[{"id": "dti-1294", "words": "4158", "extension": ".pdf", "flesch": "58", "author": "Pan, Xing Qing; Jones, Susie; Cox, Karen", "title": "The Way that PEGyl-DSPC Liposomal Doxorubicin Particles Penetrate into Solid Tumor Tissue", "date": "2006", "keywords": "blood; cells; doxorubicin; drug; liposomal; liposome; particles; tissue; tumor", "summary": "Actually, since we do not know the exact way from which liposomal particles getting into solid tumor tissue, and also the fortune of those liposomal particles after they got inside the solid tumor tissue. It is agreeable, the amount of liposomal particles can penetrate into solid tumor tissue is determined by the hole size and number of the blood vessels, but not deter- mined by the targeting group which located on the liposomal particle surface.", "mime": "application/pdf"}, {"id": "dti-1295", "words": "3042", "extension": ".pdf", "flesch": "61", "author": "Stief, Thomas W.", "title": "Inhibition of Intrinsic Thrombin Generation", "date": "2006", "keywords": "arginine; inca; min; plasma; thrombin", "summary": "There are several clinically used inhibitors of intrinsic thrombin generation. The effi ciency of any anticoagulant on intrinsic thrombin generation should be measured for each individual patient.", "mime": "application/pdf"}, {"id": "dti-1296", "words": "9090", "extension": ".pdf", "flesch": "62", "author": "Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko", "title": "Modification of Monoaminergic Activity by MAO Inhibitors Influences Methamphetamine Actions", "date": "2006", "keywords": "amphetamine; clorgyline; dopamine; et al; inhibitors; kitanaka; mao; meth; methamphetamine; mice; monoamine; pharmacol; selegiline", "summary": "However, treatment of rats with 10 mg/kg of pargyline increases locomotor activity per se (Table 1; Barbelivien et al. 2001); this effect might be interpreted by evidence that MAO-A inhibition by clorgyline (and probably by pargyline at high doses) increases extracellular dopamine concen- tration in the nucleus accumbens (Segal et al. 1992). Ito et al. 2000; Itzhak and Ali 2002; Kitanaka et al. 2003, 2005b; Okabe and Murphy, 2004).", "mime": "application/pdf"}, {"id": "dti-1297", "words": "2776", "extension": ".pdf", "flesch": "58", "author": "Taupin, Philippe", "title": "Neurogenesis and Alzheimer's Disease", "date": "2006", "keywords": "adult; brain; cells; et al; neurogenesis", "summary": "These results show that drugs used to treat AD increase neurogenesis in the adult brain, which may contribute to their therapeutic effects (Jin et al. 2006). Researchers have aimed to investigate whether neuro- genesis may contribute to the therapeutic effects of drugs used to treat other neurological diseases and disorders, particularly AD (Jin et al. 2006).", "mime": "application/pdf"}, {"id": "dti-1298", "words": "3871", "extension": ".pdf", "flesch": "52", "author": "Taupin, Philippe", "title": "Neurogenesis and the Effect of Antidepressants", "date": "2006", "keywords": "adult; antidepressants; brain; cells; depression; effects; et al; hippocampus; neurogenesis", "summary": "In press. Czeh, B., Michaelis, T. and Watanabe, T. et al. 2001. On the one hand, antidepressant treatments increase the level of expression of BDNF in the patents\u2019 brain, and BDNF has an antidepressant effect (Siuciak et al. 1997; Chen et al. 2001; Saarelainen et al. 2003).", "mime": "application/pdf"}, {"id": "dti-1299", "words": "3830", "extension": ".pdf", "flesch": "61", "author": "Di Iorio, Biagio R.; Guastaferro, Pasquale; Cillo, Nicola; Cucciniello, Emanuele; Bellizzi, Vincenzo", "title": "Long-term L-Carnitine Administration reduces Erythropoietin Resistance in Chronic Hemodialysis Patients with Thalassemia Minor", "date": "2007", "keywords": "administration; anemia; carnitine; dialysis; epo; erythropoietin; hemodialysis; patients; thal", "summary": "Introduction Anemia is very common in chronic dialysis patients and it is related to relative erythropoietin defi ciency, to blood losses from both gastrointestinal tract and dialysis fi lter or lines, and to blood drawings for laboratory tests (1\u20134). Discussion There are compelling indicators of carnitine defi - ciency in chronic dialysis patients as a result of low dietary intakes and increased losses during the Table 1.", "mime": "application/pdf"}, {"id": "dti-1300", "words": "7880", "extension": ".pdf", "flesch": "60", "author": "Guterres, S\u00edlvia S.; Alves, Marta P.; Pohlmann, Adriana R.", "title": "Polymeric Nanoparticles, Nanospheres and Nanocapsules, for Cutaneous Applications", "date": "2007", "keywords": "chemical; control; corneum; drug; et al; formulations; int; j. pharm; m\u00fcller; nanocapsules; nanoparticles; omc; penetration; pharm; release; skin; stratum; systems", "summary": "From a general point of view, those methods are based on in situ polymerization or precipitation of pre-formed polymers (Fessi et al. 1989; Soppimath et al. 2001; Couvreur et al. 2002, Schaffazick et al. 2003; Sinha et al. 2004). Preparation of polymeric nanoparticles by a) polymerization in emulsion, b) interfacial polymerization, c) nanoprecipitation or interfacial deposition of pre-formed polymers, and d) emulsifi cation-diffusion. 152 Guterres et al Drug Target Insights 2007: 2 Formulating polymeric nanoparticles for cutaneous applications Up to now, the nanoprecipitation method is the most commonly used to formulate polymeric nanoparticles intended for cutaneous applications (Alverez-Rom\u00e1n et al. 2001; Lboutounne et al. 2002; Mil\u00e3o et al. 2003; Alvarez-Rom\u00e1n et al. 2004b; Jim\u00e9nez et al. 2004a; Jim\u00e9nez et al. 2004b; Lboutounne et al. 2004; Shim et al. 2004; Kim et al. 2006).", "mime": "application/pdf"}, {"id": "dti-1301", "words": "8043", "extension": ".pdf", "flesch": "55", "author": "Hamman, J.H.; Demana, P.H.; Olivier, E.I.", "title": "Targeting Receptors, Transporters and Site of Absorption to Improve Oral Drug Delivery", "date": "2007", "keywords": "absorption; acid; cell; delivery; drug; drug delivery; endocytosis; et al; intestine; membrane; peptide; receptor; systems; target; tract; transferrin; transporters; vitamin", "summary": "Targeted drug delivery via transferring receptor-mediated endocytosis pathway. Keywords: Oral drug delivery, absorption enhancement, receptor-mediated endocytosis, active transporters, site-specifi c drug delivery.", "mime": "application/pdf"}, {"id": "dti-1302", "words": "8409", "extension": ".pdf", "flesch": "62", "author": "Hamre, Harald J.; Glockmann, Anja; Fischer, Michael; Riley, David S.; Baars, Erik; Kiene, Helmut", "title": "Use and Safety of Anthroposophic Medications for Acute Respiratory and Ear Infections: A Prospective Cohort Study", "date": "2007", "keywords": "adr; aes; amed; medication; patients; relationship; safety; study", "summary": "In gr ed ie nt s M an uf ac tu re r N % N % P la nt ag o B ro nc hi al B al m 10 0 g co nt ai ns : C am ph or a 2 g, C er a fl a va 1 5 g, D ro se ra ro tu nd ifo lia / W al a 11 7 16 .4 % 19 45 3. 0% in te rm ed ia /a ng lic a e pl an ta to ta fe rm . This ADR has not been reported to the manu- facturer previously, but has been observed repeatedly in other patients by the boy\u2019s physician.", "mime": "application/pdf"}, {"id": "dti-1304", "words": "6621", "extension": ".pdf", "flesch": "50", "author": "Kameda, Hideto; Suzuki, Miyuki; Takeuchi, Tsutomu", "title": "Platelet-Derived Growth Factor as a Therapeutic Target for Systemic Autoimmune Diseases", "date": "2007", "keywords": "arthritis; brosis; cells; diseases; et al; factor; growth; imatinib; inhibition; kameda; patients; pdgf; rheumatoid; treatment", "summary": "Daniel et al. proved that imatinib dramatically reduced hydroxyproline content and prevented 243 PDGF as a target for systemic autoimmune diseases Drug Target Insights 2007:2 histopathologic changes in bleomycin-treated lungs of 129tsvems mice Johnson, R.J., Raines, E.W., Floege, J. et al. 1992.", "mime": "application/pdf"}, {"id": "dti-1305", "words": "11377", "extension": ".pdf", "flesch": "56", "author": "Khan, M. Omar F.", "title": "Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design", "date": "2007", "keywords": "activity; agents; chem; compounds; cruzi; design; drug; enzyme; et al; fairlamb; inhibition; inhibitors; khan; med; potent; reductase; site; structure; substrate; target; trypanosoma; trypanothione; trypanothione reductase", "summary": "In Palfreyman, McCann Lovenberg, et al. ed. DNA topoisomerase I could also serve as an intracellular target, as its inhibi- tion can cause DNA-cleavage and ultimate death of trypanosomes (Bodley et al. 1995).", "mime": "application/pdf"}, {"id": "dti-1306", "words": "8017", "extension": ".pdf", "flesch": "50", "author": "N.S, Ningaraj; B.P, Salimath; U.T, Sankpal; R, Perera; T, Vats", "title": "Targeted Brain Tumor Treatment-Current Perspectives", "date": "2007", "keywords": "brain; brain tumor; cancer; cells; delivery; dna; drug; et al; expression; gene; glioma; growth; inhibitors; molecular; ningaraj; patients; res; target; therapy; treatment; tumor", "summary": "that breach or circumvent BBB and directly target brain tumor cells (Ningaraj, 2006) The potential of anti-angiogenic therapy in human brain tumors is demonstrated in experimental brain tumor models.", "mime": "application/pdf"}, {"id": "dti-1307", "words": "7255", "extension": ".pdf", "flesch": "55", "author": "Ohlsson, Bodil; Janciauskiene, Sabina", "title": "New Insights into the Understanding of Gastrointestinal Dysmotility", "date": "2007", "keywords": "bowel; cells; disease; enteric; et al; gnrh; gut; hormone; human; intestinal; motility; neurons; ohlsson; oxytocin; patients; receptor; role; system; tract", "summary": "This effect persisted when the treatment was con- tinued for up to 6\u201312 months (Mathias et al. 1994b; Palomba et al. 2005). In addition, the GnRH receptor has been found in the epithelium of gastric pits (Huang et al. 2001) and GnRH receptor mRNA in the myenteric neurons in the rat (Ho et al. 1996).", "mime": "application/pdf"}, {"id": "dti-1308", "words": "4512", "extension": ".pdf", "flesch": "60", "author": "Okubo, Yasunori; Kusumoto, Kenji; Bessho, Kazuhisa", "title": "Accelerators of Osteogenesis by Recombinant Human Bone Morphogenetic Protein-2", "date": "2007", "keywords": "activity; bone; group; hbo; implantation; rhbmp-2", "summary": "In the control group, trabecular bone tissue was observed at the outer edge of the implanted material. Experimental studies on bone inducing activity of composites of atelopeptide type I collagen as a carrier for ectopic osteoinduction by rhBMP-2.", "mime": "application/pdf"}, {"id": "dti-1309", "words": "11329", "extension": ".pdf", "flesch": "61", "author": "Panossian, Alexander; Hambardzumyan, Marina; Hovhanissyan, Areg; Wikman, Georg", "title": "The Adaptogens Rhodiola and Schizandra Modify the Response to Immobilization Stress in Rabbits by Suppressing the Increase of Phosphorylated Stress-activated Protein Kinase, Nitric Oxide and Cortisol", "date": "2007", "keywords": "adaptogens; animals; blood; cortisol; drug; e >; effects; et al; jnk; levels; panossian; rosea; sapk; stress; study", "summary": "Ohkura, Y., Mizoguchi, Y. and Morisawa, S. et al. 1990. Furthermore, psycho- logical and/or physiological stress causes NO release in, and may modulate stress-induced activa- tion of, the HPA axis and the sympatho-adrenal medullary system (Kishimoto et al. 1996).", "mime": "application/pdf"}, {"id": "dti-1310", "words": "5379", "extension": ".pdf", "flesch": "48", "author": "Konstantinopoulos, Angelis; Giannitsas, Konstantinos; Raptis, Spiros; Perimenis, Petros", "title": "Endothelial Dysfunction, Erectile Dysfunction and Phosphodiesterase 5 Inhibitors. An Update of the Current Data and Future Perspectives", "date": "2007", "keywords": "artery; cells; cgmp; disease; dysfunction; endothelial; erectile; et al; heart; muscle; sildenafi; vascular", "summary": "Abstract: Endothelial dysfunction is a pathological entity that multiply affects the health status. Erectile dysfunction is being recognized as a condition that is strongly interrelated with endothelial dysfunction, being a vascular event itself.", "mime": "application/pdf"}, {"id": "dti-1311", "words": "7290", "extension": ".pdf", "flesch": "60", "author": "Abdel-Salam, Omar M.E.", "title": "Modulation of Visceral Nociception, Inflammation and Gastric Mucosal Injury by Cinnarizine", "date": "2007", "keywords": "antagonist; antinociception; cinnarizine; control; dopamine; drug; effect; et al; i.p; mice; receptor", "summary": "Cinnarizine (1.25\u201320 mg/kg, s.c.) inhibited visceral pain evoked by i.p. acetic acid injection in mice. Cinnarizine (1.25\u201320 mg/kg, s.c.) caused dose-dependent inhibition of the abdominal constrictions evoked by i.p. injection of acetic acid by 38.7\u201399.4%.", "mime": "application/pdf"}, {"id": "dti-1312", "words": "6894", "extension": ".pdf", "flesch": "57", "author": "Salam, Omar M.E. Abdel; Sleem, Amany A.; Omara, Enayat A.; Hassan, Nabila S.", "title": "Effect of Ribavirin Alone or Combined with Silymarin on Carbon Tetrachloride Induced Hepatic Damage in Rats", "date": "2007", "keywords": "ccl4; et al; hepatic; hepatitis; liver; patients; pcna; rats; ribavirin; serum; silymarin", "summary": "A photomicrograph from a section of rat liver given CCl4 with ribavirin at 90 mg/kg, showing moderate improvement in protein content in liver cells (Bromophenol blue reaction \u00d7 300). A photomicrograph from a section of control rat liver showing normal hepatic architecture: central vein with radiating cords of liver cells, the hepatocytes had vesicular nuclei and granular cytopolasm and blood sinusoids were evident between the cords of hepatocytes (H\u00d7 & \u0395\u00d7 300).", "mime": "application/pdf"}, {"id": "dti-1313", "words": "4613", "extension": ".pdf", "flesch": "53", "author": "Nishida, Seiichiro; Satoh, Hiroyasu", "title": "Cardiovascular Pharmacology of Sinomenine: The Mechanical and Electropharmacological Actions", "date": "2007", "keywords": "actions; acutum; ca2; modulation; satoh; sinomenine", "summary": "Pharmacology of sinomenine, an anti-rheumatic alka- loids from sinomenine acutum. Its main constituent of Sinomenine acutum is sinomenine, which has also used for clinical treatment of Rheumatoid arthritis (RA), due to the anti-infl ammatory and immunomodulative actions (Yamasaki, 1976; Liu et al. 1996).", "mime": "application/pdf"}, {"id": "dti-1314", "words": "6224", "extension": ".pdf", "flesch": "63", "author": "Savaraj, Niramol; Wu, Chunjing; Kuo, Marcus Tien; You, Min; Wangpaichitr, Medhi; Robles, Carlos; Spector, Seth; Feun, Lynn", "title": "The Relationship of Arginine Deprivation, Argininosuccinate Synthetase and Cell Death in Melanoma", "date": "2007", "keywords": "a2058; adi; arginine; ass; cell; et al; expression; lane; lines; media; melanoma; peg20", "summary": "Our study indicates that ASS expression in melanoma cells is complex and governed by bio- chemical parameters which are different among melanoma cells. It is not yet clear why transfection with ASS cDNA in melanoma cells did not yield high levels of ASS expression and we are unable to generate stable transfected cell line(s).", "mime": "application/pdf"}, {"id": "dti-1317", "words": "7188", "extension": ".pdf", "flesch": "63", "author": "Stief, Thomas W.", "title": "Phospholipase A2 Activates Hemostasis", "date": "2007", "keywords": "activity; binding; cells; csa; cyclophilin; cypa; cypb; et al; genome; hcv; human; protein; replication; rna; virus", "summary": "Ozaki, K., Fujiwara, T., Kawai, A., Shimizu, F., Takami, S., Okuno, S., Takeda, S., Shimada, Y., Nagata, M. and Watanabe, T. et al. 1996. Luo, C., Luo, H., Zheng, S., Gui, C., Yue, L., Yu, C., Sun, T., He, P., Chen, J., Shen, J. et al. 2004.", "mime": "application/pdf"}, {"id": "dti-1318", "words": "19654", "extension": ".pdf", "flesch": "60", "author": "Wapling, Johanna; Srivastava, Seema; Shehu-Xhilaga, Miranda; Tachedjian, Gilda", "title": "Targeting Human Immunodeficiency Virus Type 1 Assembly, Maturation and Budding", "date": "2007", "keywords": "2004; acid; activity; assembly; biol; cell; ciency; ciency virus; dimerization; domain; drug; et al; gag; hiv-1; host; human; immunodefi; inhibition; inhibitors; maturation; particle; peptide; pol; processing; protease; protein; replication; reverse; targeting; transcriptase; type; virol; virus; virus type; vpu", "summary": "This binding creates two main pockets: the \u201cA-P\u201d pocket through contact of amino acids 7\u201310 and the \u201cP\u201d pocket through the binding of amino acids 9\u201310 of the peptide (Pornillos et al. 175 Targeting the late stages of HIV-1 replication Drug Target Insights 2007: 2 2002a; Pornillos et al. 2002b). INI1 mutants that abrogate interaction with IN or cells defi cient in INI1 exhibit a substantial reduction in viral produc- tion (Yung et al. 2001).", "mime": "application/pdf"}, {"id": "dti-1319", "words": "10916", "extension": ".pdf", "flesch": "57", "author": "R.R, Resende; H.A.M, Torres; K.K, Yuahasi; P, Majumder; H, Ulrich", "title": "Delivery Systems for In Vivo Use of Nucleic Acid Drugs", "date": "2007", "keywords": "activity; aptamer; binding; cancer; cells; delivery; dna; drug; et al; expression; gene; human; interference; interfering; molecules; mrna; protein; rna; rnai; sci; silencing; sirna; specifi; target; ulrich; ulrich et; vivo", "summary": "In many cases 2\u2032-F-modifi ed pyrimidines are employed in the in vitro transcription reaction to improve nuclease-resistance of generated RNA molecules (reviewed by Ulrich et al. 2004). The anti-TAR RNA aptamer (Ducong\u00e9 and Toulm\u00e9, 1999) was optimized by chemical modi- fi cations towards improved stability regarding nuclease resistance and decreased trans-activation of transcription in cell nuclei extract assays (Darfeuille et al. 2002a; Darfeuille et al. 2002b; Darfeuille et al. 2004; Kolb et al. 2005; Toulm\u00e9 et al. 2001).", "mime": "application/pdf"}, {"id": "dti-1320", "words": "4469", "extension": ".pdf", "flesch": "58", "author": "Nysoeter, Gunnar; Erichsen, Kari; Milde, Anne Marita; Col\u00e1s, Eva; Kristoffersen, Einar; Berstad, Arnold", "title": "Effect of live Salmonella Ty21a in Dextran Sulfate Sodium-induced Colitis", "date": "2007", "keywords": "animals; colitis; disease; dss; group; infl; rats; salmonella; study; ty21a; vaccine", "summary": "For further information go to: http://creativecommons.org/licenses/by/3.0/. Effect of live Salmonella Ty21a in Dextran Sulfate Sodium-induced Colitis Gunnar Nys\u0153ter1, Kari Erichsen2, Anne Marita Milde3, Eva Col\u00e1s4, Einar Kristoffersen5 and Arnold Berstad6 1Department of Medicine, Section for Gastroenterology, 2Children\u2019s Clinic, 3Department of Biological and Medical Psychology, 4Innovest,5Section for Microbiology and Immunology, Haukeland University Hospital, Bergen, Norway, 6Institute of Medicine, University of Bergen, Norway. Control Ty21a DSS DSS \u2212 Ty21a 0 1 2 3 4 Control Ty21a DSS DSS + Ty21a 0 1 2 3 P > 0.05 P > 0.05 C ry pt s co re In fla m m at or y sc or e 227 Effect of Salmonella Ty21a on experimental colitis Drug Target Insights 2007:2 vaccination with Salmonella Ty21a in humans with IBD is safe.", "mime": "application/pdf"}, {"id": "dti-1321", "words": "6501", "extension": ".pdf", "flesch": "56", "author": "Erkut, Bilgehan; \u00d6zyaz\u0131c\u0131o\u011flu, Ahmet; Karapolat, Bekir Sami; Ko\u00e7o\u011fullar\u0131, Cevdet U\u011fur; Keles, Sait; Ate\u015f, Azman; Gundogdu, Cemal; Kocak, Hikmet", "title": "Effects of Ascorbic Acid, Alpha-Tocopherol and Allopurinol on Ischemia-Reperfusion Injury in Rabbit Skeletal Muscle: An Experimental Study", "date": "2007", "keywords": "acide; allopurinol; antioxidant; ascorbic; group; injury; ischemia; levels; muscle; reperfusion; reperfusion injury; study; tissue; tocopherol; treatment", "summary": "Recently advances in the understanding of reperfusion injury and the pharmacology of 254 Erkut et al Drug Target Insights 2007:2 antioxidants have made the interruption of reperfusion injury clinically promising and FR mediated tissue injury can be limited by the use of antioxidant therapy and several studies have sug- gested a positive role for antioxidant therapy in skeletal muscle reperfusion injury (36,37). The aim of the present study was to determine and evaluate the effects of ascorbic acide, alpha-tocopherol and allopurinol on ischemia reperfusion injury in rabbit skeletal muscle.", "mime": "application/pdf"}, {"id": "dti-1322", "words": "4816", "extension": ".pdf", "flesch": "56", "author": "Chiang, Thomas M.; Woo-Rasberry, V.", "title": "The Toxicity of a Chemically Synthesized Peptide Derived from Non-Integrin Platelet Collagen Receptors", "date": "2008", "keywords": "aggregation; cells; chyb; collagen; effect; iii; peptide; platelet; rat; type", "summary": "cHyB inhibits type I collagen-induced platelet aggregation. Development of an inhibitor(s) from platelet collagen receptors to inhibit the collagen- induced platelet activation and aggregation will prevent the risk of thrombosis.", "mime": "application/pdf"}, {"id": "dti-1323", "words": "7241", "extension": ".pdf", "flesch": "55", "author": "Debouzy, Jean-Claude; Crouzier, David; Lefebvre, Bertrand; Dabouis, Vincent", "title": "Study of Alkylglycerol Containing Shark Liver Oil: A Physico Chemical Support for Biological Effect", "date": "2008", "keywords": "dmpc; esr; figure; membrane; nmr; oil; properties; slo; spectrum; spin; temperature; water", "summary": "SLO antioxidant properties are also of interest: hence, vitamin E is routinely used as adjuvant agent in radiotherapy, used for its antiradical properties in the prevention of radio induced fi brosis [29]. Superfi cial tension (dG-G\u00b0, mN/m), 298 K as a function of SLO concentration (mg/mL) (\u2022), and percentage of haemolysis fol- lowing the concentration of SLO (\u2022 ).", "mime": "application/pdf"}, {"id": "dti-1324", "words": "3490", "extension": ".pdf", "flesch": "53", "author": "Nys\u00e6ter, Gunnar; Berstad, Arnold", "title": "Live Typhoid Vaccine for IBD-Patients\u2013-Well Tolerated and with Possible Therapeutic Effect", "date": "2008", "keywords": "colitis; disease; effect; ibd; infl; patients; symptoms; typhoid; vaccine", "summary": "After this she has continued to take oral typhoid vaccine about once a year for the last 9 years, being convinced of the vaccine\u2019s positive effect on her ulcerative colitis. The symptomatic and endoscopic improvements were not dramatic, but encouraging enough to warrant further studies on the potential therapeutic effect of live typhoid vaccine on patients with IBD.", "mime": "application/pdf"}, {"id": "dti-1325", "words": "6525", "extension": ".pdf", "flesch": "60", "author": "Woo-Rasberry, Virginia; Chiang, Thomas M.", "title": "The Beta3 499\u2013513 Peptide Region is Required for AlphaIIb/Beta3 Active Complex Formation and Fibrinogen Binding", "date": "2008", "keywords": "binding; brinogen; cells; complex; peptide; type; \u03b1iib", "summary": "Line 2, Cells of wild type \u03b1IIb with \u03b23-mut cDNAs Lane 3, Cells of wild type \u03b1IIb cDNA and \u03b23 cDNAs. 73 The beta3 499\u2013513 peptide region is required for alphaIIb/beta3 active complex Drug Target Insights 2008:3 Figure 4. In order to study the effects of P4 (wild type \u03b23) on the formation of active \u03b1IIb/\u03b23, we have engineered a construct containing the scrambled sequence of the active peptide (P4s) in \u03b23 cDNA.", "mime": "application/pdf"}, {"id": "dti-1326", "words": "2384", "extension": ".pdf", "flesch": "54", "author": "Fernandez, Hubert H.; McCown, Katie M.; Romrell, Janet; Trieschmann, Martha E.; Friedman, Joseph H.; Jacobson IV, Charles E.; Okun, Michael S.", "title": "New-Onset Diabetes Mellitus among Parkinsonian Patients Treated with Long-term Quetiapine", "date": "2008", "keywords": "diabetes; new; patients; prevalence; quetiapine", "summary": "To determine true prevalence, patients with previous and recent diagnoses of DM, and/or use of hypo- glycemic agents prior to quetiapine initiation were included. How- ever, in schizophrenia, there are confl icting reports as to whether duration of disease is a signifi cant risk factor for DM development.", "mime": "application/pdf"}, {"id": "dti-1327", "words": "6262", "extension": ".pdf", "flesch": "62", "author": "Viola-Villegas, Nerissa; Vortherms, Anthony; Doyle, Robert P.", "title": "Targeting Gallium to Cancer Cells through the Folate Receptor", "date": "2008", "keywords": "cancer; cells; cho; dota; drug; et al; folate; gallium; peg; receptor; \u03b3-2; \u03b3-4", "summary": "Keire, D.A., Jang, Y.H., Shively, J.E. et al. 2001. We began by initially complexing gallium (III) to the 1,4,7,10-tetraazacyclo-dodecane- N,N\u2032,N\u2032\u2032,N\u2032\u2032\u2032-tetraacetic acid (DOTA) ligand (Doyle et al. 2006).", "mime": "application/pdf"}, {"id": "dti-1328", "words": "8110", "extension": ".pdf", "flesch": "64", "author": "Garrote, Jos\u00e9 A.; G\u00f3mez, Emma; Le\u00f3n, Alberto J.; Bernardo, David; Calvo, Carmen; Fern\u00e1ndez-Salazar, Luis; Blanco-Quir\u00f3s, Alfredo; Arranz, Eduardo", "title": "Cytokine, Chemokine and Immune Activation Pathway Profiles in Celiac Disease: An Immune System Activity Screening by Expression Macroarrays", "date": "2008", "keywords": "acd; cell; cytokine; disease; et al; expression; factor; gene; gfd; gluten; group; infl; intestinal; p =; patients; r:0", "summary": "Previous reports on cytokine expression in CD have studied biopsies from untreated patients (Nilsen, Jahnsen et al. 1998; Gluten challenge has been reported to induce also the expres- sion of IL-2, IL4, IL5, IL6, and TNF\u03b1 (Nilsen, Jahnsen et al. 1998), as well as IL-18, IL-15 (Maiuri, Ciacci et al. 2000; Monteleone, Pender et al. 2001; Salvati, MacDonald et al. 2002), and TGF\u03b2, but not http://creativecommons.org/licenses/by/3.0/ http://creativecommons.org/licenses/by/3.0/ 2 Garrote et al Drug Target Insights 2008:3 of IL10 (Nilsen, Jahnsen et al. 1998; Lionetti, Pazzaglia et al. 1999; Forsberg, Hernell et al. 2002; Hansson, Ulfgren et al. 2002).", "mime": "application/pdf"}, {"id": "dti-1329", "words": "3131", "extension": ".pdf", "flesch": "48", "author": "Tsen, Shaw-Wei D.", "title": "Evidence of a Novel Gene from Aeromonas hydrophila Encoding a Putative Siderophore Receptor Involved in Bacterial Growth and Survival", "date": "2008", "keywords": "hydrophila; iron; nsr1; protein; receptor; siderophore", "summary": "Bacteria frequently possess feedback systems that upregulate or downregulate the expression of certain iron uptake proteins, including the energy transducing protein TonB, in response to environ- mental iron levels (Beddek et al. 2004). The FhuA protein and similar iron uptake proteins from various bacteria were obtained and aligned using the algorithm of Thompson et al.", "mime": "application/pdf"}, {"id": "dti-1330", "words": "7884", "extension": ".pdf", "flesch": "56", "author": "Matsuyama, Masahide; Yoshimura, Rikio", "title": "The Target of 5-Lipoxygenase is a Novel Strategy over Human Urological Tumors than the Target of Cyclooxygenase-2", "date": "2008", "keywords": "5and; cancer; cells; cox-2; expression; human; inhibitors; lox; lox inhibitor; rcc; tissues; tumor", "summary": "2) Effect of COX and LOX inhibitors MTT assay a) COX RCC cell line All COX inhibitors were unable to induce a reduc- tion of cell viability with the half-maximal con- centration of growth inhibition of RCC cells in the range of 10\u201380 \u03bcM and were unable to stop the growth of RCC cells. BT cell line Similar to RCC cells, COX inhibitors could not induce a reduction of cell viability with the half- maximal concentration of growth inhibition of BT cells in the range of 10\u201380 \u03bcM and could not stop the growth of BT cells.", "mime": "application/pdf"}, {"id": "dti-1331", "words": "7195", "extension": ".pdf", "flesch": "55", "author": "Moretti, Rita; Torre, Paola; Vilotti, Cristina; Manganaro, Davide; Zanet, Luca; Antonello, Rodolfo M.", "title": "Memantine: Reality and Potentiality", "date": "2008", "keywords": "alzheimer; disease; dopamine; effect; et al; glutamate; memantine; neurons; nmda; parkinson; patients; placebo; receptors; severe", "summary": "(Reisberg et al. 2003; Reisberg et al. 2000). Beta-amyloid peptide enhances the toxicity of glutamate in in vitro test (Mattson et al. 1992; Wu et al. 1995) and augments NMDA receptor mediated transmission (Cullen et al. 1996).", "mime": "application/pdf"}, {"id": "dti-1332", "words": "11954", "extension": ".pdf", "flesch": "57", "author": "Prakash, Satya; Malhotra, Meenakshi", "title": "Recent Advancements in Targeted Delivery of Therapeutic Molecules in Neurodegenerative Disease\u2013-Spinocerebellar Ataxia\u2013-Opportunities and Challenges", "date": "2008", "keywords": "ataxia; brain; cag; cell; chromosome; delivery; disease; dominant; drug; et al; gene; hum; insights; interference; molecules; nanoparticles; nature; polyglutamine; protein; repeat; sca; silencing; sirna; specifi; spinocerebellar; system; target; type; unknown", "summary": "116 Prakash and Malhotra Drug Target Insights 2008:3 Nakamura, K., Jeong, S.Y., Uchihara, T. et al. 2001. This helps them to effectively transduce neurons (Mazarakis et al. 2001).", "mime": "application/pdf"}, {"id": "dti-1333", "words": "7724", "extension": ".pdf", "flesch": "54", "author": "Brown, William M.; Chiacchia, Fabrizio S.", "title": "Therapies to Increase ApoA-I and HDL-Cholesterol Levels", "date": "2008", "keywords": "apoa; atherosclerosis; cholesterol; density; disease; drug; et al; hdl; high; increase; ldl; levels; lipid; lipoprotein; patients; risk", "summary": "Common and rare ABCA1 variants affecting plasma HDL cholesterol. The fibrates typically raise HDL levels by 10%\u201315% and can also lower triglyceride levels by up to 60%, though they have little effect on LDL levels.", "mime": "application/pdf"}, {"id": "dti-1334", "words": "9944", "extension": ".pdf", "flesch": "55", "author": "Shen, Yuqiao; Senzer, Neil N.; Nemunaitis, John J.", "title": "Use of Proteomics Analysis for Molecular Precision Approaches in Cancer Therapy", "date": "2008", "keywords": "analysis; cancer; cation; cell; data; electrophoresis; et al; expression; gel; gene; identifi; labeling; mass; page; peptides; protein; proteomics; samples; spectrometry; tags; technology", "summary": "Using different fl uorescent dyes to label protein samples prior to gel electrophoresis, 2-D DIGE (two- dimensional differential in-gel electrophoresis) can, with reasonable sensitivity, process three protein samples on the same gel allowing for intragel relative quantifi cation. Using different fl uorescent dyes to label protein samples prior to gel electro- phoresis, the DIGE technique allows multiple samples to be co-separated and visualized on one 2-D gel (Unlu et al. 1997).", "mime": "application/pdf"}, {"id": "dti-1335", "words": "6086", "extension": ".pdf", "flesch": "55", "author": "Wilczak, Nadine; Keyser, Jacques De; Chesik, Daniel", "title": "Targeting Insulin-Like Growth Factor-1 Signaling into the Central Nervous System for Promoting Myelin Repair", "date": "2008", "keywords": "binding; brain; cns; et al; factor; growth; growth factor; igf-1; igfbps; insulin; oligodendrocytes", "summary": "Other studies have shown that systemic application of IGF-1 in acute demyelinating experimental autoim- mune encephalomyelitis (EAE), an animal model for MS, signifi cantly reduced the number and area of the demyelinated lesions in the spinal cord (Liu and Yao, 1995; Yao et al. 1995). The MAP kinase pathway is often associated in proliferation and differentiation (Kim et al. 1997), whereas the Akt pathway is induced in IGF-1 mediated cell survival (Brunet et al. 1999) and protection from apoptosis (Kermer et al. 2000).", "mime": "application/pdf"}, {"id": "dti-1336", "words": "8393", "extension": ".pdf", "flesch": "48", "author": "Zangari, Maurizio; Elice, Francesca; Tricot, Guido; Fink, Louis", "title": "Thrombophilia", "date": "2008", "keywords": "antithrombin; apc; blood; cancer; ciency; defi; factor; leiden; mutation; patients; protein; protein c; resistance; risk; therapy; thrombophilia; thrombosis; vte", "summary": "Risks factors for VTE in medically ill patients have a cumulative effect; hospitalized subjects with thrombophilia or a history of thrombosis are at increased risk of VTE, as well as patients with lower limb paralysis from acute ischaemic stroke. Risk factors for pregnancy associated venous thromboembolism.", "mime": "application/pdf"}, {"id": "dti-1337", "words": "6182", "extension": ".pdf", "flesch": "58", "author": "Begleiter, Asher; El-Gabalawy, Nadia; Lange, Laurie; Leith, Marsha K.; Guziec, Lynn J.; Guziec Jr, Frank S.", "title": "A Model for NAD(P)H:Quinoneoxidoreductase 1 (NQO1) Targeted Individualized Cancer Chemotherapy", "date": "2009", "keywords": "activity; agents; analogs; cancer; cells; growth; human; levels; mebm; nprbm; nqo1; pbm; tumor", "summary": "Human tumor cells have varied levels of NQO1 activity ranging from \ufffd 10 nmol. To test this hypothesis, we measured tumor cell growth inhibition produced by the series of BM analogs having different affi nities for activation by NQO1, in human tumor cell lines with a wide range of NQO1 activity.", "mime": "application/pdf"}, {"id": "dti-1338", "words": "5458", "extension": ".pdf", "flesch": "52", "author": "Hatakeyama, Yuji; Hatakeyama, Junko; Takahashi, Atsushi; Oka, Kyoko; Tsuruga, Eichi; Inai, Tetsuichiro; Sawa, Yoshihiko", "title": "The Effect of Valproic Acid on Mesenchymal Pluripotent Cell Proliferation and Differentiation in Extracellular Matrices", "date": "2011", "keywords": "cell; collagen; culture; differentiation; effect; mesenchymal; plastic; plate; presence; proliferation; vpa", "summary": "Previous studies have reported that VPA effects osteogenesis in vivo and in vitro, yet it remains unclear whether VPA promotes cell differentiation of osteoblasts derived from mesenchymal cells. Keywords: mesenchymal cells, valproic acid, cell proliferation http:/dx.doi.org/10.4137/DTI.S6534 http://www.la-press.com http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 http://www.la-press.com mailto:yuji_hatakey@hotmail.com hatakeyama et al 2 Drug Target Insights 2011:5 Introduction Valproic acid (2-n-propylpentanoic acid, VPA) is an effective and widely used antiepileptic and anticon- vulsant drug, and recent studies have reported that VPA influences osteogenesis in vivo and in vitro.1\u20134 It has been reported that VPA has no effect on osteo- genesis identified with calcification nodule forma- tion by a preosteoblast cell line derived from mouse calvaria, MC3T3-E1 cells.5", "mime": "application/pdf"}, {"id": "dti-1346", "words": "5158", "extension": ".pdf", "flesch": "53", "author": "O\u2019Blenes, Stacy B.; Li, Audrey W.; Bowen, Chris; DeBay, Drew; Althobaiti, Mohammed; Clarke, James", "title": "Impact of Hepatocyte Growth Factor on Skeletal Myoblast Transplantation Late After Myocardial Infarction", "date": "2013", "keywords": "control; engraftment; hgf; myoblast; skmb; transplantation; ventricular; vs.; weeks", "summary": "We evaluated HGF delivery, SKMB engraftment, and expression of genes associated with post-MI remodeling. While it is possible that neonatal SKMBs used in their study behaved differently than the more clinically relevant adult SKMBs used in our model, it is also possible that the route of HGF delivery is important.", "mime": "application/pdf"}, {"id": "dti-1347", "words": "4007", "extension": ".pdf", "flesch": "54", "author": "Roth, Bodil; Manjer, Jonas; Ohlsson, Bodil", "title": "Microscopic Colitis is Associated with Several Concomitant Diseases", "date": "2013", "keywords": "age; colitis; controls; diseases; drug; patients; study; years", "summary": "Thus, MC patients have an increased prevalence of several diseases, not only of autoimmune origin. The aim of this study was to examine the prevalence of com- mon diseases in patients with MC and controls from the general population.", "mime": "application/pdf"}, {"id": "dti-1348", "words": "10404", "extension": ".pdf", "flesch": "54", "author": "Sarangi, Upasana; Singh, Manish Kumar; Abhijnya, Kanugovi Vijaya Vittal; Reddy, Lebaka Prasanna Anjaneya; Prasad, Badabagni Siva; Pitke, Vikrant Vinay; Paithankar, Khanderao; Sreedhar, Amere Subbarao", "title": "Hsp60 Chaperonin Acts as Barrier to Pharmacologically Induced Oxidative Stress Mediated Apoptosis in Tumor Cells with Differential Stress Response", "date": "2015", "keywords": "apoptosis; bc-8; cells; combination; control; fig; h h; hsp60; imr-32; mitochondrial; production; response; ros; rotenone; shrna; stress; translocation; treatment", "summary": "However, CHX combination treat- ment with rotenone restored mitochondrial Hsp60 at 24 h treatment, but promoted cytoplasmic trans- location by 48 h both in BC-8 (Fig. 8A) and in IMR-32 (Fig. In this study, using rotenone, an irreversible inhib- itor of OXPHOS against IMR-32 cells that contain intact inducible heat shock transcriptional machin- ery30 and BC-8 tumor cells that lack inducible heat shock transcriptional machinery,31 we showed that the oxidative stress response is related to Hsp60.", "mime": "application/pdf"}, {"id": "dti-1349", "words": "4791", "extension": ".pdf", "flesch": "49", "author": "Amin, Md. Lutful", "title": "P-glycoprotein Inhibition for Optimal Drug Delivery", "date": "2013", "keywords": "cancer; cells; delivery; drug; efflux; generation; glycoprotein; inhibition; inhibitors; multidrug; resistance; target", "summary": "Keywords: P-glycoprotein, drug efflux, bioavailability, drug delivery, drug resistance, P-glycoprotein inhibitor http://dx.doi.org/10.4137/DTI.S12519 http://www.la-press.com http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 http://www.la-press.com mailto:lutful_amin@yahoo.com Amin 28 Drug Target Insights 2013:7 Introduction P-glycoprotein (P-gp) is one of the first members of the ATP-binding cassette (ABC) transporter which acts as a physiological barrier by extruding toxins and xeno- biotics out of cells.1,2 Possible involvement of the drug transport- ers P glycoprotein and multidrug resistance-associated protein Mrp2 in dispo- sition of azithromycin.", "mime": "application/pdf"}, {"id": "dti-1350", "words": "5528", "extension": ".pdf", "flesch": "57", "author": "Roth, Bodil; Manjer, Jonas; Ohlsson, Bodil", "title": "Microscopic Colitis and Reproductive Factors Related to Exposure to Estrogens and Progesterone", "date": "2013", "keywords": "age; colitis; controls; factors; patients; reference; study; value; years", "summary": "Patients with lympho- cytic colitis had children less often compared to those with collagenous colitis (OR =\u00a00.20, 95% CI =\u00a00.05\u20130.86), however no differences were observed between patients with persistent or transient disease. The majority of MC patients had used OC at some period of their life.", "mime": "application/pdf"}, {"id": "dti-1351", "words": "6076", "extension": ".pdf", "flesch": "62", "author": "Hasan, Md. Anayet; Alauddin, S. M.; Al Amin, Mohammad; Nur, Suza Mohammad; Mannan, Adnan", "title": "In Silico Molecular Characterization of Cysteine Protease YopT from Yersinia pestis by Homology Modeling and Binding Site Identification", "date": "2014", "keywords": "analysis; cell; cysteine; cysteine protease; function; model; pestis; plague; prediction; protease; protease yopt; protein; residues; site; structure; target; yersinia; yersinia pestis; yopt", "summary": "Secondary structure pre\u00ad dictions are increasingly becoming the work horse for numerous methods aimed at predicting protein structure and function. Verification of protein structures: patterns of nonbonded atomic interactions.", "mime": "application/pdf"}, {"id": "dti-1352", "words": "8348", "extension": ".pdf", "flesch": "56", "author": "Gumuslu, Esen; Mutlu, Oguz; Sunnetci, Deniz; Ulak, Guner; Celikyurt, Ipek K.; Cine, Naci; Akar, Furuzan; Savl\u0131, Hakan; Erden, Faruk", "title": "The Antidepressant Agomelatine Improves Memory Deterioration and Upregulates CREB and BDNF Gene Expression Levels in Unpredictable Chronic Mild Stress (UCMS)-Exposed Mice", "date": "2014", "keywords": "agomelatine; animals; antidepressant; bdnf; chronic; control; creb; effects; expression; gene; group; latency; levels; melatonin; memory; mice; mwm; stress; test; treatment; trial", "summary": "The results of our study revealed that chronic agomelatine increased BDNF expression in the hippocampus, and our findings are consistent with those of recent studies.57,60 These findings provide new information regarding the molecular mechanisms that contribute to the chronic effects of the new antidepressant agomelatine on brain function. Quantitative RT-PCR revealed that CREB and BDNF gene expression levels were downregulated in UCMS-exposed mice, and these alterations were reversed by chronic agomelatine or melatonin treatment.", "mime": "application/pdf"}, {"id": "dti-1353", "words": "5766", "extension": ".pdf", "flesch": "60", "author": "Akar, Furuzan; Mutlu, Oguz; Celikyurt, Ipek K.; Bektas, Emine; Tanyeri, Mehmet H.; Ulak, Guner; Tanyeri, Pelin; Erden, Faruk", "title": "Effects of Zaprinast and Rolipram on Olfactory and Visual Memory in the Social Transmission of Food Preference and Novel Object Recognition Tests in Mice", "date": "2014", "keywords": "effects; field; food; inhibitors; memory; mice; novel; object; olfactory; rolipram; stfp; test; total; zaprinast", "summary": "Rutten K, Prickaerts J, Hendrix M, van der Staay FJ, Sik A, Blokland A. Time- dependent involvement of cAMP and cGMP in consolidation of object memory: Studies using selective phosphodiesterase type 2, 4 and 5 inhibitors. For instance, the specific PDE5-Is sildenafil and vardenafil have been shown to improve object recognition memory when injected immediately fol- lowing the first trial.13 PDE5-Is are assumed to improve early processes of memory consolidation via either a presynaptic or postsynaptic mechanism.", "mime": "application/pdf"}, {"id": "dti-1354", "words": "4760", "extension": ".pdf", "flesch": "55", "author": "Vudriko, Patrick; Masatani, Tatsunori; Cao, Shinuo; Terkawi, Mohamad Alla; Kamyingkird, Ketsarin; Mousa, Ahmed A.; Moumouni, Paul F. Adjou; Nishikawa, Yoshifumi; Xuan, Xuenan", "title": "Molecular and Kinetic Characterization of Babesia microti Gray Strain Lactate Dehydrogenase as a Potential Drug Target", "date": "2014", "keywords": "amino; babesia; bmldh; drug; enzyme; gossypol; kinetic; lactate; microti; nad+; protein; target", "summary": "This was carried out using B. microti Gray strain-infected hamster blood smears (day 8 post-infection) as previously described.21 The secondary antibody was anti-mouse Alexa-488 secondary diluted 200 times with 4% fetal bovine serum (FBS), and the http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 33Drug TargeT InsIghTs 2014:8 parasite nucleus was stained with propidium iodide. The purified genomic DNA of human isolate of B. microti Gray strain (US type, culture collection catalog No. 30221) was used as template.21 Oligo nucleotide prim- ers with BamHI restriction site at the forward (5\u2032-CCTCG- GATCCCATTCGTTAAAAGAAGA ATTTC-3\u2032) and XhoI site at the reverse (5\u2032-GGGGCTCGAGTTATAGTTG- GATATCTTTCTGTG-3\u2032) were designed from B. microti strain R1 LDH gene sequence obtained from GenBank (Accession No.", "mime": "application/pdf"}, {"id": "dti-1355", "words": "4343", "extension": ".pdf", "flesch": "57", "author": "Akimoto, Tetsu; Morishita, Yoshiyuki; Ito, Chiharu; Iimura, Osamu; Tsunematsu, Sadao; Watanabe, Yuko; Kusano, Eiji; Nagata, Daisuke", "title": "Febuxostat for Hyperuricemia in Patients with Advanced Chronic Kidney Disease", "date": "2014", "keywords": "disease; febuxostat; hyperuricemia; kidney; levels; patients; serum; stress; study; treatment", "summary": "Materials and Methods Seventeen patients on chronic hemodialysis (HD) treatment who had serum UA levels above 8.0\u00a0 mg/dL and who were not receiving anti-hyperuricemic agents participated in the study. The target serum UA level was \ue02c6.0\u00a0mg/dL, and the dose of febuxostat was titrated or increased up to a maximum of 40\u00a0mg/day.", "mime": "application/pdf"}, {"id": "dti-1356", "words": "5549", "extension": ".pdf", "flesch": "49", "author": "Roth, Bodil; Berntorp, Kerstin; Ohlsson, Bodil", "title": "The Expression of Serum Antibodies Against Gonadotropin-releasing Hormone (GnRH1), Progonadoliberin-2, Luteinizing Hormone (LH), and Related Receptors in Patients with Gastrointestinal Dysfunction or Diabetes Mellitus", "date": "2014", "keywords": "antibodies; diabetes; dysmotility; expression; gastrointestinal; gnrh; hormone; ibs; igm; mellitus; patients; receptor; study", "summary": "The distribution of antibodies among subgroups of IBS or dysmotility patients is shown in Table 1. As some of the patients with diabetes mellitus and gastrointestinal complaints had no pathological changes as found in the examinations (n\u00a0 =\u00a0 3), they were diagnosed as IBS patients.", "mime": "application/pdf"}, {"id": "dti-1357", "words": "8212", "extension": ".pdf", "flesch": "52", "author": "Parvege, Md. Masud; Rahman, Monzilur; Hossain, Mohammad Shahnoor", "title": "Genome-wide Analysis of Mycoplasma hominis for the Identification of Putative Therapeutic Targets", "date": "2014", "keywords": "50s; analysis; cytoplasm; database; dna; drug; drug targets; hominis; identification; list; membrane; metabolism; mycoplasma; novel; pathways; potential; proteins; res; ribosomal; targets; yes", "summary": "Target proteins found in the cytoplasm can be used as potential drug targets, whereas extracellular and membrane-bound proteins can work as probable vaccine targets.28 Various online tools were used for the prediction of subcellular localization and mem- brane topology. Target protein interacting with http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Parvege et al 58 Drug TargeT InsIghTs 2014:8 Table 3.", "mime": "application/pdf"}, {"id": "dti-1365", "words": "5399", "extension": ".pdf", "flesch": "55", "author": "Otegbade, Olayinka O; Ojo, Johnson A; Adefokun, Dolapo I; Abiodun, Oyindamola O; Thomas, Bolaji N; Ojurongbe, Olusola", "title": "Ethanol Extract of Blighia sapida Stem Bark Show Remarkable Prophylactic Activity in Experimental Plasmodium berghei\u0096Infected Mice", "date": "2017", "keywords": "activity; berghei; coartem; day; dose; extract; group; malaria; mice; plant; sapida", "summary": "It is worth noting that B sapida extract exhibited the most active antiplas- modial properties at the lowest dosage tested. This dose- dependent activity potentially shows that response at low dose is more effective than response inhibition at high dose.29 Our results show that B sapida extracts will serve as excellent anti- malarial agent in the prophylactic model of treatment.", "mime": "application/pdf"}, {"id": "dti-1366", "words": "8202", "extension": ".pdf", "flesch": "52", "author": "Friend Tambunan, Usman Sumo; Fardiansyah Nasution, Mochammad Arfin; Azhima, Fauziah; Parikesit, Arli Aditya; Toepak, Erwin Prasetya; Idrus, Syarifuddin; Kerami, Djati", "title": "Modification of S-Adenosyl-l-Homocysteine as Inhibitor of Nonstructural Protein 5 Methyltransferase Dengue Virus Through Molecular Docking and Molecular Dynamics Simulation", "date": "2017", "keywords": "asp146; complex; dengue; docking; drug; dynamics; enzyme; interaction; ligands; m1356; m2696; m331; methyltransferase; ns5; process; protein; sah; simulation; site; software; structure; virus", "summary": "The SAM-binding site itself consists of 14 amino acids (Ser56, Lys61, Cys82, Gly86, Trp87, Thr104, Lys105, Asp131, Val132, Phe133, Asp146, Ile147, Lys181, and Glu217) that could be selected as a drug target for NS5 meth- yltransferase.48 Therefore, the modification of SAH ligand should fit with the SAM-binding site. In addition, the 2P41 PDB structure has SAH ligand as well, which can be used later for molecular docking simulation purposes.", "mime": "application/pdf"}, {"id": "dti-1367", "words": "2230", "extension": ".pdf", "flesch": "51", "author": "Avasarala, Jagannadha", "title": "Anti-CD20 Cell Therapies in Multiple Sclerosis\u2014A Fixed Dosing Schedule for Ocrelizumab is Overkill", "date": "2017", "keywords": "cd20; cell; counts; ocr; patients; rtx", "summary": "There is minimal scientific validity in infusing the drug every 6 months particularly if CD20 cell counts are negligible in the peripheral blood. Because OCR avidly targets CD20 cell populations and depletes them and as their numbers can be monitored by peripheral blood counts of CD19 cells, it remains poorly understood why OCR needs to be reinfused at sched- uled intervals regardless of CD20 cell counts.", "mime": "application/pdf"}, {"id": "dti-1370", "words": "11407", "extension": ".pdf", "flesch": "47", "author": "Vishal, Chaturvedi; Kumar, Jonnala Ujwal; Swamy, Cherukuvada Veera Brahmendra; Nandini, Rangaraj; Srinivas, Gunda; Kumaresan, Rathinam; Shashi, Singh; Sreedhar, Amere Subbarao", "title": "Repercussion of Mitochondria Deformity Induced by Anti-Hsp90 Drug 17AAG in Human Tumor Cells", "date": "2011", "keywords": "17aag; 17aag treatment; analysis; ca2; cancer; cells; chaperone; control; cytochrome; deformity; digitonin; drug; effects; family; fig; hsp90; http://www.la-press.com; inhibition; insights; membrane; min; mitochondria; potential; protein; ribosomal; ros; swelling; target; treatment; tumor", "summary": "Large portion of mitochondrial proteins is not made but imported from nuclear coded genes with the help of Hsp90 and Hsp70 chaperone machines. And any interfer- ence with either of the chaperone machinery there- fore hinders import of mitochondrial proteins.", "mime": "application/pdf"}, {"id": "dti-1371", "words": "5794", "extension": ".pdf", "flesch": "46", "author": "Bello, Edson Jos\u00e9 Monteiro; Correia, Amabel Fernandes; Marins, Jos\u00e9 Ricardo Pio; Merchan-Hamann, Edgar; Kanzaki, Luis Isamu Barros", "title": "Predictors of Virologic Failure in HIV/AIDS Patients Treated with Highly Active Antiretroviral Therapy in Bras\u00edlia, Brazil During 2002\u20132008", "date": "2011", "keywords": "antiretroviral; cd4; cell; copies; count; failure; haart; health; hiv; load; patients; therapy; treatment", "summary": "The essential objective of treatment in patients presenting therapeutic failure is to maintain T CD4+ acceptable cell population density, whilst new therapeutic options are awaited, contrary to the prior- ity aim to reach and keep up an undetectable viral load.4 According to Moore et al,5 virological failure is characterized by viral load higher than 400 cop- ies/mL after 48 weeks of initial treatment or among subjects that had complete viral suppression, but later on the viral load will recrudesce. These condi- tions are mainly suggestive of immunologic failure but laboratory analysis confirmation is mandatory.6 Cozzi-Lepri et al7 concluded that patients remaining in HAART failure presented viral load slowly pro- gressing during the next 12 months, differently to T CD4+ cell count which remained stable.", "mime": "application/pdf"}, {"id": "dti-1373", "words": "6063", "extension": ".pdf", "flesch": "51", "author": "Annabi, Borhane; Lord-Dufour, Simon; V\u00e9zina, Am\u00e9lie; B\u00e9liveau, Richard", "title": "Resveratrol Targeting of Carcinogen-Induced Brain Endothelial Cell Inflammation Biomarkers MMP-9 and COX-2 is Sirt1-Independent", "date": "2012", "keywords": "brain; cancer; cells; cox-2; endothelial; expression; gapdh; gene; grade; hbmec; inhibition; i\u03bab; mmp-9; pma; resveratrol; sirt1; target", "summary": "Results Sirt1 gene expression profiling in grade I-IV brain tumour tissues Fourthy-eight clinical tissue samples were first analyzed for Sirt1 gene expression profil using TissueScan\u2122 cancer and normal tissue cDNA arrays (OriGene, Rockville, MD) from 43 clinical samples covering brain cancer four stages and normal tissues as described in the methods section. PMA treatment by itself did not affect Sirt1 gene expression (not shown).", "mime": "application/pdf"}, {"id": "dti-1374", "words": "4507", "extension": ".pdf", "flesch": "55", "author": "Pendleton, Hillevi; Alm, Ragnar; Fredrikson, Gunilla Nordin; Ohlsson, Bodil", "title": "Antibodies Against Gonadotropin-Releasing Hormone in Patients with Posterior Laryngitis", "date": "2013", "keywords": "acid; antibodies; controls; gnrh; hormone; patients; posterior; reflux; study; symptoms", "summary": "Patients with organic gastrointestinal diseases such as inflam- matory bowel disease, celiac disease, and scleroderma do not express antibodies.12,13 This raises the hypoth- esis that patients with different functional disorders, which often are associated and show an overrepresen- tation in women,14,15 may express GnRH antibodies as a common feature. Consecutive PL patients were included after examination.", "mime": "application/pdf"}, {"id": "dti-1375", "words": "11943", "extension": ".pdf", "flesch": "54", "author": "Sarangi, Upasana; Paithankar, Khande Rao; Kumar, Jonnala Ujwal; Subramaniam, Vaidyanathan; Sreedhar, Amere Subbarao", "title": "17AAG Treatment Accelerates Doxorubicin Induced Cellular Senescence: Hsp90 Interferes with Enforced Senescence of Tumor Cells", "date": "2012", "keywords": "17aag; activation; cancer; cells; combination; control; d4 d; day; doxorubicin; drug; expression; fig; gal; hsp90; increase; inhibition; p53; pre; senescence; staining; target; treatment; tumor", "summary": "Wortma- nin treatment also resulted in increased cell death sug- gesting its role in senescence cell survival (Fig. 2D and E) that however, did not result in increased senescence positive cells (compare Fig.", "mime": "application/pdf"}, {"id": "dti-1378", "words": "12493", "extension": ".pdf", "flesch": "60", "author": "Mbah, Andreas N.; Kamga, Henri L.; Awofolu, Omotayo R.; Isokpehi, Raphael D.", "title": "Drug Target Exploitable Structural Features of Adenylyl Cyclase Activity in Schistosoma mansoni", "date": "2012", "keywords": "+ ion; adenylyl; beta; binding; box; box motif; complex; cyclase; drug; fig; gamma; gtp; ion complex; mansoni; mg2 +; motif; protein; region; residues; site; site residues; smp_059340.1; structure; switch; target", "summary": "The possible conserved domain search was car- ried out using the public server at http://www. ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi for the Smp_059340.1, and the individual domains present were analyzed and binding residues were compared within the domains. It is used for defining GTP binding proteins in general.33 The G2 box motif (green) is located on the loop and contains only one residue, being Thr188.", "mime": "application/pdf"}, {"id": "dti-1400", "words": "4221", "extension": ".pdf", "flesch": "48", "author": "Murakami, Takuya; Akimoto, Tetsu; Okada, Mari; Hishida, Erika; Sugase, Taro; Miki, Atsushi; Kohara, Marina; Yoshizawa, Hiromichi; Masuda, Takahiro; Kobayashi, Takahisa; Saito, Osamu; Muto, Shigeaki; Nagata, Daisuke", "title": "Valacyclovir Neurotoxicity and Nephrotoxicity in an Elderly Patient Complicated by Hyponatremia", "date": "2018", "keywords": "acyclovir; case; day; hyponatremia; levels; neurotoxicity; patient; serum; sodium; treatment; valacyclovir", "summary": "The withdrawal or discontinuation of the offending agent is the mainstay treatment for acyclovir or valacyclovir-mediated poisoning; however, there are several anecdotal reports suggest- ing that HD may play a role in the rapid reduction in serum acyclovir levels, thereby accelerating the recovery from renal and/or neurological disorders.4,8,11\u201314 Given the chemical and pharmacokinetic characteristics of acyclovir, including its small molecular weight (225 Da), limited protein-binding rate, low steady-state volume of distribution, and high water solubility, it can be readily removed with extracorporeal procedures, includ- ing HD, HF, and hemodiafiltration, with a high elimination rate in HD.4,8,12,15 In the present case, the concurrent hypona- tremia precluded us from promptly performing HD as the pro- cedure to remedy volume overload, azotemia, and abnormal serum electrolyte levels results in the rapid correction of the serum sodium level and predisposes patients to a risk of osmotic demyelination syndrome (ODS).16 In this context, we decided to perform HF, which may have a lower magnitude of sodium exchange than HD,17 as an initial mode of blood purification with the aim of correcting the hyperkalemia associated with AKI as well as active acyclovir removal, and it was not until the confirmation of successfully corrected serum sodium levels that HD was finally applied without any hesitation. A lack of infor- mation regarding the therapeutic benefit of HF in cases with valacyclovir or acyclovir toxicity18 also encouraged us to employ HP empirically as an adjunct treatment for the disease after confirming the normalization of the patient\u2019s serum potassium levels, although acyclovir is not necessarily listed as an agent that can be removed by this procedure.19 Given our experience with the current patient, we believe that HF and/or HP are viable therapeutic options in patients with hyponatremia who are at risk of developing a rate of sodium correction with HD that far exceeds the safe recommendation, although it does not allow us to objectively determine the clinical impact of each procedure on this pathology.", "mime": "application/pdf"}, {"id": "dti-1401", "words": "1752", "extension": ".pdf", "flesch": "47", "author": "Avasarala, Jagannadha", "title": "DRESS Syndrome and Daclizumab Failure-Were Potentially Dangerous Signs Missed in Clinical Trials", "date": "2018", "keywords": "dress; drug; patients; syndrome; zinbryta", "summary": "This should serve as a cautionary tale for all clinicians who use \u201cnewer MS drugs\u201d that have mushroomed in recent memory following a flurry of recent FDA approvals. Many stud- ies have reported DRESS syndrome patients with genetic predisposition linked to specific drugs and one wonders if Zinbryta use, DRESS syndrome, and HLA class II alleles were linked as well.", "mime": "application/pdf"}, {"id": "dti-1406", "words": "6427", "extension": ".pdf", "flesch": "67", "author": "Mutlu, Oguz; Akar, Furuzan; Celikyurt, Ipek Komsuoglu; Tanyeri, Pelin; Ulak, Guner; Erden, Faruk", "title": "7-NI and ODQ Disturbs Memory in the Elevated Plus Maze, Morris Water Maze, and Radial Arm Maze Tests in Mice", "date": "2015", "keywords": "effects; latency; learning; maze; memory; mice; odq; oxide; platform; test", "summary": "Mutlu O, Ulak G, Belzung C. Effects of nitric oxide synthase inhibitors 1-(2 trifluoromethylphenyl)\u2014imidazole (TRIM) and 7-nitroindazole (7-NI) on learning and memory in mice. Nitric oxide synthase (NOS) and guanylate cyclase (GC) inhibitors have been shown to exert some effects on cognition in previous studies; however, the findings have been controversial.", "mime": "application/pdf"}, {"id": "dti-1407", "words": "6058", "extension": ".pdf", "flesch": "58", "author": "Zulkipli, Ihsan N.; David, Sheba R.; Rajabalaya, Rajan; Idris, Adi", "title": "Medicinal Plants: A Potential Source of Compounds for Targeting Cell Division", "date": "2015", "keywords": "anticancer; biol; cancer; cell; compounds; division; drug; dynamics; microtubule; mitosis; plants; potential; source; target; targeting; tubulin", "summary": "Micro- tubules represent the best and most successful target thus far http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 17Drug TargeT InsIghTs 2015:9 Medicinal plants: a potential source of compounds for targeting cell division identified in cancer treatment.37\u201339 Cancer cells are sensitive to microtubule poisons that arrest cells in mitosis because they undergo mitosis more frequently than normal cells. Among other properties, one favorable characteristic of an anticancer drug is its ability to block the uncontrollable process of cell division, as cancer cells are notorious for their abnormal cell division.", "mime": "application/pdf"}, {"id": "dti-1408", "words": "5810", "extension": ".pdf", "flesch": "53", "author": "Ohlsson, Bodil; Melander, Olle", "title": "Basal Plasma Levels of Copeptin are Elevated in Inactive Inflammatory Bowel Disease after Bowel Resection", "date": "2015", "keywords": "bowel; cohort; controls; copeptin; disease; fragment; ibd; levels; mpm; patients; peptide; plasma; precursor; study", "summary": "The aim of this study was to examine basal plasma levels of a variety of peptide precursors in patients with inflammatory bowel disease (IBD). KEY WORDS: copeptin, inflammatory bowel disease, irritable bowel syndrome-like symptoms, neuropeptides, precursors CITATION: Ohlsson and Melander.", "mime": "application/pdf"}, {"id": "dti-1409", "words": "7204", "extension": ".pdf", "flesch": "57", "author": "Tambunan, Usman S.F.; Zahroh, Hilyatuz; Parikesit, Arli A.; Idrus, Syarifuddin; Kerami, Djati", "title": "Screening Analogs of \u03b2-OG Pocket Binder as Fusion Inhibitor of Dengue Virus 2", "date": "2015", "keywords": "analogs; complex; compounds; dengue; denv; docking; drug; envelope; ligand; pocket; protein; research; screening; structure; target; virus", "summary": "The compounds used in this research are commercially available analogs (90% resemblance) of \u03b2-OG pocket binder compounds (\u03b2-OG, as a natural ligand of this pocket) and the compounds used in Poh et al\u2019s,22 Kampmann et al\u2019s,23 and Yennamalli et al\u2019s research.21 This research aims to find new antiviral candidates against DENV that are analogs of \u03b2-OG pocket binder of DENV envelope protein according to previous research21\u201323,25 through molecular docking and dynamics simulation. Searching of 3D structure of DENV envelope protein.", "mime": "application/pdf"}, {"id": "dti-1410", "words": "2422", "extension": ".pdf", "flesch": "45", "author": "Imai, Toshimi; Akimoto, Tetsu; Ito, Chiharu; Masuda, Takahiro; Nagata, Daisuke", "title": "Management of Diabetes Associated with Nephrotic Syndrome: Therapeutic Potential of Dapagliflozin for Protracted Volume Retention", "date": "2015", "keywords": "dapagliflozin; day; diabetes; glucose; nephrotic; sodium; syndrome; type", "summary": "A case of volume depletion and prerenal azote- mia that required rehydration and the withdrawal of angio- tensin-converting inhibitor and diuretic treatment was recently reported in a phase II trial of dapagliflozin.15 Not surprisingly, dapagliflozin was effective and well tolerated as an adequate therapeutic option for modulating the present patient\u2019s level of glycemic control. The lack of longitudinal data regarding the gross daily urine output, as well as the amount of urinary excreted sodium after the commencement of oral dapagliflozin treatment in the previous studies, precludes us from evaluating the valid- ity of our findings.10\u201312 Nevertheless, List et al, demonstrated that the administration of dapagliflozin in treatment-naive patients with type 2 diabetes resulted in an increased urinary output of between 107\u00a0mL/day and 470\u00a0mL/day, equating to ~0.3\u20131.5 additional voids per day.1,17 This highlights the need for further investigation regarding the impact of the diuretic properties of this agent on the overall management of diabetic patients.9 Obviously, the accumulation of more experience with additional cases similar to ours requires continuous and careful attention, and such a strategy would aid in the estab- lishment of a novel approach to treating fluid retention as well as investigating the therapeutic impact of SGLT-2 inhibitors in diabetic patients with nephrotic syndrome.", "mime": "application/pdf"}, {"id": "dti-1415", "words": "1709", "extension": ".pdf", "flesch": "49", "author": "Oblitas, Crhistian-Mario; Galeano-Valle, Francisco; La Cruz, Laura Vela-De; Toro-Cervera, Jorge Del; Demelo-Rodr\u00edguez, Pablo", "title": "Omalizumab as a Provoking Factor for Venous Thromboembolism", "date": "2019", "keywords": "asthma; dimer; drug; omalizumab; risk; treatment; vte", "summary": "Yalcin AD, Celik B, Gumuslu S. D-dimer levels decreased in severe allergic asthma and chronic urticaria patients with the omalizumab treatment. Treating severe allergic asthma with anti-IgE monoclonal antibody (omalizumab): a review.", "mime": "application/pdf"}, {"id": "dti-1416", "words": "6265", "extension": ".pdf", "flesch": "48", "author": "Orrico, Kathleen B", "title": "Basic Concepts in Genetics and Pharmacogenomics for Pharmacists", "date": "2019", "keywords": "alleles; base; cyp2d6; dna; drug; enzyme; gene; genome; human; pgx; protein; september; sequence; testing; variation", "summary": "A set or group of gene alleles typically located on the same chromosome and inherited together is referred to as a haplotype and may indicate a common line of descent in indi- viduals who share one. To illustrate several of these concepts, let us examine how CYP2D6 gene variation relates to both the effectiveness and safety of the opioid analgesic drug codeine.", "mime": "application/pdf"}, {"id": "dti-1417", "words": "14974", "extension": ".pdf", "flesch": "64", "author": "Abdul Manap, Aimi Syamima; Vijayabalan, Shantini; Madhavan, Priya; Chia, Yoke Yin; Arya, Aditya; Wong, Eng Hwa; Rizwan, Farzana; Bindal, Umesh; Koshy, Shajan", "title": "Bacopa monnieri, a Neuroprotective Lead in Alzheimer Disease: A Review on Its Properties, Mechanisms of Action, and Preclinical and Clinical Studies", "date": "2019", "keywords": "al e; b o; bacopa; ce d; d b; d d; d w; e d; e n; e s; e t; g d; g e; h e; m e; m g; m o; m p; monnieri; n d; r e; w e", "summary": "T H E M O D E L U S E D A N D S T U D Y D E S IG N D O S E O R F R E q U E N C Y E F F E C T O F B M E T R E AT M E N T R E F E R E N C E S In v iv o m od el E th yl ch o lin e a zi ri d in iu m io n (A F 6 4A ) (2 n m o l/2 \u03bc L) \u2014 IC V -i n d u ce d m al e W is ta r ra ts 20 , 4 0, a n d 8 0 m g /k g B W B M E e nh an ce d th e es ca p e la te n cy t im e (P < .0 1) in t he M or ri s w at er m a ze te st . d e cr ea se d th e lip id p er ox id e s an d pr ot e in o xi d at io n. B ot h el e ct ro n an d flu or es ce n ce m ic ro sc o p ic s tu d ie s un co ve re d su bs ta nt ia l i nh ib iti o n of n e cr ot ic c ha n g e an d in tr a- n eu ro na l l ip of u sc in in t h e hi p p o ca m pu s C A 1 re g io n. Jy ot i e t a l7 0 S tr e pt oz ot o ci n (S T Z ) (3 m g /k g, p .", "mime": "application/pdf"}, {"id": "dti-1418", "words": "5494", "extension": ".pdf", "flesch": "47", "author": "Kossaify, Antoine", "title": "Vernakalant in Atrial Fibrillation: A Relatively New Weapon in the Armamentarium Against an Old Enemy", "date": "2019", "keywords": "atrial; cardioversion; control; conversion; fibrillation; heart; management; onset; onset af; patients; rate; rhythm; sinus; vernakalant", "summary": "Incidence of thromboem- bolic complications within 30 days of electrical cardioversion performed within 48 hours of atrial fibrillation onset. de Riva-Silva M, Montero-Cabezas JM, Salgado-Aranda R, Lopez-Gil M, Fon- tenla-Cerezuela A, Arribas-Ynsaurriaga F. 1:1 atrial flutter after vernakalant administration for atrial fibrillation cardioversion.", "mime": "application/pdf"}, {"id": "dti-1419", "words": "6245", "extension": ".pdf", "flesch": "55", "author": "Hydery, Tasmina; Coppenrath, Valerie Azzopardi", "title": "A Comprehensive Review of Pegvaliase, an Enzyme Substitution Therapy for the Treatment of Phenylketonuria", "date": "2019", "keywords": "blood; concentrations; dose; patients; pegvaliase; phase; phenylalanine; phenylketonuria; pku; study; treatment; \u00b5mol", "summary": "Studies in adult PKU patients have shown a variation in phenylalanine levels can be observed without any change in treatment.20 In clinical trials, the response to sapropterin treatment was defined as a 30% reduction in blood phenylalanine concentration from base- line.21 The assessment of blood phenylalanine concentrations may also be indicative of patient adherence to therapy.22 Poor adherence can manifest as failure to take medical foods or pre- scribed medications, and missing regular clinic appointments or blood phenylalanine testing.23", "mime": "application/pdf"}, {"id": "dti-1420", "words": "2759", "extension": ".pdf", "flesch": "44", "author": "Fragkou, Paraskevi; Souli, Maria; Theochari, Maria; Kontopoulou, Christina; Loukides, Stelios; Koumarianou, Anna", "title": "A Case of Organizing Pneumonia (OP) Associated with Pembrolizumab", "date": "2016", "keywords": "athens; immune; melanoma; patient; pd-1; pembrolizumab; pneumonia; university", "summary": "When COP is suspected in cancer patients, differential diagnoses that need to be considered include disease progres- sion, cardiogenic edema, radiation pneumonitis, allergies, pulmonary hemorrhage, and infections that cause diffuse inter- stitial infiltrates in the lungs such as gram-negative or gram- positive bacteria, fungi (Aspergillus, Candida, and P.\u00a0jirovecii), parasites (Toxoplasma gondii), or viruses (herpes simplex, vari- cella zoster, and cytomegalovirus).17 On the other hand, pneumonitis in cancer patients may hold a heterogeneous pathological background based on vari- ous antineoplastic agents including chemotherapy, such as taxanes, targeted therapy, such as everolimus, and Mabs, such as rituximab, a chimeric IgG1.17 In retrospective analysis of patients with non-Hodgkin lymphoma treated with rituximab, 8 of 23 patients, diagnosed with COP and treated with corticosteroids, died, indicat- ing that COP although rare may become a fatal pulmonary toxicity and the oncologists or internists must maintain a high index of suspicion to recognize this complication early. Introduction New monoclonal antibodies (Mabs) targeting the immune checkpoint blockade have revolutionized the treatment of advanced melanoma patients.", "mime": "application/pdf"}, {"id": "dti-1421", "words": "6023", "extension": ".pdf", "flesch": "50", "author": "Zahroh, Hilyatuz; Ma\u2019rup, Ahmad; Friend Tambunan, Usman Sumo; Parikesit, Arli Aditya", "title": "Immunoinformatics Approach in Designing Epitope-based Vaccine against Meningitis-inducing Bacteria (Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae Type b)", "date": "2016", "keywords": "antigen; cell; class; drb1; epitope; hla; hla class; influenzae; meningitidis; mhc; non; pneumoniae; prediction; protein; serogroup; table; type; vaccine", "summary": "non nKFrsLDDIaVTgYL hLa-DrB1*01:01(29.00), hLa-DrB1*04:01(201.00), hLa-DrB1*09:01(219.00), hLa-DrB1*04:05(325.00), hLa-DrB1*04:04 (440.00) antigen LhnKFrsLDDIaVTg hLa-DrB1*01:01(30.00), hLa-DrB1*04:01(203.00), hLa-DrB1*09:01(230.00), hLa-DrB1*04:05(303.00), hLa-DrB1*04:04(438.00) antigen FFnFeYIVKKLnnQn hLa-DrB1*11:01(18.00), hLa-DrB5*01:01(68.00), hLa-DrB1*04:04(207.00), hLa-DrB1*04:05(230.00), hLa-DrB1*01:01(323.00), hLa-DrB1*08:02(500.00) antigen YKPDFnsDaTsTsrF hLa-DrB1*04:01(19.00), hLa-DrB1*04:05(218.00), hLa-DrB1*01:01(236.00), hLa-DrB3*01:01(390.00), hLa-DrB1*07:01(429.00), hLa-DrB1*04:04(499.00) antigen KPDFnsDaTsTsrFL hLa-DrB1*04:01(19.00), hLa-DrB1*04:05(206.00), hLa-DrB1*01:01(207.00), hLa-DrB1*07:01(295.00), hLa-DrB3*01:01(461.00) antigen egePDYLngarnanT hLa-DrB1*01:01(100.00), hLa-DrB1*04:04(124.00), hLa-DrB1*04:01(256.00), hLa-DrB1*04:05(355.00) antigen MFILnnrKWrKLKrD hLa-DrB1*11:01(81.00), hLa-DrB1*03:01(142.00), hLa-DrB5*01:01(206.00), hLa-DrB1*13:02(373.00). antigen rnTgIKnsngKYIVF hLa-DrB1*13:02(11.00), hLa-DrB1*07:01(95.00), hLa- DrB1*09:01(248.00), hLa-DrB5*01:01(278.00), hLa-DrB1*01:01(483.00) antigen earnTgIKnsngKYI hLa-DrB1*13:02(12.00), hLa-DrB1*07:01(105.00), hLa-DrB1*09:01(266.00), hLa-DrB5*01:01(295.00) antigen sLLYILeKnaeMeFD hLa-DrB1*01:01(64.00), hLa-DrB1*04:01(123.00), hLa-DrB5*01:01(133.00), hLa-DrB1*04:04(161.00), hLa-DrB1*11:01(264.00), hLa-DrB1*04:05 (310.00) antigen LLYILeKnaeMeFDr hLa-DrB1*01:01(70.00), hLa-DrB1*04:01(128.00), hLa-DrB5*01:01(136.00), hLa-DrB1*04:04(172.00), hLa-DrB1*04:05(404.00) non KsLLYILeKnaeMeF hLa-DrB1*01:01(53.00), hLa-DrB1*04:01(118.00), hLa-DrB5*01:01(130.00), hLa-DrB1*04:04(147.00), hLa-DrB1*11:01(220.00), hLa-DrB1*04:05(237.00), hLa-DrB1*15:01(293.00), hLa-DrB1*12:01(392.00) non http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Zahroh et al 26 Drug TargeT InsIghTs 2016:10 Table 6.", "mime": "application/pdf"}, {"id": "dti-1422", "words": "3677", "extension": ".pdf", "flesch": "52", "author": "Ueda, Yuichiro; Ishii, Hiroki; Kitano, Taisuke; Shindo, Mitsutoshi; Miyazawa, Haruhisa; Ito, Kiyonori; Hirai, Keiji; Kaku, Yoshio; Mori, Honami; Hoshino, Taro; Ookawara, Susumu; Kakei, Masafumi; Tabei, Kaoru; Morishita, Yoshiyuki", "title": "Effects and Safety of Linagliptin as an Add-on Therapy in Advanced-Stage Diabetic Nephropathy Patients Taking Renin\u2013Angiotensin\u2013Aldosterone System Blockers", "date": "2016", "keywords": "blockers; diabetes; dmn; effects; glucose; linagliptin; patients; stage; study", "summary": "It is also a major risk factor for the develop- ment of cardiovascular disease.4 A poorly controlled blood glucose level and hypertension are the main contributors to progression to end-stage renal disease and the development of cardiovascular disease in DMN.5,6 Appropriate manage- ment of blood glucose and blood pressure levels is important to improve the prognosis of patients with DMN.7\u20139 Renin\u2013angiotensin\u2013aldosterone system (RAAS) block- ers are used as first-line agents for blood pressure control in DMN patients. They have been reported to decrease blood pressure and have beneficial nephroprotective and cardiopro- tective effects.10\u201312 For blood glucose control, although many kinds of hypoglycemic agents have been developed, most cannot be used in DMN patients with decreased renal function because they have diminished elimination by the kidneys, and may cause unfavorable side effects.", "mime": "application/pdf"}, {"id": "dti-1423", "words": "5975", "extension": ".pdf", "flesch": "47", "author": "Kitanaka, Junichi; Kitanaka, Nobue; Hall, F. Scott; Uhl, George R.; Takemura, Motohiko", "title": "Brain Histamine N-Methyltransferase as a Possible Target of Treatment for Methamphetamine Overdose", "date": "2016", "keywords": "abuse; activity; behavior; biting; brain; drug; effects; histamine; hmt; kitanaka; levels; meth; methamphetamine; metoprine; mice; overdose; pharmacol; receptors; stereotypy; treatment", "summary": "http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Kitanaka et al 4 Drug TargeT InsIghTs 2016:10 dependently decreased METH-induced stereotypical biting, while increasing sniffing, suggesting that metoprine may ame- liorate high-dose METH-induced symptoms by producing a leftward shift in METH behavioral effects (Table 1).65 In brain, for termination of histaminergic neurotransmission after activa- tion of histamine receptors, histamine is transferred from the extracellular space into cytoplasm by organic cation transporter 3 and/or the equilibrative nucleoside transporter (ENT4), and catabolized by the cytosolic enzyme histamine N-methyltrans- ferase (HMT) to form N-methylhistamine, which is inactive in the histaminergic system.55,56 HMT is the sole enzyme that degrades histamine in brain,57,58 whereas diamine oxidase (DAO; histaminase) catabolizes histamine in peripheral tis- sues.49,59", "mime": "application/pdf"}, {"id": "dti-1424", "words": "3331", "extension": ".pdf", "flesch": "35", "author": "\u00a0, \u00a0", "title": "Introductory Editorial: Drug-Eluting Stents or Drug-Eluting Grafts? Insights from Proteomic Analysis", "date": "2016", "keywords": "devices; drug; graft; insights; ita; spadaccio; surgery; target; tissue; university", "summary": "This has been considered as a marker of arterial stiffness and therefore increased risk of developing atherosclerosis.20 Structural proteomic studies on ITA tissue showed differential expression of proteins that are implicated in cytoskeleton activity regulation,21 in the migrative capacity of vascular smooth muscle cells, extracellular matrix composition, coagulation, apoptosis, and heat shock response.22 Interestingly, a proteomic analysis of the secrete of ITA, known as secretome, demonstrated an increased production of gelsolin, vinculin, lamin A/C and phosphoglucomutase 5 by mammary arterial tissues. Differential profiles of protein expression exclusively present in ITA tissues and secrete, but not in the other vessels, have been intriguingly discovered (Fig.\u00a01) and the identification of these proteins would provide in the future precious information to elucidate reasons of ITA superiority in CABG.", "mime": "application/pdf"}, {"id": "dti-1425", "words": "4337", "extension": ".pdf", "flesch": "49", "author": "Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo", "title": "Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery", "date": "2016", "keywords": "cardiac; collagen; dswi; gentamicin; gics; infection; patients; risk; sternal; surgery; use; wound", "summary": "ABSTR ACT: Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent.", "mime": "application/pdf"}, {"id": "dti-1426", "words": "5087", "extension": ".pdf", "flesch": "42", "author": "Spadaccio, Cristiano; Nappi, Francesco; De Marco, Federico; Sedati, Pietro; Sutherland, Fraser W.H.; Chello, Massimo; Trombetta, Marcella; Rainer, Alberto", "title": "Preliminary in Vivo Evaluation of a Hybrid Armored Vascular Graft Combining Electrospinning and Additive Manufacturing Techniques: Supplementary Issue: Current Developments in Drug Eluting Devices", "date": "2016", "keywords": "cells; drug; endothelial; engineering; et al; graft; heparin; plla; scaffold; study; tevg; tissue; vascular; vivo", "summary": "Armored vascular grafts were prepared as previously described.20 Briefly, a 13%\u00a0w/w PLLA (Sigma-Aldrich) solution in dichloromethane was combined with unfractioned heparin (sodium salt, 5000\u00a0 UI/mL; Mspharma) using methanol as a cosolvent. He W, Ma Z, Teo WE, et al.", "mime": "application/pdf"}, {"id": "dti-1548", "words": "8463", "extension": ".pdf", "flesch": "57", "author": "Mabrouk, Nada M.K.; Elkaffash, Dalal M.; Abdel-Hadi, Mona; Abdelmoneim, Salah-ElDin; Saad ElDeen, Sameh; Gewaifel, Gihan; Elella, Khaled A.; Osman, Maher; Baddour, Nahed", "title": "Identification of the possible therapeutic targets in the insulin-like growth factor 1 receptor pathway in a cohort of Egyptian hepatocellular carcinoma complicating chronic hepatitis C type 4", "date": "2020", "keywords": "aebp1; alexandria; analysis; cancer; carcinoma; cases; cell; expression; genes; hcc; hccs; hcv; human; insulin; liver; pathway; present; signaling; study; tumor", "summary": "Quantitative reverse transcription polymerase chain reaction (qRT-PCR) using RT2 Profiler PCR Array for Human Insulin Signaling Pathway was done to determine significantly up- and downregulated genes with identification of most frequently coregulated genes, followed by correlation of gene expression with different patient/tumor characteristics. Keywords: Gene expression, Hepatitis C virus, Hepatocellular carcinoma, Molecular therapeutic targets Received: January 8, 2020 Accepted: January 20, 2020 Published online: April 8, 2020 Corresponding author: Nada M.K. Mabrouk Department of Pathology University of Alexandria Alexandria, Egypt nada_mabrouk@hotmail.com, nada.mabrouk@alexmed.edu.eg Introduction Hepatocellular carcinoma (HCC) has become the fifth most common cancer in men worldwide and the ninth in women and the third leading cause of cancer-related deaths.", "mime": "application/pdf"}, {"id": "dti-2024", "words": "4985", "extension": ".pdf", "flesch": "58", "author": "de Souza, Elen M.; Oliveira, Gabriel M.; de Nazar\u00e9 C. Soeiro, Maria", "title": "Electrocardiographic Findings in Acutely and Chronically T. cruzi-infected Mice Treated by a Phenyl-Substituted Analogue of Furamidine DB569", "date": "2007", "keywords": "cardiac; chagas; cruzi; db569; disease; dpi; et al; infection; mice; souza", "summary": "The disease has two phases: the acute, which appears shortly after the infection, and the chronic phase, which can develop in about one-third of the infected individuals after a silent period of years or decades called the indeterminate phase (Cunha-Neto et al. 2006). Although the main clinical manifestations of the Chagas disease include both the cardiac and the digestive alterations, the former is the most prominent: about 25% to 30% of the infected people will develop a progressive heart disease commonly displaying symptomatic ventricular arrhythmias, hyper- trophy; congestive heart failure; sinus bradycardia and tachycardia; thomboembolism and sudden death (Marin-Neto et al. 1999; Salles et al. 2003).", "mime": "application/pdf"}, {"id": "dti-2025", "words": "3995", "extension": ".pdf", "flesch": "52", "author": "Kusumanto, Yoka H.; Meijer, Coby; Dam, Wendy; Mulder, Nanno H.; Hospers, Geke A.P.", "title": "Circulating Vascular Endothelial Growth Factor (VEGF) Levels in Advanced Stage Cancer Patients Compared to Normal Controls and Diabetes Mellitus Patients with Critical Ischemia", "date": "2007", "keywords": "cancer; elevated; et al; factor; growth; levels; patients; tumor; vegf; vegf levels", "summary": "A profi le of elevated VEGF levels in the more aggressive cancers compared to slow growing tumors and in those tumor types known to respond to VEGF antibody therapy, would support further studies on VEGF levels as predictive markers. We measured VEGF levels in whole blood in 42 patients with high grade (n = 26) and low grade (n = 16) end stage cancer, and in 28 healthy controls and 37 patients with diabetes related vascular disease.", "mime": "application/pdf"}, {"id": "dti-2103", "words": "5270", "extension": ".pdf", "flesch": "52", "author": "Sharma, Monica; Sharma, Swati; Ray, Pallab; Chakraborti, Anuradha", "title": "Targeting Streptococcus pneumoniae UDP-glucose pyrophosphorylase (UGPase): in vitro validation of a putative inhibitor", "date": "2020", "keywords": "a549; cells; effect; fig; host; inhibitor; pneumoniae; streptococcus; udp; ugpase", "summary": "Therefore, for the se- lection of UGPase inhibitor, we modeled and analyzed the structure of S. pneumoniae UGPase using I-TASSER (Iterative- Threading ASSEmbly Refinement) server (http://zhang.bioin- formatics.ku.edu/I-TASSER) to delineate its tertiary structure, active site residues, and properties. Results Putative inhibitor of UGPase The structure of S. pneumoniae UGPase was analyzed in silico using I-TASSER server (http://zhang.bioinformatics.", "mime": "application/pdf"}, {"id": "dti-2170", "words": "7564", "extension": ".pdf", "flesch": "57", "author": "Abayneh, Mengistu; Worku, Teshale", "title": "Prevalence of multidrug-resistant and extended-spectrum beta-lactamase (ESBL)-producing gram-negative bacilli: A meta-analysis report in Ethiopia", "date": "2020", "keywords": "analysis; beta; crossref; esbl; estimates; et al; ethiopia; gnb; isolates; mdr; meta; resistance; spectrum; studies; study", "summary": "Many reports have documented the differ- ence in ESBL proportion estimates between hospitals versus community-based surveys (23,25,27,30). For instance, in Ethiopia studies show that about 36.8% of the population got antibiotics from community drug retail outlets without a prescription and 67.9% of people had dis- continued the use of antibiotics once their symptoms subside (3).", "mime": "application/pdf"}, {"id": "dti-2185", "words": "11411", "extension": ".pdf", "flesch": "42", "author": "Tsuchiya, Hironori; Mizogami, Maki", "title": "Interaction of drugs with lipid raft membrane domains as a possible target", "date": "2020", "keywords": "cells; cholesterol; crossref; crossref medline; domains; dopc; drug; effects; fluidity; human; interaction; lipid; lipid rafts; medline; membrane; membrane fluidity; membrane lipid; model; mol%; molar; phase; popc; raft; ratio; receptors", "summary": "Phar- macologically relevant receptors, ion channels and enzymes are localized or cluster in membrane lipid rafts and caveolae (8-11). Given the localization of receptors, ion channels and en- zymes in membrane lipid rafts, the mode of drug action is first interpretable in a simple manner of receptor/channel/ enzyme and ligand interaction as known in the conventional mechanistic theory.", "mime": "application/pdf"}, {"id": "dti-2188", "words": "2499", "extension": ".pdf", "flesch": "54", "author": "Ayed, Khadija; Hadi Khalifa, Islam Latifa; Mokaddem, Salma; Ben Khamsa Jameleddine, Saloua", "title": "Paradoxical bronchoconstriction caused by \u03b22-adrenoceptor agonists", "date": "2020", "keywords": "agonists; bronchoconstriction; fev1; fvc; spirometry; terbutaline", "summary": "Baseline spirometry revealed a small airways obstruction, which is defined by a normal forced vital capacity (FVC), a normal FEV1/FVC ratio, and a decrease of at least one forced expiratory flow (FEF): FEF50%, FEF25%, or FEF between 25% and 75% of the FVC (FEF25-75). Many TABLE I - Spirometric parameters before and after salbutamol inhalation Spirometric parameters Baseline spirometry After salbutamol Measured % Predicted Measured % Predicted % Changing FEV1 2.36 L 74 1.76 L 55 \u221225 FVC 3.57 L 91", "mime": "application/pdf"}, {"id": "dti-2192", "words": "7537", "extension": ".pdf", "flesch": "51", "author": "de A. Morais, Ana H.; de Medeiros, Amanda F.; Medeiros, Isaiane; de Lima, Vanessa C.O.; Luz, Anna B.S.; Maciel, Bruna L.L.; Passos, Thais S.", "title": "Tamarind (Tamarindus indica L.) Seed a Candidate Protein Source with Potential for Combating SARS-CoV-2 Infection in Obesity", "date": "2021", "keywords": "adipose; coronavirus; cov-2; covid-19; crossref; crossref pubmed; effects; et al; food; infection; inflammation; inhibitor; obesity; potential; protease; protein; risk; sars; tissue; trypsin; tti", "summary": "Medeiros et al (70) described the TTI purification process, obtaining a molecule with 100% in- hibition for trypsin (pTTI), heat resistant and with a partially identified amino acid sequence (currently complete and with structural modeling\u2014unpublished data), which had high ho- mology with other trypsin inhibitors of the Kunitz family. Petersen A, Bressem K, Albrecht J, et al.", "mime": "application/pdf"}, {"id": "dti-2197", "words": "478", "extension": ".pdf", "flesch": "47", "author": "Khamsai, Sittichai; Sawanyawisuth, Kittisak; Senthong, Vichai; Limpawattana, Panita; Chindaprasirt, Jarin; Intapan, Pewpan M; Maleewong, Wanchai; Tiamkao, Somsak; Chotmongkol, Verajit; Ngamjarus, Chetta", "title": "Corticosteroid treatment reduces headache in eosinophilic meningitis: a systematic review", "date": "2021", "keywords": "search", "summary": "Search strategy in PubMed on 21 November 2019 (21 articles) #1 Search meningit*[Title/Abstract] #2 Search eosinophil*[Title/Abstract] #3 Search parasites #4 Search ((parasitic diseases) OR helminthiasis OR (nematode infections)) #5 Search (parasit* OR helminth* OR nematod*) #6 Search Angiostrongylus cantonensis #7 Search ((angiostrongylus cantonensis) OR (A. cantonenesis)) #8 Search (angiostrongylus cantonensis) OR (a. cantonensis) #9 Search (#3 OR #4 OR #5 OR #6 OR #7 OR #8) #10 Search (#1 AND #2) #11 Search (#9 AND #10) #12 Search Randomized Controlled Trial [Publication Type] #13 Search (random* OR placebo* OR trial* OR groups OR (controlled study)) #14 Search (#12 OR #13) #15 Search (#11 AND #14) Search strategy in Central on 22 November 2019 (3 articles) #1 meningit*:ti,ab,kw #2 eosinophil*:ti,ab,kw #3 parasites #4 (parasitic diseases) OR helminthiasis OR (nematode infections) #5 parasit* OR helminth* OR nematod* #6 Angiostrongylus cantonensis #7 (angiostrongylus cantonensis) OR (A. cantonenesis) #8 (angiostrongylus cantonensis) OR (a. cantonensis) #9 #3 OR #4 OR #5 OR #6 OR #7 OR #8 #10 #1 AND #2 #11 #9 AND #10 #12 (Randomized Controlled Trial) OR random* OR placebo* OR trial* OR groups OR (controlled study) #13 #11 AND #12 #14 Humans #15 #13 AND #14 Drug Target Insights 2021 | DOI: 10.33393/dti.2021.2197", "mime": "application/pdf"}, {"id": "dti-2277", "words": "7188", "extension": ".pdf", "flesch": "63", "author": "Watashi, Koichi; Shimotohno, Kunitada", "title": "Cyclophilin and Viruses: Cyclophilin as a Cofactor for Viral Infection and Possible Anti-Viral Target", "date": "2007", "keywords": "activity; binding; cells; csa; cyclophilin; cypa; cypb; et al; genome; hcv; human; protein; replication; rna; virus", "summary": "Ozaki, K., Fujiwara, T., Kawai, A., Shimizu, F., Takami, S., Okuno, S., Takeda, S., Shimada, Y., Nagata, M. and Watanabe, T. et al. 1996. Luo, C., Luo, H., Zheng, S., Gui, C., Yue, L., Yu, C., Sun, T., He, P., Chen, J., Shen, J. et al. 2004.", "mime": "application/pdf"}, {"id": "dti-2291", "words": "3350", "extension": ".pdf", "flesch": "55", "author": "Tongdee, Sukanya; Sawunyavisuth, Bundit; Sukeepaisarnjaroen, Wattana; Boonsawat, Watchara; Khamsai, Sittichai; Sawanyawisuth, Kittisak", "title": "Clinical factors predictive of appropriate treatment in COPD: a community hospital setting", "date": "2021", "keywords": "copd; crossref; disease; factors; gold; guideline; patients; pubmed; study; treatment", "summary": "Full information is available at www.aboutscience.eu Clinical factors predictive of appropriate treatment in COPD: a community hospital setting Sukanya Tongdee1, Bundit Sawunyavisuth2, Wattana Sukeepaisarnjaroen3, Watchara Boonsawat3, Sittichai Khamsai3, Kittisak Sawanyawisuth3 1Department of Medicine, Chumpae Hospital, Khon Kaen - Thailand 2Department of Marketing, Faculty of Business Administration and Accountancy, Khon Kaen University, Khon Kaen - Thailand 3Department of Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen - Thailand ABSTRACT Background: Chronic obstructive pulmonary disease (COPD) is a common respiratory disease. However, there are limited data on predictors of appropriate treatment in patients with COPD.", "mime": "application/pdf"}, {"id": "dti-2342", "words": "6535", "extension": ".pdf", "flesch": "47", "author": "Losi, Serena; Berra, Cesare Celeste Federico; Fornengo, Riccardo ; Pitocco, Dario ; Biricolti, Giovanni ; Orsini Federici, Marco ", "title": "The role of patient preferences in adherence to treatment in chronic disease: a narrative review", "date": "2021", "keywords": "adherence; crossref; diabetes; oral; osteoporosis; patient; persistence; preference; pubmed; satisfaction; studies; study; therapy; treatment", "summary": "Full information is available at www.aboutscience.eu The role of patient preferences in adherence to treatment in chronic disease: a narrative review Serena Losi1, Cesare Celeste Federico Berra2, Riccardo Fornengo3, Dario Pitocco4, Giovanni Biricolti5, Marco Orsini Federici1 1Eli Lilly Italy S.p.A., Sesto Fiorentino - Italy 2IRCCS MultiMedica, Sesto San Giovanni, Milano - Italy 3S.S.D. di Diabetologia ASL TO4, Torino - Italy 4Diabetes Care Unit Fondazione Policlinico Universitario Agostino Gemelli IRCCS, Roma - Italy 5Eli Lilly Italy S.p.A., Roma - Italy ABSTRACT Adherence to prescribed medication is important to the management of all diseases, especially those of chronic nature. We reviewed the available evidences on the impact of patient preferences for therapy on adherence to a prescribed treatment in chronic diseases requiring long-term treatment.", "mime": "application/pdf"}, {"id": "dti-2343", "words": "4240", "extension": ".pdf", "flesch": "49", "author": "Zuccarini, Silvio ; Puce, Fabrizio ; Cris\u00e0, Alessandro ", "title": "Anatomical and functional responses to single brolucizumab injection in neovascular age-related macular degeneration patients not responding to antiangiogenics: a case series", "date": "2022", "keywords": "age; brolucizumab; crossref; degeneration; fluid; injection; macular; neovascular; patients; pubmed; treatment", "summary": "Refractory neovascular age-related macular degeneration: time-dependent changes of central retinal thickness with anti-VEGF treatment. Optimizing anti-VEGF treatment outcomes for patients with neovascular age-related macular degeneration.", "mime": "application/pdf"}, {"id": "dti-2347", "words": "5884", "extension": ".pdf", "flesch": "53", "author": "Zambelli, Vanessa; Rizzi, Laura; Delvecchio, Paolo; Bresciani, Elena; Rezoagli, Emanuele ; Molteni, Laura; Meanti, Ramona; Cuttin, Maria Serena; Bovo, Giorgio; Coco, Silvia; Omeljaniuk , Robert J.; Locatelli, Vittorio; Bellani, Giacomo; Torsello, Antonio", "title": "Hexarelin modulates lung mechanics, inflammation, and fibrosis in acute lung injury", "date": "2021", "keywords": "acid; anova; ards; crossref; fibrosis; hcl; hexarelin; instillation; lung; mice; p<0.01; post; pubmed; sacrifice; treatment; vehicle", "summary": "The results of the pres- ent research demonstrate that hexarelin treatment reduces the development of lung fibrosis and further suggests that specific synthetic GHS could be developed in order to modu- late lung and cardiac fibrosis such as those associated with COVID-19 infections. In an extended study, mice were observed for a subsequent 14 days in order to assess lung fibrosis.", "mime": "application/pdf"}, {"id": "dti-2355", "words": "3312", "extension": ".pdf", "flesch": "48", "author": "Carriero, Martino", "title": "Erythrodermic psoriasis and palmoplantar hyperkeratosis successfully treated with secukinumab: a case report", "date": "2022", "keywords": "crossref; erythrodermic; il-17a; patients; psoriasis; pubmed; secukinumab; study; treatment", "summary": "A review of secukinumab in psoriasis treatment. Psoriasis may occur in different forms, such as plaque pso- riasis (characterized by dry scaly patches), which represents 80%-90% of psoriasis cases; pustular psoriasis (contains pus- like fluid mainly infiltrated with white blood cells); erythro- dermic psoriasis (EP, characterized by exfoliation of fine scaly skin with pain and itching); guttate psoriasis (characterized by drop-like dots); and inverse psoriasis (affects the flexure surfaces and characterized by smooth inflamed lesions) (1).", "mime": "application/pdf"}, {"id": "dti-2403", "words": "3499", "extension": ".pdf", "flesch": "49", "author": "Hammar, Oskar; Veress, Bela; Montgomery, Agneta; Ohlsson, Bodil ", "title": "Expression of Luteinizing Hormone Receptor in the Gastrointestinal Tract in Patients with and without Dysmotility", "date": "2012", "keywords": "bowel; cells; dysmotility; group; hormone; neurons; patients; range; receptor; tract", "summary": "However, presence of LH receptors in the gastrointestinal tract has never been described. Biopsies showed expression of LH receptors on myenteric neurons and in glial cells, neutrophils, endothelial cells and mast cells.", "mime": "application/pdf"}, {"id": "dti-2422", "words": "4355", "extension": ".pdf", "flesch": "57", "author": "Phungoen, Pariwat; Sarunyaparit, Jessada; Apiratwarakul, Korakot; Wonglakorn, Lumyai; Meesing, Atibordee; Sawanyawisuth, Kittisak", "title": "The association of ESBL Escherichia coli with mortality in patients with Escherichia coli bacteremia at the emergency department", "date": "2022", "keywords": "bacteremia; coli; crossref; esbl; factors; lactate; mortality; patients; pubmed; study", "summary": "ESBL E. coli ED14 \u00a9 2022 The Authors. In addition, there have been few studies regarding mortality in ESBL E. coli in ED settings, and results have been contradictory.", "mime": "application/pdf"}, {"id": "dti-2469", "words": "4956", "extension": ".pdf", "flesch": "51", "author": "Chordia Golchha, Nikita; Nighojkar, Anand; Nighojkar, Sadhana", "title": "Redefining genomic view of Clostridioides difficile through pangenome analysis and identification of drug targets from its core genome", "date": "2022", "keywords": "analysis; core; crossref; crossref pubmed; difficile; drug; drug target; genes; genome; pangenome; proteins; pubmed; strains; study; synthase; target", "summary": "2 - Core-pan plot of 97 strains of C. difficile genome. Full information is available at www.aboutscience.eu Drug Target Insights 2022; 16: 17-24 ISSN 1177-3928 | DOI: 10.33393/dti.2022.2469 ORIGINAL RESEARCH ARTICLE Redefining genomic view of Clostridioides difficile through pangenome analysis and identification of drug targets from its core genome Nikita Chordia Golchha1, Anand Nighojkar2, Sadhana Nighojkar3 1School of Biotechnology, Devi Ahilya University, Takshashila Campus, Indore - India 2Maharaja Ranjit Singh College of Professional Sciences, Hemkunt Campus, Indore - India 3Mata Gujri College of Professional Studies, Indore - India ABSTRACT Introduction:", "mime": "application/pdf"}, {"id": "dti-2476", "words": "9174", "extension": ".pdf", "flesch": "50", "author": "Sen, Pooja; Vijay, Mukund; Singh, Shweta; Hameed, Saif; Vijayaraghvan, Pooja", "title": "Understanding the environmental drivers of clinical azole resistance in Aspergillus species", "date": "2022", "keywords": "agents; antifungal; antimicrob; aspergillosis; aspergillus; aspergillus fumigatus; azole; azole resistance; chemother; crossref pubmed; cyp51a; drug; environmental; fumigatus; india; infect; infections; isolates; l98h; mutations; patients; resistance; species; study; triazole", "summary": "Aspergillus spe- cies and other molds in respiratory samples from patients with cystic fibrosis: a laboratory-based study with focus on Aspergillus fumigatus azole resistance. Azole resistant Aspergillus fumigatus: an emerging prob- lem.", "mime": "application/pdf"}, {"id": "dti-2477", "words": "16922", "extension": ".pdf", "flesch": "48", "author": "Zainol Abidin, Ismin; Murphy, Emma; Fehrenbach, Gustavo Waltzer; Rezoagli, Emanuele; Gately, Noel; Major, Ian", "title": "A systematic review of mucoadhesive vaginal tablet testing", "date": "2023", "keywords": "abidin et; al drug; articles; batches; chitosan; comparison; crossref; delivery; dissolution; drug; et al; formulation; khan et; mucoadhesive; pendekal et; polymer; pubmed; p\u00e9rez et; release; research; study; swelling; tablet; vaginal; \u221a \u221a", "summary": "Therefore, vaginal tablets still often represent the typi- cally acceptable dosage form with stability-related advan- tages and an economical choice for both manufacturers and users (17,18), thus advocating its role and relevance in the vaginal drug delivery system. Titles that specify a dosage form other than vaginal tablets (e.g., films, gels) and for veterinary purposes are essentially excluded.", "mime": "application/pdf"}, {"id": "dti-2481", "words": "3754", "extension": ".pdf", "flesch": "57", "author": "Shah, Syed Fahim; Paracha, Sohail Aziz; Ullah, Waheed; Muhammad, Iqbal; Iqbal, Somaid; Gul, Aisha; Hussain, Mudassir; Ullah, Hafiz; Zaman, Sadir", "title": "Success of 14-day triple and quadruple therapy for the control of Helicobacter pylori infections in Kohat district", "date": "2022", "keywords": "crossref; eradication; helicobacter; infection; patients; pubmed; pylori; therapy; treatment", "summary": "Published by AboutScience - www.aboutscience.eu TABLE II - Gastrointestinal symptom of patients Symptom Numbers Percentage (%) Epigastric pain 153/178 85.95 Recurrent abdominal pain 138/178 77.52 Nausea 141/178 79.21 Vomiting 70/178 39.32 Ballottement 30/178 16.85 Water brush 65/178 36.51 The hematological parameters of H. pylori patients included (n = 52) H. pylori positive patients whose hemato- logical values were compared with H. pylori negative control group (n = 52). The relationship between hematological para- meters of H. pylori positive patients and H. pylori negative control group was evaluated using confidential interval method by which the values are calculated for each para- meter that will fall between intervals.", "mime": "application/pdf"}, {"id": "dti-2482", "words": "8851", "extension": ".pdf", "flesch": "39", "author": "Pandey, Ramendra Pati; Mukherjee, Riya; Chang, Chung-Ming", "title": "Antimicrobial resistance surveillance system mapping in different countries", "date": "2022", "keywords": "amr; animals; antibiotic; antimicrobial; approach; bacteria; countries; data; drug; european; food; health; human; monitoring; national; research; resistance; species; surveillance; surveillance system; system", "summary": "It is the national human medicine AMR surveillance system. Similarly, AMR surveillance system for humans is also ana- lyzed by different organizations formed in these six European countries.", "mime": "application/pdf"}, {"id": "dti-2504", "words": "5956", "extension": ".pdf", "flesch": "53", "author": "Duong, Thuy B.; Duong, Minh C.; Campbell, James I.; Nguyen, Hoang V.M.; Nguyen, Hien H.; Bui, Hanh T.B.; Nguyen, Chau V.V.; Heywood, Anita", "title": "MRSA carriage among healthcare workers in a Vietnamese intensive care unit: a prospective cohort study", "date": "2022", "keywords": "aureus; care; carriage; control; crossref; hand; hcws; healthcare; icu; mrsa; nasal; pubmed; staphylococcus; study; vietnam", "summary": "Conclusion: MRSA carriage among HCWs is not rare. The questionnaire was developed based on the available lit- erature regarding the sources and vectors of MRSA as well as risk factors for MRSA carriage in healthcare settings (3,11).", "mime": "application/pdf"}, {"id": "dti-2510", "words": "6511", "extension": ".pdf", "flesch": "48", "author": "Shetty, Bhavya; Fazal, Ibrahim; Khan, Safiya Fatima; Nambiar, Manjusha; Irfana D, Khadijathul; Prasad, Rohit; Raj, Akshata", "title": "Association between cardiovascular diseases and periodontal disease: more than what meets the eye", "date": "2023", "keywords": "association; atherosclerosis; clin; crossref; cvd; disease; et al; evidence; health; heart; oral; pathogens; patients; periodontal; periodontitis; review; risk; studies; study", "summary": "Full information is available at www.aboutscience.eu Association between cardiovascular diseases and periodontal disease: more than what meets the eye Bhavya Shetty1, Ibrahim Fazal1, Safiya Fatima Khan2, Manjusha Nambiar2, Khadijathul Irfana D1, Rohit Prasad1, Akshata Raj1 1Department of Periodontics, Faculty of Dental Sciences, Ramaiah University of Applied Sciences, Bangalore, Karnataka - India 2Department of Periodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital, Bangalore, Karnataka - India ABSTRACT Cardiovascular diseases (CVDs) are inflammatory diseases of coronary arteries accompanying atheroma forma- tion that can spawn impairment and, in severe cases, death. In recent decades, investigators have focused their impact on CVD by periodontal disease (PD).", "mime": "application/pdf"}, {"id": "dti-2512", "words": "6835", "extension": ".pdf", "flesch": "60", "author": "Nandi, Sisir; Kumar, Mohit; Kumari, Rashmi; Saxena, Aaruni", "title": "Exploring the inhibitory mechanisms of indazole compounds against SAH/MTAN-mediated quorum sensing utilizing QSAR and docking", "date": "2022", "keywords": "ala150; asp197; ch3; compounds; crossref; glu172; h n; h2c; h2c n; h3c; ile152; indazole; met173; mtan; n ch3; n cl; n s; o o; phe151; phe335; qsar; s o; sah; target", "summary": "Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti ZMIC3, ZMIC4, ZMIC5, Kier1, Kier2, Kier3, nAtomLC, nAtomP, nAtomLAC, MLogP, MDEC-11, MDEC-12, MDEC-13, MDEC-22, MDEC- 23, MDEC-24, MDEC-33, MDEC-34, MDEO-11, MDEN-22, MLFER_A, MLFER_BH, MLFER_S, MLFER_E, MLFER_L, MPC2, MPC3, MPC8, MPC10, piPC1, piPC3, piPC5, piPC6, piPC10, R_TpiPCTPC, PetitjeanNumber, nRing, n6Ring, nTRing, nHeteroRing, nF10HeteroRing, nRotB, RotBFrac, nRotBt, RotBtFrac, LipinskiFailures, topoRadius, topoDiameter, GGI1, GGI2, GGI3, GGI4, GGI5, GGI6, GGI7, GGI8 , GGI9, GGI10, JGI1, JGT, VE1_D, VE3_D, VR1_D VR3_D, TopoPSA, MWC3, MWC6, MWC10, SRW7, SRW9, AMW, WTPT-2, WTPT-3, WPATH, XLogP, TDB1u, TDB2u, TDB3u, TDB4u, TDB5u, TDB6u, TDB7u, TDB8u, TDB9u, TDB10u, TDB6m, TDB7m, TDB8m, TDB9m, TDB10m, TDB1v, TDB3v, TDB4v, TDB5v, TDB6v, TDB7v, TDB8v, TDB9v, TDB10v, TDB1e, TDB2e, TDB3e, TDB4e, TDB5e, TDB6e, TDB7e, TDB8e, TDB9e, TDB10e, TDB1p, TDB3p, TDB4p, TDB5p, TDB6p, TDB7p, TDB8p, TDB9p, TDB10p, TDB1i, TDB2i, TDB3i, TDB4i, TDB5i, TDB6i, TDB7i, TDB8i, TDB9i, TDB10i, TDB1s, TDB3s, TDB5s, TDB6s, TDB7s, TDB8s, TDB9s, TDB10s, TDB1r, TDB2r, TDB3r, TDB4r, TDB5r, TDB6r, TDB7r, TDB8r ,TDB9r, TDB10r, PPSA-1, PPSA-2, PPSA-3, PNSA-1, PNSA-2, PNSA-3, DPSA-1, DPSA-2, DPSA-3, FPSA-1, FPSA-2, FNSA-2, FNSA-3, WPSA-1, WPSA-2, WPSA- 3, WNSA-1, WNSA-2, WNSA-3, RPCG, RNCG, RPCS, RNCS, THSA, TPSA, RHSA, GRAV-1, GRAVH-3, GRAV-4, LOBMAX, LOBMIN, MOMI-X, MOMI-Y, MOMI-Z, MOMI-XY, MOMI-XZ, MOMI-R, geomRadius, geomDiameter, geomShape, RDF10u, RDF15u, RDF20u, RDF25u, RDF30u, RDF35u, RDF40u, RDF45u, RDF50u, RDF55u, RDF60u, RDF65u, RDF70u, RDF75u, RDF80u, RDF85u, RDF90u, RDF95u, RDF100u, RDF105u, RDF110u, RDF115u, RDF120u, RDF125u, RDF130u, RDF135u, RDF140u, RDF145u, RDF150u, RDF155u, RDF15m, RDF20m, RDF25m, RDF30m, RDF35m, RDF40m, RDF45m, RDF50m, RDF55m, RDF60m, RDF65m, RDF70m, RDF75m, RDF80m, RDF85m, RDF90m, RDF95m, RDF100m, RDF105m, RDF110m, RDF115m, RDF120m, RDF125m, RDF130m, RDF135m, RDF140m, RDF145m, RDF150m, RDF155m, RDF20v, RDF25v, RDF30v, RDF35v, RDF40v, RDF45v, RDF50v, RDF55v, RDF60v, RDF65v, RDF70v, RDF75v, RDF80v, RDF85v, RDF90v, RDF95v, RDF100v, RDF105v, RDF110v, RDF115v, RDF120v, RDF125v, RDF130v, RDF135v, RDF140v, RDF145v, RDF150v, RDF155v, RDF30e, RDF35e, RDF70e, RDF80e, RDF95e, RDF100e, RDF155e, RDF15p, RDF20p, RDF30p, RDF35p, RDF40p, RDF45p, RDF50p,RDF60p, RDF65p, RDF70p, RDF75p, RDF80p, RDF85p, RDF90p, RDF95p, RDF100p, RDF115p, RDF130p, RDF135p, RDF140p, RDF145p, RDF150p, RDF155p, RDF30i, RDF65i, RDF10s, RDF15s, RDF20s, RDF25s, RDF30s, RDF35s, RDF40s, RDF45s, RDF50s, RDF55s, RDF60s, RDF65s, RDF70s, RDF75s, RDF80s, RDF85s, RDF90s, RDF95s, RDF100s, RDF105s, RDF110s, RDF115s, RDF120s, RDF125s, RDF130s, RDF135s, RDF140s, RDF145s, RDF150s, RDF155s, L1u, L2u, L3u, P1u, P2u, E1u, E2u, E3u, Tu, Au, Vu, Du, L1m, L2m, L3m, P1m, P2m, E1m, E2m, E3m, Tm, Am, Vm, Dm, L1v, L2v, L3v, P1v, P2v, E1v, E2v, E3v, Tv, Av, Vv, Dv, P2e, E1e, E2e, E3e, De, L1p, P1p, P2p, E1p, E2p, E3p, Dp, E1i, E2i, Di, E1s, E2s. TABLE II - Descriptors used in the current study ALogP, ALogp2, AMR, apol, naAromAtom, nAtom, nHeavyAtom, nH, nC, nN, nO, nS, nF, nCl, nX, ATS0m, ATS1m, ATS2m, ATS3m, ATS4m, ATS5m, ATS6m, ATS7m, ATS8m, ATS2v, ATS4v, ATS6v, ATS7v, ATS8v, ATS0e, ATS3e, ATS4e, ATS5e, ATS6e, ATS7e, ATS8e, ATS0p, ATS3p, ATS5p, ATS0s, ATS1s, ATS2s, ATS3s, ATS4s, ATS5s, ATS6s, ATS7s, ATS8s, AATS0m, AATS1m, AATS2m, AATS3m, AATS4m, AATS5m, AATS6m, AATS7m, AATS8m, AATS0v, AATS1v, AATS2v, AATS3v, AATS4v, AATS5v, AATS6v, AATS7v, AATS8v, AATS0e, AATS1e, AATS2e, AATS3e, AATS4e, AATS5e, AATS6e, AATS7e, AATS8e, AATS0p, AATS1p, AATS2p, AATS3p, AATS4p, AATS5p, AATS6p, AATS7p, AATS8p, AATS0i, AATS1i, AATS2i, AATS3i, AATS4i, AATS5i, AATS6i, AATS7i, AATS8i, AATS0s, AATS1s, AATS2s, AATS3s, AATS4s, AATS5s, AATS6s, AATS7s, AATS8s, ATSC0c, ATSC1c, ATSC2c, ATSC3c, ATSC4c, ATSC5c, ATSC6c, ATSC7c, ATSC8c, ATSC0m, ATSC1m, ATSC2m, ATSC3m, ATSC4m, ATSC5m, ATSC6m, ATSC7m, ATSC8m, ATSC0v, ATSC1v, ATSC2v, ATSC3v, ATSC4v, ATSC5v, ATSC6v, ATSC7v, ATSC8v, ATSC0e, ATSC1e, ATSC2e, ATSC3e, ATSC4e, ATSC5e, ATSC6e, ATSC7e, ATSC8e, ATSC0p, ATSC1p, ATSC2p, ATSC3p, ATSC4p, ATSC5p, ATSC6p, ATSC7p, ATSC8p, ATSC0i, ATSC1i, ATSC2i, ATSC3i, ATSC4i, ATSC5i, ATSC6i, ATSC7i, ATSC8i, ATSC0s, ATSC1s, ATSC2s, ATSC3s, ATSC4s, ATSC5s, ATSC6s, ATSC7s, ATSC8s, AATSC0m, AATSC1m, AATSC2m, AATSC3m, AATSC4m, AATSC5m, AATSC6m, AATSC7m, AATSC8m, AATSC0v, AATSC1v, AATSC2v, AATSC3v, AATSC4v, AATSC5v, AATSC6v, AATSC7v, AATSC8v, AATSC0e, AATSC2e, AATSC6e, AATSC7e, AATSC0p, AATSC2p, AATSC3p, AATSC4p, AATSC5p, AATSC6p, AATSC7p, AATSC8p, AATSC0i, AATSC1i, AATSC2i, AATSC3i, AATSC4i, AATSC5i, AATSC6i, AATSC7i, AATSC8i, AATSC0s, AATSC1s, AATSC2s, AATSC3s, AATSC4s, AATSC5s, AATSC6s, AATSC7s, AATSC8s, MATS1c, MATS2c, MATS3c, MATS4c, MATS5c, MATS6c, MATS7c, MATS8c, MATS1m, MATS2m, MATS3m, MATS4m, MATS5m, MATS6m, MATS7m, MATS8m, MATS1e, MATS2e, MATS3e, MATS4e, MATS5e, MATS6e, MATS7e, MATS8e, MATS1p, MATS2i, MATS3i, MATS5i, MATS6i, MATS7i, MATS8i, MATS1s, MATS2s, MATS3s, MATS4s, MATS5s, MATS6s, MATS7s, MATS8s, GATS1c, GATS2c, GATS3c, GATS4c, GATS5c, GATS6c, GATS7c, GATS8c, GATS1m, GATS2m, GATS3m, GATS4m, GATS5m, GATS6m, GATS7m, GATS8m, GATS1v, GATS2v, GATS3v, GATS4v, GATS5v, GATS6v, GATS7v, GATS8v, GATS1e, GATS2e, GATS3e, GATS4e , GATS5e, GATS6e, GATS7e, GATS8e, GATS1p, GATS2p, GATS3p, GATS4p, GATS5p, GATS6p, GATS7p, GATS8p, GATS1i, GATS2i, GATS3i, GATS4i, GATS5i, GATS6i, GATS7i, GATS8i, GATS1s, GATS2s, GATS3s, GATS4s, GATS5s, GATS6s, GATS7s, GATS8s, SpAbs_DzZ, SpMAD_ DzZ, SM1_DzZ, VE1_DzZ, VE3_DzZ, VR1_DzZ, VR3_DzZ, VR1_Dzm, VR2_Dzm, VR3_Dzm, SM1_Dzv, VE1_Dzv, VE3_Dzv, VR1_Dzv, VR2_Dzv, VR3_Dzv, SM1_Dze, VE1_Dze, VE3_Dze, VR1_Dze, VR3_Dze, SpAbs_Dzp, SpMAD_Dzp, SM1_Dzp, VE1_Dzp, VE3_Dzp, VR1_Dzp, VR3_Dzp, SM1_Dzi, VE1_Dzi, VE3_Dzi, VR1_Dzi, VR3_Dzi, SpAbs_Dzs, SpMAD_Dzs, SM1_Dzs, VE1_Dzs, VE3_Dzs, VR1_Dzs, VR2_Dzs, VR3_Dzs, BCUTw-1l, BCUTw-1h, BCUTc-1l, BCUTc-1h, BCUTp-1l, BCUTp-1h, nBondsS2, nBondsS3, nBondsD, nBondsD2, nBondsM bpol, SpMax2_ Bhm, SpMax3_Bhm, SpMax4_Bhm, SpMax5_Bhm, SpMax6_Bhm, SpMax7_Bhm, SpMax8_Bhm, SpMin1_Bhm, SpMin2_Bhm, SpMin3_ Bhm, SpMin4_Bhm, SpMin5_Bhm, SpMin6_Bhm, SpMin7_Bhm, SpMin8_Bhm, SpMax1_Bhv, SpMax2_Bhv, SpMax3_Bhv, SpMax4_Bhv, SpMax5_Bhv, SpMax6_Bhv, SpMax7_Bhv, SpMax8_Bhv, SpMin1_Bhv, SpMin2_Bhv, SpMin3_Bhv, SpMin4_Bhv, SpMin5_Bhv, SpMin6_Bhv, SpMin7_Bhv, SpMin8_Bhv, SpMax1_Bhe, SpMax2_Bhe, SpMax3_Bhe, SpMax4_Bhe, SpMax6_Bhe, SpMax7_Bhe, SpMax8_Bhe, SpMin1_ Bhe, SpMin2_Bhe, SpMin3_Bhe, SpMin4_Bhe, SpMin5_Bhe, SpMin6_Bhe, SpMin7_Bhe, SpMin8_Bhe, SpMax1_Bhp, SpMax2_Bhp, SpMax3_Bhp, SpMax4_Bhp, SpMax7_Bhp, SpMin1_Bhp, SpMin2_Bhp, SpMin3_Bhp, SpMin4_Bhp, SpMin7_Bhp, SpMin8_Bhp, SpMax2_ Bhi, SpMax3_Bhi, SpMax4_Bhi, SpMax5_Bhi, SpMax8_Bhi, SpMin2_Bhi, SpMin3_Bhi, SpMin4_Bhi, SpMin5_Bhi, SpMin7_Bhi, SpMax1_Bhs, SpMax2_Bhs, SpMax3_Bhs, SpMax4_Bhs, SpMax5_Bhs, SpMax6_Bhs, SpMax7_Bhs, SpMax8_Bhs, SpMin1_Bhs, SpMin2_Bhs, SpMin3_ Bhs, SpMin4_Bhs, SpMin5_Bhs, SpMin6_Bhs, SpMin7_Bhs, SpMin8_Bhs, C1SP2, C2SP2, C3SP2, C1SP3, C2SP3, C3SP3, C4SP3, SCH-3, SCH-6, SCH-7, VCH-6, VCH-7, SC-3, SC-4, SC-5, SC-6, VC-3, VC-5, SPC-4,SPC-5, SPC-6, VPC-4, VPC-5, VPC-6, SP-2, SP-3, SP-4, SP-6, SP-7, VP-0, VP-2, VP-3, VP-4, VP-5, VP-6, VP-7, AVP-0, AVP-1, AVP-2, Mare, Mi, CrippenLogP, SpMax_Dt, SpMAD_Dt, VE1_Dt, VE3_Dt, VR1_Dt, VR2_Dt, VR3_Dt, ECCEN, nHBd, nHBa, nwHBa, nHBint2, nHBint3, nHBint4, nHBint5, nHBint6, nHBint7, nHBint8, nHBint9, nHBint10, nHsOH, nHssNH, nHdsCH, nHaaCH, nHCsats, nHCsatu, nsCH3, nssCH2, naasC, naaaC, nssssC, naaN, nsssN, SHBd, SHBa, SwHBa, SHBint2, SHBint3, SHBint4, SHBint5, SHBint6, SHBint7, SHBint8, SHBint9, SHBint10, SHssNH, SHaaNH, SHaaCH, SHCsats, SssCH2, SaaCH, SsssCH, SdssC, SaasC, SaaaC, SssNH, SaaNH, SdO, SddssS, SsCl, minHBd, minHBa, minwHBa, minHBint2, minHBint3, minHBint5, minHBint6, minHBint9, minHBint10, minHaaCH, minHCsats, minHCsatu, minHother, minsCH3, minssCH2, minaaCH, minaasC, minaaaC, minssNH, minaaN, mindO, minsF, minsCl, maxHBd, maxHBa, maxwHBa, maxHBint2, maxHBint3, maxHBint5, maxHBint6, maxHBint10, maxHssNH, maxHaaCH, maxHCsats, maxsCH3, maxssCH2, maxaaCH, maxaasC, maxaaaC, maxssssC, maxssNH, maxaaN, maxdO, maxsCl, sumI, meanI, hmax, LipoaffinityIndex, DELS, MAXDN2, DELS2, ETA_Alpha, ETA_Epsilon_1, ETA_Epsilon_2, ETA_Epsilon_4, ETA_Epsilon_5, ETA_dEpsilon_B, ETA_Psi_1, ETA_Shape_P, ETA_Shape_Y, ETA_Shape_X, ETA_Beta, ETA_BetaP, ETA_Beta_s, ETA_BetaP_s, ETA_Beta_ns, ETA_BetaP_ns, ETA_dBeta, ETA_dBetaP, ETA_Beta_ns_d, ETA_BetaP_ns_d, ETA_Eta, ETA_EtaP, ETA_Eta_F, ETA_EtaP_F, ETA_Eta_L, ETA_EtaP_L, ETA_Eta_F_L, ETA_EtaP_F_L, ETA_Eta_B, ETA_Eta_B_RC, FMF, fragC, nHBAcc, nHBAcc2, nHBAcc3, HybRatio, IC0, IC1, IC2, IC3, IC4, IC5, TIC0, TIC1, TIC2, TIC3, SIC0, SIC1, SIC2, SIC3, SIC4, SIC5, CIC0, CIC1, CIC2, CIC3, CIC4, BIC1, BIC2, BIC3, BIC4, BIC5, MIC0, MIC1, MIC2, MIC3, MIC4, ZMIC0, ZMIC1, ZMIC2, QSAR and docking of indazole compounds against SAH/MTAN-mediated QS64 \u00a9 2022 The Authors.", "mime": "application/pdf"}, {"id": "dti-2520", "words": "5424", "extension": ".pdf", "flesch": "42", "author": "Kalra, Swinder Jeet Singh; Hari Shankar; Nasim Mansoori; Gupta, Dablu Lal", "title": "Antibiotic-resistant bacteria originating from the gut may modulate the mucosal immune response during sepsis and septic shock", "date": "2022", "keywords": "bacteria; cells; crossref; crossref pubmed; development; disease; diversity; gut; gut microbiota; host; india; microbiota; mucosal; pubmed; resistance; sepsis; system", "summary": "Several studies have confirmed that a mutual association between gut microbiota and the host is important for the metabolism of essential nutrients for the organism, for gut development, and for the maturation and development of a fully functional immune system. Full information is available at www.aboutscience.eu Drug Target Insights 2022; 16: 81-87 ISSN 1177-3928 | DOI: 10.33393/dti.2022.2520 REVIEW Antibiotic-resistant bacteria originating from the gut may modulate the mucosal immune response during sepsis and septic shock Swinder Jeet Singh Kalra1, Hari Shankar2, Nasim Mansoori3, Dablu Lal Gupta4 1D.A-V College Kanpur, Uttar Pradesh - India 2Indian Council of Medical Research (ICMR), New Delhi - India 3All India Institute of Medical Sciences (AIIMS), New Delhi - India 4All India Institute of Medical Sciences (AIIMS), Raipur, Chhattisgarh - India ABSTRACT The enrichment and diversity of gut microbiota play an important role in sepsis, but the role of gut microbiota composition and early-life colonization in sepsis and septic shock has not yet been characterized.", "mime": "application/pdf"}, {"id": "dti-2522", "words": "7434", "extension": ".pdf", "flesch": "50", "author": "Sim, Yi Xing; Lee, Qiao Wei; Abushelaibi, Aisha; Lai, Kok-Song; Lim, Swee Hua Erin; Maran, Sathiya", "title": "Current molecular approach for diagnosis of MRSA: a meta-narrative review", "date": "2022", "keywords": "aureus; crossref; crossref pubmed; detection; diagnosis; dna; et al; methicillin; microbiol; mrsa; pcr; pubmed; resistance; review; sccmec; staphylococcus; staphylococcus aureus; study; typing", "summary": "Latour et al 2019 Belgium 1,447 residents from nursing homes Pooled sampling of nose, throat and perineum Cross-sectional prevalence survey Triplex PCR and MLST (20) 17 Hida et al 2019 Japan 263 patients suspected of having staphylococcal bacteremia Fresh and frozen blood culture samples n/a GENECUBE mecA (21) 18 Luo et al 2018 China 275 isolates of S. aureus, including 148 isolates from patients, 127 from ready-to- eat food samples Secretions, blood, phlegm, cerebrospinal fluid, transudation, urine, fresh meat, meat product, cereal products, fruits and vegetables n/a PCR, multiplex PCR (22) 19 Lin et al 2018 Taiwan 106 hemodialysis patients diagnosed with MRSA Blood cultures Retrospective study PCR and MLST (23) 20 Yang et al 2017 China 104 children diagnosed with MRSA Sputum, bronchioalveolar lavage fluid, skin and soft tissues, pus, secretions, secretions of omphalitis, blood, joint effusion, pleural effusion n/a MLST (24) BSI = bloodstream infection; DNA = deoxyribonucleic acid; MALDI-TOF = matrix-assisted laser desorption/ionization-time of flight; MLST = multilocus sequence typing; MRSA = methicillin-resistant Staphylococcus aureus; MRSE = methicillin-resistant Staphylococcus epidermidis; MSSA = methicillin-sensitive Staphylococcus aureus; n/a = not available; PCR = polymerase chain reaction; SCCmec = staphylococcal cassette chromosome mec; spa = staphylococcal protein A. GPCC = Gram positive cocci in clusters; MSSA-PENS = methicillin-sensitive S. aureus \u2013 penicillin-susceptible; OAI = osteoarticular infections; SSSS = Staphylo- coccal scalded skin syndrome ; SSTI = skin and soft tissue infections; PVL = Panton Valentine leukocidin Results The dataset includes 20 different authors from Asia (n = 13), Africa (n = 5), Europe (n = 1) and America (n = 1).", "mime": "application/pdf"}, {"id": "dti-2529", "words": "5813", "extension": ".pdf", "flesch": "60", "author": "Khemla, Supphachoke; Meesing, Atibordee; Sribenjalux, Wantin; Chetchotisakd, Ploenchan", "title": "Lipid profiles of people with human immunodeficiency virus with dyslipidemia after switching from efavirenz to dolutegravir", "date": "2023", "keywords": "cholesterol; efv; hiv; lipid; mean; patients; pubmed; study; week; weight", "summary": "Week 12 Week 24 Change from week 0 vs. 12 p-Value Change from week 0 vs. 24 p-Value Change from week 12 vs. 24 p-Value Diff 95% CI Diff 95% CI Diff 95% CI Total cholesterol 209.69 \u00b1 38.99 170.88 \u00b1 36.43 176.91 \u00b1 35.14 \u221238.81 \u00b1 25.86 \u221232.35, \u221212.00 <0.001 \u221232.78 \u00b1 33.55 \u221241.16, \u221224.39 <0.001 6.03 \u00b1 33.56 \u22122.35, 14.41 0.156 LDL- cholesterol 131.88 \u00b1 36.17 106.17 \u00b1 31.37 110.88 \u00b1 30.72 \u221225.70 \u00b1 23.31 \u221231.53, \u221219.88 <0.001 \u221221.00 \u00b1 29.41 \u221228.34, \u221213.65 <0.001 4.71 \u00b1 26.78 \u22121.98, 11.39 0.165 HDL- cholesterol 54.45 \u00b1 13.56 48.20 \u00b1 12.48 50.23 \u00b1 13.23 \u22126.24 \u00b1 7.52 \u22128.12, \u22124.36 <0.001 \u22124.21 \u00b1 8.12 \u22126.24, \u22122.18 <0.001 2.03 \u00b1 6.13 0.49, 3.56 0.010 Triglycerides 181.64 \u00b1 94.12 145.47 \u00b1 77.75 131.94 \u00b1 75.28 \u221236.17 \u00b1 89.88 \u221258.62, \u221213.71 0.002 \u221249.70 \u00b1 67.40 \u221266.54, \u221232.86 <0.001 13.53 \u00b1 67.79 \u221230.46, 3.40 0.115 Cholesterol/ HDL 4.00 \u00b1 0.93 3.69 \u00b1 1.01 3.69 \u00b1 1.06 \u22120.31 \u00b1 0.61 \u22120.46, \u22120.15 <0.001 \u22120.31 \u00b1 0.85 \u22120.52, \u22120.09 0.005 \u22120.003 \u00b1 0.81 \u22120.21, 1.9 0.973 CI = confidence interval; HDL = high-density lipoprotein; LDL = low-density lipoprotein; SD = standard deviation. Week 12 Week 24 Change from week 0 vs. 12 p-Value Change from week 0 vs. 24 p-Value Change from week 12 vs. 24 p-Value Diff 95% CI Diff 95% CI Diff 95% CI Bodyweight, kg 66.00 \u00b1 12.02 66.97 \u00b1 12.46 67.39 \u00b1 12.58 0.97 \u00b1 1.88 0.49, 1.44 <0.001 1.39 \u00b1 2.49 0.77, 2.01 <0.001 0.42 \u00b1 1.85 \u22120.04, 0.88 0.073 Body mass index, kg/m2 23.99 \u00b1 3.51 24.32 \u00b1 3.55 24.49 \u00b1 3.67 0.32 \u00b1 0.67 0.16, 0.49 <0.001 0.49 \u00b1 0.92 0.27, 0.73 <0.001 0.17 \u00b1 0.68 \u22120.001, 0.34 0.051 Waist circum- ference, cm 87.79 \u00b1 10.82 89.33 \u00b1 11.38 90.39 \u00b1 10.95 1.53 \u00b1 2.60 0.88, 2.18 <0.001 2.60 \u00b1 4.27 1.53, 3.68 <0.001 1.06 \u00b1 3.65 0.15, 1.97 0.023 ASCVD risk score* 4.56 \u00b1 4.30 (N = 42) 3.99 \u00b1 3.71 (N = 39) 4.69 \u00b1 4.67 (N = 44) 0.464 \u00b1 1.43 \u22120.04, 0.97 0.07 0.14 \u00b1 1.92 \u22120.49, 0.77 0.66 \u22120.11 \u00b1 1.48 \u22120.59, 0.38 0.66 ASCVD = atherosclerotic cardiovascular disease; LDL = low-density lipoprotein; SD = standard deviation.", "mime": "application/pdf"}, {"id": "dti-2532", "words": "2322", "extension": ".pdf", "flesch": "35", "author": "Sharma, Monica; Walia, Kamini; Bansal, Nitin", "title": "Unmet needs for management of drug-resistant infections: low- and middle-income countries\u2019 viewpoint", "date": "2022", "keywords": "antimicrobial; countries; crossref; drug; india; infections; pubmed; resistance", "summary": "National estimates of resistant infections, etiology of infections, type of infections, and local resistance rates and patterns can be utilized to set research priorities regarding challenges and opportunities to tackle resistant pathogens in different healthcare and community settings. Gram-negative pathogens, drug-resistant tuberculosis, and multidrug- resistant Salmonella typhi have been reported as cause of resistant infections in developing countries.", "mime": "application/pdf"}, {"id": "dti-2545", "words": "1535", "extension": ".pdf", "flesch": "40", "author": "Kothari, Vijay", "title": "AMR research: a perspective from personal experience", "date": "2022", "keywords": "amr; anti; committee; research; surveillance", "summary": "If people with such exaggerated simplistic perception of AMR research happen to head some academic institute, they may do even more harm by indirectly dissuad- ing brilliant young minds to join AMR labs. AMR research: a perspective from personal experience Vijay Kothari Institute of Science, Nirma University, Ahmedabad - India Received: December 12, 2022 Accepted: December 12, 2022 Published online: December 23, 2022 Corresponding author: Dr. Vijay Kothari Institute of Science, Nirma University S-G Highway, Ahmedabad-382481 - India vijay.kothari@nirmauni.ac.in minimum bactericidal concentration (MBC) of test com- pounds, that is, screening molecules/natural extracts for bactericidal activity through broth dilution assay.", "mime": "application/pdf"}, {"id": "dti-2548", "words": "972", "extension": ".pdf", "flesch": "39", "author": "Iriti, Marcello", "title": "Natural Products & Phytotherapeutics: why a new section?", "date": "2023", "keywords": "anticancer; drugs; phytotherapeutics; products", "summary": "According to one of the most authoritative reports focus- ing on natural products as sources of new drugs, the use of natural products and their synthetic derivatives is still piv- otal in the discovery of new drugs (1). Indeed, among the new drugs approved (N = 1881) in the last four decades, about 25% are natural products (Fig. 1A).", "mime": "application/pdf"}, {"id": "dti-2573", "words": "3404", "extension": ".pdf", "flesch": "57", "author": "Rattanathanoo, Ratchanon; Chindaprasirt, Jarin; Boonsawat, Watchara; Limpawattana, Panita; Khamsai, Sittichai; Sawanyawisuth, Kittisak", "title": "Are calcium channel blockers related to lung cancer?", "date": "2023", "keywords": "cancer; ccb; crossref; factors; lung; lung cancer; patients; pubmed; risk; study", "summary": "The case-control study did not state how lung cancer diagnosis was made and sig- nificant factors in this study, namely dyslipidemia and family history of lung cancer, were not studied (12). Association between family history and lung cancer risk among Chinese women in Singapore.", "mime": "application/pdf"}, {"id": "dti-2574", "words": "4729", "extension": ".pdf", "flesch": "52", "author": "Zambelli, Vanessa; Murphy, Emma J.; Del Vecchio, Paolo; Rizzi, Laura; Fumagalli, Roberto; Rezoagli, Emanuele; Bellani, Giacomo", "title": "Treatment with levosimendan in an experimental model of early ventilator-induced diaphragmatic dysfunction", "date": "2023", "keywords": "care; crossref; diaphragm; levosimendan; muscle; pubmed; treatment; vidd; vidd+levo", "summary": "However, prolonged MV is also associated with numerous potential complications including https://doi.org/10.33393/dti.2023.2574 https://creativecommons.org/licenses/by-nc/4.0/legalcode mailto:vanessa.zambelli@unimib.it Effects of levosimendan treatment on diaphragmatic injury40 \u00a9 2023 At the end of the MV, rats without levosimendan treatment showed a significant lower MAP versus VIDD + Levo group, as demonstrated in Table I.", "mime": "application/pdf"}, {"id": "dti-2583", "words": "5583", "extension": ".pdf", "flesch": "43", "author": "Khan, Safiya Fatima; Shetty, Bhavya; Fazal, Ibrahim; Mustafa Khan, Asim; Muzaffar Mir, Faheem; Moothedath, Muhamood; VJ, Reshma; Muhamood, Muhaseena", "title": "Licorice as a herbal extract in periodontal therapy", "date": "2023", "keywords": "acid; activity; crossref; crossref pubmed; disease; effects; extract; glabra; glabridin; glycyrrhiza; licorice; periodontitis; potential; pubmed; study; therapy; treatment", "summary": "The bioactive ingredients in licorice extract such as glycyrrhizin, licoricidin, glabridin, licochalcone A, and licorisoflavan A have anti-inflammatory, antimicro- bial, and anti-adherence effects that are beneficial against periodontal disease. Components in licorice extract Licorice is a potential source of natural anti-inflammatory agents.", "mime": "application/pdf"}, {"id": "dti-2593", "words": "1492", "extension": ".pdf", "flesch": "47", "author": "Inno, Alessandro; Fabiana Marchetti; Matteo Valerio; Niccol\u00f2 Giaj Levra; Filippo Alongi; Giovanni Foti; Stefania Gori", "title": "Activity of sotorasib against brain metastases from NSCLC harboring KRAS p.G12C mutation: a case report", "date": "2023", "keywords": "brain; kras; metastases; nsclc; sotorasib", "summary": "The patient was started on sotorasib, and the brain magnetic resonance imaging (MRI) after 2 months of treatment showed stability of the cerebellar metastasis, reduction in size of the previ- ously treated parietal right metastasis with improvement of the surrounding edema, reduction in size of the previously untreated right frontal lobe metastasis, and no appearance of new brain metastases (Fig. 1). Full information is available at www.aboutscience.eu Activity of sotorasib against brain metastases from NSCLC harboring KRAS p.G12C mutation: a case report Alessandro Inno1, Fabiana Marchetti1, Matteo Valerio1, Niccol\u00f2 Giaj Levra2, Filippo Alongi2, Giovanni Foti3, Stefania Gori1 1Medical Oncology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy 2Advanced Radiation Oncology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy 3Radiology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy ABSTRACT In the CodeBreaK 100 phase 2 study, sotorasib was active for patients with metastatic non-small cell lung cancer (NSCLC) harboring Kirsten rat sarcoma viral oncogene homologue (KRAS)", "mime": "application/pdf"}, {"id": "dti-2595", "words": "7343", "extension": ".pdf", "flesch": "47", "author": "Ruparel, Feny J.; Shah, Siddhi K.; Patel, Jhanvi H.; Thakkar, Nidhi R.; Gajera, Gemini N.; Kothari, Vijay O.", "title": "Network analysis for identifying potential anti-virulence targets from whole transcriptome of Pseudomonas aeruginosa and Staphylococcus aureus exposed to certain anti-pathogenic polyherbal formulations", "date": "2023", "keywords": "aeruginosa; analysis; aureus; crossref; crossref pubmed; genes; network; nitrite; panchvalkal; pathogens; potential; ppi; protein; pseudomonas; pubmed; sulfur; targets; virulence", "summary": "The eight pro- teins (Tab. I) found to be members of minimum two clusters can be said to be potential hubs, whose downregulation can be hypothesized to attenuate P. aeruginosa virulence. Methods: Transcriptomes of P. aeruginosa and S. aureus exposed to two different quorum-modulatory polyherbal formulations were subjected to network analysis to identify the most highly networked differentially expressed genes (hubs) as potential anti-virulence targets.", "mime": "application/pdf"}, {"id": "dti-2596", "words": "8488", "extension": ".pdf", "flesch": "64", "author": "Bumbrah, Gurvinder Singh; Jain, Sarika; Fatima, Zeeshan; Hameed, Saif", "title": "Efficacy of LAMP assay for Mycobacterial spp. detection to prevent treatment delays and onset of drug resistance: a systematic review and meta-analysis", "date": "2023", "keywords": "amplification; crossref; detection; diagnosis; lamp; pubmed; studies; tuberculosis", "summary": "S. No. Study Accuracy Precision 1 Boehme et al (2007) 98.68 97.74 2 Pandey et al (2008) 94.00 93.75 3 Poudel et al (2009) 95.54 94.17 4 Geojith et al (2011) 60.71 94.44 5 George et al (2011) 94.36 93.93 6 Mitarai et al (2011) 88.75 95.60 7 Nagdev et al (2011) 85.18 88.23 8 Sethi et al (2013) 87.96 100.00 9 Cao et al (2015) 94.30 95.14 10 Joon et al (2015) 92.06 54.90 11 Moon et al (2015) 94.71 91.42 12 Bojang et al (2016) 95.86 90.74 13 Gray et al (2016) 93.64 86.42 14 Kaku et al (2016) 94.49 96.40 15 Modi et al (2016) 97.60 100.00 16 Sharma et al (2016) 92.94 100.00 17 Joon et al (2017) 97.03 73.91 18 Reddy et al (2017) 91.07 87.50 19 Sharma et al (2016) 93.57 100.00 20 Yadav et al (2017) 99.33 96.47 21 Kim et al (2018) 94.13 100.00 22", "mime": "application/pdf"}, {"id": "dti-2613", "words": "6181", "extension": ".pdf", "flesch": "49", "author": "Kalambry, Aim\u00e9 C\u00e9saire; Potindji, Tchamou Malraux Fleury; Guindo, Ibrehima; Kassogu\u00e9, Ambara; Drame, Boubacar Sidiki Ibrahim; Togo, Seydou; Yena, Sadio; Doumbia, Seydou; Diakite, Mahamadou", "title": "A ESBL and carbapenemase-producing Enterobacteriaceae in infectious pleural effusions: current epidemiology at H\u00f4pital du Mali", "date": "2023", "keywords": "antibiotic; carbapenemase; coli; crossref; enterobacteriaceae; esbl; genes; isolates; mali; patients; prevalence; pubmed; resistance; study", "summary": "In addition, the following genes were screened for their role in conferring antibiotic resistance: the catA1 gene responsible for encod- ing chloramphenicol acetyltransferase, mutations on genes encoding for topoisomerase IV, and DNA gyrase protective proteins targeted by quinolones (qnrA, qnrB, qnrS), as well as class 1 (int1), class 2 (int2), and class 3 (int3) integrons, which carry resistance genes for multiple antibiotics. A recent study by Tapia et al in 2021 reported 13.3% mortality rate (6).", "mime": "application/pdf"}, {"id": "dti-2614", "words": "3933", "extension": ".pdf", "flesch": "48", "author": "ALmughais, Ebtehaj Saud; Alreshidi, Fatmah Fahad; Ahmed, Hussain", "title": "Prevalence of antibiotic misuse in cases of pneumonia and diarrhea in Saudi Arabia", "date": "2023", "keywords": "antibiotic; children; crossref; diarrhea; misuse; parents; pneumonia; pubmed; saudi; study; total", "summary": "The Saudi TABLE IV - Distribution of antibiotic use status in relation to educa- tion, occupation, and income of the parents Antibiotic misuse Maximizing antibiotic use improves medical outcomes, reduces toxicity, and prevents resistance (2).", "mime": "application/pdf"}, {"id": "dti-2622", "words": "4696", "extension": ".pdf", "flesch": "47", "author": "So-ngern, Apichart; Osaithai, Naphol; Meesing, Atibordee; Chumpangern, Worawat", "title": "Mortality rate and factors associated with mortality of carbapenem-resistant Enterobacteriaceae infection", "date": "2023", "keywords": "antibiotic; carbapenem; cre; crossref; day; factors; infection; mortality; patients; pubmed; study", "summary": "This current study endorsed the ESMID guidelines that are recommended for CRE infection treatment; in case new BLBIs are not avail- able, the combination antibiotic therapy of drugs active in vitro should be considered (8). Objective: To determine the 30-day mortality and factors associated with a 30-day mortality of CRE infection.", "mime": "application/pdf"}, {"id": "dti-2626", "words": "2598", "extension": ".pdf", "flesch": "57", "author": "Inno, Alessandro; Bogina, Giuseppe; Settanni, Giulio; Salgarello, Matteo; Foti, Giovanni; Pomari, Carlo; Picece, Vincenzo; Gori, Stefania", "title": "First-line tepotinib for a very elderly patient with metastatic NSCLC harboring MET exon 14 skipping mutation and high PD-L1 expression", "date": "2023", "keywords": "chemotherapy; crossref; line; lung; nsclc; patients; tepotinib; treatment", "summary": "Keywords: Elderly, First-line treatment, MET 14-exon skipping mutation, MET inhibitor, Non-small cell lung cancer, Tepotinib Received: July 3, 2023 Accepted: September 19, 2023 Published online: October 6, 2023 Corresponding author: Alessandro Inno Medical Oncology IRCCS Ospedale Sacro Cuore Don Calabria Via don A. Sempreboni 5 37024 Negrar di Valpolicella (VR) - Italy alessandro.inno@sacrocuore.it patients (2,3). Stage was cT1c N0 M1c, IVB according to the American Introduction Mesenchymal epithelial transition gene (MET) exon 14 (METex14) skipping mutations occur in approximately 3-4% of non-small cell lung cancer (NSCLC) (1).", "mime": "application/pdf"}, {"id": "dti-2637", "words": "2507", "extension": ".pdf", "flesch": "45", "author": "Babyshkina, Nataliya; Popova, Nataliya; Grigoryev , Evgeny; Dronova , Tatyana; Gervas , Polina; Dobrodeev , Alexey; Kostromitskiy , Dmitry; Goldberg , Victor; Afanasiev , Sergei; Cherdyntseva , Nadejda", "title": "Long-term response with the atypical reaction to nivolumab in microsatellite stability metastatic colorectal cancer: A case report", "date": "2024", "keywords": "cancer; mcrc; nivolumab; patients; response; treatment", "summary": "Focal nodules in the lung at start of nivolumab treatment (A); 5 months after nivolumab treatment, reduction of lung nodules (B) and para-aortic lym- ph node lesion up to 12 mm (C); 8 months after nivolumab tre- atment, disappearance of lung lesions (D) and lack of growth of para-aortic lymph node lesion (E); increase of para-aortic lym- ph node lesion 40 months after nivolumab treatment (F). Nivolumab (Opdivo) is a human immunoglobulin G4 monoclonal antibody that blocks the interaction between the programmed cell death 1 (PD-1) receptor and its ligands 1/2 (PD-L1/PD-L2), leading to inhibition of T-cell proliferation, cytokine secretion, and enhanced immune response.", "mime": "application/pdf"}, {"id": "dti-2638", "words": "6559", "extension": ".pdf", "flesch": "52", "author": "Gajera, Gemini; Henriksen, Niel; Cox, Bryan; Kothari, Vijay", "title": "Identification of anti-pathogenic activity among in silico predicted small-molecule inhibitors of Pseudomonas aeruginosa LasR or nitric oxide reductase (NOR)", "date": "2023", "keywords": "activity; aeruginosa; bacteria; compounds; crossref; crossref pubmed; drug; host; inhibitors; lasr; pseudomonas; pubmed; screening; sensing; target; virulence; worms", "summary": "TABLE II - Anti-pathogenic activity of potential LasR inhibitors may be masked by their anthelmintic activity Lab code Manufacturer\u2019s code Conc (\u00b5g/mL) % anti-pathogenic activity based on fifth day end-point Without nullifying compound\u2019s toxicity towards worms After nullifying compound\u2019s toxicity towards worms G2 Z65195564 25 10 \u00b1 0*** 67 \u00b1 0*** G5 Z354444420 25 33 \u00b1 5*** 87 \u00b1 5*** G6 Z400859658 25 3 \u00b1 5.7 83 \u00b1 5.7*** G10 Z1426094174 25 33 \u00b1 5*** 90 \u00b1 5*** G11 Z1625994950 25 6 \u00b1 11.5 93 \u00b1 11.5*** G14 Z104586200 25 23 \u00b1 5.7** 50 \u00b1 5.7*** G18 Z1084397894 25 16 \u00b1 5.7** 63 \u00b1 5.7*** G19 Z1212781307 Table IV - Anti-pathogenic activity of potential NOR inhibitors may be masked by their anthelmintic activity Lab code Manufacturer\u2019s code Conc (\u00b5g/mL) % anti-pathogenic activity based on fifth day end-point Without nullifying compound\u2019s toxicity towards worms After nullifying compound\u2019s toxicity towards worms (A) (B) N4 Z954454636 25 25 \u00b1 7** 60 \u00b1 7** N36 Z397755956 25 40 \u00b1 0** 65 \u00b1 0*** N37 Z1190350270 25 20 \u00b1 0*** 45 \u00b1 0*** N61 Z2740017161 50 20 \u00b1 14 80 \u00b1 14** N65 Z1874308288 25 15 \u00b1 21 40 \u00b1 21** **p<0.01, ***p<0.001.", "mime": "application/pdf"}, {"id": "dti-2660", "words": "9204", "extension": ".pdf", "flesch": "45", "author": "Pothoven, Ria", "title": "Management of urinary tract infections in the era of antimicrobial resistance", "date": "2023", "keywords": "amr; antibiotic; burden; crossref; crossref pubmed; guidelines; infections; patients; prophylaxis; pubmed; recurrent; resistance; review; therapy; tract; tract infections; treatment; urinary; use; utis; women", "summary": "Reducing antibiotic use in uncomplicated urinary tract infections in adult women: a sys- tematic review and individual participant data meta-analysis. Updates to recurrent uncomplicated urinary tract infections in women: AUA/CUA/SUFU Guideline.", "mime": "application/pdf"}, {"id": "dti-2670", "words": "1583", "extension": ".pdf", "flesch": "47", "author": "Diarra, Luka; Mariko, Moussa; Traore, Salif; Dicko, Safi Bazi; Dolo, Aboudou; Coulibaly, Moussa; Sidib\u00e9, Daouda; Daou, Moumouni; Poma, Hachimi; Traor\u00e9, Madou; Guindo, Ibrahim", "title": "Evaluation of non-conformities in the drafting of bulletins for urine cytobacteriological examinations at Sikasso Hospital (Mali)", "date": "2024", "keywords": "compliance; ecbu; hospital; non; reports; study", "summary": "The majority of non-compliant reports came from the medicine (35.51%) and urology (25.85%) departments. Yes 350 52.08 No 322 47.92 The majority of non-compliance bulletins came from the medicine (35.51%) and urology (25.85%) departments (Fig. 1).", "mime": "application/pdf"}, {"id": "dti-2707", "words": "14666", "extension": ".pdf", "flesch": "52", "author": "Munjal, Kavita; Goel, Yash; Gauttam, Vinod Kumar; Chopra, Hitesh; Singla, Madhav; Smriti; Gupta, Saurabh; Sharma, Rohit", "title": "Molecular targets and therapeutic potential of baicalein: a review", "date": "2024", "keywords": "activity; anti; apoptosis; arrest; authors; baicalein; cancer; cells; crossref pubmed; cycle; cyclin; disease; drug; effects; et al; expression; gastric; growth; insights; levels; pathway; pharmacol; phase; potential; production; research; review; scutellaria; study; target; treatment; vitro; wang; zhang", "summary": "et al. Baicalein induces G1 arrest in oral cancer cells by enhancing the degradation of cyclin D1 and activating AhR to decrease Rb phosphorylation. Takahashi H, Chen MC, Pham H, et al. Baicalein, a component of Scutellaria baicalensis, induces apoptosis by Mcl-1 down- regulation in human pancreatic cancer cells.", "mime": "application/pdf"}, {"id": "dti-2745", "words": "5524", "extension": ".pdf", "flesch": "55", "author": "Rauf, Abdur; Rashid, Umer; Al Masoud, Najla; Akram, Zuneera; Saeed, Anees; Muhammad, Naveed; Alomar, Taghrid S.; Naz, Saima; Iriti, Marcello", "title": "In vivo analgesic, anti-inflammatory, sedative, muscle relaxant activities, and docking studies of 3\u2019,4\u2019,7,8-tetrahydroxy-3-methoxyflavone isolated from Pistacia chinensis", "date": "2024", "keywords": "analgesic; anti; chinensis; compound; crossref; effect; extract; figure; interaction; muscle; opioid; pistacia; pubmed; receptor", "summary": "The extract (100 mg/kg) exhibited a sig- nificant (p<0.01) prolonged latency time (16.76 seconds) as TABLE 1 - Analgesic effect of Pistacia chinensis crude extract and isolated compound Group Dose (mg/kg) Time (minutes) 30 60 90 120 NS 10 mL 9.18 \u00b1 0.06 9.19 \u00b1 0.09 9.17 \u00b1 0.10 9.20 \u00b1 0.08 Tramadol 10 25.23 \u00b1 0.07*** 25.30 \u00b1 0.13*** 26.00 \u00b1 0.15*** 26.43 \u00b1 0.12*** Extract 25 9.65 \u00b1 0.90 13.98 \u00b1 0.43 14.00 \u00b1 0.27 13.90 \u00b1 0.87 50 12.43 \u00b1 0.79 16.09 \u00b1 0.66** 16.98 \u00b1 0.64** 17.00 \u00b1 0.54** 100 14.76 \u00b1 0.66 19.49 \u00b1 0.65** 17.07 \u00b1 0.43** 16.90 \u00b1 0.23** 250 16.76 \u00b1 0.76** 21.65 \u00b1 0.54*** 22.24 \u00b1 0.21*** 21.98 \u00b1 0.11*** Compound 1 2.5 11.76 \u00b1 0.45 14.98 \u00b1 0.54 15.00 \u00b1 0.34 14.87 \u00b1 0.39 5 13.09 \u00b1 0.66 17.34 \u00b1 0.28** 17.98 \u00b1 0.54** 17.32 \u00b1 0.40** 10 17.32 \u00b1 0.55 20.87 \u00b1 0.51*** 20.98 \u00b1 0.28*** 20.07 \u00b1 0.45*** 15 20.03 \u00b1 0.45*** 24.08 \u00b1 0.55 24.65 \u00b1 0.54*** 24.11 \u00b1 0.43*** ANOVA Sattar S, Khan MR, Shah NA, Noureen F, Naz K. Nephroprotective potential of Pistacia chinensis bark extract against induced tox- icity in rats.", "mime": "application/pdf"}, {"id": "dti-3019", "words": "11386", "extension": ".pdf", "flesch": "43", "author": "Natsheh, Iyad Y.; Alsaleh, Majd M.; Alkhawaldeh, Ahmad K.; Albadawi, Duaa K.; Darwish, Maisa\u2019 M.; Shammout, Mohammed Jamal A.", "title": "The dark side of drug repurposing. From clinical trial challenges to antimicrobial resistance: analysis based on three major fields", "date": "2024", "keywords": "amr; antibiotics; antimicrobial; approach; authors; bacteria; challenges; clinical; colchicine; crossref pubmed; development; discovery; diseases; drug; drug repurposing; effects; et al; human; infections; insights; levofloxacin; medications; models; patients; potential; repurposing; resistance; review; study; target; treatment; trials; use", "summary": "Moreover, long-term exposure to antibiotics, whether at clinical or sub-stoichiometric doses, can lead to the develop- ment of drug resistance among gut microbes. Challenges in diabetes endeavor Drug repurposing trials in the field of diabetes have encountered numerous hurdles and instances of failure.", "mime": "application/pdf"}, {"id": "dti-3059", "words": "5336", "extension": ".pdf", "flesch": "53", "author": "Gupta, Dablu Lal; Meher, Jhasketan; Giri, Anjan Kumar; Shukla, Arvind Kumar; Mohapatra, Eli; Ruikar, Manisha M; Rao, DN", "title": "RBD mutations at the residues K417, E484, N501 reduced immunoreactivity with antisera from vaccinated and COVID-19 recovered patients", "date": "2024", "keywords": "antibodies; antibody; cov-2; covid-19; crossref; immunoreactivity; patients; peptides; pubmed; rbd; sars; study; variants", "summary": "Conclusion The study concludes that multiple variants of SARS-CoV-2, including the Delta and Omicron variants, reduced immuno- reactivity with polyclonal sera by vaccine-induced humoral immunity. Keywords: Antibodies, COVID-19, Immune escape, Immunoreactivity, Mutation, SARS-CoV-2 Received: March 1, 2024 Accepted: May 7, 2024 Published online: May 31, 2024 This article includes supplementary material Corresponding author: Dablu Lal Gupta email: dr.dlgupta@aiimsraipur.edu.in world (3).", "mime": "application/pdf"}, {"id": "dti-3060", "words": "4482", "extension": ".pdf", "flesch": "47", "author": "Aslam, Hafiz Muhammad; Sohail, Azka; Shahid, Ammara; Khan, Maham Abdul Bari; Muhammad Umar Sharif; Kausar, Razia; Nawab, Samia; Farooq, Waqas; Jilani, Dr. Kashif; Rasheed, Majeeda", "title": "Levofloxacin induces erythrocyte contraction leading to red cell death", "date": "2024", "keywords": "activity; cell; crossref; crossref pubmed; eryptosis; erythrocyte; levofloxacin; membrane; pubmed; stress", "summary": "Mean \u00b1 SEM (n = 10) of erythrocytes incubated in Ringer\u2019s solution for 48 hours without levofloxacin in white bar and with levofloxacin concentrations (7, 14 \u00b5M) in black bars. The high PS exposure on the outer leaflet of erythrocyte\u2019s plasma membrane in levofloxacin-treated erythrocytes indicates that levofloxacin exposure leads to increased eryptosis.", "mime": "application/pdf"}, {"id": "dti-3076", "words": "2506", "extension": ".pdf", "flesch": "47", "author": "Mistry, Nerges", "title": "Tuberculosis research: Quo vadis", "date": "2024", "keywords": "crossref; crossref pubmed; drug; pubmed; research; resistance; tuberculosis", "summary": "This is a powerful phenomenon to study the evolution of drug resistance in the coming years. Another paradigm has been the linkage of gut microbi- ome to the phenomenon of drug resistance in an individual (10).", "mime": "application/pdf"}, {"id": "dti-3082", "words": "10408", "extension": ".pdf", "flesch": "48", "author": "Parmar, Sweety; Gajera, Gemini; Thakkar, Nidhi; Palep, Hanmanthrao S.; Kothari, Vijay", "title": "Deciphering the molecular mechanisms underlying anti-pathogenic potential of a polyherbal formulation Enteropan\u00ae against multidrug-resistant Pseudomonas aeruginosa", "date": "2024", "keywords": "aeruginosa; analysis; assay; biofilm; control; crossref; crossref pubmed; culture; drug; effect; enteropan; fig; formulation; genes; insights; network; pathogen; potential; pre; protein; pseudomonas; pubmed; target; virulence; worms", "summary": "B) PPI net- work of top-ranked genes reve- aled through cytoHubba among upregulated differentially ex- pressed genes (DEG) in Entero- pan-exposed P. aeruginosa. Then we looked for genes which appear among top-10 ranked candidates by \u22656 cytoHubba methods, and 10 such genes (Tab. S11) were identified as potential hubs, whose downregulation can be hypothesized to attenuate P. aeruginosa virulence.", "mime": "application/pdf"}, {"id": "dti-3169", "words": "7194", "extension": ".pdf", "flesch": "54", "author": "Alghamdi, Ali Hendi; Ahmed, Aimun A. E.; Bashir, Mahadi; Abdalgadir, Hiadar; Khalid, Asaad; Abdallah, Mohamed E.; Almaimani, Riyad; Refaat, Bassem; Abdalla, Ashraf N.", "title": "Cytotoxic activity, selectivity, and clonogenicity of fruits and resins of Saudi medicinal plants against human liver adenocarcinoma", "date": "2024", "keywords": "activity; arabia; bep-10; cells; crossref; crossref pubmed; drug; effect; et al; extract; ficus; fruits; hepg2; indica; myrrha; opuntia; plant; pubmed; saudi; selectivity", "summary": "Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti TABLE 1 - Phytoconstituents identified by GC-MS analysis of the extract of Opuntia ficus-indica (L.) Miller (BEP-10) Compound Formula Molecular weight Peak area (%) Retention time (minutes) Biological activity \u2002(1)\u2002\ufffd5-(hydroxymethyl)-2- furancarboxaldehyde C6H6O3 126.11 13.2 5.875 Known\ufffdto\ufffdbe\ufffdassociated\ufffdwith\ufffdantimicrobial\ufffd properties\ufffd(56)\ufffdused\ufffdas\ufffdan\ufffdantifungal\ufffd(57) \u2002(2)\u2002\ufffd1-(4\u2032-Hydroxyphenyl)-2-propanone C9H10O2 150.17 2.52 7.752 Exhibits\ufffda\ufffdmyriad\ufffdof\ufffdpharmacological\ufffdactions,\ufffdsuch\ufffd as\ufffdantimicrobial,\ufffdantitussive,\ufffdantispasmodic,\ufffdand\ufffd anticancer\ufffdproperties\ufffd(58) \u2002(3)\u2002\ufffd4-Butyl-phenol\ufffd C10H14O 150.22 2.93 8.011 No\ufffdsignificant\ufffdreport \u2002(4)\u2002\ufffd1,6-Anhydro-beta-D-glucopyranose C6H10O5 162.14 5.31 8.328 No\ufffdsignificant\ufffdreport \u2002(5)\u2002\ufffdEthylalpha-d-glucopyranoside C8H16O6 208.09 4.60 9.245 Maintenance\ufffdand\ufffdimprovement\ufffdof\ufffdskin\ufffd homeostasis\ufffdand\ufffdmoisturizing\ufffdfunctions\ufffd(59) \u2002(6)\u2002\ufffdBenzeneacetic\ufffd acid,\ufffd 4-hydroxy-,\ufffd methyl\ufffdester Extract MCF7 HT29 HepG2 Average* IC50 MRC5 BEP-09 6.00\u00b11.61 8.20\u00b10.57 5.20\u00b10.58 6.47 2.94\u00b10.71 BEP-10 1.85\u00b10.73 5.85\u00b10.23 0.75\u00b10.11** 2.82** 3.34\u00b10.41 BEP-11 16.93\u00b10.66 16.07\u00b10.11 14.07\u00b11.04 15.69 10.77\u00b10.54 BEP-12 16.53\u00b10.43 19.32\u00b10.64 9.60\u00b10.82 15.15 8.72\u00b11.56 Doxorubicin 0.07\u00b10.01 1.98\u00b10.10 2.15\u00b10.15 1.40 5.86\u00b10.35 Camptothecin 0.08\u00b10.01 2.50\u00b10.26 0.76\u00b10.07 1.11 1.18\u00b10.10 *Average\ufffdcytotoxicity\ufffd(IC50)\ufffdof\ufffdeach\ufffdextract\ufffdagainst\ufffdthe\ufffdthree\ufffdcancer\ufffdcells.\ufffd**p\ufffd\u2264\ufffd0.01.", "mime": "application/pdf"}, {"id": "dti-3171", "words": "7063", "extension": ".pdf", "flesch": "55", "author": "Mishra, Abhay; Yalo, Masande; Nambooze, Jennifer; Pohl, Carolina H.; Kemp, Gabr\u00e9; Setsiba, Lekgoana K.; Matsabisa, Motlalepula G.", "title": "Characterization and enhanced antibiofilm activity of Annona muricata extract in combination with fluconazole against Candida albicans", "date": "2025", "keywords": "albicans; annona; asp; biofilms; candida; compound; crossref; drug; extract; fig; fluconazole; gly; leaves; muricata; pubmed; tyr", "summary": "Aliquots of 200 \u00b5L of the cell suspen- sion, including A. muricata methanol extract (reconstituted in sterile water) (AM), fluconazole (FLU) and a combination of the extract and antifungal drug (AM + FLU) at final con- centrations ranging from 15-240 \u00b5g/ml was dispensed into a 96-well microtiter plate (Corning Incorporated, Costar\u00ae, U.S.) and incubated for 48 hours at 37\u00b0C to allow biofilm forma- tion. Results and Discussion LCMS profile of A. muricata methanol extract A total of 17 phytochemicals were detected by LC/MS and 14 among them were identified (Table 1).", "mime": "application/pdf"}, {"id": "dti-3177", "words": "5133", "extension": ".pdf", "flesch": "51", "author": "Shahrivar, Firooz; Sadraei, Javid; Pirestani, Majid; Ahmadpour, Ehsan", "title": "Enhancement of apoptosis in Caco-2, Hep-G2, and HT29 cancer cell lines following exposure to Toxoplasma gondii peptides", "date": "2024", "keywords": "apoptosis; caco-2; cancer; cell; crossref; expression; gondii; hep; hours; ht29; lines; peptide; pubmed; toxoplasma", "summary": "Our investigation shows that parasite-derived peptide could induce apoptosis in cancer cell lines, which was in line with the lately done study by Bahadory et al (10). Cell viability rates were assessed at FIGURE 1 - The cell viability of cancer cells.", "mime": "application/pdf"}, {"id": "dti-3213", "words": "5743", "extension": ".pdf", "flesch": "54", "author": "Galeone, Carlotta; Turati, Federica; Nicol\u00f2, Massimo; Parravano, Mariacristina; Vujosevic, Stela; Bianchino, Laura; Sicari, Emilia; Lanzetta, Paolo", "title": "Faricimab versus the standard of care for neovascular age-related macular degeneration in Italy: an indirect treatment comparison", "date": "2024", "keywords": "age; analysis; anti; baseline; crossref; cst; degeneration; faricimab; patients; pubmed; radiance; soc; study; treatment; vegf", "summary": "Optimizing anti-VEGF treatment outcomes for patients with neovascular age-related macular degeneration. Of those, 17 were excluded because they did not satisfy the inclusion criteria (i.e., patients with diagnosis of nAMD, na\u00efve to any intraocular anti-VEGF treatment, with age \u226550 years on the date of the first anti-VEGF injection), 1 because of the lack of hospital charts/clinical records at anti-VEGF treatment start, 43 because of the lack of at least two VA measurements after the baseline, and 81 because of the lack of a VA measurement at week 52 \u00b1 10.", "mime": "application/pdf"}, {"id": "dti-3219", "words": "753", "extension": ".pdf", "flesch": "81", "author": "Nxasana, Thembelihle; Mangoato, Innocensia; Masiu, Patriciah; Mishra, Abhay; Matsabisa, Motlalepula", "title": "Investigating the combinatory effect of Sclerocarya birrea with doxorubicin against selected colorectal cancer cell lines", "date": "2024", "keywords": "dose; dox", "summary": "Drug/Combination CI value Dose VER Dose DOX DRI VER DRI DOX IC50 VER 6.63 2.64 DOX 0.38 0.46 DOX + VER 1.33 2.99 0.33 IC75 VER 217.40 355.6 DOX 6.11 1.1 DOX + VER 0.34 14.82 1.66 IC90 VER 7127.23 47807.7 DOX 97.73 3.0 DOX + VER 0.09 73.44 8.25 IC95 VER 7652.5 1340243 DOX 643.6 4.2 DOX+ VER 0.04 218.07 24.50 Drug Target Insights 2024 | DOI: 10.33393/d .2024.3219 The IC50 and combination index values of the DOX and VER on HT29 cells, n=3.", "mime": "application/pdf"}, {"id": "dti-3271", "words": "4865", "extension": ".pdf", "flesch": "50", "author": "Rauf, Abdur; Alam, Waqas; Khan, Momin; W. Darwish, Hany; Daglia, Maria; A. Elhenawy, Ahmed; Khan, Haroon", "title": "Exploring the in vitro anti-diabetic potential and in silico studies of 2, 3 and 2, 6-dichloroIndolinone", "date": "2025", "keywords": "amylase; binding; compounds; crossref; diabetes; docking; energy; enzyme; glucosidase; inhibition; pubmed", "summary": "Amylase inhibitors can also be used to treat obesity (29). Amylase inhibitors and their biomedical applications.", "mime": "application/pdf"}, {"id": "dti-3304", "words": "1824", "extension": ".pdf", "flesch": "27", "author": "Kaushik, Ankush; Singh, Jitendra; Fatima, Zeeshan; Hameed, Saif", "title": "Establishment and evaluation of a naked-eye diagnostic assay for tuberculosis utilizing reverse isothermal amplification-assisted CRISPR-Cas in resource-limited settings", "date": "2025", "keywords": "urine", "summary": "NA NA POSITIVE 59 HEALTHY CONTROL- 1 Sputum NA NA NA NA Urine NEGATIVE NEGATIVE Not Done NEGATIVE Serum NA NA NA POSITIVE Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3304 | Kaushik et al 44 MTB-52-SP Sputum POSITIVE POSITIVE POSITIVE POSITIVE Urine NEGATIVE NEGATIVE NOT DONE POSITIVE Serum NA NA NA POSITIVE 45 MTB-32-SP Sputum POSITIVE POSITIVE POSITIVE POSITIVE Urine Sample not found Saple not Found Sample not found", "mime": "application/pdf"}, {"id": "dti-3495", "words": "11800", "extension": ".pdf", "flesch": "49", "author": "Sardar, Haseeba; Noor, Fatima; Shah, Syed Mukarram; Khan, Ashraf Ullah; Al-Otaibi, Jamelah S.; Hadi, Fazal; Daglia, Maria; Khan, Prof. Dr. Haroon", "title": "Integrated in vitro, microarray, and network pharmacology analysis reveals the multi-target anti-diabetic potential of Vigna unguiculata", "date": "2025", "keywords": "activity; amylase; analysis; authors; binding; complexes; compounds; crossref; data; diabetes; drug; energy; figure; genes; inhibitory; insights; network; potential; protein; pubmed; study; target; unguiculata", "summary": "The solvent was evaporated using a rotary evaporator Sardar et al Drug Target Insights 2025; 19: 73 \u00a9 2025 The Authors. \u22126.865 Glycitein \u22127.645 \u22127.297 \u22126.864 Catechin \u22127.637 \u22128.098 \u22127.159 Vicine \u22126.17 \u22127.04 \u22126.479 Acarbose \u22126.9 \u22126.7 \u22128.9 Sardar et al Drug Target Insights 2025; 19: 83 \u00a9 2025 The Authors.", "mime": "application/pdf"}, {"id": "dti-3499", "words": "5451", "extension": ".pdf", "flesch": "49", "author": "Fehrenbach, Gustavo; Shiels, Katie; Juca Silva, Mariana; Walshe, Jessica; Madden, Lena; Major, Ian; Burke, Niall; Yeomans, Tim; Rezoagli, Emanuele; Murphy, Emma", "title": "Anti-Inflammatory and Regenerative Properties of Herbal Extracts: Wound Management in Equine Models", "date": "2025", "keywords": "activity; cells; crossref; crossref pubmed; day; equine; extracts; healing; lps; macrophages; panel; pubmed; treatment; wound; yarrow", "summary": "Methods: This study aimed to evaluate the therapeutic efficacy of Pau D\u2019Arco (Tabebuia), Yarrow (Achillea millefo- lium), Gotu Kola (Centella asiatica), Figwort (Scrophularia nodosa), and Broadleaf (Plantago major) extracts, both individually and combined, on wound healing in vitro and in vivo in equine models. Conclusion: These findings suggest that the herbal extracts may be useful for supporting wound healing.", "mime": "application/pdf"}, {"id": "dti-3574", "words": "1687", "extension": ".pdf", "flesch": "60", "author": "Mishra, Abhay; Tangsumranjit, Anothai; Nigam, Manisha; Chandra, Harish; Almalki, Faisal A.; Hadda, Taibi; Waranuch, Neti", "title": "Integrative in silico and Petra/Osiris/Molinspiration (POM) analysis of baicalein: identification of therapeutically relevant pharmacophores against keloid pathology", "date": "2025", "keywords": "doi; drug; dti.2025.3574; inactive; insights; receptor; target", "summary": "Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3574 | Mishra et al 5 Table S-V. Oral toxicity model report of Baicalein Classification Target Shorthand Predictio n Probability Organ toxicity Hepatotoxicity dili Inactive 0.69 Organ toxicity Neurotoxicity neuro Inactive 0.89 Organ toxicity Nephrotoxicity nephro Active 0.62 Organ toxicity Respiratory toxicity respi Active 0.83 Organ toxicity Cardiotoxicity cardio Inactive 0.99 Toxicity end points Carcinogenicity carcino Active 0.68 Toxicity end points Immunotoxicity immuno Inactive 0.99 Toxicity end points Mutagenicity mutagen Active 0.51 Toxicity end points Cytotoxicity cyto Inactive 0.99 Toxicity end points BBB-barrier bbb Active 0.53 Toxicity end points Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3574 | Mishra et al 11 A B C D Fig.", "mime": "application/pdf"}, {"id": "dti-3631", "words": "349", "extension": ".pdf", "flesch": "35", "author": "Fanta, Angele; Bayiha Ba Njock, Gaetan; Dawe, Amadou; Yakai, Fawai; Nyemb, Jean No\u00ebl; Ketsemen, Herve Landry; Taira , Vincent; Wangso, Albert; Doudja, Chantal; Pegnyemb, Dieudonne Emmanuel; Loura, Benoit", "title": "Antioxidant potential of a new macrocyclic bisbibenzyl and other compounds from Combretum molle: in vitro and docking analyses", "date": "2025", "keywords": "doi; figure", "summary": "Microsoft Word - Supplementary+material Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S1: HR-ESI-MS (-) spectrum of compound 1 Figure S2: 1H NMR spectrum of compound 1 Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S3: 13C NMR spectrum of compound 1 Figure S4: APT NMR spectrum of compound 1 Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S5: HMBC spectrum of compound 1 \uf0b7 Figure S6: HMBC spectrum of compound 1 showing 5J correlation Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Table S1. Potent antioxidant activities of extract and pure isolated compounds \uf0b7 Results are in agreement with the traditional health uses of the plant", "mime": "application/pdf"}]