Matsuyama et al.indd Drug Target Insights 2008:3 137–151 137 REVIEW Correspondence: Rikio Yoshimura, M.D., Ph.D., Department of Urology, Osaka City University Hospital, 1-4-3 Asahi-machi, Abeno-ku, Osaka 545-8585, Japan. Tel: 81-6-6645-3857; Fax: 81-6-6647-4426; Email: jasmin@med.osaka-cu.ac.jp Copyright in this article, its metadata, and any supplementary data is held by its author or authors. It is published under the Creative Commons Attribution By licence. For further information go to: http://creativecommons.org/licenses/by/3.0/. The Target of 5-Lipoxygenase is a Novel Strategy over Human Urological Tumors than the Target of Cyclooxygenase-2 Masahide Matsuyama and Rikio Yoshimura Department of Urology, Osaka City University Graduate School of Medicine, Add: 1-4-3 Asahi-machi, Abeno-ku, Osaka, 545-8585, Japan. Abstract: The metabolism of arachidonic acid by either the cyclooxygenase (COX) or lipoxygenase (LOX) pathway generates eicosanoids, which have been implicated in the pathogenesis of a variety of human diseases, including cancer. It is now considered that they play important roles in tumor promotion, progression, and metastasis, also, the involvement of COX and LOX expression and function in tumor growth and metastasis has been reported in human tumor cell lines. In this study, we examined the expression of COX and LOX in human urological tumors (renal cell carcinoma, bladder tumor, prostate cancer, testicular cancer) by immunohistochemistry and RT-PCR, and we also examined the effects of COX and LOX (5- and 12-LOX) inhibitors in those cells by MTT assay, hoechest staining, and fl ow cytometry. COX-2, 5-LOX and 12-LOX expressions were signifi cantly more extensive and intense in malignant tissues than in normal tissues. Furthermore, 5-LOX inhibitor induced the reduction of malignant cell viability through early apoptosis. These results demonstrated COX-2 and LOX were induced in urological tumors, and 5-LOX inhibitor may mediate potent antiproliferative effects against urological tumors cells. Thus, 5-LOX may become a new target in the treatment of urological tumors. Keywords: cyclooxygenase-2, 5-lipoxygenase, 12-lipoxygenase, renal cell carcinoma, bladder tumor, prostate cancer, testicular cancer Introduction Angiogenetic factors play important roles in urological tumors as well as in other cancers. In recent years, the expression of angiogenic factors in solid human tumors has been widely reported [1]. Growth factors secreted by tumor cells such as fi broblast growth factor, and transforming growth factor, have increased neovascularization in vivo and in vitro [2]. The metabolism of arachidonic acid (AA) by either the cyclooxygenase (COX) pathway or the lipoxygenase (LOX) pathway generates eicosanoids, have been implicated in the pathogenesis of a variety of human diseases, including cancer, and are considered important in tumor promotion, progression, and metastasis. COX is the fi rst enzyme in the pathway for producing prostaglandin (PG) and thromboxane (Tx) from arachidonic acid, and can occur as three isoforms, COX-1, COX-2 and COX-3. The enzymes of both COX-1 and COX-2 are transformed from the cell membrane phospholipid to arachidonic acid by the phospholipaseA2, and then transform arachidonic acid to PGH2 through PGG2 (Fig. 1). COX-1 occurs in tissues and cells and works to protect the cell. COX-2 express momentarily and strongly in response to growth factors and some endotoxins. It is involved with infl ammation, cell proliferation and differentiation [3]. COX-2 has also been shown to play an important role in carcinogenesis. Although the existence of COX-3 has recently been reported, it continues to be argued [4]. LOX is the fi rst enzyme in the pathway for producing leukotrienes (LT) from arachidonic acid. Isoenzymes of LOX include 5-LOX, 12-LOX and two 15-LOX isoforms (15-LOX-1, 15-LOX-2). These catalyze the biosynthesis of biologically active compounds such as LTs and hydroxyeicosatetraenoic acids (HETEs) [5, 6]. 5-LOX catalyzes the fi rst step in oxygenation of arachidonic acid to produce 5-hydroperoxyeicosatetraenoic acid (5-HPETE), and the subsequent metabolism of 5-HPETE to 5-HETE and LTs (Fig. 1). LTs belong to an important group of pro-infl ammatory mediators that are synthesized from arachidonic acid via the 5-LOX pathway. The activity of 5-LOX leads to the formation of unstable LTA4, which can be converted into either LTB4, or cysteinyl LTs (LTC4, LTD4 and LTE4) [7]. http://creativecommons.org/licenses/by/3.0/ http://creativecommons.org/licenses/by/3.0/ 138 Matsuyama and Yoshimura Drug Target Insights 2008:3 The 12-LOX, includes platelet 12-LOX, and leukocyte 12-LOX that oxygenate arachidonic acid at position C-12 to produce 12-hydroperoxyeico- satetra- enoic acid and then 12-HETE [8]. Whereas 5-LOX, 12-LOX and 15-LOX-1, have pro- carcinogenic roles, 15-LOX-2 appears to have an anti-carcinogenic roles. Our research focuses on the relationship between COX-2 and LOX (5- and 12-LOX) and urological tumors (renal cell carcinoma, bladder tumor, pros- tate cancer and testicular cancer) and on the anti- tumor effects of COX and LOX inhibitors. Methods Tumor specimens All tissue specimens were obtained from Osaka City University Hospital. Tumor tissues, nontumor tissues, vascular endothelium, and interstitial tissues from the subjects were preserved in 10% formalin and embedded in paraffi n, serially sectioned onto microscope slides at a thickness of 4 μm. a) COX Renal cell carcinoma (RCC) specimens Specimens were obtained from 108 patients with RCC and 20 patients with normal kidney (NK) tissues who underwent total nephroureterectomy due to ureteral cancer. Bladder tumor (BT) specimens Specimens were obtained from 118 patients with BT (including 68 who underwent total cystectomy and 50 who underwent transureteral resection of Arachidonic acid 5-LOX 15-LOX-1 15-LOX-2 12-LOX 12-HETE 5-HETE 15-HETE LTA4 LTC4 LTB4 PGG2 PGH2 PGF2 PGE2 PGD2 PGJ2 TXA2 PGI2 LTD4 LTE4 Membrane PhospholipidA2 PhospholipaseA2 COX-2 COX-1 Figure 1. Map of arachidonic acid (AA) cascade. Cyclooxygenase (COX) is the fi rst enzyme in the pathway for producing prostaglandin (PG) and thromboxane (Tx) from AA, and there are two isoforms, COX-1 and COX-2. The enzymes of both COX-1 and COX-2 are transformed from the cell membrane phospholipid to AA by the phospholipase A2, and then transform AA to PGH2 through PGG2. Lipoxygenase (LOX) is an initial enzyme in the pathway for producing leukotrien (LT) from AA and there are 5-, 12-LOX and two isoenzymes of 15-LOX (15-LOX-1, 15-LOX-2) as isoforms catalyzing the biosynthesis of biologically active compounds such as LTs and hydroxyeicosatetraenoic acids (HETEs). 139 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 bladder tumor) and 10 patients with chronic cystitis (CC) and 8 with normal bladder tissues (NB) who underwent total prostatectomy because of prostate cancer. Prostate cancer (PC) specimens Specimens were obtained from 28 patients with PC, 8 patients with benign prostatic hyperplasia (BPH), 1 patient with prostatic intraepithelial neo- plasia (PIN) who underwent total prostatectomy or subcapsular prostatectomy, and 8 patients with normal prostate (NP) tissues who underwent total cystectomy because of bladder tumor. Testicular cancer (TC) specimens Specimens were obtained from 72 patients with TC, 20 patients with normal testis (NT) tissues who underwent orchiectomy for prostate cancer. b) LOX RCC specimens Specimens were obtained from 50 patients with RCC and 10 patients with NK tissues. BT specimens Specimens were obtained from 170 patients with BT (87 total cystectomy and 83 transureteral resec- tion) and 20 patients with CC and 20 patients with NB tissues. PC specimens Specimens were obtained from 174 patients with PC, 20 patients with BPH, 20 patients with PIN, and 8 patients with NP tissues. TC specimens Specimens were obtained from 72 patients with TC, 20 patients with NT tissues. Immunohistochemical staining Immunohistochemical staining was performed with a Vectastain (vector Laboratories, Burlin- game, California) avidin-biotin preoxidase com- plex kit, as previously described [9]. Primary antibodies against rabbit COX-1 (DHHILH- VAVDV) (1:100 dilution in PBS), rabbit COX-2 (LDDINPTVLLKER) (1:100 dilution in PBS), rabbit 5-LOX (Cayman Chemical, Ann Arbor, Michigan) (1:100 dilution in PBS), rabbit 12-LOX (Oxford Biomedical Research, Oxford, Michi- gan) (1:100 dilution in PBS) and control PBS were used. Immunohistochemical analysis Staining was classifi ed into 5 grades from 0 to 4 according to staining intensity and number of positive cells by two blind observers on two sepa- rate occasions using coded slides. An average score was calculated. A 4 grade indicated that all staining was maxi- mally intense throughout the specimen, while 0 indicated that staining was absent throughout the specimen. Micro-anatomical staining sites were also recorded. This method was perfomed as previ- ously described [9]. All results are presented as the mean ± SD. Data analysis were performed using ANOVA [10]. PT-PCR Concerning COX, total RNA was extracted from RCC, BT, PC and TC tissues. Concerning LOX, total RNA was extracted from RCC tissues, BT and PC cell lines by the acid guanidium thiocyanate- phenol-chloroform method [11]. a) COX For Polymerase Chain Reaction (PCR) analysis of RNA, complementary DNA (cDNA) was made by reverse-transcription of 2 μg of each RNA sample using Super Script preamplifi cation system for fi rst-strand cDNA synthesis (GIBCO BRL, MD, U.S.A.). PCR reactions were performed with 3 μl of each cDNA, 3 μl of each sense and antisense primers (20 μM), and 1 unit of Taq polymerase (NIPPON GENE, Toyama, Japan). 35 cycles of denaturation, annealing, and extension (94ºC for 45 sec, 54 ºC for 45 sec, and 72 ºC for 2 min) were performed on automatic heat-block (Model PJ2000 DNA Thermal cycler, PERKIN ELMER, NJ, U.S.A.). The primers used were: Human COX-1 sense (5’-TGCCC AGCTCCT- GGCCCGCCGCTT-3’) and antisense (5’-GTG- CATCAACACAGGCGCCTCTT C-3’); Human COX-2 sense (5’-TTCAAATGAGA- TTGTGGGAAAATTGCT-3’) and antisense (5’-AGATCATCTCTGCCTGAGTATCTT-3’); 140 Matsuyama and Yoshimura Drug Target Insights 2008:3 Human g lyce ra ldehyde 3 -phospha te dehydrogenase (G3PDH) sense (5’-CCACCCAT- GGCAAATTCCATGGCA-3’) and antisense (5’-TCTAGAGGGCAGGTCAGGTCCACC-3’). b) LOX After the RT reaction, nested PCR was used to examine 5- and 12-LOX mRNA expression. For 5- and 12-LOX, the fi rst run PCR profi le was 94 ºC, 15s to denature; 61 ºC, 30s for annealing and extension for 30 cycles with upstream (5’- CTTCCCGTGCTACCGCTG-3’) and downstream (5’-TGGGGTTGGCACCATTGAG-3’) primers. 5 μl of fi rst run PCR product was used for the nested PCR with the profi le of 94 ºC, 15s to dena- ture; 61 ºC, 30s for annealing and extension for 25 cycles with nested primers (upstream 5’-CCAG- GAGACAATGCTTTGGACA-3’; downstream 5’-GAACAACTCATCATCCTGCCAG-3’). Reagents and materials RPMI 1640 was purchased from Nissui Pharma- ceutical Company (Tokyo, Japan), fetal bovine serum (FBS) and penicillin-streptomycin mixture from Biowhitteker (Walkerville, MD), and trypsin/ EDTA from GIBCO BRL (Rockville, MD). Ibupurofen, Piroxicam, Meloxicam, and Nimesulide were obtained from BIOMOL Research Laboratories INC (U.S.A.), Naproxen was obtained from Cayman Chemical Company (St. Louis, U.S.A.), Indomethacin and NS 398 were obtained from Wako Pure Chemical Industries Ltd (Osaka, Japan), and Etodolac was obtained from Nippon Shinyaku Co. Ltd (Kyoto, Japan). Ibupurofen, Piroxicam, Meloxicam, Nimesulide Naproxen, Indomethacin, NS 398, and Etodolac were all COX inhibitors. 5-LOX inhibitor (Caffeic acid) and 12-LOX inhibitor (Baicalein) were obtained from BIO- MOL. Research Laboratories Inc, U.S.A. Non- specifi c LOX inhibitor (NDGA) was obtained from Cayman Chemical, U.S.A. All data characteristics of these inhibitors were published in their product information. Cell cultures The human RCC cell line (Caki-1) and normal prostate stromal cell were provided by Dr. Shinichi Ikemoto (Dept. of Urology, Osaka City University School of Medicine, Osaka, Japan). The human BT cell line (T24), PC cell lines (PC3, DU-145), TC cell line (NEC-8) and normal proximal tubular endothelial cell (PRTEC) were obtained from Health Science Research Resources Bank (Osaka, Japan). Normal bladder cell line was obtained from the patients with normal bladder tissues who under- went total prostatectomy due to prostate cancer. Cells were grown in culture flask (Nunc, Roskilde, Denmark) in RPMI 1640 supplemented with 10% FBS, 100 U/ml of penicillin and 100 μg/ ml of streptomycin in a humidifi ed 5% CO2 atmo- sphere at 37 ºC. The media were changed every 3 days and the cells were separated via trypsiniza- tion, using trypsin/EDTA when they reached subconfl uence. Cell proliferative studies Approximately 1.0 × 104 cells placed onto 8 × 8 mm diameter multichamber slides (Nunc, Copen- hagen, Denmark) were treated with COX and LOX inhibitors (10–80 μM) dissolved in ethanol. The fi nal concentration of ethanol was �0.05%. Cell viability was measured after 48 hours by a micro- plate reader using a modifi ed 3-[4, 5-dimethyl- thiazol-2-thiazolyl]-2, 5- diphenyltetrazolium bromide (MTT) assay (WST-1 assay; Dojindo, Kumamoto, Japan) and presented as the percentage of control-culture conditions. Flow Cytometry (Annexin V and propidium iodide staining) The effects of LOX inhibitors on human urological tumors cell lines were determined by dual staining with Annexin V-FITC and propidium iodide using Annexin V-FITC Apoptosis Detection Kit I (Biosiences Pharmingen). Annexin V-FITC and propidium iodide (PI) were added to the cellular suspension as in the manufacturer’s instruction, and sample fl uorescence of 1.0 × 104 cells was analyzed fl ow cytometry. Flow cytometry was with FACScan (Becton Dickinson, Germany). Cell which were Annexin V-FITC positive and PI negative were identifi ed as early apoptosis. Cell which were Annexin V-FITC positive and PI positive were identified as late apoptosis or necrosis. Flow Cytometry (Identifi cation of DNA fragmentation) The assay was performed by TdT-mediated dUTP Nick End Labelling (TUNEL) method using 141 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 APO-DIRECTTM kit (Becton Dickinson, Germany). Following the experiments, human urological tumors cell lines in suspension (1 × 106/ml) were fi xed with 1% PBS, washed in PBS, and suspended in 70%(v/v) ice-cold ethanol. The cells were stored in ethanol at –20 ºC until use. The positive and negative controls and the sample were stained with FITC-dUTP by incubation in terminal deoxynu- cleotidyl transferase buffer as in the manufacturer’s instruction, and sample fl uorescence of 1 × 104 cells was analyzed by fl ow cytometry (Becton Dickinson, Germany). Results are given as % of TUNEL-positive cells. Detection of apoptosis by Hoechst staining DNA chromatin morphology was assessed using hoechst staining. Human urological tumors cell (5 × 105 cells) were incubated with 50 μM LOX inhibitor for 24 hour. Cells were washed by RPMI- 1640 and labeled with 8 mg/ml of hoechest 33342 (Sigma-Aldrich Japan K.K. Tokyo, Japan) for 10 min; PI (Sigma-Aldrich Japan K.K. Tokyo, Japan) was added (10mg/ml fi nal concentration), and the cells were examined by fl uorescence microscopy. Results Expression of COX and LOX 1) Immunohistochemistry a) COX RCC tissue sample COX-2 expression was observed in proximal and distal tubules of NK tissues. However, in epithelial cells, blood vessels and stromal tissues, while COX-2 was not expressed in NK tissues, COX-2 was strongly expressed in all RCC tissues. BT tissue sample COX-1 was weakly expressed in CC tissues but no expression was found in any BT tissues. On the other hand, COX-2 was strongly expressed in all BT tissues with an intense expression in high-grade BT group. Neither COX-1 nor COX-2 were expressed in NB tissues. PC tissue sample The expression of COX-1 was very weak in PC, PIN, BPH and NP tissues. However, COX-2 was strongly expressed in all PC tissues, although very weak expression of COX-2 was found in PIN, BPH and NP tissues. TC tissue sample COX-1 and COX-2 were strongly expressed in all TC group tissues, although very weak expression of COX-1 and COX-2 were found in NT tissues. b) LOX RCC tissue sample 5- and 12-LOX were strongly expressed in all grades RCC tissues (A: RCC -G1, B: RCC -G2, C: RCC -G3) and other types of RCC tissues (D: RCC papillary cell type, E: RCC chromphobe cell type, F: RCC collecting duct type) although very weak expressions of 5- and 12-LOX were found in NK tissues (G). Immunostaining with PBS was negative (H) (Fig. 2). BT tissue sample 5- and 12-LOX were strongly expressed in all grades of BT tissues, although very weak expressions of 5- and 12-LOX were found in CC and NB tissues. PC tissue sample 5- and 12-LOX were strongly expressed in all grades of PC and PIN tissues, although very weak expressions of 5- and 12-LOX were found in BPH and NP tissues. TC tissue sample 5- and 12-LOX were strongly expressed in all TC group tissues, although very weak expressions of 5- and 12-LOX were found in NT tissues. Statistical analysis of immunohistochemistry a) COX RCC tissue sample We classified 3 categories (epithelium, blood vessel, a small quantity of stromal tissue) in 142 Matsuyama and Yoshimura Drug Target Insights 2008:3 A B DC CCE F G H Figure 2. 5-lipoxygenase (LOX) immunostaining in renal cell carcinoma (RCC) and normal kidney (NK) tissues. 5-LOX was strongly expressed in all slides from cancer specimens, clear cell RCC -G1, -G2 and G3 (A, B and C) and other types of RCC tissues (D: RCC papillary cell type, E: RCC chromphobe cell type, F: RCC collecting duct type). In NK tissues, expression of 5-LOX was observed only in tubules and was not expressed in tissues from NK in epithelial cells, blood vessels or stromal tissues (G). Immunostaining with PBS was negative (H). 143 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 RCC tissues, and examined them for intensity of COX-2 immunostaining. COX-2 expression score was signifi cantly more extensive and intense in all categories of RCC tissues than NK tissues. COX-2 expression score was higher in G1 cancer than in G3 cancer. However, no difference was seen in all categories among grades. Another comparison between stages, the expression score was higher in early stage cancer pT1 than in advanced cancer (pT2 or above). However, this comparison among stages also shows no signifi cant difference among the categories. BT tissue sample We classified 3 categories (epithelium, blood vessel, stromal tissue) in BT tissues, and examined them for intensity of COX-1 and COX-2 immunostaining. COX-2 expression score was signifi cantly more extensive and intense in epithelial cells of BT and CC than in epithelial cells of NB. COX-2 expression score was higher in G3 cancer than in G1 cancer. Moreover, the expression score was higher in advanced cancer (pT2 or above) than in early stage cancer (pT1 or below). On the other hand, no difference was seen in blood vessels and stromal tissues between NB and BT tissues. PC tissue sample We classified 3 categories (epithelium, blood vessel, stromal tissue) in PC tissues, and examined them for intensity of COX-1 and COX-2 immunostaining. COX-2 expression score was signifi cantly more extensive and intense in epithelial cells of all grades PC tissues than in BPH and PIN tissues. On the other hand, COX-2 expression score was high in the blood vessels, and the stromal tissues of PC in the study groups with no signifi cant difference between grades. However, COX-2 expression score in the blood vessels and stromal tissues from BPH, PIN and NP were at basic level. TC tissue sample We classified 2 categories (epithelium, blood vessel) in TC tissues, and examined them for intensity of COX-1 and COX-2 immunostaining. COX-1 expression score was signifi cantly more extensive and intense in all categories of TC tissues than in NT tissues. COX-2 expression score was also signifi cantly more extensive and intense in all categories of TC tissues in the studied groups than in NT tissues. However, there were no signifi cant differences among the five histopathological groups in all categories. b) LOX RCC tissue sample We classifi ed 3 categories (epithelium, blood ves- sel, a small quantity of stromal tissue) in RCC tissues, and examined them for intensity of 5- and 12-LOX immunostaining. 5- and 12-LOX expression scores were signifi cantly more extensive and intense in all categories of RCC tissues than NK tissues. Only in epithelium, 5- and 12-LOX expression scores were higher in G1 cancer than in G3 cancer. However, no differences were seen in blood vessels and stromal tissues among the three grades. BT tissue sample We classifi ed 3 categories (epithelium, blood vessel, stromal tissue) in BT tissues, and examined them for intensity of 5- and 12-LOX immunostaining. 5- and 12-LOX expression scores were signifi - cantly more extensive and intense in BT tissues than in CC and NB. A signifi cant difference was seen only in epithelium, showing that staining was intensifi ed as the grade increased. No difference was seen in blood vessels and stromal tissues between grades. Comparison of early and advanced stages shows a signifi cant difference only in epithelium. No dif- ference was seen in blood vessels and stromal tissues between early stage (pT1 or below) and advanced cancer (pT2 or above). PC tissue sample We classifi ed 3 categories (epithelium, blood vessel, stromal tissue) in PC tissues, and examined them for intensity of 5- and 12-LOX immunostaining. 5- and 12-LOX expression scores were signifi - cantly more extensive and intense in PC and PIN tissues than BPH and NP tissues in all categories. There was no significant difference between grades. 144 Matsuyama and Yoshimura Drug Target Insights 2008:3 TC tissue sample We classified 2 categories (epithelium, blood vessel) in TC tissues, and examined them for intensity of 5- and 12-LOX immunostaining. 5- and 12-LOX expression scores were signifi cantly more extensive and intense in all TC groups than NT tissues in all categories. However, there were no signifi cant differences among the fi ve histopathological groups in all categories (Table 1). RT-PCR a) COX RCC tissue We detected a specifi c band of COX-2 mRNA band in RCC, whereas sample of from NK displayed no band of COX-2 mRNA. BT tissue We detected specifi c band of COX-1 mRNA in all samples (BT, CC and NB). However, we detected specifi c band of COX-2 in BT, while a weak band was displayed in CC and no clear band was dis- played in NB. PC tissue We detected a specifi c band of COX-1 mRNA in all samples (PC, BPH and NP). However, we detected a specifi c band of COX-2 was detected in PC, while a weak band was displayed in BPH and no clear band was displayed in NP. TC tissue We detected a specifi c band of COX-1 and COX- 2 mRNA all TC groups. b) LOX RCC tissue We detected a specifi c band of 5- and 12-LOX mRNA in RCC, whereas the sample of from NK displayed no band of—and 12-LOX mRNA. BT cell line We detected a specifi c band of 5- and 12-LOX mRNA (A: 5-LOX, B: 12-LOX, lane 2) in BT cell line, whereas the sample of from NB cells displayed no band of—and 12-LOX mRNA (A: 5-LOX, B: 12-LOX, lane 1) (Fig. 3). PC cell line We detected a specifi c band of 5- and 12-LOX mRNA in PC cell line, whereas a sample of from NP cells displayed no band of—and 12-LOX mRNA. 2) Effect of COX and LOX inhibitors MTT assay a) COX RCC cell line All COX inhibitors were unable to induce a reduc- tion of cell viability with the half-maximal con- centration of growth inhibition of RCC cells in the range of 10–80 μM and were unable to stop the growth of RCC cells. All COX inhibitors had no effect on normal proximal tubular endothelial cells (PRTEC) proliferation. BT cell line Similar to RCC cells, COX inhibitors could not induce a reduction of cell viability with the half- maximal concentration of growth inhibition of BT cells in the range of 10–80 μM and could not stop the growth of BT cells. COX inhibitors had no effect on normal bladder cells proliferation. PC cell line Similar to RCC and BT cells, none of the COX inhibitors could induce a reduction of cell via- bility with the half-maximal concentration of growth inhibition of PC cells in the range of 10–80 μM, neither could they stop the growth of PC cells. COX inhibitors had no effect on normal prostate stromal cells proliferation (Table 2). TC cell line Regarding RCC, BT and PC cells, some forms of COX inhibitors induced a slight reduction of TC cells growth in 80 μM, but we were unable to detect the induction of TC cells apoptosis in 80 μM COX inhibitors. 145 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 a) LOX RCC cell line LOX inhibitors induced a reduction of cell viabil- ity with the half-maximal concentration of growth inhibition of RCC cells in the range of 10–80 μM. Although the effect of non-specifi c LOX inhibitor was strongest, the effect of 5-LOX inhibitor was stronger than that of 12-LOX inhibitor. No LOX inhibitors had any effect on normal proximal tubular endothelial cells (PRTEC) proliferation. BT cell line Similar to RCC cells, LOX inhibitors induced a reduction of cell viability with the half-maximal concentration of growth inhibition of BT cells in Table 1. Effects of COX and LOX inhibitors in viabity of human prostate cancer and normal prostate stromal cells. % of control culture 10 μM 20 μM 40 μM 80 μM DU-145 COX inhibitors Ibupurofen 96.4% 107.5% 94.8% 96.7% Piroxicam 127.5% 126.9% 93.0% 94.7% Meloxicam 114.6% 110.2% 108.3% 97.6% Nimesulide 110.1% 99.1% 99.8% 105.9% Naproxen 121.6% 114.2% 106.5% 85.4% Indomethacin 120.6% 117.8% 114.5% 97.9% NS398 91.5% 80.7% 81.9% 61.3% Etodolac 105.1.% 106.7% 104.4% 95.1% LOX inhibitors Baicalein 102.4% 99.1% 85.3% 63.5% Caffeic acid 80.7% 69.2% 22.2% 8.1% NDGA 67.7% 42.3% 9.9% 5.2% PC3 COX inhibitors Ibupurofen 90.0% 86.2% 75.3% 62.9% Piroxicam 93.6% 87.4% 78.2% 64.3% Meloxicam 98.1% 97.9% 89.3% 67.4% Nimesulide 83.1% 91.5% 78.1% 94.1% Naproxen 87.4% 90.7% 94.7% 105.8% Indomethacin 95.1% 96.8% 86.6% 65.9% NS398 88.9% 77.5% 67.1% 58.1% Etodolac 93.6% 88.3% 89.1% 77.5% LOX inhibitors Baicalein 117.8% 100.2% 103.8% 76.5% Caffeic acid 112.5% 96.7% 78.8% 45.3% NDGA 113.0% 101.7% 51.1% 18.5% Normal prostate stromal cell COX inhibitors Ibupurofen 97.6% 95.6% 92.3% 81.7% Piroxicam 99.5% 105.1% 98.3% 108.1% Meloxicam 115.3% 97.0% 103.6% 108.7% Nimesulide 96.1% 95.1% 99.6% 103.3% Naproxen 95.2% 94.9% 94.6% 107.7% Indomethacin 98.4% 116.5% 118.1% 113.4% NS398 106.0% 92.1% 90.5% 90.3% Etodolac 101.0% 104.1% 104.8% 98.6% LOX inhibitors Baicalein 97.2% 84.8% 87.0% 81.6% Caffeic acid 89.7% 80.1% 81.8% 84.1% NDGA 107.3% 86.9% 88.6% 80.7% The dose-response analysis of viability in human prostate cancer and normal prostate stromal cells treated with COX and LOX inhibitors (10-80 μM, 48 hr) was measured by the MTT assay and expressed as% of control culture conditions. 146 Matsuyama and Yoshimura Drug Target Insights 2008:3 the range of 10–80 μM. Although the effect of non-specifi c LOX inhibitor was strongest, the effect of 5-LOX inhibitor was stronger than that of 12-LOX inhibitor. No LOX inhibitors had any effect on normal bladder cells proliferation. PC cell line Similar to RCC and BT cells, LOX inhibitors induced a reduction of cell viability with the half-maximal concentration of growth inhibition of PC cells in the range of 10–80 μM. Although the effect of non- specifi c LOX inhibitor was strongest, the effect of 5-LOX inhibitor was stronger than that of 12-LOX inhibitor. No LOX inhibitors had any effect on nor- mal prostate stromal cells proliferation (Table 2). TC cell line Similar to RCC, BT and PC cells, LOX inhibitors induced a reduction of cell viability with the half- maximal concentration of growth inhibition of TC cells in the range of 10–80 μM. Although the effect of non-specifi c LOX inhibitor was strongest, the effect of 5-LOX inhibitor was stronger than that of 12-LOX inhibitor. 3) Apoptosis effect of LOX inhibitor a) Flow cytometry RCC cell line RCC cells treated with 100 μM 5-LOX inhibitor could induce early apoptosis, not late apoptosis or necrosis and DNA fragmentation. However, treated with 100 μM 5-LOX inhibitor did not induce apoptosis in normal proximal tubular endothelial cellss (PRTEC). Diagram of FITC- Annexin V/PI fl ow cytometry (Fig. 4) and typical fl ow cytometry analysis histogram are presented (Fig. 5). BT cell line Similar to RCC cells, BT cells treated with 100 μM 5-LOX inhibitor could induce early apoptosis, not late apoptosis or necrosis and DNA fragmentation. Figure 3. RT-PCR analysis of 5- and 12-lipoxygenase (LOX) in bladder tumor (BT) cell line and normal bladder (NB) cell line. Using specifi c primers for 5- and 12-LOX, the amplifi cation predicted fragments of 337 bp for 5-LOX and 345 bp for 12-LOX in length. A; 5-LOX, B; 12-LOX. Lane 1; NB cells, Lane 2; BT cells. BT cells expressed signifi cant 5- and 12-LOX mRNA bands while NB cells expressed no 5- and 12-LOX mRNA bands. Table 2. Statistical analysis of 5- and 12-LOX immunostaining. Av. ± SD Tumor type Epithelium Blood vessel 5-LOX immunostaining Seminoma 2.3 ± 0.8* 1.9 ± 0.7* Embryonal carcinoma 2.8 ± 0.8* 2.3 ± 0.7* Yolk sac tumor 1.6 ± 0.6* 1.4 ± 0.6* Choriocarcinoma 2.4 ± 0.6* 1.9 ± 0.5* Teratoma 2.5 ± 0.7* 2.0 ± 0.6* Normal testis 0.9 ± 0.5 0.7 ± 0.5 12-LOX immunostaining Seminoma 2.0 ± 0.8* 1.6 ± 0.8* Embryonal carcinoma 2.4 ± 0.6* 1.9 ± 0.9* Yolk sac tumor 1.3 ± 0.5* 1.2 ± 0.6* Choriocarcinoma 2.1 ± 0.7* 1.7 ± 0.5* Teratoma 2.3 ± 0.8* 1.9 ± 0.7* Normal testis 0.9 ± 0.5 0.6 ± 0.4 Note: Graded 0 to 4 on the coded sections by two observers in a blinded manner. 0, no staining; 4, maximum intensity. Statistical analysis was performed using the analysis of variance (P value; ANOVA). 5-and 12-LOX immunostaining were more intense and diffuse in testicular tumor tissues than in the normal testicular tissues. p � 0.001. A B 147 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 PC cell line Similar to RCC and BT cells, PC cells treated with 100 μM 5-LOX inhibitor could induce early apoptosis, not late apoptosis or necrosis and DNA fragmentation. TC cell line Similar to RCC, BT and PC cells, TC cells treated with 100 μM 5-LOX inhibitor could induce early apoptosis, not late apoptosis or necrosis and DNA fragmentation. 2) Hoechest staining RCC cell line RCC cells treated with 50 μM 5-LOX inhibitors caffeic acid, and non-specifi c LOX inhibitor NDGA showed chromatin condensation, cellular shrinkage, small membrane-bound bodies (apoptotic bodies), and cytoplasmic condensation. Cells with 12-LOX inhibitor baicalein showed the same apoptotic changes slightly. In contrast, untreated cells main- tained normal chromatin patterns and cell size. Caki-1 PRTEC A nn ex in -V -F IT C A nn ex in -V -F IT C A nn ex in -V -F IT C A nn ex in -V -F IT C 99.5 % 74.2 % 25.8 % Control Control 100μM 5-LOX inhibitor 100μM 5-LOX inhibitor 99.6 % 95.9 %PI PI PI PI 4.1 %0.4 % 0.5 % Figure 4. Effects of 5-lipoxygenase (LOX) inhibitor on early and late apoptosis as shown by fl ow cytometry on human renal cell carcinoma (RCC) cells. Treatment with 100 μM 5-LOX inhibitor induced early apoptosis in most of the total percentage of RCC cells. However, treatment with 100μM 5-LOX inhibitor did not induce apoptosis in normal proximal tubular endothelial cells (PRTEC). The top left quadrants represent early apoptosis (Annexin V-FITC-positive cells and PI-negative cells). The top right quadrants represent late necrosis and necrosis (Annexin V-FITC-positive cells and PI-positive cells). Diagram of FITC-Annexin V/PI fl ow cytometry in a repre- sentative experiment are presented. 148 Matsuyama and Yoshimura Drug Target Insights 2008:3 BT cell line Similar to RCC cells, BT cells treated with 50 μM 5-LOX inhibitors caffeic acid (B), and non-specifi c LOX inhibitor NDGA (D) showed chromatin condensation, cellular shrinkage, apoptotic bodies, and cytoplasmic condensation. Cells with 12-LOX inhib- itor baicalein (C) showed the same apoptotic changes slightly. In contrast, untreated cells maintained normal chromatin patterns and cell size (A) (Fig. 6). PC cell line Similar to RCC and BT cells, PC cells treated with 50 μM 5-LOX inhibitors caffeic acid, and non- specifi c LOX inhibitor NDGA showed chromatin condensation, cellular shrinkage, apoptotic bodies, and cytoplasmic condensation. Cells with 12-LOX inhibitor baicalein showed the same apoptotic changes slightly. In contrast, untreated cells main- tained normal chromatin patterns and cell size. TC cell line Similar to RCC, BT and PC cells, TC cells treated with 50 μM 5-LOX inhibitors caffeic acid, and non-specific LOX inhibitor NDGA showed chromatin condensation, cellular shrinkage, apoptotic bodies, and cytoplasmic condensation. Cells with 12-LOX inhibitor baicalein showed the same apoptotic changes slightly. In contrast, untreated cells maintained normal chromatin pat- terns and cell size. Discussion With recent increases in routine medical check-ups and progress in diagnostic imaging techniques, the discoveries of RCC have risen. The cause of RCC is unknown. RCC generally does not respond well to radiotherapy and chemotherapy compared to many other types of cancers, and anticancer drugs as interleukin-2 is used with relative success. Surgery is currently the only therapeutic option. Hence, new molecular targets are needed for the treatment and prevention of RCC. The natural history of BT is not well understood, but exposure to carcinogens, including aromatic amines, is considered a major risk factors for the development of BT. Workers exposed to aromatic Caki-1 1.2 % 75.9 % dUTP FITC dUTP FITC Control 100μM 5-LOX inhibitor dUTP FITC dUTP FITC Control 100μM 5-LOX inhibitor PRTEC 1.6 % 11.5 % Figure 5. 5-lipoxygenase induced DNA fragmentation in human renal cell carcinoma (RCC) cells. Treatment with 100 μM 5-LOX inhibitor induced DNA fragmentation in RCC cells. However, treatment with 100μM 5-LOX inhibitor did not induce DNA fragmentation in normal proximal tubular endothelial cells (PRTEC). Typical fl ow cytometry analysis histogram in representative experiment are presented. 149 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 amines frequently have a mutated p53 gene, a tumor suppressor gene involved in the carcinogen- esis of many tumors. PC comprises 32% of all cancers in American men and is on the rise worldwide. Because of increased screening, PC is frequently diagnosed at a clinically localized stage, making it amenable to the therapy. Nevertheless, it remains the second most common cause of cancer death in men. These patients generally respond to androgen deprivation therapy, but the vast majority eventually experience disease progression and become refractory to sus- tained hormonal manipulation. Typically, such patients progress with a rise in their serum prostate- specific antigen level. Unfortunately, standard therapeutic options at this stage of disease are lim- ited, and while there has been some success with chemotherapy for hormone-refractory PC patients, the response is generally short-lived [12]. TC is very rare with over 90% of all TC being germ cell tumors (seminoma and non-seminoma), and the remaining percentage non-germinal tumors. The survival rate of TC has improved in recent years, refl ecting the development and refi nement of effective combination chemotherapy. However, it is still necessary to improve the treatment of TC. Non-steroidal anti-inflammatory drugs (NSAIDs) have anti-tumor effects on human uro- logical tumors (RCC, BT, PC and TC) and have attracted a great deal of attention. The typical tar- get of NSAIDs is COX. In recent reports, a number of patients have had significantly low-risk of colorectal cancer while they continued using NSAIDs typifi ed by aspirin. Consequently, the suppression of carcinogenesis by administering NSAIDs has come into focus. It was also reported that the size and number of adenoma were mark- edly reduced when sulindac which is a type of NSAIDs was given to patients with the familial adenomatous polyposis, a high risk group for colorectal cancer [13]. A B C D Figure 6. Effects of lipoxygenase (LOX) inhibitor in induction of apoptosis on human bladder tumor (BT) cells. BT cells treated with 5-LOX inhibitors caffeic acid (B), and non-specifi c LOX inhibitor NDGA (D) showed chromatin condensation, cellular shrinkage, small mem- brane-bound bodies (apoptotic bodies), and cytoplasmic condensation. Cells with 12-LOX inhibitor baicalein showed the same apoptotic changes slightly (C). In contrast, untreated cells (A) maintained normal chromatin patterns and cell size. 150 Matsuyama and Yoshimura Drug Target Insights 2008:3 Regarding COX-2 in RCC, BT and PC, COX-2 expression in malignant tissues was stronger than that in normal tissues using immunohistochemical staining and RT-PCR [9, 14, 15]. Both COX-1 and COX-2 expressions in all tissue types of TC were stronger than those in normal tissues using immunohistochemical stain- ing and RT-PCR [16]. Both COX-1 and COX-2 expressions appeared stronger in all tissue types of TC possibly due to the amount of PG increased in TC. Evidence revealed the PG quantity increased in breast cancer tissue compared to normal breast tissue and the expression of both COX-1 and COX-2 increased [17]. Many publications have reported COX-2 expression in malignant tissue was stronger than in normal tissue, and COX-2 expression in malig- nant tissue was stronger than COX-1 expression in malignant tissue. However, the correlation between the grade or stage, and COX-2 expression can be argued. Although many papers have reported NSAIDs produce anti-tumor effects, our studies confi rmed that eight kinds of COX inhibitors were unable to induce reduction of the viability in human uro- logical tumors cells in the range of 10–80 μM by MTT assay [18]. Our results suggest COX-2 expression is strong in treating urological tumors, but the antitumor effect of COX inhibitor (including COX-2 inhibitor) is very weak in urological tumor patients in a single administration at a clinical dose. COX-2 inhibitor is suitable for chemopreventive therapy. Regarding 5- and 12-LOX in urological tumors, 5- and 12-LOX expressions in malignant tissues were stronger than those in normal tissues using immunohistochemical staining and RT-PCR [8, 19–21]. Similar to COX-2, the correlation between the grade or stage, and LOX expression can be argued. Furthermore, LOX inhibitor (particularly 5-LOX inhibitor) could induce reduction of the viability in human urological tumors cells in the range of 10–80 μM by MTT assay. The effect of 5-LOX inhibitor was stronger than that of 12-LOX inhibitor [22]. Furthermore, urological tumors cells treated with 5-LOX inhibitor could induce early apoptosis and DNA fragmantation in urological tumors cells using fl ow cytometry and hoechest staining. Several papers have reported LOX inhibitors to be targets for development of new chemopreventive or chemotherapeutic strategies for PC. Ghosh J et al. reported that inhibition of arachidonate 5-LOX triggers massive apoptosis in both androgen-sensitive (LNCaP) and androgen- refractory (PC3) human PC cells [23]. Further- more, Ghosh J also reported the metabolites of arachidonate 5-LOX promoted survival of PC cells involving down-regulation of stress-activated protein kinase [24]. Pommery N et al. reported dual COX-2/5-LOX inhibitors induced agents poten- tially useful in PC chemotherapy through apopto- sis [25]. Ghosh J also reported the combination of selenium and 5-LOX inhibitors may be a more effective regimen for PC control [26]. Research strongly suggests LOX expression is strong in urological tumors, but the anti-tumor effect of 5-LOX inhibitor is weak in urological tumor patients receiving a single administration at a clinical dose. 5-LOX inhibitor is suitable as a chemo-preventive therapy. In conclusion, it is clear that COX-2 and LOX (particularly 5-LOX) are involved in the initiation and promotion of urological tumor tissues. It may be possible to use COX-2 and LOX inhibitors as anti-tumor drugs from the viewpoint of preventing cancer. However, it may be diffi cult to use the COX-2 inhibitor or 5-LOX inhibitor at the clinical dose with expectation of a suppressive effect on the cancer. Although the clinical application of 5-LOX inhibitor requires further research and consideration, the target of 5-LOX is a novel strat- egy in the treatment of human urological tumors. Acknowledements This manuscript was edited by Hilah Edney, BS, MS. References [1] Weidner, N., Folkman, J., Pozza, F., Bevilaqua, P., Allred, E.N. and Moore, D.H. 1992. Tumor angiogenesis: a new signifi cant and inde- pendent prognostic indicator in early stage brest carcinoma. J. Nalt. Cancer Inst., 84:1875–87. [2] Lafyatis, R., Thompson, N.L., Remmers, E.F., Flanders, K.C., Roche, N.S. and Kim, S.J. 1989. Transforming growth factor-beta production by synovial tissues from rheumatoid patients and strep- tococcal cell wall arthritic rats. Studies on secretion by synovial fi broblast-like cells and immunohistologic localization. J. Immunol., 143:1142–8. [3] Xie, W., Chipman, J.G., Robertson, D.L., Erikson, R.L. and Simmons, D.L. 1991. Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing. Proc. Natl. Acad. Sci. U.S.A., 88:2692–6. [4] Matsuyama, M. and Yoshimura, R. 2004. Relationship between cyclooxygenase (COX)-2 and malignant tumors. Recent Res. Devel. Cancer., 6:243–51. 151 5-lipoxygenase in urological tumor Drug Target Insights 2008:3 [5] Sigal, E. 1991. The molecular biology of mammalian arachidonic acid metabolism. Am. J. Physiol., 260:13–28. [6] Funk, C.D. 1996. The molecular biology of mammalian lipoxygenases and the quest for eicosanoid functions using lipoxygenase-defi cient mice. Biochim. Biophys. Acta., 11:65–84. [7] Matsuyama, M., Hayama, T., Funao, K., Kawahito, Y., Sano, H., Takemoto, Y., Nakatani, T. and Yoshimura, R. 2007. Overexpression of cysteinylLT1 receptor in prostate cancer and CysLT1R antagonist inhibits prostate cancer cell growth through apoptosis. Oncol. Rep., 18:99–104. [8] Yoshimura, R., Matsuyama, M., Tsuchida, K., Kawahito, Y., Sano, H. and Nakatani, T. 2003. Expression of lipoxygenase in human blad- der carcinoma and growth inhibition by its inhibitors. J. Urol., 170:1994–9. [9] Yoshimura, R., Sano, H., Masuda, C., Kawamura, M., Tsubouchi, Y., Chargui, J., Yoshimura, N., Hla, T. and Wada, S. 2000. Expression of cyclooxygenase-2 in prostate carcinoma. Cancer, 89:589–96. [10] Fitzgerald, S.M. and Flinn, S. 2000. Evaluating research studies using the analysis of variance (ANOVA): issues and interpretations. J. Hand. Ther., 13:56–60. [11] Kawahito, Y., Sano, H., Mukai, S., Asai, K., Kimura, S., Yamamura, S., Kato, H., Chrousos, G.P., Wilder, R.L. and Kondo, M. 1995. Corticotoropin-releasing hormone in colonic mucosa in patients with ulcerative colitis. Gut, 37:544–51. [12] Oh, W.K. and Kantoff, P.W. 1998. Management of hormone refractory prostate cancer: current standards and future prospects. J. Urol, 160:1220–9. [13] Sano, H., Kawahito, Y., Wilder, R.L., Hashiramoto, A., Mukai, S., Asai, K., Kimura, S., Kato, H., Kondo, M. and Hla, T. 1995. Expression of cyclooxygenase-1 and -2 in human colorectal cancer. Cancer Res., 55:3785–9. [14] Yoshimura, R., Matsuyama, M., Kawahito, Y., Tsuchida, K., Kuratsukuri, K., Takemoto, Y., Mitsuhashi, M., Sano, Y. and Nakatani, T. 2004. Stydy of cyclooxygenase-2 in renal cell carcinoma. Int. J. Mol. Med., 13:229–33. [15] Yoshimura, R., Sano, H., Mitsuhashi, M., Kohno, M., Chargui, J. and Wada, S. 2001. Expression of cyclooxygenase-2 in patients with bladder carcinoma. J. Urol., 165:1468–72. [16] Hase, T., Yoshimura, R., Matsuyama, M., Kawahito, Y., Wada, S., Tsuchida, K., Sano, H. and Nakatani, T. 2003. Cyclooxygenase-1 and -2 in human testicular tumours. Eur. J. Cancer, 39:2043–9. [17] Hwang, D., Scollard, D., Byrne, J. and Levine, E. 1998. Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J. Natl. Cancer Inst., 90:455–60. [18] Yoshimura, R., Matsuyama, M., Kawahito, Y., Takemoto, Y., Tsuchida, K., Kuratsukuri, K., Segawa, Y., Sinnka, T., Sano, Y. and Nakatani, T. 2004. The effect of cyclooxygenase-2 inhibitors on urological cancer cells. Int. J. Mol. Med., 13:789–93. [19] Matsuyama, M., Yoshimura, R., Mitsuhashi, M., Tsuchida, K., Takemoto, Y., Kawahito, Y., Sano, H. and Nakatani, T. 2005. 5-lipoxygenase inhibitors attenuate growth of human renal cell carcinoma and induce apoptosis through arachidonic acid pathway. Oncol. Rep., 14:73–9. [20] Matsuyama, M., Yoshimura, R., Mitsuhashi, M., Hase, T., Tsuchida, K., Takemoto, Y., Kawahito, Y., Sano, H. and Nakatani, T. 2004. Expression of lipoxygenase in human prostate cancer and growth reduction by its inhibitors. Int. J. Oncol., 24:821–7. [21] Yoshimura, R., Matsuyama, M., Mitsuhashi, M., Takemoto, Y., Tsuchida, K., Kawahito, Y., Sano, H. and Nakatani, T. 2004. Relationship between lipoxygenase and human testicular cancer. Int. J. Mol. Med., 13:389–93. [22] Matsuyama, M., Yoshimuira, R., Tsuchida, K., Takemoto, Y., Segawa, Y., Shinnka, T., Kawahito, Y., Sano, H. and Nakatani, T. 2004. Lipoxygenase inhibitors prevent urological cancer cell growth. Int. J. Mol. Med., 13:665–8. [23] Ghosh, J. and Myers, C.E. 1998. Inhibition of arachidonate 5-lipoxygenase triggers massive apoptosis in human prostate cancer cells. Proc. Natl. Acad. Sci. U.S.A., 95:13182–7. [24] Ghosh, J. 2003. Inhibition of arachidonate 5-lipoxygenase triggers prostate cancer cell death through rapid activation of c-Jun N-terminal kinase. Biochem. Biophys. Res. Commun., 307:342–9. [25] Pommery, N., Taverne, T., Telliez, A., Goossens, L., Charlier, C., Pommery, J., Goossens, J.F., Houssin, R., Durant, F. and Henichart, J.P. 2004. New COX-2/5-LOX inhibitors: apoptosis-inducing agents potentially useful in prostate cancer chemotherapy. J. Med. Chem., 47:6195–206. [26] Ghosh, J. 2004. Rapid induction of apoptosis in prostate cancer cells by selenium: reversal by metabolites of arachidonate 5-lipoxygenase. Biochem. Biophys. Res. Commun., 315:624–35. << /ASCII85EncodePages false /AllowTransparency false /AutoPositionEPSFiles true /AutoRotatePages /None /Binding /Left /CalGrayProfile (Dot Gain 20%) /CalRGBProfile (sRGB IEC61966-2.1) /CalCMYKProfile (U.S. Web Coated \050SWOP\051 v2) /sRGBProfile (sRGB IEC61966-2.1) /CannotEmbedFontPolicy /Error /CompatibilityLevel 1.4 /CompressObjects /Tags /CompressPages true /ConvertImagesToIndexed true /PassThroughJPEGImages true /CreateJDFFile false /CreateJobTicket false /DefaultRenderingIntent /Default /DetectBlends true /DetectCurves 0.1000 /ColorConversionStrategy /LeaveColorUnchanged /DoThumbnails false /EmbedAllFonts true /EmbedOpenType false /ParseICCProfilesInComments true /EmbedJobOptions true /DSCReportingLevel 0 /EmitDSCWarnings false /EndPage -1 /ImageMemory 1048576 /LockDistillerParams false /MaxSubsetPct 100 /Optimize true /OPM 1 /ParseDSCComments true /ParseDSCCommentsForDocInfo true /PreserveCopyPage true /PreserveDICMYKValues true /PreserveEPSInfo true /PreserveFlatness true /PreserveHalftoneInfo false /PreserveOPIComments false /PreserveOverprintSettings true /StartPage 1 /SubsetFonts true /TransferFunctionInfo /Apply /UCRandBGInfo /Preserve /UsePrologue false /ColorSettingsFile () /AlwaysEmbed [ true ] /NeverEmbed [ true ] /AntiAliasColorImages false /CropColorImages true /ColorImageMinResolution 150 /ColorImageMinResolutionPolicy /OK /DownsampleColorImages true /ColorImageDownsampleType /Bicubic /ColorImageResolution 300 /ColorImageDepth -1 /ColorImageMinDownsampleDepth 1 /ColorImageDownsampleThreshold 1.50000 /EncodeColorImages true /ColorImageFilter /DCTEncode /AutoFilterColorImages true /ColorImageAutoFilterStrategy /JPEG /ColorACSImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /ColorImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /JPEG2000ColorACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /JPEG2000ColorImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 150 /GrayImageMinResolutionPolicy /OK /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /GrayImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /JPEG2000GrayACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /JPEG2000GrayImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 1200 /MonoImageMinResolutionPolicy /OK /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 1200 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict << /K -1 >> /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile () /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName (http://www.color.org) /PDFXTrapped /Unknown /Description << /JPN /FRA /DEU /PTB /DAN /NLD /ESP /SUO /ITA /NOR /SVE /ENU >> >> setdistillerparams << /HWResolution [2400 2400] /PageSize [612.000 792.000] >> setpagedevice