity	activity	NOUN
dentistry3000-784	295	8	relationship	relationship	NOUN
dentistry3000-784	295	9	of	of	ADP
dentistry3000-784	295	10	coumarin	coumarin	NOUN
dentistry3000-784	295	11	derivatives	derivative	NOUN
dentistry3000-784	295	12	.	.	PUNCT
dentistry3000-784	296	1	european	european	ADJ
dentistry3000-784	296	2	journal	journal	PROPN
dentistry3000-784	296	3	of	of	ADP
dentistry3000-784	296	4	medicinal	medicinal	ADJ
dentistry3000-784	296	5	chemistry	chemistry	NOUN
dentistry3000-784	296	6	,	,	PUNCT
dentistry3000-784	296	7	112832	112832	NUM
dentistry3000-784	296	8	.	.	PUNCT
dentistry3000-784	297	1	46qiu	46qiu	PROPN
dentistry3000-784	297	2	,	,	PUNCT
dentistry3000-784	297	3	y.	y.	PROPN
dentistry3000-784	297	4	,	,	PUNCT
dentistry3000-784	297	5	he	he	PRON
dentistry3000-784	297	6	,	,	PUNCT
dentistry3000-784	297	7	d.	d.	PROPN
dentistry3000-784	297	8	,	,	PUNCT
dentistry3000-784	297	9	yang	yang	PROPN
dentistry3000-784	297	10	,	,	PUNCT
dentistry3000-784	297	11	j.	j.	PROPN
dentistry3000-784	297	12	,	,	PUNCT
dentistry3000-784	297	13	ma	ma	PROPN
dentistry3000-784	297	14	,	,	PUNCT
dentistry3000-784	297	15	l.	l.	PROPN
dentistry3000-784	297	16	,	,	PUNCT
dentistry3000-784	297	17	zhu	zhu	PROPN
dentistry3000-784	297	18	,	,	PUNCT
dentistry3000-784	297	19	k.	k.	PROPN
dentistry3000-784	297	20	&	&	CCONJ
dentistry3000-784	297	21	cao	cao	PROPN
dentistry3000-784	297	22	,	,	PUNCT
dentistry3000-784	297	23	y.	y.	PROPN
dentistry3000-784	297	24	2020	2020	NUM
dentistry3000-784	297	25	.	.	PUNCT
dentistry3000-784	298	1	kaempferol	kaempferol	NOUN
dentistry3000-784	298	2	separated	separate	VERB
dentistry3000-784	298	3	from	from	ADP
dentistry3000-784	298	4	camellia	camellia	NOUN
dentistry3000-784	298	5	oleifera	oleifera	NOUN
dentistry3000-784	298	6	meal	meal	NOUN
dentistry3000-784	298	7	by	by	ADP
dentistry3000-784	298	8	highspeed	highspeed	NOUN
dentistry3000-784	298	9	countercurrent	countercurrent	NOUN
dentistry3000-784	298	10	chromatography	chromatography	NOUN
dentistry3000-784	298	11	for	for	ADP
dentistry3000-784	298	12	antibacterial	antibacterial	ADJ
dentistry3000-784	298	13	application	application	NOUN
dentistry3000-784	298	14	.	.	PUNCT
dentistry3000-784	299	1	european	european	ADJ
dentistry3000-784	299	2	food	food	PROPN
dentistry3000-784	299	3	research	research	NOUN
dentistry3000-784	299	4	and	and	CCONJ
dentistry3000-784	299	5	technology	technology	NOUN
dentistry3000-784	299	6	,	,	PUNCT
dentistry3000-784	299	7	246	246	NUM
dentistry3000-784	299	8	,	,	PUNCT
dentistry3000-784	299	9	2383	2383	NUM
dentistry3000-784	299	10	-	-	SYM
dentistry3000-784	299	11	2397	2397	NUM
dentistry3000-784	299	12	.	.	PUNCT