835 final Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu Molecular Detection of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Aseel Jalil Ibrahim Al-Karawi1, Abdulhameed Salim Hameed2, Sally Talib Da'aj3, Hadeel J. Ibrahim4 1University of Bilad Alrafidain, Diyala, Iraq 2Ministry of Health, Diyala, Iraq 3University of Bilad Alrafidain, Diyala, Iraq 4General Directorate of Education, Diyala, Iraq Abstract Objec&ve: The aim of this study was to established diagnos4c approaches to dental caries using polymerase chain reac4on technology. Methods: PCR series. 60 samples of oral bacteria were collected between 8/6/2023 and 12/1/2023, where 27 teeth showed a growth rate for bacterial culture (45%). The bacterial isolates under study were characterized. The sensi4vity of the bacterial isolates of Streptococcus viridans under study to eight an4bio4cs was tested. The results of the current study showed that the resistance rates were as follows: 71.4% for tetracycline, 57% for augmen4n, 57% for ciprofloxacin, 28% for clindamycin, 57% for erythromycin, 57% for doxycycline, and 28% for doxycycline for clarithromycin. Results: The minimum inhibitory concentra4on (MIC) for the bacterial isolates under study was determined for the tetracycline an4bio4c. S. viridans isolates showed resistance to this an4bio4c through a sensi4vity test using the disk method, as the MIC value. for the isolates ranged from (1024-8) micrograms/m l. The percentage of S. viridans isolates producing virulence factors was as follows: protease enzyme 42%, and membrane protease. Bioac4ve 71%, bacteriocin 14%, hemolycin 57%, DNAase 71%, capsule 28%, and lipase 28%. Conclusion: The total DNA of all bacterial isolates under study was extracted, aXer which a polymerase chain reac4on (PCR) was performed for the S. viridans resistant to tetracycline and with an MIC value higher than 64 µg/ml using specialized primers targe4ng the specific sequence of the tetM gene with a size of 1,862bp. When the amplified products were migrated on an agarose gel, one band appeared in all tracks in the gel at the same level for all samples. The results showed that the presence of the tetM gene was 100%. Keywords: Streptococcus viridans, rpoA, tetM, Sequencing, PCR Cita9on: Al-Karawi AJI, et al. (2025) Molecular Detec9on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene. Den9stry 3000. 1:a001 doi:10.5195/d3000.2025.835 Received: January 26, 2025 Accepted: March 30, 2025 Published: April 1, 2025 Copyright: ©2025 Al-Karawi AJI, et al. This is an open access ar9cle licensed under a Crea9ve Commons AYribu9on Work 4.0 United States License. Email: aseeljaleel68@gmail.com Introduction Streptococcus is a gram-positive coccus that includes several species, as they share common characteristics, as they are facultative anaerobic and spherical in shape [1]. Some of them are obligate anaerobic and some are facultative anaerobic that ferment carbohydrates and grow with the availability of CO2 and are negative to produce oxidase and catalase enzymes. The growth requirements of this species are complex as they require culture media rich in blood, such as blood agar [2]. The pathogenicity of the Streptococcus genus is linked to its ability to produce several virulence factors, which include the production of hemolytic toxins such as hemolysin, in addition to its production of intestinal toxins that cause food poisoning. It also possesses the ability to produce many extracellular enzymes such as lipase, proteinase, and streptokinase, which help the bacteria in tissue invasion and spread of infections. Most of its types are surrounded by a capsule and grow at a temperature of 37°C, Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu which is the optimum temperature for their growth, and growth is weak in ordinary solid or liquid media [3]. S. viridans are gram positive, facultative anaerobic, and negative for oxidase and catalase tests. Their growth is inhibited by optochin and their colonies do not dissolve in bile salts. Unlike pneumococci, some Streptococci viridans, such as S. mutans, accumulate large polysaccharides, such as dextran or levans of sucrose, and contribute to the development of tooth decay [4]. Some types of Streptomyces may enter the bloodstream by tooth brushing or during dental work [5]. When these organisms enter the bloodstream, they will form colonies and form biofilms, causing chronic endocarditis. Resistance to tetracycline and its other derivatives is widespread in spherical gram-positive bacteria, and the mechanisms of resistance against the tetracycline family are either by changing the target site for the action of the antibiotic or reducing the permeability of the antigen through the outer membrane, or through genetic expression of the transposon gene containing it [6]. There is an interest in Diyala Governorate on methods to detect resistance of Streptococcus viridans bacteria to tetracycline antibiotics among hospitalized patients. The aim of this study was to isolate S. viridans and characterize them phenotypically, biochemically and by molecular methods using 16SrRNA and rpoA. Material and Methods Isolation and diagnosis of the bacteria under study Oral samples were cultured on blood agar and on mitis salivarius agar medium and incubated in an anaerobic growth cylinder candle jar for 48 hours at a temperature of 37°C, and then the isolates were morphologically characterized based on the shape of the colony [7], and microscopically, based on the shape, color, cell clusters, and type of pigmentation [8]. In addition, biochemical characterization, based on the ability of the bacteria to produce enzymes such as oxidase [9] and catalase [10] was performed. Finally, we tested the solubility in bile salts [11] and tested sensitivity to optogen [12]. Sample collection 60 oral samples were collected from patients at the Specialized Dental Center in Baquba, Diyala, Iraq and from outpatient dental clinics, under the supervision of specialized dentists, during the period between August and December 2017. The samples were taken using sterile cotton swabs inside a closed carrier medium for the purpose of avoiding external contamination as well as to prevent contamination of samples during their transport to the laboratory. Detection of virulence factors Various methods were utilized for determination of virulent factor: the ability of bacterial isolates to produce hemolysin [13] lipase [11], protease [14], DNase [15] enzymes, biofilm production [16], composition of the portfolio [17], and the ability to produce bacteriocin [18]. Antibiotic susceptibility testing The sensitivity of the S. viridans isolates under study to eight antibiotics was tested using the disk diffusion method on Mueller- Hinton agar medium [19,20]. Antibiotics used in this study were doxycycline (30 µg), erythromycin (15 µg), clindamycin (15 µg), clarithromycin (15 µg), ciprofloxacin (5 µg), bacitracin (0.04 micrograms), tetracycline (30 micrograms), and augmentin (30 micrograms). Extraction of total DNA and PCR amplification Total DNA extraction and PCR amplification of the tetracycline- resistant bacterial isolates under study was done using Geneaid. Genomic DNA was purified and the rpoA and tetM genes (445 base pairs) were amplified using specific primers: rpoA F- (CAC AGT TCC AGG TGT TCG) and R- (TGC TGA Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu AAG CCC TAA AGCAT) and tetM F- (AGTTTTAGCTCATGTTGATG) and R- (TCCGACTATTTGGGACGACGG), respectively. For the PCR master mix, Geneaid, Accupower®Profi Taq PCR Premix was placed in stander Accupower®Profi Taq PCR Premix) that contained all other components. To execute the PCR reaction, Taq DNA polymerase, dNTP, Tris-HCl, pH 9, KCl MgCl2 stabilizer, and tacking dye were used (Table 1). Table 1. Components for the polymerase chain reaction (PCR). PCR tubes were prepared according to manufacture instructions. They were transferred into a spin vortex centrifuge for 3 minutes at 3000 rpm and then placed in the PCR thermocycler. PCR amplification conditions for rpoA were denaturation at 950C for 5 minutes followed by 30 cycles of annealing at 500C for 30 seconds, extension at 72°C for 30 seconds, and a final extension cycle at 72°C for 5 minutes. For the tetM gene, the reaction conditions were denaturation at 950C for 5 minutes, followed by 30 cycles, annealing at 640C for 30 seconds, extension at 72°C for 30 seconds, and a final extension cycle at 72°C for 5 minutes. PCR products were resolved in 1% agarose gel and visualized by UV gel documentation and the image was captured by digital camera (Canon, USA) [21]. RESULTS AND DISCUSSION Isolation and identification of Streptococcus spp The results showed that 27 samples, representing 45% of the total 60, had Streptococcus. Isolation rate of S. viridans bacteria in the current study was 25.9%. These results were inconsistent with previous work [22,23], which showed the isolation rate of these bacteria as 11% and 5%, respectively, and more like others [24-26] that found percentages of 43%, 19.6%, or 24.5%. The reason for the difference in the percentage of isolation of Hemolytic Streptococcus in the current study in comparison with previous studies is possibly due to differences in the source of isolation, geographical location, ages, or nutritional and health habits. Volume Components 5 Master Mix PCR solution 3 DNA template 2 Forward primer 2 Revers primer 13 PCR water 25 Total volume Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu 445 b.p Figure 1. Electrophoresis of amplification products of rpoA (445 base pairs) in an agarose gel. Detection of Streptococcus viridans using the diagnostic rpoA gene rpoA was detected in all samples (Figure 1). Antibiotic susceptibility testing for Streptococcus viridans The sensitivity of Streptococcus viridans isolates to eight antibiotics (doxycycline, tetracycline, augmentin, ciprofloxacin, clindamycin, bacitracin, clarithromycin, and erythromycin) was tested. The results of the current study showed that the rate of resistance of viridans to the tetracycline antibiotic was 71.4%, which is inconsistent with previous results [27,28], that showed the rate of resistance of S. viridans bacteria to this antibiotic was 2.7% or 15.8%. The reason for this resistance is suggested as the inability of the antibiotic to reach inhibitory concentrations into the bacterial cell because of the presence of plasmids that encode efflux pumps, which are responsible for either increasing the transfer of the antigen outside the bacterial cell or reducing its permeability [4]. The tetracycline antagonist inhibits protein synthesis by binding to the 30S ribosomal unit. As a result of this inhibition, it prevents the binding of amionacyl-tRNA to the special site on the mRNA. The resistance rate of ciprofloxacin for S. viridans isolates was 57%, which is like results of the resistance of S. mutans defined as 75% [29]. The antibiotic effect of ciprofloxacin is bactericidal by inhibiting the DNA synthesis process by stopping the action of the enzyme DNA gyrase [30]. As for the antibiotic erythromycin, the resistance rate of the isolates under study was 57%. The reason for the resistance of bacterial isolates to the anti-erythromycin is likely due either to the presence of plasmids that carry genes responsible for this resistance or to a change in the target site, or to add a methyl group to adenine to rRNA [31,32]. Resistance of the bacterial isolates of S. viridans to the antibiotic clindamycin was 28%. Previous data showed resistance of S. pyogenes bacteria to this antibiotic was 1.6% [33]. Clindamycin is a macrolide, and bacteria become resistant to macrolides by acquiring the mef (A) gene. This gene encodes the 5 4 3 2 1 M b.p 2000 1000 500 100 Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu synthesis of efflux pump protein synthesis, which works on pumping 4-15 rings of the macrolide group [34].). As for the resistance of bacterial isolates to the antibiotic augmentin, it reached 57% for S. viridans, which is different than previous work that showed a resistance rate of S. pyogenes of 6.6% [22]. The resistance of S. viridans isolates to doxicyclin was 57%, which was different to S. mutans isolates in previous work that were sensitive at 100% level [29]. For clarithromycin, the resistance of S. viridans was 71%. These results were close to the results reached earlier for S. viridans [35]. The increase in resistance resulting from misuse of antibiotics leads to the transfer of this resistance through genetic factors such as transposons or plasmids, or because of a change in the permeability of the bacterial cell wall [36]. The results of the study showed that all isolates were 100% resistant to bacitracin. These results were close to results reached earlier, where the resistance of S. mutans bacteria to this antibiotic was 100% [37]. Detection of the tetM gene using PCR technology Five bacterial isolates under study, belonging to the S. viridans bacterium, were tested [38]. The results of the current study showed that all isolates had the tetM gene that encodes resistance to tetracycline in S. viridans. The results of our study were inconsistent with previous work, which indicated S. viridans resistance of 43% [39]. Figure 2. Electrophoresis of the amplification products of the tetM gene in an agarose gel at a concentration of 1% and a voltage of 100 V for an hour and using a DNA Ladder (100bp-2000bp), as this appears in the M path and starts from 100 base pairs, and the gene packages are 1,862 base pairs long in S. viridans bacteria. Conflicts of interest The authors declare no competing interest. References 1. Brooks GF, Caroll KC, Butel JS, Mores SA, Maietzner TA. (2010). Jawets, Melnik and Adelberg's Medical Microbiology. 25th ed. The McGraw-Hill Companies. 2. Murray PR, Rosenthl KS, Pfaller MA. (2013). Medical Microbiology Seventh Ediion (textbook). Philadelphia, PA. 1,862 bp b p 2000 1000 500 100 Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu 3. Ryan KJ, Ray CG, Champoux JJ, Drew WI, Neidhardt FC, Plorde JJ. (2004). Sherris medical microbiology: an introducion to infecious diseases. 4th ediion. Mcgraw-Hill company. 4. Jawetz E, Melnick JA, Adelberg EA. (2016). Review of Medical Microbiology. 27th ed. McGraw- Hill educaion, Inc: 851pp. 5. Wescombe PA, Heng NCK, Burton JP, Chilcoj CN, Tagg JR. (2009). Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probioics. Future Microbial. 4:819–835. 6. Reyes J, Hidalgo M, D1i'az L, Rinco'n S, Moreno J, Vanegas N, Castaneda E, Arias CA. (2007). Internaional J. of Infect. Dis. 11:329-336. 7. Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. (1994). Bergey's manual of determinaive bacteriology. 9th ed. Williams and Wilkins: Balimore, Maryland; pp. 20 & 527-558. 8. Yoo S, Kim P, Hwang H, Kim K, Choe S, Min B, Kook J. (2005). Idenificaion of non-mutans Streptococci organisms in dental plaques recovering on miis salivarius bacitracin agar medium. Microbial. 43(2): 204-208. 9. Koneman EW, Allen SD, Janda WM, Schreckenberger PC, Winn WCJ. (1992). Color atlas and textbook of diagnosic microbiology. (4th) ed. J.B. Lippincoj Company. Philadelphia. 10. Tadesse A, Alem M. (2006). Medical bacteriology. EPHTI. Gondar University. 11. Collee JG, Fraser AG, Marmion BP Simmons A. (1996). Mackie and McCartney pracical medical microbiology. 14th ed. Churchill Livingston. P.173-174. 12. Messmer TO, Sampson JS, Sinson A, Wong B, Carlone GM, Facklam RR. (2004). Comparison four polymerase chain reacion assays for specificity in the idenificaion of S. pneumoniae. Diagn. Microbiol. Infect. Dis., 49: 249-254. 13. Atlas RM, Brown AE, Parks LC. (1995) Laboratory manual experimental microbiology. 1th ed. Inc. Biofilm formaion and determinaion of chemical inhibiion. MSc Thesis. College of Science. University of Baghdad. 14. Straus DC, Mapngly SJ, Milligan TW, Doran TI Nealon TJ. (1980). Protease producion by clinical isolates of type III group B streptococci. J. Clin. Microb. 12: 421-425. 15. Jeffries CD, Holtman DF, Guse DG. Rapid method for determining the acivity of microorganisms on nucleic acids. J Bacteriol. 1957;73(4):590-1. 16. Mathur T, Singhal S, Khan S, Upadhyay DJ, Fatma T, Rajan A. (2006). Detecion of biofilm formaion among the clinical isolates of Staphylococci: An evaluaion of three different screening methods. Indian J. Med. Microbiol. 24(1): 25-29. 17. Stukus PE. (1997). Invesigaing microbiology: a laboratory manual for general microbiology. Harcout Brace and companies. 18. Al-Qasab Abdul-Jabbar’emer, Al-Khafaji Zahra Mahmoud. (1992). Effect of different condiions on the inhibitory efficacy of intesinal lactobacilli in the direcion of intesinal bacteria causing diarrhea. Faculty of Agricultural Sciences. Folder 123 (7), 26-18. 19. CLSI (2010) Methods for diluion animicrobial suscepibility tests for bacteria that grow aerobically; Approved Standard— Ninth Ediion. 32(8). CLSI, Wayne, Pennsylvania, USA. 20. CLSI (2017) Methods for diluion animicrobial suscepibility tests for bacteria that grow aerobically; Approved Standard— Ninth Ediion. 32(8). CLSI, Wayne, Pennsylvania, USA. 21. Park HK, Yoon JW, Shin JW, Kim JY, Kim W. (2010). rpoA is a useful gene for idenificaion and classificaion of Streptococcus pneumoniae from the closely related viridans group Streptococci. FEMS microbiology lejers, 305(1), 58-64. 22. Tamimi Zainab Amer Hatem (2013). Bacteriological and hereditary study of Streptococcus pyogenes isolated from paients with tonsilliis in the city of Muqdadiya, Master Thesis, College of Educaion for Pure Sciences, University of Diyala. Molecular Detec,on of Tetracycline-Resistant Streptococcus viridans Bacteria Using the rpoA Gene Vol 13 No 1 (2025) DOI 10.5195/d3000.2025.835 h#p://den*stry3000.pi#.edu 23. Srinivasan R, Karaoz U, Volegova M, MacKichan J, Kato- Maeda M, Miller S, Lynch SV. (2015). Use of16S rRNA gene for idenificaion of a broad range of clinically relevant bacterial pathogens. 10(2). 24. Al-Saeed, Muhammad Sabry Abdel Razzaq. (1997). Plasmid transcriptome of aerobic respiratory bacteria. Doctoral thesis. College of Science. Baghdad University. 25. Al-Mahdawi, Abbas Yassin Hassan. (2005). Study of the effect of pomegranate peel extract on bacteria Isolated from tonsilliis paients in Diyala Governorate and some of their immunological features. Master’s thesis. Faculty of Educaion. Diyala University. 26. Lhja M, Raisanen S, Jokineno K, Stenfors, L. (1997). Direct microscopy of effusions obtained from peritonsillar abscesses as a complement to bacterial culturing. J. Laryngology. Otology, 111:392- 395. 27. Brenciani A, Tiberi E, Tili E, Mingoia M, Palmieri C, Varaldo PE, Giovanep E. (2013). Geneic determinants and elements associated with anibioic resistance in viridans group streptococci. Journal of Animicrobial Chemotherapy, 69(5), 1197-1204. 28. Thummeepak R, Leerach N, Kunthalert D, Tangchaisuriya U, Thanwisai A, Sijhisak S. (2015). High prevalence of muli-drug- resistant Streptococcus pneumoniae among healthy children in Thailand. Journal Infecion and Public Health, 8(3), 274-281. 29. Jebar MS. (2011). Virulence factors of Streptococcus mutans isolated from pregnant women with acute vaginiis. 24(7), 27-34. 30. Akinjogunla OJ, Eghafona NO, Enabulele IO. (2011). Revalence, haemolyic aciviies and flourokuinolones suscepibility profiles of Moraxella catarhalis, Streptococcus pneumonia and Haemophilus influenza associated with acute oiis media. In nature and science, 9(6):85-92. 31. Iroha IR, Chibuko NM, Moses IB, Ejikeugwu PC, Ugbo EN, Nwakaeze EA, Agumah NB. (2015). Anibioic suscepibility pajerns of Streptococcus pneumoniae isolated from the nasopharyngeal mucosa of children in Enugu Metropolis, Nigeria. Int. J. Curr. Microbiol App. Sci, 4(9), 1-9. 32. Zmantar T, Kouidhi B, Miladi H, Bakhrouf A. (2011). Detecion of macrolide and disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negaive staphylococci. BMC Res. 4(453): 2-9. 33. Megged O, Assous M, Weinberg G, Chlesinger Y. (2013). Inducible clindamycin resistance in beta-hemolyic streptococci and Streptococcus pneumoniae. IMAJ. 34. Sutcliffe J, Grebe T, Kamradt AT, Wondrack LT. (1996). Detecion of erythromycin-resistant determinants by PCR. Animicro. Ag. and Chemoth. 40 (11): 2562– 2566. 35. Al-Marzoqi AH. (2009). Animicrobial suscepibiliies among respiratory isolates of Haemophilus influenza, methicillin-resistant Staphylococcus aureus (MRSA) and Streptococcus pneumoniae in Hillah infants. Journal of Al- Qadisiyah for Pure Science (quarterly), 14(1), 23-32. 36. Sharat K. (2004). Group B Streptococcus infecion. Medicine. 16(3):1425. 37. Turki Sumaya Hassan (2018). A study on Streptococcus mutans, isolated from tooth decay, and comparing the effect of some plant extracts and animicrobial agents on these bacteria, Master Thesis, Faculty of Science, Diyala University. 38. Doherty N, Trzcinski K, Pickerill P, Zawadzki P, Dowson CG. (2000). Geneic diversity of the tet (M) gene in tetracycline-resistant clonal lineages of Streptococcus pneumoniae. Animicrobial Agents and Chemotherapy, 44(11), 2979- 2984. 39. Sun JQ, Li L, Zhao K, Zhang LF, Ji HT, He YX. (2017). Molecular epidemiology of tetracycline resistance among viridians group streptococci isolated from various clinical specimens. Biomedical Research (0970- 938X), 28(2).