id	author	title	date	pages	extension	mime	words	sentence	flesch	summary	cache	txt
dti-1354	Vudriko, Patrick; Masatani, Tatsunori; Cao, Shinuo; Terkawi, Mohamad Alla; Kamyingkird, Ketsarin; Mousa, Ahmed A.; Moumouni, Paul F. Adjou; Nishikawa, Yoshifumi; Xuan, Xuenan	Molecular and Kinetic Characterization of Babesia microti Gray Strain Lactate Dehydrogenase as a Potential Drug Target	2014	8	.pdf	application/pdf	4760	312	55	This was carried out using B. microti Gray strain-infected hamster blood smears (day 8 post-infection) as previously described.21 The secondary antibody was anti-mouse Alexa-488 secondary diluted 200 times with 4% fetal bovine serum (FBS), and the http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 33Drug TargeT InsIghTs 2014:8 parasite nucleus was stained with propidium iodide. The purified genomic DNA of human isolate of B. microti Gray strain (US type, culture collection catalog No. 30221) was used as template.21 Oligo nucleotide prim- ers with BamHI restriction site at the forward (5′-CCTCG- GATCCCATTCGTTAAAAGAAGA ATTTC-3′) and XhoI site at the reverse (5′-GGGGCTCGAGTTATAGTTG- GATATCTTTCTGTG-3′) were designed from B. microti strain R1 LDH gene sequence obtained from GenBank (Accession No.	cache/dti-1354.pdf	txt/dti-1354.txt