item: #1 of 145 id: dti-1294 author: Pan, Xing Qing; Jones, Susie; Cox, Karen title: The Way that PEGyl-DSPC Liposomal Doxorubicin Particles Penetrate into Solid Tumor Tissue date: 2006 words: 4158 flesch: 58 summary: Actually, since we do not know the exact way from which liposomal particles getting into solid tumor tissue, and also the fortune of those liposomal particles after they got inside the solid tumor tissue. It is agreeable, the amount of liposomal particles can penetrate into solid tumor tissue is determined by the hole size and number of the blood vessels, but not deter- mined by the targeting group which located on the liposomal particle surface. keywords: blood; cells; doxorubicin; drug; liposomal; liposome; particles; tissue; tumor cache: dti-1294.pdf plain text: dti-1294.txt item: #2 of 145 id: dti-1295 author: Stief, Thomas W. title: Inhibition of Intrinsic Thrombin Generation date: 2006 words: 3042 flesch: 61 summary: There are several clinically used inhibitors of intrinsic thrombin generation. The effi ciency of any anticoagulant on intrinsic thrombin generation should be measured for each individual patient. keywords: arginine; inca; min; plasma; thrombin cache: dti-1295.pdf plain text: dti-1295.txt item: #3 of 145 id: dti-1296 author: Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko title: Modification of Monoaminergic Activity by MAO Inhibitors Influences Methamphetamine Actions date: 2006 words: 9090 flesch: 62 summary: However, treatment of rats with 10 mg/kg of pargyline increases locomotor activity per se (Table 1; Barbelivien et al. 2001); this effect might be interpreted by evidence that MAO-A inhibition by clorgyline (and probably by pargyline at high doses) increases extracellular dopamine concen- tration in the nucleus accumbens (Segal et al. 1992). Ito et al. 2000; Itzhak and Ali 2002; Kitanaka et al. 2003, 2005b; Okabe and Murphy, 2004). keywords: amphetamine; clorgyline; dopamine; et al; inhibitors; kitanaka; mao; meth; methamphetamine; mice; monoamine; pharmacol; selegiline cache: dti-1296.pdf plain text: dti-1296.txt item: #4 of 145 id: dti-1297 author: Taupin, Philippe title: Neurogenesis and Alzheimer's Disease date: 2006 words: 2776 flesch: 58 summary: These results show that drugs used to treat AD increase neurogenesis in the adult brain, which may contribute to their therapeutic effects (Jin et al. 2006). Researchers have aimed to investigate whether neuro- genesis may contribute to the therapeutic effects of drugs used to treat other neurological diseases and disorders, particularly AD (Jin et al. 2006). keywords: adult; brain; cells; et al; neurogenesis cache: dti-1297.pdf plain text: dti-1297.txt item: #5 of 145 id: dti-1298 author: Taupin, Philippe title: Neurogenesis and the Effect of Antidepressants date: 2006 words: 3871 flesch: 52 summary: In press. Czeh, B., Michaelis, T. and Watanabe, T. et al. 2001. On the one hand, antidepressant treatments increase the level of expression of BDNF in the patents’ brain, and BDNF has an antidepressant effect (Siuciak et al. 1997; Chen et al. 2001; Saarelainen et al. 2003). keywords: adult; antidepressants; brain; cells; depression; effects; et al; hippocampus; neurogenesis cache: dti-1298.pdf plain text: dti-1298.txt item: #6 of 145 id: dti-1299 author: Di Iorio, Biagio R.; Guastaferro, Pasquale; Cillo, Nicola; Cucciniello, Emanuele; Bellizzi, Vincenzo title: Long-term L-Carnitine Administration reduces Erythropoietin Resistance in Chronic Hemodialysis Patients with Thalassemia Minor date: 2007 words: 3830 flesch: 61 summary: Introduction Anemia is very common in chronic dialysis patients and it is related to relative erythropoietin defi ciency, to blood losses from both gastrointestinal tract and dialysis fi lter or lines, and to blood drawings for laboratory tests (1–4). Discussion There are compelling indicators of carnitine defi - ciency in chronic dialysis patients as a result of low dietary intakes and increased losses during the Table 1. keywords: administration; anemia; carnitine; dialysis; epo; erythropoietin; hemodialysis; patients; thal cache: dti-1299.pdf plain text: dti-1299.txt item: #7 of 145 id: dti-1300 author: Guterres, Sílvia S.; Alves, Marta P.; Pohlmann, Adriana R. title: Polymeric Nanoparticles, Nanospheres and Nanocapsules, for Cutaneous Applications date: 2007 words: 7880 flesch: 60 summary: From a general point of view, those methods are based on in situ polymerization or precipitation of pre-formed polymers (Fessi et al. 1989; Soppimath et al. 2001; Couvreur et al. 2002, Schaffazick et al. 2003; Sinha et al. 2004). Preparation of polymeric nanoparticles by a) polymerization in emulsion, b) interfacial polymerization, c) nanoprecipitation or interfacial deposition of pre-formed polymers, and d) emulsifi cation-diffusion. 152 Guterres et al Drug Target Insights 2007: 2 Formulating polymeric nanoparticles for cutaneous applications Up to now, the nanoprecipitation method is the most commonly used to formulate polymeric nanoparticles intended for cutaneous applications (Alverez-Román et al. 2001; Lboutounne et al. 2002; Milão et al. 2003; Alvarez-Román et al. 2004b; Jiménez et al. 2004a; Jiménez et al. 2004b; Lboutounne et al. 2004; Shim et al. 2004; Kim et al. 2006). keywords: chemical; control; corneum; drug; et al; formulations; int; j. pharm; müller; nanocapsules; nanoparticles; omc; penetration; pharm; release; skin; stratum; systems cache: dti-1300.pdf plain text: dti-1300.txt item: #8 of 145 id: dti-1301 author: Hamman, J.H.; Demana, P.H.; Olivier, E.I. title: Targeting Receptors, Transporters and Site of Absorption to Improve Oral Drug Delivery date: 2007 words: 8043 flesch: 55 summary: Targeted drug delivery via transferring receptor-mediated endocytosis pathway. Keywords: Oral drug delivery, absorption enhancement, receptor-mediated endocytosis, active transporters, site-specifi c drug delivery. keywords: absorption; acid; cell; delivery; drug; drug delivery; endocytosis; et al; intestine; membrane; peptide; receptor; systems; target; tract; transferrin; transporters; vitamin cache: dti-1301.pdf plain text: dti-1301.txt item: #9 of 145 id: dti-1302 author: Hamre, Harald J.; Glockmann, Anja; Fischer, Michael; Riley, David S.; Baars, Erik; Kiene, Helmut title: Use and Safety of Anthroposophic Medications for Acute Respiratory and Ear Infections: A Prospective Cohort Study date: 2007 words: 8409 flesch: 62 summary: In gr ed ie nt s M an uf ac tu re r N % N % P la nt ag o B ro nc hi al B al m 10 0 g co nt ai ns : C am ph or a 2 g, C er a fl a va 1 5 g, D ro se ra ro tu nd ifo lia / W al a 11 7 16 .4 % 19 45 3. 0% in te rm ed ia /a ng lic a e pl an ta to ta fe rm . This ADR has not been reported to the manu- facturer previously, but has been observed repeatedly in other patients by the boy’s physician. keywords: adr; aes; amed; medication; patients; relationship; safety; study cache: dti-1302.pdf plain text: dti-1302.txt item: #10 of 145 id: dti-1304 author: Kameda, Hideto; Suzuki, Miyuki; Takeuchi, Tsutomu title: Platelet-Derived Growth Factor as a Therapeutic Target for Systemic Autoimmune Diseases date: 2007 words: 6621 flesch: 50 summary: Daniel et al. proved that imatinib dramatically reduced hydroxyproline content and prevented 243 PDGF as a target for systemic autoimmune diseases Drug Target Insights 2007:2 histopathologic changes in bleomycin-treated lungs of 129tsvems mice Johnson, R.J., Raines, E.W., Floege, J. et al. 1992. keywords: arthritis; brosis; cells; diseases; et al; factor; growth; imatinib; inhibition; kameda; patients; pdgf; rheumatoid; treatment cache: dti-1304.pdf plain text: dti-1304.txt item: #11 of 145 id: dti-1305 author: Khan, M. Omar F. title: Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design date: 2007 words: 11377 flesch: 56 summary: In Palfreyman, McCann Lovenberg, et al. ed. DNA topoisomerase I could also serve as an intracellular target, as its inhibi- tion can cause DNA-cleavage and ultimate death of trypanosomes (Bodley et al. 1995). keywords: activity; agents; chem; compounds; cruzi; design; drug; enzyme; et al; fairlamb; inhibition; inhibitors; khan; med; potent; reductase; site; structure; substrate; target; trypanosoma; trypanothione; trypanothione reductase cache: dti-1305.pdf plain text: dti-1305.txt item: #12 of 145 id: dti-1306 author: N.S, Ningaraj; B.P, Salimath; U.T, Sankpal; R, Perera; T, Vats title: Targeted Brain Tumor Treatment-Current Perspectives date: 2007 words: 8017 flesch: 50 summary: that breach or circumvent BBB and directly target brain tumor cells (Ningaraj, 2006) The potential of anti-angiogenic therapy in human brain tumors is demonstrated in experimental brain tumor models. keywords: brain; brain tumor; cancer; cells; delivery; dna; drug; et al; expression; gene; glioma; growth; inhibitors; molecular; ningaraj; patients; res; target; therapy; treatment; tumor cache: dti-1306.pdf plain text: dti-1306.txt item: #13 of 145 id: dti-1307 author: Ohlsson, Bodil; Janciauskiene, Sabina title: New Insights into the Understanding of Gastrointestinal Dysmotility date: 2007 words: 7255 flesch: 55 summary: This effect persisted when the treatment was con- tinued for up to 6–12 months (Mathias et al. 1994b; Palomba et al. 2005). In addition, the GnRH receptor has been found in the epithelium of gastric pits (Huang et al. 2001) and GnRH receptor mRNA in the myenteric neurons in the rat (Ho et al. 1996). keywords: bowel; cells; disease; enteric; et al; gnrh; gut; hormone; human; intestinal; motility; neurons; ohlsson; oxytocin; patients; receptor; role; system; tract cache: dti-1307.pdf plain text: dti-1307.txt item: #14 of 145 id: dti-1308 author: Okubo, Yasunori; Kusumoto, Kenji; Bessho, Kazuhisa title: Accelerators of Osteogenesis by Recombinant Human Bone Morphogenetic Protein-2 date: 2007 words: 4512 flesch: 60 summary: In the control group, trabecular bone tissue was observed at the outer edge of the implanted material. Experimental studies on bone inducing activity of composites of atelopeptide type I collagen as a carrier for ectopic osteoinduction by rhBMP-2. keywords: activity; bone; group; hbo; implantation; rhbmp-2 cache: dti-1308.pdf plain text: dti-1308.txt item: #15 of 145 id: dti-1309 author: Panossian, Alexander; Hambardzumyan, Marina; Hovhanissyan, Areg; Wikman, Georg title: The Adaptogens Rhodiola and Schizandra Modify the Response to Immobilization Stress in Rabbits by Suppressing the Increase of Phosphorylated Stress-activated Protein Kinase, Nitric Oxide and Cortisol date: 2007 words: 11329 flesch: 61 summary: Ohkura, Y., Mizoguchi, Y. and Morisawa, S. et al. 1990. Furthermore, psycho- logical and/or physiological stress causes NO release in, and may modulate stress-induced activa- tion of, the HPA axis and the sympatho-adrenal medullary system (Kishimoto et al. 1996). keywords: adaptogens; animals; blood; cortisol; drug; e >; effects; et al; jnk; levels; panossian; rosea; sapk; stress; study cache: dti-1309.pdf plain text: dti-1309.txt item: #16 of 145 id: dti-1310 author: Konstantinopoulos, Angelis; Giannitsas, Konstantinos; Raptis, Spiros; Perimenis, Petros title: Endothelial Dysfunction, Erectile Dysfunction and Phosphodiesterase 5 Inhibitors. An Update of the Current Data and Future Perspectives date: 2007 words: 5379 flesch: 48 summary: Abstract: Endothelial dysfunction is a pathological entity that multiply affects the health status. Erectile dysfunction is being recognized as a condition that is strongly interrelated with endothelial dysfunction, being a vascular event itself. keywords: artery; cells; cgmp; disease; dysfunction; endothelial; erectile; et al; heart; muscle; sildenafi; vascular cache: dti-1310.pdf plain text: dti-1310.txt item: #17 of 145 id: dti-1311 author: Abdel-Salam, Omar M.E. title: Modulation of Visceral Nociception, Inflammation and Gastric Mucosal Injury by Cinnarizine date: 2007 words: 7290 flesch: 60 summary: Cinnarizine (1.25–20 mg/kg, s.c.) inhibited visceral pain evoked by i.p. acetic acid injection in mice. Cinnarizine (1.25–20 mg/kg, s.c.) caused dose-dependent inhibition of the abdominal constrictions evoked by i.p. injection of acetic acid by 38.7–99.4%. keywords: antagonist; antinociception; cinnarizine; control; dopamine; drug; effect; et al; i.p; mice; receptor cache: dti-1311.pdf plain text: dti-1311.txt item: #18 of 145 id: dti-1312 author: Salam, Omar M.E. Abdel; Sleem, Amany A.; Omara, Enayat A.; Hassan, Nabila S. title: Effect of Ribavirin Alone or Combined with Silymarin on Carbon Tetrachloride Induced Hepatic Damage in Rats date: 2007 words: 6894 flesch: 57 summary: A photomicrograph from a section of rat liver given CCl4 with ribavirin at 90 mg/kg, showing moderate improvement in protein content in liver cells (Bromophenol blue reaction × 300). A photomicrograph from a section of control rat liver showing normal hepatic architecture: central vein with radiating cords of liver cells, the hepatocytes had vesicular nuclei and granular cytopolasm and blood sinusoids were evident between the cords of hepatocytes (H× & Ε× 300). keywords: ccl4; et al; hepatic; hepatitis; liver; patients; pcna; rats; ribavirin; serum; silymarin cache: dti-1312.pdf plain text: dti-1312.txt item: #19 of 145 id: dti-1313 author: Nishida, Seiichiro; Satoh, Hiroyasu title: Cardiovascular Pharmacology of Sinomenine: The Mechanical and Electropharmacological Actions date: 2007 words: 4613 flesch: 53 summary: Pharmacology of sinomenine, an anti-rheumatic alka- loids from sinomenine acutum. Its main constituent of Sinomenine acutum is sinomenine, which has also used for clinical treatment of Rheumatoid arthritis (RA), due to the anti-infl ammatory and immunomodulative actions (Yamasaki, 1976; Liu et al. 1996). keywords: actions; acutum; ca2; modulation; satoh; sinomenine cache: dti-1313.pdf plain text: dti-1313.txt item: #20 of 145 id: dti-1314 author: Savaraj, Niramol; Wu, Chunjing; Kuo, Marcus Tien; You, Min; Wangpaichitr, Medhi; Robles, Carlos; Spector, Seth; Feun, Lynn title: The Relationship of Arginine Deprivation, Argininosuccinate Synthetase and Cell Death in Melanoma date: 2007 words: 6224 flesch: 63 summary: Our study indicates that ASS expression in melanoma cells is complex and governed by bio- chemical parameters which are different among melanoma cells. It is not yet clear why transfection with ASS cDNA in melanoma cells did not yield high levels of ASS expression and we are unable to generate stable transfected cell line(s). keywords: a2058; adi; arginine; ass; cell; et al; expression; lane; lines; media; melanoma; peg20 cache: dti-1314.pdf plain text: dti-1314.txt item: #21 of 145 id: dti-1317 author: Stief, Thomas W. title: Phospholipase A2 Activates Hemostasis date: 2007 words: 7188 flesch: 63 summary: Ozaki, K., Fujiwara, T., Kawai, A., Shimizu, F., Takami, S., Okuno, S., Takeda, S., Shimada, Y., Nagata, M. and Watanabe, T. et al. 1996. Luo, C., Luo, H., Zheng, S., Gui, C., Yue, L., Yu, C., Sun, T., He, P., Chen, J., Shen, J. et al. 2004. keywords: activity; binding; cells; csa; cyclophilin; cypa; cypb; et al; genome; hcv; human; protein; replication; rna; virus cache: dti-1317.pdf plain text: dti-1317.txt item: #22 of 145 id: dti-1318 author: Wapling, Johanna; Srivastava, Seema; Shehu-Xhilaga, Miranda; Tachedjian, Gilda title: Targeting Human Immunodeficiency Virus Type 1 Assembly, Maturation and Budding date: 2007 words: 19654 flesch: 60 summary: This binding creates two main pockets: the “A-P” pocket through contact of amino acids 7–10 and the “P” pocket through the binding of amino acids 9–10 of the peptide (Pornillos et al. 175 Targeting the late stages of HIV-1 replication Drug Target Insights 2007: 2 2002a; Pornillos et al. 2002b). INI1 mutants that abrogate interaction with IN or cells defi cient in INI1 exhibit a substantial reduction in viral produc- tion (Yung et al. 2001). keywords: 2004; acid; activity; assembly; biol; cell; ciency; ciency virus; dimerization; domain; drug; et al; gag; hiv-1; host; human; immunodefi; inhibition; inhibitors; maturation; particle; peptide; pol; processing; protease; protein; replication; reverse; targeting; transcriptase; type; virol; virus; virus type; vpu cache: dti-1318.pdf plain text: dti-1318.txt item: #23 of 145 id: dti-1319 author: R.R, Resende; H.A.M, Torres; K.K, Yuahasi; P, Majumder; H, Ulrich title: Delivery Systems for In Vivo Use of Nucleic Acid Drugs date: 2007 words: 10916 flesch: 57 summary: In many cases 2′-F-modifi ed pyrimidines are employed in the in vitro transcription reaction to improve nuclease-resistance of generated RNA molecules (reviewed by Ulrich et al. 2004). The anti-TAR RNA aptamer (Ducongé and Toulmé, 1999) was optimized by chemical modi- fi cations towards improved stability regarding nuclease resistance and decreased trans-activation of transcription in cell nuclei extract assays (Darfeuille et al. 2002a; Darfeuille et al. 2002b; Darfeuille et al. 2004; Kolb et al. 2005; Toulmé et al. 2001). keywords: activity; aptamer; binding; cancer; cells; delivery; dna; drug; et al; expression; gene; human; interference; interfering; molecules; mrna; protein; rna; rnai; sci; silencing; sirna; specifi; target; ulrich; ulrich et; vivo cache: dti-1319.pdf plain text: dti-1319.txt item: #24 of 145 id: dti-1320 author: Nysoeter, Gunnar; Erichsen, Kari; Milde, Anne Marita; Colás, Eva; Kristoffersen, Einar; Berstad, Arnold title: Effect of live Salmonella Ty21a in Dextran Sulfate Sodium-induced Colitis date: 2007 words: 4469 flesch: 58 summary: For further information go to: http://creativecommons.org/licenses/by/3.0/. Effect of live Salmonella Ty21a in Dextran Sulfate Sodium-induced Colitis Gunnar Nysœter1, Kari Erichsen2, Anne Marita Milde3, Eva Colás4, Einar Kristoffersen5 and Arnold Berstad6 1Department of Medicine, Section for Gastroenterology, 2Children’s Clinic, 3Department of Biological and Medical Psychology, 4Innovest,5Section for Microbiology and Immunology, Haukeland University Hospital, Bergen, Norway, 6Institute of Medicine, University of Bergen, Norway. Control Ty21a DSS DSS − Ty21a 0 1 2 3 4 Control Ty21a DSS DSS + Ty21a 0 1 2 3 P > 0.05 P > 0.05 C ry pt s co re In fla m m at or y sc or e 227 Effect of Salmonella Ty21a on experimental colitis Drug Target Insights 2007:2 vaccination with Salmonella Ty21a in humans with IBD is safe. keywords: animals; colitis; disease; dss; group; infl; rats; salmonella; study; ty21a; vaccine cache: dti-1320.pdf plain text: dti-1320.txt item: #25 of 145 id: dti-1321 author: Erkut, Bilgehan; Özyazıcıoğlu, Ahmet; Karapolat, Bekir Sami; Koçoğulları, Cevdet Uğur; Keles, Sait; Ateş, Azman; Gundogdu, Cemal; Kocak, Hikmet title: Effects of Ascorbic Acid, Alpha-Tocopherol and Allopurinol on Ischemia-Reperfusion Injury in Rabbit Skeletal Muscle: An Experimental Study date: 2007 words: 6501 flesch: 56 summary: Recently advances in the understanding of reperfusion injury and the pharmacology of 254 Erkut et al Drug Target Insights 2007:2 antioxidants have made the interruption of reperfusion injury clinically promising and FR mediated tissue injury can be limited by the use of antioxidant therapy and several studies have sug- gested a positive role for antioxidant therapy in skeletal muscle reperfusion injury (36,37). The aim of the present study was to determine and evaluate the effects of ascorbic acide, alpha-tocopherol and allopurinol on ischemia reperfusion injury in rabbit skeletal muscle. keywords: acide; allopurinol; antioxidant; ascorbic; group; injury; ischemia; levels; muscle; reperfusion; reperfusion injury; study; tissue; tocopherol; treatment cache: dti-1321.pdf plain text: dti-1321.txt item: #26 of 145 id: dti-1322 author: Chiang, Thomas M.; Woo-Rasberry, V. title: The Toxicity of a Chemically Synthesized Peptide Derived from Non-Integrin Platelet Collagen Receptors date: 2008 words: 4816 flesch: 56 summary: cHyB inhibits type I collagen-induced platelet aggregation. Development of an inhibitor(s) from platelet collagen receptors to inhibit the collagen- induced platelet activation and aggregation will prevent the risk of thrombosis. keywords: aggregation; cells; chyb; collagen; effect; iii; peptide; platelet; rat; type cache: dti-1322.pdf plain text: dti-1322.txt item: #27 of 145 id: dti-1323 author: Debouzy, Jean-Claude; Crouzier, David; Lefebvre, Bertrand; Dabouis, Vincent title: Study of Alkylglycerol Containing Shark Liver Oil: A Physico Chemical Support for Biological Effect date: 2008 words: 7241 flesch: 55 summary: SLO antioxidant properties are also of interest: hence, vitamin E is routinely used as adjuvant agent in radiotherapy, used for its antiradical properties in the prevention of radio induced fi brosis [29]. Superfi cial tension (dG-G°, mN/m), 298 K as a function of SLO concentration (mg/mL) (•), and percentage of haemolysis fol- lowing the concentration of SLO (• ). keywords: dmpc; esr; figure; membrane; nmr; oil; properties; slo; spectrum; spin; temperature; water cache: dti-1323.pdf plain text: dti-1323.txt item: #28 of 145 id: dti-1324 author: Nysæter, Gunnar; Berstad, Arnold title: Live Typhoid Vaccine for IBD-Patients–-Well Tolerated and with Possible Therapeutic Effect date: 2008 words: 3490 flesch: 53 summary: After this she has continued to take oral typhoid vaccine about once a year for the last 9 years, being convinced of the vaccine’s positive effect on her ulcerative colitis. The symptomatic and endoscopic improvements were not dramatic, but encouraging enough to warrant further studies on the potential therapeutic effect of live typhoid vaccine on patients with IBD. keywords: colitis; disease; effect; ibd; infl; patients; symptoms; typhoid; vaccine cache: dti-1324.pdf plain text: dti-1324.txt item: #29 of 145 id: dti-1325 author: Woo-Rasberry, Virginia; Chiang, Thomas M. title: The Beta3 499–513 Peptide Region is Required for AlphaIIb/Beta3 Active Complex Formation and Fibrinogen Binding date: 2008 words: 6525 flesch: 60 summary: Line 2, Cells of wild type αIIb with β3-mut cDNAs Lane 3, Cells of wild type αIIb cDNA and β3 cDNAs. 73 The beta3 499–513 peptide region is required for alphaIIb/beta3 active complex Drug Target Insights 2008:3 Figure 4. In order to study the effects of P4 (wild type β3) on the formation of active αIIb/β3, we have engineered a construct containing the scrambled sequence of the active peptide (P4s) in β3 cDNA. keywords: binding; brinogen; cells; complex; peptide; type; αiib cache: dti-1325.pdf plain text: dti-1325.txt item: #30 of 145 id: dti-1326 author: Fernandez, Hubert H.; McCown, Katie M.; Romrell, Janet; Trieschmann, Martha E.; Friedman, Joseph H.; Jacobson IV, Charles E.; Okun, Michael S. title: New-Onset Diabetes Mellitus among Parkinsonian Patients Treated with Long-term Quetiapine date: 2008 words: 2384 flesch: 54 summary: To determine true prevalence, patients with previous and recent diagnoses of DM, and/or use of hypo- glycemic agents prior to quetiapine initiation were included. How- ever, in schizophrenia, there are confl icting reports as to whether duration of disease is a signifi cant risk factor for DM development. keywords: diabetes; new; patients; prevalence; quetiapine cache: dti-1326.pdf plain text: dti-1326.txt item: #31 of 145 id: dti-1327 author: Viola-Villegas, Nerissa; Vortherms, Anthony; Doyle, Robert P. title: Targeting Gallium to Cancer Cells through the Folate Receptor date: 2008 words: 6262 flesch: 62 summary: Keire, D.A., Jang, Y.H., Shively, J.E. et al. 2001. We began by initially complexing gallium (III) to the 1,4,7,10-tetraazacyclo-dodecane- N,N′,N′′,N′′′-tetraacetic acid (DOTA) ligand (Doyle et al. 2006). keywords: cancer; cells; cho; dota; drug; et al; folate; gallium; peg; receptor; γ-2; γ-4 cache: dti-1327.pdf plain text: dti-1327.txt item: #32 of 145 id: dti-1328 author: Garrote, José A.; Gómez, Emma; León, Alberto J.; Bernardo, David; Calvo, Carmen; Fernández-Salazar, Luis; Blanco-Quirós, Alfredo; Arranz, Eduardo title: Cytokine, Chemokine and Immune Activation Pathway Profiles in Celiac Disease: An Immune System Activity Screening by Expression Macroarrays date: 2008 words: 8110 flesch: 64 summary: Previous reports on cytokine expression in CD have studied biopsies from untreated patients (Nilsen, Jahnsen et al. 1998; Gluten challenge has been reported to induce also the expres- sion of IL-2, IL4, IL5, IL6, and TNFα (Nilsen, Jahnsen et al. 1998), as well as IL-18, IL-15 (Maiuri, Ciacci et al. 2000; Monteleone, Pender et al. 2001; Salvati, MacDonald et al. 2002), and TGFβ, but not http://creativecommons.org/licenses/by/3.0/ http://creativecommons.org/licenses/by/3.0/ 2 Garrote et al Drug Target Insights 2008:3 of IL10 (Nilsen, Jahnsen et al. 1998; Lionetti, Pazzaglia et al. 1999; Forsberg, Hernell et al. 2002; Hansson, Ulfgren et al. 2002). keywords: acd; cell; cytokine; disease; et al; expression; factor; gene; gfd; gluten; group; infl; intestinal; p =; patients; r:0 cache: dti-1328.pdf plain text: dti-1328.txt item: #33 of 145 id: dti-1329 author: Tsen, Shaw-Wei D. title: Evidence of a Novel Gene from Aeromonas hydrophila Encoding a Putative Siderophore Receptor Involved in Bacterial Growth and Survival date: 2008 words: 3131 flesch: 48 summary: Bacteria frequently possess feedback systems that upregulate or downregulate the expression of certain iron uptake proteins, including the energy transducing protein TonB, in response to environ- mental iron levels (Beddek et al. 2004). The FhuA protein and similar iron uptake proteins from various bacteria were obtained and aligned using the algorithm of Thompson et al. keywords: hydrophila; iron; nsr1; protein; receptor; siderophore cache: dti-1329.pdf plain text: dti-1329.txt item: #34 of 145 id: dti-1330 author: Matsuyama, Masahide; Yoshimura, Rikio title: The Target of 5-Lipoxygenase is a Novel Strategy over Human Urological Tumors than the Target of Cyclooxygenase-2 date: 2008 words: 7884 flesch: 56 summary: 2) Effect of COX and LOX inhibitors MTT assay a) COX RCC cell line All COX inhibitors were unable to induce a reduc- tion of cell viability with the half-maximal con- centration of growth inhibition of RCC cells in the range of 10–80 μM and were unable to stop the growth of RCC cells. BT cell line Similar to RCC cells, COX inhibitors could not induce a reduction of cell viability with the half- maximal concentration of growth inhibition of BT cells in the range of 10–80 μM and could not stop the growth of BT cells. keywords: 5and; cancer; cells; cox-2; expression; human; inhibitors; lox; lox inhibitor; rcc; tissues; tumor cache: dti-1330.pdf plain text: dti-1330.txt item: #35 of 145 id: dti-1331 author: Moretti, Rita; Torre, Paola; Vilotti, Cristina; Manganaro, Davide; Zanet, Luca; Antonello, Rodolfo M. title: Memantine: Reality and Potentiality date: 2008 words: 7195 flesch: 55 summary: (Reisberg et al. 2003; Reisberg et al. 2000). Beta-amyloid peptide enhances the toxicity of glutamate in in vitro test (Mattson et al. 1992; Wu et al. 1995) and augments NMDA receptor mediated transmission (Cullen et al. 1996). keywords: alzheimer; disease; dopamine; effect; et al; glutamate; memantine; neurons; nmda; parkinson; patients; placebo; receptors; severe cache: dti-1331.pdf plain text: dti-1331.txt item: #36 of 145 id: dti-1332 author: Prakash, Satya; Malhotra, Meenakshi title: Recent Advancements in Targeted Delivery of Therapeutic Molecules in Neurodegenerative Disease–-Spinocerebellar Ataxia–-Opportunities and Challenges date: 2008 words: 11954 flesch: 57 summary: 116 Prakash and Malhotra Drug Target Insights 2008:3 Nakamura, K., Jeong, S.Y., Uchihara, T. et al. 2001. This helps them to effectively transduce neurons (Mazarakis et al. 2001). keywords: ataxia; brain; cag; cell; chromosome; delivery; disease; dominant; drug; et al; gene; hum; insights; interference; molecules; nanoparticles; nature; polyglutamine; protein; repeat; sca; silencing; sirna; specifi; spinocerebellar; system; target; type; unknown cache: dti-1332.pdf plain text: dti-1332.txt item: #37 of 145 id: dti-1333 author: Brown, William M.; Chiacchia, Fabrizio S. title: Therapies to Increase ApoA-I and HDL-Cholesterol Levels date: 2008 words: 7724 flesch: 54 summary: Common and rare ABCA1 variants affecting plasma HDL cholesterol. The fibrates typically raise HDL levels by 10%–15% and can also lower triglyceride levels by up to 60%, though they have little effect on LDL levels. keywords: apoa; atherosclerosis; cholesterol; density; disease; drug; et al; hdl; high; increase; ldl; levels; lipid; lipoprotein; patients; risk cache: dti-1333.pdf plain text: dti-1333.txt item: #38 of 145 id: dti-1334 author: Shen, Yuqiao; Senzer, Neil N.; Nemunaitis, John J. title: Use of Proteomics Analysis for Molecular Precision Approaches in Cancer Therapy date: 2008 words: 9944 flesch: 55 summary: Using different fl uorescent dyes to label protein samples prior to gel electrophoresis, 2-D DIGE (two- dimensional differential in-gel electrophoresis) can, with reasonable sensitivity, process three protein samples on the same gel allowing for intragel relative quantifi cation. Using different fl uorescent dyes to label protein samples prior to gel electro- phoresis, the DIGE technique allows multiple samples to be co-separated and visualized on one 2-D gel (Unlu et al. 1997). keywords: analysis; cancer; cation; cell; data; electrophoresis; et al; expression; gel; gene; identifi; labeling; mass; page; peptides; protein; proteomics; samples; spectrometry; tags; technology cache: dti-1334.pdf plain text: dti-1334.txt item: #39 of 145 id: dti-1335 author: Wilczak, Nadine; Keyser, Jacques De; Chesik, Daniel title: Targeting Insulin-Like Growth Factor-1 Signaling into the Central Nervous System for Promoting Myelin Repair date: 2008 words: 6086 flesch: 55 summary: Other studies have shown that systemic application of IGF-1 in acute demyelinating experimental autoim- mune encephalomyelitis (EAE), an animal model for MS, signifi cantly reduced the number and area of the demyelinated lesions in the spinal cord (Liu and Yao, 1995; Yao et al. 1995). The MAP kinase pathway is often associated in proliferation and differentiation (Kim et al. 1997), whereas the Akt pathway is induced in IGF-1 mediated cell survival (Brunet et al. 1999) and protection from apoptosis (Kermer et al. 2000). keywords: binding; brain; cns; et al; factor; growth; growth factor; igf-1; igfbps; insulin; oligodendrocytes cache: dti-1335.pdf plain text: dti-1335.txt item: #40 of 145 id: dti-1336 author: Zangari, Maurizio; Elice, Francesca; Tricot, Guido; Fink, Louis title: Thrombophilia date: 2008 words: 8393 flesch: 48 summary: Risks factors for VTE in medically ill patients have a cumulative effect; hospitalized subjects with thrombophilia or a history of thrombosis are at increased risk of VTE, as well as patients with lower limb paralysis from acute ischaemic stroke. Risk factors for pregnancy associated venous thromboembolism. keywords: antithrombin; apc; blood; cancer; ciency; defi; factor; leiden; mutation; patients; protein; protein c; resistance; risk; therapy; thrombophilia; thrombosis; vte cache: dti-1336.pdf plain text: dti-1336.txt item: #41 of 145 id: dti-1337 author: Begleiter, Asher; El-Gabalawy, Nadia; Lange, Laurie; Leith, Marsha K.; Guziec, Lynn J.; Guziec Jr, Frank S. title: A Model for NAD(P)H:Quinoneoxidoreductase 1 (NQO1) Targeted Individualized Cancer Chemotherapy date: 2009 words: 6182 flesch: 58 summary: Human tumor cells have varied levels of NQO1 activity ranging from � 10 nmol. To test this hypothesis, we measured tumor cell growth inhibition produced by the series of BM analogs having different affi nities for activation by NQO1, in human tumor cell lines with a wide range of NQO1 activity. keywords: activity; agents; analogs; cancer; cells; growth; human; levels; mebm; nprbm; nqo1; pbm; tumor cache: dti-1337.pdf plain text: dti-1337.txt item: #42 of 145 id: dti-1338 author: Hatakeyama, Yuji; Hatakeyama, Junko; Takahashi, Atsushi; Oka, Kyoko; Tsuruga, Eichi; Inai, Tetsuichiro; Sawa, Yoshihiko title: The Effect of Valproic Acid on Mesenchymal Pluripotent Cell Proliferation and Differentiation in Extracellular Matrices date: 2011 words: 5458 flesch: 52 summary: Previous studies have reported that VPA effects osteogenesis in vivo and in vitro, yet it remains unclear whether VPA promotes cell differentiation of osteoblasts derived from mesenchymal cells. Keywords: mesenchymal cells, valproic acid, cell proliferation http:/dx.doi.org/10.4137/DTI.S6534 http://www.la-press.com http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 http://www.la-press.com mailto:yuji_hatakey@hotmail.com hatakeyama et al 2 Drug Target Insights 2011:5 Introduction Valproic acid (2-n-propylpentanoic acid, VPA) is an effective and widely used antiepileptic and anticon- vulsant drug, and recent studies have reported that VPA influences osteogenesis in vivo and in vitro.1–4 It has been reported that VPA has no effect on osteo- genesis identified with calcification nodule forma- tion by a preosteoblast cell line derived from mouse calvaria, MC3T3-E1 cells.5 keywords: cell; collagen; culture; differentiation; effect; mesenchymal; plastic; plate; presence; proliferation; vpa cache: dti-1338.pdf plain text: dti-1338.txt item: #43 of 145 id: dti-1346 author: O’Blenes, Stacy B.; Li, Audrey W.; Bowen, Chris; DeBay, Drew; Althobaiti, Mohammed; Clarke, James title: Impact of Hepatocyte Growth Factor on Skeletal Myoblast Transplantation Late After Myocardial Infarction date: 2013 words: 5158 flesch: 53 summary: We evaluated HGF delivery, SKMB engraftment, and expression of genes associated with post-MI remodeling. While it is possible that neonatal SKMBs used in their study behaved differently than the more clinically relevant adult SKMBs used in our model, it is also possible that the route of HGF delivery is important. keywords: control; engraftment; hgf; myoblast; skmb; transplantation; ventricular; vs.; weeks cache: dti-1346.pdf plain text: dti-1346.txt item: #44 of 145 id: dti-1347 author: Roth, Bodil; Manjer, Jonas; Ohlsson, Bodil title: Microscopic Colitis is Associated with Several Concomitant Diseases date: 2013 words: 4007 flesch: 54 summary: Thus, MC patients have an increased prevalence of several diseases, not only of autoimmune origin. The aim of this study was to examine the prevalence of com- mon diseases in patients with MC and controls from the general population. keywords: age; colitis; controls; diseases; drug; patients; study; years cache: dti-1347.pdf plain text: dti-1347.txt item: #45 of 145 id: dti-1348 author: Sarangi, Upasana; Singh, Manish Kumar; Abhijnya, Kanugovi Vijaya Vittal; Reddy, Lebaka Prasanna Anjaneya; Prasad, Badabagni Siva; Pitke, Vikrant Vinay; Paithankar, Khanderao; Sreedhar, Amere Subbarao title: Hsp60 Chaperonin Acts as Barrier to Pharmacologically Induced Oxidative Stress Mediated Apoptosis in Tumor Cells with Differential Stress Response date: 2015 words: 10404 flesch: 54 summary: However, CHX combination treat- ment with rotenone restored mitochondrial Hsp60 at 24 h treatment, but promoted cytoplasmic trans- location by 48 h both in BC-8 (Fig. 8A) and in IMR-32 (Fig. In this study, using rotenone, an irreversible inhib- itor of OXPHOS against IMR-32 cells that contain intact inducible heat shock transcriptional machin- ery30 and BC-8 tumor cells that lack inducible heat shock transcriptional machinery,31 we showed that the oxidative stress response is related to Hsp60. keywords: apoptosis; bc-8; cells; combination; control; fig; h h; hsp60; imr-32; mitochondrial; production; response; ros; rotenone; shrna; stress; translocation; treatment cache: dti-1348.pdf plain text: dti-1348.txt item: #46 of 145 id: dti-1349 author: Amin, Md. Lutful title: P-glycoprotein Inhibition for Optimal Drug Delivery date: 2013 words: 4791 flesch: 49 summary: Keywords: P-glycoprotein, drug efflux, bioavailability, drug delivery, drug resistance, P-glycoprotein inhibitor http://dx.doi.org/10.4137/DTI.S12519 http://www.la-press.com http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 http://www.la-press.com mailto:lutful_amin@yahoo.com Amin 28 Drug Target Insights 2013:7 Introduction P-glycoprotein (P-gp) is one of the first members of the ATP-binding cassette (ABC) transporter which acts as a physiological barrier by extruding toxins and xeno- biotics out of cells.1,2 Possible involvement of the drug transport- ers P glycoprotein and multidrug resistance-associated protein Mrp2 in dispo- sition of azithromycin. keywords: cancer; cells; delivery; drug; efflux; generation; glycoprotein; inhibition; inhibitors; multidrug; resistance; target cache: dti-1349.pdf plain text: dti-1349.txt item: #47 of 145 id: dti-1350 author: Roth, Bodil; Manjer, Jonas; Ohlsson, Bodil title: Microscopic Colitis and Reproductive Factors Related to Exposure to Estrogens and Progesterone date: 2013 words: 5528 flesch: 57 summary: Patients with lympho- cytic colitis had children less often compared to those with collagenous colitis (OR = 0.20, 95% CI = 0.05–0.86), however no differences were observed between patients with persistent or transient disease. The majority of MC patients had used OC at some period of their life. keywords: age; colitis; controls; factors; patients; reference; study; value; years cache: dti-1350.pdf plain text: dti-1350.txt item: #48 of 145 id: dti-1351 author: Hasan, Md. Anayet; Alauddin, S. M.; Al Amin, Mohammad; Nur, Suza Mohammad; Mannan, Adnan title: In Silico Molecular Characterization of Cysteine Protease YopT from Yersinia pestis by Homology Modeling and Binding Site Identification date: 2014 words: 6076 flesch: 62 summary: Secondary structure pre­ dictions are increasingly becoming the work horse for numerous methods aimed at predicting protein structure and function. Verification of protein structures: patterns of nonbonded atomic interactions. keywords: analysis; cell; cysteine; cysteine protease; function; model; pestis; plague; prediction; protease; protease yopt; protein; residues; site; structure; target; yersinia; yersinia pestis; yopt cache: dti-1351.pdf plain text: dti-1351.txt item: #49 of 145 id: dti-1352 author: Gumuslu, Esen; Mutlu, Oguz; Sunnetci, Deniz; Ulak, Guner; Celikyurt, Ipek K.; Cine, Naci; Akar, Furuzan; Savlı, Hakan; Erden, Faruk title: The Antidepressant Agomelatine Improves Memory Deterioration and Upregulates CREB and BDNF Gene Expression Levels in Unpredictable Chronic Mild Stress (UCMS)-Exposed Mice date: 2014 words: 8348 flesch: 56 summary: The results of our study revealed that chronic agomelatine increased BDNF expression in the hippocampus, and our findings are consistent with those of recent studies.57,60 These findings provide new information regarding the molecular mechanisms that contribute to the chronic effects of the new antidepressant agomelatine on brain function. Quantitative RT-PCR revealed that CREB and BDNF gene expression levels were downregulated in UCMS-exposed mice, and these alterations were reversed by chronic agomelatine or melatonin treatment. keywords: agomelatine; animals; antidepressant; bdnf; chronic; control; creb; effects; expression; gene; group; latency; levels; melatonin; memory; mice; mwm; stress; test; treatment; trial cache: dti-1352.pdf plain text: dti-1352.txt item: #50 of 145 id: dti-1353 author: Akar, Furuzan; Mutlu, Oguz; Celikyurt, Ipek K.; Bektas, Emine; Tanyeri, Mehmet H.; Ulak, Guner; Tanyeri, Pelin; Erden, Faruk title: Effects of Zaprinast and Rolipram on Olfactory and Visual Memory in the Social Transmission of Food Preference and Novel Object Recognition Tests in Mice date: 2014 words: 5766 flesch: 60 summary: Rutten K, Prickaerts J, Hendrix M, van der Staay FJ, Sik A, Blokland A. Time- dependent involvement of cAMP and cGMP in consolidation of object memory: Studies using selective phosphodiesterase type 2, 4 and 5 inhibitors. For instance, the specific PDE5-Is sildenafil and vardenafil have been shown to improve object recognition memory when injected immediately fol- lowing the first trial.13 PDE5-Is are assumed to improve early processes of memory consolidation via either a presynaptic or postsynaptic mechanism. keywords: effects; field; food; inhibitors; memory; mice; novel; object; olfactory; rolipram; stfp; test; total; zaprinast cache: dti-1353.pdf plain text: dti-1353.txt item: #51 of 145 id: dti-1354 author: Vudriko, Patrick; Masatani, Tatsunori; Cao, Shinuo; Terkawi, Mohamad Alla; Kamyingkird, Ketsarin; Mousa, Ahmed A.; Moumouni, Paul F. Adjou; Nishikawa, Yoshifumi; Xuan, Xuenan title: Molecular and Kinetic Characterization of Babesia microti Gray Strain Lactate Dehydrogenase as a Potential Drug Target date: 2014 words: 4760 flesch: 55 summary: This was carried out using B. microti Gray strain-infected hamster blood smears (day 8 post-infection) as previously described.21 The secondary antibody was anti-mouse Alexa-488 secondary diluted 200 times with 4% fetal bovine serum (FBS), and the http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 33Drug TargeT InsIghTs 2014:8 parasite nucleus was stained with propidium iodide. The purified genomic DNA of human isolate of B. microti Gray strain (US type, culture collection catalog No. 30221) was used as template.21 Oligo nucleotide prim- ers with BamHI restriction site at the forward (5′-CCTCG- GATCCCATTCGTTAAAAGAAGA ATTTC-3′) and XhoI site at the reverse (5′-GGGGCTCGAGTTATAGTTG- GATATCTTTCTGTG-3′) were designed from B. microti strain R1 LDH gene sequence obtained from GenBank (Accession No. keywords: amino; babesia; bmldh; drug; enzyme; gossypol; kinetic; lactate; microti; nad+; protein; target cache: dti-1354.pdf plain text: dti-1354.txt item: #52 of 145 id: dti-1355 author: Akimoto, Tetsu; Morishita, Yoshiyuki; Ito, Chiharu; Iimura, Osamu; Tsunematsu, Sadao; Watanabe, Yuko; Kusano, Eiji; Nagata, Daisuke title: Febuxostat for Hyperuricemia in Patients with Advanced Chronic Kidney Disease date: 2014 words: 4343 flesch: 57 summary: Materials and Methods Seventeen patients on chronic hemodialysis (HD) treatment who had serum UA levels above 8.0  mg/dL and who were not receiving anti-hyperuricemic agents participated in the study. The target serum UA level was 6.0 mg/dL, and the dose of febuxostat was titrated or increased up to a maximum of 40 mg/day. keywords: disease; febuxostat; hyperuricemia; kidney; levels; patients; serum; stress; study; treatment cache: dti-1355.pdf plain text: dti-1355.txt item: #53 of 145 id: dti-1356 author: Roth, Bodil; Berntorp, Kerstin; Ohlsson, Bodil title: The Expression of Serum Antibodies Against Gonadotropin-releasing Hormone (GnRH1), Progonadoliberin-2, Luteinizing Hormone (LH), and Related Receptors in Patients with Gastrointestinal Dysfunction or Diabetes Mellitus date: 2014 words: 5549 flesch: 49 summary: The distribution of antibodies among subgroups of IBS or dysmotility patients is shown in Table 1. As some of the patients with diabetes mellitus and gastrointestinal complaints had no pathological changes as found in the examinations (n  =  3), they were diagnosed as IBS patients. keywords: antibodies; diabetes; dysmotility; expression; gastrointestinal; gnrh; hormone; ibs; igm; mellitus; patients; receptor; study cache: dti-1356.pdf plain text: dti-1356.txt item: #54 of 145 id: dti-1357 author: Parvege, Md. Masud; Rahman, Monzilur; Hossain, Mohammad Shahnoor title: Genome-wide Analysis of Mycoplasma hominis for the Identification of Putative Therapeutic Targets date: 2014 words: 8212 flesch: 52 summary: Target proteins found in the cytoplasm can be used as potential drug targets, whereas extracellular and membrane-bound proteins can work as probable vaccine targets.28 Various online tools were used for the prediction of subcellular localization and mem- brane topology. Target protein interacting with http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Parvege et al 58 Drug TargeT InsIghTs 2014:8 Table 3. keywords: 50s; analysis; cytoplasm; database; dna; drug; drug targets; hominis; identification; list; membrane; metabolism; mycoplasma; novel; pathways; potential; proteins; res; ribosomal; targets; yes cache: dti-1357.pdf plain text: dti-1357.txt item: #55 of 145 id: dti-1365 author: Otegbade, Olayinka O; Ojo, Johnson A; Adefokun, Dolapo I; Abiodun, Oyindamola O; Thomas, Bolaji N; Ojurongbe, Olusola title: Ethanol Extract of Blighia sapida Stem Bark Show Remarkable Prophylactic Activity in Experimental Plasmodium berghei–Infected Mice date: 2017 words: 5399 flesch: 55 summary: It is worth noting that B sapida extract exhibited the most active antiplas- modial properties at the lowest dosage tested. This dose- dependent activity potentially shows that response at low dose is more effective than response inhibition at high dose.29 Our results show that B sapida extracts will serve as excellent anti- malarial agent in the prophylactic model of treatment. keywords: activity; berghei; coartem; day; dose; extract; group; malaria; mice; plant; sapida cache: dti-1365.pdf plain text: dti-1365.txt item: #56 of 145 id: dti-1366 author: Friend Tambunan, Usman Sumo; Fardiansyah Nasution, Mochammad Arfin; Azhima, Fauziah; Parikesit, Arli Aditya; Toepak, Erwin Prasetya; Idrus, Syarifuddin; Kerami, Djati title: Modification of S-Adenosyl-l-Homocysteine as Inhibitor of Nonstructural Protein 5 Methyltransferase Dengue Virus Through Molecular Docking and Molecular Dynamics Simulation date: 2017 words: 8202 flesch: 52 summary: The SAM-binding site itself consists of 14 amino acids (Ser56, Lys61, Cys82, Gly86, Trp87, Thr104, Lys105, Asp131, Val132, Phe133, Asp146, Ile147, Lys181, and Glu217) that could be selected as a drug target for NS5 meth- yltransferase.48 Therefore, the modification of SAH ligand should fit with the SAM-binding site. In addition, the 2P41 PDB structure has SAH ligand as well, which can be used later for molecular docking simulation purposes. keywords: asp146; complex; dengue; docking; drug; dynamics; enzyme; interaction; ligands; m1356; m2696; m331; methyltransferase; ns5; process; protein; sah; simulation; site; software; structure; virus cache: dti-1366.pdf plain text: dti-1366.txt item: #57 of 145 id: dti-1367 author: Avasarala, Jagannadha title: Anti-CD20 Cell Therapies in Multiple Sclerosis—A Fixed Dosing Schedule for Ocrelizumab is Overkill date: 2017 words: 2230 flesch: 51 summary: There is minimal scientific validity in infusing the drug every 6 months particularly if CD20 cell counts are negligible in the peripheral blood. Because OCR avidly targets CD20 cell populations and depletes them and as their numbers can be monitored by peripheral blood counts of CD19 cells, it remains poorly understood why OCR needs to be reinfused at sched- uled intervals regardless of CD20 cell counts. keywords: cd20; cell; counts; ocr; patients; rtx cache: dti-1367.pdf plain text: dti-1367.txt item: #58 of 145 id: dti-1370 author: Vishal, Chaturvedi; Kumar, Jonnala Ujwal; Swamy, Cherukuvada Veera Brahmendra; Nandini, Rangaraj; Srinivas, Gunda; Kumaresan, Rathinam; Shashi, Singh; Sreedhar, Amere Subbarao title: Repercussion of Mitochondria Deformity Induced by Anti-Hsp90 Drug 17AAG in Human Tumor Cells date: 2011 words: 11407 flesch: 47 summary: Large portion of mitochondrial proteins is not made but imported from nuclear coded genes with the help of Hsp90 and Hsp70 chaperone machines. And any interfer- ence with either of the chaperone machinery there- fore hinders import of mitochondrial proteins. keywords: 17aag; 17aag treatment; analysis; ca2; cancer; cells; chaperone; control; cytochrome; deformity; digitonin; drug; effects; family; fig; hsp90; http://www.la-press.com; inhibition; insights; membrane; min; mitochondria; potential; protein; ribosomal; ros; swelling; target; treatment; tumor cache: dti-1370.pdf plain text: dti-1370.txt item: #59 of 145 id: dti-1371 author: Bello, Edson José Monteiro; Correia, Amabel Fernandes; Marins, José Ricardo Pio; Merchan-Hamann, Edgar; Kanzaki, Luis Isamu Barros title: Predictors of Virologic Failure in HIV/AIDS Patients Treated with Highly Active Antiretroviral Therapy in Brasília, Brazil During 2002–2008 date: 2011 words: 5794 flesch: 46 summary: The essential objective of treatment in patients presenting therapeutic failure is to maintain T CD4+ acceptable cell population density, whilst new therapeutic options are awaited, contrary to the prior- ity aim to reach and keep up an undetectable viral load.4 According to Moore et al,5 virological failure is characterized by viral load higher than 400 cop- ies/mL after 48 weeks of initial treatment or among subjects that had complete viral suppression, but later on the viral load will recrudesce. These condi- tions are mainly suggestive of immunologic failure but laboratory analysis confirmation is mandatory.6 Cozzi-Lepri et al7 concluded that patients remaining in HAART failure presented viral load slowly pro- gressing during the next 12 months, differently to T CD4+ cell count which remained stable. keywords: antiretroviral; cd4; cell; copies; count; failure; haart; health; hiv; load; patients; therapy; treatment cache: dti-1371.pdf plain text: dti-1371.txt item: #60 of 145 id: dti-1373 author: Annabi, Borhane; Lord-Dufour, Simon; Vézina, Amélie; Béliveau, Richard title: Resveratrol Targeting of Carcinogen-Induced Brain Endothelial Cell Inflammation Biomarkers MMP-9 and COX-2 is Sirt1-Independent date: 2012 words: 6063 flesch: 51 summary: Results Sirt1 gene expression profiling in grade I-IV brain tumour tissues Fourthy-eight clinical tissue samples were first analyzed for Sirt1 gene expression profil using TissueScan™ cancer and normal tissue cDNA arrays (OriGene, Rockville, MD) from 43 clinical samples covering brain cancer four stages and normal tissues as described in the methods section. PMA treatment by itself did not affect Sirt1 gene expression (not shown). keywords: brain; cancer; cells; cox-2; endothelial; expression; gapdh; gene; grade; hbmec; inhibition; iκb; mmp-9; pma; resveratrol; sirt1; target cache: dti-1373.pdf plain text: dti-1373.txt item: #61 of 145 id: dti-1374 author: Pendleton, Hillevi; Alm, Ragnar; Fredrikson, Gunilla Nordin; Ohlsson, Bodil title: Antibodies Against Gonadotropin-Releasing Hormone in Patients with Posterior Laryngitis date: 2013 words: 4507 flesch: 55 summary: Patients with organic gastrointestinal diseases such as inflam- matory bowel disease, celiac disease, and scleroderma do not express antibodies.12,13 This raises the hypoth- esis that patients with different functional disorders, which often are associated and show an overrepresen- tation in women,14,15 may express GnRH antibodies as a common feature. Consecutive PL patients were included after examination. keywords: acid; antibodies; controls; gnrh; hormone; patients; posterior; reflux; study; symptoms cache: dti-1374.pdf plain text: dti-1374.txt item: #62 of 145 id: dti-1375 author: Sarangi, Upasana; Paithankar, Khande Rao; Kumar, Jonnala Ujwal; Subramaniam, Vaidyanathan; Sreedhar, Amere Subbarao title: 17AAG Treatment Accelerates Doxorubicin Induced Cellular Senescence: Hsp90 Interferes with Enforced Senescence of Tumor Cells date: 2012 words: 11943 flesch: 54 summary: Wortma- nin treatment also resulted in increased cell death sug- gesting its role in senescence cell survival (Fig. 2D and E) that however, did not result in increased senescence positive cells (compare Fig. keywords: 17aag; activation; cancer; cells; combination; control; d4 d; day; doxorubicin; drug; expression; fig; gal; hsp90; increase; inhibition; p53; pre; senescence; staining; target; treatment; tumor cache: dti-1375.pdf plain text: dti-1375.txt item: #63 of 145 id: dti-1378 author: Mbah, Andreas N.; Kamga, Henri L.; Awofolu, Omotayo R.; Isokpehi, Raphael D. title: Drug Target Exploitable Structural Features of Adenylyl Cyclase Activity in Schistosoma mansoni date: 2012 words: 12493 flesch: 60 summary: The possible conserved domain search was car- ried out using the public server at http://www. ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi for the Smp_059340.1, and the individual domains present were analyzed and binding residues were compared within the domains. It is used for defining GTP binding proteins in general.33 The G2 box motif (green) is located on the loop and contains only one residue, being Thr188. keywords: + ion; adenylyl; beta; binding; box; box motif; complex; cyclase; drug; fig; gamma; gtp; ion complex; mansoni; mg2 +; motif; protein; region; residues; site; site residues; smp_059340.1; structure; switch; target cache: dti-1378.pdf plain text: dti-1378.txt item: #64 of 145 id: dti-1400 author: Murakami, Takuya; Akimoto, Tetsu; Okada, Mari; Hishida, Erika; Sugase, Taro; Miki, Atsushi; Kohara, Marina; Yoshizawa, Hiromichi; Masuda, Takahiro; Kobayashi, Takahisa; Saito, Osamu; Muto, Shigeaki; Nagata, Daisuke title: Valacyclovir Neurotoxicity and Nephrotoxicity in an Elderly Patient Complicated by Hyponatremia date: 2018 words: 4221 flesch: 48 summary: The withdrawal or discontinuation of the offending agent is the mainstay treatment for acyclovir or valacyclovir-mediated poisoning; however, there are several anecdotal reports suggest- ing that HD may play a role in the rapid reduction in serum acyclovir levels, thereby accelerating the recovery from renal and/or neurological disorders.4,8,11–14 Given the chemical and pharmacokinetic characteristics of acyclovir, including its small molecular weight (225 Da), limited protein-binding rate, low steady-state volume of distribution, and high water solubility, it can be readily removed with extracorporeal procedures, includ- ing HD, HF, and hemodiafiltration, with a high elimination rate in HD.4,8,12,15 In the present case, the concurrent hypona- tremia precluded us from promptly performing HD as the pro- cedure to remedy volume overload, azotemia, and abnormal serum electrolyte levels results in the rapid correction of the serum sodium level and predisposes patients to a risk of osmotic demyelination syndrome (ODS).16 In this context, we decided to perform HF, which may have a lower magnitude of sodium exchange than HD,17 as an initial mode of blood purification with the aim of correcting the hyperkalemia associated with AKI as well as active acyclovir removal, and it was not until the confirmation of successfully corrected serum sodium levels that HD was finally applied without any hesitation. A lack of infor- mation regarding the therapeutic benefit of HF in cases with valacyclovir or acyclovir toxicity18 also encouraged us to employ HP empirically as an adjunct treatment for the disease after confirming the normalization of the patient’s serum potassium levels, although acyclovir is not necessarily listed as an agent that can be removed by this procedure.19 Given our experience with the current patient, we believe that HF and/or HP are viable therapeutic options in patients with hyponatremia who are at risk of developing a rate of sodium correction with HD that far exceeds the safe recommendation, although it does not allow us to objectively determine the clinical impact of each procedure on this pathology. keywords: acyclovir; case; day; hyponatremia; levels; neurotoxicity; patient; serum; sodium; treatment; valacyclovir cache: dti-1400.pdf plain text: dti-1400.txt item: #65 of 145 id: dti-1401 author: Avasarala, Jagannadha title: DRESS Syndrome and Daclizumab Failure-Were Potentially Dangerous Signs Missed in Clinical Trials date: 2018 words: 1752 flesch: 47 summary: This should serve as a cautionary tale for all clinicians who use “newer MS drugs” that have mushroomed in recent memory following a flurry of recent FDA approvals. Many stud- ies have reported DRESS syndrome patients with genetic predisposition linked to specific drugs and one wonders if Zinbryta use, DRESS syndrome, and HLA class II alleles were linked as well. keywords: dress; drug; patients; syndrome; zinbryta cache: dti-1401.pdf plain text: dti-1401.txt item: #66 of 145 id: dti-1406 author: Mutlu, Oguz; Akar, Furuzan; Celikyurt, Ipek Komsuoglu; Tanyeri, Pelin; Ulak, Guner; Erden, Faruk title: 7-NI and ODQ Disturbs Memory in the Elevated Plus Maze, Morris Water Maze, and Radial Arm Maze Tests in Mice date: 2015 words: 6427 flesch: 67 summary: Mutlu O, Ulak G, Belzung C. Effects of nitric oxide synthase inhibitors 1-(2 trifluoromethylphenyl)—imidazole (TRIM) and 7-nitroindazole (7-NI) on learning and memory in mice. Nitric oxide synthase (NOS) and guanylate cyclase (GC) inhibitors have been shown to exert some effects on cognition in previous studies; however, the findings have been controversial. keywords: effects; latency; learning; maze; memory; mice; odq; oxide; platform; test cache: dti-1406.pdf plain text: dti-1406.txt item: #67 of 145 id: dti-1407 author: Zulkipli, Ihsan N.; David, Sheba R.; Rajabalaya, Rajan; Idris, Adi title: Medicinal Plants: A Potential Source of Compounds for Targeting Cell Division date: 2015 words: 6058 flesch: 58 summary: Micro- tubules represent the best and most successful target thus far http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 17Drug TargeT InsIghTs 2015:9 Medicinal plants: a potential source of compounds for targeting cell division identified in cancer treatment.37–39 Cancer cells are sensitive to microtubule poisons that arrest cells in mitosis because they undergo mitosis more frequently than normal cells. Among other properties, one favorable characteristic of an anticancer drug is its ability to block the uncontrollable process of cell division, as cancer cells are notorious for their abnormal cell division. keywords: anticancer; biol; cancer; cell; compounds; division; drug; dynamics; microtubule; mitosis; plants; potential; source; target; targeting; tubulin cache: dti-1407.pdf plain text: dti-1407.txt item: #68 of 145 id: dti-1408 author: Ohlsson, Bodil; Melander, Olle title: Basal Plasma Levels of Copeptin are Elevated in Inactive Inflammatory Bowel Disease after Bowel Resection date: 2015 words: 5810 flesch: 53 summary: The aim of this study was to examine basal plasma levels of a variety of peptide precursors in patients with inflammatory bowel disease (IBD). KEY WORDS: copeptin, inflammatory bowel disease, irritable bowel syndrome-like symptoms, neuropeptides, precursors CITATION: Ohlsson and Melander. keywords: bowel; cohort; controls; copeptin; disease; fragment; ibd; levels; mpm; patients; peptide; plasma; precursor; study cache: dti-1408.pdf plain text: dti-1408.txt item: #69 of 145 id: dti-1409 author: Tambunan, Usman S.F.; Zahroh, Hilyatuz; Parikesit, Arli A.; Idrus, Syarifuddin; Kerami, Djati title: Screening Analogs of β-OG Pocket Binder as Fusion Inhibitor of Dengue Virus 2 date: 2015 words: 7204 flesch: 57 summary: The compounds used in this research are commercially available analogs (90% resemblance) of β-OG pocket binder compounds (β-OG, as a natural ligand of this pocket) and the compounds used in Poh et al’s,22 Kampmann et al’s,23 and Yennamalli et al’s research.21 This research aims to find new antiviral candidates against DENV that are analogs of β-OG pocket binder of DENV envelope protein according to previous research21–23,25 through molecular docking and dynamics simulation. Searching of 3D structure of DENV envelope protein. keywords: analogs; complex; compounds; dengue; denv; docking; drug; envelope; ligand; pocket; protein; research; screening; structure; target; virus cache: dti-1409.pdf plain text: dti-1409.txt item: #70 of 145 id: dti-1410 author: Imai, Toshimi; Akimoto, Tetsu; Ito, Chiharu; Masuda, Takahiro; Nagata, Daisuke title: Management of Diabetes Associated with Nephrotic Syndrome: Therapeutic Potential of Dapagliflozin for Protracted Volume Retention date: 2015 words: 2422 flesch: 45 summary: A case of volume depletion and prerenal azote- mia that required rehydration and the withdrawal of angio- tensin-converting inhibitor and diuretic treatment was recently reported in a phase II trial of dapagliflozin.15 Not surprisingly, dapagliflozin was effective and well tolerated as an adequate therapeutic option for modulating the present patient’s level of glycemic control. The lack of longitudinal data regarding the gross daily urine output, as well as the amount of urinary excreted sodium after the commencement of oral dapagliflozin treatment in the previous studies, precludes us from evaluating the valid- ity of our findings.10–12 Nevertheless, List et al, demonstrated that the administration of dapagliflozin in treatment-naive patients with type 2 diabetes resulted in an increased urinary output of between 107 mL/day and 470 mL/day, equating to ~0.3–1.5 additional voids per day.1,17 This highlights the need for further investigation regarding the impact of the diuretic properties of this agent on the overall management of diabetic patients.9 Obviously, the accumulation of more experience with additional cases similar to ours requires continuous and careful attention, and such a strategy would aid in the estab- lishment of a novel approach to treating fluid retention as well as investigating the therapeutic impact of SGLT-2 inhibitors in diabetic patients with nephrotic syndrome. keywords: dapagliflozin; day; diabetes; glucose; nephrotic; sodium; syndrome; type cache: dti-1410.pdf plain text: dti-1410.txt item: #71 of 145 id: dti-1415 author: Oblitas, Crhistian-Mario; Galeano-Valle, Francisco; La Cruz, Laura Vela-De; Toro-Cervera, Jorge Del; Demelo-Rodríguez, Pablo title: Omalizumab as a Provoking Factor for Venous Thromboembolism date: 2019 words: 1709 flesch: 49 summary: Yalcin AD, Celik B, Gumuslu S. D-dimer levels decreased in severe allergic asthma and chronic urticaria patients with the omalizumab treatment. Treating severe allergic asthma with anti-IgE monoclonal antibody (omalizumab): a review. keywords: asthma; dimer; drug; omalizumab; risk; treatment; vte cache: dti-1415.pdf plain text: dti-1415.txt item: #72 of 145 id: dti-1416 author: Orrico, Kathleen B title: Basic Concepts in Genetics and Pharmacogenomics for Pharmacists date: 2019 words: 6265 flesch: 48 summary: A set or group of gene alleles typically located on the same chromosome and inherited together is referred to as a haplotype and may indicate a common line of descent in indi- viduals who share one. To illustrate several of these concepts, let us examine how CYP2D6 gene variation relates to both the effectiveness and safety of the opioid analgesic drug codeine. keywords: alleles; base; cyp2d6; dna; drug; enzyme; gene; genome; human; pgx; protein; september; sequence; testing; variation cache: dti-1416.pdf plain text: dti-1416.txt item: #73 of 145 id: dti-1417 author: Abdul Manap, Aimi Syamima; Vijayabalan, Shantini; Madhavan, Priya; Chia, Yoke Yin; Arya, Aditya; Wong, Eng Hwa; Rizwan, Farzana; Bindal, Umesh; Koshy, Shajan title: Bacopa monnieri, a Neuroprotective Lead in Alzheimer Disease: A Review on Its Properties, Mechanisms of Action, and Preclinical and Clinical Studies date: 2019 words: 14974 flesch: 64 summary: T H E M O D E L U S E D A N D S T U D Y D E S IG N D O S E O R F R E q U E N C Y E F F E C T O F B M E T R E AT M E N T R E F E R E N C E S In v iv o m od el E th yl ch o lin e a zi ri d in iu m io n (A F 6 4A ) (2 n m o l/2 μ L) — IC V -i n d u ce d m al e W is ta r ra ts 20 , 4 0, a n d 8 0 m g /k g B W B M E e nh an ce d th e es ca p e la te n cy t im e (P < .0 1) in t he M or ri s w at er m a ze te st . d e cr ea se d th e lip id p er ox id e s an d pr ot e in o xi d at io n. B ot h el e ct ro n an d flu or es ce n ce m ic ro sc o p ic s tu d ie s un co ve re d su bs ta nt ia l i nh ib iti o n of n e cr ot ic c ha n g e an d in tr a- n eu ro na l l ip of u sc in in t h e hi p p o ca m pu s C A 1 re g io n. Jy ot i e t a l7 0 S tr e pt oz ot o ci n (S T Z ) (3 m g /k g, p . keywords: al e; b o; bacopa; ce d; d b; d d; d w; e d; e n; e s; e t; g d; g e; h e; m e; m g; m o; m p; monnieri; n d; r e; w e cache: dti-1417.pdf plain text: dti-1417.txt item: #74 of 145 id: dti-1418 author: Kossaify, Antoine title: Vernakalant in Atrial Fibrillation: A Relatively New Weapon in the Armamentarium Against an Old Enemy date: 2019 words: 5494 flesch: 47 summary: Incidence of thromboem- bolic complications within 30 days of electrical cardioversion performed within 48 hours of atrial fibrillation onset. de Riva-Silva M, Montero-Cabezas JM, Salgado-Aranda R, Lopez-Gil M, Fon- tenla-Cerezuela A, Arribas-Ynsaurriaga F. 1:1 atrial flutter after vernakalant administration for atrial fibrillation cardioversion. keywords: atrial; cardioversion; control; conversion; fibrillation; heart; management; onset; onset af; patients; rate; rhythm; sinus; vernakalant cache: dti-1418.pdf plain text: dti-1418.txt item: #75 of 145 id: dti-1419 author: Hydery, Tasmina; Coppenrath, Valerie Azzopardi title: A Comprehensive Review of Pegvaliase, an Enzyme Substitution Therapy for the Treatment of Phenylketonuria date: 2019 words: 6245 flesch: 55 summary: Studies in adult PKU patients have shown a variation in phenylalanine levels can be observed without any change in treatment.20 In clinical trials, the response to sapropterin treatment was defined as a 30% reduction in blood phenylalanine concentration from base- line.21 The assessment of blood phenylalanine concentrations may also be indicative of patient adherence to therapy.22 Poor adherence can manifest as failure to take medical foods or pre- scribed medications, and missing regular clinic appointments or blood phenylalanine testing.23 keywords: blood; concentrations; dose; patients; pegvaliase; phase; phenylalanine; phenylketonuria; pku; study; treatment; µmol cache: dti-1419.pdf plain text: dti-1419.txt item: #76 of 145 id: dti-1420 author: Fragkou, Paraskevi; Souli, Maria; Theochari, Maria; Kontopoulou, Christina; Loukides, Stelios; Koumarianou, Anna title: A Case of Organizing Pneumonia (OP) Associated with Pembrolizumab date: 2016 words: 2759 flesch: 44 summary: When COP is suspected in cancer patients, differential diagnoses that need to be considered include disease progres- sion, cardiogenic edema, radiation pneumonitis, allergies, pulmonary hemorrhage, and infections that cause diffuse inter- stitial infiltrates in the lungs such as gram-negative or gram- positive bacteria, fungi (Aspergillus, Candida, and P. jirovecii), parasites (Toxoplasma gondii), or viruses (herpes simplex, vari- cella zoster, and cytomegalovirus).17 On the other hand, pneumonitis in cancer patients may hold a heterogeneous pathological background based on vari- ous antineoplastic agents including chemotherapy, such as taxanes, targeted therapy, such as everolimus, and Mabs, such as rituximab, a chimeric IgG1.17 In retrospective analysis of patients with non-Hodgkin lymphoma treated with rituximab, 8 of 23 patients, diagnosed with COP and treated with corticosteroids, died, indicat- ing that COP although rare may become a fatal pulmonary toxicity and the oncologists or internists must maintain a high index of suspicion to recognize this complication early. Introduction New monoclonal antibodies (Mabs) targeting the immune checkpoint blockade have revolutionized the treatment of advanced melanoma patients. keywords: athens; immune; melanoma; patient; pd-1; pembrolizumab; pneumonia; university cache: dti-1420.pdf plain text: dti-1420.txt item: #77 of 145 id: dti-1421 author: Zahroh, Hilyatuz; Ma’rup, Ahmad; Friend Tambunan, Usman Sumo; Parikesit, Arli Aditya title: Immunoinformatics Approach in Designing Epitope-based Vaccine against Meningitis-inducing Bacteria (Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae Type b) date: 2016 words: 6023 flesch: 50 summary: non nKFrsLDDIaVTgYL hLa-DrB1*01:01(29.00), hLa-DrB1*04:01(201.00), hLa-DrB1*09:01(219.00), hLa-DrB1*04:05(325.00), hLa-DrB1*04:04 (440.00) antigen LhnKFrsLDDIaVTg hLa-DrB1*01:01(30.00), hLa-DrB1*04:01(203.00), hLa-DrB1*09:01(230.00), hLa-DrB1*04:05(303.00), hLa-DrB1*04:04(438.00) antigen FFnFeYIVKKLnnQn hLa-DrB1*11:01(18.00), hLa-DrB5*01:01(68.00), hLa-DrB1*04:04(207.00), hLa-DrB1*04:05(230.00), hLa-DrB1*01:01(323.00), hLa-DrB1*08:02(500.00) antigen YKPDFnsDaTsTsrF hLa-DrB1*04:01(19.00), hLa-DrB1*04:05(218.00), hLa-DrB1*01:01(236.00), hLa-DrB3*01:01(390.00), hLa-DrB1*07:01(429.00), hLa-DrB1*04:04(499.00) antigen KPDFnsDaTsTsrFL hLa-DrB1*04:01(19.00), hLa-DrB1*04:05(206.00), hLa-DrB1*01:01(207.00), hLa-DrB1*07:01(295.00), hLa-DrB3*01:01(461.00) antigen egePDYLngarnanT hLa-DrB1*01:01(100.00), hLa-DrB1*04:04(124.00), hLa-DrB1*04:01(256.00), hLa-DrB1*04:05(355.00) antigen MFILnnrKWrKLKrD hLa-DrB1*11:01(81.00), hLa-DrB1*03:01(142.00), hLa-DrB5*01:01(206.00), hLa-DrB1*13:02(373.00). antigen rnTgIKnsngKYIVF hLa-DrB1*13:02(11.00), hLa-DrB1*07:01(95.00), hLa- DrB1*09:01(248.00), hLa-DrB5*01:01(278.00), hLa-DrB1*01:01(483.00) antigen earnTgIKnsngKYI hLa-DrB1*13:02(12.00), hLa-DrB1*07:01(105.00), hLa-DrB1*09:01(266.00), hLa-DrB5*01:01(295.00) antigen sLLYILeKnaeMeFD hLa-DrB1*01:01(64.00), hLa-DrB1*04:01(123.00), hLa-DrB5*01:01(133.00), hLa-DrB1*04:04(161.00), hLa-DrB1*11:01(264.00), hLa-DrB1*04:05 (310.00) antigen LLYILeKnaeMeFDr hLa-DrB1*01:01(70.00), hLa-DrB1*04:01(128.00), hLa-DrB5*01:01(136.00), hLa-DrB1*04:04(172.00), hLa-DrB1*04:05(404.00) non KsLLYILeKnaeMeF hLa-DrB1*01:01(53.00), hLa-DrB1*04:01(118.00), hLa-DrB5*01:01(130.00), hLa-DrB1*04:04(147.00), hLa-DrB1*11:01(220.00), hLa-DrB1*04:05(237.00), hLa-DrB1*15:01(293.00), hLa-DrB1*12:01(392.00) non http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Zahroh et al 26 Drug TargeT InsIghTs 2016:10 Table 6. keywords: antigen; cell; class; drb1; epitope; hla; hla class; influenzae; meningitidis; mhc; non; pneumoniae; prediction; protein; serogroup; table; type; vaccine cache: dti-1421.pdf plain text: dti-1421.txt item: #78 of 145 id: dti-1422 author: Ueda, Yuichiro; Ishii, Hiroki; Kitano, Taisuke; Shindo, Mitsutoshi; Miyazawa, Haruhisa; Ito, Kiyonori; Hirai, Keiji; Kaku, Yoshio; Mori, Honami; Hoshino, Taro; Ookawara, Susumu; Kakei, Masafumi; Tabei, Kaoru; Morishita, Yoshiyuki title: Effects and Safety of Linagliptin as an Add-on Therapy in Advanced-Stage Diabetic Nephropathy Patients Taking Renin–Angiotensin–Aldosterone System Blockers date: 2016 words: 3677 flesch: 52 summary: It is also a major risk factor for the develop- ment of cardiovascular disease.4 A poorly controlled blood glucose level and hypertension are the main contributors to progression to end-stage renal disease and the development of cardiovascular disease in DMN.5,6 Appropriate manage- ment of blood glucose and blood pressure levels is important to improve the prognosis of patients with DMN.7–9 Renin–angiotensin–aldosterone system (RAAS) block- ers are used as first-line agents for blood pressure control in DMN patients. They have been reported to decrease blood pressure and have beneficial nephroprotective and cardiopro- tective effects.10–12 For blood glucose control, although many kinds of hypoglycemic agents have been developed, most cannot be used in DMN patients with decreased renal function because they have diminished elimination by the kidneys, and may cause unfavorable side effects. keywords: blockers; diabetes; dmn; effects; glucose; linagliptin; patients; stage; study cache: dti-1422.pdf plain text: dti-1422.txt item: #79 of 145 id: dti-1423 author: Kitanaka, Junichi; Kitanaka, Nobue; Hall, F. Scott; Uhl, George R.; Takemura, Motohiko title: Brain Histamine N-Methyltransferase as a Possible Target of Treatment for Methamphetamine Overdose date: 2016 words: 5975 flesch: 47 summary: http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 Kitanaka et al 4 Drug TargeT InsIghTs 2016:10 dependently decreased METH-induced stereotypical biting, while increasing sniffing, suggesting that metoprine may ame- liorate high-dose METH-induced symptoms by producing a leftward shift in METH behavioral effects (Table 1).65 In brain, for termination of histaminergic neurotransmission after activa- tion of histamine receptors, histamine is transferred from the extracellular space into cytoplasm by organic cation transporter 3 and/or the equilibrative nucleoside transporter (ENT4), and catabolized by the cytosolic enzyme histamine N-methyltrans- ferase (HMT) to form N-methylhistamine, which is inactive in the histaminergic system.55,56 HMT is the sole enzyme that degrades histamine in brain,57,58 whereas diamine oxidase (DAO; histaminase) catabolizes histamine in peripheral tis- sues.49,59 keywords: abuse; activity; behavior; biting; brain; drug; effects; histamine; hmt; kitanaka; levels; meth; methamphetamine; metoprine; mice; overdose; pharmacol; receptors; stereotypy; treatment cache: dti-1423.pdf plain text: dti-1423.txt item: #80 of 145 id: dti-1424 author:  ,   title: Introductory Editorial: Drug-Eluting Stents or Drug-Eluting Grafts? Insights from Proteomic Analysis date: 2016 words: 3331 flesch: 35 summary: This has been considered as a marker of arterial stiffness and therefore increased risk of developing atherosclerosis.20 Structural proteomic studies on ITA tissue showed differential expression of proteins that are implicated in cytoskeleton activity regulation,21 in the migrative capacity of vascular smooth muscle cells, extracellular matrix composition, coagulation, apoptosis, and heat shock response.22 Interestingly, a proteomic analysis of the secrete of ITA, known as secretome, demonstrated an increased production of gelsolin, vinculin, lamin A/C and phosphoglucomutase 5 by mammary arterial tissues. Differential profiles of protein expression exclusively present in ITA tissues and secrete, but not in the other vessels, have been intriguingly discovered (Fig. 1) and the identification of these proteins would provide in the future precious information to elucidate reasons of ITA superiority in CABG. keywords: devices; drug; graft; insights; ita; spadaccio; surgery; target; tissue; university cache: dti-1424.pdf plain text: dti-1424.txt item: #81 of 145 id: dti-1425 author: Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo title: Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery date: 2016 words: 4337 flesch: 49 summary: ABSTR ACT: Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent. keywords: cardiac; collagen; dswi; gentamicin; gics; infection; patients; risk; sternal; surgery; use; wound cache: dti-1425.pdf plain text: dti-1425.txt item: #82 of 145 id: dti-1426 author: Spadaccio, Cristiano; Nappi, Francesco; De Marco, Federico; Sedati, Pietro; Sutherland, Fraser W.H.; Chello, Massimo; Trombetta, Marcella; Rainer, Alberto title: Preliminary in Vivo Evaluation of a Hybrid Armored Vascular Graft Combining Electrospinning and Additive Manufacturing Techniques: Supplementary Issue: Current Developments in Drug Eluting Devices date: 2016 words: 5087 flesch: 42 summary: Armored vascular grafts were prepared as previously described.20 Briefly, a 13% w/w PLLA (Sigma-Aldrich) solution in dichloromethane was combined with unfractioned heparin (sodium salt, 5000  UI/mL; Mspharma) using methanol as a cosolvent. He W, Ma Z, Teo WE, et al. keywords: cells; drug; endothelial; engineering; et al; graft; heparin; plla; scaffold; study; tevg; tissue; vascular; vivo cache: dti-1426.pdf plain text: dti-1426.txt item: #83 of 145 id: dti-1548 author: Mabrouk, Nada M.K.; Elkaffash, Dalal M.; Abdel-Hadi, Mona; Abdelmoneim, Salah-ElDin; Saad ElDeen, Sameh; Gewaifel, Gihan; Elella, Khaled A.; Osman, Maher; Baddour, Nahed title: Identification of the possible therapeutic targets in the insulin-like growth factor 1 receptor pathway in a cohort of Egyptian hepatocellular carcinoma complicating chronic hepatitis C type 4 date: 2020 words: 8463 flesch: 57 summary: Quantitative reverse transcription polymerase chain reaction (qRT-PCR) using RT2 Profiler PCR Array for Human Insulin Signaling Pathway was done to determine significantly up- and downregulated genes with identification of most frequently coregulated genes, followed by correlation of gene expression with different patient/tumor characteristics. Keywords: Gene expression, Hepatitis C virus, Hepatocellular carcinoma, Molecular therapeutic targets Received: January 8, 2020 Accepted: January 20, 2020 Published online: April 8, 2020 Corresponding author: Nada M.K. Mabrouk Department of Pathology University of Alexandria Alexandria, Egypt nada_mabrouk@hotmail.com, nada.mabrouk@alexmed.edu.eg Introduction Hepatocellular carcinoma (HCC) has become the fifth most common cancer in men worldwide and the ninth in women and the third leading cause of cancer-related deaths. keywords: aebp1; alexandria; analysis; cancer; carcinoma; cases; cell; expression; genes; hcc; hccs; hcv; human; insulin; liver; pathway; present; signaling; study; tumor cache: dti-1548.pdf plain text: dti-1548.txt item: #84 of 145 id: dti-2024 author: de Souza, Elen M.; Oliveira, Gabriel M.; de Nazaré C. Soeiro, Maria title: Electrocardiographic Findings in Acutely and Chronically T. cruzi-infected Mice Treated by a Phenyl-Substituted Analogue of Furamidine DB569 date: 2007 words: 4985 flesch: 58 summary: The disease has two phases: the acute, which appears shortly after the infection, and the chronic phase, which can develop in about one-third of the infected individuals after a silent period of years or decades called the indeterminate phase (Cunha-Neto et al. 2006). Although the main clinical manifestations of the Chagas disease include both the cardiac and the digestive alterations, the former is the most prominent: about 25% to 30% of the infected people will develop a progressive heart disease commonly displaying symptomatic ventricular arrhythmias, hyper- trophy; congestive heart failure; sinus bradycardia and tachycardia; thomboembolism and sudden death (Marin-Neto et al. 1999; Salles et al. 2003). keywords: cardiac; chagas; cruzi; db569; disease; dpi; et al; infection; mice; souza cache: dti-2024.pdf plain text: dti-2024.txt item: #85 of 145 id: dti-2025 author: Kusumanto, Yoka H.; Meijer, Coby; Dam, Wendy; Mulder, Nanno H.; Hospers, Geke A.P. title: Circulating Vascular Endothelial Growth Factor (VEGF) Levels in Advanced Stage Cancer Patients Compared to Normal Controls and Diabetes Mellitus Patients with Critical Ischemia date: 2007 words: 3995 flesch: 52 summary: A profi le of elevated VEGF levels in the more aggressive cancers compared to slow growing tumors and in those tumor types known to respond to VEGF antibody therapy, would support further studies on VEGF levels as predictive markers. We measured VEGF levels in whole blood in 42 patients with high grade (n = 26) and low grade (n = 16) end stage cancer, and in 28 healthy controls and 37 patients with diabetes related vascular disease. keywords: cancer; elevated; et al; factor; growth; levels; patients; tumor; vegf; vegf levels cache: dti-2025.pdf plain text: dti-2025.txt item: #86 of 145 id: dti-2103 author: Sharma, Monica; Sharma, Swati; Ray, Pallab; Chakraborti, Anuradha title: Targeting Streptococcus pneumoniae UDP-glucose pyrophosphorylase (UGPase): in vitro validation of a putative inhibitor date: 2020 words: 5270 flesch: 52 summary: Therefore, for the se- lection of UGPase inhibitor, we modeled and analyzed the structure of S. pneumoniae UGPase using I-TASSER (Iterative- Threading ASSEmbly Refinement) server (http://zhang.bioin- formatics.ku.edu/I-TASSER) to delineate its tertiary structure, active site residues, and properties. Results Putative inhibitor of UGPase The structure of S. pneumoniae UGPase was analyzed in silico using I-TASSER server (http://zhang.bioinformatics. keywords: a549; cells; effect; fig; host; inhibitor; pneumoniae; streptococcus; udp; ugpase cache: dti-2103.pdf plain text: dti-2103.txt item: #87 of 145 id: dti-2170 author: Abayneh, Mengistu; Worku, Teshale title: Prevalence of multidrug-resistant and extended-spectrum beta-lactamase (ESBL)-producing gram-negative bacilli: A meta-analysis report in Ethiopia date: 2020 words: 7564 flesch: 57 summary: Many reports have documented the differ- ence in ESBL proportion estimates between hospitals versus community-based surveys (23,25,27,30). For instance, in Ethiopia studies show that about 36.8% of the population got antibiotics from community drug retail outlets without a prescription and 67.9% of people had dis- continued the use of antibiotics once their symptoms subside (3). keywords: analysis; beta; crossref; esbl; estimates; et al; ethiopia; gnb; isolates; mdr; meta; resistance; spectrum; studies; study cache: dti-2170.pdf plain text: dti-2170.txt item: #88 of 145 id: dti-2185 author: Tsuchiya, Hironori; Mizogami, Maki title: Interaction of drugs with lipid raft membrane domains as a possible target date: 2020 words: 11411 flesch: 42 summary: Phar- macologically relevant receptors, ion channels and enzymes are localized or cluster in membrane lipid rafts and caveolae (8-11). Given the localization of receptors, ion channels and en- zymes in membrane lipid rafts, the mode of drug action is first interpretable in a simple manner of receptor/channel/ enzyme and ligand interaction as known in the conventional mechanistic theory. keywords: cells; cholesterol; crossref; crossref medline; domains; dopc; drug; effects; fluidity; human; interaction; lipid; lipid rafts; medline; membrane; membrane fluidity; membrane lipid; model; mol%; molar; phase; popc; raft; ratio; receptors cache: dti-2185.pdf plain text: dti-2185.txt item: #89 of 145 id: dti-2188 author: Ayed, Khadija; Hadi Khalifa, Islam Latifa; Mokaddem, Salma; Ben Khamsa Jameleddine, Saloua title: Paradoxical bronchoconstriction caused by β2-adrenoceptor agonists date: 2020 words: 2499 flesch: 54 summary: Baseline spirometry revealed a small airways obstruction, which is defined by a normal forced vital capacity (FVC), a normal FEV1/FVC ratio, and a decrease of at least one forced expiratory flow (FEF): FEF50%, FEF25%, or FEF between 25% and 75% of the FVC (FEF25-75). Many TABLE I - Spirometric parameters before and after salbutamol inhalation Spirometric parameters Baseline spirometry After salbutamol Measured % Predicted Measured % Predicted % Changing FEV1 2.36 L 74 1.76 L 55 −25 FVC 3.57 L 91 keywords: agonists; bronchoconstriction; fev1; fvc; spirometry; terbutaline cache: dti-2188.pdf plain text: dti-2188.txt item: #90 of 145 id: dti-2192 author: de A. Morais, Ana H.; de Medeiros, Amanda F.; Medeiros, Isaiane; de Lima, Vanessa C.O.; Luz, Anna B.S.; Maciel, Bruna L.L.; Passos, Thais S. title: Tamarind (Tamarindus indica L.) Seed a Candidate Protein Source with Potential for Combating SARS-CoV-2 Infection in Obesity date: 2021 words: 7537 flesch: 51 summary: Medeiros et al (70) described the TTI purification process, obtaining a molecule with 100% in- hibition for trypsin (pTTI), heat resistant and with a partially identified amino acid sequence (currently complete and with structural modeling—unpublished data), which had high ho- mology with other trypsin inhibitors of the Kunitz family. Petersen A, Bressem K, Albrecht J, et al. keywords: adipose; coronavirus; cov-2; covid-19; crossref; crossref pubmed; effects; et al; food; infection; inflammation; inhibitor; obesity; potential; protease; protein; risk; sars; tissue; trypsin; tti cache: dti-2192.pdf plain text: dti-2192.txt item: #91 of 145 id: dti-2197 author: Khamsai, Sittichai; Sawanyawisuth, Kittisak; Senthong, Vichai; Limpawattana, Panita; Chindaprasirt, Jarin; Intapan, Pewpan M; Maleewong, Wanchai; Tiamkao, Somsak; Chotmongkol, Verajit; Ngamjarus, Chetta title: Corticosteroid treatment reduces headache in eosinophilic meningitis: a systematic review date: 2021 words: 478 flesch: 47 summary: Search strategy in PubMed on 21 November 2019 (21 articles) #1 Search meningit*[Title/Abstract] #2 Search eosinophil*[Title/Abstract] #3 Search parasites #4 Search ((parasitic diseases) OR helminthiasis OR (nematode infections)) #5 Search (parasit* OR helminth* OR nematod*) #6 Search Angiostrongylus cantonensis #7 Search ((angiostrongylus cantonensis) OR (A. cantonenesis)) #8 Search (angiostrongylus cantonensis) OR (a. cantonensis) #9 Search (#3 OR #4 OR #5 OR #6 OR #7 OR #8) #10 Search (#1 AND #2) #11 Search (#9 AND #10) #12 Search Randomized Controlled Trial [Publication Type] #13 Search (random* OR placebo* OR trial* OR groups OR (controlled study)) #14 Search (#12 OR #13) #15 Search (#11 AND #14) Search strategy in Central on 22 November 2019 (3 articles) #1 meningit*:ti,ab,kw #2 eosinophil*:ti,ab,kw #3 parasites #4 (parasitic diseases) OR helminthiasis OR (nematode infections) #5 parasit* OR helminth* OR nematod* #6 Angiostrongylus cantonensis #7 (angiostrongylus cantonensis) OR (A. cantonenesis) #8 (angiostrongylus cantonensis) OR (a. cantonensis) #9 #3 OR #4 OR #5 OR #6 OR #7 OR #8 #10 #1 AND #2 #11 #9 AND #10 #12 (Randomized Controlled Trial) OR random* OR placebo* OR trial* OR groups OR (controlled study) #13 #11 AND #12 #14 Humans #15 #13 AND #14 Drug Target Insights 2021 | DOI: 10.33393/dti.2021.2197 keywords: search cache: dti-2197.pdf plain text: dti-2197.txt item: #92 of 145 id: dti-2277 author: Watashi, Koichi; Shimotohno, Kunitada title: Cyclophilin and Viruses: Cyclophilin as a Cofactor for Viral Infection and Possible Anti-Viral Target date: 2007 words: 7188 flesch: 63 summary: Ozaki, K., Fujiwara, T., Kawai, A., Shimizu, F., Takami, S., Okuno, S., Takeda, S., Shimada, Y., Nagata, M. and Watanabe, T. et al. 1996. Luo, C., Luo, H., Zheng, S., Gui, C., Yue, L., Yu, C., Sun, T., He, P., Chen, J., Shen, J. et al. 2004. keywords: activity; binding; cells; csa; cyclophilin; cypa; cypb; et al; genome; hcv; human; protein; replication; rna; virus cache: dti-2277.pdf plain text: dti-2277.txt item: #93 of 145 id: dti-2291 author: Tongdee, Sukanya; Sawunyavisuth, Bundit; Sukeepaisarnjaroen, Wattana; Boonsawat, Watchara; Khamsai, Sittichai; Sawanyawisuth, Kittisak title: Clinical factors predictive of appropriate treatment in COPD: a community hospital setting date: 2021 words: 3350 flesch: 55 summary: Full information is available at www.aboutscience.eu Clinical factors predictive of appropriate treatment in COPD: a community hospital setting Sukanya Tongdee1, Bundit Sawunyavisuth2, Wattana Sukeepaisarnjaroen3, Watchara Boonsawat3, Sittichai Khamsai3, Kittisak Sawanyawisuth3 1Department of Medicine, Chumpae Hospital, Khon Kaen - Thailand 2Department of Marketing, Faculty of Business Administration and Accountancy, Khon Kaen University, Khon Kaen - Thailand 3Department of Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen - Thailand ABSTRACT Background: Chronic obstructive pulmonary disease (COPD) is a common respiratory disease. However, there are limited data on predictors of appropriate treatment in patients with COPD. keywords: copd; crossref; disease; factors; gold; guideline; patients; pubmed; study; treatment cache: dti-2291.pdf plain text: dti-2291.txt item: #94 of 145 id: dti-2342 author: Losi, Serena; Berra, Cesare Celeste Federico; Fornengo, Riccardo ; Pitocco, Dario ; Biricolti, Giovanni ; Orsini Federici, Marco title: The role of patient preferences in adherence to treatment in chronic disease: a narrative review date: 2021 words: 6535 flesch: 47 summary: Full information is available at www.aboutscience.eu The role of patient preferences in adherence to treatment in chronic disease: a narrative review Serena Losi1, Cesare Celeste Federico Berra2, Riccardo Fornengo3, Dario Pitocco4, Giovanni Biricolti5, Marco Orsini Federici1 1Eli Lilly Italy S.p.A., Sesto Fiorentino - Italy 2IRCCS MultiMedica, Sesto San Giovanni, Milano - Italy 3S.S.D. di Diabetologia ASL TO4, Torino - Italy 4Diabetes Care Unit Fondazione Policlinico Universitario Agostino Gemelli IRCCS, Roma - Italy 5Eli Lilly Italy S.p.A., Roma - Italy ABSTRACT Adherence to prescribed medication is important to the management of all diseases, especially those of chronic nature. We reviewed the available evidences on the impact of patient preferences for therapy on adherence to a prescribed treatment in chronic diseases requiring long-term treatment. keywords: adherence; crossref; diabetes; oral; osteoporosis; patient; persistence; preference; pubmed; satisfaction; studies; study; therapy; treatment cache: dti-2342.pdf plain text: dti-2342.txt item: #95 of 145 id: dti-2343 author: Zuccarini, Silvio ; Puce, Fabrizio ; Crisà, Alessandro title: Anatomical and functional responses to single brolucizumab injection in neovascular age-related macular degeneration patients not responding to antiangiogenics: a case series date: 2022 words: 4240 flesch: 49 summary: Refractory neovascular age-related macular degeneration: time-dependent changes of central retinal thickness with anti-VEGF treatment. Optimizing anti-VEGF treatment outcomes for patients with neovascular age-related macular degeneration. keywords: age; brolucizumab; crossref; degeneration; fluid; injection; macular; neovascular; patients; pubmed; treatment cache: dti-2343.pdf plain text: dti-2343.txt item: #96 of 145 id: dti-2347 author: Zambelli, Vanessa; Rizzi, Laura; Delvecchio, Paolo; Bresciani, Elena; Rezoagli, Emanuele ; Molteni, Laura; Meanti, Ramona; Cuttin, Maria Serena; Bovo, Giorgio; Coco, Silvia; Omeljaniuk , Robert J.; Locatelli, Vittorio; Bellani, Giacomo; Torsello, Antonio title: Hexarelin modulates lung mechanics, inflammation, and fibrosis in acute lung injury date: 2021 words: 5884 flesch: 53 summary: The results of the pres- ent research demonstrate that hexarelin treatment reduces the development of lung fibrosis and further suggests that specific synthetic GHS could be developed in order to modu- late lung and cardiac fibrosis such as those associated with COVID-19 infections. In an extended study, mice were observed for a subsequent 14 days in order to assess lung fibrosis. keywords: acid; anova; ards; crossref; fibrosis; hcl; hexarelin; instillation; lung; mice; p<0.01; post; pubmed; sacrifice; treatment; vehicle cache: dti-2347.pdf plain text: dti-2347.txt item: #97 of 145 id: dti-2355 author: Carriero, Martino title: Erythrodermic psoriasis and palmoplantar hyperkeratosis successfully treated with secukinumab: a case report date: 2022 words: 3312 flesch: 48 summary: A review of secukinumab in psoriasis treatment. Psoriasis may occur in different forms, such as plaque pso- riasis (characterized by dry scaly patches), which represents 80%-90% of psoriasis cases; pustular psoriasis (contains pus- like fluid mainly infiltrated with white blood cells); erythro- dermic psoriasis (EP, characterized by exfoliation of fine scaly skin with pain and itching); guttate psoriasis (characterized by drop-like dots); and inverse psoriasis (affects the flexure surfaces and characterized by smooth inflamed lesions) (1). keywords: crossref; erythrodermic; il-17a; patients; psoriasis; pubmed; secukinumab; study; treatment cache: dti-2355.pdf plain text: dti-2355.txt item: #98 of 145 id: dti-2403 author: Hammar, Oskar; Veress, Bela; Montgomery, Agneta; Ohlsson, Bodil title: Expression of Luteinizing Hormone Receptor in the Gastrointestinal Tract in Patients with and without Dysmotility date: 2012 words: 3499 flesch: 49 summary: However, presence of LH receptors in the gastrointestinal tract has never been described. Biopsies showed expression of LH receptors on myenteric neurons and in glial cells, neutrophils, endothelial cells and mast cells. keywords: bowel; cells; dysmotility; group; hormone; neurons; patients; range; receptor; tract cache: dti-2403.pdf plain text: dti-2403.txt item: #99 of 145 id: dti-2422 author: Phungoen, Pariwat; Sarunyaparit, Jessada; Apiratwarakul, Korakot; Wonglakorn, Lumyai; Meesing, Atibordee; Sawanyawisuth, Kittisak title: The association of ESBL Escherichia coli with mortality in patients with Escherichia coli bacteremia at the emergency department date: 2022 words: 4355 flesch: 57 summary: ESBL E. coli ED14 © 2022 The Authors. In addition, there have been few studies regarding mortality in ESBL E. coli in ED settings, and results have been contradictory. keywords: bacteremia; coli; crossref; esbl; factors; lactate; mortality; patients; pubmed; study cache: dti-2422.pdf plain text: dti-2422.txt item: #100 of 145 id: dti-2469 author: Chordia Golchha, Nikita; Nighojkar, Anand; Nighojkar, Sadhana title: Redefining genomic view of Clostridioides difficile through pangenome analysis and identification of drug targets from its core genome date: 2022 words: 4956 flesch: 51 summary: 2 - Core-pan plot of 97 strains of C. difficile genome. Full information is available at www.aboutscience.eu Drug Target Insights 2022; 16: 17-24 ISSN 1177-3928 | DOI: 10.33393/dti.2022.2469 ORIGINAL RESEARCH ARTICLE Redefining genomic view of Clostridioides difficile through pangenome analysis and identification of drug targets from its core genome Nikita Chordia Golchha1, Anand Nighojkar2, Sadhana Nighojkar3 1School of Biotechnology, Devi Ahilya University, Takshashila Campus, Indore - India 2Maharaja Ranjit Singh College of Professional Sciences, Hemkunt Campus, Indore - India 3Mata Gujri College of Professional Studies, Indore - India ABSTRACT Introduction: keywords: analysis; core; crossref; crossref pubmed; difficile; drug; drug target; genes; genome; pangenome; proteins; pubmed; strains; study; synthase; target cache: dti-2469.pdf plain text: dti-2469.txt item: #101 of 145 id: dti-2476 author: Sen, Pooja; Vijay, Mukund; Singh, Shweta; Hameed, Saif; Vijayaraghvan, Pooja title: Understanding the environmental drivers of clinical azole resistance in Aspergillus species date: 2022 words: 9174 flesch: 50 summary: Aspergillus spe- cies and other molds in respiratory samples from patients with cystic fibrosis: a laboratory-based study with focus on Aspergillus fumigatus azole resistance. Azole resistant Aspergillus fumigatus: an emerging prob- lem. keywords: agents; antifungal; antimicrob; aspergillosis; aspergillus; aspergillus fumigatus; azole; azole resistance; chemother; crossref pubmed; cyp51a; drug; environmental; fumigatus; india; infect; infections; isolates; l98h; mutations; patients; resistance; species; study; triazole cache: dti-2476.pdf plain text: dti-2476.txt item: #102 of 145 id: dti-2477 author: Zainol Abidin, Ismin; Murphy, Emma; Fehrenbach, Gustavo Waltzer; Rezoagli, Emanuele; Gately, Noel; Major, Ian title: A systematic review of mucoadhesive vaginal tablet testing date: 2023 words: 16922 flesch: 48 summary: Therefore, vaginal tablets still often represent the typi- cally acceptable dosage form with stability-related advan- tages and an economical choice for both manufacturers and users (17,18), thus advocating its role and relevance in the vaginal drug delivery system. Titles that specify a dosage form other than vaginal tablets (e.g., films, gels) and for veterinary purposes are essentially excluded. keywords: abidin et; al drug; articles; batches; chitosan; comparison; crossref; delivery; dissolution; drug; et al; formulation; khan et; mucoadhesive; pendekal et; polymer; pubmed; pérez et; release; research; study; swelling; tablet; vaginal; √ √ cache: dti-2477.pdf plain text: dti-2477.txt item: #103 of 145 id: dti-2481 author: Shah, Syed Fahim; Paracha, Sohail Aziz; Ullah, Waheed; Muhammad, Iqbal; Iqbal, Somaid; Gul, Aisha; Hussain, Mudassir; Ullah, Hafiz; Zaman, Sadir title: Success of 14-day triple and quadruple therapy for the control of Helicobacter pylori infections in Kohat district date: 2022 words: 3754 flesch: 57 summary: Published by AboutScience - www.aboutscience.eu TABLE II - Gastrointestinal symptom of patients Symptom Numbers Percentage (%) Epigastric pain 153/178 85.95 Recurrent abdominal pain 138/178 77.52 Nausea 141/178 79.21 Vomiting 70/178 39.32 Ballottement 30/178 16.85 Water brush 65/178 36.51 The hematological parameters of H. pylori patients included (n = 52) H. pylori positive patients whose hemato- logical values were compared with H. pylori negative control group (n = 52). The relationship between hematological para- meters of H. pylori positive patients and H. pylori negative control group was evaluated using confidential interval method by which the values are calculated for each para- meter that will fall between intervals. keywords: crossref; eradication; helicobacter; infection; patients; pubmed; pylori; therapy; treatment cache: dti-2481.pdf plain text: dti-2481.txt item: #104 of 145 id: dti-2482 author: Pandey, Ramendra Pati; Mukherjee, Riya; Chang, Chung-Ming title: Antimicrobial resistance surveillance system mapping in different countries date: 2022 words: 8851 flesch: 39 summary: It is the national human medicine AMR surveillance system. Similarly, AMR surveillance system for humans is also ana- lyzed by different organizations formed in these six European countries. keywords: amr; animals; antibiotic; antimicrobial; approach; bacteria; countries; data; drug; european; food; health; human; monitoring; national; research; resistance; species; surveillance; surveillance system; system cache: dti-2482.pdf plain text: dti-2482.txt item: #105 of 145 id: dti-2504 author: Duong, Thuy B.; Duong, Minh C.; Campbell, James I.; Nguyen, Hoang V.M.; Nguyen, Hien H.; Bui, Hanh T.B.; Nguyen, Chau V.V.; Heywood, Anita title: MRSA carriage among healthcare workers in a Vietnamese intensive care unit: a prospective cohort study date: 2022 words: 5956 flesch: 53 summary: Conclusion: MRSA carriage among HCWs is not rare. The questionnaire was developed based on the available lit- erature regarding the sources and vectors of MRSA as well as risk factors for MRSA carriage in healthcare settings (3,11). keywords: aureus; care; carriage; control; crossref; hand; hcws; healthcare; icu; mrsa; nasal; pubmed; staphylococcus; study; vietnam cache: dti-2504.pdf plain text: dti-2504.txt item: #106 of 145 id: dti-2510 author: Shetty, Bhavya; Fazal, Ibrahim; Khan, Safiya Fatima; Nambiar, Manjusha; Irfana D, Khadijathul; Prasad, Rohit; Raj, Akshata title: Association between cardiovascular diseases and periodontal disease: more than what meets the eye date: 2023 words: 6511 flesch: 48 summary: Full information is available at www.aboutscience.eu Association between cardiovascular diseases and periodontal disease: more than what meets the eye Bhavya Shetty1, Ibrahim Fazal1, Safiya Fatima Khan2, Manjusha Nambiar2, Khadijathul Irfana D1, Rohit Prasad1, Akshata Raj1 1Department of Periodontics, Faculty of Dental Sciences, Ramaiah University of Applied Sciences, Bangalore, Karnataka - India 2Department of Periodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital, Bangalore, Karnataka - India ABSTRACT Cardiovascular diseases (CVDs) are inflammatory diseases of coronary arteries accompanying atheroma forma- tion that can spawn impairment and, in severe cases, death. In recent decades, investigators have focused their impact on CVD by periodontal disease (PD). keywords: association; atherosclerosis; clin; crossref; cvd; disease; et al; evidence; health; heart; oral; pathogens; patients; periodontal; periodontitis; review; risk; studies; study cache: dti-2510.pdf plain text: dti-2510.txt item: #107 of 145 id: dti-2512 author: Nandi, Sisir; Kumar, Mohit; Kumari, Rashmi; Saxena, Aaruni title: Exploring the inhibitory mechanisms of indazole compounds against SAH/MTAN-mediated quorum sensing utilizing QSAR and docking date: 2022 words: 6835 flesch: 60 summary: Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti ZMIC3, ZMIC4, ZMIC5, Kier1, Kier2, Kier3, nAtomLC, nAtomP, nAtomLAC, MLogP, MDEC-11, MDEC-12, MDEC-13, MDEC-22, MDEC- 23, MDEC-24, MDEC-33, MDEC-34, MDEO-11, MDEN-22, MLFER_A, MLFER_BH, MLFER_S, MLFER_E, MLFER_L, MPC2, MPC3, MPC8, MPC10, piPC1, piPC3, piPC5, piPC6, piPC10, R_TpiPCTPC, PetitjeanNumber, nRing, n6Ring, nTRing, nHeteroRing, nF10HeteroRing, nRotB, RotBFrac, nRotBt, RotBtFrac, LipinskiFailures, topoRadius, topoDiameter, GGI1, GGI2, GGI3, GGI4, GGI5, GGI6, GGI7, GGI8 , GGI9, GGI10, JGI1, JGT, VE1_D, VE3_D, VR1_D VR3_D, TopoPSA, MWC3, MWC6, MWC10, SRW7, SRW9, AMW, WTPT-2, WTPT-3, WPATH, XLogP, TDB1u, TDB2u, TDB3u, TDB4u, TDB5u, TDB6u, TDB7u, TDB8u, TDB9u, TDB10u, TDB6m, TDB7m, TDB8m, TDB9m, TDB10m, TDB1v, TDB3v, TDB4v, TDB5v, TDB6v, TDB7v, TDB8v, TDB9v, TDB10v, TDB1e, TDB2e, TDB3e, TDB4e, TDB5e, TDB6e, TDB7e, TDB8e, TDB9e, TDB10e, TDB1p, TDB3p, TDB4p, TDB5p, TDB6p, TDB7p, TDB8p, TDB9p, TDB10p, TDB1i, TDB2i, TDB3i, TDB4i, TDB5i, TDB6i, TDB7i, TDB8i, TDB9i, TDB10i, TDB1s, TDB3s, TDB5s, TDB6s, TDB7s, TDB8s, TDB9s, TDB10s, TDB1r, TDB2r, TDB3r, TDB4r, TDB5r, TDB6r, TDB7r, TDB8r ,TDB9r, TDB10r, PPSA-1, PPSA-2, PPSA-3, PNSA-1, PNSA-2, PNSA-3, DPSA-1, DPSA-2, DPSA-3, FPSA-1, FPSA-2, FNSA-2, FNSA-3, WPSA-1, WPSA-2, WPSA- 3, WNSA-1, WNSA-2, WNSA-3, RPCG, RNCG, RPCS, RNCS, THSA, TPSA, RHSA, GRAV-1, GRAVH-3, GRAV-4, LOBMAX, LOBMIN, MOMI-X, MOMI-Y, MOMI-Z, MOMI-XY, MOMI-XZ, MOMI-R, geomRadius, geomDiameter, geomShape, RDF10u, RDF15u, RDF20u, RDF25u, RDF30u, RDF35u, RDF40u, RDF45u, RDF50u, RDF55u, RDF60u, RDF65u, RDF70u, RDF75u, RDF80u, RDF85u, RDF90u, RDF95u, RDF100u, RDF105u, RDF110u, RDF115u, RDF120u, RDF125u, RDF130u, RDF135u, RDF140u, RDF145u, RDF150u, RDF155u, RDF15m, RDF20m, RDF25m, RDF30m, RDF35m, RDF40m, RDF45m, RDF50m, RDF55m, RDF60m, RDF65m, RDF70m, RDF75m, RDF80m, RDF85m, RDF90m, RDF95m, RDF100m, RDF105m, RDF110m, RDF115m, RDF120m, RDF125m, RDF130m, RDF135m, RDF140m, RDF145m, RDF150m, RDF155m, RDF20v, RDF25v, RDF30v, RDF35v, RDF40v, RDF45v, RDF50v, RDF55v, RDF60v, RDF65v, RDF70v, RDF75v, RDF80v, RDF85v, RDF90v, RDF95v, RDF100v, RDF105v, RDF110v, RDF115v, RDF120v, RDF125v, RDF130v, RDF135v, RDF140v, RDF145v, RDF150v, RDF155v, RDF30e, RDF35e, RDF70e, RDF80e, RDF95e, RDF100e, RDF155e, RDF15p, RDF20p, RDF30p, RDF35p, RDF40p, RDF45p, RDF50p,RDF60p, RDF65p, RDF70p, RDF75p, RDF80p, RDF85p, RDF90p, RDF95p, RDF100p, RDF115p, RDF130p, RDF135p, RDF140p, RDF145p, RDF150p, RDF155p, RDF30i, RDF65i, RDF10s, RDF15s, RDF20s, RDF25s, RDF30s, RDF35s, RDF40s, RDF45s, RDF50s, RDF55s, RDF60s, RDF65s, RDF70s, RDF75s, RDF80s, RDF85s, RDF90s, RDF95s, RDF100s, RDF105s, RDF110s, RDF115s, RDF120s, RDF125s, RDF130s, RDF135s, RDF140s, RDF145s, RDF150s, RDF155s, L1u, L2u, L3u, P1u, P2u, E1u, E2u, E3u, Tu, Au, Vu, Du, L1m, L2m, L3m, P1m, P2m, E1m, E2m, E3m, Tm, Am, Vm, Dm, L1v, L2v, L3v, P1v, P2v, E1v, E2v, E3v, Tv, Av, Vv, Dv, P2e, E1e, E2e, E3e, De, L1p, P1p, P2p, E1p, E2p, E3p, Dp, E1i, E2i, Di, E1s, E2s. TABLE II - Descriptors used in the current study ALogP, ALogp2, AMR, apol, naAromAtom, nAtom, nHeavyAtom, nH, nC, nN, nO, nS, nF, nCl, nX, ATS0m, ATS1m, ATS2m, ATS3m, ATS4m, ATS5m, ATS6m, ATS7m, ATS8m, ATS2v, ATS4v, ATS6v, ATS7v, ATS8v, ATS0e, ATS3e, ATS4e, ATS5e, ATS6e, ATS7e, ATS8e, ATS0p, ATS3p, ATS5p, ATS0s, ATS1s, ATS2s, ATS3s, ATS4s, ATS5s, ATS6s, ATS7s, ATS8s, AATS0m, AATS1m, AATS2m, AATS3m, AATS4m, AATS5m, AATS6m, AATS7m, AATS8m, AATS0v, AATS1v, AATS2v, AATS3v, AATS4v, AATS5v, AATS6v, AATS7v, AATS8v, AATS0e, AATS1e, AATS2e, AATS3e, AATS4e, AATS5e, AATS6e, AATS7e, AATS8e, AATS0p, AATS1p, AATS2p, AATS3p, AATS4p, AATS5p, AATS6p, AATS7p, AATS8p, AATS0i, AATS1i, AATS2i, AATS3i, AATS4i, AATS5i, AATS6i, AATS7i, AATS8i, AATS0s, AATS1s, AATS2s, AATS3s, AATS4s, AATS5s, AATS6s, AATS7s, AATS8s, ATSC0c, ATSC1c, ATSC2c, ATSC3c, ATSC4c, ATSC5c, ATSC6c, ATSC7c, ATSC8c, ATSC0m, ATSC1m, ATSC2m, ATSC3m, ATSC4m, ATSC5m, ATSC6m, ATSC7m, ATSC8m, ATSC0v, ATSC1v, ATSC2v, ATSC3v, ATSC4v, ATSC5v, ATSC6v, ATSC7v, ATSC8v, ATSC0e, ATSC1e, ATSC2e, ATSC3e, ATSC4e, ATSC5e, ATSC6e, ATSC7e, ATSC8e, ATSC0p, ATSC1p, ATSC2p, ATSC3p, ATSC4p, ATSC5p, ATSC6p, ATSC7p, ATSC8p, ATSC0i, ATSC1i, ATSC2i, ATSC3i, ATSC4i, ATSC5i, ATSC6i, ATSC7i, ATSC8i, ATSC0s, ATSC1s, ATSC2s, ATSC3s, ATSC4s, ATSC5s, ATSC6s, ATSC7s, ATSC8s, AATSC0m, AATSC1m, AATSC2m, AATSC3m, AATSC4m, AATSC5m, AATSC6m, AATSC7m, AATSC8m, AATSC0v, AATSC1v, AATSC2v, AATSC3v, AATSC4v, AATSC5v, AATSC6v, AATSC7v, AATSC8v, AATSC0e, AATSC2e, AATSC6e, AATSC7e, AATSC0p, AATSC2p, AATSC3p, AATSC4p, AATSC5p, AATSC6p, AATSC7p, AATSC8p, AATSC0i, AATSC1i, AATSC2i, AATSC3i, AATSC4i, AATSC5i, AATSC6i, AATSC7i, AATSC8i, AATSC0s, AATSC1s, AATSC2s, AATSC3s, AATSC4s, AATSC5s, AATSC6s, AATSC7s, AATSC8s, MATS1c, MATS2c, MATS3c, MATS4c, MATS5c, MATS6c, MATS7c, MATS8c, MATS1m, MATS2m, MATS3m, MATS4m, MATS5m, MATS6m, MATS7m, MATS8m, MATS1e, MATS2e, MATS3e, MATS4e, MATS5e, MATS6e, MATS7e, MATS8e, MATS1p, MATS2i, MATS3i, MATS5i, MATS6i, MATS7i, MATS8i, MATS1s, MATS2s, MATS3s, MATS4s, MATS5s, MATS6s, MATS7s, MATS8s, GATS1c, GATS2c, GATS3c, GATS4c, GATS5c, GATS6c, GATS7c, GATS8c, GATS1m, GATS2m, GATS3m, GATS4m, GATS5m, GATS6m, GATS7m, GATS8m, GATS1v, GATS2v, GATS3v, GATS4v, GATS5v, GATS6v, GATS7v, GATS8v, GATS1e, GATS2e, GATS3e, GATS4e , GATS5e, GATS6e, GATS7e, GATS8e, GATS1p, GATS2p, GATS3p, GATS4p, GATS5p, GATS6p, GATS7p, GATS8p, GATS1i, GATS2i, GATS3i, GATS4i, GATS5i, GATS6i, GATS7i, GATS8i, GATS1s, GATS2s, GATS3s, GATS4s, GATS5s, GATS6s, GATS7s, GATS8s, SpAbs_DzZ, SpMAD_ DzZ, SM1_DzZ, VE1_DzZ, VE3_DzZ, VR1_DzZ, VR3_DzZ, VR1_Dzm, VR2_Dzm, VR3_Dzm, SM1_Dzv, VE1_Dzv, VE3_Dzv, VR1_Dzv, VR2_Dzv, VR3_Dzv, SM1_Dze, VE1_Dze, VE3_Dze, VR1_Dze, VR3_Dze, SpAbs_Dzp, SpMAD_Dzp, SM1_Dzp, VE1_Dzp, VE3_Dzp, VR1_Dzp, VR3_Dzp, SM1_Dzi, VE1_Dzi, VE3_Dzi, VR1_Dzi, VR3_Dzi, SpAbs_Dzs, SpMAD_Dzs, SM1_Dzs, VE1_Dzs, VE3_Dzs, VR1_Dzs, VR2_Dzs, VR3_Dzs, BCUTw-1l, BCUTw-1h, BCUTc-1l, BCUTc-1h, BCUTp-1l, BCUTp-1h, nBondsS2, nBondsS3, nBondsD, nBondsD2, nBondsM bpol, SpMax2_ Bhm, SpMax3_Bhm, SpMax4_Bhm, SpMax5_Bhm, SpMax6_Bhm, SpMax7_Bhm, SpMax8_Bhm, SpMin1_Bhm, SpMin2_Bhm, SpMin3_ Bhm, SpMin4_Bhm, SpMin5_Bhm, SpMin6_Bhm, SpMin7_Bhm, SpMin8_Bhm, SpMax1_Bhv, SpMax2_Bhv, SpMax3_Bhv, SpMax4_Bhv, SpMax5_Bhv, SpMax6_Bhv, SpMax7_Bhv, SpMax8_Bhv, SpMin1_Bhv, SpMin2_Bhv, SpMin3_Bhv, SpMin4_Bhv, SpMin5_Bhv, SpMin6_Bhv, SpMin7_Bhv, SpMin8_Bhv, SpMax1_Bhe, SpMax2_Bhe, SpMax3_Bhe, SpMax4_Bhe, SpMax6_Bhe, SpMax7_Bhe, SpMax8_Bhe, SpMin1_ Bhe, SpMin2_Bhe, SpMin3_Bhe, SpMin4_Bhe, SpMin5_Bhe, SpMin6_Bhe, SpMin7_Bhe, SpMin8_Bhe, SpMax1_Bhp, SpMax2_Bhp, SpMax3_Bhp, SpMax4_Bhp, SpMax7_Bhp, SpMin1_Bhp, SpMin2_Bhp, SpMin3_Bhp, SpMin4_Bhp, SpMin7_Bhp, SpMin8_Bhp, SpMax2_ Bhi, SpMax3_Bhi, SpMax4_Bhi, SpMax5_Bhi, SpMax8_Bhi, SpMin2_Bhi, SpMin3_Bhi, SpMin4_Bhi, SpMin5_Bhi, SpMin7_Bhi, SpMax1_Bhs, SpMax2_Bhs, SpMax3_Bhs, SpMax4_Bhs, SpMax5_Bhs, SpMax6_Bhs, SpMax7_Bhs, SpMax8_Bhs, SpMin1_Bhs, SpMin2_Bhs, SpMin3_ Bhs, SpMin4_Bhs, SpMin5_Bhs, SpMin6_Bhs, SpMin7_Bhs, SpMin8_Bhs, C1SP2, C2SP2, C3SP2, C1SP3, C2SP3, C3SP3, C4SP3, SCH-3, SCH-6, SCH-7, VCH-6, VCH-7, SC-3, SC-4, SC-5, SC-6, VC-3, VC-5, SPC-4,SPC-5, SPC-6, VPC-4, VPC-5, VPC-6, SP-2, SP-3, SP-4, SP-6, SP-7, VP-0, VP-2, VP-3, VP-4, VP-5, VP-6, VP-7, AVP-0, AVP-1, AVP-2, Mare, Mi, CrippenLogP, SpMax_Dt, SpMAD_Dt, VE1_Dt, VE3_Dt, VR1_Dt, VR2_Dt, VR3_Dt, ECCEN, nHBd, nHBa, nwHBa, nHBint2, nHBint3, nHBint4, nHBint5, nHBint6, nHBint7, nHBint8, nHBint9, nHBint10, nHsOH, nHssNH, nHdsCH, nHaaCH, nHCsats, nHCsatu, nsCH3, nssCH2, naasC, naaaC, nssssC, naaN, nsssN, SHBd, SHBa, SwHBa, SHBint2, SHBint3, SHBint4, SHBint5, SHBint6, SHBint7, SHBint8, SHBint9, SHBint10, SHssNH, SHaaNH, SHaaCH, SHCsats, SssCH2, SaaCH, SsssCH, SdssC, SaasC, SaaaC, SssNH, SaaNH, SdO, SddssS, SsCl, minHBd, minHBa, minwHBa, minHBint2, minHBint3, minHBint5, minHBint6, minHBint9, minHBint10, minHaaCH, minHCsats, minHCsatu, minHother, minsCH3, minssCH2, minaaCH, minaasC, minaaaC, minssNH, minaaN, mindO, minsF, minsCl, maxHBd, maxHBa, maxwHBa, maxHBint2, maxHBint3, maxHBint5, maxHBint6, maxHBint10, maxHssNH, maxHaaCH, maxHCsats, maxsCH3, maxssCH2, maxaaCH, maxaasC, maxaaaC, maxssssC, maxssNH, maxaaN, maxdO, maxsCl, sumI, meanI, hmax, LipoaffinityIndex, DELS, MAXDN2, DELS2, ETA_Alpha, ETA_Epsilon_1, ETA_Epsilon_2, ETA_Epsilon_4, ETA_Epsilon_5, ETA_dEpsilon_B, ETA_Psi_1, ETA_Shape_P, ETA_Shape_Y, ETA_Shape_X, ETA_Beta, ETA_BetaP, ETA_Beta_s, ETA_BetaP_s, ETA_Beta_ns, ETA_BetaP_ns, ETA_dBeta, ETA_dBetaP, ETA_Beta_ns_d, ETA_BetaP_ns_d, ETA_Eta, ETA_EtaP, ETA_Eta_F, ETA_EtaP_F, ETA_Eta_L, ETA_EtaP_L, ETA_Eta_F_L, ETA_EtaP_F_L, ETA_Eta_B, ETA_Eta_B_RC, FMF, fragC, nHBAcc, nHBAcc2, nHBAcc3, HybRatio, IC0, IC1, IC2, IC3, IC4, IC5, TIC0, TIC1, TIC2, TIC3, SIC0, SIC1, SIC2, SIC3, SIC4, SIC5, CIC0, CIC1, CIC2, CIC3, CIC4, BIC1, BIC2, BIC3, BIC4, BIC5, MIC0, MIC1, MIC2, MIC3, MIC4, ZMIC0, ZMIC1, ZMIC2, QSAR and docking of indazole compounds against SAH/MTAN-mediated QS64 © 2022 The Authors. keywords: ala150; asp197; ch3; compounds; crossref; glu172; h n; h2c; h2c n; h3c; ile152; indazole; met173; mtan; n ch3; n cl; n s; o o; phe151; phe335; qsar; s o; sah; target cache: dti-2512.pdf plain text: dti-2512.txt item: #108 of 145 id: dti-2520 author: Kalra, Swinder Jeet Singh; Hari Shankar; Nasim Mansoori; Gupta, Dablu Lal title: Antibiotic-resistant bacteria originating from the gut may modulate the mucosal immune response during sepsis and septic shock date: 2022 words: 5424 flesch: 42 summary: Several studies have confirmed that a mutual association between gut microbiota and the host is important for the metabolism of essential nutrients for the organism, for gut development, and for the maturation and development of a fully functional immune system. Full information is available at www.aboutscience.eu Drug Target Insights 2022; 16: 81-87 ISSN 1177-3928 | DOI: 10.33393/dti.2022.2520 REVIEW Antibiotic-resistant bacteria originating from the gut may modulate the mucosal immune response during sepsis and septic shock Swinder Jeet Singh Kalra1, Hari Shankar2, Nasim Mansoori3, Dablu Lal Gupta4 1D.A-V College Kanpur, Uttar Pradesh - India 2Indian Council of Medical Research (ICMR), New Delhi - India 3All India Institute of Medical Sciences (AIIMS), New Delhi - India 4All India Institute of Medical Sciences (AIIMS), Raipur, Chhattisgarh - India ABSTRACT The enrichment and diversity of gut microbiota play an important role in sepsis, but the role of gut microbiota composition and early-life colonization in sepsis and septic shock has not yet been characterized. keywords: bacteria; cells; crossref; crossref pubmed; development; disease; diversity; gut; gut microbiota; host; india; microbiota; mucosal; pubmed; resistance; sepsis; system cache: dti-2520.pdf plain text: dti-2520.txt item: #109 of 145 id: dti-2522 author: Sim, Yi Xing; Lee, Qiao Wei; Abushelaibi, Aisha; Lai, Kok-Song; Lim, Swee Hua Erin; Maran, Sathiya title: Current molecular approach for diagnosis of MRSA: a meta-narrative review date: 2022 words: 7434 flesch: 50 summary: Latour et al 2019 Belgium 1,447 residents from nursing homes Pooled sampling of nose, throat and perineum Cross-sectional prevalence survey Triplex PCR and MLST (20) 17 Hida et al 2019 Japan 263 patients suspected of having staphylococcal bacteremia Fresh and frozen blood culture samples n/a GENECUBE mecA (21) 18 Luo et al 2018 China 275 isolates of S. aureus, including 148 isolates from patients, 127 from ready-to- eat food samples Secretions, blood, phlegm, cerebrospinal fluid, transudation, urine, fresh meat, meat product, cereal products, fruits and vegetables n/a PCR, multiplex PCR (22) 19 Lin et al 2018 Taiwan 106 hemodialysis patients diagnosed with MRSA Blood cultures Retrospective study PCR and MLST (23) 20 Yang et al 2017 China 104 children diagnosed with MRSA Sputum, bronchioalveolar lavage fluid, skin and soft tissues, pus, secretions, secretions of omphalitis, blood, joint effusion, pleural effusion n/a MLST (24) BSI = bloodstream infection; DNA = deoxyribonucleic acid; MALDI-TOF = matrix-assisted laser desorption/ionization-time of flight; MLST = multilocus sequence typing; MRSA = methicillin-resistant Staphylococcus aureus; MRSE = methicillin-resistant Staphylococcus epidermidis; MSSA = methicillin-sensitive Staphylococcus aureus; n/a = not available; PCR = polymerase chain reaction; SCCmec = staphylococcal cassette chromosome mec; spa = staphylococcal protein A. GPCC = Gram positive cocci in clusters; MSSA-PENS = methicillin-sensitive S. aureus – penicillin-susceptible; OAI = osteoarticular infections; SSSS = Staphylo- coccal scalded skin syndrome ; SSTI = skin and soft tissue infections; PVL = Panton Valentine leukocidin Results The dataset includes 20 different authors from Asia (n = 13), Africa (n = 5), Europe (n = 1) and America (n = 1). keywords: aureus; crossref; crossref pubmed; detection; diagnosis; dna; et al; methicillin; microbiol; mrsa; pcr; pubmed; resistance; review; sccmec; staphylococcus; staphylococcus aureus; study; typing cache: dti-2522.pdf plain text: dti-2522.txt item: #110 of 145 id: dti-2529 author: Khemla, Supphachoke; Meesing, Atibordee; Sribenjalux, Wantin; Chetchotisakd, Ploenchan title: Lipid profiles of people with human immunodeficiency virus with dyslipidemia after switching from efavirenz to dolutegravir date: 2023 words: 5813 flesch: 60 summary: Week 12 Week 24 Change from week 0 vs. 12 p-Value Change from week 0 vs. 24 p-Value Change from week 12 vs. 24 p-Value Diff 95% CI Diff 95% CI Diff 95% CI Total cholesterol 209.69 ± 38.99 170.88 ± 36.43 176.91 ± 35.14 −38.81 ± 25.86 −32.35, −12.00 <0.001 −32.78 ± 33.55 −41.16, −24.39 <0.001 6.03 ± 33.56 −2.35, 14.41 0.156 LDL- cholesterol 131.88 ± 36.17 106.17 ± 31.37 110.88 ± 30.72 −25.70 ± 23.31 −31.53, −19.88 <0.001 −21.00 ± 29.41 −28.34, −13.65 <0.001 4.71 ± 26.78 −1.98, 11.39 0.165 HDL- cholesterol 54.45 ± 13.56 48.20 ± 12.48 50.23 ± 13.23 −6.24 ± 7.52 −8.12, −4.36 <0.001 −4.21 ± 8.12 −6.24, −2.18 <0.001 2.03 ± 6.13 0.49, 3.56 0.010 Triglycerides 181.64 ± 94.12 145.47 ± 77.75 131.94 ± 75.28 −36.17 ± 89.88 −58.62, −13.71 0.002 −49.70 ± 67.40 −66.54, −32.86 <0.001 13.53 ± 67.79 −30.46, 3.40 0.115 Cholesterol/ HDL 4.00 ± 0.93 3.69 ± 1.01 3.69 ± 1.06 −0.31 ± 0.61 −0.46, −0.15 <0.001 −0.31 ± 0.85 −0.52, −0.09 0.005 −0.003 ± 0.81 −0.21, 1.9 0.973 CI = confidence interval; HDL = high-density lipoprotein; LDL = low-density lipoprotein; SD = standard deviation. Week 12 Week 24 Change from week 0 vs. 12 p-Value Change from week 0 vs. 24 p-Value Change from week 12 vs. 24 p-Value Diff 95% CI Diff 95% CI Diff 95% CI Bodyweight, kg 66.00 ± 12.02 66.97 ± 12.46 67.39 ± 12.58 0.97 ± 1.88 0.49, 1.44 <0.001 1.39 ± 2.49 0.77, 2.01 <0.001 0.42 ± 1.85 −0.04, 0.88 0.073 Body mass index, kg/m2 23.99 ± 3.51 24.32 ± 3.55 24.49 ± 3.67 0.32 ± 0.67 0.16, 0.49 <0.001 0.49 ± 0.92 0.27, 0.73 <0.001 0.17 ± 0.68 −0.001, 0.34 0.051 Waist circum- ference, cm 87.79 ± 10.82 89.33 ± 11.38 90.39 ± 10.95 1.53 ± 2.60 0.88, 2.18 <0.001 2.60 ± 4.27 1.53, 3.68 <0.001 1.06 ± 3.65 0.15, 1.97 0.023 ASCVD risk score* 4.56 ± 4.30 (N = 42) 3.99 ± 3.71 (N = 39) 4.69 ± 4.67 (N = 44) 0.464 ± 1.43 −0.04, 0.97 0.07 0.14 ± 1.92 −0.49, 0.77 0.66 −0.11 ± 1.48 −0.59, 0.38 0.66 ASCVD = atherosclerotic cardiovascular disease; LDL = low-density lipoprotein; SD = standard deviation. keywords: cholesterol; efv; hiv; lipid; mean; patients; pubmed; study; week; weight cache: dti-2529.pdf plain text: dti-2529.txt item: #111 of 145 id: dti-2532 author: Sharma, Monica; Walia, Kamini; Bansal, Nitin title: Unmet needs for management of drug-resistant infections: low- and middle-income countries’ viewpoint date: 2022 words: 2322 flesch: 35 summary: National estimates of resistant infections, etiology of infections, type of infections, and local resistance rates and patterns can be utilized to set research priorities regarding challenges and opportunities to tackle resistant pathogens in different healthcare and community settings. Gram-negative pathogens, drug-resistant tuberculosis, and multidrug- resistant Salmonella typhi have been reported as cause of resistant infections in developing countries. keywords: antimicrobial; countries; crossref; drug; india; infections; pubmed; resistance cache: dti-2532.pdf plain text: dti-2532.txt item: #112 of 145 id: dti-2545 author: Kothari, Vijay title: AMR research: a perspective from personal experience date: 2022 words: 1535 flesch: 40 summary: If people with such exaggerated simplistic perception of AMR research happen to head some academic institute, they may do even more harm by indirectly dissuad- ing brilliant young minds to join AMR labs. AMR research: a perspective from personal experience Vijay Kothari Institute of Science, Nirma University, Ahmedabad - India Received: December 12, 2022 Accepted: December 12, 2022 Published online: December 23, 2022 Corresponding author: Dr. Vijay Kothari Institute of Science, Nirma University S-G Highway, Ahmedabad-382481 - India vijay.kothari@nirmauni.ac.in minimum bactericidal concentration (MBC) of test com- pounds, that is, screening molecules/natural extracts for bactericidal activity through broth dilution assay. keywords: amr; anti; committee; research; surveillance cache: dti-2545.pdf plain text: dti-2545.txt item: #113 of 145 id: dti-2548 author: Iriti, Marcello title: Natural Products & Phytotherapeutics: why a new section? date: 2023 words: 972 flesch: 39 summary: According to one of the most authoritative reports focus- ing on natural products as sources of new drugs, the use of natural products and their synthetic derivatives is still piv- otal in the discovery of new drugs (1). Indeed, among the new drugs approved (N = 1881) in the last four decades, about 25% are natural products (Fig. 1A). keywords: anticancer; drugs; phytotherapeutics; products cache: dti-2548.pdf plain text: dti-2548.txt item: #114 of 145 id: dti-2573 author: Rattanathanoo, Ratchanon; Chindaprasirt, Jarin; Boonsawat, Watchara; Limpawattana, Panita; Khamsai, Sittichai; Sawanyawisuth, Kittisak title: Are calcium channel blockers related to lung cancer? date: 2023 words: 3404 flesch: 57 summary: The case-control study did not state how lung cancer diagnosis was made and sig- nificant factors in this study, namely dyslipidemia and family history of lung cancer, were not studied (12). Association between family history and lung cancer risk among Chinese women in Singapore. keywords: cancer; ccb; crossref; factors; lung; lung cancer; patients; pubmed; risk; study cache: dti-2573.pdf plain text: dti-2573.txt item: #115 of 145 id: dti-2574 author: Zambelli, Vanessa; Murphy, Emma J.; Del Vecchio, Paolo; Rizzi, Laura; Fumagalli, Roberto; Rezoagli, Emanuele; Bellani, Giacomo title: Treatment with levosimendan in an experimental model of early ventilator-induced diaphragmatic dysfunction date: 2023 words: 4729 flesch: 52 summary: However, prolonged MV is also associated with numerous potential complications including https://doi.org/10.33393/dti.2023.2574 https://creativecommons.org/licenses/by-nc/4.0/legalcode mailto:vanessa.zambelli@unimib.it Effects of levosimendan treatment on diaphragmatic injury40 © 2023 At the end of the MV, rats without levosimendan treatment showed a significant lower MAP versus VIDD + Levo group, as demonstrated in Table I. keywords: care; crossref; diaphragm; levosimendan; muscle; pubmed; treatment; vidd; vidd+levo cache: dti-2574.pdf plain text: dti-2574.txt item: #116 of 145 id: dti-2583 author: Khan, Safiya Fatima; Shetty, Bhavya; Fazal, Ibrahim; Mustafa Khan, Asim; Muzaffar Mir, Faheem; Moothedath, Muhamood; VJ, Reshma; Muhamood, Muhaseena title: Licorice as a herbal extract in periodontal therapy date: 2023 words: 5583 flesch: 43 summary: The bioactive ingredients in licorice extract such as glycyrrhizin, licoricidin, glabridin, licochalcone A, and licorisoflavan A have anti-inflammatory, antimicro- bial, and anti-adherence effects that are beneficial against periodontal disease. Components in licorice extract Licorice is a potential source of natural anti-inflammatory agents. keywords: acid; activity; crossref; crossref pubmed; disease; effects; extract; glabra; glabridin; glycyrrhiza; licorice; periodontitis; potential; pubmed; study; therapy; treatment cache: dti-2583.pdf plain text: dti-2583.txt item: #117 of 145 id: dti-2593 author: Inno, Alessandro; Fabiana Marchetti; Matteo Valerio; Niccolò Giaj Levra; Filippo Alongi; Giovanni Foti; Stefania Gori title: Activity of sotorasib against brain metastases from NSCLC harboring KRAS p.G12C mutation: a case report date: 2023 words: 1492 flesch: 47 summary: The patient was started on sotorasib, and the brain magnetic resonance imaging (MRI) after 2 months of treatment showed stability of the cerebellar metastasis, reduction in size of the previ- ously treated parietal right metastasis with improvement of the surrounding edema, reduction in size of the previously untreated right frontal lobe metastasis, and no appearance of new brain metastases (Fig. 1). Full information is available at www.aboutscience.eu Activity of sotorasib against brain metastases from NSCLC harboring KRAS p.G12C mutation: a case report Alessandro Inno1, Fabiana Marchetti1, Matteo Valerio1, Niccolò Giaj Levra2, Filippo Alongi2, Giovanni Foti3, Stefania Gori1 1Medical Oncology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy 2Advanced Radiation Oncology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy 3Radiology, IRCCS Ospedale Sacro Cuore Don Calabria, Negrar di Valpolicella (VR) - Italy ABSTRACT In the CodeBreaK 100 phase 2 study, sotorasib was active for patients with metastatic non-small cell lung cancer (NSCLC) harboring Kirsten rat sarcoma viral oncogene homologue (KRAS) keywords: brain; kras; metastases; nsclc; sotorasib cache: dti-2593.pdf plain text: dti-2593.txt item: #118 of 145 id: dti-2595 author: Ruparel, Feny J.; Shah, Siddhi K.; Patel, Jhanvi H.; Thakkar, Nidhi R.; Gajera, Gemini N.; Kothari, Vijay O. title: Network analysis for identifying potential anti-virulence targets from whole transcriptome of Pseudomonas aeruginosa and Staphylococcus aureus exposed to certain anti-pathogenic polyherbal formulations date: 2023 words: 7343 flesch: 47 summary: The eight pro- teins (Tab. I) found to be members of minimum two clusters can be said to be potential hubs, whose downregulation can be hypothesized to attenuate P. aeruginosa virulence. Methods: Transcriptomes of P. aeruginosa and S. aureus exposed to two different quorum-modulatory polyherbal formulations were subjected to network analysis to identify the most highly networked differentially expressed genes (hubs) as potential anti-virulence targets. keywords: aeruginosa; analysis; aureus; crossref; crossref pubmed; genes; network; nitrite; panchvalkal; pathogens; potential; ppi; protein; pseudomonas; pubmed; sulfur; targets; virulence cache: dti-2595.pdf plain text: dti-2595.txt item: #119 of 145 id: dti-2596 author: Bumbrah, Gurvinder Singh; Jain, Sarika; Fatima, Zeeshan; Hameed, Saif title: Efficacy of LAMP assay for Mycobacterial spp. detection to prevent treatment delays and onset of drug resistance: a systematic review and meta-analysis date: 2023 words: 8488 flesch: 64 summary: S. No. Study Accuracy Precision 1 Boehme et al (2007) 98.68 97.74 2 Pandey et al (2008) 94.00 93.75 3 Poudel et al (2009) 95.54 94.17 4 Geojith et al (2011) 60.71 94.44 5 George et al (2011) 94.36 93.93 6 Mitarai et al (2011) 88.75 95.60 7 Nagdev et al (2011) 85.18 88.23 8 Sethi et al (2013) 87.96 100.00 9 Cao et al (2015) 94.30 95.14 10 Joon et al (2015) 92.06 54.90 11 Moon et al (2015) 94.71 91.42 12 Bojang et al (2016) 95.86 90.74 13 Gray et al (2016) 93.64 86.42 14 Kaku et al (2016) 94.49 96.40 15 Modi et al (2016) 97.60 100.00 16 Sharma et al (2016) 92.94 100.00 17 Joon et al (2017) 97.03 73.91 18 Reddy et al (2017) 91.07 87.50 19 Sharma et al (2016) 93.57 100.00 20 Yadav et al (2017) 99.33 96.47 21 Kim et al (2018) 94.13 100.00 22 keywords: amplification; crossref; detection; diagnosis; lamp; pubmed; studies; tuberculosis cache: dti-2596.pdf plain text: dti-2596.txt item: #120 of 145 id: dti-2613 author: Kalambry, Aimé Césaire; Potindji, Tchamou Malraux Fleury; Guindo, Ibrehima; Kassogué, Ambara; Drame, Boubacar Sidiki Ibrahim; Togo, Seydou; Yena, Sadio; Doumbia, Seydou; Diakite, Mahamadou title: A ESBL and carbapenemase-producing Enterobacteriaceae in infectious pleural effusions: current epidemiology at Hôpital du Mali date: 2023 words: 6181 flesch: 49 summary: In addition, the following genes were screened for their role in conferring antibiotic resistance: the catA1 gene responsible for encod- ing chloramphenicol acetyltransferase, mutations on genes encoding for topoisomerase IV, and DNA gyrase protective proteins targeted by quinolones (qnrA, qnrB, qnrS), as well as class 1 (int1), class 2 (int2), and class 3 (int3) integrons, which carry resistance genes for multiple antibiotics. A recent study by Tapia et al in 2021 reported 13.3% mortality rate (6). keywords: antibiotic; carbapenemase; coli; crossref; enterobacteriaceae; esbl; genes; isolates; mali; patients; prevalence; pubmed; resistance; study cache: dti-2613.pdf plain text: dti-2613.txt item: #121 of 145 id: dti-2614 author: ALmughais, Ebtehaj Saud; Alreshidi, Fatmah Fahad; Ahmed, Hussain title: Prevalence of antibiotic misuse in cases of pneumonia and diarrhea in Saudi Arabia date: 2023 words: 3933 flesch: 48 summary: The Saudi TABLE IV - Distribution of antibiotic use status in relation to educa- tion, occupation, and income of the parents Antibiotic misuse Maximizing antibiotic use improves medical outcomes, reduces toxicity, and prevents resistance (2). keywords: antibiotic; children; crossref; diarrhea; misuse; parents; pneumonia; pubmed; saudi; study; total cache: dti-2614.pdf plain text: dti-2614.txt item: #122 of 145 id: dti-2622 author: So-ngern, Apichart; Osaithai, Naphol; Meesing, Atibordee; Chumpangern, Worawat title: Mortality rate and factors associated with mortality of carbapenem-resistant Enterobacteriaceae infection date: 2023 words: 4696 flesch: 47 summary: This current study endorsed the ESMID guidelines that are recommended for CRE infection treatment; in case new BLBIs are not avail- able, the combination antibiotic therapy of drugs active in vitro should be considered (8). Objective: To determine the 30-day mortality and factors associated with a 30-day mortality of CRE infection. keywords: antibiotic; carbapenem; cre; crossref; day; factors; infection; mortality; patients; pubmed; study cache: dti-2622.pdf plain text: dti-2622.txt item: #123 of 145 id: dti-2626 author: Inno, Alessandro; Bogina, Giuseppe; Settanni, Giulio; Salgarello, Matteo; Foti, Giovanni; Pomari, Carlo; Picece, Vincenzo; Gori, Stefania title: First-line tepotinib for a very elderly patient with metastatic NSCLC harboring MET exon 14 skipping mutation and high PD-L1 expression date: 2023 words: 2598 flesch: 57 summary: Keywords: Elderly, First-line treatment, MET 14-exon skipping mutation, MET inhibitor, Non-small cell lung cancer, Tepotinib Received: July 3, 2023 Accepted: September 19, 2023 Published online: October 6, 2023 Corresponding author: Alessandro Inno Medical Oncology IRCCS Ospedale Sacro Cuore Don Calabria Via don A. Sempreboni 5 37024 Negrar di Valpolicella (VR) - Italy alessandro.inno@sacrocuore.it patients (2,3). Stage was cT1c N0 M1c, IVB according to the American Introduction Mesenchymal epithelial transition gene (MET) exon 14 (METex14) skipping mutations occur in approximately 3-4% of non-small cell lung cancer (NSCLC) (1). keywords: chemotherapy; crossref; line; lung; nsclc; patients; tepotinib; treatment cache: dti-2626.pdf plain text: dti-2626.txt item: #124 of 145 id: dti-2637 author: Babyshkina, Nataliya; Popova, Nataliya; Grigoryev , Evgeny; Dronova , Tatyana; Gervas , Polina; Dobrodeev , Alexey; Kostromitskiy , Dmitry; Goldberg , Victor; Afanasiev , Sergei; Cherdyntseva , Nadejda title: Long-term response with the atypical reaction to nivolumab in microsatellite stability metastatic colorectal cancer: A case report date: 2024 words: 2507 flesch: 45 summary: Focal nodules in the lung at start of nivolumab treatment (A); 5 months after nivolumab treatment, reduction of lung nodules (B) and para-aortic lym- ph node lesion up to 12 mm (C); 8 months after nivolumab tre- atment, disappearance of lung lesions (D) and lack of growth of para-aortic lymph node lesion (E); increase of para-aortic lym- ph node lesion 40 months after nivolumab treatment (F). Nivolumab (Opdivo) is a human immunoglobulin G4 monoclonal antibody that blocks the interaction between the programmed cell death 1 (PD-1) receptor and its ligands 1/2 (PD-L1/PD-L2), leading to inhibition of T-cell proliferation, cytokine secretion, and enhanced immune response. keywords: cancer; mcrc; nivolumab; patients; response; treatment cache: dti-2637.pdf plain text: dti-2637.txt item: #125 of 145 id: dti-2638 author: Gajera, Gemini; Henriksen, Niel; Cox, Bryan; Kothari, Vijay title: Identification of anti-pathogenic activity among in silico predicted small-molecule inhibitors of Pseudomonas aeruginosa LasR or nitric oxide reductase (NOR) date: 2023 words: 6559 flesch: 52 summary: TABLE II - Anti-pathogenic activity of potential LasR inhibitors may be masked by their anthelmintic activity Lab code Manufacturer’s code Conc (µg/mL) % anti-pathogenic activity based on fifth day end-point Without nullifying compound’s toxicity towards worms After nullifying compound’s toxicity towards worms G2 Z65195564 25 10 ± 0*** 67 ± 0*** G5 Z354444420 25 33 ± 5*** 87 ± 5*** G6 Z400859658 25 3 ± 5.7 83 ± 5.7*** G10 Z1426094174 25 33 ± 5*** 90 ± 5*** G11 Z1625994950 25 6 ± 11.5 93 ± 11.5*** G14 Z104586200 25 23 ± 5.7** 50 ± 5.7*** G18 Z1084397894 25 16 ± 5.7** 63 ± 5.7*** G19 Z1212781307 Table IV - Anti-pathogenic activity of potential NOR inhibitors may be masked by their anthelmintic activity Lab code Manufacturer’s code Conc (µg/mL) % anti-pathogenic activity based on fifth day end-point Without nullifying compound’s toxicity towards worms After nullifying compound’s toxicity towards worms (A) (B) N4 Z954454636 25 25 ± 7** 60 ± 7** N36 Z397755956 25 40 ± 0** 65 ± 0*** N37 Z1190350270 25 20 ± 0*** 45 ± 0*** N61 Z2740017161 50 20 ± 14 80 ± 14** N65 Z1874308288 25 15 ± 21 40 ± 21** **p<0.01, ***p<0.001. keywords: activity; aeruginosa; bacteria; compounds; crossref; crossref pubmed; drug; host; inhibitors; lasr; pseudomonas; pubmed; screening; sensing; target; virulence; worms cache: dti-2638.pdf plain text: dti-2638.txt item: #126 of 145 id: dti-2660 author: Pothoven, Ria title: Management of urinary tract infections in the era of antimicrobial resistance date: 2023 words: 9204 flesch: 45 summary: Reducing antibiotic use in uncomplicated urinary tract infections in adult women: a sys- tematic review and individual participant data meta-analysis. Updates to recurrent uncomplicated urinary tract infections in women: AUA/CUA/SUFU Guideline. keywords: amr; antibiotic; burden; crossref; crossref pubmed; guidelines; infections; patients; prophylaxis; pubmed; recurrent; resistance; review; therapy; tract; tract infections; treatment; urinary; use; utis; women cache: dti-2660.pdf plain text: dti-2660.txt item: #127 of 145 id: dti-2670 author: Diarra, Luka; Mariko, Moussa; Traore, Salif; Dicko, Safi Bazi; Dolo, Aboudou; Coulibaly, Moussa; Sidibé, Daouda; Daou, Moumouni; Poma, Hachimi; Traoré, Madou; Guindo, Ibrahim title: Evaluation of non-conformities in the drafting of bulletins for urine cytobacteriological examinations at Sikasso Hospital (Mali) date: 2024 words: 1583 flesch: 47 summary: The majority of non-compliant reports came from the medicine (35.51%) and urology (25.85%) departments. Yes 350 52.08 No 322 47.92 The majority of non-compliance bulletins came from the medicine (35.51%) and urology (25.85%) departments (Fig. 1). keywords: compliance; ecbu; hospital; non; reports; study cache: dti-2670.pdf plain text: dti-2670.txt item: #128 of 145 id: dti-2707 author: Munjal, Kavita; Goel, Yash; Gauttam, Vinod Kumar; Chopra, Hitesh; Singla, Madhav; Smriti; Gupta, Saurabh; Sharma, Rohit title: Molecular targets and therapeutic potential of baicalein: a review date: 2024 words: 14666 flesch: 52 summary: et al. Baicalein induces G1 arrest in oral cancer cells by enhancing the degradation of cyclin D1 and activating AhR to decrease Rb phosphorylation. Takahashi H, Chen MC, Pham H, et al. Baicalein, a component of Scutellaria baicalensis, induces apoptosis by Mcl-1 down- regulation in human pancreatic cancer cells. keywords: activity; anti; apoptosis; arrest; authors; baicalein; cancer; cells; crossref pubmed; cycle; cyclin; disease; drug; effects; et al; expression; gastric; growth; insights; levels; pathway; pharmacol; phase; potential; production; research; review; scutellaria; study; target; treatment; vitro; wang; zhang cache: dti-2707.pdf plain text: dti-2707.txt item: #129 of 145 id: dti-2745 author: Rauf, Abdur; Rashid, Umer; Al Masoud, Najla; Akram, Zuneera; Saeed, Anees; Muhammad, Naveed; Alomar, Taghrid S.; Naz, Saima; Iriti, Marcello title: In vivo analgesic, anti-inflammatory, sedative, muscle relaxant activities, and docking studies of 3’,4’,7,8-tetrahydroxy-3-methoxyflavone isolated from Pistacia chinensis date: 2024 words: 5524 flesch: 55 summary: The extract (100 mg/kg) exhibited a sig- nificant (p<0.01) prolonged latency time (16.76 seconds) as TABLE 1 - Analgesic effect of Pistacia chinensis crude extract and isolated compound Group Dose (mg/kg) Time (minutes) 30 60 90 120 NS 10 mL 9.18 ± 0.06 9.19 ± 0.09 9.17 ± 0.10 9.20 ± 0.08 Tramadol 10 25.23 ± 0.07*** 25.30 ± 0.13*** 26.00 ± 0.15*** 26.43 ± 0.12*** Extract 25 9.65 ± 0.90 13.98 ± 0.43 14.00 ± 0.27 13.90 ± 0.87 50 12.43 ± 0.79 16.09 ± 0.66** 16.98 ± 0.64** 17.00 ± 0.54** 100 14.76 ± 0.66 19.49 ± 0.65** 17.07 ± 0.43** 16.90 ± 0.23** 250 16.76 ± 0.76** 21.65 ± 0.54*** 22.24 ± 0.21*** 21.98 ± 0.11*** Compound 1 2.5 11.76 ± 0.45 14.98 ± 0.54 15.00 ± 0.34 14.87 ± 0.39 5 13.09 ± 0.66 17.34 ± 0.28** 17.98 ± 0.54** 17.32 ± 0.40** 10 17.32 ± 0.55 20.87 ± 0.51*** 20.98 ± 0.28*** 20.07 ± 0.45*** 15 20.03 ± 0.45*** 24.08 ± 0.55 24.65 ± 0.54*** 24.11 ± 0.43*** ANOVA Sattar S, Khan MR, Shah NA, Noureen F, Naz K. Nephroprotective potential of Pistacia chinensis bark extract against induced tox- icity in rats. keywords: analgesic; anti; chinensis; compound; crossref; effect; extract; figure; interaction; muscle; opioid; pistacia; pubmed; receptor cache: dti-2745.pdf plain text: dti-2745.txt item: #130 of 145 id: dti-3019 author: Natsheh, Iyad Y.; Alsaleh, Majd M.; Alkhawaldeh, Ahmad K.; Albadawi, Duaa K.; Darwish, Maisa’ M.; Shammout, Mohammed Jamal A. title: The dark side of drug repurposing. From clinical trial challenges to antimicrobial resistance: analysis based on three major fields date: 2024 words: 11386 flesch: 43 summary: Moreover, long-term exposure to antibiotics, whether at clinical or sub-stoichiometric doses, can lead to the develop- ment of drug resistance among gut microbes. Challenges in diabetes endeavor Drug repurposing trials in the field of diabetes have encountered numerous hurdles and instances of failure. keywords: amr; antibiotics; antimicrobial; approach; authors; bacteria; challenges; clinical; colchicine; crossref pubmed; development; discovery; diseases; drug; drug repurposing; effects; et al; human; infections; insights; levofloxacin; medications; models; patients; potential; repurposing; resistance; review; study; target; treatment; trials; use cache: dti-3019.pdf plain text: dti-3019.txt item: #131 of 145 id: dti-3059 author: Gupta, Dablu Lal; Meher, Jhasketan; Giri, Anjan Kumar; Shukla, Arvind Kumar; Mohapatra, Eli; Ruikar, Manisha M; Rao, DN title: RBD mutations at the residues K417, E484, N501 reduced immunoreactivity with antisera from vaccinated and COVID-19 recovered patients date: 2024 words: 5336 flesch: 53 summary: Conclusion The study concludes that multiple variants of SARS-CoV-2, including the Delta and Omicron variants, reduced immuno- reactivity with polyclonal sera by vaccine-induced humoral immunity. Keywords: Antibodies, COVID-19, Immune escape, Immunoreactivity, Mutation, SARS-CoV-2 Received: March 1, 2024 Accepted: May 7, 2024 Published online: May 31, 2024 This article includes supplementary material Corresponding author: Dablu Lal Gupta email: dr.dlgupta@aiimsraipur.edu.in world (3). keywords: antibodies; antibody; cov-2; covid-19; crossref; immunoreactivity; patients; peptides; pubmed; rbd; sars; study; variants cache: dti-3059.pdf plain text: dti-3059.txt item: #132 of 145 id: dti-3060 author: Aslam, Hafiz Muhammad; Sohail, Azka; Shahid, Ammara; Khan, Maham Abdul Bari; Muhammad Umar Sharif; Kausar, Razia; Nawab, Samia; Farooq, Waqas; Jilani, Dr. Kashif; Rasheed, Majeeda title: Levofloxacin induces erythrocyte contraction leading to red cell death date: 2024 words: 4482 flesch: 47 summary: Mean ± SEM (n = 10) of erythrocytes incubated in Ringer’s solution for 48 hours without levofloxacin in white bar and with levofloxacin concentrations (7, 14 µM) in black bars. The high PS exposure on the outer leaflet of erythrocyte’s plasma membrane in levofloxacin-treated erythrocytes indicates that levofloxacin exposure leads to increased eryptosis. keywords: activity; cell; crossref; crossref pubmed; eryptosis; erythrocyte; levofloxacin; membrane; pubmed; stress cache: dti-3060.pdf plain text: dti-3060.txt item: #133 of 145 id: dti-3076 author: Mistry, Nerges title: Tuberculosis research: Quo vadis date: 2024 words: 2506 flesch: 47 summary: This is a powerful phenomenon to study the evolution of drug resistance in the coming years. Another paradigm has been the linkage of gut microbi- ome to the phenomenon of drug resistance in an individual (10). keywords: crossref; crossref pubmed; drug; pubmed; research; resistance; tuberculosis cache: dti-3076.pdf plain text: dti-3076.txt item: #134 of 145 id: dti-3082 author: Parmar, Sweety; Gajera, Gemini; Thakkar, Nidhi; Palep, Hanmanthrao S.; Kothari, Vijay title: Deciphering the molecular mechanisms underlying anti-pathogenic potential of a polyherbal formulation Enteropan® against multidrug-resistant Pseudomonas aeruginosa date: 2024 words: 10408 flesch: 48 summary: B) PPI net- work of top-ranked genes reve- aled through cytoHubba among upregulated differentially ex- pressed genes (DEG) in Entero- pan-exposed P. aeruginosa. Then we looked for genes which appear among top-10 ranked candidates by ≥6 cytoHubba methods, and 10 such genes (Tab. S11) were identified as potential hubs, whose downregulation can be hypothesized to attenuate P. aeruginosa virulence. keywords: aeruginosa; analysis; assay; biofilm; control; crossref; crossref pubmed; culture; drug; effect; enteropan; fig; formulation; genes; insights; network; pathogen; potential; pre; protein; pseudomonas; pubmed; target; virulence; worms cache: dti-3082.pdf plain text: dti-3082.txt item: #135 of 145 id: dti-3169 author: Alghamdi, Ali Hendi; Ahmed, Aimun A. E.; Bashir, Mahadi; Abdalgadir, Hiadar; Khalid, Asaad; Abdallah, Mohamed E.; Almaimani, Riyad; Refaat, Bassem; Abdalla, Ashraf N. title: Cytotoxic activity, selectivity, and clonogenicity of fruits and resins of Saudi medicinal plants against human liver adenocarcinoma date: 2024 words: 7194 flesch: 54 summary: Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti TABLE 1 - Phytoconstituents identified by GC-MS analysis of the extract of Opuntia ficus-indica (L.) Miller (BEP-10) Compound Formula Molecular weight Peak area (%) Retention time (minutes) Biological activity  (1) �5-(hydroxymethyl)-2- furancarboxaldehyde C6H6O3 126.11 13.2 5.875 Known�to�be�associated�with�antimicrobial� properties�(56)�used�as�an�antifungal�(57)  (2) �1-(4′-Hydroxyphenyl)-2-propanone C9H10O2 150.17 2.52 7.752 Exhibits�a�myriad�of�pharmacological�actions,�such� as�antimicrobial,�antitussive,�antispasmodic,�and� anticancer�properties�(58)  (3) �4-Butyl-phenol� C10H14O 150.22 2.93 8.011 No�significant�report  (4) �1,6-Anhydro-beta-D-glucopyranose C6H10O5 162.14 5.31 8.328 No�significant�report  (5) �Ethylalpha-d-glucopyranoside C8H16O6 208.09 4.60 9.245 Maintenance�and�improvement�of�skin� homeostasis�and�moisturizing�functions�(59)  (6) �Benzeneacetic� acid,� 4-hydroxy-,� methyl�ester Extract MCF7 HT29 HepG2 Average* IC50 MRC5 BEP-09 6.00±1.61 8.20±0.57 5.20±0.58 6.47 2.94±0.71 BEP-10 1.85±0.73 5.85±0.23 0.75±0.11** 2.82** 3.34±0.41 BEP-11 16.93±0.66 16.07±0.11 14.07±1.04 15.69 10.77±0.54 BEP-12 16.53±0.43 19.32±0.64 9.60±0.82 15.15 8.72±1.56 Doxorubicin 0.07±0.01 1.98±0.10 2.15±0.15 1.40 5.86±0.35 Camptothecin 0.08±0.01 2.50±0.26 0.76±0.07 1.11 1.18±0.10 *Average�cytotoxicity�(IC50)�of�each�extract�against�the�three�cancer�cells.�**p�≤�0.01. keywords: activity; arabia; bep-10; cells; crossref; crossref pubmed; drug; effect; et al; extract; ficus; fruits; hepg2; indica; myrrha; opuntia; plant; pubmed; saudi; selectivity cache: dti-3169.pdf plain text: dti-3169.txt item: #136 of 145 id: dti-3171 author: Mishra, Abhay; Yalo, Masande; Nambooze, Jennifer; Pohl, Carolina H.; Kemp, Gabré; Setsiba, Lekgoana K.; Matsabisa, Motlalepula G. title: Characterization and enhanced antibiofilm activity of Annona muricata extract in combination with fluconazole against Candida albicans date: 2025 words: 7063 flesch: 55 summary: Aliquots of 200 µL of the cell suspen- sion, including A. muricata methanol extract (reconstituted in sterile water) (AM), fluconazole (FLU) and a combination of the extract and antifungal drug (AM + FLU) at final con- centrations ranging from 15-240 µg/ml was dispensed into a 96-well microtiter plate (Corning Incorporated, Costar®, U.S.) and incubated for 48 hours at 37°C to allow biofilm forma- tion. Results and Discussion LCMS profile of A. muricata methanol extract A total of 17 phytochemicals were detected by LC/MS and 14 among them were identified (Table 1). keywords: albicans; annona; asp; biofilms; candida; compound; crossref; drug; extract; fig; fluconazole; gly; leaves; muricata; pubmed; tyr cache: dti-3171.pdf plain text: dti-3171.txt item: #137 of 145 id: dti-3177 author: Shahrivar, Firooz; Sadraei, Javid; Pirestani, Majid; Ahmadpour, Ehsan title: Enhancement of apoptosis in Caco-2, Hep-G2, and HT29 cancer cell lines following exposure to Toxoplasma gondii peptides date: 2024 words: 5133 flesch: 51 summary: Our investigation shows that parasite-derived peptide could induce apoptosis in cancer cell lines, which was in line with the lately done study by Bahadory et al (10). Cell viability rates were assessed at FIGURE 1 - The cell viability of cancer cells. keywords: apoptosis; caco-2; cancer; cell; crossref; expression; gondii; hep; hours; ht29; lines; peptide; pubmed; toxoplasma cache: dti-3177.pdf plain text: dti-3177.txt item: #138 of 145 id: dti-3213 author: Galeone, Carlotta; Turati, Federica; Nicolò, Massimo; Parravano, Mariacristina; Vujosevic, Stela; Bianchino, Laura; Sicari, Emilia; Lanzetta, Paolo title: Faricimab versus the standard of care for neovascular age-related macular degeneration in Italy: an indirect treatment comparison date: 2024 words: 5743 flesch: 54 summary: Optimizing anti-VEGF treatment outcomes for patients with neovascular age-related macular degeneration. Of those, 17 were excluded because they did not satisfy the inclusion criteria (i.e., patients with diagnosis of nAMD, naïve to any intraocular anti-VEGF treatment, with age ≥50 years on the date of the first anti-VEGF injection), 1 because of the lack of hospital charts/clinical records at anti-VEGF treatment start, 43 because of the lack of at least two VA measurements after the baseline, and 81 because of the lack of a VA measurement at week 52 ± 10. keywords: age; analysis; anti; baseline; crossref; cst; degeneration; faricimab; patients; pubmed; radiance; soc; study; treatment; vegf cache: dti-3213.pdf plain text: dti-3213.txt item: #139 of 145 id: dti-3219 author: Nxasana, Thembelihle; Mangoato, Innocensia; Masiu, Patriciah; Mishra, Abhay; Matsabisa, Motlalepula title: Investigating the combinatory effect of Sclerocarya birrea with doxorubicin against selected colorectal cancer cell lines date: 2024 words: 753 flesch: 81 summary: Drug/Combination CI value Dose VER Dose DOX DRI VER DRI DOX IC50 VER 6.63 2.64 DOX 0.38 0.46 DOX + VER 1.33 2.99 0.33 IC75 VER 217.40 355.6 DOX 6.11 1.1 DOX + VER 0.34 14.82 1.66 IC90 VER 7127.23 47807.7 DOX 97.73 3.0 DOX + VER 0.09 73.44 8.25 IC95 VER 7652.5 1340243 DOX 643.6 4.2 DOX+ VER 0.04 218.07 24.50 Drug Target Insights 2024 | DOI: 10.33393/d .2024.3219 The IC50 and combination index values of the DOX and VER on HT29 cells, n=3. keywords: dose; dox cache: dti-3219.pdf plain text: dti-3219.txt item: #140 of 145 id: dti-3271 author: Rauf, Abdur; Alam, Waqas; Khan, Momin; W. Darwish, Hany; Daglia, Maria; A. Elhenawy, Ahmed; Khan, Haroon title: Exploring the in vitro anti-diabetic potential and in silico studies of 2, 3 and 2, 6-dichloroIndolinone date: 2025 words: 4865 flesch: 50 summary: Amylase inhibitors can also be used to treat obesity (29). Amylase inhibitors and their biomedical applications. keywords: amylase; binding; compounds; crossref; diabetes; docking; energy; enzyme; glucosidase; inhibition; pubmed cache: dti-3271.pdf plain text: dti-3271.txt item: #141 of 145 id: dti-3304 author: Kaushik, Ankush; Singh, Jitendra; Fatima, Zeeshan; Hameed, Saif title: Establishment and evaluation of a naked-eye diagnostic assay for tuberculosis utilizing reverse isothermal amplification-assisted CRISPR-Cas in resource-limited settings date: 2025 words: 1824 flesch: 27 summary: NA NA POSITIVE 59 HEALTHY CONTROL- 1 Sputum NA NA NA NA Urine NEGATIVE NEGATIVE Not Done NEGATIVE Serum NA NA NA POSITIVE Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3304 | Kaushik et al 44 MTB-52-SP Sputum POSITIVE POSITIVE POSITIVE POSITIVE Urine NEGATIVE NEGATIVE NOT DONE POSITIVE Serum NA NA NA POSITIVE 45 MTB-32-SP Sputum POSITIVE POSITIVE POSITIVE POSITIVE Urine Sample not found Saple not Found Sample not found keywords: urine cache: dti-3304.pdf plain text: dti-3304.txt item: #142 of 145 id: dti-3495 author: Sardar, Haseeba; Noor, Fatima; Shah, Syed Mukarram; Khan, Ashraf Ullah; Al-Otaibi, Jamelah S.; Hadi, Fazal; Daglia, Maria; Khan, Prof. Dr. Haroon title: Integrated in vitro, microarray, and network pharmacology analysis reveals the multi-target anti-diabetic potential of Vigna unguiculata date: 2025 words: 11800 flesch: 49 summary: The solvent was evaporated using a rotary evaporator Sardar et al Drug Target Insights 2025; 19: 73 © 2025 The Authors. −6.865 Glycitein −7.645 −7.297 −6.864 Catechin −7.637 −8.098 −7.159 Vicine −6.17 −7.04 −6.479 Acarbose −6.9 −6.7 −8.9 Sardar et al Drug Target Insights 2025; 19: 83 © 2025 The Authors. keywords: activity; amylase; analysis; authors; binding; complexes; compounds; crossref; data; diabetes; drug; energy; figure; genes; inhibitory; insights; network; potential; protein; pubmed; study; target; unguiculata cache: dti-3495.pdf plain text: dti-3495.txt item: #143 of 145 id: dti-3499 author: Fehrenbach, Gustavo; Shiels, Katie; Juca Silva, Mariana; Walshe, Jessica; Madden, Lena; Major, Ian; Burke, Niall; Yeomans, Tim; Rezoagli, Emanuele; Murphy, Emma title: Anti-Inflammatory and Regenerative Properties of Herbal Extracts: Wound Management in Equine Models date: 2025 words: 5451 flesch: 49 summary: Methods: This study aimed to evaluate the therapeutic efficacy of Pau D’Arco (Tabebuia), Yarrow (Achillea millefo- lium), Gotu Kola (Centella asiatica), Figwort (Scrophularia nodosa), and Broadleaf (Plantago major) extracts, both individually and combined, on wound healing in vitro and in vivo in equine models. Conclusion: These findings suggest that the herbal extracts may be useful for supporting wound healing. keywords: activity; cells; crossref; crossref pubmed; day; equine; extracts; healing; lps; macrophages; panel; pubmed; treatment; wound; yarrow cache: dti-3499.pdf plain text: dti-3499.txt item: #144 of 145 id: dti-3574 author: Mishra, Abhay; Tangsumranjit, Anothai; Nigam, Manisha; Chandra, Harish; Almalki, Faisal A.; Hadda, Taibi; Waranuch, Neti title: Integrative in silico and Petra/Osiris/Molinspiration (POM) analysis of baicalein: identification of therapeutically relevant pharmacophores against keloid pathology date: 2025 words: 1687 flesch: 60 summary: Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3574 | Mishra et al 5 Table S-V. Oral toxicity model report of Baicalein Classification Target Shorthand Predictio n Probability Organ toxicity Hepatotoxicity dili Inactive 0.69 Organ toxicity Neurotoxicity neuro Inactive 0.89 Organ toxicity Nephrotoxicity nephro Active 0.62 Organ toxicity Respiratory toxicity respi Active 0.83 Organ toxicity Cardiotoxicity cardio Inactive 0.99 Toxicity end points Carcinogenicity carcino Active 0.68 Toxicity end points Immunotoxicity immuno Inactive 0.99 Toxicity end points Mutagenicity mutagen Active 0.51 Toxicity end points Cytotoxicity cyto Inactive 0.99 Toxicity end points BBB-barrier bbb Active 0.53 Toxicity end points Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3574 | Mishra et al 11 A B C D Fig. keywords: doi; drug; dti.2025.3574; inactive; insights; receptor; target cache: dti-3574.pdf plain text: dti-3574.txt item: #145 of 145 id: dti-3631 author: Fanta, Angele; Bayiha Ba Njock, Gaetan; Dawe, Amadou; Yakai, Fawai; Nyemb, Jean Noël; Ketsemen, Herve Landry; Taira , Vincent; Wangso, Albert; Doudja, Chantal; Pegnyemb, Dieudonne Emmanuel; Loura, Benoit title: Antioxidant potential of a new macrocyclic bisbibenzyl and other compounds from Combretum molle: in vitro and docking analyses date: 2025 words: 349 flesch: 35 summary: Microsoft Word - Supplementary+material Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S1: HR-ESI-MS (-) spectrum of compound 1 Figure S2: 1H NMR spectrum of compound 1 Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S3: 13C NMR spectrum of compound 1 Figure S4: APT NMR spectrum of compound 1 Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Figure S5: HMBC spectrum of compound 1  Figure S6: HMBC spectrum of compound 1 showing 5J correlation Drug Target Insights 2025 | DOI: 10.33393/dti.2025.3631 | Fanta et al Table S1. Potent antioxidant activities of extract and pure isolated compounds  Results are in agreement with the traditional health uses of the plant keywords: doi; figure cache: dti-3631.pdf plain text: dti-3631.txt