Dermatology: Practical and Conceptual Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 1 Lenalidomide Augments Differentiation of Cultured Hair Follicle Derived Melanocyte Stem Cells Into Functional Melanocytes Uma Kumari1, Naveed Pervaiz1, Harjot Kaur1, Himani Sharma1, Davinder Parsad2, Ravinder Kumar1 1 Department of Zoology, Panjab University, Chandigarh, India 2 Department of Dermatology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Key words: lenalidomide, melanocyte stem cells, melanocyte, differentiation Citation: Kumari U, Pervaiz N, Kaur H, Sharma H, Parsad D, Kumar R. Lenalidomide Augments Differentiation of Cultured Hair Follicle Derived Melanocyte Stem Cells Into Functional Melanocytes. Dermatol Pract Concept. 2023;13(2):e2023077. DOI: https://doi.org/10.5826/dpc.1302a77 Accepted: September 3, 2022; Published: April 2023 Copyright: ©2023 Kumari et al. This is an open-access article distributed under the terms of the Creative Commons Attribution- NonCommercial License (BY-NC-4.0), https://creativecommons.org/licenses/by-nc/4.0/, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original authors and source are credited. Funding: None. Competing interests: None. Authorship: All authors have contributed significantly to this publication. Corresponding author: Ravinder Kumar, Department of Zoology, Panjab University, Chandigarh, India-160014. E-mail: ravinder03@gmail.com/ravinder@pu.ac.in Introduction: Melanocyte progenitors are embryonically derived from the neural crest and subsequently get localized in hair follicles and epidermis to provide hair and skin pigmentation. These progenitor cells in hair follicles repeatedly proliferate and differentiate to maintain pigmentation. Vitiligo, a pig- mentary disorder, is associated with loss of melanocytes. Repigmentation of vitiligo lesions mainly depends upon the proliferation, migration and differentiation of melanocyte stem cells (MelSCs) into functional melanocytes. The current study is designed to check the efficacy of lenalidomide, an imide drug in the differentiation of MelSCs into functional melanocytes. Objectives:The aim of the study is to check the effect of lenalidomide in the proliferation, migration of cultured hair follicle derived melanocyte stem cells and their differentiation into functional melanocytes. Methods: Primary culture of MelSCs was established from whisker hair of C57BL/6 mice. Prolifera- tion and migration of cultured cells were done by MTT assay and Boyden’s chamber migration assay, respectively. Effect of lenalidomide on the MelSCs differentiation was checked at gene level by qPCR and protein expression was checked by immunocytochemistry. Results: A significant increase in the migration of MelSCs in comparison to control was also observed. Lenalidomide treatment significantly increased the expression of melanocyte specific genes in cultured MelSCs as compared to control. Conclusions: From the results we concluded that lenalidomide induce the proliferation and migration of MelSCs and accelerate the differentiation of MelSCs into functional melanocytes. ABSTRACT 2 Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 Introduction Hair follicle melanocyte stem cells (MelSCs) are present in bulge or sub-bulge regions of hair and are important reser- voirs of melanocytes. They persist as self-renewing cells and play a very significant role in the pigmentation of hair and skin [1]. They regenerate mature melanocytes for hair and skin in response to some kind of melanocyte loss under nor- mal conditions and ultimately maintain the pigmentation [2]. The regeneration of functional melanocytes is influenced by activation, proliferation and differentiation of these MelSCs [3]. Loss of functional melanocytes causes skin de- pigmentation and thus leads to depigmentory disorders like vitiligo [4,5]. Vitiligo is an autoimmune cutaneous disorder that has grave psychosocial impact on the patient’s quality of life [6]. The mechanism of melanocyte disappearance in this disease still remains unclear [7]. Several treatment modali- ties are available like the conventional medical, surgical and physical means but none are completely satisfactory. In the depigmented patches there is a loss of functional melanocytes but hair follicle MelSCs are preserved. Therefore this original source of regeneration in the hair follicle bulge is being targeted to repopulates the vitiligo-depigmented epidermis with melanocytes [8]. Various studies have shown that MelSCs in the outer root sheath played important part in the epidermal follicular repigmentation. However the activation, proliferation, migration and differentiation of MelSCs from the outer root sheath of the hair follicle require more novel and effective strategies. Here we aimed at investigating the potential therapeu- tic efficacy of lenalidomide as the possible repigmentation strategy. Lenalidomide is an immunomodulatory drug that has shown a clinical effect in several autoimmune and in- flammatory disorders. Recently, its effect was observed as the hyperpigmentation of skin in black/African-American patients suffering from multiple myeloma [9]. Interestingly, in a case study it also led to progressive hair repigmentation in an old multiple myeloma patient [10]. Pervaiz et al [11] also reported the inhibitory influence of this drug on the pro- gression of depigmented lesions in a vitiligo mouse model. Therefore, the current study was designed to check the role of lenalidomide on the differentiation of murine hair folli- cle derived melanocyte stem cells into pigment producing melanocytes. Objectives The aim of the study is to check the effect of lenalidomide in the proliferation, migration of cultured hair follicle derived melanocyte stem cells and their differentiation into func- tional melanocytes. Methods Ethical Statement The study design was based on the guidelines set by the Institutional Animal Ethics committee, Panjab Univer- sity, Chandigarh, India (Approval No: PU/45/99/CPCSEA/ IAEC/2017/31). C57BL/6 mice were maintained as per the guiding principles of the Committee for the purpose of Con- trol and Supervision of Experiments on Animals (CPCSEA). Reagents The reagents used in the study include Dulbecco’s Modified Eagle Media (Cat. No. BE12-604F), Fetal Bovine Serum (Cat. No. 10270106), and Recombinant Human FGF-Basic pro- tein (Cat. No. PHG0264). The antibodies include Anti-mouse AF488-conjugated CD34 (Cat. No.  sc-7324AF488), PE- conjugated TRP2/ DCT (Cat.No. sc-74439PE), pri- mary anti-mouse tyrosinase (Cat. No. sc-20035) and nestin (Cat. N0  sc-23972) antibody and secondary antibody anti-mouse IgG-FITC (sc-2010), purchased from Santa Cruz Biotechnology. Isolation and Culture of MelSCs MelSCs culture was established from whisker hair cells of C57BL/6 mice at 4 weeks of age. Mice were euthanized and the upper lips containing vibrissae were dissected as described by Gilanchi [12].It was rinsed with betadine and 70% ethanol for 2 minutes and placed in phosphate buffer saline (PBS). Hair follicles were separated from lip pad un- der sterile conditions and were incubated overnight at room temperature in collagenase IV (1mg/ml). After incubation the digested hair follicles were pipetted thoroughly to ob- tain single cell suspension. Afterwards, the cell suspension was centrifuged at 1000 rpm for 5 minutes and the obtained pellet was resuspended in a stem cell specific culture medium which contains 80% KnockOut™ DMEM/F12 medium, 20% KnockOut™ serum replacement, 200 mM L-glutamine, 0.1  mM β-mercaptoethanol, 1% nonessential amino acids and 4 ng/ml basic fibroblast growth factor (bFGF) [13]. Characterization of Cultured Spheres Cultured spheres were characterized for the presence of nestin which is a neural crest marker. Spheres were fixed in chilled paraformaldehyde for 10 minutes and then washed in PBS. Blocking was performed overnight at 4o C with 3% BSA in a humidified chamber. For nestin immunostaining, primary antibody (dilution 1:100) and secondary antibody (dilution 1:200) were used. After antibody incubation PBS washing was done and spheres were then counterstained with DAPI. Spheres were washed again with PBS and exam- ined using confocal microscope. Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 3 Subculturing of Cells From Cultured Spheres Subculturing was done for further propagation of cells. For that, spheres were easily detached by agitating the culture plate. Spheres were then transferred to new culture wells, where they were cultured in media having DMEM, FBS and recombinant human FGF-basic protein [14]. Next day cells started coming out of the sphere and when the cells reached to 80% confluency, they were further subcultured by tryp- sinization method using trypsin-EDTA. Characterization of Cells Obtained From Spheres Cultured cells obtained from the spheres were characterized by nestin, CD34, DCT and TYR immunostaining and DOPA staining. For immunostaining, cells were fixed in chilled paraformaldehyde for 10 minutes and then washed in PBS. Blocking was performed overnight at 4oC with 3% BSA in humidified chamber. Next day, the fixed cells were incubated with fluorochrome conjugated antibodies CD34 and DCT for 3 hours at room temperature (dilution 1:150). For nestin and tyrosinase immunostaining, primary antibody (dilution 1:100) and secondary antibody (dilution 1:200) were used for 3 hours and 2 hours respectively. After PBS washing, cells were then counterstained with DAPI. Cells were washed again with PBS and examined using confocal microscope. For DOPA staining, washing of cultured cells was done with 1X PBS and then fixed with chilled paraformaldehyde for 10 minutes. 10 mM L-DOPA was added to the cells and then incubated at 37o C. Cells were examined hourly under the microscope for 4 hours. Cell Proliferation Assay Cell proliferation was checked by MTT assay by following the modified procedure of Mosmann [15].Cultured MelSCs (5×103) were plated in the 96-well cell culture plate. Lenalid- omide treatment was given to the cells at 2.5 μM and 5 μM concentrations, the untreated cells were considered as con- trol. After 24 hours of lenalidomide treatment, culture media was removed from each well and 100μl of MTT (0.5 mg/ml) solution was added. The cells with MTT (0.5mg/ml) solution were incubated for 4 hours at 37oC till the formation of for- mazan crystals. After incubation 100 μl of DMSO was added to each well and proper dissolution of formazan crystals was done. Optical density was evaluated using microplate spec- trophotometer (EPOCH) at 560 nm. Boyden Chamber Migration Assay Cultured MelSCs were starved for about six hours in serum free culture media. After the starvation period, 3 × 104 cells were plated in serum-free medium (no chemoattractant) in the upper chamber. To the lower chamber, medium with serum for control group and serum plus lenalidomide for treatment groups was added. Cells were kept at 37° C in CO2 incubator for 18 hours. Afterwards, cells were fixed with 4% formaldehyde and stained with 0.5% crystal violet. The inside of each insert was swabbed using cotton swabs. Randomly selected fields were photographed, and the cells that had migrated were counted. In Vitro Treatment of Melscs With Lenalidomide and Its Effect on Differentiation Into Functional Melanocytes Cultured MelSCs were treated with lenalidomide at con- centrations of 2.5 μM and 5 μM for 2 weeks. The media was changed in plate after every 48 hours. After 2 weeks of lenalidomide treatment, its effect on the differentiation of MelSCs into melanocytes was checked at both gene and protein level. Quantitative Real-Time Polymerase Chain Reaction (qPCR) qPCR was performed to analyze the transcriptional gene ex- pression. RNA was isolated using Trizol reagent (Sigma) by following manufacturer’s guidelines. Gel electrophoresis was performed after RNA isolation to assess its quality. Absor- bance at 260 and 280 nm measured on Nano-drop was used to determine the concentration and purity of RNA. cDNA was synthesized from the isolated RNA using iScriptTM c-DNA synthesis kit (BIO-RAD). qPCR was performed us- ing SYBR(R) Green JumpStart (TM) TaqReadyMix (TM) master mix on a real time PCR system (Roche LC480) ac- cording to manufacturer’s guidelines. The forward and re- verse sequences of primers are given in Table 1. The relative levels of mRNA expression were calculated by following the method of Livak and Schmittgen [16], normalized by β-actin. Immunostaining of Differentiated Melanocytes After 14 days of differentiation assay MelSCs cells were checked for melanocyte marker TYR and DCT by immu- nostaining (protocol discussed in characterization of cells obtained from spheres section). The fluorescence was quan- tified using image-J software. Statistical Analysis Statistical analysis was performed by using GraphPad Prism 6 for windows version 6.01 (GraphPad Software, Inc.). Final results were shown as mean with standard deviation (mean ± SD). The data was examined for normality by the Shapiro– Wilk test. Two-tailed Student t test was done to calculate the statistical significance between two groups, whereas One-way analysis of variance (one-way ANOVA) followed by post hoc Tukey test was used to calculate statistical sig- nificance for more than two groups. P-values less than 0.05 4 Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 Effect of Lenalidomide on the Differentiation of MelSCs Into Functional Melanocytes The cultured cells derived from spheres were treated with lenalidomide for 14 days to check its effect on the differenti- ation of MelSCs into functional melanocytes. After 14 days of treatment cell were checked for expression of melanocyte specific genes. qPCR results showed that lenalidomide signifi- cantly enhanced the expression of melanocyte specific genes (DCT, TYRP1, TYR, MITF, SOX10, SOX9) as compared to control. After lenalidomide treatment, the expression of TYR was found higher at 2.5 µM (1.902 ± 0.023 fold) and 5 µM concentrations (3.516 ± 0.269 fold) as compared to control. Similarly, we observed a significant elevation in the expression of TYRP1 (2.543 ± 0.08 fold) and (1.715 ± 0.104 fold), DCT (1.786 ± 0.335 fold) and (3.516 ± 1.353 fold), MITF (1.640 ± 0.080 fold) and (1.498 ± 0.188 fold), SOX9 (2.738 ± 0.129 fold) and (1.166 ± 0.470 fold), and SOX10 (1.077 ± 0.408 fold) and (5.508 ± 2.203 fold) in 2.5 µM and 5 µM concentrations, respectively (Figure 3). Differen- tiation of MelSCs into functional melanocyte was further confirmed by protein expression of melanocyte specific genes TYR and DCT. It was found that lenalidomide treatment significantly increased the protein expression of tyrosinase in treated MelSCs. After 14 days of lenalidomide treatment, number of TYR positive cells were found significantly higher at both 2.5  µM (14.33 times) and 5 µM concentration of lenalidomide (7.33 times) as compared to control. Similarly, we observed a significant elevation in the expression of DCT (1.56 ± 0.1081 fold) and (1.33 ± 0.12 fold) in 2.5 µM and 5 µM concentrations, respectively (Figure 4). Hence, the re- sults from immunocytochemistry also showed that the pro- tein expression of TYR and DCT was significantly higher in lenalidomide treated cells in comparison to control (Figure 4). Conclusions Vitiligo is an autoimmune disease characterized by cutane- ous depigmentation caused by autoimmune-mediated dam- age of melanocytes. Despite continuous research is being (*P  <0.05, **P <0.01, ***P <0.001 and ****P <0.0001) were considered as significant. Results Primary Culture and Characterization of MelSCs MelSCs were cultured from whisker hair cells of C57BL/6mice. On the 5th day of cell plating, some of the cells started aggregating and forming spheres. A well-marked sphere took around 10 to 15 days in formation (Figure 1A). Spheres were characterized for neural crest stem cells marker nestin, and it was found that the cells of the spheres showed positive staining for nestin (Figure 1D). For subcul- turing of MelSCs, spheres were taken out and plated in a new culture plate. The next day, the cells began to migrate out of the spheres gradually (Figure 1B). These cells were than further characterized for specific stem cell marker nestin, CD34, and melanocyte stem cell marker, DCT and melanocyte specific marker TYR. We observed that these sphere- derived cultured cells were nestin (Figure 1E) and DCT (Figure 1G) positive and were negative for CD34 ( Figure 1F) and TYR (Figure 1H). Further, DOPA staining was performed to check the presence of melanocyte contam- ination in MelSCs culture. The results indicated that cells were negative for DOPA, compared to melanocytes taken as positive control (Figure 1C). Effect of Lenalidomide on the Proliferation and Migration of MelSCs Effect of lenalidomide was checked on the proliferation of MelSCs and we found that after 24 hours of treatment, it increased the proliferation of MelSCs at both 2.5 µM and 5µM concentrations in comparison to untreated control, al- though the increase was insignificant (Figure 2,A- and B). Further it significantly enhanced the migration of MelSCs at both concentrations in comparison to control. The percent- age of migrated cells increased by 88% and 95% in 2.5 µM and 5 µM treated wells respectively in comparison to control ( Figure 2, C and D). Table 1. Primers used for qPCR, their Amplicon Length and Annealing Temperature. Gene Forward primer Reverse primer Amplicon length Annealing temperature β-Actin 5’ GAATTGCTATGTGTCTGGGT 3’ 5’ CATCTTCAAACCTCCATGATG 3’ 257bp 58oC TYR 5’ GGGCCCAAATTGTACAGAGA 3’ 5’ ATGGGTGTTGACCCATTGTT 3’ 174bp 58oC TYRP1 5’ AAGTTCAATGGCCAGGTCAG 3’ 5’ TCAGTGAGGAGAGGCTGGTT 3’ 157bp 58oC DCT 5’ AGCAGACGGAACACTGGACT 3’ 5’ GCATCTGTGGAAGGGTTGTT 3’ 180bp 58oC MITF 5’ GGAACAGCAACGAGCTAAGG 3’ 5’ TGATGATCCGATTCACCAGA 3’ 170bp 58oC SOX9 5’ CGACTACGCTGACCATCAGA 3’ 5’ AGACTGGTTGTTCCCAGTGC 3’ 188bp 58oC SOX10 5’ AGCCCAGGTGAAGACAGAGA 3’ 5’ ATAGGGTCCTGAGGGCTGAT 3’ 175bp 58oC Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 5 disorders and has shown therapeutic effects on various au- toimmune or inflammatory diseases. Dasanu et al [10] re- ported the first case of progressive hair repigmentation with the use of this drug in an elderly patient of multiple myeloma. Further they hypothesized that lenalidomide may be capable of stimulating migration and differentiation of melanocytes elucidated, a definitive cure still remains elusive. Therefore, many newer therapeutic options are being explored to im- prove the outcome; immunomodulators being the most re- cent and exciting additions. Lenalidomide is an FDA approved immunomodulatory imide drug which is currently being investigated in various Figure 1. Representative images showing (A) primary culture of melanocyte stem cells at Day 0, Day 5, Day 10 and Day 15, (B) Subculture of MelSCs at 3 hours and Day 1, (C) Dopa staining of melanocyte stem cells and melanocytes (taken as positive control) after 4 hours, (D)  Confocal imaging indicating nestin immunostaining for the characterization of MelSC spheres. Representative images from confocal microscopy showing the characterization of MelSCs by immunostaining with (E) nestin, (F) CD34, (G) DCT, and (H) tyrosinase. 6 Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 B Pe rc en ta ge P ro lif er at io n of M el SC s LEN 2.5 µM LEN 5 µM CONTROL 0 50 100 150 A LEN 2.5 µM LEN 5 µMCONTROL PROLIFERATION OF MELANOCYTE STEM CELLS (24HR) C LEN 2.5 µM LEN 5 µMCONTROL MIGRATION ASSAY OF MELANOCYTE STEM CELLS (18HR) D Pe rc en ta ge m ig ra ti on o f M el SC s LEN 2.5 µM LEN 5 µM CONTROL 0 50 100 250 150 200 Figure 2. (A) Representative pictures of cultured MelSCs. (B) Bar diagram showing the effect of lenalidomide (2.5 µM and 5 µM) on the proliferation of MelSCs as compared to untreated control cells after 24 hours of treatment. (C) Light microscopic images depicting the mi- gration of MelSCs in control, 2.5 µM and 5 µM lenalidomide treated cells at 18 hours. (D) Bar diagram displaying the effect of lenalidomide (2.5 µM and 5 µM) on migration (at 18 hours) of MelSCs as compared to control. Data are presented as mean ± standard deviation; statistical significance is shown by *P < 0.05, **P < 0.01. A Fo ld c ha ng e (D CT e xp re ss io n) LEN 2.5 µM LEN 5 µM CONTROL 0 2 1 3 B Fo ld c ha ng e (T YR P1 e xp re ss io n) LEN 2.5 µM LEN 5 µM CONTROL 0 2 1 3 C Fo ld c ha ng e (T YR e xp re ss io n) LEN 2.5 µM LEN 5 µM CONTROL 0 4 2 6 D Fo ld c ha ng e (M IT F ex pr es si on ) LEN 2.5 µM LEN 5 µM CONTROL 0.0 1.5 1.0 0.5 2.0 E Fo ld c ha ng e (S O X1 0 ex pr es si on ) LEN 2.5 µM LEN 5 µM CONTROL 0 8 6 4 2 10 F Fo ld c ha ng e (S O X9 e xp re ss io n) LEN 2.5 µM LEN 5 µM CONTROL 0 4 NS2 3 1 Figure 3. Bar diagram showing relative mRNA expression of (A) DCT (B) TYRP1 (C) TYR (D) MITF (E) SOX10 and (F) SOX9 in con- trol, 2.5 µM lenalidomide and 5 µM lenalidomide treated MelSCs. The relative level of target gene expression was calculated by Livak and Schmittgen method and normalized with β-actin. Data are presented as mean ± standard deviation; statistical significance is shown by (*P <0.05, **P <0.01, ***P <0.001 and ****P <0.0001). Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 7 for neural crest cell marker, nestin. Nestin-positive neural crest-derived stem cells have the ability to form neurospheres [19,20]. The cultured spheres were later transferred to new culture and cells started migrating out of these spheres and were characterized for the various markers like nestin, CD34, tyrosinase, DCT and DOPA. The results showed that these cells expressed nestin, a marker for neural progenitors that is also expressed by stem cells of the hair follicle bulge [21]. Cultured cells were also positive for DCT, which is a marker of MelSCs in hair matrix [22] but were negative for CD34. CD34 negative neural crest derived melanocyte stem cells to promote repigmentation. Also, in a previous study from our laboratory we have shown that lenalidomide inhibited the vitiligo progression in a vitiligo mouse model  [11]. For the repigmentation of vitiliginous skin, melanocyte reser- voir in the hair follicles must be activated, differentiated and migrated toward depigmented epidermis of vitiliginous skin [17,18]. In this study effect of lenalidomide was directly checked on the cultured hair follicle derived melanocyte stem cells. Cells from the murine whisker hair were isolated and cul- tured. These cells formed spheres and were found positive LEN 2.5 µM LEN 5 µMCONTROL 0.0 0.5 1.0 1.5 2.0 2.5 D Re la ti ve in te ns it y of D CT (f ol d ch an ge ) LEN 2.5 µM LEN 5 µMCONTROL 0 10 20 30 B TY R + CE LL S/ M M 2 Figure 4. Representative images from confocal microscopy showing the effect of lenalidomide at 2.5µM and 5µM concentrations on mela- nocyte differentiation markers (A) TYR and (C) DCT in MelSCs after 14 days of treatment. (B) Bar diagrams depicting the TYR positive cells after lenalidomide (2.5 µM and 5 µM) treatment in MelSCs. (D) Bar diagrams display the relative fold change of DCT in control and lenalido- mide (2.5 µM and 5 µM) treated MelSCs after 14 days of their differentiation. Representative images of both proteins are from 3 independent experiments that were quantified by using ImageJ software. Data are presented as mean ± standard deviation; statistical significance is shown by *P < 0.05, ***P < 0.0001, ****P < 0.0001. 8 Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 Kumar and Council of Scientific and Industrial Research, New Delhi, India (09/135(0735)/2016-EMR-I) to grant fel- lowship to Uma Kumari. References 1. Nishimura EK. Melanocyte stem cells: a melanocyte reservoir in hair follicles for hair and skin pigmentation.  Pigment Cell Melanoma Res. 2011;24(3):401-410. DOI: 10.1111/j.1755 -148X.2011.00855.x. PMID: 21466661. 2. Li H, Fan L, Zhu S, et al. Epilation induces hair and skin pig- mentation through an EDN3/EDNRB-dependent regenerative response of melanocyte stem cells. Sci Rep. 2017;7(1):1-13. DOI: 10.1038/s41598-017-07683-x. PMID: 28779103. PMCID: PMC5544680. 3. Falabella R. Vitiligo and the melanocyte reservoir. Indian J. Der- matol. 2009;54(4):313-318. DOI:  10.4103/0019-5154.57604. PMID: 20101329; PMCID: PMC2807704. 4. Bellono NW, Oancea EV. Ion transport in pigmentation. Arch Biochem. 2014;563:35-41.DOI: 10.1016/j.abb.2014.06.020. PMID: 25034214; PMCID: PMC4497562. 5. Nordlund JJ. The pigmentary system and inflammation. Pigment Cell Res.1992;5(5):362-365.DOI: 10.1111/j.1600-0749.1992. tb00563.x. PMID: 1292021. 6. Lai YC, Yew YW, Kennedy C, et al. Vitiligo and depression: A  systematic review and meta-analysis of observational studies. Br J Dermatol. 2017;177(3):708–718.DOI: 10.1111/bjd.15199. PMID: 27878819. 7. Lotti TM, Berti SF, Hercogova J, et al. Vitiligo: Recent insights and new therapeutic approaches. G Ital Dermatol Venereol. 2012 Dec;147(6):637-647. PMID: 23149710. 8. Goldstein NB, Koster MI, Hoaglin LG, et al. Narrow band ultra- violet B treatment for human vitiligo is associated with prolifer- ation, migration, and differentiation of melanocyte precursors. J Invest Dermatol. 2015;135(8):2068–2076. DOI: 10.1038 /jid.2015.126.PMID: 25822579. PMCID: PMC4683025. 9. Milrod CJ, Blevins F, Hughes D, et al. Incidence of skin hyper- pigmentation in Black patients receiving treatment with immu- nomodulatory drugs.  Blood. 2021;137(21):2987–2989. DOI: 10.1182/blood.2021010853. PMID: 33728443. 10. Dasanu CA, Mitsis D, Alexandrescu DT. Hair repigmentation associated with the use of lenalidomide: graying may not be an irreversible process. J Oncol Pharma Pract. 20119(2):165-169. DOI: 10.1177/1078155212442561. PMID: 22440400. 11. Pervaiz N, Kaur H, Parsad D, et al. Immune‐modulatory effects of lenalidomide inhibited the progression of lesions in a vitil- igo mouse model. Pigment Cell Melanoma Res. 2021;34(5): 918-927.DOI: 10.1111/pcmr.12962. PMID: 33522688. 12. Gilanchi S, Esmaeilzade B, Eidi A, et al. Neuronal differentiation of rat hair follicle stem cells: the involvement of the neuroprotec- tive factor Seladin-1 (DHCR24). Iran Biomed J. 2014;18(3):136. DOI: 10.6091/ibj.1284.2014. PMID: 24842139. PMCID: PMC4048477. 13. Li L, Fukunaga-Kalabis M, Yu H, et al. Human dermal stem cells differentiate into functional epidermal melanocytes. J Cell Sci. 2010;123(Pt 6):853-860.DOI: 10.1242/jcs.061598.PMID: 20159965. PMCID: PMC2831759. 14. Osada A, Iwabuchi T, Kishimoto J, Hamazaki TS, Okochi H. Long-term culture of mouse vibrissal dermal papilla cells and de from hair follicle are primed for melanocyte differentiation [23]. As these sphere derived cells were negative for functional melanocyte marker tyrosinase and DOPA, it confirmed that these cells were not functional melanocytes. Melanocytes are also derived from the neural tube and neural-crest, and then play an important role in pigmentation [24]. For repigmentation process, the most important step is the proliferation and migration of stem cells from hair der- mis to the lesional areas [25]. Recovery from vitiligo is ini- tiated by the subsequent migration of the melanocyte stem cells from the hair matrices to produce melanocytes [26]. Therefore, we checked the effect of lenalidomide in prolif- eration and migration of MelSCs. The results revealed that there was a non-significant rise in the proliferation of lena- lidomide treated MelSCs in comparison to control. On the other hand, very importantly a significant increase in migra- tion of lenalidomide treated MelSCs in comparison to con- trol was observed. The proliferative role of lenalidomide has been earlier reported in the hematopoietic progenitor cells by Verhelle et al [27]. Role of lenalidomide in the differentiation of MelSCs into functional melanocytes was further analyzed. Differ- entiation of MelSCs into functional melanocytes was inves- tigated through gene expression and immunocytochemical studies, which indicated that lenalidomide treatment en- hanced the differentiation of MelSCs into melanocytes con- firmed by their increased expression of TYR, DCT, MITF, SOX10, SOX9 genes. MITF is the master gene that regulates the pigmentation through activation of downstream genes like TYR which ultimately determines pigmentation of skin as well as hair [28,29]. SOX10 is one of the key genes which play its role in coordinating melanocyte differentiation by upregulating expression of genes required for melanogene- sis [30]. TYR initiates the melanogenesis by oxidizing tyro- sine to L-DOPA while DCT is required down the pathway in synthesis of melanin [31,32]. The increased expression of DCT and TYR by lenalidomide treatment was also observed at protein level, which further verified the differentiating ef- fect of lenalidomide in the MelSCs into pigment producing melanocytes. In conclusion, our data indicated that lenalidomide had very encouraging effects on the in vitro differentiation of MelSCs. It enhanced the proliferation and migration of cultured MelSCs. Further, it augmented the differentiation of hair follicle derived MelSCs into functional melanocytes that endorses its therapeu- tic use in the repigmentation process of vitiligo. Acknowledgements We acknowledge the Science and Engineering Research Board, Department of Science and Technology, New Delhi, India for financial support (ECR/2016/000671) to Ravinder Original Article | Dermatol Pract Concept. 2023;13(2):e2023077 9 24. Colombo S, Berlin I, Delmas V, et al. Classical and non- classical melanocytes in vertebrates). Weinheim, Germany: Wiley-Blackwell. 2011:21-61. 25. Qiu W, Yang K, Lei M, et al. SCF/c-kit signaling is required in 12-O-tetradecanoylphorbol-13-acetate-induced migration and differentiation of hair follicle melanocytes for epidermal pig- mentation. Cell Tissue Res. 2015;360(2):333-346.DOI: 10.1007 /s00441-014-2101-8. PMID: 25727244. 26. Cui J, Shen LY, Wang GC. Role of hair follicles in the repigmen- tation of vitiligo. J Invest Dermatol. 1991;97(3):410-416.DOI: 10.1111/1523-1747.ep12480997. PMID: 1714927. 27. Verhelle D, Corral LG, Wong K, et al. Lenalidomide and CC-4047 inhibit the proliferation of malignant B cells while expanding nor- mal CD34+ progenitor cells. Cancer Res. 2007;67(2):746-755. DOI: 10.1158/0008-5472.CAN-06-2317. PMID: 17234786. 28. Kawakami A, Fisher DE. The master role of microphthalmia- associated transcription factor in melanocyte and melanoma biology. Lab Invest.2017;97(6):649-656.DOI:  10.1038/ labinvest.2017.9. PMID: 28263292. 29. Wu M, Chen X, Cui K, Li H, Jiang Y. Pigmentation forma- tion and expression analysis of tyrosinase in Siniperca chuatsi. Fish Physiol Biochem. 2020;46(4):1279-1293. DOI: 10.1007 /s10695-020-00788-7. PMID: 32185567. 30. Wegner M. Secrets to a healthy Sox life: lessons for melano- cytes. Pigment Cell Res. 2005;18(2):74–85.DOI: 10.1111/j.1600 -0749.2005.00218.x. PMID: 15760336. 31. Yasumoto KI, Yokoyama K, Shibata K, Tomita Y, Shibahara S. Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol Cell Biol. 1994;14(12):8058-8070. DOI: 10.1128/mcb.14.12.8058- 8070.1994. PMID: 7969144. PMCID: PMC359344. 32. Bertolotto C, Abbe P, Bille K, et al. Different cis-acting elements are involved in the regulation of TRP1 and TRP2promoter activities bycyclic AMP: pivotal role of M boxes (GTCAT- GTGCT)and of microphthalmia. Mol Cel. Biol. 1998;18(2): 694-702.DOI: 10.1128/MCB.18.2.694. PMID: 9447965. PM- CID: PMC108780. novo hair follicle induction. J Tissue Eng. 2007;13(5):975-982. DOI: 10.1089/ten.2006.0304. PMID: 17341162. 15. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983;65(1-2):55-63.DOI: 10.1016/0022 -1759(83)90303-4. PMID: 6606682. 16. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods.2001;25(4):402-408.DOI: 10.1006/meth.2001.1262. PMID: 11846609. 17. Ortonne JP, Schmitt D, Thivolet J. PUVA-induced repigmentation of vitiligo: scanning electron microscopy of hair follicles. J In- vest Dermatol. 1980;74:40–42.DOI: 10.1006/meth.2001.1262. PMID: 7351492. 18. Buffoli B, Rinaldi F, Labanca M, et al. The human hair: from anatomy to physiology.  Int J Dermatol.  2014;53(3):331–341. DOI: 10.1111/ijd.12362.PMID: 24372228. 19. Zeuner MT, Didenko NN, Humphries D, et al. Isolation and char- acterization of neural crest-derived stem cells from adult ovine palatal tissue.  Front Cell Dev Biol. 2018;6:39.DOI: 10.3389 /fcell.2018.00039.PMID: 29696142. PMCID: PMC5904732. 20. Amoh Y, Li L, Yang M, et al. Nascent blood vessels in the skin arise from nestin-expressing hair follicle cells. Proc Natl Acad Sci USA. 2004;101(36):13291-5.DOI: 10.1073/pnas.0405250101. PMID: 15331785. PMCID: PMC516562. 21. Li L, Mignone J, Yang M, Matic et al. Nestin expression in hair follicle sheath progenitor cells.  ProcNatl Acad Sci USA.2003;100:9958–9961.DOI: 10.1073/pnas.1733025100. PMID: 12904579. PMCID: PMC187900. 22. Osawa M, Egawa G, Mak SS, et al. Molecular characteriza- tion of melanocyte stem cells in their niche. Development. 2005;132(24):5589–5599. DOI: 10.1242/dev.02161.PMID: 16314490. 23. Joshi SS, Tandukar B, Pan L, et al. CD34 defines melanocyte stem cell subpopulations with distinct regenerative proper- ties.  PLoS Genet. 2019;15(4):1008034. DOI: 10.1371/journal .pgen.1008034. PMID: 31017901. PMCID: PMC6481766.