id	sid	tid	token	lemma	pos
dentistry3000-835	1	1	835	835	NUM
dentistry3000-835	1	2	final	final	ADJ
dentistry3000-835	1	3	molecular	molecular	ADJ
dentistry3000-835	1	4	detec	detec	ADJ
dentistry3000-835	1	5	,	,	PUNCT
dentistry3000-835	1	6	on	on	ADP
dentistry3000-835	1	7	of	of	ADP
dentistry3000-835	1	8	tetracycline	tetracycline	NOUN
dentistry3000-835	1	9	-	-	PUNCT
dentistry3000-835	1	10	resistant	resistant	ADJ
dentistry3000-835	1	11	streptococcus	streptococcus	NOUN
dentistry3000-835	1	12	viridans	viridan	NOUN
dentistry3000-835	1	13	bacteria	bacteria	NOUN
dentistry3000-835	1	14	using	use	VERB
dentistry3000-835	1	15	the	the	DET
dentistry3000-835	1	16	rpoa	rpoa	ADJ
dentistry3000-835	1	17	gene	gene	NOUN
dentistry3000-835	1	18	vol	vol	NOUN
dentistry3000-835	1	19	13	13	NUM
dentistry3000-835	1	20	no	no	DET
dentistry3000-835	1	21	1	1	NUM
dentistry3000-835	1	22	(	(	PUNCT
dentistry3000-835	1	23	2025	2025	NUM
dentistry3000-835	1	24	)	)	PUNCT
dentistry3000-835	1	25	doi	doi	NOUN
dentistry3000-835	1	26	10.5195	10.5195	NUM
dentistry3000-835	1	27	/	/	SYM
dentistry3000-835	1	28	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	1	29	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-835	1	30	molecular	molecular	ADJ
dentistry3000-835	1	31	detection	detection	NOUN
dentistry3000-835	1	32	of	of	ADP
dentistry3000-835	1	33	tetracycline	tetracycline	NOUN
dentistry3000-835	1	34	-	-	PUNCT
dentistry3000-835	1	35	resistant	resistant	ADJ
dentistry3000-835	1	36	streptococcus	streptococcus	NOUN
dentistry3000-835	1	37	viridans	viridan	NOUN
dentistry3000-835	1	38	bacteria	bacteria	NOUN
dentistry3000-835	1	39	using	use	VERB
dentistry3000-835	1	40	the	the	DET
dentistry3000-835	1	41	rpoa	rpoa	PROPN
dentistry3000-835	1	42	gene	gene	NOUN
dentistry3000-835	1	43	aseel	aseel	NOUN
dentistry3000-835	1	44	jalil	jalil	PROPN
dentistry3000-835	1	45	ibrahim	ibrahim	PROPN
dentistry3000-835	1	46	al	al	PROPN
dentistry3000-835	1	47	-	-	PROPN
dentistry3000-835	1	48	karawi1	karawi1	PROPN
dentistry3000-835	1	49	,	,	PUNCT
dentistry3000-835	1	50	abdulhameed	abdulhamee	VERB
dentistry3000-835	1	51	salim	salim	PROPN
dentistry3000-835	1	52	hameed2	hameed2	PROPN
dentistry3000-835	1	53	,	,	PUNCT
dentistry3000-835	1	54	sally	sally	PROPN
dentistry3000-835	1	55	talib	talib	PROPN
dentistry3000-835	1	56	da'aj3	da'aj3	PROPN
dentistry3000-835	1	57	,	,	PUNCT
dentistry3000-835	1	58	hadeel	hadeel	PROPN
dentistry3000-835	1	59	j.	j.	PROPN
dentistry3000-835	1	60	ibrahim4	ibrahim4	PROPN
dentistry3000-835	1	61	1university	1university	NUM
dentistry3000-835	1	62	of	of	ADP
dentistry3000-835	1	63	bilad	bilad	ADJ
dentistry3000-835	1	64	alrafidain	alrafidain	NOUN
dentistry3000-835	1	65	,	,	PUNCT
dentistry3000-835	1	66	diyala	diyala	PROPN
dentistry3000-835	1	67	,	,	PUNCT
dentistry3000-835	1	68	iraq	iraq	PROPN
dentistry3000-835	1	69	2ministry	2ministry	NUM
dentistry3000-835	1	70	of	of	ADP
dentistry3000-835	1	71	health	health	NOUN
dentistry3000-835	1	72	,	,	PUNCT
dentistry3000-835	1	73	diyala	diyala	PROPN
dentistry3000-835	1	74	,	,	PUNCT
dentistry3000-835	1	75	iraq	iraq	PROPN
dentistry3000-835	1	76	3university	3university	NUM
dentistry3000-835	1	77	of	of	ADP
dentistry3000-835	1	78	bilad	bilad	ADJ
dentistry3000-835	1	79	alrafidain	alrafidain	NOUN
dentistry3000-835	1	80	,	,	PUNCT
dentistry3000-835	1	81	diyala	diyala	PROPN
dentistry3000-835	1	82	,	,	PUNCT
dentistry3000-835	1	83	iraq	iraq	PROPN
dentistry3000-835	1	84	4general	4general	NUM
dentistry3000-835	1	85	directorate	directorate	NOUN
dentistry3000-835	1	86	of	of	ADP
dentistry3000-835	1	87	education	education	NOUN
dentistry3000-835	1	88	,	,	PUNCT
dentistry3000-835	1	89	diyala	diyala	PROPN
dentistry3000-835	1	90	,	,	PUNCT
dentistry3000-835	1	91	iraq	iraq	PROPN
dentistry3000-835	1	92	abstract	abstract	PROPN
dentistry3000-835	1	93	objec&ve	objec&ve	NUM
dentistry3000-835	1	94	:	:	PUNCT
dentistry3000-835	1	95	the	the	DET
dentistry3000-835	1	96	aim	aim	NOUN
dentistry3000-835	1	97	of	of	ADP
dentistry3000-835	1	98	this	this	DET
dentistry3000-835	1	99	study	study	NOUN
dentistry3000-835	1	100	was	be	AUX
dentistry3000-835	1	101	to	to	AUX
dentistry3000-835	1	102	established	establish	VERB
dentistry3000-835	1	103	diagnos4c	diagnos4c	PROPN
dentistry3000-835	1	104	approaches	approach	NOUN
dentistry3000-835	1	105	to	to	ADP
dentistry3000-835	1	106	dental	dental	ADJ
dentistry3000-835	1	107	caries	carie	NOUN
dentistry3000-835	1	108	using	use	VERB
dentistry3000-835	1	109	polymerase	polymerase	NOUN
dentistry3000-835	1	110	chain	chain	NOUN
dentistry3000-835	1	111	reac4on	reac4on	NOUN
dentistry3000-835	1	112	technology	technology	NOUN
dentistry3000-835	1	113	.	.	PUNCT
dentistry3000-835	2	1	methods	method	NOUN
dentistry3000-835	2	2	:	:	PUNCT
dentistry3000-835	2	3	pcr	pcr	ADJ
dentistry3000-835	2	4	series	series	NOUN
dentistry3000-835	2	5	.	.	PUNCT
dentistry3000-835	3	1	60	60	NUM
dentistry3000-835	3	2	samples	sample	NOUN
dentistry3000-835	3	3	of	of	ADP
dentistry3000-835	3	4	oral	oral	ADJ
dentistry3000-835	3	5	bacteria	bacteria	NOUN
dentistry3000-835	3	6	were	be	AUX
dentistry3000-835	3	7	collected	collect	VERB
dentistry3000-835	3	8	between	between	ADP
dentistry3000-835	3	9	8/6/2023	8/6/2023	PROPN
dentistry3000-835	3	10	and	and	CCONJ
dentistry3000-835	3	11	12/1/2023	12/1/2023	NUM
dentistry3000-835	3	12	,	,	PUNCT
dentistry3000-835	3	13	where	where	SCONJ
dentistry3000-835	3	14	27	27	NUM
dentistry3000-835	3	15	teeth	tooth	NOUN
dentistry3000-835	3	16	showed	show	VERB
dentistry3000-835	3	17	a	a	DET
dentistry3000-835	3	18	growth	growth	NOUN
dentistry3000-835	3	19	rate	rate	NOUN
dentistry3000-835	3	20	for	for	ADP
dentistry3000-835	3	21	bacterial	bacterial	ADJ
dentistry3000-835	3	22	culture	culture	NOUN
dentistry3000-835	3	23	(	(	PUNCT
dentistry3000-835	3	24	45	45	NUM
dentistry3000-835	3	25	%	%	NOUN
dentistry3000-835	3	26	)	)	PUNCT
dentistry3000-835	3	27	.	.	PUNCT
dentistry3000-835	4	1	the	the	DET
dentistry3000-835	4	2	bacterial	bacterial	ADJ
dentistry3000-835	4	3	isolates	isolate	NOUN
dentistry3000-835	4	4	under	under	ADP
dentistry3000-835	4	5	study	study	NOUN
dentistry3000-835	4	6	were	be	AUX
dentistry3000-835	4	7	characterized	characterize	VERB
dentistry3000-835	4	8	.	.	PUNCT
dentistry3000-835	5	1	the	the	DET
dentistry3000-835	5	2	sensi4vity	sensi4vity	NOUN
dentistry3000-835	5	3	of	of	ADP
dentistry3000-835	5	4	the	the	DET
dentistry3000-835	5	5	bacterial	bacterial	ADJ
dentistry3000-835	5	6	isolates	isolate	NOUN
dentistry3000-835	5	7	of	of	ADP
dentistry3000-835	5	8	streptococcus	streptococcus	ADJ
dentistry3000-835	5	9	viridans	viridan	NOUN
dentistry3000-835	5	10	under	under	ADP
dentistry3000-835	5	11	study	study	NOUN
dentistry3000-835	5	12	to	to	ADP
dentistry3000-835	5	13	eight	eight	NUM
dentistry3000-835	5	14	an4bio4cs	an4bio4cs	NOUN
dentistry3000-835	5	15	was	be	AUX
dentistry3000-835	5	16	tested	test	VERB
dentistry3000-835	5	17	.	.	PUNCT
dentistry3000-835	6	1	the	the	DET
dentistry3000-835	6	2	results	result	NOUN
dentistry3000-835	6	3	of	of	ADP
dentistry3000-835	6	4	the	the	DET
dentistry3000-835	6	5	current	current	ADJ
dentistry3000-835	6	6	study	study	NOUN
dentistry3000-835	6	7	showed	show	VERB
dentistry3000-835	6	8	that	that	SCONJ
dentistry3000-835	6	9	the	the	DET
dentistry3000-835	6	10	resistance	resistance	NOUN
dentistry3000-835	6	11	rates	rate	NOUN
dentistry3000-835	6	12	were	be	AUX
dentistry3000-835	6	13	as	as	SCONJ
dentistry3000-835	6	14	follows	follow	VERB
dentistry3000-835	6	15	:	:	PUNCT
dentistry3000-835	6	16	71.4	71.4	NUM
dentistry3000-835	6	17	%	%	NOUN
dentistry3000-835	6	18	for	for	ADP
dentistry3000-835	6	19	tetracycline	tetracycline	NOUN
dentistry3000-835	6	20	,	,	PUNCT
dentistry3000-835	6	21	57	57	NUM
dentistry3000-835	6	22	%	%	NOUN
dentistry3000-835	6	23	for	for	ADP
dentistry3000-835	6	24	augmen4n	augmen4n	PROPN
dentistry3000-835	6	25	,	,	PUNCT
dentistry3000-835	6	26	57	57	NUM
dentistry3000-835	6	27	%	%	NOUN
dentistry3000-835	6	28	for	for	ADP
dentistry3000-835	6	29	ciprofloxacin	ciprofloxacin	NOUN
dentistry3000-835	6	30	,	,	PUNCT
dentistry3000-835	6	31	28	28	NUM
dentistry3000-835	6	32	%	%	NOUN
dentistry3000-835	6	33	for	for	ADP
dentistry3000-835	6	34	clindamycin	clindamycin	NOUN
dentistry3000-835	6	35	,	,	PUNCT
dentistry3000-835	6	36	57	57	NUM
dentistry3000-835	6	37	%	%	NOUN
dentistry3000-835	6	38	for	for	ADP
dentistry3000-835	6	39	erythromycin	erythromycin	NOUN
dentistry3000-835	6	40	,	,	PUNCT
dentistry3000-835	6	41	57	57	NUM
dentistry3000-835	6	42	%	%	NOUN
dentistry3000-835	6	43	for	for	ADP
dentistry3000-835	6	44	doxycycline	doxycycline	NOUN
dentistry3000-835	6	45	,	,	PUNCT
dentistry3000-835	6	46	and	and	CCONJ
dentistry3000-835	6	47	28	28	NUM
dentistry3000-835	6	48	%	%	NOUN
dentistry3000-835	6	49	for	for	ADP
dentistry3000-835	6	50	doxycycline	doxycycline	NOUN
dentistry3000-835	6	51	for	for	ADP
dentistry3000-835	6	52	clarithromycin	clarithromycin	PROPN
dentistry3000-835	6	53	.	.	PUNCT
dentistry3000-835	7	1	results	result	NOUN
dentistry3000-835	7	2	:	:	PUNCT
dentistry3000-835	7	3	the	the	DET
dentistry3000-835	7	4	minimum	minimum	ADJ
dentistry3000-835	7	5	inhibitory	inhibitory	ADJ
dentistry3000-835	7	6	concentra4on	concentra4on	NOUN
dentistry3000-835	7	7	(	(	PUNCT
dentistry3000-835	7	8	mic	mic	ADJ
dentistry3000-835	7	9	)	)	PUNCT
dentistry3000-835	7	10	for	for	ADP
dentistry3000-835	7	11	the	the	DET
dentistry3000-835	7	12	bacterial	bacterial	ADJ
dentistry3000-835	7	13	isolates	isolate	NOUN
dentistry3000-835	7	14	under	under	ADP
dentistry3000-835	7	15	study	study	NOUN
dentistry3000-835	7	16	was	be	AUX
dentistry3000-835	7	17	determined	determine	VERB
dentistry3000-835	7	18	for	for	ADP
dentistry3000-835	7	19	the	the	DET
dentistry3000-835	7	20	tetracycline	tetracycline	NOUN
dentistry3000-835	7	21	an4bio4c	an4bio4c	PROPN
dentistry3000-835	7	22	.	.	PUNCT
dentistry3000-835	8	1	s.	s.	PROPN
dentistry3000-835	8	2	viridans	viridans	PROPN
dentistry3000-835	8	3	isolates	isolate	NOUN
dentistry3000-835	8	4	showed	show	VERB
dentistry3000-835	8	5	resistance	resistance	NOUN
dentistry3000-835	8	6	to	to	ADP
dentistry3000-835	8	7	this	this	DET
dentistry3000-835	8	8	an4bio4c	an4bio4c	PROPN
dentistry3000-835	8	9	through	through	ADP
dentistry3000-835	8	10	a	a	DET
dentistry3000-835	8	11	sensi4vity	sensi4vity	NOUN
dentistry3000-835	8	12	test	test	NOUN
dentistry3000-835	8	13	using	use	VERB
dentistry3000-835	8	14	the	the	DET
dentistry3000-835	8	15	disk	disk	NOUN
dentistry3000-835	8	16	method	method	NOUN
dentistry3000-835	8	17	,	,	PUNCT
dentistry3000-835	8	18	as	as	ADP
dentistry3000-835	8	19	the	the	DET
dentistry3000-835	8	20	mic	mic	ADJ
dentistry3000-835	8	21	value	value	NOUN
dentistry3000-835	8	22	.	.	PUNCT
dentistry3000-835	9	1	for	for	SCONJ
dentistry3000-835	9	2	the	the	DET
dentistry3000-835	9	3	isolates	isolate	NOUN
dentistry3000-835	9	4	ranged	range	VERB
dentistry3000-835	9	5	from	from	ADP
dentistry3000-835	9	6	(	(	PUNCT
dentistry3000-835	9	7	1024	1024	NUM
dentistry3000-835	9	8	-	-	SYM
dentistry3000-835	9	9	8)	8)	NUM
dentistry3000-835	9	10	micrograms	microgram	NOUN
dentistry3000-835	9	11	/	/	SYM
dentistry3000-835	9	12	m	m	PROPN
dentistry3000-835	9	13	l.	l.	NOUN
dentistry3000-835	9	14	the	the	DET
dentistry3000-835	9	15	percentage	percentage	NOUN
dentistry3000-835	9	16	of	of	ADP
dentistry3000-835	9	17	s.	s.	PROPN
dentistry3000-835	9	18	viridans	viridans	PROPN
dentistry3000-835	9	19	isolates	isolate	NOUN
dentistry3000-835	9	20	producing	produce	VERB
dentistry3000-835	9	21	virulence	virulence	NOUN
dentistry3000-835	9	22	factors	factor	NOUN
dentistry3000-835	9	23	was	be	AUX
dentistry3000-835	9	24	as	as	SCONJ
dentistry3000-835	9	25	follows	follow	VERB
dentistry3000-835	9	26	:	:	PUNCT
dentistry3000-835	9	27	protease	protease	NOUN
dentistry3000-835	9	28	enzyme	enzyme	NOUN
dentistry3000-835	9	29	42	42	NUM
dentistry3000-835	9	30	%	%	NOUN
dentistry3000-835	9	31	,	,	PUNCT
dentistry3000-835	9	32	and	and	CCONJ
dentistry3000-835	9	33	membrane	membrane	NOUN
dentistry3000-835	9	34	protease	protease	NOUN
dentistry3000-835	9	35	.	.	PUNCT
dentistry3000-835	10	1	bioac4ve	bioac4ve	PROPN
dentistry3000-835	10	2	71	71	NUM
dentistry3000-835	10	3	%	%	NOUN
dentistry3000-835	10	4	,	,	PUNCT
dentistry3000-835	10	5	bacteriocin	bacteriocin	PRON
dentistry3000-835	10	6	14	14	NUM
dentistry3000-835	10	7	%	%	NOUN
dentistry3000-835	10	8	,	,	PUNCT
dentistry3000-835	10	9	hemolycin	hemolycin	PRON
dentistry3000-835	10	10	57	57	NUM
dentistry3000-835	10	11	%	%	NOUN
dentistry3000-835	10	12	,	,	PUNCT
dentistry3000-835	10	13	dnaase	dnaase	NOUN
dentistry3000-835	10	14	71	71	NUM
dentistry3000-835	10	15	%	%	NOUN
dentistry3000-835	10	16	,	,	PUNCT
dentistry3000-835	10	17	capsule	capsule	NOUN
dentistry3000-835	10	18	28	28	NUM
dentistry3000-835	10	19	%	%	NOUN
dentistry3000-835	10	20	,	,	PUNCT
dentistry3000-835	10	21	and	and	CCONJ
dentistry3000-835	10	22	lipase	lipase	NOUN
dentistry3000-835	10	23	28	28	NUM
dentistry3000-835	10	24	%	%	NOUN
dentistry3000-835	10	25	.	.	PUNCT
dentistry3000-835	11	1	conclusion	conclusion	NOUN
dentistry3000-835	11	2	:	:	PUNCT
dentistry3000-835	11	3	the	the	DET
dentistry3000-835	11	4	total	total	ADJ
dentistry3000-835	11	5	dna	dna	NOUN
dentistry3000-835	11	6	of	of	ADP
dentistry3000-835	11	7	all	all	DET
dentistry3000-835	11	8	bacterial	bacterial	ADJ
dentistry3000-835	11	9	isolates	isolate	NOUN
dentistry3000-835	11	10	under	under	ADP
dentistry3000-835	11	11	study	study	NOUN
dentistry3000-835	11	12	was	be	AUX
dentistry3000-835	11	13	extracted	extract	VERB
dentistry3000-835	11	14	,	,	PUNCT
dentistry3000-835	11	15	axer	axer	NOUN
dentistry3000-835	11	16	which	which	PRON
dentistry3000-835	11	17	a	a	DET
dentistry3000-835	11	18	polymerase	polymerase	NOUN
dentistry3000-835	11	19	chain	chain	NOUN
dentistry3000-835	11	20	reac4on	reac4on	NOUN
dentistry3000-835	11	21	(	(	PUNCT
dentistry3000-835	11	22	pcr	pcr	PROPN
dentistry3000-835	11	23	)	)	PUNCT
dentistry3000-835	11	24	was	be	AUX
dentistry3000-835	11	25	performed	perform	VERB
dentistry3000-835	11	26	for	for	ADP
dentistry3000-835	11	27	the	the	DET
dentistry3000-835	11	28	s.	s.	PROPN
dentistry3000-835	11	29	viridans	viridan	NOUN
dentistry3000-835	11	30	resistant	resistant	ADJ
dentistry3000-835	11	31	to	to	ADP
dentistry3000-835	11	32	tetracycline	tetracycline	NOUN
dentistry3000-835	11	33	and	and	CCONJ
dentistry3000-835	11	34	with	with	ADP
dentistry3000-835	11	35	an	an	DET
dentistry3000-835	11	36	mic	mic	ADJ
dentistry3000-835	11	37	value	value	NOUN
dentistry3000-835	11	38	higher	high	ADJ
dentistry3000-835	11	39	than	than	ADP
dentistry3000-835	11	40	64	64	NUM
dentistry3000-835	11	41	µg	µg	NOUN
dentistry3000-835	11	42	/	/	SYM
dentistry3000-835	11	43	ml	ml	VERB
dentistry3000-835	11	44	using	use	VERB
dentistry3000-835	11	45	specialized	specialized	ADJ
dentistry3000-835	11	46	primers	primer	NOUN
dentistry3000-835	11	47	targe4ng	targe4ng	PRON
dentistry3000-835	11	48	the	the	DET
dentistry3000-835	11	49	specific	specific	ADJ
dentistry3000-835	11	50	sequence	sequence	NOUN
dentistry3000-835	11	51	of	of	ADP
dentistry3000-835	11	52	the	the	DET
dentistry3000-835	11	53	tetm	tetm	NOUN
dentistry3000-835	11	54	gene	gene	NOUN
dentistry3000-835	11	55	with	with	ADP
dentistry3000-835	11	56	a	a	DET
dentistry3000-835	11	57	size	size	NOUN
dentistry3000-835	11	58	of	of	ADP
dentistry3000-835	11	59	1,862bp	1,862bp	NOUN
dentistry3000-835	11	60	.	.	PUNCT
dentistry3000-835	12	1	when	when	SCONJ
dentistry3000-835	12	2	the	the	DET
dentistry3000-835	12	3	amplified	amplify	VERB
dentistry3000-835	12	4	products	product	NOUN
dentistry3000-835	12	5	were	be	AUX
dentistry3000-835	12	6	migrated	migrate	VERB
dentistry3000-835	12	7	on	on	ADP
dentistry3000-835	12	8	an	an	DET
dentistry3000-835	12	9	agarose	agarose	NOUN
dentistry3000-835	12	10	gel	gel	NOUN
dentistry3000-835	12	11	,	,	PUNCT
dentistry3000-835	12	12	one	one	NUM
dentistry3000-835	12	13	band	band	NOUN
dentistry3000-835	12	14	appeared	appear	VERB
dentistry3000-835	12	15	in	in	ADP
dentistry3000-835	12	16	all	all	DET
dentistry3000-835	12	17	tracks	track	NOUN
dentistry3000-835	12	18	in	in	ADP
dentistry3000-835	12	19	the	the	DET
dentistry3000-835	12	20	gel	gel	NOUN
dentistry3000-835	12	21	at	at	ADP
dentistry3000-835	12	22	the	the	DET
dentistry3000-835	12	23	same	same	ADJ
dentistry3000-835	12	24	level	level	NOUN
dentistry3000-835	12	25	for	for	ADP
dentistry3000-835	12	26	all	all	DET
dentistry3000-835	12	27	samples	sample	NOUN
dentistry3000-835	12	28	.	.	PUNCT
dentistry3000-835	13	1	the	the	DET
dentistry3000-835	13	2	results	result	NOUN
dentistry3000-835	13	3	showed	show	VERB
dentistry3000-835	13	4	that	that	SCONJ
dentistry3000-835	13	5	the	the	DET
dentistry3000-835	13	6	presence	presence	NOUN
dentistry3000-835	13	7	of	of	ADP
dentistry3000-835	13	8	the	the	DET
dentistry3000-835	13	9	tetm	tetm	NOUN
dentistry3000-835	13	10	gene	gene	NOUN
dentistry3000-835	13	11	was	be	AUX
dentistry3000-835	13	12	100	100	NUM
dentistry3000-835	13	13	%	%	NOUN
dentistry3000-835	13	14	.	.	PUNCT
dentistry3000-835	14	1	keywords	keyword	NOUN
dentistry3000-835	14	2	:	:	PUNCT
dentistry3000-835	14	3	streptococcus	streptococcus	NOUN
dentistry3000-835	14	4	viridans	viridan	NOUN
dentistry3000-835	14	5	,	,	PUNCT
dentistry3000-835	14	6	rpoa	rpoa	NOUN
dentistry3000-835	14	7	,	,	PUNCT
dentistry3000-835	14	8	tetm	tetm	NOUN
dentistry3000-835	14	9	,	,	PUNCT
dentistry3000-835	14	10	sequencing	sequencing	NOUN
dentistry3000-835	14	11	,	,	PUNCT
dentistry3000-835	14	12	pcr	pcr	ADJ
dentistry3000-835	14	13	cita9on	cita9on	NOUN
dentistry3000-835	14	14	:	:	PUNCT
dentistry3000-835	14	15	al	al	PROPN
dentistry3000-835	14	16	-	-	PUNCT
dentistry3000-835	14	17	karawi	karawi	PROPN
dentistry3000-835	14	18	aji	aji	PROPN
dentistry3000-835	14	19	,	,	PUNCT
dentistry3000-835	14	20	et	et	PROPN
dentistry3000-835	14	21	al	al	PROPN
dentistry3000-835	14	22	.	.	PROPN
dentistry3000-835	15	1	(	(	PUNCT
dentistry3000-835	15	2	2025	2025	NUM
dentistry3000-835	15	3	)	)	PUNCT
dentistry3000-835	15	4	molecular	molecular	ADJ
dentistry3000-835	15	5	detec9on	detec9on	NOUN
dentistry3000-835	15	6	of	of	ADP
dentistry3000-835	15	7	tetracycline	tetracycline	NOUN
dentistry3000-835	15	8	-	-	PUNCT
dentistry3000-835	15	9	resistant	resistant	ADJ
dentistry3000-835	15	10	streptococcus	streptococcus	NOUN
dentistry3000-835	15	11	viridans	viridan	NOUN
dentistry3000-835	15	12	bacteria	bacteria	NOUN
dentistry3000-835	15	13	using	use	VERB
dentistry3000-835	15	14	the	the	DET
dentistry3000-835	15	15	rpoa	rpoa	NOUN
dentistry3000-835	15	16	gene	gene	NOUN
dentistry3000-835	15	17	.	.	PUNCT
dentistry3000-835	16	1	den9stry	den9stry	PROPN
dentistry3000-835	16	2	3000	3000	NUM
dentistry3000-835	16	3	.	.	PUNCT
dentistry3000-835	17	1	1	1	NUM
dentistry3000-835	17	2	:	:	PUNCT
dentistry3000-835	17	3	a001	a001	PROPN
dentistry3000-835	17	4	doi:10.5195	doi:10.5195	ADJ
dentistry3000-835	17	5	/	/	SYM
dentistry3000-835	17	6	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	17	7	received	receive	VERB
dentistry3000-835	17	8	:	:	PUNCT
dentistry3000-835	17	9	january	january	PROPN
dentistry3000-835	17	10	26	26	NUM
dentistry3000-835	17	11	,	,	PUNCT
dentistry3000-835	17	12	2025	2025	NUM
dentistry3000-835	17	13	accepted	accept	VERB
dentistry3000-835	17	14	:	:	PUNCT
dentistry3000-835	17	15	march	march	PROPN
dentistry3000-835	17	16	30	30	NUM
dentistry3000-835	17	17	,	,	PUNCT
dentistry3000-835	17	18	2025	2025	NUM
dentistry3000-835	17	19	published	publish	VERB
dentistry3000-835	17	20	:	:	PUNCT
dentistry3000-835	17	21	april	april	PROPN
dentistry3000-835	17	22	1	1	NUM
dentistry3000-835	17	23	,	,	PUNCT
dentistry3000-835	17	24	2025	2025	NUM
dentistry3000-835	17	25	copyright	copyright	NOUN
dentistry3000-835	17	26	:	:	PUNCT
dentistry3000-835	18	1	©	©	PROPN
dentistry3000-835	18	2	2025	2025	NUM
dentistry3000-835	18	3	al	al	PROPN
dentistry3000-835	18	4	-	-	PUNCT
dentistry3000-835	18	5	karawi	karawi	PROPN
dentistry3000-835	18	6	aji	aji	PROPN
dentistry3000-835	18	7	,	,	PUNCT
dentistry3000-835	18	8	et	et	PROPN
dentistry3000-835	18	9	al	al	PROPN
dentistry3000-835	18	10	.	.	PUNCT
dentistry3000-835	19	1	this	this	PRON
dentistry3000-835	19	2	is	be	AUX
dentistry3000-835	19	3	an	an	DET
dentistry3000-835	19	4	open	open	ADJ
dentistry3000-835	19	5	access	access	NOUN
dentistry3000-835	19	6	ar9cle	ar9cle	NOUN
dentistry3000-835	19	7	licensed	license	VERB
dentistry3000-835	19	8	under	under	ADP
dentistry3000-835	19	9	a	a	DET
dentistry3000-835	19	10	crea9ve	crea9ve	PROPN
dentistry3000-835	19	11	commons	common	NOUN
dentistry3000-835	19	12	ayribu9on	ayribu9on	AUX
dentistry3000-835	19	13	work	work	VERB
dentistry3000-835	19	14	4.0	4.0	NUM
dentistry3000-835	19	15	united	united	ADJ
dentistry3000-835	19	16	states	states	PROPN
dentistry3000-835	19	17	license	license	NOUN
dentistry3000-835	19	18	.	.	PUNCT
dentistry3000-835	20	1	email	email	NOUN
dentistry3000-835	20	2	:	:	PUNCT
dentistry3000-835	21	1	aseeljaleel68@gmail.com	aseeljaleel68@gmail.com	X
dentistry3000-835	21	2	introduction	introduction	NOUN
dentistry3000-835	21	3	streptococcus	streptococcus	NOUN
dentistry3000-835	21	4	is	be	AUX
dentistry3000-835	21	5	a	a	DET
dentistry3000-835	21	6	gram	gram	NOUN
dentistry3000-835	21	7	-	-	PUNCT
dentistry3000-835	21	8	positive	positive	ADJ
dentistry3000-835	21	9	coccus	coccus	NOUN
dentistry3000-835	21	10	that	that	PRON
dentistry3000-835	21	11	includes	include	VERB
dentistry3000-835	21	12	several	several	ADJ
dentistry3000-835	21	13	species	specie	NOUN
dentistry3000-835	21	14	,	,	PUNCT
dentistry3000-835	21	15	as	as	SCONJ
dentistry3000-835	21	16	they	they	PRON
dentistry3000-835	21	17	share	share	VERB
dentistry3000-835	21	18	common	common	ADJ
dentistry3000-835	21	19	characteristics	characteristic	NOUN
dentistry3000-835	21	20	,	,	PUNCT
dentistry3000-835	21	21	as	as	SCONJ
dentistry3000-835	21	22	they	they	PRON
dentistry3000-835	21	23	are	be	AUX
dentistry3000-835	21	24	facultative	facultative	ADJ
dentistry3000-835	21	25	anaerobic	anaerobic	NOUN
dentistry3000-835	21	26	and	and	CCONJ
dentistry3000-835	21	27	spherical	spherical	ADJ
dentistry3000-835	21	28	in	in	ADP
dentistry3000-835	21	29	shape	shape	NOUN
dentistry3000-835	21	30	[	[	X
dentistry3000-835	21	31	1	1	NUM
dentistry3000-835	21	32	]	]	PUNCT
dentistry3000-835	21	33	.	.	PUNCT
dentistry3000-835	22	1	some	some	PRON
dentistry3000-835	22	2	of	of	ADP
dentistry3000-835	22	3	them	they	PRON
dentistry3000-835	22	4	are	be	AUX
dentistry3000-835	22	5	obligate	obligate	NOUN
dentistry3000-835	22	6	anaerobic	anaerobic	NOUN
dentistry3000-835	22	7	and	and	CCONJ
dentistry3000-835	22	8	some	some	PRON
dentistry3000-835	22	9	are	be	AUX
dentistry3000-835	22	10	facultative	facultative	ADJ
dentistry3000-835	22	11	anaerobic	anaerobic	NOUN
dentistry3000-835	23	1	that	that	SCONJ
dentistry3000-835	23	2	ferment	ferment	NOUN
dentistry3000-835	23	3	carbohydrates	carbohydrate	NOUN
dentistry3000-835	23	4	and	and	CCONJ
dentistry3000-835	23	5	grow	grow	VERB
dentistry3000-835	23	6	with	with	ADP
dentistry3000-835	23	7	the	the	DET
dentistry3000-835	23	8	availability	availability	NOUN
dentistry3000-835	23	9	of	of	ADP
dentistry3000-835	23	10	co2	co2	NOUN
dentistry3000-835	23	11	and	and	CCONJ
dentistry3000-835	23	12	are	be	AUX
dentistry3000-835	23	13	negative	negative	ADJ
dentistry3000-835	23	14	to	to	PART
dentistry3000-835	23	15	produce	produce	VERB
dentistry3000-835	23	16	oxidase	oxidase	NOUN
dentistry3000-835	23	17	and	and	CCONJ
dentistry3000-835	23	18	catalase	catalase	NOUN
dentistry3000-835	23	19	enzymes	enzyme	NOUN
dentistry3000-835	24	1	.	.	PUNCT
dentistry3000-835	25	1	the	the	DET
dentistry3000-835	25	2	growth	growth	NOUN
dentistry3000-835	25	3	requirements	requirement	NOUN
dentistry3000-835	25	4	of	of	ADP
dentistry3000-835	25	5	this	this	DET
dentistry3000-835	25	6	species	specie	NOUN
dentistry3000-835	25	7	are	be	AUX
dentistry3000-835	25	8	complex	complex	ADJ
dentistry3000-835	25	9	as	as	SCONJ
dentistry3000-835	25	10	they	they	PRON
dentistry3000-835	25	11	require	require	VERB
dentistry3000-835	25	12	culture	culture	NOUN
dentistry3000-835	25	13	media	medium	NOUN
dentistry3000-835	25	14	rich	rich	ADJ
dentistry3000-835	25	15	in	in	ADP
dentistry3000-835	25	16	blood	blood	NOUN
dentistry3000-835	25	17	,	,	PUNCT
dentistry3000-835	25	18	such	such	ADJ
dentistry3000-835	25	19	as	as	ADP
dentistry3000-835	25	20	blood	blood	NOUN
dentistry3000-835	25	21	agar	agar	NOUN
dentistry3000-835	25	22	[	[	X
dentistry3000-835	25	23	2	2	NUM
dentistry3000-835	25	24	]	]	PUNCT
dentistry3000-835	25	25	.	.	PUNCT
dentistry3000-835	26	1	the	the	DET
dentistry3000-835	26	2	pathogenicity	pathogenicity	NOUN
dentistry3000-835	26	3	of	of	ADP
dentistry3000-835	26	4	the	the	DET
dentistry3000-835	26	5	streptococcus	streptococcus	NOUN
dentistry3000-835	26	6	genus	genus	NOUN
dentistry3000-835	26	7	is	be	AUX
dentistry3000-835	26	8	linked	link	VERB
dentistry3000-835	26	9	to	to	ADP
dentistry3000-835	26	10	its	its	PRON
dentistry3000-835	26	11	ability	ability	NOUN
dentistry3000-835	26	12	to	to	PART
dentistry3000-835	26	13	produce	produce	VERB
dentistry3000-835	26	14	several	several	ADJ
dentistry3000-835	26	15	virulence	virulence	NOUN
dentistry3000-835	26	16	factors	factor	NOUN
dentistry3000-835	26	17	,	,	PUNCT
dentistry3000-835	26	18	which	which	PRON
dentistry3000-835	26	19	include	include	VERB
dentistry3000-835	26	20	the	the	DET
dentistry3000-835	26	21	production	production	NOUN
dentistry3000-835	26	22	of	of	ADP
dentistry3000-835	26	23	hemolytic	hemolytic	ADJ
dentistry3000-835	26	24	toxins	toxin	NOUN
dentistry3000-835	26	25	such	such	ADJ
dentistry3000-835	26	26	as	as	ADP
dentistry3000-835	26	27	hemolysin	hemolysin	NOUN
dentistry3000-835	26	28	,	,	PUNCT
dentistry3000-835	26	29	in	in	ADP
dentistry3000-835	26	30	addition	addition	NOUN
dentistry3000-835	26	31	to	to	ADP
dentistry3000-835	26	32	its	its	PRON
dentistry3000-835	26	33	production	production	NOUN
dentistry3000-835	26	34	of	of	ADP
dentistry3000-835	26	35	intestinal	intestinal	ADJ
dentistry3000-835	26	36	toxins	toxin	NOUN
dentistry3000-835	26	37	that	that	PRON
dentistry3000-835	26	38	cause	cause	VERB
dentistry3000-835	26	39	food	food	NOUN
dentistry3000-835	26	40	poisoning	poisoning	NOUN
dentistry3000-835	26	41	.	.	PUNCT
dentistry3000-835	27	1	it	it	PRON
dentistry3000-835	27	2	also	also	ADV
dentistry3000-835	27	3	possesses	possess	VERB
dentistry3000-835	27	4	the	the	DET
dentistry3000-835	27	5	ability	ability	NOUN
dentistry3000-835	27	6	to	to	PART
dentistry3000-835	27	7	produce	produce	VERB
dentistry3000-835	27	8	many	many	ADJ
dentistry3000-835	27	9	extracellular	extracellular	ADJ
dentistry3000-835	27	10	enzymes	enzyme	NOUN
dentistry3000-835	27	11	such	such	ADJ
dentistry3000-835	27	12	as	as	ADP
dentistry3000-835	27	13	lipase	lipase	NOUN
dentistry3000-835	27	14	,	,	PUNCT
dentistry3000-835	27	15	proteinase	proteinase	NOUN
dentistry3000-835	27	16	,	,	PUNCT
dentistry3000-835	27	17	and	and	CCONJ
dentistry3000-835	27	18	streptokinase	streptokinase	PROPN
dentistry3000-835	27	19	,	,	PUNCT
dentistry3000-835	27	20	which	which	PRON
dentistry3000-835	27	21	help	help	VERB
dentistry3000-835	27	22	the	the	DET
dentistry3000-835	27	23	bacteria	bacteria	NOUN
dentistry3000-835	27	24	in	in	ADP
dentistry3000-835	27	25	tissue	tissue	NOUN
dentistry3000-835	27	26	invasion	invasion	NOUN
dentistry3000-835	27	27	and	and	CCONJ
dentistry3000-835	27	28	spread	spread	VERB
dentistry3000-835	27	29	of	of	ADP
dentistry3000-835	27	30	infections	infection	NOUN
dentistry3000-835	27	31	.	.	PUNCT
dentistry3000-835	28	1	most	most	ADJ
dentistry3000-835	28	2	of	of	ADP
dentistry3000-835	28	3	its	its	PRON
dentistry3000-835	28	4	types	type	NOUN
dentistry3000-835	28	5	are	be	AUX
dentistry3000-835	28	6	surrounded	surround	VERB
dentistry3000-835	28	7	by	by	ADP
dentistry3000-835	28	8	a	a	DET
dentistry3000-835	28	9	capsule	capsule	NOUN
dentistry3000-835	28	10	and	and	CCONJ
dentistry3000-835	28	11	grow	grow	VERB
dentistry3000-835	28	12	at	at	ADP
dentistry3000-835	28	13	a	a	DET
dentistry3000-835	28	14	temperature	temperature	NOUN
dentistry3000-835	28	15	of	of	ADP
dentistry3000-835	28	16	37	37	NUM
dentistry3000-835	28	17	°	°	NOUN
dentistry3000-835	28	18	c	c	NOUN
dentistry3000-835	28	19	,	,	PUNCT
dentistry3000-835	28	20	molecular	molecular	ADJ
dentistry3000-835	28	21	detec	detec	ADJ
dentistry3000-835	28	22	,	,	PUNCT
dentistry3000-835	28	23	on	on	ADP
dentistry3000-835	28	24	of	of	ADP
dentistry3000-835	28	25	tetracycline	tetracycline	NOUN
dentistry3000-835	28	26	-	-	PUNCT
dentistry3000-835	28	27	resistant	resistant	ADJ
dentistry3000-835	28	28	streptococcus	streptococcus	NOUN
dentistry3000-835	28	29	viridans	viridan	NOUN
dentistry3000-835	28	30	bacteria	bacteria	NOUN
dentistry3000-835	28	31	using	use	VERB
dentistry3000-835	28	32	the	the	DET
dentistry3000-835	28	33	rpoa	rpoa	ADJ
dentistry3000-835	28	34	gene	gene	NOUN
dentistry3000-835	28	35	vol	vol	NOUN
dentistry3000-835	28	36	13	13	NUM
dentistry3000-835	28	37	no	no	DET
dentistry3000-835	28	38	1	1	NUM
dentistry3000-835	28	39	(	(	PUNCT
dentistry3000-835	28	40	2025	2025	NUM
dentistry3000-835	28	41	)	)	PUNCT
dentistry3000-835	28	42	doi	doi	NOUN
dentistry3000-835	28	43	10.5195	10.5195	NUM
dentistry3000-835	28	44	/	/	SYM
dentistry3000-835	28	45	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	28	46	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	NOUN
dentistry3000-835	28	47	which	which	PRON
dentistry3000-835	28	48	is	be	AUX
dentistry3000-835	28	49	the	the	DET
dentistry3000-835	28	50	optimum	optimum	ADJ
dentistry3000-835	28	51	temperature	temperature	NOUN
dentistry3000-835	28	52	for	for	ADP
dentistry3000-835	28	53	their	their	PRON
dentistry3000-835	28	54	growth	growth	NOUN
dentistry3000-835	28	55	,	,	PUNCT
dentistry3000-835	28	56	and	and	CCONJ
dentistry3000-835	28	57	growth	growth	NOUN
dentistry3000-835	28	58	is	be	AUX
dentistry3000-835	28	59	weak	weak	ADJ
dentistry3000-835	28	60	in	in	ADP
dentistry3000-835	28	61	ordinary	ordinary	ADJ
dentistry3000-835	28	62	solid	solid	ADJ
dentistry3000-835	28	63	or	or	CCONJ
dentistry3000-835	28	64	liquid	liquid	ADJ
dentistry3000-835	28	65	media	medium	NOUN
dentistry3000-835	28	66	[	[	X
dentistry3000-835	28	67	3	3	NUM
dentistry3000-835	28	68	]	]	PUNCT
dentistry3000-835	28	69	.	.	PUNCT
dentistry3000-835	29	1	s.	s.	PROPN
dentistry3000-835	29	2	viridans	viridan	NOUN
dentistry3000-835	29	3	are	be	AUX
dentistry3000-835	29	4	gram	gram	NOUN
dentistry3000-835	29	5	positive	positive	ADJ
dentistry3000-835	29	6	,	,	PUNCT
dentistry3000-835	29	7	facultative	facultative	ADJ
dentistry3000-835	29	8	anaerobic	anaerobic	NOUN
dentistry3000-835	29	9	,	,	PUNCT
dentistry3000-835	29	10	and	and	CCONJ
dentistry3000-835	29	11	negative	negative	ADJ
dentistry3000-835	29	12	for	for	ADP
dentistry3000-835	29	13	oxidase	oxidase	NOUN
dentistry3000-835	29	14	and	and	CCONJ
dentistry3000-835	29	15	catalase	catalase	NOUN
dentistry3000-835	29	16	tests	test	NOUN
dentistry3000-835	29	17	.	.	PUNCT
dentistry3000-835	30	1	their	their	PRON
dentistry3000-835	30	2	growth	growth	NOUN
dentistry3000-835	30	3	is	be	AUX
dentistry3000-835	30	4	inhibited	inhibit	VERB
dentistry3000-835	30	5	by	by	ADP
dentistry3000-835	30	6	optochin	optochin	PROPN
dentistry3000-835	30	7	and	and	CCONJ
dentistry3000-835	30	8	their	their	PRON
dentistry3000-835	30	9	colonies	colony	NOUN
dentistry3000-835	30	10	do	do	AUX
dentistry3000-835	30	11	not	not	PART
dentistry3000-835	30	12	dissolve	dissolve	VERB
dentistry3000-835	30	13	in	in	ADP
dentistry3000-835	30	14	bile	bile	NOUN
dentistry3000-835	30	15	salts	salt	NOUN
dentistry3000-835	30	16	.	.	PUNCT
dentistry3000-835	31	1	unlike	unlike	ADP
dentistry3000-835	31	2	pneumococci	pneumococci	NOUN
dentistry3000-835	31	3	,	,	PUNCT
dentistry3000-835	31	4	some	some	DET
dentistry3000-835	31	5	streptococci	streptococci	NOUN
dentistry3000-835	31	6	viridans	viridan	NOUN
dentistry3000-835	31	7	,	,	PUNCT
dentistry3000-835	31	8	such	such	ADJ
dentistry3000-835	31	9	as	as	ADP
dentistry3000-835	31	10	s.	s.	PROPN
dentistry3000-835	31	11	mutans	mutans	PROPN
dentistry3000-835	31	12	,	,	PUNCT
dentistry3000-835	31	13	accumulate	accumulate	VERB
dentistry3000-835	31	14	large	large	ADJ
dentistry3000-835	31	15	polysaccharides	polysaccharide	NOUN
dentistry3000-835	31	16	,	,	PUNCT
dentistry3000-835	31	17	such	such	ADJ
dentistry3000-835	31	18	as	as	ADP
dentistry3000-835	31	19	dextran	dextran	NOUN
dentistry3000-835	31	20	or	or	CCONJ
dentistry3000-835	31	21	levans	levan	NOUN
dentistry3000-835	31	22	of	of	ADP
dentistry3000-835	31	23	sucrose	sucrose	PROPN
dentistry3000-835	31	24	,	,	PUNCT
dentistry3000-835	31	25	and	and	CCONJ
dentistry3000-835	31	26	contribute	contribute	VERB
dentistry3000-835	31	27	to	to	ADP
dentistry3000-835	31	28	the	the	DET
dentistry3000-835	31	29	development	development	NOUN
dentistry3000-835	31	30	of	of	ADP
dentistry3000-835	31	31	tooth	tooth	NOUN
dentistry3000-835	31	32	decay	decay	NOUN
dentistry3000-835	31	33	[	[	X
dentistry3000-835	31	34	4	4	NUM
dentistry3000-835	31	35	]	]	PUNCT
dentistry3000-835	31	36	.	.	PUNCT
dentistry3000-835	32	1	some	some	DET
dentistry3000-835	32	2	types	type	NOUN
dentistry3000-835	32	3	of	of	ADP
dentistry3000-835	32	4	streptomyces	streptomyce	NOUN
dentistry3000-835	32	5	may	may	AUX
dentistry3000-835	32	6	enter	enter	VERB
dentistry3000-835	32	7	the	the	DET
dentistry3000-835	32	8	bloodstream	bloodstream	NOUN
dentistry3000-835	32	9	by	by	ADP
dentistry3000-835	32	10	tooth	tooth	NOUN
dentistry3000-835	32	11	brushing	brushing	NOUN
dentistry3000-835	32	12	or	or	CCONJ
dentistry3000-835	32	13	during	during	ADP
dentistry3000-835	32	14	dental	dental	ADJ
dentistry3000-835	32	15	work	work	NOUN
dentistry3000-835	32	16	[	[	X
dentistry3000-835	32	17	5	5	NUM
dentistry3000-835	32	18	]	]	PUNCT
dentistry3000-835	32	19	.	.	PUNCT
dentistry3000-835	33	1	when	when	SCONJ
dentistry3000-835	33	2	these	these	DET
dentistry3000-835	33	3	organisms	organism	NOUN
dentistry3000-835	33	4	enter	enter	VERB
dentistry3000-835	33	5	the	the	DET
dentistry3000-835	33	6	bloodstream	bloodstream	NOUN
dentistry3000-835	33	7	,	,	PUNCT
dentistry3000-835	33	8	they	they	PRON
dentistry3000-835	33	9	will	will	AUX
dentistry3000-835	33	10	form	form	VERB
dentistry3000-835	33	11	colonies	colony	NOUN
dentistry3000-835	33	12	and	and	CCONJ
dentistry3000-835	33	13	form	form	NOUN
dentistry3000-835	33	14	biofilms	biofilm	NOUN
dentistry3000-835	33	15	,	,	PUNCT
dentistry3000-835	33	16	causing	cause	VERB
dentistry3000-835	33	17	chronic	chronic	ADJ
dentistry3000-835	33	18	endocarditis	endocarditis	NOUN
dentistry3000-835	33	19	.	.	PUNCT
dentistry3000-835	34	1	resistance	resistance	NOUN
dentistry3000-835	34	2	to	to	ADP
dentistry3000-835	34	3	tetracycline	tetracycline	NOUN
dentistry3000-835	34	4	and	and	CCONJ
dentistry3000-835	34	5	its	its	PRON
dentistry3000-835	34	6	other	other	ADJ
dentistry3000-835	34	7	derivatives	derivative	NOUN
dentistry3000-835	34	8	is	be	AUX
dentistry3000-835	34	9	widespread	widespread	ADJ
dentistry3000-835	34	10	in	in	ADP
dentistry3000-835	34	11	spherical	spherical	ADJ
dentistry3000-835	34	12	gram	gram	NOUN
dentistry3000-835	34	13	-	-	PUNCT
dentistry3000-835	34	14	positive	positive	ADJ
dentistry3000-835	34	15	bacteria	bacteria	NOUN
dentistry3000-835	34	16	,	,	PUNCT
dentistry3000-835	34	17	and	and	CCONJ
dentistry3000-835	34	18	the	the	DET
dentistry3000-835	34	19	mechanisms	mechanism	NOUN
dentistry3000-835	34	20	of	of	ADP
dentistry3000-835	34	21	resistance	resistance	NOUN
dentistry3000-835	34	22	against	against	ADP
dentistry3000-835	34	23	the	the	DET
dentistry3000-835	34	24	tetracycline	tetracycline	PROPN
dentistry3000-835	34	25	family	family	NOUN
dentistry3000-835	34	26	are	be	AUX
dentistry3000-835	34	27	either	either	CCONJ
dentistry3000-835	34	28	by	by	ADP
dentistry3000-835	34	29	changing	change	VERB
dentistry3000-835	34	30	the	the	DET
dentistry3000-835	34	31	target	target	NOUN
dentistry3000-835	34	32	site	site	NOUN
dentistry3000-835	34	33	for	for	ADP
dentistry3000-835	34	34	the	the	DET
dentistry3000-835	34	35	action	action	NOUN
dentistry3000-835	34	36	of	of	ADP
dentistry3000-835	34	37	the	the	DET
dentistry3000-835	34	38	antibiotic	antibiotic	NOUN
dentistry3000-835	34	39	or	or	CCONJ
dentistry3000-835	34	40	reducing	reduce	VERB
dentistry3000-835	34	41	the	the	DET
dentistry3000-835	34	42	permeability	permeability	NOUN
dentistry3000-835	34	43	of	of	ADP
dentistry3000-835	34	44	the	the	DET
dentistry3000-835	34	45	antigen	antigen	NOUN
dentistry3000-835	34	46	through	through	ADP
dentistry3000-835	34	47	the	the	DET
dentistry3000-835	34	48	outer	outer	ADJ
dentistry3000-835	34	49	membrane	membrane	NOUN
dentistry3000-835	34	50	,	,	PUNCT
dentistry3000-835	34	51	or	or	CCONJ
dentistry3000-835	34	52	through	through	ADP
dentistry3000-835	34	53	genetic	genetic	ADJ
dentistry3000-835	34	54	expression	expression	NOUN
dentistry3000-835	34	55	of	of	ADP
dentistry3000-835	34	56	the	the	DET
dentistry3000-835	34	57	transposon	transposon	NOUN
dentistry3000-835	34	58	gene	gene	NOUN
dentistry3000-835	34	59	containing	contain	VERB
dentistry3000-835	34	60	it	it	PRON
dentistry3000-835	35	1	[	[	X
dentistry3000-835	35	2	6	6	NUM
dentistry3000-835	35	3	]	]	PUNCT
dentistry3000-835	35	4	.	.	PUNCT
dentistry3000-835	36	1	there	there	PRON
dentistry3000-835	36	2	is	be	VERB
dentistry3000-835	36	3	an	an	DET
dentistry3000-835	36	4	interest	interest	NOUN
dentistry3000-835	36	5	in	in	ADP
dentistry3000-835	36	6	diyala	diyala	PROPN
dentistry3000-835	36	7	governorate	governorate	PROPN
dentistry3000-835	36	8	on	on	ADP
dentistry3000-835	36	9	methods	method	NOUN
dentistry3000-835	36	10	to	to	PART
dentistry3000-835	36	11	detect	detect	VERB
dentistry3000-835	36	12	resistance	resistance	NOUN
dentistry3000-835	36	13	of	of	ADP
dentistry3000-835	36	14	streptococcus	streptococcus	NOUN
dentistry3000-835	36	15	viridans	viridan	NOUN
dentistry3000-835	36	16	bacteria	bacteria	NOUN
dentistry3000-835	36	17	to	to	PART
dentistry3000-835	36	18	tetracycline	tetracycline	VERB
dentistry3000-835	36	19	antibiotics	antibiotic	NOUN
dentistry3000-835	36	20	among	among	ADP
dentistry3000-835	36	21	hospitalized	hospitalize	VERB
dentistry3000-835	36	22	patients	patient	NOUN
dentistry3000-835	36	23	.	.	PUNCT
dentistry3000-835	37	1	the	the	DET
dentistry3000-835	37	2	aim	aim	NOUN
dentistry3000-835	37	3	of	of	ADP
dentistry3000-835	37	4	this	this	DET
dentistry3000-835	37	5	study	study	NOUN
dentistry3000-835	37	6	was	be	AUX
dentistry3000-835	37	7	to	to	PART
dentistry3000-835	37	8	isolate	isolate	VERB
dentistry3000-835	37	9	s.	s.	PROPN
dentistry3000-835	37	10	viridans	viridan	NOUN
dentistry3000-835	37	11	and	and	CCONJ
dentistry3000-835	37	12	characterize	characterize	VERB
dentistry3000-835	37	13	them	they	PRON
dentistry3000-835	37	14	phenotypically	phenotypically	ADV
dentistry3000-835	37	15	,	,	PUNCT
dentistry3000-835	37	16	biochemically	biochemically	ADV
dentistry3000-835	37	17	and	and	CCONJ
dentistry3000-835	37	18	by	by	ADP
dentistry3000-835	37	19	molecular	molecular	ADJ
dentistry3000-835	37	20	methods	method	NOUN
dentistry3000-835	37	21	using	use	VERB
dentistry3000-835	37	22	16srrna	16srrna	NOUN
dentistry3000-835	37	23	and	and	CCONJ
dentistry3000-835	37	24	rpoa	rpoa	PROPN
dentistry3000-835	37	25	.	.	PUNCT
dentistry3000-835	38	1	material	material	NOUN
dentistry3000-835	38	2	and	and	CCONJ
dentistry3000-835	38	3	methods	method	NOUN
dentistry3000-835	38	4	isolation	isolation	NOUN
dentistry3000-835	38	5	and	and	CCONJ
dentistry3000-835	38	6	diagnosis	diagnosis	NOUN
dentistry3000-835	38	7	of	of	ADP
dentistry3000-835	38	8	the	the	DET
dentistry3000-835	38	9	bacteria	bacteria	NOUN
dentistry3000-835	38	10	under	under	ADP
dentistry3000-835	38	11	study	study	NOUN
dentistry3000-835	38	12	oral	oral	ADJ
dentistry3000-835	38	13	samples	sample	NOUN
dentistry3000-835	38	14	were	be	AUX
dentistry3000-835	38	15	cultured	cultured	ADJ
dentistry3000-835	38	16	on	on	ADP
dentistry3000-835	38	17	blood	blood	NOUN
dentistry3000-835	38	18	agar	agar	NOUN
dentistry3000-835	38	19	and	and	CCONJ
dentistry3000-835	38	20	on	on	ADP
dentistry3000-835	38	21	mitis	mitis	NOUN
dentistry3000-835	38	22	salivarius	salivarius	NOUN
dentistry3000-835	38	23	agar	agar	NOUN
dentistry3000-835	38	24	medium	medium	NOUN
dentistry3000-835	38	25	and	and	CCONJ
dentistry3000-835	38	26	incubated	incubate	VERB
dentistry3000-835	38	27	in	in	ADP
dentistry3000-835	38	28	an	an	DET
dentistry3000-835	38	29	anaerobic	anaerobic	NOUN
dentistry3000-835	38	30	growth	growth	NOUN
dentistry3000-835	38	31	cylinder	cylinder	NOUN
dentistry3000-835	38	32	candle	candle	NOUN
dentistry3000-835	38	33	jar	jar	NOUN
dentistry3000-835	38	34	for	for	ADP
dentistry3000-835	38	35	48	48	NUM
dentistry3000-835	38	36	hours	hour	NOUN
dentistry3000-835	38	37	at	at	ADP
dentistry3000-835	38	38	a	a	DET
dentistry3000-835	38	39	temperature	temperature	NOUN
dentistry3000-835	38	40	of	of	ADP
dentistry3000-835	38	41	37	37	NUM
dentistry3000-835	38	42	°	°	NOUN
dentistry3000-835	38	43	c	c	NOUN
dentistry3000-835	38	44	,	,	PUNCT
dentistry3000-835	38	45	and	and	CCONJ
dentistry3000-835	38	46	then	then	ADV
dentistry3000-835	38	47	the	the	DET
dentistry3000-835	38	48	isolates	isolate	NOUN
dentistry3000-835	38	49	were	be	AUX
dentistry3000-835	38	50	morphologically	morphologically	ADV
dentistry3000-835	38	51	characterized	characterize	VERB
dentistry3000-835	38	52	based	base	VERB
dentistry3000-835	38	53	on	on	ADP
dentistry3000-835	38	54	the	the	DET
dentistry3000-835	38	55	shape	shape	NOUN
dentistry3000-835	38	56	of	of	ADP
dentistry3000-835	38	57	the	the	DET
dentistry3000-835	38	58	colony	colony	NOUN
dentistry3000-835	39	1	[	[	X
dentistry3000-835	39	2	7	7	NUM
dentistry3000-835	39	3	]	]	PUNCT
dentistry3000-835	39	4	,	,	PUNCT
dentistry3000-835	39	5	and	and	CCONJ
dentistry3000-835	39	6	microscopically	microscopically	ADV
dentistry3000-835	39	7	,	,	PUNCT
dentistry3000-835	39	8	based	base	VERB
dentistry3000-835	39	9	on	on	ADP
dentistry3000-835	39	10	the	the	DET
dentistry3000-835	39	11	shape	shape	NOUN
dentistry3000-835	39	12	,	,	PUNCT
dentistry3000-835	39	13	color	color	NOUN
dentistry3000-835	39	14	,	,	PUNCT
dentistry3000-835	39	15	cell	cell	NOUN
dentistry3000-835	39	16	clusters	cluster	NOUN
dentistry3000-835	39	17	,	,	PUNCT
dentistry3000-835	39	18	and	and	CCONJ
dentistry3000-835	39	19	type	type	NOUN
dentistry3000-835	39	20	of	of	ADP
dentistry3000-835	39	21	pigmentation	pigmentation	NOUN
dentistry3000-835	39	22	[	[	X
dentistry3000-835	39	23	8	8	NUM
dentistry3000-835	39	24	]	]	PUNCT
dentistry3000-835	39	25	.	.	PUNCT
dentistry3000-835	40	1	in	in	ADP
dentistry3000-835	40	2	addition	addition	NOUN
dentistry3000-835	40	3	,	,	PUNCT
dentistry3000-835	40	4	biochemical	biochemical	ADJ
dentistry3000-835	40	5	characterization	characterization	NOUN
dentistry3000-835	40	6	,	,	PUNCT
dentistry3000-835	40	7	based	base	VERB
dentistry3000-835	40	8	on	on	ADP
dentistry3000-835	40	9	the	the	DET
dentistry3000-835	40	10	ability	ability	NOUN
dentistry3000-835	40	11	of	of	ADP
dentistry3000-835	40	12	the	the	DET
dentistry3000-835	40	13	bacteria	bacteria	NOUN
dentistry3000-835	40	14	to	to	PART
dentistry3000-835	40	15	produce	produce	VERB
dentistry3000-835	40	16	enzymes	enzyme	NOUN
dentistry3000-835	40	17	such	such	ADJ
dentistry3000-835	40	18	as	as	ADP
dentistry3000-835	40	19	oxidase	oxidase	NOUN
dentistry3000-835	40	20	[	[	X
dentistry3000-835	40	21	9	9	NUM
dentistry3000-835	40	22	]	]	PUNCT
dentistry3000-835	40	23	and	and	CCONJ
dentistry3000-835	40	24	catalase	catalase	VERB
dentistry3000-835	41	1	[	[	X
dentistry3000-835	41	2	10	10	NUM
dentistry3000-835	41	3	]	]	PUNCT
dentistry3000-835	41	4	was	be	AUX
dentistry3000-835	41	5	performed	perform	VERB
dentistry3000-835	41	6	.	.	PUNCT
dentistry3000-835	42	1	finally	finally	ADV
dentistry3000-835	42	2	,	,	PUNCT
dentistry3000-835	42	3	we	we	PRON
dentistry3000-835	42	4	tested	test	VERB
dentistry3000-835	42	5	the	the	DET
dentistry3000-835	42	6	solubility	solubility	NOUN
dentistry3000-835	42	7	in	in	ADP
dentistry3000-835	42	8	bile	bile	NOUN
dentistry3000-835	42	9	salts	salt	NOUN
dentistry3000-835	42	10	[	[	X
dentistry3000-835	42	11	11	11	NUM
dentistry3000-835	42	12	]	]	PUNCT
dentistry3000-835	42	13	and	and	CCONJ
dentistry3000-835	42	14	tested	test	VERB
dentistry3000-835	42	15	sensitivity	sensitivity	NOUN
dentistry3000-835	42	16	to	to	PART
dentistry3000-835	42	17	optogen	optogen	VERB
dentistry3000-835	42	18	[	[	X
dentistry3000-835	42	19	12	12	NUM
dentistry3000-835	42	20	]	]	PUNCT
dentistry3000-835	42	21	.	.	PUNCT
dentistry3000-835	43	1	sample	sample	NOUN
dentistry3000-835	43	2	collection	collection	NOUN
dentistry3000-835	43	3	60	60	NUM
dentistry3000-835	43	4	oral	oral	ADJ
dentistry3000-835	43	5	samples	sample	NOUN
dentistry3000-835	43	6	were	be	AUX
dentistry3000-835	43	7	collected	collect	VERB
dentistry3000-835	43	8	from	from	ADP
dentistry3000-835	43	9	patients	patient	NOUN
dentistry3000-835	43	10	at	at	ADP
dentistry3000-835	43	11	the	the	DET
dentistry3000-835	43	12	specialized	specialized	ADJ
dentistry3000-835	43	13	dental	dental	ADJ
dentistry3000-835	43	14	center	center	NOUN
dentistry3000-835	43	15	in	in	ADP
dentistry3000-835	43	16	baquba	baquba	PROPN
dentistry3000-835	43	17	,	,	PUNCT
dentistry3000-835	43	18	diyala	diyala	PROPN
dentistry3000-835	43	19	,	,	PUNCT
dentistry3000-835	43	20	iraq	iraq	PROPN
dentistry3000-835	43	21	and	and	CCONJ
dentistry3000-835	43	22	from	from	ADP
dentistry3000-835	43	23	outpatient	outpatient	NOUN
dentistry3000-835	43	24	dental	dental	ADJ
dentistry3000-835	43	25	clinics	clinic	NOUN
dentistry3000-835	43	26	,	,	PUNCT
dentistry3000-835	43	27	under	under	ADP
dentistry3000-835	43	28	the	the	DET
dentistry3000-835	43	29	supervision	supervision	NOUN
dentistry3000-835	43	30	of	of	ADP
dentistry3000-835	43	31	specialized	specialized	ADJ
dentistry3000-835	43	32	dentists	dentist	NOUN
dentistry3000-835	43	33	,	,	PUNCT
dentistry3000-835	43	34	during	during	ADP
dentistry3000-835	43	35	the	the	DET
dentistry3000-835	43	36	period	period	NOUN
dentistry3000-835	43	37	between	between	ADP
dentistry3000-835	43	38	august	august	PROPN
dentistry3000-835	43	39	and	and	CCONJ
dentistry3000-835	43	40	december	december	PROPN
dentistry3000-835	43	41	2017	2017	NUM
dentistry3000-835	43	42	.	.	PUNCT
dentistry3000-835	44	1	the	the	DET
dentistry3000-835	44	2	samples	sample	NOUN
dentistry3000-835	44	3	were	be	AUX
dentistry3000-835	44	4	taken	take	VERB
dentistry3000-835	44	5	using	use	VERB
dentistry3000-835	44	6	sterile	sterile	ADJ
dentistry3000-835	44	7	cotton	cotton	NOUN
dentistry3000-835	44	8	swabs	swab	NOUN
dentistry3000-835	44	9	inside	inside	ADP
dentistry3000-835	44	10	a	a	DET
dentistry3000-835	44	11	closed	closed	ADJ
dentistry3000-835	44	12	carrier	carrier	NOUN
dentistry3000-835	44	13	medium	medium	NOUN
dentistry3000-835	44	14	for	for	ADP
dentistry3000-835	44	15	the	the	DET
dentistry3000-835	44	16	purpose	purpose	NOUN
dentistry3000-835	44	17	of	of	ADP
dentistry3000-835	44	18	avoiding	avoid	VERB
dentistry3000-835	44	19	external	external	ADJ
dentistry3000-835	44	20	contamination	contamination	NOUN
dentistry3000-835	44	21	as	as	ADV
dentistry3000-835	44	22	well	well	ADV
dentistry3000-835	44	23	as	as	ADP
dentistry3000-835	44	24	to	to	PART
dentistry3000-835	44	25	prevent	prevent	VERB
dentistry3000-835	44	26	contamination	contamination	NOUN
dentistry3000-835	44	27	of	of	ADP
dentistry3000-835	44	28	samples	sample	NOUN
dentistry3000-835	44	29	during	during	ADP
dentistry3000-835	44	30	their	their	PRON
dentistry3000-835	44	31	transport	transport	NOUN
dentistry3000-835	44	32	to	to	ADP
dentistry3000-835	44	33	the	the	DET
dentistry3000-835	44	34	laboratory	laboratory	NOUN
dentistry3000-835	44	35	.	.	PUNCT
dentistry3000-835	45	1	detection	detection	NOUN
dentistry3000-835	45	2	of	of	ADP
dentistry3000-835	45	3	virulence	virulence	NOUN
dentistry3000-835	45	4	factors	factor	NOUN
dentistry3000-835	45	5	various	various	ADJ
dentistry3000-835	45	6	methods	method	NOUN
dentistry3000-835	45	7	were	be	AUX
dentistry3000-835	45	8	utilized	utilize	VERB
dentistry3000-835	45	9	for	for	ADP
dentistry3000-835	45	10	determination	determination	NOUN
dentistry3000-835	45	11	of	of	ADP
dentistry3000-835	45	12	virulent	virulent	ADJ
dentistry3000-835	45	13	factor	factor	NOUN
dentistry3000-835	45	14	:	:	PUNCT
dentistry3000-835	45	15	the	the	DET
dentistry3000-835	45	16	ability	ability	NOUN
dentistry3000-835	45	17	of	of	ADP
dentistry3000-835	45	18	bacterial	bacterial	ADJ
dentistry3000-835	45	19	isolates	isolate	NOUN
dentistry3000-835	45	20	to	to	PART
dentistry3000-835	45	21	produce	produce	VERB
dentistry3000-835	45	22	hemolysin	hemolysin	NOUN
dentistry3000-835	45	23	[	[	X
dentistry3000-835	45	24	13	13	NUM
dentistry3000-835	45	25	]	]	SYM
dentistry3000-835	45	26	lipase	lipase	NOUN
dentistry3000-835	46	1	[	[	X
dentistry3000-835	46	2	11	11	NUM
dentistry3000-835	46	3	]	]	PUNCT
dentistry3000-835	46	4	,	,	PUNCT
dentistry3000-835	46	5	protease	protease	NOUN
dentistry3000-835	46	6	[	[	X
dentistry3000-835	46	7	14	14	NUM
dentistry3000-835	46	8	]	]	PUNCT
dentistry3000-835	46	9	,	,	PUNCT
dentistry3000-835	46	10	dnase	dnase	VERB
dentistry3000-835	46	11	[	[	X
dentistry3000-835	46	12	15	15	NUM
dentistry3000-835	46	13	]	]	X
dentistry3000-835	46	14	enzymes	enzyme	NOUN
dentistry3000-835	46	15	,	,	PUNCT
dentistry3000-835	46	16	biofilm	biofilm	NOUN
dentistry3000-835	46	17	production	production	NOUN
dentistry3000-835	47	1	[	[	X
dentistry3000-835	47	2	16	16	NUM
dentistry3000-835	47	3	]	]	PUNCT
dentistry3000-835	47	4	,	,	PUNCT
dentistry3000-835	47	5	composition	composition	NOUN
dentistry3000-835	47	6	of	of	ADP
dentistry3000-835	47	7	the	the	DET
dentistry3000-835	47	8	portfolio	portfolio	NOUN
dentistry3000-835	48	1	[	[	X
dentistry3000-835	48	2	17	17	NUM
dentistry3000-835	48	3	]	]	PUNCT
dentistry3000-835	48	4	,	,	PUNCT
dentistry3000-835	48	5	and	and	CCONJ
dentistry3000-835	48	6	the	the	DET
dentistry3000-835	48	7	ability	ability	NOUN
dentistry3000-835	48	8	to	to	PART
dentistry3000-835	48	9	produce	produce	VERB
dentistry3000-835	48	10	bacteriocin	bacteriocin	PRON
dentistry3000-835	48	11	[	[	X
dentistry3000-835	48	12	18	18	NUM
dentistry3000-835	48	13	]	]	PUNCT
dentistry3000-835	48	14	.	.	PUNCT
dentistry3000-835	49	1	antibiotic	antibiotic	ADJ
dentistry3000-835	49	2	susceptibility	susceptibility	NOUN
dentistry3000-835	49	3	testing	test	VERB
dentistry3000-835	49	4	the	the	DET
dentistry3000-835	49	5	sensitivity	sensitivity	NOUN
dentistry3000-835	49	6	of	of	ADP
dentistry3000-835	49	7	the	the	DET
dentistry3000-835	49	8	s.	s.	PROPN
dentistry3000-835	49	9	viridans	viridans	PROPN
dentistry3000-835	49	10	isolates	isolate	NOUN
dentistry3000-835	49	11	under	under	ADP
dentistry3000-835	49	12	study	study	NOUN
dentistry3000-835	49	13	to	to	ADP
dentistry3000-835	49	14	eight	eight	NUM
dentistry3000-835	49	15	antibiotics	antibiotic	NOUN
dentistry3000-835	49	16	was	be	AUX
dentistry3000-835	49	17	tested	test	VERB
dentistry3000-835	49	18	using	use	VERB
dentistry3000-835	49	19	the	the	DET
dentistry3000-835	49	20	disk	disk	NOUN
dentistry3000-835	49	21	diffusion	diffusion	NOUN
dentistry3000-835	49	22	method	method	NOUN
dentistry3000-835	49	23	on	on	ADP
dentistry3000-835	49	24	muellerhinton	muellerhinton	NOUN
dentistry3000-835	49	25	agar	agar	NOUN
dentistry3000-835	49	26	medium	medium	NOUN
dentistry3000-835	49	27	[	[	X
dentistry3000-835	49	28	19,20	19,20	NOUN
dentistry3000-835	49	29	]	]	PUNCT
dentistry3000-835	49	30	.	.	PUNCT
dentistry3000-835	50	1	antibiotics	antibiotic	NOUN
dentistry3000-835	50	2	used	use	VERB
dentistry3000-835	50	3	in	in	ADP
dentistry3000-835	50	4	this	this	DET
dentistry3000-835	50	5	study	study	NOUN
dentistry3000-835	50	6	were	be	AUX
dentistry3000-835	50	7	doxycycline	doxycycline	NOUN
dentistry3000-835	50	8	(	(	PUNCT
dentistry3000-835	50	9	30	30	NUM
dentistry3000-835	50	10	µg	µg	NOUN
dentistry3000-835	50	11	)	)	PUNCT
dentistry3000-835	50	12	,	,	PUNCT
dentistry3000-835	50	13	erythromycin	erythromycin	NOUN
dentistry3000-835	50	14	(	(	PUNCT
dentistry3000-835	50	15	15	15	NUM
dentistry3000-835	50	16	µg	µg	NOUN
dentistry3000-835	50	17	)	)	PUNCT
dentistry3000-835	50	18	,	,	PUNCT
dentistry3000-835	50	19	clindamycin	clindamycin	NOUN
dentistry3000-835	50	20	(	(	PUNCT
dentistry3000-835	50	21	15	15	NUM
dentistry3000-835	50	22	µg	µg	NOUN
dentistry3000-835	50	23	)	)	PUNCT
dentistry3000-835	50	24	,	,	PUNCT
dentistry3000-835	50	25	clarithromycin	clarithromycin	NOUN
dentistry3000-835	50	26	(	(	PUNCT
dentistry3000-835	50	27	15	15	NUM
dentistry3000-835	50	28	µg	µg	NOUN
dentistry3000-835	50	29	)	)	PUNCT
dentistry3000-835	50	30	,	,	PUNCT
dentistry3000-835	50	31	ciprofloxacin	ciprofloxacin	NOUN
dentistry3000-835	50	32	(	(	PUNCT
dentistry3000-835	50	33	5	5	NUM
dentistry3000-835	50	34	µg	µg	NOUN
dentistry3000-835	50	35	)	)	PUNCT
dentistry3000-835	50	36	,	,	PUNCT
dentistry3000-835	50	37	bacitracin	bacitracin	NOUN
dentistry3000-835	50	38	(	(	PUNCT
dentistry3000-835	50	39	0.04	0.04	NUM
dentistry3000-835	50	40	micrograms	microgram	NOUN
dentistry3000-835	50	41	)	)	PUNCT
dentistry3000-835	50	42	,	,	PUNCT
dentistry3000-835	50	43	tetracycline	tetracycline	NOUN
dentistry3000-835	50	44	(	(	PUNCT
dentistry3000-835	50	45	30	30	NUM
dentistry3000-835	50	46	micrograms	microgram	NOUN
dentistry3000-835	50	47	)	)	PUNCT
dentistry3000-835	50	48	,	,	PUNCT
dentistry3000-835	50	49	and	and	CCONJ
dentistry3000-835	50	50	augmentin	augmentin	PROPN
dentistry3000-835	50	51	(	(	PUNCT
dentistry3000-835	50	52	30	30	NUM
dentistry3000-835	50	53	micrograms	microgram	NOUN
dentistry3000-835	50	54	)	)	PUNCT
dentistry3000-835	50	55	.	.	PUNCT
dentistry3000-835	51	1	extraction	extraction	NOUN
dentistry3000-835	51	2	of	of	ADP
dentistry3000-835	51	3	total	total	ADJ
dentistry3000-835	51	4	dna	dna	NOUN
dentistry3000-835	51	5	and	and	CCONJ
dentistry3000-835	51	6	pcr	pcr	ADJ
dentistry3000-835	51	7	amplification	amplification	NOUN
dentistry3000-835	51	8	total	total	NOUN
dentistry3000-835	51	9	dna	dna	NOUN
dentistry3000-835	51	10	extraction	extraction	NOUN
dentistry3000-835	51	11	and	and	CCONJ
dentistry3000-835	51	12	pcr	pcr	ADJ
dentistry3000-835	51	13	amplification	amplification	NOUN
dentistry3000-835	51	14	of	of	ADP
dentistry3000-835	51	15	the	the	DET
dentistry3000-835	51	16	tetracyclineresistant	tetracyclineresistant	ADJ
dentistry3000-835	51	17	bacterial	bacterial	ADJ
dentistry3000-835	51	18	isolates	isolate	NOUN
dentistry3000-835	51	19	under	under	ADP
dentistry3000-835	51	20	study	study	NOUN
dentistry3000-835	51	21	was	be	AUX
dentistry3000-835	51	22	done	do	VERB
dentistry3000-835	51	23	using	use	VERB
dentistry3000-835	51	24	geneaid	geneaid	PROPN
dentistry3000-835	51	25	.	.	PUNCT
dentistry3000-835	52	1	genomic	genomic	PROPN
dentistry3000-835	52	2	dna	dna	PROPN
dentistry3000-835	52	3	was	be	AUX
dentistry3000-835	52	4	purified	purify	VERB
dentistry3000-835	52	5	and	and	CCONJ
dentistry3000-835	52	6	the	the	DET
dentistry3000-835	52	7	rpoa	rpoa	NOUN
dentistry3000-835	52	8	and	and	CCONJ
dentistry3000-835	52	9	tetm	tetm	NOUN
dentistry3000-835	52	10	genes	gene	NOUN
dentistry3000-835	52	11	(	(	PUNCT
dentistry3000-835	52	12	445	445	NUM
dentistry3000-835	52	13	base	base	NOUN
dentistry3000-835	52	14	pairs	pair	NOUN
dentistry3000-835	52	15	)	)	PUNCT
dentistry3000-835	52	16	were	be	AUX
dentistry3000-835	52	17	amplified	amplify	VERB
dentistry3000-835	52	18	using	use	VERB
dentistry3000-835	52	19	specific	specific	ADJ
dentistry3000-835	52	20	primers	primer	NOUN
dentistry3000-835	52	21	:	:	PUNCT
dentistry3000-835	52	22	rpoa	rpoa	PROPN
dentistry3000-835	52	23	f(cac	f(cac	PROPN
dentistry3000-835	52	24	agt	agt	PROPN
dentistry3000-835	52	25	tcc	tcc	PROPN
dentistry3000-835	52	26	agg	agg	PROPN
dentistry3000-835	52	27	tgt	tgt	PROPN
dentistry3000-835	52	28	tcg	tcg	PROPN
dentistry3000-835	52	29	)	)	PUNCT
dentistry3000-835	52	30	and	and	CCONJ
dentistry3000-835	52	31	r(tgc	r(tgc	NOUN
dentistry3000-835	52	32	tga	tga	X
dentistry3000-835	52	33	molecular	molecular	ADJ
dentistry3000-835	52	34	detec	detec	ADJ
dentistry3000-835	52	35	,	,	PUNCT
dentistry3000-835	52	36	on	on	ADP
dentistry3000-835	52	37	of	of	ADP
dentistry3000-835	52	38	tetracycline	tetracycline	NOUN
dentistry3000-835	52	39	-	-	PUNCT
dentistry3000-835	52	40	resistant	resistant	ADJ
dentistry3000-835	52	41	streptococcus	streptococcus	NOUN
dentistry3000-835	52	42	viridans	viridan	NOUN
dentistry3000-835	52	43	bacteria	bacteria	NOUN
dentistry3000-835	52	44	using	use	VERB
dentistry3000-835	52	45	the	the	DET
dentistry3000-835	52	46	rpoa	rpoa	ADJ
dentistry3000-835	52	47	gene	gene	NOUN
dentistry3000-835	52	48	vol	vol	NOUN
dentistry3000-835	52	49	13	13	NUM
dentistry3000-835	52	50	no	no	DET
dentistry3000-835	52	51	1	1	NUM
dentistry3000-835	52	52	(	(	PUNCT
dentistry3000-835	52	53	2025	2025	NUM
dentistry3000-835	52	54	)	)	PUNCT
dentistry3000-835	52	55	doi	doi	NOUN
dentistry3000-835	52	56	10.5195	10.5195	NUM
dentistry3000-835	52	57	/	/	SYM
dentistry3000-835	52	58	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	52	59	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-835	52	60	aag	aag	PROPN
dentistry3000-835	52	61	ccc	ccc	PROPN
dentistry3000-835	52	62	taa	taa	PROPN
dentistry3000-835	52	63	agcat	agcat	PROPN
dentistry3000-835	52	64	)	)	PUNCT
dentistry3000-835	52	65	and	and	CCONJ
dentistry3000-835	52	66	tetm	tetm	X
dentistry3000-835	52	67	f	f	PROPN
dentistry3000-835	52	68	(	(	PUNCT
dentistry3000-835	52	69	agttttagctcatgttgatg	agttttagctcatgttgatg	PROPN
dentistry3000-835	52	70	)	)	PUNCT
dentistry3000-835	52	71	and	and	CCONJ
dentistry3000-835	52	72	r(tccgactatttgggacgacgg	r(tccgactatttgggacgacgg	NOUN
dentistry3000-835	52	73	)	)	PUNCT
dentistry3000-835	52	74	,	,	PUNCT
dentistry3000-835	52	75	respectively	respectively	ADV
dentistry3000-835	52	76	.	.	PUNCT
dentistry3000-835	53	1	for	for	ADP
dentistry3000-835	53	2	the	the	DET
dentistry3000-835	53	3	pcr	pcr	PROPN
dentistry3000-835	53	4	master	master	NOUN
dentistry3000-835	53	5	mix	mix	NOUN
dentistry3000-835	53	6	,	,	PUNCT
dentistry3000-835	53	7	geneaid	geneaid	VERB
dentistry3000-835	53	8	,	,	PUNCT
dentistry3000-835	53	9	accupower	accupower	PROPN
dentistry3000-835	53	10	®	®	PROPN
dentistry3000-835	53	11	profi	profi	PROPN
dentistry3000-835	53	12	taq	taq	PROPN
dentistry3000-835	53	13	pcr	pcr	PROPN
dentistry3000-835	53	14	premix	premix	NOUN
dentistry3000-835	53	15	was	be	AUX
dentistry3000-835	53	16	placed	place	VERB
dentistry3000-835	53	17	in	in	ADP
dentistry3000-835	53	18	stander	stander	NOUN
dentistry3000-835	53	19	accupower	accupower	NOUN
dentistry3000-835	53	20	®	®	PROPN
dentistry3000-835	53	21	profi	profi	PROPN
dentistry3000-835	53	22	taq	taq	PROPN
dentistry3000-835	53	23	pcr	pcr	PROPN
dentistry3000-835	53	24	premix	premix	NOUN
dentistry3000-835	53	25	)	)	PUNCT
dentistry3000-835	53	26	that	that	PRON
dentistry3000-835	53	27	contained	contain	VERB
dentistry3000-835	53	28	all	all	DET
dentistry3000-835	53	29	other	other	ADJ
dentistry3000-835	53	30	components	component	NOUN
dentistry3000-835	53	31	.	.	PUNCT
dentistry3000-835	54	1	to	to	PART
dentistry3000-835	54	2	execute	execute	VERB
dentistry3000-835	54	3	the	the	DET
dentistry3000-835	54	4	pcr	pcr	ADJ
dentistry3000-835	54	5	reaction	reaction	NOUN
dentistry3000-835	54	6	,	,	PUNCT
dentistry3000-835	54	7	taq	taq	PROPN
dentistry3000-835	54	8	dna	dna	PROPN
dentistry3000-835	54	9	polymerase	polymerase	NOUN
dentistry3000-835	54	10	,	,	PUNCT
dentistry3000-835	54	11	dntp	dntp	NOUN
dentistry3000-835	54	12	,	,	PUNCT
dentistry3000-835	54	13	tris	tris	NOUN
dentistry3000-835	54	14	-	-	PUNCT
dentistry3000-835	54	15	hcl	hcl	NOUN
dentistry3000-835	54	16	,	,	PUNCT
dentistry3000-835	54	17	ph	ph	NOUN
dentistry3000-835	54	18	9	9	NUM
dentistry3000-835	54	19	,	,	PUNCT
dentistry3000-835	54	20	kcl	kcl	PROPN
dentistry3000-835	54	21	mgcl2	mgcl2	PROPN
dentistry3000-835	54	22	stabilizer	stabilizer	NOUN
dentistry3000-835	54	23	,	,	PUNCT
dentistry3000-835	54	24	and	and	CCONJ
dentistry3000-835	54	25	tacking	tack	VERB
dentistry3000-835	54	26	dye	dye	NOUN
dentistry3000-835	54	27	were	be	AUX
dentistry3000-835	54	28	used	use	VERB
dentistry3000-835	54	29	(	(	PUNCT
dentistry3000-835	54	30	table	table	NOUN
dentistry3000-835	54	31	1	1	NUM
dentistry3000-835	54	32	)	)	PUNCT
dentistry3000-835	54	33	.	.	PUNCT
dentistry3000-835	55	1	table	table	NOUN
dentistry3000-835	55	2	1	1	NUM
dentistry3000-835	55	3	.	.	PUNCT
dentistry3000-835	56	1	components	component	NOUN
dentistry3000-835	56	2	for	for	ADP
dentistry3000-835	56	3	the	the	DET
dentistry3000-835	56	4	polymerase	polymerase	NOUN
dentistry3000-835	56	5	chain	chain	NOUN
dentistry3000-835	56	6	reaction	reaction	NOUN
dentistry3000-835	56	7	(	(	PUNCT
dentistry3000-835	56	8	pcr	pcr	PROPN
dentistry3000-835	56	9	)	)	PUNCT
dentistry3000-835	56	10	.	.	PUNCT
dentistry3000-835	57	1	pcr	pcr	PROPN
dentistry3000-835	57	2	tubes	tube	NOUN
dentistry3000-835	57	3	were	be	AUX
dentistry3000-835	57	4	prepared	prepare	VERB
dentistry3000-835	57	5	according	accord	VERB
dentistry3000-835	57	6	to	to	PART
dentistry3000-835	57	7	manufacture	manufacture	VERB
dentistry3000-835	57	8	instructions	instruction	NOUN
dentistry3000-835	57	9	.	.	PUNCT
dentistry3000-835	58	1	they	they	PRON
dentistry3000-835	58	2	were	be	AUX
dentistry3000-835	58	3	transferred	transfer	VERB
dentistry3000-835	58	4	into	into	ADP
dentistry3000-835	58	5	a	a	DET
dentistry3000-835	58	6	spin	spin	NOUN
dentistry3000-835	58	7	vortex	vortex	NOUN
dentistry3000-835	58	8	centrifuge	centrifuge	NOUN
dentistry3000-835	58	9	for	for	ADP
dentistry3000-835	58	10	3	3	NUM
dentistry3000-835	58	11	minutes	minute	NOUN
dentistry3000-835	58	12	at	at	ADP
dentistry3000-835	58	13	3000	3000	NUM
dentistry3000-835	58	14	rpm	rpm	NOUN
dentistry3000-835	58	15	and	and	CCONJ
dentistry3000-835	58	16	then	then	ADV
dentistry3000-835	58	17	placed	place	VERB
dentistry3000-835	58	18	in	in	ADP
dentistry3000-835	58	19	the	the	DET
dentistry3000-835	58	20	pcr	pcr	ADJ
dentistry3000-835	58	21	thermocycler	thermocycler	NOUN
dentistry3000-835	58	22	.	.	PUNCT
dentistry3000-835	59	1	pcr	pcr	ADJ
dentistry3000-835	59	2	amplification	amplification	NOUN
dentistry3000-835	59	3	conditions	condition	NOUN
dentistry3000-835	59	4	for	for	ADP
dentistry3000-835	59	5	rpoa	rpoa	NOUN
dentistry3000-835	59	6	were	be	AUX
dentistry3000-835	59	7	denaturation	denaturation	NOUN
dentistry3000-835	59	8	at	at	ADP
dentistry3000-835	59	9	950c	950c	NOUN
dentistry3000-835	59	10	for	for	ADP
dentistry3000-835	59	11	5	5	NUM
dentistry3000-835	59	12	minutes	minute	NOUN
dentistry3000-835	59	13	followed	follow	VERB
dentistry3000-835	59	14	by	by	ADP
dentistry3000-835	59	15	30	30	NUM
dentistry3000-835	59	16	cycles	cycle	NOUN
dentistry3000-835	59	17	of	of	ADP
dentistry3000-835	59	18	annealing	anneal	VERB
dentistry3000-835	59	19	at	at	ADP
dentistry3000-835	59	20	500c	500c	NUM
dentistry3000-835	59	21	for	for	ADP
dentistry3000-835	59	22	30	30	NUM
dentistry3000-835	59	23	seconds	second	NOUN
dentistry3000-835	59	24	,	,	PUNCT
dentistry3000-835	59	25	extension	extension	NOUN
dentistry3000-835	59	26	at	at	ADP
dentistry3000-835	59	27	72	72	NUM
dentistry3000-835	59	28	°	°	ADP
dentistry3000-835	59	29	c	c	NOUN
dentistry3000-835	59	30	for	for	ADP
dentistry3000-835	59	31	30	30	NUM
dentistry3000-835	59	32	seconds	second	NOUN
dentistry3000-835	59	33	,	,	PUNCT
dentistry3000-835	59	34	and	and	CCONJ
dentistry3000-835	59	35	a	a	DET
dentistry3000-835	59	36	final	final	ADJ
dentistry3000-835	59	37	extension	extension	NOUN
dentistry3000-835	59	38	cycle	cycle	NOUN
dentistry3000-835	59	39	at	at	ADP
dentistry3000-835	59	40	72	72	NUM
dentistry3000-835	59	41	°	°	ADP
dentistry3000-835	59	42	c	c	NOUN
dentistry3000-835	59	43	for	for	ADP
dentistry3000-835	59	44	5	5	NUM
dentistry3000-835	59	45	minutes	minute	NOUN
dentistry3000-835	59	46	.	.	PUNCT
dentistry3000-835	60	1	for	for	ADP
dentistry3000-835	60	2	the	the	DET
dentistry3000-835	60	3	tetm	tetm	NOUN
dentistry3000-835	60	4	gene	gene	NOUN
dentistry3000-835	60	5	,	,	PUNCT
dentistry3000-835	60	6	the	the	DET
dentistry3000-835	60	7	reaction	reaction	NOUN
dentistry3000-835	60	8	conditions	condition	NOUN
dentistry3000-835	60	9	were	be	AUX
dentistry3000-835	60	10	denaturation	denaturation	NOUN
dentistry3000-835	60	11	at	at	ADP
dentistry3000-835	60	12	950c	950c	NOUN
dentistry3000-835	60	13	for	for	ADP
dentistry3000-835	60	14	5	5	NUM
dentistry3000-835	60	15	minutes	minute	NOUN
dentistry3000-835	60	16	,	,	PUNCT
dentistry3000-835	60	17	followed	follow	VERB
dentistry3000-835	60	18	by	by	ADP
dentistry3000-835	60	19	30	30	NUM
dentistry3000-835	60	20	cycles	cycle	NOUN
dentistry3000-835	60	21	,	,	PUNCT
dentistry3000-835	60	22	annealing	anneal	VERB
dentistry3000-835	60	23	at	at	ADP
dentistry3000-835	60	24	640c	640c	NOUN
dentistry3000-835	60	25	for	for	ADP
dentistry3000-835	60	26	30	30	NUM
dentistry3000-835	60	27	seconds	second	NOUN
dentistry3000-835	60	28	,	,	PUNCT
dentistry3000-835	60	29	extension	extension	NOUN
dentistry3000-835	60	30	at	at	ADP
dentistry3000-835	60	31	72	72	NUM
dentistry3000-835	60	32	°	°	ADP
dentistry3000-835	60	33	c	c	NOUN
dentistry3000-835	60	34	for	for	ADP
dentistry3000-835	60	35	30	30	NUM
dentistry3000-835	60	36	seconds	second	NOUN
dentistry3000-835	60	37	,	,	PUNCT
dentistry3000-835	60	38	and	and	CCONJ
dentistry3000-835	60	39	a	a	DET
dentistry3000-835	60	40	final	final	ADJ
dentistry3000-835	60	41	extension	extension	NOUN
dentistry3000-835	60	42	cycle	cycle	NOUN
dentistry3000-835	60	43	at	at	ADP
dentistry3000-835	60	44	72	72	NUM
dentistry3000-835	60	45	°	°	ADP
dentistry3000-835	60	46	c	c	NOUN
dentistry3000-835	60	47	for	for	ADP
dentistry3000-835	60	48	5	5	NUM
dentistry3000-835	60	49	minutes	minute	NOUN
dentistry3000-835	60	50	.	.	PUNCT
dentistry3000-835	61	1	pcr	pcr	ADJ
dentistry3000-835	61	2	products	product	NOUN
dentistry3000-835	61	3	were	be	AUX
dentistry3000-835	61	4	resolved	resolve	VERB
dentistry3000-835	61	5	in	in	ADP
dentistry3000-835	61	6	1	1	NUM
dentistry3000-835	61	7	%	%	NOUN
dentistry3000-835	61	8	agarose	agarose	NOUN
dentistry3000-835	61	9	gel	gel	NOUN
dentistry3000-835	61	10	and	and	CCONJ
dentistry3000-835	61	11	visualized	visualize	VERB
dentistry3000-835	61	12	by	by	ADP
dentistry3000-835	61	13	uv	uv	NOUN
dentistry3000-835	61	14	gel	gel	NOUN
dentistry3000-835	61	15	documentation	documentation	NOUN
dentistry3000-835	61	16	and	and	CCONJ
dentistry3000-835	61	17	the	the	DET
dentistry3000-835	61	18	image	image	NOUN
dentistry3000-835	61	19	was	be	AUX
dentistry3000-835	61	20	captured	capture	VERB
dentistry3000-835	61	21	by	by	ADP
dentistry3000-835	61	22	digital	digital	ADJ
dentistry3000-835	61	23	camera	camera	NOUN
dentistry3000-835	61	24	(	(	PUNCT
dentistry3000-835	61	25	canon	canon	NOUN
dentistry3000-835	61	26	,	,	PUNCT
dentistry3000-835	61	27	usa	usa	PROPN
dentistry3000-835	61	28	)	)	PUNCT
dentistry3000-835	62	1	[	[	X
dentistry3000-835	62	2	21	21	NUM
dentistry3000-835	62	3	]	]	PUNCT
dentistry3000-835	62	4	.	.	PUNCT
dentistry3000-835	63	1	results	result	NOUN
dentistry3000-835	63	2	and	and	CCONJ
dentistry3000-835	63	3	discussion	discussion	NOUN
dentistry3000-835	63	4	isolation	isolation	NOUN
dentistry3000-835	63	5	and	and	CCONJ
dentistry3000-835	63	6	identification	identification	NOUN
dentistry3000-835	63	7	of	of	ADP
dentistry3000-835	63	8	streptococcus	streptococcus	NOUN
dentistry3000-835	63	9	spp	spp	NOUN
dentistry3000-835	63	10	the	the	DET
dentistry3000-835	63	11	results	result	NOUN
dentistry3000-835	63	12	showed	show	VERB
dentistry3000-835	63	13	that	that	SCONJ
dentistry3000-835	63	14	27	27	NUM
dentistry3000-835	63	15	samples	sample	NOUN
dentistry3000-835	63	16	,	,	PUNCT
dentistry3000-835	63	17	representing	represent	VERB
dentistry3000-835	63	18	45	45	NUM
dentistry3000-835	63	19	%	%	NOUN
dentistry3000-835	63	20	of	of	ADP
dentistry3000-835	63	21	the	the	DET
dentistry3000-835	63	22	total	total	ADJ
dentistry3000-835	63	23	60	60	NUM
dentistry3000-835	63	24	,	,	PUNCT
dentistry3000-835	63	25	had	have	VERB
dentistry3000-835	63	26	streptococcus	streptococcus	NOUN
dentistry3000-835	63	27	.	.	PUNCT
dentistry3000-835	64	1	isolation	isolation	NOUN
dentistry3000-835	64	2	rate	rate	NOUN
dentistry3000-835	64	3	of	of	ADP
dentistry3000-835	64	4	s.	s.	PROPN
dentistry3000-835	64	5	viridans	viridan	VERB
dentistry3000-835	64	6	bacteria	bacteria	NOUN
dentistry3000-835	64	7	in	in	ADP
dentistry3000-835	64	8	the	the	DET
dentistry3000-835	64	9	current	current	ADJ
dentistry3000-835	64	10	study	study	NOUN
dentistry3000-835	64	11	was	be	AUX
dentistry3000-835	64	12	25.9	25.9	NUM
dentistry3000-835	64	13	%	%	NOUN
dentistry3000-835	64	14	.	.	PUNCT
dentistry3000-835	65	1	these	these	DET
dentistry3000-835	65	2	results	result	NOUN
dentistry3000-835	65	3	were	be	AUX
dentistry3000-835	65	4	inconsistent	inconsistent	ADJ
dentistry3000-835	65	5	with	with	ADP
dentistry3000-835	65	6	previous	previous	ADJ
dentistry3000-835	65	7	work	work	NOUN
dentistry3000-835	66	1	[	[	X
dentistry3000-835	66	2	22,23	22,23	NOUN
dentistry3000-835	66	3	]	]	PUNCT
dentistry3000-835	66	4	,	,	PUNCT
dentistry3000-835	66	5	which	which	PRON
dentistry3000-835	66	6	showed	show	VERB
dentistry3000-835	66	7	the	the	DET
dentistry3000-835	66	8	isolation	isolation	NOUN
dentistry3000-835	66	9	rate	rate	NOUN
dentistry3000-835	66	10	of	of	ADP
dentistry3000-835	66	11	these	these	DET
dentistry3000-835	66	12	bacteria	bacteria	NOUN
dentistry3000-835	66	13	as	as	ADP
dentistry3000-835	66	14	11	11	NUM
dentistry3000-835	66	15	%	%	NOUN
dentistry3000-835	66	16	and	and	CCONJ
dentistry3000-835	66	17	5	5	NUM
dentistry3000-835	66	18	%	%	NOUN
dentistry3000-835	66	19	,	,	PUNCT
dentistry3000-835	66	20	respectively	respectively	ADV
dentistry3000-835	66	21	,	,	PUNCT
dentistry3000-835	66	22	and	and	CCONJ
dentistry3000-835	66	23	more	more	ADV
dentistry3000-835	66	24	like	like	ADP
dentistry3000-835	66	25	others	other	NOUN
dentistry3000-835	66	26	[	[	X
dentistry3000-835	66	27	24	24	NUM
dentistry3000-835	66	28	-	-	SYM
dentistry3000-835	66	29	26	26	NUM
dentistry3000-835	66	30	]	]	PUNCT
dentistry3000-835	66	31	that	that	PRON
dentistry3000-835	66	32	found	find	VERB
dentistry3000-835	66	33	percentages	percentage	NOUN
dentistry3000-835	66	34	of	of	ADP
dentistry3000-835	66	35	43	43	NUM
dentistry3000-835	66	36	%	%	NOUN
dentistry3000-835	66	37	,	,	PUNCT
dentistry3000-835	66	38	19.6	19.6	NUM
dentistry3000-835	66	39	%	%	NOUN
dentistry3000-835	66	40	,	,	PUNCT
dentistry3000-835	66	41	or	or	CCONJ
dentistry3000-835	66	42	24.5	24.5	NUM
dentistry3000-835	66	43	%	%	NOUN
dentistry3000-835	66	44	.	.	PUNCT
dentistry3000-835	67	1	the	the	DET
dentistry3000-835	67	2	reason	reason	NOUN
dentistry3000-835	67	3	for	for	ADP
dentistry3000-835	67	4	the	the	DET
dentistry3000-835	67	5	difference	difference	NOUN
dentistry3000-835	67	6	in	in	ADP
dentistry3000-835	67	7	the	the	DET
dentistry3000-835	67	8	percentage	percentage	NOUN
dentistry3000-835	67	9	of	of	ADP
dentistry3000-835	67	10	isolation	isolation	NOUN
dentistry3000-835	67	11	of	of	ADP
dentistry3000-835	67	12	hemolytic	hemolytic	ADJ
dentistry3000-835	67	13	streptococcus	streptococcus	NOUN
dentistry3000-835	67	14	in	in	ADP
dentistry3000-835	67	15	the	the	DET
dentistry3000-835	67	16	current	current	ADJ
dentistry3000-835	67	17	study	study	NOUN
dentistry3000-835	67	18	in	in	ADP
dentistry3000-835	67	19	comparison	comparison	NOUN
dentistry3000-835	67	20	with	with	ADP
dentistry3000-835	67	21	previous	previous	ADJ
dentistry3000-835	67	22	studies	study	NOUN
dentistry3000-835	67	23	is	be	AUX
dentistry3000-835	67	24	possibly	possibly	ADV
dentistry3000-835	67	25	due	due	ADJ
dentistry3000-835	67	26	to	to	ADP
dentistry3000-835	67	27	differences	difference	NOUN
dentistry3000-835	67	28	in	in	ADP
dentistry3000-835	67	29	the	the	DET
dentistry3000-835	67	30	source	source	NOUN
dentistry3000-835	67	31	of	of	ADP
dentistry3000-835	67	32	isolation	isolation	NOUN
dentistry3000-835	67	33	,	,	PUNCT
dentistry3000-835	67	34	geographical	geographical	ADJ
dentistry3000-835	67	35	location	location	NOUN
dentistry3000-835	67	36	,	,	PUNCT
dentistry3000-835	67	37	ages	age	NOUN
dentistry3000-835	67	38	,	,	PUNCT
dentistry3000-835	67	39	or	or	CCONJ
dentistry3000-835	67	40	nutritional	nutritional	ADJ
dentistry3000-835	67	41	and	and	CCONJ
dentistry3000-835	67	42	health	health	NOUN
dentistry3000-835	67	43	habits	habit	NOUN
dentistry3000-835	67	44	.	.	PUNCT
dentistry3000-835	68	1	volume	volume	NOUN
dentistry3000-835	68	2	components	component	NOUN
dentistry3000-835	68	3	5	5	NUM
dentistry3000-835	68	4	master	master	NOUN
dentistry3000-835	68	5	mix	mix	NOUN
dentistry3000-835	68	6	pcr	pcr	ADJ
dentistry3000-835	68	7	solution	solution	NOUN
dentistry3000-835	68	8	3	3	NUM
dentistry3000-835	68	9	dna	dna	NOUN
dentistry3000-835	68	10	template	template	NOUN
dentistry3000-835	68	11	2	2	NUM
dentistry3000-835	68	12	forward	forward	NOUN
dentistry3000-835	68	13	primer	primer	NOUN
dentistry3000-835	68	14	2	2	NUM
dentistry3000-835	68	15	revers	rever	NOUN
dentistry3000-835	68	16	primer	primer	VERB
dentistry3000-835	68	17	13	13	NUM
dentistry3000-835	68	18	pcr	pcr	NOUN
dentistry3000-835	68	19	water	water	NOUN
dentistry3000-835	68	20	25	25	NUM
dentistry3000-835	68	21	total	total	ADJ
dentistry3000-835	68	22	volume	volume	NOUN
dentistry3000-835	68	23	molecular	molecular	ADJ
dentistry3000-835	68	24	detec	detec	ADJ
dentistry3000-835	68	25	,	,	PUNCT
dentistry3000-835	68	26	on	on	ADP
dentistry3000-835	68	27	of	of	ADP
dentistry3000-835	68	28	tetracycline	tetracycline	NOUN
dentistry3000-835	68	29	-	-	PUNCT
dentistry3000-835	68	30	resistant	resistant	ADJ
dentistry3000-835	68	31	streptococcus	streptococcus	NOUN
dentistry3000-835	68	32	viridans	viridan	NOUN
dentistry3000-835	68	33	bacteria	bacteria	NOUN
dentistry3000-835	68	34	using	use	VERB
dentistry3000-835	68	35	the	the	DET
dentistry3000-835	68	36	rpoa	rpoa	ADJ
dentistry3000-835	68	37	gene	gene	NOUN
dentistry3000-835	68	38	vol	vol	NOUN
dentistry3000-835	68	39	13	13	NUM
dentistry3000-835	68	40	no	no	DET
dentistry3000-835	68	41	1	1	NUM
dentistry3000-835	68	42	(	(	PUNCT
dentistry3000-835	68	43	2025	2025	NUM
dentistry3000-835	69	1	)	)	PUNCT
dentistry3000-835	69	2	doi	doi	NOUN
dentistry3000-835	69	3	10.5195	10.5195	NUM
dentistry3000-835	69	4	/	/	SYM
dentistry3000-835	69	5	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	69	6	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-835	69	7	445	445	NUM
dentistry3000-835	69	8	b.p	b.p	PROPN
dentistry3000-835	69	9	figure	figure	NOUN
dentistry3000-835	69	10	1	1	NUM
dentistry3000-835	69	11	.	.	PUNCT
dentistry3000-835	70	1	electrophoresis	electrophoresis	NOUN
dentistry3000-835	70	2	of	of	ADP
dentistry3000-835	70	3	amplification	amplification	NOUN
dentistry3000-835	70	4	products	product	NOUN
dentistry3000-835	70	5	of	of	ADP
dentistry3000-835	70	6	rpoa	rpoa	NOUN
dentistry3000-835	70	7	(	(	PUNCT
dentistry3000-835	70	8	445	445	NUM
dentistry3000-835	70	9	base	base	NOUN
dentistry3000-835	70	10	pairs	pair	NOUN
dentistry3000-835	70	11	)	)	PUNCT
dentistry3000-835	70	12	in	in	ADP
dentistry3000-835	70	13	an	an	DET
dentistry3000-835	70	14	agarose	agarose	NOUN
dentistry3000-835	70	15	gel	gel	NOUN
dentistry3000-835	70	16	.	.	PUNCT
dentistry3000-835	71	1	detection	detection	NOUN
dentistry3000-835	71	2	of	of	ADP
dentistry3000-835	71	3	streptococcus	streptococcus	NOUN
dentistry3000-835	71	4	viridans	viridan	NOUN
dentistry3000-835	71	5	using	use	VERB
dentistry3000-835	71	6	the	the	DET
dentistry3000-835	71	7	diagnostic	diagnostic	ADJ
dentistry3000-835	71	8	rpoa	rpoa	NOUN
dentistry3000-835	71	9	gene	gene	NOUN
dentistry3000-835	71	10	rpoa	rpoa	NOUN
dentistry3000-835	71	11	was	be	AUX
dentistry3000-835	71	12	detected	detect	VERB
dentistry3000-835	71	13	in	in	ADP
dentistry3000-835	71	14	all	all	DET
dentistry3000-835	71	15	samples	sample	NOUN
dentistry3000-835	71	16	(	(	PUNCT
dentistry3000-835	71	17	figure	figure	NOUN
dentistry3000-835	71	18	1	1	NUM
dentistry3000-835	71	19	)	)	PUNCT
dentistry3000-835	71	20	.	.	PUNCT
dentistry3000-835	72	1	antibiotic	antibiotic	ADJ
dentistry3000-835	72	2	susceptibility	susceptibility	NOUN
dentistry3000-835	72	3	testing	testing	NOUN
dentistry3000-835	72	4	for	for	ADP
dentistry3000-835	72	5	streptococcus	streptococcus	NOUN
dentistry3000-835	72	6	viridans	viridan	NOUN
dentistry3000-835	72	7	the	the	DET
dentistry3000-835	72	8	sensitivity	sensitivity	NOUN
dentistry3000-835	72	9	of	of	ADP
dentistry3000-835	72	10	streptococcus	streptococcus	NOUN
dentistry3000-835	72	11	viridans	viridan	NOUN
dentistry3000-835	72	12	isolates	isolate	NOUN
dentistry3000-835	72	13	to	to	ADP
dentistry3000-835	72	14	eight	eight	NUM
dentistry3000-835	72	15	antibiotics	antibiotic	NOUN
dentistry3000-835	72	16	(	(	PUNCT
dentistry3000-835	72	17	doxycycline	doxycycline	NOUN
dentistry3000-835	72	18	,	,	PUNCT
dentistry3000-835	72	19	tetracycline	tetracycline	PROPN
dentistry3000-835	72	20	,	,	PUNCT
dentistry3000-835	72	21	augmentin	augmentin	PROPN
dentistry3000-835	72	22	,	,	PUNCT
dentistry3000-835	72	23	ciprofloxacin	ciprofloxacin	NOUN
dentistry3000-835	72	24	,	,	PUNCT
dentistry3000-835	72	25	clindamycin	clindamycin	NOUN
dentistry3000-835	72	26	,	,	PUNCT
dentistry3000-835	72	27	bacitracin	bacitracin	NOUN
dentistry3000-835	72	28	,	,	PUNCT
dentistry3000-835	72	29	clarithromycin	clarithromycin	NOUN
dentistry3000-835	72	30	,	,	PUNCT
dentistry3000-835	72	31	and	and	CCONJ
dentistry3000-835	72	32	erythromycin	erythromycin	NOUN
dentistry3000-835	72	33	)	)	PUNCT
dentistry3000-835	72	34	was	be	AUX
dentistry3000-835	72	35	tested	test	VERB
dentistry3000-835	72	36	.	.	PUNCT
dentistry3000-835	73	1	the	the	DET
dentistry3000-835	73	2	results	result	NOUN
dentistry3000-835	73	3	of	of	ADP
dentistry3000-835	73	4	the	the	DET
dentistry3000-835	73	5	current	current	ADJ
dentistry3000-835	73	6	study	study	NOUN
dentistry3000-835	73	7	showed	show	VERB
dentistry3000-835	73	8	that	that	SCONJ
dentistry3000-835	73	9	the	the	DET
dentistry3000-835	73	10	rate	rate	NOUN
dentistry3000-835	73	11	of	of	ADP
dentistry3000-835	73	12	resistance	resistance	NOUN
dentistry3000-835	73	13	of	of	ADP
dentistry3000-835	73	14	viridans	viridan	NOUN
dentistry3000-835	73	15	to	to	ADP
dentistry3000-835	73	16	the	the	DET
dentistry3000-835	73	17	tetracycline	tetracycline	ADJ
dentistry3000-835	73	18	antibiotic	antibiotic	NOUN
dentistry3000-835	73	19	was	be	AUX
dentistry3000-835	73	20	71.4	71.4	NUM
dentistry3000-835	73	21	%	%	NOUN
dentistry3000-835	73	22	,	,	PUNCT
dentistry3000-835	73	23	which	which	PRON
dentistry3000-835	73	24	is	be	AUX
dentistry3000-835	73	25	inconsistent	inconsistent	ADJ
dentistry3000-835	73	26	with	with	ADP
dentistry3000-835	73	27	previous	previous	ADJ
dentistry3000-835	73	28	results	result	NOUN
dentistry3000-835	73	29	[	[	X
dentistry3000-835	73	30	27,28	27,28	NOUN
dentistry3000-835	73	31	]	]	X
dentistry3000-835	73	32	,	,	PUNCT
dentistry3000-835	73	33	that	that	PRON
dentistry3000-835	73	34	showed	show	VERB
dentistry3000-835	73	35	the	the	DET
dentistry3000-835	73	36	rate	rate	NOUN
dentistry3000-835	73	37	of	of	ADP
dentistry3000-835	73	38	resistance	resistance	NOUN
dentistry3000-835	73	39	of	of	ADP
dentistry3000-835	73	40	s.	s.	PROPN
dentistry3000-835	73	41	viridans	viridan	VERB
dentistry3000-835	73	42	bacteria	bacteria	NOUN
dentistry3000-835	73	43	to	to	ADP
dentistry3000-835	73	44	this	this	DET
dentistry3000-835	73	45	antibiotic	antibiotic	NOUN
dentistry3000-835	73	46	was	be	AUX
dentistry3000-835	73	47	2.7	2.7	NUM
dentistry3000-835	73	48	%	%	NOUN
dentistry3000-835	73	49	or	or	CCONJ
dentistry3000-835	73	50	15.8	15.8	NUM
dentistry3000-835	73	51	%	%	NOUN
dentistry3000-835	73	52	.	.	PUNCT
dentistry3000-835	74	1	the	the	DET
dentistry3000-835	74	2	reason	reason	NOUN
dentistry3000-835	74	3	for	for	ADP
dentistry3000-835	74	4	this	this	DET
dentistry3000-835	74	5	resistance	resistance	NOUN
dentistry3000-835	74	6	is	be	AUX
dentistry3000-835	74	7	suggested	suggest	VERB
dentistry3000-835	74	8	as	as	ADP
dentistry3000-835	74	9	the	the	DET
dentistry3000-835	74	10	inability	inability	NOUN
dentistry3000-835	74	11	of	of	ADP
dentistry3000-835	74	12	the	the	DET
dentistry3000-835	74	13	antibiotic	antibiotic	NOUN
dentistry3000-835	74	14	to	to	PART
dentistry3000-835	74	15	reach	reach	VERB
dentistry3000-835	74	16	inhibitory	inhibitory	ADJ
dentistry3000-835	74	17	concentrations	concentration	NOUN
dentistry3000-835	74	18	into	into	ADP
dentistry3000-835	74	19	the	the	DET
dentistry3000-835	74	20	bacterial	bacterial	ADJ
dentistry3000-835	74	21	cell	cell	NOUN
dentistry3000-835	74	22	because	because	SCONJ
dentistry3000-835	74	23	of	of	ADP
dentistry3000-835	74	24	the	the	DET
dentistry3000-835	74	25	presence	presence	NOUN
dentistry3000-835	74	26	of	of	ADP
dentistry3000-835	74	27	plasmids	plasmid	NOUN
dentistry3000-835	74	28	that	that	PRON
dentistry3000-835	74	29	encode	encode	ADJ
dentistry3000-835	74	30	efflux	efflux	NOUN
dentistry3000-835	74	31	pumps	pump	NOUN
dentistry3000-835	74	32	,	,	PUNCT
dentistry3000-835	74	33	which	which	PRON
dentistry3000-835	74	34	are	be	AUX
dentistry3000-835	74	35	responsible	responsible	ADJ
dentistry3000-835	74	36	for	for	ADP
dentistry3000-835	74	37	either	either	CCONJ
dentistry3000-835	74	38	increasing	increase	VERB
dentistry3000-835	74	39	the	the	DET
dentistry3000-835	74	40	transfer	transfer	NOUN
dentistry3000-835	74	41	of	of	ADP
dentistry3000-835	74	42	the	the	DET
dentistry3000-835	74	43	antigen	antigen	NOUN
dentistry3000-835	74	44	outside	outside	ADP
dentistry3000-835	74	45	the	the	DET
dentistry3000-835	74	46	bacterial	bacterial	ADJ
dentistry3000-835	74	47	cell	cell	NOUN
dentistry3000-835	74	48	or	or	CCONJ
dentistry3000-835	74	49	reducing	reduce	VERB
dentistry3000-835	74	50	its	its	PRON
dentistry3000-835	74	51	permeability	permeability	NOUN
dentistry3000-835	74	52	[	[	X
dentistry3000-835	74	53	4	4	NUM
dentistry3000-835	74	54	]	]	PUNCT
dentistry3000-835	74	55	.	.	PUNCT
dentistry3000-835	75	1	the	the	DET
dentistry3000-835	75	2	tetracycline	tetracycline	NOUN
dentistry3000-835	75	3	antagonist	antagonist	NOUN
dentistry3000-835	75	4	inhibits	inhibit	VERB
dentistry3000-835	75	5	protein	protein	NOUN
dentistry3000-835	75	6	synthesis	synthesis	NOUN
dentistry3000-835	75	7	by	by	ADP
dentistry3000-835	75	8	binding	bind	VERB
dentistry3000-835	75	9	to	to	ADP
dentistry3000-835	75	10	the	the	DET
dentistry3000-835	75	11	30s	30	NOUN
dentistry3000-835	75	12	ribosomal	ribosomal	NOUN
dentistry3000-835	75	13	unit	unit	NOUN
dentistry3000-835	75	14	.	.	PUNCT
dentistry3000-835	76	1	as	as	ADP
dentistry3000-835	76	2	a	a	DET
dentistry3000-835	76	3	result	result	NOUN
dentistry3000-835	76	4	of	of	ADP
dentistry3000-835	76	5	this	this	DET
dentistry3000-835	76	6	inhibition	inhibition	NOUN
dentistry3000-835	76	7	,	,	PUNCT
dentistry3000-835	76	8	it	it	PRON
dentistry3000-835	76	9	prevents	prevent	VERB
dentistry3000-835	76	10	the	the	DET
dentistry3000-835	76	11	binding	binding	NOUN
dentistry3000-835	76	12	of	of	ADP
dentistry3000-835	76	13	amionacyl	amionacyl	NOUN
dentistry3000-835	76	14	-	-	PUNCT
dentistry3000-835	76	15	trna	trna	NOUN
dentistry3000-835	76	16	to	to	ADP
dentistry3000-835	76	17	the	the	DET
dentistry3000-835	76	18	special	special	ADJ
dentistry3000-835	76	19	site	site	NOUN
dentistry3000-835	76	20	on	on	ADP
dentistry3000-835	76	21	the	the	DET
dentistry3000-835	76	22	mrna	mrna	PROPN
dentistry3000-835	76	23	.	.	PUNCT
dentistry3000-835	77	1	the	the	DET
dentistry3000-835	77	2	resistance	resistance	NOUN
dentistry3000-835	77	3	rate	rate	NOUN
dentistry3000-835	77	4	of	of	ADP
dentistry3000-835	77	5	ciprofloxacin	ciprofloxacin	PROPN
dentistry3000-835	77	6	for	for	ADP
dentistry3000-835	77	7	s.	s.	PROPN
dentistry3000-835	77	8	viridans	viridans	PROPN
dentistry3000-835	77	9	isolates	isolate	NOUN
dentistry3000-835	77	10	was	be	AUX
dentistry3000-835	77	11	57	57	NUM
dentistry3000-835	77	12	%	%	NOUN
dentistry3000-835	77	13	,	,	PUNCT
dentistry3000-835	77	14	which	which	PRON
dentistry3000-835	77	15	is	be	AUX
dentistry3000-835	77	16	like	like	ADP
dentistry3000-835	77	17	results	result	NOUN
dentistry3000-835	77	18	of	of	ADP
dentistry3000-835	77	19	the	the	DET
dentistry3000-835	77	20	resistance	resistance	NOUN
dentistry3000-835	77	21	of	of	ADP
dentistry3000-835	77	22	s.	s.	PROPN
dentistry3000-835	77	23	mutans	mutans	PROPN
dentistry3000-835	77	24	defined	define	VERB
dentistry3000-835	77	25	as	as	ADP
dentistry3000-835	77	26	75	75	NUM
dentistry3000-835	77	27	%	%	NOUN
dentistry3000-835	77	28	[	[	X
dentistry3000-835	77	29	29	29	NUM
dentistry3000-835	77	30	]	]	PUNCT
dentistry3000-835	77	31	.	.	PUNCT
dentistry3000-835	78	1	the	the	DET
dentistry3000-835	78	2	antibiotic	antibiotic	ADJ
dentistry3000-835	78	3	effect	effect	NOUN
dentistry3000-835	78	4	of	of	ADP
dentistry3000-835	78	5	ciprofloxacin	ciprofloxacin	NOUN
dentistry3000-835	78	6	is	be	AUX
dentistry3000-835	78	7	bactericidal	bactericidal	ADJ
dentistry3000-835	78	8	by	by	ADP
dentistry3000-835	78	9	inhibiting	inhibit	VERB
dentistry3000-835	78	10	the	the	DET
dentistry3000-835	78	11	dna	dna	PROPN
dentistry3000-835	78	12	synthesis	synthesis	NOUN
dentistry3000-835	78	13	process	process	NOUN
dentistry3000-835	78	14	by	by	ADP
dentistry3000-835	78	15	stopping	stop	VERB
dentistry3000-835	78	16	the	the	DET
dentistry3000-835	78	17	action	action	NOUN
dentistry3000-835	78	18	of	of	ADP
dentistry3000-835	78	19	the	the	DET
dentistry3000-835	78	20	enzyme	enzyme	NOUN
dentistry3000-835	78	21	dna	dna	NOUN
dentistry3000-835	78	22	gyrase	gyrase	NOUN
dentistry3000-835	78	23	[	[	X
dentistry3000-835	78	24	30	30	NUM
dentistry3000-835	78	25	]	]	PUNCT
dentistry3000-835	78	26	.	.	PUNCT
dentistry3000-835	79	1	as	as	ADP
dentistry3000-835	79	2	for	for	ADP
dentistry3000-835	79	3	the	the	DET
dentistry3000-835	79	4	antibiotic	antibiotic	ADJ
dentistry3000-835	79	5	erythromycin	erythromycin	NOUN
dentistry3000-835	79	6	,	,	PUNCT
dentistry3000-835	79	7	the	the	DET
dentistry3000-835	79	8	resistance	resistance	NOUN
dentistry3000-835	79	9	rate	rate	NOUN
dentistry3000-835	79	10	of	of	ADP
dentistry3000-835	79	11	the	the	DET
dentistry3000-835	79	12	isolates	isolate	NOUN
dentistry3000-835	79	13	under	under	ADP
dentistry3000-835	79	14	study	study	NOUN
dentistry3000-835	79	15	was	be	AUX
dentistry3000-835	79	16	57	57	NUM
dentistry3000-835	79	17	%	%	NOUN
dentistry3000-835	79	18	.	.	PUNCT
dentistry3000-835	80	1	the	the	DET
dentistry3000-835	80	2	reason	reason	NOUN
dentistry3000-835	80	3	for	for	ADP
dentistry3000-835	80	4	the	the	DET
dentistry3000-835	80	5	resistance	resistance	NOUN
dentistry3000-835	80	6	of	of	ADP
dentistry3000-835	80	7	bacterial	bacterial	ADJ
dentistry3000-835	80	8	isolates	isolate	NOUN
dentistry3000-835	80	9	to	to	ADP
dentistry3000-835	80	10	the	the	DET
dentistry3000-835	80	11	anti	anti	ADJ
dentistry3000-835	80	12	-	-	ADJ
dentistry3000-835	80	13	erythromycin	erythromycin	NOUN
dentistry3000-835	80	14	is	be	AUX
dentistry3000-835	80	15	likely	likely	ADJ
dentistry3000-835	80	16	due	due	ADJ
dentistry3000-835	80	17	either	either	CCONJ
dentistry3000-835	80	18	to	to	ADP
dentistry3000-835	80	19	the	the	DET
dentistry3000-835	80	20	presence	presence	NOUN
dentistry3000-835	80	21	of	of	ADP
dentistry3000-835	80	22	plasmids	plasmid	NOUN
dentistry3000-835	80	23	that	that	PRON
dentistry3000-835	80	24	carry	carry	VERB
dentistry3000-835	80	25	genes	gene	NOUN
dentistry3000-835	80	26	responsible	responsible	ADJ
dentistry3000-835	80	27	for	for	ADP
dentistry3000-835	80	28	this	this	DET
dentistry3000-835	80	29	resistance	resistance	NOUN
dentistry3000-835	80	30	or	or	CCONJ
dentistry3000-835	80	31	to	to	ADP
dentistry3000-835	80	32	a	a	DET
dentistry3000-835	80	33	change	change	NOUN
dentistry3000-835	80	34	in	in	ADP
dentistry3000-835	80	35	the	the	DET
dentistry3000-835	80	36	target	target	NOUN
dentistry3000-835	80	37	site	site	NOUN
dentistry3000-835	80	38	,	,	PUNCT
dentistry3000-835	80	39	or	or	CCONJ
dentistry3000-835	80	40	to	to	PART
dentistry3000-835	80	41	add	add	VERB
dentistry3000-835	80	42	a	a	DET
dentistry3000-835	80	43	methyl	methyl	NOUN
dentistry3000-835	80	44	group	group	NOUN
dentistry3000-835	80	45	to	to	PART
dentistry3000-835	80	46	adenine	adenine	VERB
dentistry3000-835	80	47	to	to	PART
dentistry3000-835	80	48	rrna	rrna	VERB
dentistry3000-835	80	49	[	[	X
dentistry3000-835	80	50	31,32	31,32	NUM
dentistry3000-835	80	51	]	]	PUNCT
dentistry3000-835	80	52	.	.	PUNCT
dentistry3000-835	81	1	resistance	resistance	NOUN
dentistry3000-835	81	2	of	of	ADP
dentistry3000-835	81	3	the	the	DET
dentistry3000-835	81	4	bacterial	bacterial	ADJ
dentistry3000-835	81	5	isolates	isolate	NOUN
dentistry3000-835	81	6	of	of	ADP
dentistry3000-835	81	7	s.	s.	PROPN
dentistry3000-835	81	8	viridans	viridan	NOUN
dentistry3000-835	81	9	to	to	ADP
dentistry3000-835	81	10	the	the	DET
dentistry3000-835	81	11	antibiotic	antibiotic	ADJ
dentistry3000-835	81	12	clindamycin	clindamycin	NOUN
dentistry3000-835	81	13	was	be	AUX
dentistry3000-835	81	14	28	28	NUM
dentistry3000-835	81	15	%	%	NOUN
dentistry3000-835	81	16	.	.	PUNCT
dentistry3000-835	82	1	previous	previous	ADJ
dentistry3000-835	82	2	data	datum	NOUN
dentistry3000-835	82	3	showed	show	VERB
dentistry3000-835	82	4	resistance	resistance	NOUN
dentistry3000-835	82	5	of	of	ADP
dentistry3000-835	82	6	s.	s.	PROPN
dentistry3000-835	82	7	pyogenes	pyogenes	PROPN
dentistry3000-835	82	8	bacteria	bacteria	NOUN
dentistry3000-835	82	9	to	to	ADP
dentistry3000-835	82	10	this	this	DET
dentistry3000-835	82	11	antibiotic	antibiotic	NOUN
dentistry3000-835	82	12	was	be	AUX
dentistry3000-835	82	13	1.6	1.6	NUM
dentistry3000-835	82	14	%	%	NOUN
dentistry3000-835	82	15	[	[	X
dentistry3000-835	82	16	33	33	NUM
dentistry3000-835	82	17	]	]	PUNCT
dentistry3000-835	82	18	.	.	PUNCT
dentistry3000-835	83	1	clindamycin	clindamycin	NOUN
dentistry3000-835	83	2	is	be	AUX
dentistry3000-835	83	3	a	a	DET
dentistry3000-835	83	4	macrolide	macrolide	NOUN
dentistry3000-835	83	5	,	,	PUNCT
dentistry3000-835	83	6	and	and	CCONJ
dentistry3000-835	83	7	bacteria	bacteria	NOUN
dentistry3000-835	83	8	become	become	VERB
dentistry3000-835	83	9	resistant	resistant	ADJ
dentistry3000-835	83	10	to	to	ADP
dentistry3000-835	83	11	macrolides	macrolide	NOUN
dentistry3000-835	83	12	by	by	ADP
dentistry3000-835	83	13	acquiring	acquire	VERB
dentistry3000-835	83	14	the	the	DET
dentistry3000-835	83	15	mef	mef	NOUN
dentistry3000-835	83	16	(	(	PUNCT
dentistry3000-835	83	17	a	a	PRON
dentistry3000-835	83	18	)	)	PUNCT
dentistry3000-835	83	19	gene	gene	NOUN
dentistry3000-835	83	20	.	.	PUNCT
dentistry3000-835	84	1	this	this	DET
dentistry3000-835	84	2	gene	gene	NOUN
dentistry3000-835	84	3	encodes	encode	VERB
dentistry3000-835	84	4	the	the	DET
dentistry3000-835	84	5	5	5	NUM
dentistry3000-835	84	6	4	4	NUM
dentistry3000-835	84	7	3	3	NUM
dentistry3000-835	84	8	2	2	NUM
dentistry3000-835	84	9	1	1	NUM
dentistry3000-835	84	10	m	m	NOUN
dentistry3000-835	84	11	b.p	b.p	PROPN
dentistry3000-835	84	12	2000	2000	NUM
dentistry3000-835	84	13	1000	1000	NUM
dentistry3000-835	84	14	500	500	NUM
dentistry3000-835	84	15	100	100	NUM
dentistry3000-835	84	16	molecular	molecular	ADJ
dentistry3000-835	84	17	detec	detec	ADJ
dentistry3000-835	84	18	,	,	PUNCT
dentistry3000-835	84	19	on	on	ADP
dentistry3000-835	84	20	of	of	ADP
dentistry3000-835	84	21	tetracycline	tetracycline	NOUN
dentistry3000-835	84	22	-	-	PUNCT
dentistry3000-835	84	23	resistant	resistant	ADJ
dentistry3000-835	84	24	streptococcus	streptococcus	NOUN
dentistry3000-835	84	25	viridans	viridan	NOUN
dentistry3000-835	84	26	bacteria	bacteria	NOUN
dentistry3000-835	84	27	using	use	VERB
dentistry3000-835	84	28	the	the	DET
dentistry3000-835	84	29	rpoa	rpoa	ADJ
dentistry3000-835	84	30	gene	gene	NOUN
dentistry3000-835	84	31	vol	vol	NOUN
dentistry3000-835	84	32	13	13	NUM
dentistry3000-835	84	33	no	no	DET
dentistry3000-835	84	34	1	1	NUM
dentistry3000-835	84	35	(	(	PUNCT
dentistry3000-835	84	36	2025	2025	NUM
dentistry3000-835	84	37	)	)	PUNCT
dentistry3000-835	84	38	doi	doi	NOUN
dentistry3000-835	84	39	10.5195	10.5195	NUM
dentistry3000-835	84	40	/	/	SYM
dentistry3000-835	84	41	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	84	42	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	NOUN
dentistry3000-835	84	43	synthesis	synthesis	NOUN
dentistry3000-835	84	44	of	of	ADP
dentistry3000-835	84	45	efflux	efflux	NOUN
dentistry3000-835	84	46	pump	pump	NOUN
dentistry3000-835	84	47	protein	protein	NOUN
dentistry3000-835	84	48	synthesis	synthesis	NOUN
dentistry3000-835	84	49	,	,	PUNCT
dentistry3000-835	84	50	which	which	PRON
dentistry3000-835	84	51	works	work	VERB
dentistry3000-835	84	52	on	on	ADP
dentistry3000-835	84	53	pumping	pump	VERB
dentistry3000-835	84	54	4	4	NUM
dentistry3000-835	84	55	-	-	SYM
dentistry3000-835	84	56	15	15	NUM
dentistry3000-835	84	57	rings	ring	NOUN
dentistry3000-835	84	58	of	of	ADP
dentistry3000-835	84	59	the	the	DET
dentistry3000-835	84	60	macrolide	macrolide	ADJ
dentistry3000-835	84	61	group	group	NOUN
dentistry3000-835	84	62	[	[	X
dentistry3000-835	84	63	34	34	NUM
dentistry3000-835	84	64	]	]	PUNCT
dentistry3000-835	84	65	.	.	PUNCT
dentistry3000-835	84	66	)	)	PUNCT
dentistry3000-835	84	67	.	.	PUNCT
dentistry3000-835	85	1	as	as	ADP
dentistry3000-835	85	2	for	for	ADP
dentistry3000-835	85	3	the	the	DET
dentistry3000-835	85	4	resistance	resistance	NOUN
dentistry3000-835	85	5	of	of	ADP
dentistry3000-835	85	6	bacterial	bacterial	ADJ
dentistry3000-835	85	7	isolates	isolate	NOUN
dentistry3000-835	85	8	to	to	ADP
dentistry3000-835	85	9	the	the	DET
dentistry3000-835	85	10	antibiotic	antibiotic	ADJ
dentistry3000-835	85	11	augmentin	augmentin	NOUN
dentistry3000-835	85	12	,	,	PUNCT
dentistry3000-835	85	13	it	it	PRON
dentistry3000-835	85	14	reached	reach	VERB
dentistry3000-835	85	15	57	57	NUM
dentistry3000-835	85	16	%	%	NOUN
dentistry3000-835	85	17	for	for	ADP
dentistry3000-835	85	18	s.	s.	PROPN
dentistry3000-835	85	19	viridans	viridan	NOUN
dentistry3000-835	85	20	,	,	PUNCT
dentistry3000-835	85	21	which	which	PRON
dentistry3000-835	85	22	is	be	AUX
dentistry3000-835	85	23	different	different	ADJ
dentistry3000-835	85	24	than	than	ADP
dentistry3000-835	85	25	previous	previous	ADJ
dentistry3000-835	85	26	work	work	NOUN
dentistry3000-835	85	27	that	that	PRON
dentistry3000-835	85	28	showed	show	VERB
dentistry3000-835	85	29	a	a	DET
dentistry3000-835	85	30	resistance	resistance	NOUN
dentistry3000-835	85	31	rate	rate	NOUN
dentistry3000-835	85	32	of	of	ADP
dentistry3000-835	85	33	s.	s.	PROPN
dentistry3000-835	85	34	pyogenes	pyogenes	PROPN
dentistry3000-835	85	35	of	of	ADP
dentistry3000-835	85	36	6.6	6.6	NUM
dentistry3000-835	85	37	%	%	NOUN
dentistry3000-835	85	38	[	[	X
dentistry3000-835	85	39	22	22	NUM
dentistry3000-835	85	40	]	]	PUNCT
dentistry3000-835	85	41	.	.	PUNCT
dentistry3000-835	86	1	the	the	DET
dentistry3000-835	86	2	resistance	resistance	NOUN
dentistry3000-835	86	3	of	of	ADP
dentistry3000-835	86	4	s.	s.	PROPN
dentistry3000-835	86	5	viridans	viridans	PROPN
dentistry3000-835	86	6	isolates	isolate	NOUN
dentistry3000-835	86	7	to	to	ADP
dentistry3000-835	86	8	doxicyclin	doxicyclin	NOUN
dentistry3000-835	86	9	was	be	AUX
dentistry3000-835	86	10	57	57	NUM
dentistry3000-835	86	11	%	%	NOUN
dentistry3000-835	86	12	,	,	PUNCT
dentistry3000-835	86	13	which	which	PRON
dentistry3000-835	86	14	was	be	AUX
dentistry3000-835	86	15	different	different	ADJ
dentistry3000-835	86	16	to	to	ADP
dentistry3000-835	86	17	s.	s.	PROPN
dentistry3000-835	86	18	mutans	mutans	PROPN
dentistry3000-835	86	19	isolates	isolate	NOUN
dentistry3000-835	86	20	in	in	ADP
dentistry3000-835	86	21	previous	previous	ADJ
dentistry3000-835	86	22	work	work	NOUN
dentistry3000-835	86	23	that	that	PRON
dentistry3000-835	86	24	were	be	AUX
dentistry3000-835	86	25	sensitive	sensitive	ADJ
dentistry3000-835	86	26	at	at	ADP
dentistry3000-835	86	27	100	100	NUM
dentistry3000-835	86	28	%	%	NOUN
dentistry3000-835	86	29	level	level	NOUN
dentistry3000-835	86	30	[	[	X
dentistry3000-835	86	31	29	29	NUM
dentistry3000-835	86	32	]	]	PUNCT
dentistry3000-835	86	33	.	.	PUNCT
dentistry3000-835	87	1	for	for	ADP
dentistry3000-835	87	2	clarithromycin	clarithromycin	PROPN
dentistry3000-835	87	3	,	,	PUNCT
dentistry3000-835	87	4	the	the	DET
dentistry3000-835	87	5	resistance	resistance	NOUN
dentistry3000-835	87	6	of	of	ADP
dentistry3000-835	87	7	s.	s.	PROPN
dentistry3000-835	87	8	viridans	viridan	NOUN
dentistry3000-835	87	9	was	be	AUX
dentistry3000-835	87	10	71	71	NUM
dentistry3000-835	87	11	%	%	NOUN
dentistry3000-835	87	12	.	.	PUNCT
dentistry3000-835	88	1	these	these	DET
dentistry3000-835	88	2	results	result	NOUN
dentistry3000-835	88	3	were	be	AUX
dentistry3000-835	88	4	close	close	ADJ
dentistry3000-835	88	5	to	to	ADP
dentistry3000-835	88	6	the	the	DET
dentistry3000-835	88	7	results	result	NOUN
dentistry3000-835	88	8	reached	reach	VERB
dentistry3000-835	88	9	earlier	early	ADV
dentistry3000-835	88	10	for	for	ADP
dentistry3000-835	88	11	s.	s.	PROPN
dentistry3000-835	88	12	viridans	viridans	PROPN
dentistry3000-835	88	13	[	[	X
dentistry3000-835	88	14	35	35	NUM
dentistry3000-835	88	15	]	]	PUNCT
dentistry3000-835	88	16	.	.	PUNCT
dentistry3000-835	89	1	the	the	DET
dentistry3000-835	89	2	increase	increase	NOUN
dentistry3000-835	89	3	in	in	ADP
dentistry3000-835	89	4	resistance	resistance	NOUN
dentistry3000-835	89	5	resulting	result	VERB
dentistry3000-835	89	6	from	from	ADP
dentistry3000-835	89	7	misuse	misuse	NOUN
dentistry3000-835	89	8	of	of	ADP
dentistry3000-835	89	9	antibiotics	antibiotic	NOUN
dentistry3000-835	89	10	leads	lead	VERB
dentistry3000-835	89	11	to	to	ADP
dentistry3000-835	89	12	the	the	DET
dentistry3000-835	89	13	transfer	transfer	NOUN
dentistry3000-835	89	14	of	of	ADP
dentistry3000-835	89	15	this	this	DET
dentistry3000-835	89	16	resistance	resistance	NOUN
dentistry3000-835	89	17	through	through	ADP
dentistry3000-835	89	18	genetic	genetic	ADJ
dentistry3000-835	89	19	factors	factor	NOUN
dentistry3000-835	89	20	such	such	ADJ
dentistry3000-835	89	21	as	as	ADP
dentistry3000-835	89	22	transposons	transposon	NOUN
dentistry3000-835	89	23	or	or	CCONJ
dentistry3000-835	89	24	plasmids	plasmid	NOUN
dentistry3000-835	89	25	,	,	PUNCT
dentistry3000-835	89	26	or	or	CCONJ
dentistry3000-835	89	27	because	because	SCONJ
dentistry3000-835	89	28	of	of	ADP
dentistry3000-835	89	29	a	a	DET
dentistry3000-835	89	30	change	change	NOUN
dentistry3000-835	89	31	in	in	ADP
dentistry3000-835	89	32	the	the	DET
dentistry3000-835	89	33	permeability	permeability	NOUN
dentistry3000-835	89	34	of	of	ADP
dentistry3000-835	89	35	the	the	DET
dentistry3000-835	89	36	bacterial	bacterial	ADJ
dentistry3000-835	89	37	cell	cell	NOUN
dentistry3000-835	89	38	wall	wall	NOUN
dentistry3000-835	90	1	[	[	X
dentistry3000-835	90	2	36	36	NUM
dentistry3000-835	90	3	]	]	PUNCT
dentistry3000-835	90	4	.	.	PUNCT
dentistry3000-835	91	1	the	the	DET
dentistry3000-835	91	2	results	result	NOUN
dentistry3000-835	91	3	of	of	ADP
dentistry3000-835	91	4	the	the	DET
dentistry3000-835	91	5	study	study	NOUN
dentistry3000-835	91	6	showed	show	VERB
dentistry3000-835	91	7	that	that	SCONJ
dentistry3000-835	91	8	all	all	DET
dentistry3000-835	91	9	isolates	isolate	NOUN
dentistry3000-835	91	10	were	be	AUX
dentistry3000-835	91	11	100	100	NUM
dentistry3000-835	91	12	%	%	NOUN
dentistry3000-835	91	13	resistant	resistant	ADJ
dentistry3000-835	91	14	to	to	ADP
dentistry3000-835	91	15	bacitracin	bacitracin	NOUN
dentistry3000-835	91	16	.	.	PUNCT
dentistry3000-835	92	1	these	these	DET
dentistry3000-835	92	2	results	result	NOUN
dentistry3000-835	92	3	were	be	AUX
dentistry3000-835	92	4	close	close	ADJ
dentistry3000-835	92	5	to	to	ADP
dentistry3000-835	92	6	results	result	NOUN
dentistry3000-835	92	7	reached	reach	VERB
dentistry3000-835	92	8	earlier	early	ADV
dentistry3000-835	92	9	,	,	PUNCT
dentistry3000-835	92	10	where	where	SCONJ
dentistry3000-835	92	11	the	the	DET
dentistry3000-835	92	12	resistance	resistance	NOUN
dentistry3000-835	92	13	of	of	ADP
dentistry3000-835	92	14	s.	s.	PROPN
dentistry3000-835	92	15	mutans	mutans	PROPN
dentistry3000-835	92	16	bacteria	bacteria	NOUN
dentistry3000-835	92	17	to	to	ADP
dentistry3000-835	92	18	this	this	DET
dentistry3000-835	92	19	antibiotic	antibiotic	NOUN
dentistry3000-835	92	20	was	be	AUX
dentistry3000-835	92	21	100	100	NUM
dentistry3000-835	92	22	%	%	NOUN
dentistry3000-835	92	23	[	[	X
dentistry3000-835	92	24	37	37	NUM
dentistry3000-835	92	25	]	]	PUNCT
dentistry3000-835	92	26	.	.	PUNCT
dentistry3000-835	93	1	detection	detection	NOUN
dentistry3000-835	93	2	of	of	ADP
dentistry3000-835	93	3	the	the	DET
dentistry3000-835	93	4	tetm	tetm	NOUN
dentistry3000-835	93	5	gene	gene	NOUN
dentistry3000-835	93	6	using	use	VERB
dentistry3000-835	93	7	pcr	pcr	ADJ
dentistry3000-835	93	8	technology	technology	NOUN
dentistry3000-835	93	9	five	five	NUM
dentistry3000-835	93	10	bacterial	bacterial	ADJ
dentistry3000-835	93	11	isolates	isolate	NOUN
dentistry3000-835	93	12	under	under	ADP
dentistry3000-835	93	13	study	study	NOUN
dentistry3000-835	93	14	,	,	PUNCT
dentistry3000-835	93	15	belonging	belong	VERB
dentistry3000-835	93	16	to	to	ADP
dentistry3000-835	93	17	the	the	DET
dentistry3000-835	93	18	s.	s.	PROPN
dentistry3000-835	93	19	viridans	viridans	PROPN
dentistry3000-835	93	20	bacterium	bacterium	PROPN
dentistry3000-835	93	21	,	,	PUNCT
dentistry3000-835	93	22	were	be	AUX
dentistry3000-835	93	23	tested	test	VERB
dentistry3000-835	93	24	[	[	PUNCT
dentistry3000-835	93	25	38	38	NUM
dentistry3000-835	93	26	]	]	PUNCT
dentistry3000-835	93	27	.	.	PUNCT
dentistry3000-835	94	1	the	the	DET
dentistry3000-835	94	2	results	result	NOUN
dentistry3000-835	94	3	of	of	ADP
dentistry3000-835	94	4	the	the	DET
dentistry3000-835	94	5	current	current	ADJ
dentistry3000-835	94	6	study	study	NOUN
dentistry3000-835	94	7	showed	show	VERB
dentistry3000-835	94	8	that	that	SCONJ
dentistry3000-835	94	9	all	all	DET
dentistry3000-835	94	10	isolates	isolate	NOUN
dentistry3000-835	94	11	had	have	VERB
dentistry3000-835	94	12	the	the	DET
dentistry3000-835	94	13	tetm	tetm	ADJ
dentistry3000-835	94	14	gene	gene	NOUN
dentistry3000-835	94	15	that	that	PRON
dentistry3000-835	94	16	encodes	encode	VERB
dentistry3000-835	94	17	resistance	resistance	NOUN
dentistry3000-835	94	18	to	to	ADP
dentistry3000-835	94	19	tetracycline	tetracycline	NOUN
dentistry3000-835	94	20	in	in	ADP
dentistry3000-835	94	21	s.	s.	PROPN
dentistry3000-835	94	22	viridans	viridans	PROPN
dentistry3000-835	94	23	.	.	PUNCT
dentistry3000-835	95	1	the	the	DET
dentistry3000-835	95	2	results	result	NOUN
dentistry3000-835	95	3	of	of	ADP
dentistry3000-835	95	4	our	our	PRON
dentistry3000-835	95	5	study	study	NOUN
dentistry3000-835	95	6	were	be	AUX
dentistry3000-835	95	7	inconsistent	inconsistent	ADJ
dentistry3000-835	95	8	with	with	ADP
dentistry3000-835	95	9	previous	previous	ADJ
dentistry3000-835	95	10	work	work	NOUN
dentistry3000-835	95	11	,	,	PUNCT
dentistry3000-835	95	12	which	which	PRON
dentistry3000-835	95	13	indicated	indicate	VERB
dentistry3000-835	95	14	s.	s.	PROPN
dentistry3000-835	95	15	viridans	viridans	PROPN
dentistry3000-835	95	16	resistance	resistance	NOUN
dentistry3000-835	95	17	of	of	ADP
dentistry3000-835	95	18	43	43	NUM
dentistry3000-835	95	19	%	%	NOUN
dentistry3000-835	95	20	[	[	X
dentistry3000-835	95	21	39	39	NUM
dentistry3000-835	95	22	]	]	PUNCT
dentistry3000-835	95	23	.	.	PUNCT
dentistry3000-835	96	1	figure	figure	NOUN
dentistry3000-835	96	2	2	2	NUM
dentistry3000-835	96	3	.	.	PUNCT
dentistry3000-835	97	1	electrophoresis	electrophoresis	NOUN
dentistry3000-835	97	2	of	of	ADP
dentistry3000-835	97	3	the	the	DET
dentistry3000-835	97	4	amplification	amplification	NOUN
dentistry3000-835	97	5	products	product	NOUN
dentistry3000-835	97	6	of	of	ADP
dentistry3000-835	97	7	the	the	DET
dentistry3000-835	97	8	tetm	tetm	NOUN
dentistry3000-835	97	9	gene	gene	NOUN
dentistry3000-835	97	10	in	in	ADP
dentistry3000-835	97	11	an	an	DET
dentistry3000-835	97	12	agarose	agarose	NOUN
dentistry3000-835	97	13	gel	gel	NOUN
dentistry3000-835	97	14	at	at	ADP
dentistry3000-835	97	15	a	a	DET
dentistry3000-835	97	16	concentration	concentration	NOUN
dentistry3000-835	97	17	of	of	ADP
dentistry3000-835	97	18	1	1	NUM
dentistry3000-835	97	19	%	%	NOUN
dentistry3000-835	97	20	and	and	CCONJ
dentistry3000-835	97	21	a	a	DET
dentistry3000-835	97	22	voltage	voltage	NOUN
dentistry3000-835	97	23	of	of	ADP
dentistry3000-835	97	24	100	100	NUM
dentistry3000-835	97	25	v	v	NOUN
dentistry3000-835	97	26	for	for	ADP
dentistry3000-835	97	27	an	an	DET
dentistry3000-835	97	28	hour	hour	NOUN
dentistry3000-835	97	29	and	and	CCONJ
dentistry3000-835	97	30	using	use	VERB
dentistry3000-835	97	31	a	a	DET
dentistry3000-835	97	32	dna	dna	NOUN
dentistry3000-835	97	33	ladder	ladder	NOUN
dentistry3000-835	97	34	(	(	PUNCT
dentistry3000-835	97	35	100bp-2000bp	100bp-2000bp	NUM
dentistry3000-835	97	36	)	)	PUNCT
dentistry3000-835	97	37	,	,	PUNCT
dentistry3000-835	97	38	as	as	SCONJ
dentistry3000-835	97	39	this	this	PRON
dentistry3000-835	97	40	appears	appear	VERB
dentistry3000-835	97	41	in	in	ADP
dentistry3000-835	97	42	the	the	DET
dentistry3000-835	97	43	m	m	NOUN
dentistry3000-835	97	44	path	path	NOUN
dentistry3000-835	97	45	and	and	CCONJ
dentistry3000-835	97	46	starts	start	VERB
dentistry3000-835	97	47	from	from	ADP
dentistry3000-835	97	48	100	100	NUM
dentistry3000-835	97	49	base	base	NOUN
dentistry3000-835	97	50	pairs	pair	NOUN
dentistry3000-835	97	51	,	,	PUNCT
dentistry3000-835	97	52	and	and	CCONJ
dentistry3000-835	97	53	the	the	DET
dentistry3000-835	97	54	gene	gene	NOUN
dentistry3000-835	97	55	packages	package	NOUN
dentistry3000-835	97	56	are	be	AUX
dentistry3000-835	97	57	1,862	1,862	NUM
dentistry3000-835	97	58	base	base	NOUN
dentistry3000-835	97	59	pairs	pair	NOUN
dentistry3000-835	97	60	long	long	ADJ
dentistry3000-835	97	61	in	in	ADP
dentistry3000-835	97	62	s.	s.	PROPN
dentistry3000-835	97	63	viridans	viridans	PROPN
dentistry3000-835	97	64	bacteria	bacteria	NOUN
dentistry3000-835	97	65	.	.	PUNCT
dentistry3000-835	98	1	conflicts	conflict	NOUN
dentistry3000-835	98	2	of	of	ADP
dentistry3000-835	98	3	interest	interest	NOUN
dentistry3000-835	98	4	the	the	DET
dentistry3000-835	98	5	authors	author	NOUN
dentistry3000-835	98	6	declare	declare	VERB
dentistry3000-835	98	7	no	no	DET
dentistry3000-835	98	8	competing	compete	VERB
dentistry3000-835	98	9	interest	interest	NOUN
dentistry3000-835	98	10	.	.	PUNCT
dentistry3000-835	99	1	references	reference	NOUN
dentistry3000-835	99	2	1	1	NUM
dentistry3000-835	99	3	.	.	PUNCT
dentistry3000-835	99	4	brooks	brooks	PROPN
dentistry3000-835	99	5	gf	gf	PROPN
dentistry3000-835	99	6	,	,	PUNCT
dentistry3000-835	99	7	caroll	caroll	PROPN
dentistry3000-835	99	8	kc	kc	PROPN
dentistry3000-835	99	9	,	,	PUNCT
dentistry3000-835	99	10	butel	butel	NOUN
dentistry3000-835	99	11	js	js	PROPN
dentistry3000-835	99	12	,	,	PUNCT
dentistry3000-835	99	13	mores	more	NOUN
dentistry3000-835	99	14	sa	sa	PROPN
dentistry3000-835	99	15	,	,	PUNCT
dentistry3000-835	99	16	maietzner	maietzner	NOUN
dentistry3000-835	99	17	ta	ta	PROPN
dentistry3000-835	99	18	.	.	PUNCT
dentistry3000-835	100	1	(	(	PUNCT
dentistry3000-835	100	2	2010	2010	NUM
dentistry3000-835	100	3	)	)	PUNCT
dentistry3000-835	100	4	.	.	PUNCT
dentistry3000-835	101	1	jawets	jawet	NOUN
dentistry3000-835	101	2	,	,	PUNCT
dentistry3000-835	101	3	melnik	melnik	X
dentistry3000-835	101	4	and	and	CCONJ
dentistry3000-835	101	5	adelberg	adelberg	NOUN
dentistry3000-835	101	6	's	's	PART
dentistry3000-835	101	7	medical	medical	ADJ
dentistry3000-835	101	8	microbiology	microbiology	NOUN
dentistry3000-835	101	9	.	.	PUNCT
dentistry3000-835	102	1	25th	25th	NOUN
dentistry3000-835	102	2	ed	ed	NOUN
dentistry3000-835	102	3	.	.	PUNCT
dentistry3000-835	103	1	the	the	DET
dentistry3000-835	103	2	mcgraw	mcgraw	PROPN
dentistry3000-835	103	3	-	-	PUNCT
dentistry3000-835	103	4	hill	hill	NOUN
dentistry3000-835	103	5	companies	company	NOUN
dentistry3000-835	103	6	.	.	PUNCT
dentistry3000-835	104	1	2	2	X
dentistry3000-835	104	2	.	.	X
dentistry3000-835	104	3	murray	murray	PROPN
dentistry3000-835	104	4	pr	pr	PROPN
dentistry3000-835	104	5	,	,	PUNCT
dentistry3000-835	104	6	rosenthl	rosenthl	VERB
dentistry3000-835	104	7	ks	ks	PROPN
dentistry3000-835	104	8	,	,	PUNCT
dentistry3000-835	104	9	pfaller	pfaller	PROPN
dentistry3000-835	104	10	ma	ma	PROPN
dentistry3000-835	104	11	.	.	PROPN
dentistry3000-835	104	12	(	(	PUNCT
dentistry3000-835	104	13	2013	2013	NUM
dentistry3000-835	104	14	)	)	PUNCT
dentistry3000-835	104	15	.	.	PUNCT
dentistry3000-835	105	1	medical	medical	ADJ
dentistry3000-835	105	2	microbiology	microbiology	NOUN
dentistry3000-835	105	3	seventh	seventh	ADJ
dentistry3000-835	105	4	ediion	ediion	NOUN
dentistry3000-835	105	5	(	(	PUNCT
dentistry3000-835	105	6	textbook	textbook	NOUN
dentistry3000-835	105	7	)	)	PUNCT
dentistry3000-835	105	8	.	.	PUNCT
dentistry3000-835	106	1	philadelphia	philadelphia	PROPN
dentistry3000-835	106	2	,	,	PUNCT
dentistry3000-835	106	3	pa	pa	PROPN
dentistry3000-835	106	4	.	.	PROPN
dentistry3000-835	106	5	1,862	1,862	NUM
dentistry3000-835	106	6	bp	bp	PROPN
dentistry3000-835	106	7	b	b	PROPN
dentistry3000-835	106	8	p	p	X
dentistry3000-835	106	9	2000	2000	NUM
dentistry3000-835	106	10	1000	1000	NUM
dentistry3000-835	106	11	500	500	NUM
dentistry3000-835	106	12	100	100	NUM
dentistry3000-835	106	13	molecular	molecular	ADJ
dentistry3000-835	106	14	detec	detec	ADJ
dentistry3000-835	106	15	,	,	PUNCT
dentistry3000-835	106	16	on	on	ADP
dentistry3000-835	106	17	of	of	ADP
dentistry3000-835	106	18	tetracycline	tetracycline	NOUN
dentistry3000-835	106	19	-	-	PUNCT
dentistry3000-835	106	20	resistant	resistant	ADJ
dentistry3000-835	106	21	streptococcus	streptococcus	NOUN
dentistry3000-835	106	22	viridans	viridan	NOUN
dentistry3000-835	106	23	bacteria	bacteria	NOUN
dentistry3000-835	106	24	using	use	VERB
dentistry3000-835	106	25	the	the	DET
dentistry3000-835	106	26	rpoa	rpoa	ADJ
dentistry3000-835	106	27	gene	gene	NOUN
dentistry3000-835	106	28	vol	vol	NOUN
dentistry3000-835	106	29	13	13	NUM
dentistry3000-835	106	30	no	no	DET
dentistry3000-835	106	31	1	1	NUM
dentistry3000-835	106	32	(	(	PUNCT
dentistry3000-835	106	33	2025	2025	NUM
dentistry3000-835	106	34	)	)	PUNCT
dentistry3000-835	106	35	doi	doi	NOUN
dentistry3000-835	106	36	10.5195	10.5195	NUM
dentistry3000-835	106	37	/	/	SYM
dentistry3000-835	106	38	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	106	39	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-835	106	40	3	3	NUM
dentistry3000-835	106	41	.	.	PROPN
dentistry3000-835	106	42	ryan	ryan	PROPN
dentistry3000-835	106	43	kj	kj	PROPN
dentistry3000-835	106	44	,	,	PUNCT
dentistry3000-835	106	45	ray	ray	PROPN
dentistry3000-835	106	46	cg	cg	PROPN
dentistry3000-835	106	47	,	,	PUNCT
dentistry3000-835	106	48	champoux	champoux	PROPN
dentistry3000-835	106	49	jj	jj	PROPN
dentistry3000-835	106	50	,	,	PUNCT
dentistry3000-835	106	51	drew	draw	VERB
dentistry3000-835	106	52	wi	wi	PROPN
dentistry3000-835	106	53	,	,	PUNCT
dentistry3000-835	106	54	neidhardt	neidhardt	PROPN
dentistry3000-835	106	55	fc	fc	PROPN
dentistry3000-835	106	56	,	,	PUNCT
dentistry3000-835	106	57	plorde	plorde	PROPN
dentistry3000-835	106	58	jj	jj	PROPN
dentistry3000-835	106	59	.	.	PROPN
dentistry3000-835	106	60	(	(	PUNCT
dentistry3000-835	106	61	2004	2004	NUM
dentistry3000-835	106	62	)	)	PUNCT
dentistry3000-835	106	63	.	.	PUNCT
dentistry3000-835	107	1	sherris	sherris	PROPN
dentistry3000-835	107	2	medical	medical	ADJ
dentistry3000-835	107	3	microbiology	microbiology	NOUN
dentistry3000-835	107	4	:	:	PUNCT
dentistry3000-835	107	5	an	an	DET
dentistry3000-835	107	6	introducion	introducion	NOUN
dentistry3000-835	107	7	to	to	ADP
dentistry3000-835	107	8	infecious	infecious	ADJ
dentistry3000-835	107	9	diseases	disease	NOUN
dentistry3000-835	107	10	.	.	PUNCT
dentistry3000-835	108	1	4th	4th	ADJ
dentistry3000-835	108	2	ediion	ediion	NOUN
dentistry3000-835	108	3	.	.	PUNCT
dentistry3000-835	109	1	mcgraw	mcgraw	PROPN
dentistry3000-835	109	2	-	-	PUNCT
dentistry3000-835	109	3	hill	hill	NOUN
dentistry3000-835	109	4	company	company	NOUN
dentistry3000-835	109	5	.	.	PUNCT
dentistry3000-835	110	1	4	4	X
dentistry3000-835	110	2	.	.	X
dentistry3000-835	110	3	jawetz	jawetz	VERB
dentistry3000-835	110	4	e	e	PROPN
dentistry3000-835	110	5	,	,	PUNCT
dentistry3000-835	110	6	melnick	melnick	PROPN
dentistry3000-835	110	7	ja	ja	PROPN
dentistry3000-835	110	8	,	,	PUNCT
dentistry3000-835	110	9	adelberg	adelberg	PROPN
dentistry3000-835	110	10	ea	ea	X
dentistry3000-835	110	11	.	.	PUNCT
dentistry3000-835	111	1	(	(	PUNCT
dentistry3000-835	111	2	2016	2016	NUM
dentistry3000-835	111	3	)	)	PUNCT
dentistry3000-835	111	4	.	.	PUNCT
dentistry3000-835	112	1	review	review	NOUN
dentistry3000-835	112	2	of	of	ADP
dentistry3000-835	112	3	medical	medical	ADJ
dentistry3000-835	112	4	microbiology	microbiology	NOUN
dentistry3000-835	112	5	.	.	PUNCT
dentistry3000-835	113	1	27th	27th	ADJ
dentistry3000-835	113	2	ed	ed	NOUN
dentistry3000-835	113	3	.	.	PUNCT
dentistry3000-835	113	4	mcgrawhill	mcgrawhill	PROPN
dentistry3000-835	113	5	educaion	educaion	PROPN
dentistry3000-835	113	6	,	,	PUNCT
dentistry3000-835	113	7	inc	inc	PROPN
dentistry3000-835	113	8	:	:	PUNCT
dentistry3000-835	113	9	851pp	851pp	PROPN
dentistry3000-835	113	10	.	.	PUNCT
dentistry3000-835	114	1	5	5	X
dentistry3000-835	114	2	.	.	X
dentistry3000-835	114	3	wescombe	wescombe	PROPN
dentistry3000-835	114	4	pa	pa	PROPN
dentistry3000-835	114	5	,	,	PUNCT
dentistry3000-835	114	6	heng	heng	PROPN
dentistry3000-835	114	7	nck	nck	PROPN
dentistry3000-835	114	8	,	,	PUNCT
dentistry3000-835	114	9	burton	burton	PROPN
dentistry3000-835	114	10	jp	jp	PROPN
dentistry3000-835	114	11	,	,	PUNCT
dentistry3000-835	114	12	chilcoj	chilcoj	PROPN
dentistry3000-835	114	13	cn	cn	PROPN
dentistry3000-835	114	14	,	,	PUNCT
dentistry3000-835	114	15	tagg	tagg	PROPN
dentistry3000-835	114	16	jr	jr	PROPN
dentistry3000-835	114	17	.	.	PROPN
dentistry3000-835	114	18	(	(	PUNCT
dentistry3000-835	114	19	2009	2009	NUM
dentistry3000-835	114	20	)	)	PUNCT
dentistry3000-835	114	21	.	.	PUNCT
dentistry3000-835	115	1	streptococcal	streptococcal	ADJ
dentistry3000-835	115	2	bacteriocins	bacteriocin	NOUN
dentistry3000-835	115	3	and	and	CCONJ
dentistry3000-835	115	4	the	the	DET
dentistry3000-835	115	5	case	case	NOUN
dentistry3000-835	115	6	for	for	ADP
dentistry3000-835	115	7	streptococcus	streptococcus	NOUN
dentistry3000-835	115	8	salivarius	salivarius	NOUN
dentistry3000-835	115	9	as	as	ADP
dentistry3000-835	115	10	model	model	NOUN
dentistry3000-835	115	11	oral	oral	ADJ
dentistry3000-835	115	12	probioics	probioic	NOUN
dentistry3000-835	115	13	.	.	PUNCT
dentistry3000-835	116	1	future	future	ADJ
dentistry3000-835	116	2	microbial	microbial	NOUN
dentistry3000-835	116	3	.	.	PUNCT
dentistry3000-835	117	1	4:819–835	4:819–835	NOUN
dentistry3000-835	117	2	.	.	PUNCT
dentistry3000-835	118	1	6	6	NUM
dentistry3000-835	118	2	.	.	X
dentistry3000-835	118	3	reyes	reyes	PROPN
dentistry3000-835	118	4	j	j	PROPN
dentistry3000-835	118	5	,	,	PUNCT
dentistry3000-835	118	6	hidalgo	hidalgo	PROPN
dentistry3000-835	118	7	m	m	PROPN
dentistry3000-835	118	8	,	,	PUNCT
dentistry3000-835	118	9	d1i'az	d1i'az	PROPN
dentistry3000-835	118	10	l	l	NOUN
dentistry3000-835	118	11	,	,	PUNCT
dentistry3000-835	118	12	rinco'n	rinco'n	PROPN
dentistry3000-835	118	13	s	s	PROPN
dentistry3000-835	118	14	,	,	PUNCT
dentistry3000-835	118	15	moreno	moreno	PROPN
dentistry3000-835	118	16	j	j	PROPN
dentistry3000-835	118	17	,	,	PUNCT
dentistry3000-835	118	18	vanegas	vanegas	NOUN
dentistry3000-835	118	19	n	n	CCONJ
dentistry3000-835	118	20	,	,	PUNCT
dentistry3000-835	118	21	castaneda	castaneda	PROPN
dentistry3000-835	118	22	e	e	PROPN
dentistry3000-835	118	23	,	,	PUNCT
dentistry3000-835	118	24	arias	arias	PROPN
dentistry3000-835	118	25	ca	can	AUX
dentistry3000-835	118	26	.	.	PUNCT
dentistry3000-835	119	1	(	(	PUNCT
dentistry3000-835	119	2	2007	2007	NUM
dentistry3000-835	119	3	)	)	PUNCT
dentistry3000-835	119	4	.	.	PUNCT
dentistry3000-835	120	1	internaional	internaional	ADJ
dentistry3000-835	120	2	j.	j.	PROPN
dentistry3000-835	120	3	of	of	ADP
dentistry3000-835	120	4	infect	infect	PROPN
dentistry3000-835	120	5	.	.	PUNCT
dentistry3000-835	121	1	dis	dis	PROPN
dentistry3000-835	121	2	.	.	PUNCT
dentistry3000-835	122	1	11:329	11:329	NUM
dentistry3000-835	122	2	-	-	PUNCT
dentistry3000-835	122	3	336	336	NUM
dentistry3000-835	122	4	.	.	PUNCT
dentistry3000-835	123	1	7	7	X
dentistry3000-835	123	2	.	.	NUM
dentistry3000-835	123	3	holt	holt	PROPN
dentistry3000-835	123	4	jg	jg	PROPN
dentistry3000-835	123	5	,	,	PUNCT
dentistry3000-835	123	6	krieg	krieg	PROPN
dentistry3000-835	123	7	nr	nr	PROPN
dentistry3000-835	123	8	,	,	PUNCT
dentistry3000-835	123	9	sneath	sneath	PROPN
dentistry3000-835	123	10	pha	pha	PROPN
dentistry3000-835	123	11	,	,	PUNCT
dentistry3000-835	123	12	staley	staley	PROPN
dentistry3000-835	123	13	jt	jt	PROPN
dentistry3000-835	123	14	,	,	PUNCT
dentistry3000-835	123	15	williams	williams	PROPN
dentistry3000-835	123	16	st	st	PROPN
dentistry3000-835	123	17	.	.	PROPN
dentistry3000-835	123	18	(	(	PUNCT
dentistry3000-835	123	19	1994	1994	NUM
dentistry3000-835	123	20	)	)	PUNCT
dentistry3000-835	123	21	.	.	PUNCT
dentistry3000-835	124	1	bergey	bergey	PROPN
dentistry3000-835	124	2	's	's	PART
dentistry3000-835	124	3	manual	manual	NOUN
dentistry3000-835	124	4	of	of	ADP
dentistry3000-835	124	5	determinaive	determinaive	ADJ
dentistry3000-835	124	6	bacteriology	bacteriology	NOUN
dentistry3000-835	124	7	.	.	PUNCT
dentistry3000-835	125	1	9th	9th	ADJ
dentistry3000-835	125	2	ed	ed	NOUN
dentistry3000-835	125	3	.	.	PUNCT
dentistry3000-835	126	1	williams	williams	PROPN
dentistry3000-835	126	2	and	and	CCONJ
dentistry3000-835	126	3	wilkins	wilkin	NOUN
dentistry3000-835	126	4	:	:	PUNCT
dentistry3000-835	126	5	balimore	balimore	NOUN
dentistry3000-835	126	6	,	,	PUNCT
dentistry3000-835	126	7	maryland	maryland	PROPN
dentistry3000-835	126	8	;	;	PUNCT
dentistry3000-835	126	9	pp	pp	X
dentistry3000-835	126	10	.	.	PUNCT
dentistry3000-835	126	11	20	20	NUM
dentistry3000-835	126	12	&	&	CCONJ
dentistry3000-835	126	13	527	527	NUM
dentistry3000-835	126	14	-	-	SYM
dentistry3000-835	126	15	558	558	NUM
dentistry3000-835	126	16	.	.	NOUN
dentistry3000-835	126	17	8	8	NUM
dentistry3000-835	126	18	.	.	X
dentistry3000-835	126	19	yoo	yoo	PROPN
dentistry3000-835	126	20	s	s	PROPN
dentistry3000-835	126	21	,	,	PUNCT
dentistry3000-835	126	22	kim	kim	PROPN
dentistry3000-835	126	23	p	p	PROPN
dentistry3000-835	126	24	,	,	PUNCT
dentistry3000-835	126	25	hwang	hwang	PROPN
dentistry3000-835	126	26	h	h	PROPN
dentistry3000-835	126	27	,	,	PUNCT
dentistry3000-835	126	28	kim	kim	PROPN
dentistry3000-835	126	29	k	k	PROPN
dentistry3000-835	126	30	,	,	PUNCT
dentistry3000-835	126	31	choe	choe	PROPN
dentistry3000-835	126	32	s	s	PROPN
dentistry3000-835	126	33	,	,	PUNCT
dentistry3000-835	126	34	min	min	PROPN
dentistry3000-835	126	35	b	b	PROPN
dentistry3000-835	126	36	,	,	PUNCT
dentistry3000-835	126	37	kook	kook	PROPN
dentistry3000-835	126	38	j.	j.	PROPN
dentistry3000-835	126	39	(	(	PUNCT
dentistry3000-835	126	40	2005	2005	NUM
dentistry3000-835	126	41	)	)	PUNCT
dentistry3000-835	126	42	.	.	PUNCT
dentistry3000-835	127	1	idenificaion	idenificaion	NOUN
dentistry3000-835	127	2	of	of	ADP
dentistry3000-835	127	3	non	non	ADJ
dentistry3000-835	127	4	-	-	ADJ
dentistry3000-835	127	5	mutans	mutans	ADJ
dentistry3000-835	127	6	streptococci	streptococci	NOUN
dentistry3000-835	127	7	organisms	organism	NOUN
dentistry3000-835	127	8	in	in	ADP
dentistry3000-835	127	9	dental	dental	ADJ
dentistry3000-835	127	10	plaques	plaque	NOUN
dentistry3000-835	127	11	recovering	recover	VERB
dentistry3000-835	127	12	on	on	ADP
dentistry3000-835	127	13	miis	miis	ADJ
dentistry3000-835	127	14	salivarius	salivarius	PROPN
dentistry3000-835	127	15	bacitracin	bacitracin	NOUN
dentistry3000-835	127	16	agar	agar	VERB
dentistry3000-835	127	17	medium	medium	ADJ
dentistry3000-835	127	18	.	.	PUNCT
dentistry3000-835	128	1	microbial	microbial	ADJ
dentistry3000-835	128	2	.	.	PUNCT
dentistry3000-835	129	1	43(2	43(2	NUM
dentistry3000-835	129	2	):	):	PUNCT
dentistry3000-835	129	3	204	204	NUM
dentistry3000-835	129	4	-	-	SYM
dentistry3000-835	129	5	208	208	NUM
dentistry3000-835	129	6	.	.	PUNCT
dentistry3000-835	130	1	9	9	NUM
dentistry3000-835	130	2	.	.	X
dentistry3000-835	130	3	koneman	koneman	PROPN
dentistry3000-835	130	4	ew	ew	PROPN
dentistry3000-835	130	5	,	,	PUNCT
dentistry3000-835	130	6	allen	allen	PROPN
dentistry3000-835	130	7	sd	sd	PROPN
dentistry3000-835	130	8	,	,	PUNCT
dentistry3000-835	130	9	janda	janda	PROPN
dentistry3000-835	130	10	wm	wm	PROPN
dentistry3000-835	130	11	,	,	PUNCT
dentistry3000-835	130	12	schreckenberger	schreckenberger	NOUN
dentistry3000-835	130	13	pc	pc	PROPN
dentistry3000-835	130	14	,	,	PUNCT
dentistry3000-835	130	15	winn	winn	PROPN
dentistry3000-835	130	16	wcj	wcj	PROPN
dentistry3000-835	130	17	.	.	PUNCT
dentistry3000-835	131	1	(	(	PUNCT
dentistry3000-835	131	2	1992	1992	NUM
dentistry3000-835	131	3	)	)	PUNCT
dentistry3000-835	131	4	.	.	PUNCT
dentistry3000-835	132	1	color	color	PROPN
dentistry3000-835	132	2	atlas	atlas	PROPN
dentistry3000-835	132	3	and	and	CCONJ
dentistry3000-835	132	4	textbook	textbook	NOUN
dentistry3000-835	132	5	of	of	ADP
dentistry3000-835	132	6	diagnosic	diagnosic	ADJ
dentistry3000-835	132	7	microbiology	microbiology	NOUN
dentistry3000-835	132	8	.	.	PUNCT
dentistry3000-835	133	1	(	(	PUNCT
dentistry3000-835	133	2	4th	4th	ADJ
dentistry3000-835	133	3	)	)	PUNCT
dentistry3000-835	133	4	ed	ed	NOUN
dentistry3000-835	133	5	.	.	PUNCT
dentistry3000-835	134	1	j.b	j.b	PROPN
dentistry3000-835	134	2	.	.	PROPN
dentistry3000-835	134	3	lippincoj	lippincoj	PROPN
dentistry3000-835	134	4	company	company	PROPN
dentistry3000-835	134	5	.	.	PUNCT
dentistry3000-835	135	1	philadelphia	philadelphia	PROPN
dentistry3000-835	135	2	.	.	PUNCT
dentistry3000-835	136	1	10	10	NUM
dentistry3000-835	136	2	.	.	PUNCT
dentistry3000-835	137	1	tadesse	tadesse	PROPN
dentistry3000-835	137	2	a	a	PRON
dentistry3000-835	137	3	,	,	PUNCT
dentistry3000-835	137	4	alem	alem	ADJ
dentistry3000-835	137	5	m.	m.	NOUN
dentistry3000-835	137	6	(	(	PUNCT
dentistry3000-835	137	7	2006	2006	NUM
dentistry3000-835	137	8	)	)	PUNCT
dentistry3000-835	137	9	.	.	PUNCT
dentistry3000-835	138	1	medical	medical	ADJ
dentistry3000-835	138	2	bacteriology	bacteriology	NOUN
dentistry3000-835	138	3	.	.	PUNCT
dentistry3000-835	139	1	ephti	ephti	PROPN
dentistry3000-835	139	2	.	.	PUNCT
dentistry3000-835	140	1	gondar	gondar	PROPN
dentistry3000-835	140	2	university	university	PROPN
dentistry3000-835	140	3	.	.	PUNCT
dentistry3000-835	141	1	11	11	NUM
dentistry3000-835	141	2	.	.	X
dentistry3000-835	142	1	collee	collee	PROPN
dentistry3000-835	142	2	jg	jg	PROPN
dentistry3000-835	142	3	,	,	PUNCT
dentistry3000-835	142	4	fraser	fraser	PROPN
dentistry3000-835	142	5	ag	ag	PROPN
dentistry3000-835	142	6	,	,	PUNCT
dentistry3000-835	142	7	marmion	marmion	PROPN
dentistry3000-835	142	8	bp	bp	PROPN
dentistry3000-835	142	9	simmons	simmons	PROPN
dentistry3000-835	142	10	a.	a.	PROPN
dentistry3000-835	142	11	(	(	PUNCT
dentistry3000-835	142	12	1996	1996	NUM
dentistry3000-835	142	13	)	)	PUNCT
dentistry3000-835	142	14	.	.	PUNCT
dentistry3000-835	143	1	mackie	mackie	PROPN
dentistry3000-835	143	2	and	and	CCONJ
dentistry3000-835	143	3	mccartney	mccartney	PROPN
dentistry3000-835	143	4	pracical	pracical	PROPN
dentistry3000-835	143	5	medical	medical	ADJ
dentistry3000-835	143	6	microbiology	microbiology	NOUN
dentistry3000-835	143	7	.	.	PUNCT
dentistry3000-835	144	1	14th	14th	ADJ
dentistry3000-835	144	2	ed	ed	NOUN
dentistry3000-835	144	3	.	.	PUNCT
dentistry3000-835	145	1	churchill	churchill	PROPN
dentistry3000-835	145	2	livingston	livingston	PROPN
dentistry3000-835	145	3	.	.	PUNCT
dentistry3000-835	146	1	p.173	p.173	PROPN
dentistry3000-835	146	2	-	-	PUNCT
dentistry3000-835	146	3	174	174	NUM
dentistry3000-835	146	4	.	.	PUNCT
dentistry3000-835	147	1	12	12	NUM
dentistry3000-835	147	2	.	.	PUNCT
dentistry3000-835	148	1	messmer	messmer	PROPN
dentistry3000-835	148	2	to	to	ADP
dentistry3000-835	148	3	,	,	PUNCT
dentistry3000-835	148	4	sampson	sampson	PROPN
dentistry3000-835	148	5	js	js	PROPN
dentistry3000-835	148	6	,	,	PUNCT
dentistry3000-835	148	7	sinson	sinson	NOUN
dentistry3000-835	148	8	a	a	NOUN
dentistry3000-835	148	9	,	,	PUNCT
dentistry3000-835	148	10	wong	wong	PROPN
dentistry3000-835	148	11	b	b	PROPN
dentistry3000-835	148	12	,	,	PUNCT
dentistry3000-835	148	13	carlone	carlone	NOUN
dentistry3000-835	148	14	gm	gm	PROPN
dentistry3000-835	148	15	,	,	PUNCT
dentistry3000-835	148	16	facklam	facklam	PROPN
dentistry3000-835	148	17	rr	rr	PROPN
dentistry3000-835	148	18	.	.	PUNCT
dentistry3000-835	149	1	(	(	PUNCT
dentistry3000-835	149	2	2004	2004	NUM
dentistry3000-835	149	3	)	)	PUNCT
dentistry3000-835	149	4	.	.	PUNCT
dentistry3000-835	150	1	comparison	comparison	NOUN
dentistry3000-835	150	2	four	four	NUM
dentistry3000-835	150	3	polymerase	polymerase	NOUN
dentistry3000-835	150	4	chain	chain	NOUN
dentistry3000-835	150	5	reacion	reacion	NOUN
dentistry3000-835	150	6	assays	assay	NOUN
dentistry3000-835	150	7	for	for	ADP
dentistry3000-835	150	8	specificity	specificity	NOUN
dentistry3000-835	150	9	in	in	ADP
dentistry3000-835	150	10	the	the	DET
dentistry3000-835	150	11	idenificaion	idenificaion	NOUN
dentistry3000-835	150	12	of	of	ADP
dentistry3000-835	150	13	s.	s.	PROPN
dentistry3000-835	150	14	pneumoniae	pneumoniae	PROPN
dentistry3000-835	150	15	.	.	PUNCT
dentistry3000-835	151	1	diagn	diagn	NOUN
dentistry3000-835	151	2	.	.	PUNCT
dentistry3000-835	152	1	microbiol	microbiol	PROPN
dentistry3000-835	152	2	.	.	PUNCT
dentistry3000-835	153	1	infect	infect	VERB
dentistry3000-835	153	2	.	.	PUNCT
dentistry3000-835	154	1	dis	dis	PROPN
dentistry3000-835	154	2	.	.	PROPN
dentistry3000-835	154	3	,	,	PUNCT
dentistry3000-835	154	4	49	49	NUM
dentistry3000-835	154	5	:	:	PUNCT
dentistry3000-835	154	6	249	249	NUM
dentistry3000-835	154	7	-	-	SYM
dentistry3000-835	154	8	254	254	NUM
dentistry3000-835	154	9	.	.	PUNCT
dentistry3000-835	155	1	13	13	NUM
dentistry3000-835	155	2	.	.	PUNCT
dentistry3000-835	156	1	atlas	atlas	PROPN
dentistry3000-835	156	2	rm	rm	PROPN
dentistry3000-835	156	3	,	,	PUNCT
dentistry3000-835	156	4	brown	brown	PROPN
dentistry3000-835	156	5	ae	ae	PROPN
dentistry3000-835	156	6	,	,	PUNCT
dentistry3000-835	156	7	parks	parks	PROPN
dentistry3000-835	156	8	lc	lc	PROPN
dentistry3000-835	156	9	.	.	PUNCT
dentistry3000-835	156	10	(	(	PUNCT
dentistry3000-835	156	11	1995	1995	NUM
dentistry3000-835	156	12	)	)	PUNCT
dentistry3000-835	156	13	laboratory	laboratory	NOUN
dentistry3000-835	156	14	manual	manual	NOUN
dentistry3000-835	156	15	experimental	experimental	ADJ
dentistry3000-835	156	16	microbiology	microbiology	NOUN
dentistry3000-835	156	17	.	.	PUNCT
dentistry3000-835	157	1	1th	1th	ADJ
dentistry3000-835	157	2	ed	ed	PROPN
dentistry3000-835	157	3	.	.	PROPN
dentistry3000-835	157	4	inc	inc	PROPN
dentistry3000-835	157	5	.	.	PROPN
dentistry3000-835	157	6	biofilm	biofilm	NOUN
dentistry3000-835	157	7	formaion	formaion	NOUN
dentistry3000-835	157	8	and	and	CCONJ
dentistry3000-835	157	9	determinaion	determinaion	NOUN
dentistry3000-835	157	10	of	of	ADP
dentistry3000-835	157	11	chemical	chemical	ADJ
dentistry3000-835	157	12	inhibiion	inhibiion	NOUN
dentistry3000-835	157	13	.	.	PUNCT
dentistry3000-835	158	1	msc	msc	PROPN
dentistry3000-835	158	2	thesis	thesis	PROPN
dentistry3000-835	158	3	.	.	PUNCT
dentistry3000-835	159	1	college	college	NOUN
dentistry3000-835	159	2	of	of	ADP
dentistry3000-835	159	3	science	science	NOUN
dentistry3000-835	159	4	.	.	PUNCT
dentistry3000-835	160	1	university	university	NOUN
dentistry3000-835	160	2	of	of	ADP
dentistry3000-835	160	3	baghdad	baghdad	PROPN
dentistry3000-835	160	4	.	.	PUNCT
dentistry3000-835	161	1	14	14	NUM
dentistry3000-835	161	2	.	.	X
dentistry3000-835	161	3	straus	straus	PROPN
dentistry3000-835	161	4	dc	dc	PROPN
dentistry3000-835	161	5	,	,	PUNCT
dentistry3000-835	161	6	mapngly	mapngly	ADV
dentistry3000-835	161	7	sj	sj	PROPN
dentistry3000-835	161	8	,	,	PUNCT
dentistry3000-835	161	9	milligan	milligan	PROPN
dentistry3000-835	161	10	tw	tw	PROPN
dentistry3000-835	161	11	,	,	PUNCT
dentistry3000-835	161	12	doran	doran	PROPN
dentistry3000-835	161	13	ti	ti	PROPN
dentistry3000-835	161	14	nealon	nealon	PROPN
dentistry3000-835	161	15	tj	tj	PROPN
dentistry3000-835	161	16	.	.	PROPN
dentistry3000-835	162	1	(	(	PUNCT
dentistry3000-835	162	2	1980	1980	NUM
dentistry3000-835	162	3	)	)	PUNCT
dentistry3000-835	162	4	.	.	PUNCT
dentistry3000-835	163	1	protease	protease	NOUN
dentistry3000-835	163	2	producion	producion	NOUN
dentistry3000-835	163	3	by	by	ADP
dentistry3000-835	163	4	clinical	clinical	ADJ
dentistry3000-835	163	5	isolates	isolate	NOUN
dentistry3000-835	163	6	of	of	ADP
dentistry3000-835	163	7	type	type	NOUN
dentistry3000-835	163	8	iii	iii	PROPN
dentistry3000-835	163	9	group	group	NOUN
dentistry3000-835	163	10	b	b	NOUN
dentistry3000-835	163	11	streptococci	streptococci	NOUN
dentistry3000-835	163	12	.	.	PUNCT
dentistry3000-835	164	1	j.	j.	PROPN
dentistry3000-835	164	2	clin	clin	PROPN
dentistry3000-835	164	3	.	.	PUNCT
dentistry3000-835	165	1	microb	microb	PROPN
dentistry3000-835	165	2	.	.	PUNCT
dentistry3000-835	166	1	12	12	NUM
dentistry3000-835	166	2	:	:	PUNCT
dentistry3000-835	166	3	421	421	NUM
dentistry3000-835	166	4	-	-	SYM
dentistry3000-835	166	5	425	425	NUM
dentistry3000-835	166	6	.	.	NOUN
dentistry3000-835	166	7	15	15	NUM
dentistry3000-835	166	8	.	.	PUNCT
dentistry3000-835	167	1	jeffries	jeffries	PROPN
dentistry3000-835	167	2	cd	cd	PROPN
dentistry3000-835	167	3	,	,	PUNCT
dentistry3000-835	167	4	holtman	holtman	PROPN
dentistry3000-835	167	5	df	df	PROPN
dentistry3000-835	167	6	,	,	PUNCT
dentistry3000-835	167	7	guse	guse	NOUN
dentistry3000-835	167	8	dg	dg	PROPN
dentistry3000-835	167	9	.	.	PUNCT
dentistry3000-835	168	1	rapid	rapid	ADJ
dentistry3000-835	168	2	method	method	NOUN
dentistry3000-835	168	3	for	for	ADP
dentistry3000-835	168	4	determining	determine	VERB
dentistry3000-835	168	5	the	the	DET
dentistry3000-835	168	6	acivity	acivity	NOUN
dentistry3000-835	168	7	of	of	ADP
dentistry3000-835	168	8	microorganisms	microorganism	NOUN
dentistry3000-835	168	9	on	on	ADP
dentistry3000-835	168	10	nucleic	nucleic	ADJ
dentistry3000-835	168	11	acids	acid	NOUN
dentistry3000-835	168	12	.	.	PUNCT
dentistry3000-835	169	1	j	j	PROPN
dentistry3000-835	169	2	bacteriol	bacteriol	NOUN
dentistry3000-835	169	3	.	.	PUNCT
dentistry3000-835	170	1	1957;73(4):590	1957;73(4):590	NUM
dentistry3000-835	170	2	-	-	SYM
dentistry3000-835	170	3	1	1	NUM
dentistry3000-835	170	4	.	.	NUM
dentistry3000-835	170	5	16	16	NUM
dentistry3000-835	170	6	.	.	PUNCT
dentistry3000-835	171	1	mathur	mathur	PROPN
dentistry3000-835	171	2	t	t	PROPN
dentistry3000-835	171	3	,	,	PUNCT
dentistry3000-835	171	4	singhal	singhal	PROPN
dentistry3000-835	171	5	s	s	PROPN
dentistry3000-835	171	6	,	,	PUNCT
dentistry3000-835	171	7	khan	khan	PROPN
dentistry3000-835	171	8	s	s	PROPN
dentistry3000-835	171	9	,	,	PUNCT
dentistry3000-835	171	10	upadhyay	upadhyay	PROPN
dentistry3000-835	171	11	dj	dj	PROPN
dentistry3000-835	171	12	,	,	PUNCT
dentistry3000-835	171	13	fatma	fatma	PROPN
dentistry3000-835	171	14	t	t	PROPN
dentistry3000-835	171	15	,	,	PUNCT
dentistry3000-835	171	16	rajan	rajan	PROPN
dentistry3000-835	171	17	a.	a.	PROPN
dentistry3000-835	171	18	(	(	PUNCT
dentistry3000-835	171	19	2006	2006	NUM
dentistry3000-835	171	20	)	)	PUNCT
dentistry3000-835	171	21	.	.	PUNCT
dentistry3000-835	172	1	detecion	detecion	NOUN
dentistry3000-835	172	2	of	of	ADP
dentistry3000-835	172	3	biofilm	biofilm	NOUN
dentistry3000-835	172	4	formaion	formaion	NOUN
dentistry3000-835	172	5	among	among	ADP
dentistry3000-835	172	6	the	the	DET
dentistry3000-835	172	7	clinical	clinical	ADJ
dentistry3000-835	172	8	isolates	isolate	NOUN
dentistry3000-835	172	9	of	of	ADP
dentistry3000-835	172	10	staphylococci	staphylococci	PROPN
dentistry3000-835	172	11	:	:	PUNCT
dentistry3000-835	172	12	an	an	DET
dentistry3000-835	172	13	evaluaion	evaluaion	NOUN
dentistry3000-835	172	14	of	of	ADP
dentistry3000-835	172	15	three	three	NUM
dentistry3000-835	172	16	different	different	ADJ
dentistry3000-835	172	17	screening	screening	NOUN
dentistry3000-835	172	18	methods	method	NOUN
dentistry3000-835	172	19	.	.	PUNCT
dentistry3000-835	173	1	indian	indian	PROPN
dentistry3000-835	173	2	j.	j.	PROPN
dentistry3000-835	173	3	med	med	PROPN
dentistry3000-835	173	4	.	.	PUNCT
dentistry3000-835	173	5	microbiol	microbiol	PROPN
dentistry3000-835	173	6	.	.	PUNCT
dentistry3000-835	174	1	24(1	24(1	NUM
dentistry3000-835	174	2	):	):	PUNCT
dentistry3000-835	174	3	25	25	NUM
dentistry3000-835	174	4	-	-	SYM
dentistry3000-835	174	5	29	29	NUM
dentistry3000-835	174	6	.	.	PUNCT
dentistry3000-835	175	1	17	17	NUM
dentistry3000-835	175	2	.	.	PUNCT
dentistry3000-835	176	1	stukus	stukus	PROPN
dentistry3000-835	176	2	pe	pe	PROPN
dentistry3000-835	176	3	.	.	PUNCT
dentistry3000-835	177	1	(	(	PUNCT
dentistry3000-835	177	2	1997	1997	NUM
dentistry3000-835	177	3	)	)	PUNCT
dentistry3000-835	177	4	.	.	PUNCT
dentistry3000-835	178	1	invesigaing	invesigae	VERB
dentistry3000-835	178	2	microbiology	microbiology	NOUN
dentistry3000-835	178	3	:	:	PUNCT
dentistry3000-835	178	4	a	a	DET
dentistry3000-835	178	5	laboratory	laboratory	NOUN
dentistry3000-835	178	6	manual	manual	NOUN
dentistry3000-835	178	7	for	for	ADP
dentistry3000-835	178	8	general	general	ADJ
dentistry3000-835	178	9	microbiology	microbiology	NOUN
dentistry3000-835	178	10	.	.	PUNCT
dentistry3000-835	179	1	harcout	harcout	PROPN
dentistry3000-835	179	2	brace	brace	PROPN
dentistry3000-835	179	3	and	and	CCONJ
dentistry3000-835	179	4	companies	company	NOUN
dentistry3000-835	179	5	.	.	PUNCT
dentistry3000-835	180	1	18	18	NUM
dentistry3000-835	180	2	.	.	PUNCT
dentistry3000-835	181	1	al	al	PROPN
dentistry3000-835	181	2	-	-	PUNCT
dentistry3000-835	181	3	qasab	qasab	NOUN
dentistry3000-835	181	4	abdul	abdul	NOUN
dentistry3000-835	181	5	-	-	PUNCT
dentistry3000-835	181	6	jabbar’emer	jabbar’emer	NOUN
dentistry3000-835	181	7	,	,	PUNCT
dentistry3000-835	181	8	al	al	PROPN
dentistry3000-835	181	9	-	-	PUNCT
dentistry3000-835	181	10	khafaji	khafaji	PROPN
dentistry3000-835	181	11	zahra	zahra	PROPN
dentistry3000-835	181	12	mahmoud	mahmoud	PROPN
dentistry3000-835	181	13	.	.	PUNCT
dentistry3000-835	182	1	(	(	PUNCT
dentistry3000-835	182	2	1992	1992	NUM
dentistry3000-835	182	3	)	)	PUNCT
dentistry3000-835	182	4	.	.	PUNCT
dentistry3000-835	183	1	effect	effect	NOUN
dentistry3000-835	183	2	of	of	ADP
dentistry3000-835	183	3	different	different	ADJ
dentistry3000-835	183	4	condiions	condiion	NOUN
dentistry3000-835	183	5	on	on	ADP
dentistry3000-835	183	6	the	the	DET
dentistry3000-835	183	7	inhibitory	inhibitory	ADJ
dentistry3000-835	183	8	efficacy	efficacy	NOUN
dentistry3000-835	183	9	of	of	ADP
dentistry3000-835	183	10	intesinal	intesinal	ADJ
dentistry3000-835	183	11	lactobacilli	lactobacilli	NOUN
dentistry3000-835	183	12	in	in	ADP
dentistry3000-835	183	13	the	the	DET
dentistry3000-835	183	14	direcion	direcion	NOUN
dentistry3000-835	183	15	of	of	ADP
dentistry3000-835	183	16	intesinal	intesinal	ADJ
dentistry3000-835	183	17	bacteria	bacteria	NOUN
dentistry3000-835	183	18	causing	cause	VERB
dentistry3000-835	183	19	diarrhea	diarrhea	NOUN
dentistry3000-835	183	20	.	.	PUNCT
dentistry3000-835	184	1	faculty	faculty	NOUN
dentistry3000-835	184	2	of	of	ADP
dentistry3000-835	184	3	agricultural	agricultural	ADJ
dentistry3000-835	184	4	sciences	science	NOUN
dentistry3000-835	184	5	.	.	PUNCT
dentistry3000-835	185	1	folder	folder	NOUN
dentistry3000-835	185	2	123	123	NUM
dentistry3000-835	185	3	(	(	PUNCT
dentistry3000-835	185	4	7	7	NUM
dentistry3000-835	185	5	)	)	PUNCT
dentistry3000-835	185	6	,	,	PUNCT
dentistry3000-835	185	7	26	26	NUM
dentistry3000-835	185	8	-	-	SYM
dentistry3000-835	185	9	18	18	NUM
dentistry3000-835	185	10	.	.	NOUN
dentistry3000-835	185	11	19	19	NUM
dentistry3000-835	185	12	.	.	NUM
dentistry3000-835	185	13	clsi	clsi	PROPN
dentistry3000-835	185	14	(	(	PUNCT
dentistry3000-835	185	15	2010	2010	NUM
dentistry3000-835	185	16	)	)	PUNCT
dentistry3000-835	185	17	methods	method	NOUN
dentistry3000-835	185	18	for	for	ADP
dentistry3000-835	185	19	diluion	diluion	NOUN
dentistry3000-835	185	20	animicrobial	animicrobial	ADJ
dentistry3000-835	185	21	suscepibility	suscepibility	NOUN
dentistry3000-835	185	22	tests	test	NOUN
dentistry3000-835	185	23	for	for	ADP
dentistry3000-835	185	24	bacteria	bacteria	NOUN
dentistry3000-835	185	25	that	that	PRON
dentistry3000-835	185	26	grow	grow	VERB
dentistry3000-835	185	27	aerobically	aerobically	ADV
dentistry3000-835	185	28	;	;	PUNCT
dentistry3000-835	185	29	approved	approved	ADJ
dentistry3000-835	185	30	standard	standard	NOUN
dentistry3000-835	185	31	—	—	PUNCT
dentistry3000-835	185	32	ninth	ninth	ADJ
dentistry3000-835	185	33	ediion	ediion	NOUN
dentistry3000-835	185	34	.	.	PUNCT
dentistry3000-835	186	1	32(8	32(8	NUM
dentistry3000-835	186	2	)	)	PUNCT
dentistry3000-835	186	3	.	.	PUNCT
dentistry3000-835	187	1	clsi	clsi	PROPN
dentistry3000-835	187	2	,	,	PUNCT
dentistry3000-835	187	3	wayne	wayne	PROPN
dentistry3000-835	187	4	,	,	PUNCT
dentistry3000-835	187	5	pennsylvania	pennsylvania	PROPN
dentistry3000-835	187	6	,	,	PUNCT
dentistry3000-835	187	7	usa	usa	PROPN
dentistry3000-835	187	8	.	.	PROPN
dentistry3000-835	187	9	20	20	NUM
dentistry3000-835	187	10	.	.	PUNCT
dentistry3000-835	188	1	clsi	clsi	PROPN
dentistry3000-835	188	2	(	(	PUNCT
dentistry3000-835	188	3	2017	2017	NUM
dentistry3000-835	188	4	)	)	PUNCT
dentistry3000-835	188	5	methods	method	NOUN
dentistry3000-835	188	6	for	for	ADP
dentistry3000-835	188	7	diluion	diluion	NOUN
dentistry3000-835	188	8	animicrobial	animicrobial	ADJ
dentistry3000-835	188	9	suscepibility	suscepibility	NOUN
dentistry3000-835	188	10	tests	test	NOUN
dentistry3000-835	188	11	for	for	ADP
dentistry3000-835	188	12	bacteria	bacteria	NOUN
dentistry3000-835	188	13	that	that	PRON
dentistry3000-835	188	14	grow	grow	VERB
dentistry3000-835	188	15	aerobically	aerobically	ADV
dentistry3000-835	188	16	;	;	PUNCT
dentistry3000-835	188	17	approved	approved	ADJ
dentistry3000-835	188	18	standard	standard	NOUN
dentistry3000-835	188	19	—	—	PUNCT
dentistry3000-835	188	20	ninth	ninth	ADJ
dentistry3000-835	188	21	ediion	ediion	NOUN
dentistry3000-835	188	22	.	.	PUNCT
dentistry3000-835	189	1	32(8	32(8	NUM
dentistry3000-835	189	2	)	)	PUNCT
dentistry3000-835	189	3	.	.	PUNCT
dentistry3000-835	190	1	clsi	clsi	PROPN
dentistry3000-835	190	2	,	,	PUNCT
dentistry3000-835	190	3	wayne	wayne	PROPN
dentistry3000-835	190	4	,	,	PUNCT
dentistry3000-835	190	5	pennsylvania	pennsylvania	PROPN
dentistry3000-835	190	6	,	,	PUNCT
dentistry3000-835	190	7	usa	usa	PROPN
dentistry3000-835	190	8	.	.	PROPN
dentistry3000-835	190	9	21	21	NUM
dentistry3000-835	190	10	.	.	PUNCT
dentistry3000-835	191	1	park	park	PROPN
dentistry3000-835	191	2	hk	hk	PROPN
dentistry3000-835	191	3	,	,	PUNCT
dentistry3000-835	191	4	yoon	yoon	PROPN
dentistry3000-835	191	5	jw	jw	PROPN
dentistry3000-835	191	6	,	,	PUNCT
dentistry3000-835	191	7	shin	shin	PROPN
dentistry3000-835	191	8	jw	jw	PROPN
dentistry3000-835	191	9	,	,	PUNCT
dentistry3000-835	191	10	kim	kim	PROPN
dentistry3000-835	191	11	jy	jy	PROPN
dentistry3000-835	191	12	,	,	PUNCT
dentistry3000-835	191	13	kim	kim	PROPN
dentistry3000-835	191	14	w.	w.	PROPN
dentistry3000-835	191	15	(	(	PUNCT
dentistry3000-835	191	16	2010	2010	NUM
dentistry3000-835	191	17	)	)	PUNCT
dentistry3000-835	191	18	.	.	PUNCT
dentistry3000-835	192	1	rpoa	rpoa	PROPN
dentistry3000-835	192	2	is	be	AUX
dentistry3000-835	192	3	a	a	DET
dentistry3000-835	192	4	useful	useful	ADJ
dentistry3000-835	192	5	gene	gene	NOUN
dentistry3000-835	192	6	for	for	ADP
dentistry3000-835	192	7	idenificaion	idenificaion	NOUN
dentistry3000-835	192	8	and	and	CCONJ
dentistry3000-835	192	9	classificaion	classificaion	NOUN
dentistry3000-835	192	10	of	of	ADP
dentistry3000-835	192	11	streptococcus	streptococcus	NOUN
dentistry3000-835	192	12	pneumoniae	pneumoniae	ADV
dentistry3000-835	192	13	from	from	ADP
dentistry3000-835	192	14	the	the	DET
dentistry3000-835	192	15	closely	closely	ADV
dentistry3000-835	192	16	related	relate	VERB
dentistry3000-835	192	17	viridans	viridan	NOUN
dentistry3000-835	192	18	group	group	NOUN
dentistry3000-835	192	19	streptococci	streptococci	NOUN
dentistry3000-835	192	20	.	.	PUNCT
dentistry3000-835	193	1	fems	fems	PROPN
dentistry3000-835	193	2	microbiology	microbiology	NOUN
dentistry3000-835	193	3	lejers	lejer	NOUN
dentistry3000-835	193	4	,	,	PUNCT
dentistry3000-835	193	5	305(1	305(1	NUM
dentistry3000-835	193	6	)	)	PUNCT
dentistry3000-835	193	7	,	,	PUNCT
dentistry3000-835	193	8	58	58	NUM
dentistry3000-835	193	9	-	-	SYM
dentistry3000-835	193	10	64	64	NUM
dentistry3000-835	193	11	.	.	PUNCT
dentistry3000-835	194	1	22	22	NUM
dentistry3000-835	194	2	.	.	PUNCT
dentistry3000-835	195	1	tamimi	tamimi	PROPN
dentistry3000-835	195	2	zainab	zainab	PROPN
dentistry3000-835	195	3	amer	amer	PROPN
dentistry3000-835	195	4	hatem	hatem	PROPN
dentistry3000-835	195	5	(	(	PUNCT
dentistry3000-835	195	6	2013	2013	NUM
dentistry3000-835	195	7	)	)	PUNCT
dentistry3000-835	195	8	.	.	PUNCT
dentistry3000-835	196	1	bacteriological	bacteriological	ADJ
dentistry3000-835	196	2	and	and	CCONJ
dentistry3000-835	196	3	hereditary	hereditary	ADJ
dentistry3000-835	196	4	study	study	NOUN
dentistry3000-835	196	5	of	of	ADP
dentistry3000-835	196	6	streptococcus	streptococcus	NOUN
dentistry3000-835	196	7	pyogenes	pyogene	NOUN
dentistry3000-835	196	8	isolated	isolate	VERB
dentistry3000-835	196	9	from	from	ADP
dentistry3000-835	196	10	paients	paient	NOUN
dentistry3000-835	196	11	with	with	ADP
dentistry3000-835	196	12	tonsilliis	tonsilliis	NOUN
dentistry3000-835	196	13	in	in	ADP
dentistry3000-835	196	14	the	the	DET
dentistry3000-835	196	15	city	city	NOUN
dentistry3000-835	196	16	of	of	ADP
dentistry3000-835	196	17	muqdadiya	muqdadiya	NOUN
dentistry3000-835	196	18	,	,	PUNCT
dentistry3000-835	196	19	master	master	NOUN
dentistry3000-835	196	20	thesis	thesis	NOUN
dentistry3000-835	196	21	,	,	PUNCT
dentistry3000-835	196	22	college	college	NOUN
dentistry3000-835	196	23	of	of	ADP
dentistry3000-835	196	24	educaion	educaion	NOUN
dentistry3000-835	196	25	for	for	ADP
dentistry3000-835	196	26	pure	pure	ADJ
dentistry3000-835	196	27	sciences	science	NOUN
dentistry3000-835	196	28	,	,	PUNCT
dentistry3000-835	196	29	university	university	NOUN
dentistry3000-835	196	30	of	of	ADP
dentistry3000-835	196	31	diyala	diyala	PROPN
dentistry3000-835	196	32	.	.	PUNCT
dentistry3000-835	197	1	molecular	molecular	ADJ
dentistry3000-835	197	2	detec	detec	ADJ
dentistry3000-835	197	3	,	,	PUNCT
dentistry3000-835	197	4	on	on	ADP
dentistry3000-835	197	5	of	of	ADP
dentistry3000-835	197	6	tetracycline	tetracycline	NOUN
dentistry3000-835	197	7	-	-	PUNCT
dentistry3000-835	197	8	resistant	resistant	ADJ
dentistry3000-835	197	9	streptococcus	streptococcus	NOUN
dentistry3000-835	197	10	viridans	viridan	NOUN
dentistry3000-835	197	11	bacteria	bacteria	NOUN
dentistry3000-835	197	12	using	use	VERB
dentistry3000-835	197	13	the	the	DET
dentistry3000-835	197	14	rpoa	rpoa	ADJ
dentistry3000-835	197	15	gene	gene	NOUN
dentistry3000-835	197	16	vol	vol	NOUN
dentistry3000-835	197	17	13	13	NUM
dentistry3000-835	197	18	no	no	DET
dentistry3000-835	197	19	1	1	NUM
dentistry3000-835	197	20	(	(	PUNCT
dentistry3000-835	197	21	2025	2025	NUM
dentistry3000-835	197	22	)	)	PUNCT
dentistry3000-835	197	23	doi	doi	NOUN
dentistry3000-835	197	24	10.5195	10.5195	NUM
dentistry3000-835	197	25	/	/	SYM
dentistry3000-835	197	26	d3000.2025.835	d3000.2025.835	NOUN
dentistry3000-835	197	27	h#p://den*stry3000.pi#.edu	h#p://den*stry3000.pi#.edu	PROPN
dentistry3000-835	197	28	23	23	NUM
dentistry3000-835	197	29	.	.	PUNCT
dentistry3000-835	198	1	srinivasan	srinivasan	NOUN
dentistry3000-835	198	2	r	r	PROPN
dentistry3000-835	198	3	,	,	PUNCT
dentistry3000-835	198	4	karaoz	karaoz	NOUN
dentistry3000-835	198	5	u	u	NOUN
dentistry3000-835	198	6	,	,	PUNCT
dentistry3000-835	198	7	volegova	volegova	VERB
dentistry3000-835	198	8	m	m	PRON
dentistry3000-835	198	9	,	,	PUNCT
dentistry3000-835	198	10	mackichan	mackichan	PROPN
dentistry3000-835	198	11	j	j	PROPN
dentistry3000-835	198	12	,	,	PUNCT
dentistry3000-835	198	13	katomaeda	katomaeda	PROPN
dentistry3000-835	198	14	m	m	PROPN
dentistry3000-835	198	15	,	,	PUNCT
dentistry3000-835	198	16	miller	miller	PROPN
dentistry3000-835	198	17	s	s	PROPN
dentistry3000-835	198	18	,	,	PUNCT
dentistry3000-835	198	19	lynch	lynch	PROPN
dentistry3000-835	198	20	sv	sv	PROPN
dentistry3000-835	198	21	.	.	PUNCT
dentistry3000-835	199	1	(	(	PUNCT
dentistry3000-835	199	2	2015	2015	NUM
dentistry3000-835	199	3	)	)	PUNCT
dentistry3000-835	199	4	.	.	PUNCT
dentistry3000-835	200	1	use	use	NOUN
dentistry3000-835	200	2	of16s	of16s	X
dentistry3000-835	200	3	rrna	rrna	PROPN
dentistry3000-835	200	4	gene	gene	NOUN
dentistry3000-835	200	5	for	for	ADP
dentistry3000-835	200	6	idenificaion	idenificaion	NOUN
dentistry3000-835	200	7	of	of	ADP
dentistry3000-835	200	8	a	a	DET
dentistry3000-835	200	9	broad	broad	ADJ
dentistry3000-835	200	10	range	range	NOUN
dentistry3000-835	200	11	of	of	ADP
dentistry3000-835	200	12	clinically	clinically	ADV
dentistry3000-835	200	13	relevant	relevant	ADJ
dentistry3000-835	200	14	bacterial	bacterial	ADJ
dentistry3000-835	200	15	pathogens	pathogen	NOUN
dentistry3000-835	200	16	.	.	PUNCT
dentistry3000-835	201	1	10(2	10(2	NUM
dentistry3000-835	201	2	)	)	PUNCT
dentistry3000-835	201	3	.	.	PUNCT
dentistry3000-835	202	1	24	24	NUM
dentistry3000-835	202	2	.	.	PUNCT
dentistry3000-835	203	1	al	al	PROPN
dentistry3000-835	203	2	-	-	PUNCT
dentistry3000-835	203	3	saeed	saeed	PROPN
dentistry3000-835	203	4	,	,	PUNCT
dentistry3000-835	203	5	muhammad	muhammad	PROPN
dentistry3000-835	203	6	sabry	sabry	PROPN
dentistry3000-835	203	7	abdel	abdel	PROPN
dentistry3000-835	203	8	razzaq	razzaq	PROPN
dentistry3000-835	203	9	.	.	PUNCT
dentistry3000-835	204	1	(	(	PUNCT
dentistry3000-835	204	2	1997	1997	NUM
dentistry3000-835	204	3	)	)	PUNCT
dentistry3000-835	204	4	.	.	PUNCT
dentistry3000-835	205	1	plasmid	plasmid	VERB
dentistry3000-835	205	2	transcriptome	transcriptome	NOUN
dentistry3000-835	205	3	of	of	ADP
dentistry3000-835	205	4	aerobic	aerobic	ADJ
dentistry3000-835	205	5	respiratory	respiratory	ADJ
dentistry3000-835	205	6	bacteria	bacteria	NOUN
dentistry3000-835	205	7	.	.	PUNCT
dentistry3000-835	206	1	doctoral	doctoral	ADJ
dentistry3000-835	206	2	thesis	thesis	NOUN
dentistry3000-835	206	3	.	.	PUNCT
dentistry3000-835	207	1	college	college	NOUN
dentistry3000-835	207	2	of	of	ADP
dentistry3000-835	207	3	science	science	PROPN
dentistry3000-835	207	4	.	.	PUNCT
dentistry3000-835	208	1	baghdad	baghdad	PROPN
dentistry3000-835	208	2	university	university	PROPN
dentistry3000-835	208	3	.	.	PUNCT
dentistry3000-835	209	1	25	25	NUM
dentistry3000-835	209	2	.	.	PUNCT
dentistry3000-835	210	1	al	al	PROPN
dentistry3000-835	210	2	-	-	PUNCT
dentistry3000-835	210	3	mahdawi	mahdawi	PROPN
dentistry3000-835	210	4	,	,	PUNCT
dentistry3000-835	210	5	abbas	abbas	PROPN
dentistry3000-835	210	6	yassin	yassin	PROPN
dentistry3000-835	210	7	hassan	hassan	PROPN
dentistry3000-835	210	8	.	.	PUNCT
dentistry3000-835	211	1	(	(	PUNCT
dentistry3000-835	211	2	2005	2005	NUM
dentistry3000-835	211	3	)	)	PUNCT
dentistry3000-835	211	4	.	.	PUNCT
dentistry3000-835	212	1	study	study	NOUN
dentistry3000-835	212	2	of	of	ADP
dentistry3000-835	212	3	the	the	DET
dentistry3000-835	212	4	effect	effect	NOUN
dentistry3000-835	212	5	of	of	ADP
dentistry3000-835	212	6	pomegranate	pomegranate	ADJ
dentistry3000-835	212	7	peel	peel	NOUN
dentistry3000-835	212	8	extract	extract	NOUN
dentistry3000-835	212	9	on	on	ADP
dentistry3000-835	212	10	bacteria	bacteria	NOUN
dentistry3000-835	212	11	isolated	isolate	VERB
dentistry3000-835	212	12	from	from	ADP
dentistry3000-835	212	13	tonsilliis	tonsilliis	ADJ
dentistry3000-835	212	14	paients	paient	NOUN
dentistry3000-835	212	15	in	in	ADP
dentistry3000-835	212	16	diyala	diyala	PROPN
dentistry3000-835	212	17	governorate	governorate	NOUN
dentistry3000-835	212	18	and	and	CCONJ
dentistry3000-835	212	19	some	some	PRON
dentistry3000-835	212	20	of	of	ADP
dentistry3000-835	212	21	their	their	PRON
dentistry3000-835	212	22	immunological	immunological	ADJ
dentistry3000-835	212	23	features	feature	NOUN
dentistry3000-835	212	24	.	.	PUNCT
dentistry3000-835	213	1	master	master	NOUN
dentistry3000-835	213	2	’s	’s	PART
dentistry3000-835	213	3	thesis	thesis	NOUN
dentistry3000-835	213	4	.	.	PUNCT
dentistry3000-835	214	1	faculty	faculty	NOUN
dentistry3000-835	214	2	of	of	ADP
dentistry3000-835	214	3	educaion	educaion	NOUN
dentistry3000-835	214	4	.	.	PUNCT
dentistry3000-835	215	1	diyala	diyala	PROPN
dentistry3000-835	215	2	university	university	PROPN
dentistry3000-835	215	3	.	.	PUNCT
dentistry3000-835	216	1	26	26	NUM
dentistry3000-835	216	2	.	.	X
dentistry3000-835	216	3	lhja	lhja	PROPN
dentistry3000-835	216	4	m	m	PROPN
dentistry3000-835	216	5	,	,	PUNCT
dentistry3000-835	216	6	raisanen	raisanen	PROPN
dentistry3000-835	216	7	s	s	PROPN
dentistry3000-835	216	8	,	,	PUNCT
dentistry3000-835	216	9	jokineno	jokineno	PROPN
dentistry3000-835	216	10	k	k	PROPN
dentistry3000-835	216	11	,	,	PUNCT
dentistry3000-835	216	12	stenfors	stenfor	NOUN
dentistry3000-835	216	13	,	,	PUNCT
dentistry3000-835	216	14	l.	l.	PROPN
dentistry3000-835	216	15	(	(	PUNCT
dentistry3000-835	216	16	1997	1997	NUM
dentistry3000-835	216	17	)	)	PUNCT
dentistry3000-835	216	18	.	.	PUNCT
dentistry3000-835	217	1	direct	direct	ADJ
dentistry3000-835	217	2	microscopy	microscopy	NOUN
dentistry3000-835	217	3	of	of	ADP
dentistry3000-835	217	4	effusions	effusion	NOUN
dentistry3000-835	217	5	obtained	obtain	VERB
dentistry3000-835	217	6	from	from	ADP
dentistry3000-835	217	7	peritonsillar	peritonsillar	ADJ
dentistry3000-835	217	8	abscesses	abscess	NOUN
dentistry3000-835	217	9	as	as	ADP
dentistry3000-835	217	10	a	a	DET
dentistry3000-835	217	11	complement	complement	NOUN
dentistry3000-835	217	12	to	to	ADP
dentistry3000-835	217	13	bacterial	bacterial	ADJ
dentistry3000-835	217	14	culturing	culturing	NOUN
dentistry3000-835	217	15	.	.	PUNCT
dentistry3000-835	218	1	j.	j.	PROPN
dentistry3000-835	218	2	laryngology	laryngology	PROPN
dentistry3000-835	218	3	.	.	PUNCT
dentistry3000-835	219	1	otology	otology	NOUN
dentistry3000-835	219	2	,	,	PUNCT
dentistry3000-835	219	3	111:392395	111:392395	PROPN
dentistry3000-835	219	4	.	.	NOUN
dentistry3000-835	219	5	27	27	NUM
dentistry3000-835	219	6	.	.	PUNCT
dentistry3000-835	220	1	brenciani	brenciani	PROPN
dentistry3000-835	220	2	a	a	X
dentistry3000-835	220	3	,	,	PUNCT
dentistry3000-835	220	4	tiberi	tiberi	PROPN
dentistry3000-835	220	5	e	e	PROPN
dentistry3000-835	220	6	,	,	PUNCT
dentistry3000-835	220	7	tili	tili	PROPN
dentistry3000-835	220	8	e	e	PROPN
dentistry3000-835	220	9	,	,	PUNCT
dentistry3000-835	220	10	mingoia	mingoia	PROPN
dentistry3000-835	220	11	m	m	PROPN
dentistry3000-835	220	12	,	,	PUNCT
dentistry3000-835	220	13	palmieri	palmieri	PROPN
dentistry3000-835	220	14	c	c	PROPN
dentistry3000-835	220	15	,	,	PUNCT
dentistry3000-835	220	16	varaldo	varaldo	NOUN
dentistry3000-835	220	17	pe	pe	PART
dentistry3000-835	220	18	,	,	PUNCT
dentistry3000-835	220	19	giovanep	giovanep	PROPN
dentistry3000-835	220	20	e.	e.	PROPN
dentistry3000-835	220	21	(	(	PUNCT
dentistry3000-835	220	22	2013	2013	NUM
dentistry3000-835	220	23	)	)	PUNCT
dentistry3000-835	220	24	.	.	PUNCT
dentistry3000-835	221	1	geneic	geneic	VERB
dentistry3000-835	221	2	determinants	determinant	NOUN
dentistry3000-835	221	3	and	and	CCONJ
dentistry3000-835	221	4	elements	element	NOUN
dentistry3000-835	221	5	associated	associate	VERB
dentistry3000-835	221	6	with	with	ADP
dentistry3000-835	221	7	anibioic	anibioic	ADJ
dentistry3000-835	221	8	resistance	resistance	NOUN
dentistry3000-835	221	9	in	in	ADP
dentistry3000-835	221	10	viridans	viridan	NOUN
dentistry3000-835	221	11	group	group	NOUN
dentistry3000-835	221	12	streptococci	streptococci	NOUN
dentistry3000-835	221	13	.	.	PUNCT
dentistry3000-835	222	1	journal	journal	NOUN
dentistry3000-835	222	2	of	of	ADP
dentistry3000-835	222	3	animicrobial	animicrobial	ADJ
dentistry3000-835	222	4	chemotherapy	chemotherapy	NOUN
dentistry3000-835	222	5	,	,	PUNCT
dentistry3000-835	222	6	69(5	69(5	NUM
dentistry3000-835	222	7	)	)	PUNCT
dentistry3000-835	222	8	,	,	PUNCT
dentistry3000-835	222	9	1197	1197	NUM
dentistry3000-835	222	10	-	-	SYM
dentistry3000-835	222	11	1204	1204	NUM
dentistry3000-835	222	12	.	.	PUNCT
dentistry3000-835	223	1	28	28	NUM
dentistry3000-835	223	2	.	.	PUNCT
dentistry3000-835	224	1	thummeepak	thummeepak	NOUN
dentistry3000-835	224	2	r	r	PROPN
dentistry3000-835	224	3	,	,	PUNCT
dentistry3000-835	224	4	leerach	leerach	ADJ
dentistry3000-835	224	5	n	n	CCONJ
dentistry3000-835	224	6	,	,	PUNCT
dentistry3000-835	224	7	kunthalert	kunthalert	PROPN
dentistry3000-835	224	8	d	d	PROPN
dentistry3000-835	224	9	,	,	PUNCT
dentistry3000-835	224	10	tangchaisuriya	tangchaisuriya	NOUN
dentistry3000-835	224	11	u	u	NOUN
dentistry3000-835	224	12	,	,	PUNCT
dentistry3000-835	224	13	thanwisai	thanwisai	ADP
dentistry3000-835	224	14	a	a	DET
dentistry3000-835	224	15	,	,	PUNCT
dentistry3000-835	224	16	sijhisak	sijhisak	ADJ
dentistry3000-835	224	17	s.	s.	PROPN
dentistry3000-835	224	18	(	(	PUNCT
dentistry3000-835	224	19	2015	2015	NUM
dentistry3000-835	224	20	)	)	PUNCT
dentistry3000-835	224	21	.	.	PUNCT
dentistry3000-835	225	1	high	high	ADJ
dentistry3000-835	225	2	prevalence	prevalence	NOUN
dentistry3000-835	225	3	of	of	ADP
dentistry3000-835	225	4	muli	muli	NOUN
dentistry3000-835	225	5	-	-	PUNCT
dentistry3000-835	225	6	drugresistant	drugresistant	NOUN
dentistry3000-835	225	7	streptococcus	streptococcus	NOUN
dentistry3000-835	225	8	pneumoniae	pneumoniae	ADV
dentistry3000-835	225	9	among	among	ADP
dentistry3000-835	225	10	healthy	healthy	ADJ
dentistry3000-835	225	11	children	child	NOUN
dentistry3000-835	225	12	in	in	ADP
dentistry3000-835	225	13	thailand	thailand	PROPN
dentistry3000-835	225	14	.	.	PUNCT
dentistry3000-835	226	1	journal	journal	PROPN
dentistry3000-835	226	2	infecion	infecion	NOUN
dentistry3000-835	226	3	and	and	CCONJ
dentistry3000-835	226	4	public	public	ADJ
dentistry3000-835	226	5	health	health	NOUN
dentistry3000-835	226	6	,	,	PUNCT
dentistry3000-835	226	7	8(3	8(3	NUM
dentistry3000-835	226	8	)	)	PUNCT
dentistry3000-835	226	9	,	,	PUNCT
dentistry3000-835	226	10	274	274	NUM
dentistry3000-835	226	11	-	-	SYM
dentistry3000-835	226	12	281	281	NUM
dentistry3000-835	226	13	.	.	PUNCT
dentistry3000-835	227	1	29	29	NUM
dentistry3000-835	227	2	.	.	PUNCT
dentistry3000-835	228	1	jebar	jebar	PROPN
dentistry3000-835	228	2	ms	ms	PROPN
dentistry3000-835	228	3	.	.	PROPN
dentistry3000-835	228	4	(	(	PUNCT
dentistry3000-835	228	5	2011	2011	NUM
dentistry3000-835	228	6	)	)	PUNCT
dentistry3000-835	228	7	.	.	PUNCT
dentistry3000-835	229	1	virulence	virulence	NOUN
dentistry3000-835	229	2	factors	factor	NOUN
dentistry3000-835	229	3	of	of	ADP
dentistry3000-835	229	4	streptococcus	streptococcus	NOUN
dentistry3000-835	229	5	mutans	mutan	NOUN
dentistry3000-835	229	6	isolated	isolate	VERB
dentistry3000-835	229	7	from	from	ADP
dentistry3000-835	229	8	pregnant	pregnant	ADJ
dentistry3000-835	229	9	women	woman	NOUN
dentistry3000-835	229	10	with	with	ADP
dentistry3000-835	229	11	acute	acute	ADJ
dentistry3000-835	229	12	vaginiis	vaginiis	NOUN
dentistry3000-835	229	13	.	.	PUNCT
dentistry3000-835	229	14	24(7	24(7	NUM
dentistry3000-835	229	15	)	)	PUNCT
dentistry3000-835	229	16	,	,	PUNCT
dentistry3000-835	229	17	27	27	NUM
dentistry3000-835	229	18	-	-	SYM
dentistry3000-835	229	19	34	34	NUM
dentistry3000-835	229	20	.	.	NOUN
dentistry3000-835	229	21	30	30	NUM
dentistry3000-835	229	22	.	.	PUNCT
dentistry3000-835	230	1	akinjogunla	akinjogunla	PROPN
dentistry3000-835	230	2	oj	oj	PROPN
dentistry3000-835	230	3	,	,	PUNCT
dentistry3000-835	230	4	eghafona	eghafona	PROPN
dentistry3000-835	230	5	no	no	PROPN
dentistry3000-835	230	6	,	,	PUNCT
dentistry3000-835	230	7	enabulele	enabulele	PROPN
dentistry3000-835	230	8	io	io	PROPN
dentistry3000-835	230	9	.	.	PROPN
dentistry3000-835	230	10	(	(	PUNCT
dentistry3000-835	230	11	2011	2011	NUM
dentistry3000-835	230	12	)	)	PUNCT
dentistry3000-835	230	13	.	.	PUNCT
dentistry3000-835	231	1	revalence	revalence	NOUN
dentistry3000-835	231	2	,	,	PUNCT
dentistry3000-835	231	3	haemolyic	haemolyic	ADJ
dentistry3000-835	231	4	aciviies	aciviie	NOUN
dentistry3000-835	231	5	and	and	CCONJ
dentistry3000-835	231	6	flourokuinolones	flourokuinolone	NOUN
dentistry3000-835	231	7	suscepibility	suscepibility	NOUN
dentistry3000-835	231	8	profiles	profile	NOUN
dentistry3000-835	231	9	of	of	ADP
dentistry3000-835	231	10	moraxella	moraxella	PROPN
dentistry3000-835	231	11	catarhalis	catarhalis	PROPN
dentistry3000-835	231	12	,	,	PUNCT
dentistry3000-835	231	13	streptococcus	streptococcus	VERB
dentistry3000-835	231	14	pneumonia	pneumonia	NOUN
dentistry3000-835	231	15	and	and	CCONJ
dentistry3000-835	231	16	haemophilus	haemophilus	ADJ
dentistry3000-835	231	17	influenza	influenza	NOUN
dentistry3000-835	231	18	associated	associate	VERB
dentistry3000-835	231	19	with	with	ADP
dentistry3000-835	231	20	acute	acute	ADJ
dentistry3000-835	231	21	oiis	oiis	ADJ
dentistry3000-835	231	22	media	medium	NOUN
dentistry3000-835	231	23	.	.	PUNCT
dentistry3000-835	232	1	in	in	ADP
dentistry3000-835	232	2	nature	nature	NOUN
dentistry3000-835	232	3	and	and	CCONJ
dentistry3000-835	232	4	science	science	NOUN
dentistry3000-835	232	5	,	,	PUNCT
dentistry3000-835	232	6	9(6):85	9(6):85	PROPN
dentistry3000-835	232	7	-	-	SYM
dentistry3000-835	232	8	92	92	NUM
dentistry3000-835	232	9	.	.	PUNCT
dentistry3000-835	233	1	31	31	NUM
dentistry3000-835	233	2	.	.	PUNCT
dentistry3000-835	234	1	iroha	iroha	PROPN
dentistry3000-835	234	2	ir	ir	PROPN
dentistry3000-835	234	3	,	,	PUNCT
dentistry3000-835	234	4	chibuko	chibuko	PROPN
dentistry3000-835	234	5	nm	nm	PROPN
dentistry3000-835	234	6	,	,	PUNCT
dentistry3000-835	234	7	moses	moses	PROPN
dentistry3000-835	234	8	ib	ib	PROPN
dentistry3000-835	234	9	,	,	PUNCT
dentistry3000-835	234	10	ejikeugwu	ejikeugwu	ADJ
dentistry3000-835	234	11	pc	pc	NOUN
dentistry3000-835	234	12	,	,	PUNCT
dentistry3000-835	234	13	ugbo	ugbo	VERB
dentistry3000-835	234	14	en	en	X
dentistry3000-835	234	15	,	,	PUNCT
dentistry3000-835	234	16	nwakaeze	nwakaeze	PROPN
dentistry3000-835	234	17	ea	ea	PROPN
dentistry3000-835	234	18	,	,	PUNCT
dentistry3000-835	234	19	agumah	agumah	PROPN
dentistry3000-835	234	20	nb	nb	PROPN
dentistry3000-835	234	21	.	.	PUNCT
dentistry3000-835	235	1	(	(	PUNCT
dentistry3000-835	235	2	2015	2015	NUM
dentistry3000-835	235	3	)	)	PUNCT
dentistry3000-835	235	4	.	.	PUNCT
dentistry3000-835	236	1	anibioic	anibioic	ADJ
dentistry3000-835	236	2	suscepibility	suscepibility	NOUN
dentistry3000-835	236	3	pajerns	pajern	NOUN
dentistry3000-835	236	4	of	of	ADP
dentistry3000-835	236	5	streptococcus	streptococcus	NOUN
dentistry3000-835	236	6	pneumoniae	pneumoniae	ADJ
dentistry3000-835	236	7	isolated	isolate	VERB
dentistry3000-835	236	8	from	from	ADP
dentistry3000-835	236	9	the	the	DET
dentistry3000-835	236	10	nasopharyngeal	nasopharyngeal	ADJ
dentistry3000-835	236	11	mucosa	mucosa	NOUN
dentistry3000-835	236	12	of	of	ADP
dentistry3000-835	236	13	children	child	NOUN
dentistry3000-835	236	14	in	in	ADP
dentistry3000-835	236	15	enugu	enugu	PROPN
dentistry3000-835	236	16	metropolis	metropolis	PROPN
dentistry3000-835	236	17	,	,	PUNCT
dentistry3000-835	236	18	nigeria	nigeria	PROPN
dentistry3000-835	236	19	.	.	PUNCT
dentistry3000-835	237	1	int	int	PROPN
dentistry3000-835	237	2	.	.	PUNCT
dentistry3000-835	238	1	j.	j.	PROPN
dentistry3000-835	238	2	curr	curr	PROPN
dentistry3000-835	238	3	.	.	PUNCT
dentistry3000-835	238	4	microbiol	microbiol	PROPN
dentistry3000-835	238	5	app	app	PROPN
dentistry3000-835	238	6	.	.	PUNCT
dentistry3000-835	239	1	sci	sci	PROPN
dentistry3000-835	239	2	,	,	PUNCT
dentistry3000-835	239	3	4(9	4(9	NUM
dentistry3000-835	239	4	)	)	PUNCT
dentistry3000-835	239	5	,	,	PUNCT
dentistry3000-835	239	6	1	1	NUM
dentistry3000-835	239	7	-	-	SYM
dentistry3000-835	239	8	9	9	NUM
dentistry3000-835	239	9	.	.	X
dentistry3000-835	239	10	32	32	NUM
dentistry3000-835	239	11	.	.	PUNCT
dentistry3000-835	240	1	zmantar	zmantar	PROPN
dentistry3000-835	240	2	t	t	PROPN
dentistry3000-835	240	3	,	,	PUNCT
dentistry3000-835	240	4	kouidhi	kouidhi	PROPN
dentistry3000-835	240	5	b	b	NUM
dentistry3000-835	240	6	,	,	PUNCT
dentistry3000-835	240	7	miladi	miladi	NOUN
dentistry3000-835	240	8	h	h	NOUN
dentistry3000-835	240	9	,	,	PUNCT
dentistry3000-835	240	10	bakhrouf	bakhrouf	PROPN
dentistry3000-835	240	11	a.	a.	PROPN
dentistry3000-835	240	12	(	(	PUNCT
dentistry3000-835	240	13	2011	2011	NUM
dentistry3000-835	240	14	)	)	PUNCT
dentistry3000-835	240	15	.	.	PUNCT
dentistry3000-835	241	1	detecion	detecion	NOUN
dentistry3000-835	241	2	of	of	ADP
dentistry3000-835	241	3	macrolide	macrolide	NOUN
dentistry3000-835	241	4	and	and	CCONJ
dentistry3000-835	241	5	disinfectant	disinfectant	NOUN
dentistry3000-835	241	6	resistance	resistance	NOUN
dentistry3000-835	241	7	genes	gene	NOUN
dentistry3000-835	241	8	in	in	ADP
dentistry3000-835	241	9	clinical	clinical	ADJ
dentistry3000-835	241	10	staphylococcus	staphylococcus	NOUN
dentistry3000-835	241	11	aureus	aureus	NOUN
dentistry3000-835	241	12	and	and	CCONJ
dentistry3000-835	241	13	coagulase	coagulase	NOUN
dentistry3000-835	241	14	-	-	PUNCT
dentistry3000-835	241	15	negaive	negaive	PROPN
dentistry3000-835	241	16	staphylococci	staphylococci	PROPN
dentistry3000-835	241	17	.	.	PUNCT
dentistry3000-835	242	1	bmc	bmc	PROPN
dentistry3000-835	242	2	res	re	NOUN
dentistry3000-835	242	3	.	.	PUNCT
dentistry3000-835	243	1	4(453	4(453	NUM
dentistry3000-835	243	2	):	):	PUNCT
dentistry3000-835	243	3	2	2	NUM
dentistry3000-835	243	4	-	-	SYM
dentistry3000-835	243	5	9	9	NUM
dentistry3000-835	243	6	.	.	NOUN
dentistry3000-835	243	7	33	33	NUM
dentistry3000-835	243	8	.	.	PUNCT
dentistry3000-835	244	1	megged	megge	VERB
dentistry3000-835	244	2	o	o	NOUN
dentistry3000-835	244	3	,	,	PUNCT
dentistry3000-835	244	4	assous	assous	PROPN
dentistry3000-835	244	5	m	m	PROPN
dentistry3000-835	244	6	,	,	PUNCT
dentistry3000-835	244	7	weinberg	weinberg	PROPN
dentistry3000-835	244	8	g	g	PROPN
dentistry3000-835	244	9	,	,	PUNCT
dentistry3000-835	244	10	chlesinger	chlesinger	PROPN
dentistry3000-835	244	11	y.	y.	PROPN
dentistry3000-835	244	12	(	(	PUNCT
dentistry3000-835	244	13	2013	2013	NUM
dentistry3000-835	244	14	)	)	PUNCT
dentistry3000-835	244	15	.	.	PUNCT
dentistry3000-835	245	1	inducible	inducible	ADJ
dentistry3000-835	245	2	clindamycin	clindamycin	NOUN
dentistry3000-835	245	3	resistance	resistance	NOUN
dentistry3000-835	245	4	in	in	ADP
dentistry3000-835	245	5	beta	beta	NOUN
dentistry3000-835	245	6	-	-	PUNCT
dentistry3000-835	245	7	hemolyic	hemolyic	ADJ
dentistry3000-835	245	8	streptococci	streptococci	NOUN
dentistry3000-835	245	9	and	and	CCONJ
dentistry3000-835	245	10	streptococcus	streptococcus	VERB
dentistry3000-835	245	11	pneumoniae	pneumoniae	NOUN
dentistry3000-835	245	12	.	.	PUNCT
dentistry3000-835	246	1	imaj	imaj	ADJ
dentistry3000-835	246	2	.	.	PUNCT
dentistry3000-835	247	1	34	34	NUM
dentistry3000-835	247	2	.	.	PUNCT
dentistry3000-835	248	1	sutcliffe	sutcliffe	PROPN
dentistry3000-835	248	2	j	j	PROPN
dentistry3000-835	248	3	,	,	PUNCT
dentistry3000-835	248	4	grebe	grebe	PROPN
dentistry3000-835	248	5	t	t	PROPN
dentistry3000-835	248	6	,	,	PUNCT
dentistry3000-835	248	7	kamradt	kamradt	NOUN
dentistry3000-835	248	8	at	at	ADV
dentistry3000-835	248	9	,	,	PUNCT
dentistry3000-835	248	10	wondrack	wondrack	NOUN
dentistry3000-835	248	11	lt	lt	PROPN
dentistry3000-835	248	12	.	.	PROPN
dentistry3000-835	248	13	(	(	PUNCT
dentistry3000-835	248	14	1996	1996	NUM
dentistry3000-835	248	15	)	)	PUNCT
dentistry3000-835	248	16	.	.	PUNCT
dentistry3000-835	249	1	detecion	detecion	NOUN
dentistry3000-835	249	2	of	of	ADP
dentistry3000-835	249	3	erythromycin	erythromycin	NOUN
dentistry3000-835	249	4	-	-	PUNCT
dentistry3000-835	249	5	resistant	resistant	ADJ
dentistry3000-835	249	6	determinants	determinant	NOUN
dentistry3000-835	249	7	by	by	ADP
dentistry3000-835	249	8	pcr	pcr	PROPN
dentistry3000-835	249	9	.	.	PUNCT
dentistry3000-835	250	1	animicro	animicro	PROPN
dentistry3000-835	250	2	.	.	PROPN
dentistry3000-835	251	1	ag	ag	PROPN
dentistry3000-835	251	2	.	.	PROPN
dentistry3000-835	251	3	and	and	CCONJ
dentistry3000-835	251	4	chemoth	chemoth	ADV
dentistry3000-835	251	5	.	.	PUNCT
dentistry3000-835	252	1	40	40	NUM
dentistry3000-835	252	2	(	(	PUNCT
dentistry3000-835	252	3	11	11	NUM
dentistry3000-835	252	4	):	):	PUNCT
dentistry3000-835	252	5	2562	2562	NUM
dentistry3000-835	252	6	–	–	PUNCT
dentistry3000-835	252	7	2566	2566	NUM
dentistry3000-835	252	8	.	.	PUNCT
dentistry3000-835	253	1	35	35	NUM
dentistry3000-835	253	2	.	.	PUNCT
dentistry3000-835	254	1	al	al	PROPN
dentistry3000-835	254	2	-	-	PUNCT
dentistry3000-835	254	3	marzoqi	marzoqi	ADV
dentistry3000-835	254	4	ah	ah	INTJ
dentistry3000-835	254	5	.	.	PUNCT
dentistry3000-835	254	6	(	(	PUNCT
dentistry3000-835	254	7	2009	2009	NUM
dentistry3000-835	254	8	)	)	PUNCT
dentistry3000-835	254	9	.	.	PUNCT
dentistry3000-835	255	1	animicrobial	animicrobial	ADJ
dentistry3000-835	255	2	suscepibiliies	suscepibiliie	NOUN
dentistry3000-835	255	3	among	among	ADP
dentistry3000-835	255	4	respiratory	respiratory	ADJ
dentistry3000-835	255	5	isolates	isolate	NOUN
dentistry3000-835	255	6	of	of	ADP
dentistry3000-835	255	7	haemophilus	haemophilus	ADJ
dentistry3000-835	255	8	influenza	influenza	NOUN
dentistry3000-835	255	9	,	,	PUNCT
dentistry3000-835	255	10	methicillin	methicillin	NOUN
dentistry3000-835	255	11	-	-	PUNCT
dentistry3000-835	255	12	resistant	resistant	ADJ
dentistry3000-835	255	13	staphylococcus	staphylococcus	NOUN
dentistry3000-835	255	14	aureus	aureus	NOUN
dentistry3000-835	255	15	(	(	PUNCT
dentistry3000-835	255	16	mrsa	mrsa	NOUN
dentistry3000-835	255	17	)	)	PUNCT
dentistry3000-835	255	18	and	and	CCONJ
dentistry3000-835	255	19	streptococcus	streptococcus	VERB
dentistry3000-835	255	20	pneumoniae	pneumoniae	ADV
dentistry3000-835	255	21	in	in	ADP
dentistry3000-835	255	22	hillah	hillah	NOUN
dentistry3000-835	255	23	infants	infant	NOUN
dentistry3000-835	255	24	.	.	PUNCT
dentistry3000-835	256	1	journal	journal	NOUN
dentistry3000-835	256	2	of	of	ADP
dentistry3000-835	256	3	alqadisiyah	alqadisiyah	NOUN
dentistry3000-835	256	4	for	for	ADP
dentistry3000-835	256	5	pure	pure	ADJ
dentistry3000-835	256	6	science	science	NOUN
dentistry3000-835	256	7	(	(	PUNCT
dentistry3000-835	256	8	quarterly	quarterly	ADJ
dentistry3000-835	256	9	)	)	PUNCT
dentistry3000-835	256	10	,	,	PUNCT
dentistry3000-835	256	11	14(1	14(1	NUM
dentistry3000-835	256	12	)	)	PUNCT
dentistry3000-835	256	13	,	,	PUNCT
dentistry3000-835	256	14	23	23	NUM
dentistry3000-835	256	15	-	-	SYM
dentistry3000-835	256	16	32	32	NUM
dentistry3000-835	256	17	.	.	PUNCT
dentistry3000-835	257	1	36	36	NUM
dentistry3000-835	257	2	.	.	PUNCT
dentistry3000-835	258	1	sharat	sharat	PROPN
dentistry3000-835	258	2	k.	k.	PROPN
dentistry3000-835	258	3	(	(	PUNCT
dentistry3000-835	258	4	2004	2004	NUM
dentistry3000-835	258	5	)	)	PUNCT
dentistry3000-835	258	6	.	.	PUNCT
dentistry3000-835	259	1	group	group	PROPN
dentistry3000-835	259	2	b	b	PROPN
dentistry3000-835	259	3	streptococcus	streptococcus	NOUN
dentistry3000-835	259	4	infecion	infecion	NOUN
dentistry3000-835	259	5	.	.	PUNCT
dentistry3000-835	260	1	medicine	medicine	NOUN
dentistry3000-835	260	2	.	.	PUNCT
dentistry3000-835	261	1	16(3):1425	16(3):1425	X
dentistry3000-835	261	2	.	.	NOUN
dentistry3000-835	261	3	37	37	NUM
dentistry3000-835	261	4	.	.	PUNCT
dentistry3000-835	262	1	turki	turki	PROPN
dentistry3000-835	262	2	sumaya	sumaya	PROPN
dentistry3000-835	262	3	hassan	hassan	PROPN
dentistry3000-835	262	4	(	(	PUNCT
dentistry3000-835	262	5	2018	2018	NUM
dentistry3000-835	262	6	)	)	PUNCT
dentistry3000-835	262	7	.	.	PUNCT
dentistry3000-835	263	1	a	a	DET
dentistry3000-835	263	2	study	study	NOUN
dentistry3000-835	263	3	on	on	ADP
dentistry3000-835	263	4	streptococcus	streptococcus	NOUN
dentistry3000-835	263	5	mutans	mutan	NOUN
dentistry3000-835	263	6	,	,	PUNCT
dentistry3000-835	263	7	isolated	isolate	VERB
dentistry3000-835	263	8	from	from	ADP
dentistry3000-835	263	9	tooth	tooth	NOUN
dentistry3000-835	263	10	decay	decay	NOUN
dentistry3000-835	263	11	,	,	PUNCT
dentistry3000-835	263	12	and	and	CCONJ
dentistry3000-835	263	13	comparing	compare	VERB
dentistry3000-835	263	14	the	the	DET
dentistry3000-835	263	15	effect	effect	NOUN
dentistry3000-835	263	16	of	of	ADP
dentistry3000-835	263	17	some	some	DET
dentistry3000-835	263	18	plant	plant	NOUN
dentistry3000-835	263	19	extracts	extract	NOUN
dentistry3000-835	263	20	and	and	CCONJ
dentistry3000-835	263	21	animicrobial	animicrobial	ADJ
dentistry3000-835	263	22	agents	agent	NOUN
dentistry3000-835	263	23	on	on	ADP
dentistry3000-835	263	24	these	these	DET
dentistry3000-835	263	25	bacteria	bacteria	NOUN
dentistry3000-835	263	26	,	,	PUNCT
dentistry3000-835	263	27	master	master	NOUN
dentistry3000-835	263	28	thesis	thesis	NOUN
dentistry3000-835	263	29	,	,	PUNCT
dentistry3000-835	263	30	faculty	faculty	NOUN
dentistry3000-835	263	31	of	of	ADP
dentistry3000-835	263	32	science	science	NOUN
dentistry3000-835	263	33	,	,	PUNCT
dentistry3000-835	263	34	diyala	diyala	PROPN
dentistry3000-835	263	35	university	university	NOUN
dentistry3000-835	263	36	.	.	PUNCT
dentistry3000-835	264	1	38	38	NUM
dentistry3000-835	264	2	.	.	PUNCT
dentistry3000-835	265	1	doherty	doherty	PROPN
dentistry3000-835	265	2	n	n	CCONJ
dentistry3000-835	265	3	,	,	PUNCT
dentistry3000-835	265	4	trzcinski	trzcinski	PROPN
dentistry3000-835	265	5	k	k	PROPN
dentistry3000-835	265	6	,	,	PUNCT
dentistry3000-835	265	7	pickerill	pickerill	NOUN
dentistry3000-835	265	8	p	p	NOUN
dentistry3000-835	265	9	,	,	PUNCT
dentistry3000-835	265	10	zawadzki	zawadzki	NOUN
dentistry3000-835	265	11	p	p	NOUN
dentistry3000-835	265	12	,	,	PUNCT
dentistry3000-835	265	13	dowson	dowson	NOUN
dentistry3000-835	265	14	cg	cg	NOUN
dentistry3000-835	265	15	.	.	PUNCT
dentistry3000-835	265	16	(	(	PUNCT
dentistry3000-835	265	17	2000	2000	NUM
dentistry3000-835	265	18	)	)	PUNCT
dentistry3000-835	265	19	.	.	PUNCT
dentistry3000-835	266	1	geneic	geneic	VERB
dentistry3000-835	266	2	diversity	diversity	NOUN
dentistry3000-835	266	3	of	of	ADP
dentistry3000-835	266	4	the	the	DET
dentistry3000-835	266	5	tet	tet	NOUN
dentistry3000-835	266	6	(	(	PUNCT
dentistry3000-835	266	7	m	m	NOUN
dentistry3000-835	266	8	)	)	PUNCT
dentistry3000-835	266	9	gene	gene	NOUN
dentistry3000-835	266	10	in	in	ADP
dentistry3000-835	266	11	tetracycline	tetracycline	NOUN
dentistry3000-835	266	12	-	-	PUNCT
dentistry3000-835	266	13	resistant	resistant	ADJ
dentistry3000-835	266	14	clonal	clonal	ADJ
dentistry3000-835	266	15	lineages	lineage	NOUN
dentistry3000-835	266	16	of	of	ADP
dentistry3000-835	266	17	streptococcus	streptococcus	NOUN
dentistry3000-835	266	18	pneumoniae	pneumoniae	ADJ
dentistry3000-835	266	19	.	.	PUNCT
dentistry3000-835	267	1	animicrobial	animicrobial	ADJ
dentistry3000-835	267	2	agents	agent	NOUN
dentistry3000-835	267	3	and	and	CCONJ
dentistry3000-835	267	4	chemotherapy	chemotherapy	NOUN
dentistry3000-835	267	5	,	,	PUNCT
dentistry3000-835	267	6	44(11	44(11	NUM
dentistry3000-835	267	7	)	)	PUNCT
dentistry3000-835	267	8	,	,	PUNCT
dentistry3000-835	267	9	29792984	29792984	NUM
dentistry3000-835	267	10	.	.	PUNCT
dentistry3000-835	268	1	39	39	NUM
dentistry3000-835	268	2	.	.	PUNCT
dentistry3000-835	269	1	sun	sun	PROPN
dentistry3000-835	269	2	jq	jq	PROPN
dentistry3000-835	269	3	,	,	PUNCT
dentistry3000-835	269	4	li	li	PROPN
dentistry3000-835	269	5	l	l	PROPN
dentistry3000-835	269	6	,	,	PUNCT
dentistry3000-835	269	7	zhao	zhao	PROPN
dentistry3000-835	269	8	k	k	PROPN
dentistry3000-835	269	9	,	,	PUNCT
dentistry3000-835	269	10	zhang	zhang	PROPN
dentistry3000-835	269	11	lf	lf	PROPN
dentistry3000-835	269	12	,	,	PUNCT
dentistry3000-835	269	13	ji	ji	PROPN
dentistry3000-835	269	14	ht	ht	PROPN
dentistry3000-835	269	15	,	,	PUNCT
dentistry3000-835	269	16	he	he	PRON
dentistry3000-835	269	17	yx	yx	NOUN
dentistry3000-835	269	18	.	.	PUNCT
dentistry3000-835	269	19	(	(	PUNCT
dentistry3000-835	269	20	2017	2017	NUM
dentistry3000-835	269	21	)	)	PUNCT
dentistry3000-835	269	22	.	.	PUNCT
dentistry3000-835	270	1	molecular	molecular	ADJ
dentistry3000-835	270	2	epidemiology	epidemiology	NOUN
dentistry3000-835	270	3	of	of	ADP
dentistry3000-835	270	4	tetracycline	tetracycline	PROPN
dentistry3000-835	270	5	resistance	resistance	NOUN
dentistry3000-835	270	6	among	among	ADP
dentistry3000-835	270	7	viridians	viridian	NOUN
dentistry3000-835	270	8	group	group	NOUN
dentistry3000-835	270	9	streptococci	streptococcus	NOUN
dentistry3000-835	270	10	isolated	isolate	VERB
dentistry3000-835	270	11	from	from	ADP
dentistry3000-835	270	12	various	various	ADJ
dentistry3000-835	270	13	clinical	clinical	ADJ
dentistry3000-835	270	14	specimens	specimen	NOUN
dentistry3000-835	270	15	.	.	PUNCT
dentistry3000-835	270	16	biomedical	biomedical	PROPN
dentistry3000-835	270	17	research	research	NOUN
dentistry3000-835	270	18	(	(	PUNCT
dentistry3000-835	270	19	0970938x	0970938x	PROPN
dentistry3000-835	270	20	)	)	PUNCT
dentistry3000-835	270	21	,	,	PUNCT
dentistry3000-835	270	22	28(2	28(2	NUM
dentistry3000-835	270	23	)	)	PUNCT
dentistry3000-835	270	24	.	.	PUNCT