31Drug TargeT InsIghTs 2014:8 Open Access: Full open access to this and thousands of other papers at http://www.la-press.com. Drug Target Insights Molecular and Kinetic Characterization of Babesia microti Gray Strain Lactate Dehydrogenase as a Potential Drug Target Patrick Vudriko1,2, Tatsunori Masatani1, shinuo Cao1, Mohamad alla Terkawi1, Ketsarin Kamyingkird1, ahmed a. Mousa1, Paul F. adjou Moumouni1, Yoshifumi nishikawa1 and Xuenan Xuan1 1National Research Center for Protozoan Diseases (NRCPD), Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido, Japan. 2Department of Veterinary Pharmacy, Clinics and Comparative Medicine, College of Veterinary Medicine, Animal Resources and Biosecurity, Makerere University, Kampala, Uganda. ABSTR ACT: Babesia microti is an emerging zoonotic protozoan organism that causes “malaria-like” symptoms that can be fatal in immunocompromised people. Owing to lack of specific therapeutic regiment against the disease, we cloned and characterized B. microti lactate dehydrogenase (BmLDH) as a potential molecular drug receptor. The in vitro kinetic properties of BmLDH enzyme was evaluated using nicotinamide adenine dinucleotide (NAD+) as a co-factor and lactate as a substrate. Inhibitory assay was also done using gossypol as BmLDH inhibitor to determine the inhibitory concentration 50 (IC50). The result showed that the 0.99 kbp BmLDH gene codes for a barely soluble 36 kDa protein (332 amino acids) localized in both the cytoplasm and nucleus of the parasite. In vitro enzyme kinetic studies further revealed that BmLDH is an active enzyme with a high catalytic efficiency at optimal pH of 10.2. The Km values of NAD+ and lactate were 8.7 ± 0.57 mM and 99.9 ± 22.33 mM, respectively. The IC50 value for gossypol was 0.345 µM, while at 2.5 µM, gossypol caused 100% inhibition of BmLDH catalytic activity. These findings, therefore, provide initial evidence that BmLDH could be a potential drug target, although further in vivo studies are needed to validate the practical application of lactate dehydrogenase inhibitors against B. microti infection. KEY WORDS: Babesia microti Gray, lactate dehydrogenenase, drug target, gossypol CITATION: Vudriko et al. Molecular and Kinetic Characterization of Babesia microti gray strain Lactate Dehydrogenase as a Potential Drug Target. Drug Target Insights 2014:8 31–38 doi:10.4137/DTI.s16504. RECEIVED: april 27, 2014. RESUBMITTED: May 27, 2014. ACCEPTED FOR PUBLICATION: June 3, 2014. ACADEMIC EDITOR: anuj Chauhan, editor in Chief TYPE: Original research FUNDING: This study was supported by Japanese International Cooperation agency (JICa). COMPETING INTERESTS: Authors disclose no potential conflicts of interest. COPYRIGHT: © the authors, publisher and licensee Libertas academica Limited. This is an open-access article distributed under the terms of the Creative Commons CC-BY-nC 3.0 License. CORRESPONDENCE: vpato@covab.mak.ac.ug; gen@obihiro.ac.jp This paper was subject to independent, expert peer review by a minimum of two blind peer reviewers. all editorial decisions were made by the independent academic editor. all authors have provided signed confirmation of their compliance with ethical and legal obligations including (but not limited to) use of any copyrighted material, compliance with ICMJE authorship and competing interests disclosure guidelines and, where applicable, compliance with legal and ethical guidelines on human and animal research participants. Introduction Babesia microti is a protozoan organism (Piroplasmida: Api- complexa) that infects mainly rodents and humans.1 Through phylogenetic investigations,2 B. microti has been classified into four subtypes, namely US (R1 and Gray strains), Munich, Kobe, and Hobetsu. Recent studies suggest that B. microti has a wide distribution of wild reservoirs in the United States of America3 and northeastern Eurasia.4 The emerging zoonotic importance of B. microti has been widely reported.5–7 The organism has been implicated as a major concern for the safety of blood transfusion supply in USA.8,9 Human co-infection of patients with both B. microti and other zoonotic tick-borne hemoparasites has been reported.10 Moreover, the parasite causes “malaria-like” symptoms in immunocompetent indi- viduals and can potentially lead to fatal relapsing illness in immunocompromised patients.11 The importance of B. microti as an emerging zoonotic disease has created an urgent need for innovation of effective chemotherapeutic agents for its treatment. A combination of atovaquone and azithromycin as well as clindamycin and qui- nine were reported as effective against B. microti.12 However, recrudescence and resistance against atovaquone and lack of http://www.la-press.com http://www.la-press.com http://www.la-press.com/drug-target-insights-journal-j23 http://dx.doi.org/10.4137/DTI.S16504 http://creativecommons.org/licenses/by-nc/3.0/ http://creativecommons.org/licenses/by-nc/3.0/ mailto:vpato@covab.mak.ac.ug mailto:gen@obihiro.ac.jp Vudriko et al 32 Drug TargeT InsIghTs 2014:8 enzymes involved in heme metabolism limits the use of atova- quone and quinoline-derived drugs such as quinine and chlo- roquine in the treatment of B. microti infections.13,14 Lactate dehydrogenase (LDH) is one of the apicom- plexan glycolytic enzymes that catalyze interconversion of pyruvate to lactate.15 The enzyme plays indispensable role in apicomplexan energy metabolism using NAD+ as a co- factor under anaerobic conditions.16 The resultant energy generated is used by parasites for their biochemical processes and sur- vival. Available reports indicate that the enzyme is a novel drug target in Plasmodium spp, Toxoplasma gondii, Theileria annulata, and Babesia bovis.15,17–19 For this reason, there is a growing momentum in the synthesis of new LDH inhibitors as potential drugs against the above organisms.20 However, to the best of our knowledge, there is still paucity of scientific evidence on the suitability of B. microti LDH as a potential drug target. Therefore, the aim of the current study was to clone B. microti lactate dehydrogenase (BmLDH), charac- terize the protein, and evaluate its in vitro kinetic properties with the view of assessing its potential as a novel drug target against B. microti infection. Materials and Method Ethics. Ethical clearance (approval No. 250035) was sought and obtained in accordance with the provision of Arti- cle 32-1 of the Regulation of Animal Experiment of Obihiro University of Agriculture and Veterinary Medicine, Japan. Polymerase chain reaction (PCR), cloning and sequencing. The purified genomic DNA of human isolate of B. microti Gray strain (US type, culture collection catalog No. 30221) was used as template.21 Oligo nucleotide prim- ers with BamHI restriction site at the forward (5′-CCTCG- GATCCCATTCGTTAAAAGAAGA ATTTC-3′) and XhoI site at the reverse (5′-GGGGCTCGAGTTATAGTTG- GATATCTTTCTGTG-3′) were designed from B. microti strain R1 LDH gene sequence obtained from GenBank (Accession No. CCF72479).14 Thermocycling was done in a 50 µL reaction volume containing 10 ng genomic DNA, 20 pg primers, 0.2  µM dNTP (Takara, Japan), and 2.5  U ExTaq polymerase (Takara, Japan). The PCR condition included two minutes denaturation followed by 30 cycles of 98°C for 10 seconds, 55°C for 30 seconds, 68°C for 50 seconds, and fur- ther extension at 72°C for five minutes. The resultant poly- merase chain reaction (PCR) product was electrophoresed, stained with ethidium, and viewed under UV transillumina- tor. The BmLDH amplicon was extracted and purified from the gel using QIAquick Gel extraction kit (Qiagen, Germany) according to the manufacturer’s instruction. The purified BmLDH was cloned into pGEM-T Easy Vector (Promega, USA) and transformed into competent Escherichia coli DH5α (Invitrogen). The resultant pGEM-T Easy-BmLDH was purified using NucleoSpin® Plasmid kit according to the manufacturer’s (Macherey-Nagel, Germany) instruction. Sequencing was carried out using M13 forward 5′-TGTA- AAACGACGGCCAGT-3′) and reverse (5′-CAGGAAA- CAGCTATGACC-3′) primers with automated sequencer (ABI Prism 3100 Genetic Analyzer, USA). Expression and purification of recombinant BmLDH in E. coli BL21. Both BmLDH PCR product and pGEX- 6P-1 expression vector were double digested with BamHI (Roche, Germany) and XhoI (Roche) restriction enzymes. The digested BmLDH and pGEX-6P-1 were ligated and trans- formed into competent E. coli BL21 (Invitrogen, Japan). The nucleotide sequence of the cloned BmLDH was confirmed using pGEX-6P-1 forward and reverse sequencing primers with automated sequencer (ABI Prism 3100 Genetic Ana- lyzer, USA). The recombinant BmLDH was expressed in E. coli BL21 as glutathione S-transferase fusion protein. The soluble frac- tion of the recombinant protein was purified as previously described21 with minor modifications. PreScission™ Protease (GE Healthcare, Sweden) was used to cleave BmLDH from Glutathione-Sepharose™ 4B beads to yield GST-free BmLH for enzyme kinetic assay. The purity and concentration of the purified protein were determined using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Lowry protein assay kit (Thermo Scientific, USA). Production of anti-BmLDH sera. One milliliter of the recombinant BmLDH (220 µg/mL) was mixed with 1 mL of complete Freund’s adjuvant (CFA) in sterile syringe as pre- viously described.22 Five BALB/c mice (10 weeks old) were immunized with 33 ng of BmLDH through the intra-perito- neal route. Three booster doses of 15 days apart were adminis- tered, and sera were collected 10 days after the last dose. Infection of hamsters with B. microti Gray strain, par- asite lysate, and Western blotting. Four female (8 weeks old) specific pathogen-free (SPF) Syrian hamsters (SLC, Japan) were used in this experiment. Prior to parasite inoculation, SPF sera were obtained from all the hamsters. Two hamsters were inoculated with previously stocked B. microti-infected hamster RBC intra-peritoneally as previously described.23 Observation of parasitemia was done every 2 days by microscopy. At peak (51%) parasitemia (day 13 and 14), the hamsters were sacri- ficed, and blood was obtained for collection of infected sera and preparation of parasite lysate. Parasite and non-infected RBC lysates were prepared as previously described.24 Transfer of the protein from the gel to Western blot membrane was carried out as previously described.21 However, the BmLDH polyclonal sera was diluted at 1:250, and the antibody solution was diluted at 1:2,000. The native BmLDH was detected with color development solution containing 3,3′-diaminobenzidine tetrahydrochloride (DAB) and hydrogen peroxide. Native protein localization by indirect florescent anti- body test (IFAT) and confocal laser microscopy. This was carried out using B. microti Gray strain-infected hamster blood smears (day 8 post-infection) as previously described.21 The secondary antibody was anti-mouse Alexa-488 secondary diluted 200 times with 4% fetal bovine serum (FBS), and the http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 33Drug TargeT InsIghTs 2014:8 parasite nucleus was stained with propidium iodide. Parasites were observed using confocal laser scanning microscope (Leicia, Japan). Enzyme kinetic assay. Optimization of pH and determination of Vmax and Km for lactate and NAD+. The method by Kavanagh and others was used with minor modifications.16 The oxidation of lactate to pyruvate and subsequent formation of NADH from NAD+ was assayed in 7 mM KCl and 70 mM Tris-HCl buffer. Opti- mal pH, Km, and Vmax were all determined using 0.5  µg of BmLDH. The amount of NADH produced was measured using DU® 800 spectrophotometer (Beckman Coulter Inc., Fullerton, CA, USA) at 340  nm (ε  =  6.2  mM-1  cm-1) and 25°C. Optimal pH for BmLDH catalytic activity was deter- mined using 3  mM NAD+ and 120  mM lactate in vary- ing pH (2–12.2) of the buffer. Initial velocities for the rate of formation of NADH in the first 60 seconds were calcu- lated, and relative percentage activity was determined. The Km and Vmax for NAD+ (co-factor) were determined in a 500 µL reaction volume containing the buffer, 100 mM lactate and 0.05–6.8 mM NAD+. Similarly, Km and Vmax for lactate were assayed in a solution containing the buffer, 2.4 mM NAD+ and 20–500 mM lactate. BmLDH inhibitory assay. This was carried out according to the methods reported by Bork and colleagues,19 with gos- sypol as an inhibitor. Briefly, a 400 mM gossypol stock solu- tion was prepared by dissolving gossypol in dimethyl sulfoxide (DMSO). The percentage inhibition of BmLDH was deter- mined at various concentration of gossypol (9.5–5,000 nM) at 1.2 and 30 mM of NAD+ and lactate, respectively. The final concentration of DMSO in each assay did not exceed 0.2%. The negative control contained 0.2% of DMSO. All the experiments were repeated three times, and the concentration of gossypol that inhibited NADH production by 50% (IC50) was calculated using non-linear regression with GraphPad prism (GraphPad Prism version 5.00 for Windows, GraphPad Software, USA). Bioinformatic analysis. The BmLDH nucleotide sequenc es of both pGEM-T Easy-BmLDH and pGEX-6P-1-BmLDH clones were edited using CodonCode Aligner version 1.5.2 (CodonCode Corporation, USA) and consensus sequence derived using Genetyx software (Genetyx Corporation, Japan). The consensus nucleotide sequences for full-length BmLDH were aligned using BLAST (http://blast.ncbi.nlm. nih.gov/) to determine the homology. Prediction of importin α-dependent nuclear localization signals was done using cyto- plasmic-nucleus localization signal predictor (cNLS) mapper so as to account for localization of the native protein based on its amino acid sequence (http://nls-mapper.iab.keio.ac.jp/cgi- bin/NLS_Mapper_form.cgi). Results Characterization of BmLDH gene. The amplified BmLDH gene was approximately 0.99  kbp. Nucleotide sequence analysis revealed that BmLDH gene has an open reading frame of 996 nucleotides that codes for 332 amino acids. There were no introns in the BmLDH DNA. Align- ment of the translated BmLDH amino acid sequence with that of related apicomplexan parasites and selected mamma- lian LDH gave contrasting result. The amino acid sequence for BmLDH was less than 28% identical to that of Plasmodium falciparum (Accession No. AAK12097), T. gondii (Accession No. XP_002368488), B. bovis (Accession No. EDO07479), and T. annulata (Accession No. ADG45564). However, there was high frequency of identical amino acid sequence between BmLDH and LDH mammals like hamster (70.3%, Acces- sion No. NP_001230979), mouse (69.1%, Accession No. CAA26360), and humans (61.9%, Accession No. CAE11711). Approximately 43 amino acid residues were highly conserved in all the eight LDH sequences aligned (Fig. 1). Characterization of expressed recombinant BmLDH protein. The recombinant GST-fussed BmLDH (GST- BmLDH) had a molecular weight of approximately 62 kDa (Fig. 2B, lane 4). Since the molecular weight of GST is 26 kDa, it is estimated that the molecular weight of BmLDH protein is 36 kDa. Over 70% of the recombinant protein was insoluble in water upon over expression in E. coli (Fig. 2A, lane 2). The average yield of the GST-BmLDH and GST-free BmLDH from the soluble fraction was approximately 200  µg/mL (Fig. 2B, lanes 4 and 5). Characterization of native BmLDH protein. Analy- sis of parasite lysate by Western blot method revealed a specific 36  kDa native BmLDH (Fig. 3, lane 1). No band appeared when mice SPF sera was used as control as shown in Figure 3, lane 2. The polyclonal antibody raised against recombinant BmLDH was able to detect the native BmLDH in infected RBCs by indirect IFAT. This was shown by specific green fluorescence observed in the cytoplasm and nucleus of B. microti merozoites (Fig. 4). The location of the green fluo- rescence in both the merozoite cytoplasm and nucleus is consistent with the finding from the cNLS mapper, which showed that BmLDH has both cytoplasmic and nucleus localization signal sequence from amino acid number 241–269 (EIIKLKGYTSWAIGLSVGDLSCSLIKNLR). BmLDH enzyme activity. Optimal pH, Vmax, and Km. The recombinant BmLDH protein is an active enzyme with a high catalytic efficiency at optimal pH of 10.2 (Fig. 5A). The Km values for NAD+ and lactate were 8.7  ±  0.57  mM and 99.9  ±  22.33  mM, respectively (Fig. 5B and C). BmLDH had very high cata- lytic activity for both NAD+ (6.3 × 105 minute-1) and lactate (7.3  ×  105 minute-1). Similarly, a catalytic efficiency of 5.126 × 108 M-1 minute-1 and 7.3003 × 106 M-1 minute-1 was recorded for NAD+ and lactate, respectively (Table 1). Inhibition of BmLDH by gossypol. Gossypol (NAD+ ana- log) caused over 20% inhibition of BmLDH catalytic activity at very low concentration of 9.5 nM. Moreover, 100% inhibi- tion of BmLDH enzyme activity was recorded when 2.5 µM http://www.la-press.com Vudriko et al 34 Drug TargeT InsIghTs 2014:8 Figure 1. Multiple amino acid sequence alignment and identity score between BmLDh and LDh for P. falciparum (PfLDh), B. bovis (BbLDh), T. gondii (TgLDh), T. annulata (TaLDh), Mus musculus (mouse LDh), Cricetulus griseus (hamster LDh), and human (H. sapiens LDh). M2 4 97 66 45 kD a kD a 30 14 5 62 kDa 36 kDa 2 3 50 37 25 20 15 250 M1 A B 1 75 Figure 2. sDs-Page (A) showing non-induced control (lane 1), expressed protein in pellet (lane 2), and supernatant/soluble fraction (lanes 3); sDs- Page (B) for purified GST-BmLDH protein (lanes 4) and PreScission™ Protease cleaved BmLDh (lane 5). http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 35Drug TargeT InsIghTs 2014:8 1 A B 2 3 Figure 4. (A) Cytoplasmic localization of BmLDh in merozoite; (B) nucleus localization of BmLDh; (1) Immunoflourescent staining of B. microti with polyclonal BmLDh and anti-mouse alexa-488; (2) B. microti merozoite nuclei stained with PI; and (3) merged image; scale bar is 5 and 2.5 µm for a and B, respectively. kDa M 1 2 97 66 45 36 kDa 30 14 Figure 3. Western blot lane M: molecular marker stained with amide black; lane 1 is 36 kDa native BmLDh in parasite lysate after probe with polyclonal sera raised against BmLDh; lane 2 is parasite lysate probed with sPF sera (negative control). of the inhibitor was added to the assay. The IC50 value for gos- sypol was 345.0 ± 1.11 nM (Fig. 5D). Discussion This study revealed that both B. microti Gray strain and R1 strain have identical LDH and share high frequency of iden- tical amino acid with their mammalian counterparts. This suggests that B. microti LDH was probably acquired through lateral gene transfer. This is possible because the chromosome on which the LDH gene is located is known to be suscep- tible to double-stranded breaks, hence suitable for insertion of foreign DNA.14 The acquired genetic sequence can often be modified by the parasite to suit its survival mechanism in the host.25 However, it is worth noting that despite the above sim- ilarity in amino acid sequence, BmLDH has different amino acid residues in its antigenic domains (Supplementary Table 1). This suggests that the host immune system can detect the antigenic epitopes of BmLDH and produce antibodies against them. Thus, explaining why anti-rBmLDH polyclonal sera raised in mice was able to detect native BmLDH by West- ern blot and IFAT. Confocal laser microscopy revealed that native BmLDH is dominantly localized in the cytoplasma, although cases of nuclear localization were also observed. The above finding agrees with previous reports that while LDH is dominantly expressed in the cytoplasm, it can be found in the nucleus.26,27 The role of LDH in the nucleus remains unclear but it is understood that their association with DNA may play a role in transcription and replication of DNA through general stabilization of the nuclear matrix or chromatin structure.27 The enzyme kinetic studies revealed that BmLDH has higher catalytic activity and efficiency. This finding is consis- tent with earlier report that B. microti depends extensively on glycolysis for its energy requirement, and BmLDH plays a key role.14 The high catalytic activity (high Kcat value) of BmLDH for lactate compared to B. bovis LDH, P. falciparum LDH, http://www.la-press.com Vudriko et al 36 Drug TargeT InsIghTs 2014:8 T. gondii, and human LDH further suggests that it could be a novel candidate for drug target.19,28–30 Indeed, BmLDH inhibitory assay showed that the IC50 value for gossypol (a competitive antagonist for NAD+) was 0.345 µM. At 2.5 µM, catalytic activity of BmLDH was completely inhibited. This finding is consistent with previous reports that LDH is a novel drug target against some protozoan parasites.15,17–19 Since B. microti lacks well-developed tricarboxylic acid cycle, we hypothesize that inhibition of glycolysis via BmLDH would lead to energy starvation and death of the parasite. How- ever, there is need for further research on in vivo efficacy of BmLDH inhibitors in B. microti-infected hamsters. Such a study would also generate important information on the safety of LDH inhibitor at therapeutic dose. While LDH plays a key role in glycolysis in mammalian red blood cells and muscles, suppression or deficiency of LDH causes benign conditions with no or minimum adverse effects.31,32 Merkle and others33 have also reported that up to 50% reduction of LDH-A activ- ity in mice produced no obvious harm. This probably explains why there is a growing momentum in the synthesis of new LDH inhibitors as potential drug against some protozoan organisms20 and their potential use as anti-tumor drugs.34,35 Conclusion This study revealed that BmLDH is a 36 kDa protein that has nucleoplasmin localization. The kinetic parameters of BmLD also suggest that the enzyme has a very high catalytic activity compared to other apicomplexan LDH; moreover, its activity can be inhibited at low concentration of NAD+ analog, gos- sypol. We therefore propose further studies to explore the in vivo efficacy of BmLH inhibitor in hamster model. Acknowledgment We acknowledge the technical contributions made by members of the Host defense, Babesia and Vaccine labo- ratories, National Research Center for Protozoan diseases (NRCPD), Obihiro University of Agriculture and Vet- erinary Medicine. The contributions offered by Dennis Table 1. Kinetic parameters for BmLDh. COFACTOR/SUBSTRATE Km (mM) Vmax (mM/MIN) Kcat (MIN-1) Kcat/Km (M-1 MIN-1) naD+ 8.76 ± 0.57 0.008765 ± 0.00057 6.31 × 105 5.126 × 108 Lactate 99.96 ± 22.33 0.01014 ± 0.00077 7.3 × 105 7.3003 × 106 Figure 5. (A) Effect of pH on catalytic efficiency of BmLDH. (B) Michaelis–Menten curve for naD+ (co-factor) at 100 mM lactate. (C) Michaelis–Menten curve for lactate (substrate) at 2.4 mM naD+. (D) non-linear regression curve for inhibition of BmLDh by gossypol. http://www.la-press.com Molecular and kinetic characterization of B. microti LDH 37Drug TargeT InsIghTs 2014:8 Muhanguzi, Maki Ishiwata, Miki-Araki, and Ken Saito are acknowledged. Author Contributions PV, TM, SC, MAT, AAM, KK, YN, and XX conceived and designed the experiments. PV, SC, TM, PFAM, and MAT analyzed the data. PV, SC, and XX wrote the first draft of the manuscript. PV, TM, SC, AAM, PFAM, KK, and XX contributed to the writing of the manuscript. PV, TM, SC, MAT, AAM, KK, PFAM, YN, and XX agree with manu- script results and conclusions. PV, SC, TM, and XX jointly developed the structure and arguments for the paper. MAT and XX made critical revisions and approved final version. All authors reviewed and approved the final manuscript. REFERENCES 1. Hunfeld KP, Hildebrandt A, Gray JS. Babesiosis: recent insights into an ancient disease. Int J Parasitol. 2008;38(11):1219–1237. 2. Nakajima R, Tsuji M, Oda K, et al. Babesia microti-group parasites compared phylogenetically by complete sequencing of the CCTeta gene in 36 isolates. J Vet Med Sci. 2009;71(1):55–68. 3. Hersh MH, Tibbetts M, Strauss M, Ostfeld RS, Keesing F. Reservoir competence of wildlife host species for Babesia microti. Emerg Infect Dis. 2012;18(12):1951. 4. Zamoto A, Tsuji M, Wei Q , et al. Epizootiologic survey for Babesia microti among small wild mammals in northeastern Eurasia and a geographic diversity in the beta-tubulin gene sequences. J Vet Med Sci. 2004;66(7):785–792. 5. Hildebrandt A, Hunfeld KP, Baier M, et al. First confirmed autochthonous case of human Babesia microti infection in Europe. Eur J Clin Microbiol Infect Dis. 2007; 26(8):595–601. 6. Gray J, Zintl A, Hildebrandt A, Hunfeld KP, Weiss L. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis. 2010;1(1):3–10. 7. Schnittger L, Rodriguez AE, Florin-Christensen M, et al. Babesia: a world emerging. Infect Genet Evol. 2012;12(8):1788–1809. 8. Gubernot DM, Lucey CT, Lee KC, Conley GB, Holness LG, Wise RP. Babesia infection through blood transfusions: reports received by the US food and drug administration, 1997–2007. Clin Infect Dis. 2009;48(1):25–30. 9. McQuiston J, Childs J, Chamberland M, et al. Transmission of tick-borne agents of disease by blood transfusion: a review of known and potential risks in the United States. Transfusion. 2000;40(3):274–284. 10. Sweeney CJ, Ghassemi M, Agger WA, Persing DH. Coinfection with Babesia microti and Borrelia burgdorferi in a western Wisconsin resident. Mayo Clin Proc. 1998;73(4):338–341. 11. Krause PJ, Gewurz BE, Hill D, et al. Persistent and relapsing babesiosis in immunocompromised patients. Clin Infect Dis. 2008;46(3):370–376. 12. Krause PJ, Lepore T, Sikand VK, et al. Atovaquone and azithromycin for the treatment of babesiosis. N Engl J Med. 2000;343(20):1454–1458. 13. Wittner M, Lederman J, Tanowitz HB, Rosenbaum GS, Weiss LM. Atova- quone in the treatment of Babesia microti infections in hamsters. Am J Trop Med Hyg. 1996;55(2):219–222. 14. Cornillot E, Hadj-Kaddour K, Dassouli A, et al. Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti. Nucleic Acids Res. 2012;40(18):9102–9114. 15. Al-Anouti F, Tomavo S, Parmley S, Ananvoranich S. The expression of lactate dehydrogenase is important for the cell cycle of Toxoplasma gondii. J Biol Chem. 2004;279(50):52300–52311. 16. Kavanagh KL, Elling RA, Wilson DK. Structure of Toxoplasma gondii LDH1: active-site differences from human lactate dehydrogenases and the structural basis for efficient APAD+ use. Biochemistry. 2004;43(4):879–889. 17. Gomez MS, Piper RC, Hunsaker LA, et al. Substrate and cofactor specificity and selective inhibition of lactate dehydrogenase from the malarial parasite P. falciparum. Mol Biochem Parasitol. 1997;90(1):235–246. 18. Penna-Coutinho J, Cortopassi WA, Oliveira AA, França TC, Krettli AU. Anti- malarial activity of potential inhibitors of Plasmodium falciparum lactate dehy- drogenase enzyme selected by docking studies. PLoS One. 2011;6(7):e21237. 19. Bork S, Okamura M, Boonchit S, Hirata H, Yokoyama N, Igarashi I. Identifica- tion of Babesia bovis l-lactate dehydrogenase as a potential chemotherapeutical target against bovine babesiosis. Mol Biochem Parasitol. 2004;136(2):165. 20. Granchi C, Roy S, Giacomelli C, et al. Discovery of N-hydroxyindole-based inhibitors of human lactate dehydrogenase isoform A (LDH-A) as starvation agents against cancer cells. J Med Chem. 2011;54(6):1599–1612. 21. Luo Y, Jia H, Terkawi MA, et al. Identification and characterization of a novel secreted antigen 1 of Babesia microti and evaluation of its potential use in enzyme-linked immunosorbent assay and immunochromatographic test. Parasi- tol. 2011;60(2):119–125. 22. Cao S, Luo Y, Aboge GO, et al. Identification and characterization of an inter- spersed repeat antigen of Babesia microti (BmIRA). Exp Parasitol. 2013;133(3): 346–352. 23. Luo Y, Terkawi MA, Jia H, et al. A double antibody sandwich enzyme-linked immunosorbent assay for detection of secreted antigen 1 of Babesia microti using hamster model. Exp Parasitol. 2012;130(2):178–182. 24. Terkawi MA, Aboge G, Jia H, et al. Molecular and immunological characteriza- tion of Babesia gibsoni and Babesia microti heat shock protein-70. Parasite Immu- nol. 2009;31(6):328–340. 25. de la Casa-Esperón E. Horizontal transfer and the evolution of host-pathogen interactions. Int J Evol Biol. 2012;2012:9. 26. Yhu S-K, Park H-S, Kim H-Y, et al. Expression of lactate dehydrogenase A-gene in regenerating rat liver. Arch Pharm Res. 1988;11(4):278–284. 27. Ronai Z. Glycolytic enzymes as DNA binding proteins. Int J Biochem. 1993;25(7): 1073–1076. 28. Shoemark DK, Cliff MJ, Sessions RB, Clarke AR. Enzymatic properties of the lactate dehydrogenase enzyme from Plasmodium falciparum. FEBS J. 2007;274(11):2738–2748. 29. Dando C, Schroeder ER, Hunsaker LA, et al. The kinetic properties and sen- sitivities to inhibitors of lactate dehydrogenases (LDH1 and LDH2) from Toxoplasma gondii: comparisons with pLDH from Plasmodium falciparum. Mol Biochem Parasitol. 2001;118(1):23–32. 30. Hewitt CO, Eszes CM, Sessions RB, et al. A general method for relieving sub- strate inhibition in lactate dehydrogenases. Protein Eng. 1999;12(6):491–496. 31. Xu L, Yang D, Wang S, et al. (-)-Gossypol enhances response to radiation ther- apy and results in tumor regression of human prostate cancer. Mol Cancer Ther. 2005;4(2):197–205. 32. Beutler E. Energy metabolism and maintenance of erythrocytes. Williams Hema- tology. 6th ed. Lichtman AM, editor New York: McGraw-Hill; 2001:319–332. 33. Merkle S, Favor J, Graw J, Hornhardt S, Pretsch W. Hereditary lactate dehydro- genase A subunit deficiency as cause of early postimplantation death of homozy- gotes in Mus musculus. Genetics. 1992;131(2):413–421. 34. Pelicano H, Martin DS, Xu RH, Huang P. Glycolysis inhibition for anticancer treatment. Oncogene. 2006;25(34):4633–4646. 35. Zhou M, Zhao Y, Ding Y, et al. Warburg effect in chemosensitivity: targeting lactate dehydrogenase-A re-sensitizes taxol-resistant cancer cells to taxol. Mol Cancer. 2010;9:33. http://www.la-press.com Vudriko et al 38 Drug TargeT InsIghTs 2014:8 Supplementary Data Supplementary Table 1. unique amino acid residues at antigenic domain of BmLDh compared to other apicomplexan parasites and mammalian LDh. LDH FOR DIFFERENT SPECIES UNIQUE ANTIGENIC BmLDH AMINO ACIDS RESIDUES AT SPECIFIC SEQUENCE NUMBERS COMPARED TO OTHER LDH 10 42 52 191 211 228 311 327 B. microti gray strain LDh L n I n L V e n Homo sapien LDh I L V s V D D K Mus musculus LDh I M V s V D D K Cricetulus griseus LDh I M V s V D D K P. facuparum LDh n L F D I L Q e B. bovis LDh – L F Y V e K a T. annulata LDh – L L Y s Y K a T. gondii LDh – L F D V K Q K Note: The antigenic amino acid domains for BmLDh were elucidated using JaMBW antigenicity plot followed by multiple sequence alignment to determine unique amino acid residues for BmLDh at the antigenic sites. http://www.la-press.com