Dermatology: Practical and Conceptual Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 1 The Role of EREG, PTPN1, and SERPINB7 Genes in the Pathogenesis of Psoriasis: May SERPINB7 Be Protective and a Marker of Severity for Psoriasis? Havva Hilal Ayvaz1, Kuyaş Hekimler Öztürk2, Mehmet Ali Seyirci1, Emrah Atay3, Selma Korkmaz1, İjlal Erturan1, Mehmet Yıldırım1 1 Department of Dermatology, Faculty of Medicine, Suleyman Demirel University, Isparta, Turkey 2 Department of Medical Genetics, Faculty of Medicine, Suleyman Demirel University, Isparta, Turkey 3 Public health expertise, Eskişehir Directorate of Health, Eskişehir, Turkey Key words: psoriasis, epiregulin, tyrosine-protein phosphatase non-receptor type 1, serine proteinase inhibitors Citation: Ayvaz HH, Öztürk KH, Seyirci MA, et al. The role of EREG, PTPN1, and SERPINB7 genes in the pathogenesis of psoriasis: May SERPINB7 be protective and a marker of severity for psoriasis? Dermatol Pract Concept. 2023;13(2):e2023085. DOI: https://doi .org/10.5826/dpc.1302a85 Accepted: September 26, 2022; Published: April 2023 Copyright: ©2023 Ayvaz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (BY-NC-4.0), https://creativecommons.org/licenses/by-nc/4.0/, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original authors and source are credited. Funding: None. Competing Interests: None. Authorship: All authors have contributed significantly to this publication. Corresponding Author: Havva Hilal Ayvaz, Çünür Mah SDÜ Dermatology Department, 32260, Isparta, TURKEY. E-mail: drhhilalayvaz@gmail.com, Phone number: +905309505907 Introduction: Psoriasis is a chronic inflammatory dermatological disease with complex pathogenesis in which many immune system cells, including keratinocytes, play a role. Many genes regulate the proliferation of keratinocytes and other immune cells that have essential roles in the pathogenesis of psoriasis. The expressions of EREG, PTPN1, and SERPINB7 genes were shown as upregulated in psoriatic skins in a few studies previously. Objectives: We aimed to evaluate the expressions of these genes in psoriatic lesional skin and com- pared them with non-lesional adjacent skin of the same patients and normal skin of healthy controls. Results: Our results revealed that the expressions of EREG and PTPN1 genes were upregulated, whereas the SERPINB7 gene expression was down regulated in the psoriatic skin of the patients than normal skin of controls. Moreover, the expression level of the SERPINB7 gene was also negatively correlated with the severity of the disease among patients. Conclusions: According to our results, overexpression of EREG and PTPN1 genes, and decreased expression of SERPINB7 gene may lead to the development of psoriasis. ABSTRACT 2 Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 Introduction Psoriasis is an auto-inflammatory dermatological disease with complex pathogenesis, including immunological, bio- chemical, vascular, and neurological changes [1]. The main pathological findings of psoriasis are the hyperproliferation of epidermis, altered keratinocytes, dermal angiogenesis, a dense epidermal and dermal infiltrate consisting of macro- phages, lymphocytes, and neutrophils [2]. Keratinocytes are one of the principal cells playing essential roles in the patho- genesis of psoriasis and, many cytokines and chemokines regulate the proliferation of them. The most important signal for proliferation of keratinocytes comes from the epidermal growth factor (EGF) receptor, and epiregulin (EREG) is a member of the EGF family [3]. Serpin Family B Member 7 (SERPINB7) is a cytoplasmic member of the serine protease inhibitor family that can alter the epithelium of the skin, and also protects keratinocytes from oxidative stress-mediated cellular damage [4]. Protein Tyrosine Phosphatase Non-Receptor Type 1 (PTPN1) is a member of the PTP family that has regulatory effects on Munc18c protein, which interacts with SNARE in adipocytes, insulin signaling pathways, and also immuno- logical processes which may also be related to its role in the pathogenesis of psoriasis [5,6]. Objectives In the literature, the expression of EREG, PTPN1, and SER- PINB7 genes have been evaluated in a few studies, and these genes are claimed to be novel susceptible genes for psoriasis especially related to keratinocytes, adipocytes, other immu- nological cells [2,7-10]. Unlike these studies, we investigated all these genes together, at the tissue level, and in more sam- ples. We also compared the genes expressions between le- sional skin and non-lesional adjacent skin of patients with psoriasis, and normal skin of healthy controls. Methods The present prospective case-control study was performed according to the Declaration of Helsinki guidelines and ap- proved by the Ethics Committee of Suleyman Demirel Med- ical Faculty (decision 11 on 16.01.2020). All participants in the study were provided informed consent. Study Population Twenty-five patients diagnosed with psoriasis clinically and histopathologically, aged over 18 and under 65 years, pre- senting to the dermatology outpatient clinic of Suleyman Demirel Medical Faculty between February 2020 and Janu- ary 2021, were considered for this study. Detailed anamnesis was taken, skin examination was performed, and the pres- ence of arthritis or nail involvement was also examined and noted by the same physician. Psoriasis area and severity in- dex (PASI) scores were calculated, and according to the PASI scores, patients were divided into two subgroups: a mild dis- ease with PASI score ≤ 10, moderate-severe disease with PASI score > 10 [11]. All participants were selected from patients not treated with systemic therapy, including phototherapy, for at least eight weeks before the study entry. Age- and sex-matched 11 healthy volunteers without any systemic inflammatory dis- eases, including cardiovascular and/or neurovascular diseases, inflammatory skin disorders, and regular drug intake for any reason, were also enrolled as the control group. Patients with a history of cardiovascular or cerebrovascular events, active infection, and inflammatory systemic (including diabetes mel- litus [DM]) or skin diseases, other autoimmune diseases, and/ or malignancy in the last 5 years were excluded. Skin samples, 3 mm in size, were collected from 25 pa- tients with psoriasis and 11 healthy controls. The lesional and non-lesional psoriatic skin (each 3 mm in size) were taken from each patient with psoriasis and one skin sample in similar size from healthy controls. These skin tissues were taken into DNAse RNase-free 1.5 ml Eppendorf tubes and stored in the refrigerator at -80˚C. mRNA Extraction and cDNA Synthesis mRNA isolation from tissue samples belonging to the study group was performed with Hybrid-RTM mRNA Isolation Kit (GeneAll Biotechnology) according to the manufac- turer instructions. The concentration and purity of isolated total mRNAs were measured with a Thermo Fisher Nano- DropTM spectrophotometer. WizScript™ cDNA Synthesis Kit (Wizbio) was used to obtain cDNA from the obtained mRNA. Reverse transcription was performed using the Sim- pliAmp Thermal Cycler (Thermo Fisher Scientific) according to the manufacturer instructions. Obtained cDNA samples were stored at -80ºC until real-time (RT)-PCR analysis. Primary Sequences and Quantitation of Genes The sequence used for EREG (Accession No: NM_001432) includes primers as follows. F: GGACAGTGCATCTATCTG- GTGG, R: TTGGTGGACGGTTAAAAAGAAGT, for PTPN1 (Accession No: NM_002827) F: GCAGATCGACAAGTC- CGGG, R: GCCACTCTACATGGGAAGTCAC, for SERPINB7 (Accession No: NM_001040147) F: TAAGCTCATCTGCTG- TAATGGTG, R: GGCAATTTATGGTTTCGCTCTTG, for ACTB (Accession No: NM_001101) F: CATGTACGTTGC- TATCCAGGC R: CTCCTTAATGTCACGCACGAT. Quantitation of the obtained mRNAs was performed with Rotor-Gene Q (Qiagen, Hiden) according to the manu- facturer instructions. mRNAs were analyzed by SYBR green Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 3 method using β-Actin (ACTB as an internal control, house- keeping gene). Cycle threshold (CT) values of mRNAs were determined, and the obtained CT values were normalized to ACTB. The fold change of each mRNA expression was cal- culated using the 2−ΔΔCt equation. Statistical Analysis Data were analyzed using IBM SPSS Statistics 27.0. The de- scriptive values of participants were presented as mean ± standard deviation (SD) (also minimum and maximum val- ues). The categorical variables were presented as frequency and percentage. Chi-Square analysis was used for categorical variables. The distribution characteristics were first exam- ined with the Shapiro Wilk test to analyze continuous vari- ables across groups. Mann Whitney U or Kruskal Wallis test was used for non-parametric distributions according to the number of groups. For analysis of 2 scale/continuous type variables, Spearman correlation analysis was used. P value < 0.05 was accepted as statistically significant for all analyses. Results Twenty-five patients (13 females and 12 males) with a mean age of 39.8 ± 13.72 years and 11 control (6 females and 5 males) subjects with a mean age of 40.6 ± 14.07 years were included in the study. No significant difference was found between the groups regarding mean age and sex (P = 0.866, P = 0.999 respectively). The mean duration of the disease in the patient group was 9.8 years, and the mean PASI score was 13.3 ± 6.1. According to the PASI scores, 12 (48%) patients had mild, and 13 (52%) patients had moderate-severe psori- asis. Furthermore, 13 patients (52%) had nail involvement, 10 (40%) had psoriatic arthritis, and 14 (56%) had a posi- tive family history. Patients and controls had approximately similar body mass index (26.06 kg/m2 versus 26.76 kg/m2) (P  = 0.946). Descriptive features of the participants were given in Table 1. Gene Expression Levels in Tissue Samples In the real time (RT)-PCR analysis, we observed that the EREG gene expression level was significantly upregu- lated in the lesional psoriatic skin tissue compared to the non-lesional psoriatic tissue (FC=1.60, P = 0.010). In ad- dition, a significant down-regulation was demonstrated in the expression levels of the EREG gene in the adjacent non-lesional skin tissue of patients compared to the healthy skin tissue of controls (FC = -1.82, P = 0.001) (Table 2). It was observed that PTPN1 gene expression level was signifi- cantly increased in the lesional tissue compared to healthy control tissue (FC = 2.44, P < 0.001). In addition, no differ- ence was found in the expression levels of the PTPN1 gene in the adjacent non-lesional skin tissue of psoriasis patients compared to the healthy skin tissue of controls (FC = -1.35, P > 0.05) (Table 2). It was observed that the expression level of the SERPINB7 gene was significantly decreased in psoriatic tissue compared to the healthy control tissue (FC = -2.33, P < 0.001). Moreover, no significant difference was seen in the expression levels of the SERPINB7 gene in the adjacent non-lesional skin tissue of psoriasis patients compared to the healthy skin tissue of controls (FC = -9.1, P > 0.05) (Table 2). According to these results, the expres- sion levels of all genes were significantly different between psoriatic skin and healthy control skin (for all P < 0.05) (Figure 1). Table 1. Baseline characteristics of the study groups. Patient group (N = 25) Control group (N = 11) Pa Age, years, mean ± SD 39.8 ± 13.72 40.6 ± 14.07 .866 Sex Female, N (%) Male, N (%) 13 (52%) 12 (48%) 6 (45.5%) 5 (54.5%) .999 BMI, mean ± SD 26.06 ± 4.8 26.19± 3.18 .946 Duration of disease, years, mean ± SD 9.8 ± 9.2 (1-35)b - PASI scores, mean ± SD 13.3 ± 6.1 - Arthritis, N (%) 10 (40%) - Nail involvement, N (%) 13 (52%) - Positive family history, N (%) 14 (56%) - Severity of the disease Mild disease, N (%) Moderate-severe disease, N (%) 12 (48%) 13 (52%) - BMI = body mass index; PASI = psoriasis area and severity index; SD = standard deviation. a P value is significant at the 0.05 level b Minimum and maximum values 4 Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 Table 2. Comparison of the expression of EREG, PTPN1, and SERPINB7 genes between the lesional and non-lesional skins of the psoriatic patients and normal skins of healthy controls. Lesional skin of psoriatic patients Non-lesional skin of psoriatic patients Controls Pa Pb EREG, mean ± SD (min-max) 1.82 ± 0.95 (0.6-4.11) 0.57 ± 0.2 (0.34-1.06) 1.03 ± 0.3 (0.7-1.68) 0.012 AB:<0.001 AC:0.345 BC:0.004 PTPN1, mean ± SD (min-max) 3.76 ± 1.89 (1.26-10.6) 1.18 ± 0.57 (0.24-2.19) 1 ± 0.13 (0.86-1.24) <0.001 AB:<0.001 AC:<0.001 BC:0.999 SERPINB7, mean ± SD (min-max) 2.54 ± 0.61 (1.5-4.14) 4.49 ± 0.42 (3.95-5.31) 4.29 ± 0.32 (3.79-4.72) <0.001 AB:<0.001 AC:<0.001 BC:0.999 A = lesional skin of patients; B = non-lesional skin of patients; C = normal skin of controls; EREG = epiregulin; PTPN1 = tyrosine-protein phosphatase non-receptor type 1; SD = standard deviation; SERPINB7 = serpin family B member 7. a triple comparison of the groups (with Kruskal-Wallis, P < 0.05 is accepted as statistically significant) b pairwise comparison of the groups (Bonferroni correction was used, and P < 0.05 is accepted as statistically significant) NON-LESIONAL ADJACENT SKIN NORMAL SKIN EREG PTPN1 5,00 4,50 4,00 3,50 3,00 2,50 2,00 1,50 1,00 0,50 0,00 -0,50 SERPINB7 LESIONAL SKIN M RN A F O LD C H A N G E Figure 1. Comparison of the expression levels of EREG, PTPN1, SERPINB7 genes between the lesional and non- lesional skins of the psoriatic patients and the normal skin of healthy controls. RT-PCR analysis of the indicated genes in indicated skin tissues was performed. * P < 0.05; ** P < 0.001 EREG = epiregulin; PTPN1 = tyrosine-protein phosphatase non-receptor type 1; SERPINB7 = serpin family B member 7. Furthermore, the decrease of the expression of the SERPINB7 gene was correlated with PASI scores in the pa- tient group (P = 0.038, r = 0.417) (Figure 2). There was no correlation between other genes’ expression levels and PASI scores (Figures 3 and 4). In addition, there were no correlations between the expression levels of the genes and nail involvement, positive family history, and presence of arthritis, either. Conclusions Over the years, as our knowledge of the pathogenesis of pso- riasis has increased considerably, we know that it includes complex, multiple factors covering the genetic factors that only explain about 70% of disease susceptibility [12]. Up to now, many single nucleotide polymorphism microarray and genome-wide association studies have been performed Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 5 P*=0.038 R=0.417 1.00 2.00 3.00 4.00 .0 10.0 20.0 PASI 30.0 40.0 SE RP IN B7 Figure 2. The correlation graph between SERPINB7 gene expression levels and PASI scores *P < 0.05. PASI = psoriasis area and severity index; SERPINB7 = serpin family B member 7. PASI P=0.639 R=0.098 ,0 10,0 20,0 30,0 40,0 PT PN 1 ,00 12,00 10,00 8,00 6,00 4,00 2,00 Figure 3. The correlation graph between PTPN1 gene expression levels and PASI scores (Spearman correlation). PASI = psoriasis area and severity index; PTPN1 = tyrosine-protein phosphatase non-receptor type 1. [13-15]. However, there is still a gap between genetic basis and environmental triggers in pathogenesis. There have been many identified potential susceptibility genes for psoriasis, and this discovery has been continued [8,13-15]. Shirakata et al compared EREG gene expressions of 12 psoriatic skin samples and 10 healthy skin samples [2]. They observed that EREG mRNA was expressed very faintly in the basal layer of the epidermis of normal control skin, whereas it was overexpressed in the spinous layer of the epidermis of the psoriatic skin. Thus, they reported EREG might lead hyperproliferation of epidermis via possible intracellular sig- naling systems such as STAT3 and may have essential for the development of psoriasis-like phenotype. In the same way, Iwata et al reported that the expression of EREG in dermal fibroblasts was significantly upregulated approximately 50 times fold by co-stimulation with IL-17A and TNF-α, and 6 Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 which is an inhibitor of insulin signaling pathway in many studies [6,21-23]. In chronic inflammatory situations such as psoriasis, it was demonstrated that high levels of proin- flammatory cytokines activate p38MAPK, which induces in- sulin receptors, and leads to blockade of differentiation and hyperproliferation of basal keratinocytes. In addition, as a result of the insulin receptor induction, much more insulin was produced than normal. This condition, called hyperin- sulinemia, accelerates lipogenesis with increased production of free fatty acids, though [24]. We know that psoriatic pa- tients have a higher risk of having type 2 DM compared to controls [25]. In addition, as mentioned before, the regula- tory effect of PTPN1 on Munc18c protein affects adipocytes which are also attendant cells to the psoriasis pathogenesis [24]. In our study we excluded the psoriatic patients who also have systemic inflammatory diseases or conditions such as DM and hyperlipidemia, thus we did not evaluate the as- sociation of psoriasis and them at all. However, since the expression of the PTPN1 gene was observed significantly up- regulated in the lesional skin of patients compared to normal skin of controls, there could be an underlying undiagnosed insulin resistance or glucose intolerance conditions or altered lipid metabolism pathways in our patient group enrolled in the study. Besides these, Yin et al evaluated the common genetic factors shared between psoriasis and schizophrenia. Even though they reported that any common variant was not found between two diseases, they claimed that PTPN1 gene may be a novel-susceptible gene for psoriasis which inter- acts with well-known susceptible genes for psoriasis such as NFKBA, STAT3, and TYK2 genes [7]. Similarly, we showed this upregulation of EREG leads to keratinocyte prolifera- tion in vitro [16]. Thus, both study showed that EREG is a vital stimulator of keratinocyte proliferation which is cru- cial feature of immunopathogenesis of psoriasis as well. Al- though we could not show expression levels of the EREG gene according to the layers of the skin, since it is known his- topathologically that the spinous layer is hyperproliferated in psoriasis [17], it might be thought that overexpression of EREG gene seems to be related to this change. Our study supports these notions about EREG gene with the result of overexpressed EREG gene in the lesional skin of psoriatic patients. Furthermore, the non-lesional skin of patients with psoriasis has significantly down-regulated expression of the EREG gene than the healthy skin of controls, which may be caused by the migration of immune cells including fibro- blasts to the inflammation regions in the psoriatic patients. In 2004, Shirasawa et al showed that EREG is expressed not only in keratinocytes but also in tissue-resident macro- phages which are important cells for the immune balance in the skin. They claimed that EREG is physiologically a critical molecule for tight regulation of IL-18 in keratinocytes and proper production of proinflammatory cytokines by macro- phages [18]. IL-18 belongs to IL-1 cytokine family that plays a pathogenetically important role in chronic inflammatory conditions of skin such as psoriasis [19,20]. Therefore, we assume that upregulation of EREG gene causes hyperprolif- eration of keratinocytes and chronic inflammation in psoria- sis via intracellular signaling pathways. Up to now, PTPN1 was shown as associated with dyslip- idemia, insulin resistance, type 2 DM, and obesity via PTP1B PASI P=0.103 R=0.333 ,0 10,0 20,0 30,0 40,0 ER EG ,00 1,00 -1,00 2,00 Figure 4. The correlation graph between EREG gene expression levels and PASI scores (Spearman correlation). EREG = epiregulin; PASI = psoriasis area and severity index. Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 7 with future studies. Even though our study is the only study evaluating SERPINB7 gene in a high number of real patients lesional, non-lesional skins and normal skins of healthy con- trols, these findings need to be proven in further studies. With this study, we demonstrated that balanced function of the EREG gene, decreased function of the PTPN1 gene, and normal function of the SERPINB7 gene play a critical role in preventing the development of psoriasis. We believe that in the future, gene therapies that can even cure diseases will be more important than inhibiting the underlying in- flammatory mechanism in chronic inflammatory diseases. Acknowledgement: This work was supported by scholarship from Turkish Dermatology Association. References 1. Gudjonsson JE, Ding J, Johnston A, et al. Assessment of the psoriatic transcriptome in a large sample: additional regulated genes and comparisons with in vitro models. J Invest Derma- tol. 2010;130(7):1829-1840. DOI: 10.1038/jid.2010.36. PMID: 20220767. PMCID: PMC3128718. 2. Shirakata Y, Kishimoto J, Tokumaru S, et al. Epiregulin, a member of the EGF family, is over-expressed in psoriatic epi- dermis. J Dermatol Sci. 2007;45(1):69-72. DOI: 10.1016/j. jdermsci.2006.08.010. PMID: 16996251. 3. Hashimoto K. Regulation of keratinocyte function by growth factors. J Dermatol Sci. 2000;24 Suppl 1:46-50. DOI: 10.1016/ s0923-1811(00)00141-9. PMID: 11137396. 4. Kubo A, Shiohama A, Sasaki T, et al. Mutations in SERPINB7, encoding a member of the serine protease inhibitor superfam- ily, cause Nagashima-type palmoplantar keratosis. Am J Hum Genet. 2013;93(5):945-956. DOI: 10.1016/j.ajhg.2013.09.015. PMID: 24207119; PMCID: PMC3824127. 5. AlFadhli S, Al-Zufairi AAM, Nizam R, AlSaffar HA, Al-Mutairi N. De-regulation of diabetic regulatory genes in psoriasis: Deci- phering the unsolved riddle. Gene. 2016;593(1):110-116. DOI: 10.1016/j.gene.2016.08.024. PMID: 27530212. 6. Cheyssac C, Lecoeur C, Dechaume A, et al. Analysis of com- mon PTPN1 gene variants in type 2 diabetes, obesity and asso- ciated phenotypes in the French population. BMC Med Genet. 2006;7:44. DOI: 10.1186/1471-2350-7-44. PMID: 16677372. PMCID: PMC1525165. 7. Yin X, Lin Y, Shen C, et al. Integration of expression quantitative trait loci and pleiotropy identifies a novel psoriasis susceptibil- ity gene, PTPN1. J Gene Med. 2017;19(1-2):10.1002/jgm.2939. DOI: 10.1002/jgm.2939. PMID: 27976820. 8. Wang Z, Zheng H, Zhou H, et al. Systematic screening and iden- tification of novel psoriasis-specific genes from the transcriptome of psoriasis-like keratinocytes. Mol Med Rep. 2019;19(3):1529- 1542. DOI: 10.3892/mmr.2018.9782. PMID: 30592269. PM- CID: PMC6390042. 9. Benezeder T, Painsi C, Patra V, et al. Dithranol targets kera- tinocytes, their crosstalk with neutrophils and inhibits the IL-36 inflammatory loop in psoriasis. Elife. 2020;9:e56991. DOI: 10.7554/eLife.56991. PMID: 32484435. PMCID: PMC7266641. significantly upregulated PTPN1 gene expression in the le- sional psoriatic skin than the non-lesional skin of the same patients, and also healthy skin of controls. Moreover, to the best of our knowledge, the present study is the only study evaluating PTPN1 gene expression at the tissue layer. In ad- dition, even though we have yet to learn very little about how the PTPN1 gene causes psoriasis development, upregu- lation of PTPN1 might lead to hyperproliferation of epider- mis via STAT3 like EREG gene, and therefore, upregulated expression of PTPN1 gene has crucial roles in the psoriasis pathogenesis as well. A type of hereditary palmoplantar keratoderma (PPK) with SERPINB7 gene mutations was identified by Kubo et al and, they reported that mutations in the SERPINB7 gene cause alteration in the epithelium of the skin [4]. They also claimed that the normal functioned SERPINB7 gene pro- tects keratinocytes from oxidative stress-mediated cellular damage. Therefore, the most critical roles of SERPINB7 in the pathogenesis of psoriasis are mainly epidermis develop- ment, epithelial cell differentiation, and keratinization [10]. Wang et al showed upregulated expressions of SERPINB7, EREG, NIPAL4, and WFDC12 in the keratinocytes of pso- riatic skin, and they claimed that SERPINB7 and the other 3 genes lead to hyperproliferation and abnormal differ- entiation of keratinocytes in psoriatic epidermis, and also migration of a large number of inflammatory cells into the dermal lesions [8]. Similar to this study, Benezeder et al re- ported after dithranol application SERPINB7 expressions and other immunological mechanisms including T-cell infil- tration were decreased in the psoriatic skin [9]. Contrary to these studies, Zheng reported that SERPINB7 deficiency leads to excessive proliferation and impaired differentiation of keratinocytes, and also excessive production of chemok- ines and antimicrobial peptides via calcium mediated path- ways and, as a result psoriasis develops [10]. Similar to this report, our findings regarding significantly down-regulated expression levels of SERPINB7 in the lesional skin of pso- riatic patients makes us think that SERPINB7 has protec- tive roles for many cells including keratinocytes. Shiba et al reported significant down-regulation of SERPINB7 gene expression in oral squamous cell carcinoma samples than in normal tissue samples which also supports our findings about protective role of SERPINB7 gene [26]. Furthermore, we also found a negative correlation between the severity of the disease and SERPINB7 gene expression levels. Nev- ertheless, the contradictory results about SERPINB7 in the literature may be related to low number of tissue sample or different methods of the studies such as cell culture, mice tissues in vitro. Besides the protective roles of SERPINB7, it also seems to be a marker of disease severity. We also think that SERPINB7 might be showed as a determinant of prog- nosis and response to treatment in patients with psoriasis 8 Original Article | Dermatol Pract Concept. 2023;13(2):e2023085 10. Zheng H. SerpinB7 deficiency contributes to development of psoriasis via Calcium-mediated keratinocyte differentia- tion dysfunction. Cell Death Dis. 2022 21;13(7):635. DOI: 10.1038/s41419-022-05045-8. PMID: 35864103. PMCID: PMC9304369. 11. Langley RG, Ellis CN. Evaluating psoriasis with Psoriasis Area and Severity Index, Psoriasis Global Assessment, and Lattice System Physician’s Global Assessment. J Am Acad Dermatol. 2004;51(4):563-569. DOI: 10.1016/j.jaad.2004.04.012. PMID: 15389191 12. Ogawa K, Okada Y. The current landscape of psoriasis genetics in 2020. J Dermatol Sci. 2020;99(1):2-8. DOI: 10.1016/j.jderm- sci.2020.05.008. PMID: 32536600. 13. Griffiths CE, Barker JN. Pathogenesis and clinical features of psoriasis. Lancet. 2007;370(9583):263-271. DOI: 10.1016/ S0140-6736(07)61128-3. PMID: 17658397. 14. Sagoo GS, Tazi-Ahnini R, Barker JW, et al. Meta-analysis of genome-wide studies of psoriasis susceptibility reveals linkage to chromosomes 6p21 and 4q28-q31 in Caucasian and Chinese Hans population. J Invest Dermatol. 2004;122(6):1401-1405. DOI: 10.1111/j.0022-202X.2004.22607.x. PMID: 15175030. 15. Pastore S, Mascia F, Mariani V, Girolomoni G. The epidermal growth factor receptor system in skin repair and inflammation. J Invest Dermatol. 2008;128(6):1365-1374. DOI: 10.1038/sj. jid.5701184. PMID: 18049451. 16. Iwata H, Haga N, Ujiie H. Possible role of epiregulin from dermal fibroblasts in the keratinocyte hyperprolifera- tion of psoriasis. J Dermatol. 2021;48(9):1433-1438. DOI: 10.1111/1346-8138.16003. PMID: 34128258. 17. Lu Q, Jiang G. Progress in the application of reflectance con- focal microscopy in dermatology. Postepy Dermatol Alergol. 2021;38(5):709-715. DOI: 10.5114/ada.2021.110077. PMID: 34849113; PMCID: PMC8610039. 18. Shirasawa S, Sugiyama S, Baba I, et al. Dermatitis due to epireg- ulin deficiency and a critical role of epiregulin in immune-related responses of keratinocyte and macrophage. Proc Natl Acad Sci USA. 2004;101(38):13921-13926. DOI: 10.1073/ pnas.0404217101 PMID: 15365177. PMCID: PMC518854. 19. Wittmann M, Macdonald A, Renne J. IL-18 and skin inflam- mation. Autoimmun Rev. 2009;9(1):45-48. DOI: 10.1016/j.au- trev.2009.03.003. PMID: 19285156. 20. Sedimbi SK, Hagglof T, Karlsson MC. IL-18 in inflammatory and autoimmune disease. Cell Mol Life Sci. 2013; 70:4795–4808. DOI: 10.1007/s00018-013-1425-y. PMID: 23892891. 21. Combs AP. Recent advances in the discovery of competitive pro- tein tyrosine phosphatase 1B inhibitors for the treatment of dia- betes, obesity, and cancer. J Med Chem. 2010;53(6):2333-2344. DOI. 10.1021/jm901090b. PMID: 20000419. 22. Kipfer-Coudreau S, Eberlé D, Sahbatou M, et al. Single nucle- otide polymorphisms of protein tyrosine phosphatase 1B gene are associated with obesity in morbidly obese French subjects. Diabetologia. 2004;47(7):1278-1284. DOI: 10.1007/s00125- 004-1432-5. PMID: 15235769. 23. Bento JL, Palmer ND, Mychaleckyj JC, et al. Association of pro- tein tyrosine phosphatase 1B gene polymorphisms with type 2 diabetes. Diabetes. 2004;53(11):3007-3012. DOI: 10.2337/dia- betes.53.11.3007. PMID: 15504984. 24. Buerger C, Richter B, Woth K, et al. Interleukin-1β interferes with epidermal homeostasis through induction of insulin resis- tance: implications for psoriasis pathogenesis. J Invest Dermatol. 2012;132(9):2206-2214. DOI: 10.1038/jid.2012.123. PMID: 22513786. 25. Holm JG, Thomsen SF. Type 2 diabetes and psoriasis: links and risks. Psoriasis (Auckl). 2019;9:1-6. DOI: 10.2147/PTT. S159163. PMID: 30697518. PMCID: PMC6340647. 26. Shiiba M, Nomura H, Shinozuka K, et al. Down-regulated ex- pression of SERPIN genes located on chromosome 18q21 in oral squamous cell carcinomas. Oncol Rep. 2010;24(1):241-249. DOI: 10.3892/or_00000852. PMID: 20514468.