DTI Drug Target Insights 2023; 17: 92-100 ISSN 1177-3928 | DOI: 10.33393/dti.2023.2613 ORIGINAL RESEARCH ARTICLE Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti © 2023 The Authors. This article is published by AboutScience and licensed under Creative Commons Attribution-NonCommercial 4.0 International (CC BY-NC 4.0). Commercial use is not permitted and is subject to Publisher’s permissions. Full information is available at www.aboutscience.eu ESBL and carbapenemase-producing Enterobacteriaceae in infectious pleural effusions: current epidemiology at Hôpital du Mali Aimé Césaire Kalambry1, Tchamou Malraux Fleury Potindji2, Ibrehima Guindo3, Ambara Kassogue1, Boubacar Sidiki Ibrahim Drame1, Seydou Togo4, Sadio Yena4, Seydou Doumbia5,6, Mahamadou Diakite6,7 1Medical Biology Laboratory, “Hôpital du Mali” Teaching Hospital, Bamako - Mali 2Graduate School of Biological and Food Techniques, University of Lomé, Lomé - Togo 3National Institute of Public Health, Bamako - Mali 4Department of Thoracic Surgery, “Hôpital du Mali” Teaching Hospital, Bamako - Mali 5Faculty of Medicine and Odontostomatology of Bamako, Bamako - Mali 6University Clinical Research Center (UCRC), University of Science, Technique and Technologies of Bamako, Bamako - Mali 7Malaria Research and Training Center (MRTC), Bamako - Mali ABSTRACT Background: Antimicrobial resistance (AMR) is a global health concern, with extended-spectrum β-lactamases (ESBLs) and carbapenemases being major contributors. Pleural infection (PI) is a severe condition in West Africa, complicated by AMR. This study aimed to investigate the prevalence and molecular characteristics of ESBL and carbapenemase-producing enterobacteria in pleural effusions in Mali. Materials and methods: Pleural fluid samples from 526 patients with pleuritis were analyzed. Enterobacterial species were isolated and identified, and the prevalence of resistance genes (blaOXA-48, blaNDM-1, blaKPC, blaTEM, blaSHV) and virulence factors was determined. Results: Among the patients, 110 were diagnosed with enterobacterial pleuritis. Escherichia coli, Klebsiella pneu- moniae, and Proteus mirabilis were the main pathogens identified. Resistance to β-lactams and cephalosporins was high, while carbapenems showed good activity. ESBL production was detected in 33.6% of isolates, with blaTEM being the most common gene. Carbapenemase gene (blaNDM-1) was found in three isolates. Conclusion: The study highlights the high prevalence of multidrug-resistant bacteria and the need for appropriate antibiotic selection based on local resistance patterns. Understanding the molecular characteristics of resistance is crucial for optimizing patient care and developing effective therapeutic strategies. Further research is needed to monitor and control AMR in PIs in Mali. Keywords: Carbapenem-resistant Enterobacteriaceae, ESBL, Mali, Pleural effusions Received: May 29, 2023 Accepted: August 2, 2023 Published online: August 29, 2023 Corresponding author: Aimé Césaire Kalambry Medical Biology Laboratory, Hopital du Mali Bamako - Mali kaimecesaire@gmail.com Introduction Infectious pleural effusion (IPE) is a severe clinical issue. Often secondary to a pre-evolving pulmonary infection, the condition presents with an increasing incidence worldwide (1,2). Care of IPE involves pleural drainage in most of the cases and antibiotic therapy; however, treatment proves inadequate in substantial cases, resulting in mortality rate ranging from 10.7% to 22% (3-5). Few studies have evaluated IPE management, status, and microbiology in Mali. A recent study by Tapia et al in 2021 reported 13.3% mortality rate (6). Among causal factors predictive of treatment failure is the alarming emergence of antimicrobial resistance (AMR). AMR has emerged as a significant global health concern, undermining the effectiveness of antibiotics and exacerbat- ing the burden of infectious diseases. Major contributors to AMR include extended-spectrum β-lactamases (ESBLs) and carbapenemases produced by Enterobacteriaceae (7,8). Both enzymes are β-lactamases with proven ability to degrade β-lactam antibiotics. The ESBLs exhibit hydrolytic activity against penicillins and all cephalosporins, yet are suppressed by β-lactam inhibitors (9). Mutation-wise, ESBLs encoding genes can be grouped into several variants: blaTEM, blaSHV, blaIRT, etc (10). On the other hand, another important https://doi.org/10.33393/dti.2023.2613 https://creativecommons.org/licenses/by-nc/4.0/legalcode mailto:kaimecesaire@gmail.com Kalambry et al Drug Target Insights 2023; 17: 93 © 2023 The Authors. Published by AboutScience - www.aboutscience.eu enzyme is carbapenemase, which degrade carbapenem anti- biotics and include gene variants like blaKPC, blaIMP, blaOXA-1, etc (9). Thus, their inclusion in World Health Organization list as top priority pathogens underscores their potential to pose significant challenge in clinical settings (11). Data from recent studies found an association between extended- spectrum β-lactamases and carbapenemases producing Enterobacteriaceae (ESBL-E/CPE) infections and risk of mor- tality (12,13). Moreover, prior to antibiotherapy, comor- bidities as well as persistent colonization were found to be strong predictors of infection and subsequent treatment failure (14,15). Yet to date, detailed reports on the magni- tude of ESBL-E/CPE in West Africa are scarce (16). Although there are data on phenotypic and genotypic distribution of AMR in pathogens responsible for various clinical infections in Mali, there are still unanswered questions related to the genotypic distribution of these AMR genes in IPEs (17-19). Understanding the extent of resistance and identifying the underlying resistance mechanisms is crucial for designing effective therapeutic strategies and optimizing patient care in this region. This study has mainly focused on the epidemiology of blaOXA-48, blaNDM-1, blaKPC genes responsible for the induction of carbapenem resistance; blaTEM, blaSHV genes that are respon- sible for ESBL production, as well as genes associated with bacterial adhesins (bfp, eae, ipah, eagg) and toxin genes (slt1, slt2, lt, sta). The primary objective of this study was to isolate, identify, and analyze the diversity of enterobacterial species found in pleural fluid samples from patients with IPE. A better knowledge of IPE in Mali could facilitate the manage- ment of the condition and thus reduce the level of mortality. Material and methods Study design and population The present research is a prospective cross-sectional study conducted between October 2021 and December 2022, in the thoracic surgery and pediatrics departments of CHU “Hôpital du Mali” in Bamako. The study included all 6,096 hospitalized patients with pleurisy in these two departments. The inclusion criteria were: (1) clinical diagnosis of pleural infection (PI) with subsequent diagnostic thoracentesis and microbiological confirmation (pleural fluid culture positive to at least one microorganism). PI was defined as the pres- ence of positive pleural fluid culture and/or purulent pleural fluid and clinically manifesting as complex parapneumonic effusion (CPPE) or empyema (20); (2) patients who provided written informed consent to participate in the study. The exclusion criteria were: (1) patients who had non- purulent or no growth from pleural fluid; (2) patients with pleural effusion caused by noninfectious etiologies such as malignancy and congestive heart failure. The data were collected using Microsoft Excel through questionnaires administered to consenting patients by phy- sicians prior to sample collection. Subsequently, laboratory data were obtained and combined with the questionnaire responses. Microbiological processing and identification All pleural fluid samples were processed within an hour after collection at the microbiology laboratory of CHU Hôpital du Mali. Samples were inoculated on brain-heart infusion (BHI) and an anaerobic blood culture flask and incubated for 18 to 24 hours at 35±2°C. From these broth cultures, fresh blood agar, enriched chocolate agar, and Sabouraud agar were plated. The colonies were characterized and identified using Gram stain, biochemical tests, and the Phoenix M50 automated system (panel 449044-NMIC/ID-435). Susceptibility to antibiotics All isolates were subjected to susceptibility testing against 19 antibiotics (Tab. I). Table I provides an overview of the different antibiotic classes and specific antibiotic used for susceptibility tests. The antibiogram was conducted using the Phoenix M50 automated system (panel 449044-NMIC/ ID-435) and was complemented by disk diffusion technique for antibiotics not covered by the automated panel. The results were expressed as susceptible or resistant in accor- dance with the guidelines previously described (21). ESBL production was detected using the combination disk test method with the following combinations: ceftazidime- clavulanate, cefepime-clavulanate, and cefotaxime-clavulanate (21). Klebsiella pneumoniae ATCC 700603 was used as quality control strain. TABLE I - Antibiotic classes and specific antibiotics used in this study Family Antibiotics Beta-lactam antibiotics Amoxicillin (20 µg) Amoxicillin (20 µg) + clavulanic acid (10 µg) Piperacillin (30 µg) Piperacillin (30 µg) + tazobactam (6 µg) Ticarcillin (75 µg) Cefuroxime (30 µg) Cefoxitin (30 µg) Ceftazidime (10 µg) Ceftriaxone (30 µg) Cefepime (30 µg) Aztreonam (30 µg) Imipenem (10 µg) Meropenem (10 µg) Ertapenem (10 µg) Aminosides Amikacin (30 µg) Gentamicin (10 µg) Tobramycin (10 µg) Quinolones Ciprofloxacin (05 µg) Other Trimethoprim (1.25 µg) + sulfamethoxazole (23.75 µg) Hôpital du Mali: antibiotic resistance in IPEs94 © 2023 The Authors. Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti Molecular analysis DNA was extracted according to the method described previously (22). Briefly, pure colonies were suspended in 200 μL of Tris-ethylenediamine tetraacetic acid (EDTA) solu- tion, heated at 100°C for 10 minutes, and then immediately placed at −20°C for 5 to 10 minutes. After centrifugation at 12,000 rpm for 10 minutes, the obtained supernatant was used as DNA template. Quality control of the extraction was carried out using Thermo Scientific NanoDrop One/OneC instrument at the molecular biology unit of the University Centre for Clinical Research (UCRC) in Bamako. Using conventional polymerase chain reaction (PCR), eight virulence factor genes from Escherichia coli, namely bfp, eae, eagg, ipah, slt1, slt2, lt and sta, as well as ESBL coding genes, namely blaTEM and blaSHV, were characterized. In addition, the following genes were screened for their role in conferring antibiotic resistance: the catA1 gene responsible for encod- ing chloramphenicol acetyltransferase, mutations on genes encoding for topoisomerase IV, and DNA gyrase protective proteins targeted by quinolones (qnrA, qnrB, qnrS), as well as class 1 (int1), class 2 (int2), and class 3 (int3) integrons, which carry resistance genes for multiple antibiotics. We screened bacterial isolates for the presence of carbapenemase genes, namely: blaKPC, blaNDM-1, and blaOXA-48. PCR was performed using ABI 9700 thermocycler (Applied Biosystems, USA) with the following cycling parameters: ini- tial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at variable temperature for each primer set for 39 seconds, and exten- sion at 72°C for 60 seconds (Tab. II). Table II provides essential information about selected genes, including their nucleotide sequences, hybridization temperatures, amplicon sizes. The final extension step was carried out at 72°C for 5 minutes. TABLE II - Primer sequences and characteristics of selected genes Gene names Nucleotide sequences (5ʹ → 3ʹ) Hybridization temperature Amplicon size Reference Adhesin genes 22 bfp GAC ACC TCA TTG CTG AAG TCG 57°C 324 bp CCA GAA CAC CTC CGT TAT GC eae TCA ATG CAG TTC CGT TAT CAG TT 65°C 494 bp GTA AAG TCC GTT ACC CCA ACC TG ipaH GAA AAC CTC CTG GTC CAT CAG G 53°C 424 bp GCC GGT CAG CCA CCC TCT GAG AGT AC Eagg ACG CAG AGT TGC CTG ATA AAG 53°C 630 bp AAT ACA GAA TCG TCA GCA TCA GC Toxin genes slt1 TTT ACG ATA GCA TTC TCG AC 56°C 130 bp CAC ATA TAA ATT ATT TCG CTC slt2 CTT CAC GTC ACC ATA CAT AT 56°C 346 bp ACG ATG TGG TTT ATT CTG GA lt GGC GAC AGA TTA TAC CGT GC 56°C 707 bp CCG AAT TCT GTT ATA TAT GTC sta TTA ATA GCA CCC GGT ACA AGC AGG 43°C 146 bp CTT GAC TCT TCA AAA GAG AAA ATT AC Antibiotic resistance genes int1 ACATGTGATGGCGACGCA CGA 57°C 580 bp ATTTCTGTCCTGGCTGGC GA int2 GTAGCAAACGACTGACGAAAT G 62°C 806 bp CACGGATATGCGACAAAA AGG T int3 GCC CCG GCA GCG ACT TTC AG 62°C 1200 bp ACG GCT CTG CCA AAC CTG ACT SHV TTATCTCCCTGTTAGCCACC 55°C 800 bp GATTTGCTGATTTCGCTCGG Tem ATAAAATTCTTGAAGACGAAA 55°C 850 bp GACAGTTACCAATGCTTAATC Kalambry et al Drug Target Insights 2023; 17: 95 © 2023 The Authors. Published by AboutScience - www.aboutscience.eu Each reaction was carried out in a 25 μL mixture prepared as described previously, with modifications (22). In all reactions, a negative control (water) was included alongside a positive control consisting of reference isolates (E2348-69, M90T, EDL 933, EDL 1493, R3, R4, R5, R6, and R7). The sequence of primers used for amplification and the expected amplicon size are detailed in Table II. PCR products were visualized by transillumination after migration in 1.5% Tris base, acetic acid and EDTA (TAE) buffer. Statistical analysis The data were analyzed using IBM SPSS Statistics for Windows, Version 23.0. Student’s t-test was used to compare mean values of continuous variables, while chi-square test was employed to analyze categorical variables. A p-value of less than 0.05 was considered to indicate statistical signifi- cance. Statistical analysis of AMR data was performed using the software R (version 4.3.0) and the integrated develop- ment environment R Studio (version 2023.03.1+446). The package “AMR” was employed for AMR data processing (23). Ethical approval Written consent was obtained from all included par- ticipants, and the study protocol was subjected to review and approval by the Ethics Committee of the University of Sciences, Techniques, and Technologies of Bamako. The approval was granted under reference number 2021/228/ USTTB on June 9, 2021. Results Sociodemographic characteristics of patients The study specifically analyzed pleural fluid samples obtained from 526 patients with pleurisy, out of which 110 were diagnosed with enterobacterial pleuritis (Tab. III). Table III provides an overview of patient characteristics and their distribution within the thoracic surgery and pediatrics’ ward. It allows for a comparison between the two groups and helps identify any statistically significant differences in Gene names Nucleotide sequences (5ʹ → 3ʹ) Hybridization temperature Amplicon size Reference catA1 CCTGCCACTCATCGCAGTAC 57°C 450 bp CTGCCTGGACAACATTGCTT QnrA TCAGCACAAGAGGATTTCTC 55°C 657 bp GGCAGCACTATTACTCCCA QnrB GATCGTGAAAGCCAGAAAGG 55°C 469 bp ACGATGCCTGGTAGTTGTCC QnrS ACGACATTCGTCAACTGCAA 55°C 417 bp TAAATTGGCACCCTGTAGGC Carbapenemase 27 blaKPC CATTCAAGGGCTTTCTTGCTGC 55°C 538 bp ACGACGGCATAGTCATTTGC blaOXA-48 GCTTGATCGCCCTCGATT 55°C 281 bp GATTTGCTCCGTGGCCGAAA blaNDM-1 ATGGAATTGCCCAATATTATGCAC 55°C 813 bp TCAGCGCAGCTTGTCGGC TABLE III - Patient characteristics and distribution by thoracic surgery and pediatric wards Thoracic surgery Pediatrics Total P Characteristics n = 92 (%) n = 18 (%) n = 110 (%) 0.000 Gender 1.000  Male gender 59 (64.1) 12 (66.7) 71 (64.5)  Female gender 33 (35.9) 6 (33.3) 39 (35.5)  Median age 42 8.5 37.5 Age group  0–4 – 13 (72.2) 0.000  5–9 – 5 (27.8)  10–14 –  15–19 3 (3.3) –  20–24 3 (3.3) –  25–29 16 (17.4) – 0.000  30–34 12 (13.0) –  35–39 6 (6.6) –  40–44 10 (10.9) –  45–49 6 (6.5) –  50–54 10 (10.9) –  55–59 9 (9.8) –  60–64 8 (8.7) –  65–69 4 (4.3) –  70–90 5 (5.4) – Hôpital du Mali: antibiotic resistance in IPEs96 © 2023 The Authors. Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti gender, age, and age group distribution. A total of 71 (64.5%) patients were men and 39 (35.5%) were women with a male-to-female sex ratio of 1.8. The majority of the patients (76/110, 69.1%) resided in urban areas. Pediatric patients aged 0-4 years, and young adults (25-29 years) constituted 72.2% of the cases, highlighting the vulnerability of these age groups to the condition. The observed distribution within these age groups was found to be statistically significant (p = 0.000). Bacterial diversity and antibiotics resistance profile The three main pathogens isolated in this study were Escherichia coli (44.5%; n = 49), Klebsiella pneumoniae (11.8%; n = 13), and Proteus mirabilis (13.6%; n = 15). Antibiotic resistance profile of E. coli, P. mirabilis, and K. pneumoniae was assessed against several antibiotics (Tab. I). Results showed marked differences in antibiotic susceptibility between β-lactams, cephalosporins, and car- bapenems. β-Lactams showed no activity against the three Enterobacteriaceae; second-generation cephalosporins had shown moderate activity against E. coli and K. pneumoniae (65.3% and 53.8% respectively) but had no activity against P. mirabilis, while third-generation cephalosporins showed moderate activity against all three types of isolates, with susceptibility rates ranging from 8.2% to 91.8%. In contrast, all carbapenems had high activity against all three types of isolates. In terms of efficacy, E. coli and P. mirabilis isolates exhibited higher susceptibility to the combination of peni- cillins and β-lactamase inhibitors (piperacillin/tazobactam [TZP]); however, they were moderately to highly resistant to trimethoprim/sulfamethoxazole (Tab. IV). Table IV provides valuable information on the susceptibility patterns of E. coli, P. mirabilis, and K. pneumoniae to various antibiotics. It assists in understanding the effectiveness of different antibi- otics against these bacterial species, aiding in the selection of appropriate treatment options. The combination disk test method revealed that 33.6% (n = 37) of all isolates were ESBL producing. E. coli had the highest prevalence at 24.5% (n = 27), followed by K. pneu- moniae, Enterobacter cloacae, and others. It is noteworthy that a substantial proportion of the patients, precisely 77.3% (85/110), had previously under- gone at least one course of antibiotic treatment before the sampling procedure. Moreover, an alarming 94.5% of the iso- lates displayed multidrug-resistant (MDR) profiles, as per the guidelines set forth by Magiorakos et al (24). Molecular characterization of genes Table V lists the frequencies of the virulence genes identi- fied in E. coli isolates. Table V provides valuable information on the presence and distribution of genes related to adhes- ins, enteroxins, antibiotic resistance, and carbapenemases in E. coli and related species. It helps in understanding the genetic characteristics and potential resistance patterns of these bacterial strains. Eagg was found in 6.1% (n = 3) of the E. coli isolates while bfp and eae were not detected; the gene ipah was found in a higher percentage (n = 27; 55.1%). Among isolates, blaTEM was the most common ESBL, being present in 29.7% of E. coli. In contrast, blaSHV, int2, int3, qnrS, qnrA, and qnrB genes were not detected. In terms of carbapenemase genes, blaNDM-1 was detected (Tab. V). TABLE IV - Antibiotic susceptibility profiles of Escherichia coli, Proteus mirabilis, and Klebsiella pneumoniae Antibiotics E. coli P. mirabilis K. pneumoniae S% R% S% R% S% R% Amoxicillin 0 49 (100) 0 15 (100) 0 13 (100) Amoxi + clavulanic acid 4 (8.2) 45 (91.8) 0 15 (100) 2 (15.4) 11 (84.6) Piperacillin 0 49 (100) 0 15 (100) 0 13 (100) Piperacillin + tazobactam 46 (93.9) 3 (6.1) 12 (80) 3 (20) 10 (76.9) 3 (23.1) Ticarcillin 0 49 (100) 2 (13.3) 13 (86.7) 0 13 (100) Aztreonam 46 (93.9) 3 (6.1) 11 (73.3) 4 (26.7) 12 (92.3) 1 (7.7) C2G 4 (8.2) 45 (91.8) 0 15 (100) 3 (23.1) 10 (76.9) C3G 4 (8.2) 45 (91.8) 2 (13.3) 13 (86.7) 5 (38.5) 8 (61.5) Cefoxitin 32 (65.3) 17 (34.7) 0 15 (100) 7 (53.8) 6 (46.2) Ertapenem 48 (98.0) 1 (2.0) 14 (88.2) 1 (6.7) 11 (84.6) 2 (15.3) Imipenem 46 (93.9) 3 (6.1) 11 (73.3) 4 (26.7) 11 (84.6) 2 (15.3) Amikacin 39 (79.6) 10 (20.4) 10 (66.7) 5 (33.3) 9 (69.2) 4 (30.8) Gentamicin 12 (24.5) 37 (75.5) 2 (13.3) 13 (86.7) 5 (38.5) 8 (61.5) Tobramycin 13 (26.5) 36 (73.5) 2 (13.3) 13 (86.7) 5 (38.5) 8 (61.5) Ciprofloxacin 5 (10.2) 44 (89.8) 6 (40) 9 (60) 4 (30.7) 9 (69.2) Trimethoprim + sulfamethoxazole 2 (4.1) 47 (95.9) 6 (40) 9 (60) 3 (23.1) 10 (76.9) Kalambry et al Drug Target Insights 2023; 17: 97 © 2023 The Authors. Published by AboutScience - www.aboutscience.eu Based on molecular screening, only one carbapenemase gene, blaNDM-1, was detected in three different isolates only with single occurrence, namely K. pneumonia, Providencia rettgeri, and Providencia penneri. Discussion The results reported in this study provide valuable insights into the bacteriology of PIs in Mali. By addressing resis- tance rates toward various antibiotics, and the frequency of ESBL, carbapenemases, and MDR bacteria, this study is the first to comprehensively analyze these factors and lay the groundwork for future clinical studies to determine whether improved bacterial diagnosis and antibiotic selection can positively impact the outcomes of PIs. According to the British Thoracic Society (BTS) Guidelines for Pleural Disease, PI was clinically addressed in this discussion as a case of CPPE or empyema and literature was searched accordingly (20). Out of the 526 samples analyzed, 244 were positive to culture; of which 110 cultures tested positive for Entero- bacteriaceae, indicating a significant number of negative results. These results could potentially be attributed to alter- native etiologies or could be a result of previous antibiotic utilization (as 77.3% of our patient’s population have admit- tedly taken at least one antibiotic prior to sampling). In the current study, E. coli, K. pneumoniae, and P. mirabi- lis were the main bacteria identified, indicating their signifi- cant role as causative agents of PI. These findings align with previous studies that have also identified the above-men- tioned pathogens as the primary contributors to PI (25,26). Furthermore, the study revealed that those pathogens exhib- ited higher rate of resistance to third-generation cephalospo- rins, indicating their classification as ESBL phenotypes. The prevalence rates of ESBL reported in this study were signifi- cantly lower than a study from Burkina Faso, which reported 70% of ESBL-producing isolates in hospitalized patients (27). Genotypically, the most common ESBL gene was blaTEM. This finding was also reported by Sonda et al (28). We did not detect blaSHV gene. The observed high resistance among the most common isolates to penicillin, quinolones, cephalosporins, and others is likely attributed to the higher utilization of those antibiotic classes in hospital settings. The existence of such associa- tion between antibiotic prescriptions and susceptibility pat- tern was previously highlighted in another hospital setting in Eritrea (29). Clinicians’ choice of broad-spectrum antibiotics or combination therapy may be suggestive of the infection being acquired in a hospital setting. It could be inferred that despite the treatment recommendations as per European Respiratory Society (ERS) and American Association for Thoracic Surgery (AATS), the selection of the treatment regi- men must typically depend on infection setting, the local prevalence of microorganisms, and antibiotic resistance pat- terns (30,31). Additionally, our study reported a high prevalence of MDR bacteria. This MDR rate aligns with previous study in Turkey reporting the widespread occurrence of MDR bac- teria (26). The study findings revealed a higher prevalence of carbapenem resistance (7.2%) compared to the previous report by Dwomoh et al (32), which documented a resistance rate of 5.6%. Hackman et al (33) reported a similar rate of carbapenem resistance. However, our study observed sig- nificant disparities in the resistance rates of individual car- bapenems (ertapenem, imipenem, meropenem) as well as the TZP combination compared to their study. These vari- ances can be attributed to our study’s focus on the three predominant pathogens isolated (E. coli, K. pneumoniae, P. mirabilis). On the basis of available data, TZP and carbapen- ems appear to maintain significant effectiveness against the tested pathogens; the results were in accordance with those of a Malaysian observational cohort study (34). The recorded prevalence aligns with other studies conducted in Africa, such as those conducted in Nigeria (35) and South Africa (36). However, Egypt has recently reported a notably higher preva- lence of carbapenem resistance (37). TABLE V - Distribution of genes of adhesins, enteroxins, antibiotic resistance, and carbapenemases in Escherichia coli and related species Genes of adhesins Escherichia coli n = 49 (%) Eagg 3 (6.1) Bfp 0 eae 0 ipaH 27 (55.1) Enteroxin genes E. coli n = 49 (%) lt 1 (2.0) slt1 1 (2.0) slt2 0 Sta 1 (2.0) Antibiotic resistance genes N = 37 E. coli n = 27 Klebsiella pneumoniae n = 4 Enterobacter cloacae n = 2 Others* n = 4 Tem 11 (29.7) 1 (2.7) 0 SHV 0 – – 0 Int1 10 (27.0) 4 (10.8) 1 (2.7) 0 Int2 0 0 0 0 Int3 0 0 0 0 QnrS 0 0 0 0 QnrA 0 0 0 0 QnrB 0 0 0 0 CatA1 12 (32.4) 0 0 0 Carbapen- emase N = 13 Proteus penneri n = 1 (%) K. pneumoniae n = 2 (%) Providencia rettgeri n = 2 (%) Others** n = 8 KPC 0 0 0 0 OXA-48 0 0 0 0 NDM-1 1 (7.7) 1 (7.7) 1 (7.7) 0 Hôpital du Mali: antibiotic resistance in IPEs98 © 2023 The Authors. Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti The relatively low abundance of carbapenem resistance genes further supports this notion, indicating that the iso- lates in this study may not possess robust mechanisms of resistance to carbapenems. We did not detect cases of blaKPC and blaOXA-48 type of carbapenemase but 7.7% of blaNDM-1. In 2022, a study investigating the global epidemiology of OXA- 48-like β-lactamases, treatment option and pipeline develop- ment were conducted by Sara E. Boyd et al (38). The study found that the enzymes of blaOXA-48 type are the most com- mon carbapenemases among Enterobacteriaceae in much of western Europe. In Africa, the same study reported circula- tion of these types of β-lactamase in Tunisia, Algeria, Egypt, and South Africa. In West Africa, cases have been reported in Senegal and Nigeria. Mali did not provide data probably due to lack of adequate health care infrastructure and limited molecular diagnostic capabilities (38). Nabi Jomehzadeh et al found higher levels of blaNDM-1 (31%) (39). In 2020, Muggeo et al reported the first description of blaNDM-5 in Mali (18). Overall, β-lactam/β-lactam inhibitor combinations and car- bapenems are suitable choices, as presented previously in observational studies and guidelines (40-42). However, it is crucial to interpret these results within the context of the provided data. The analysis is limited to the specific isolates and may not be representative of the broader population or other geographical regions. According to this study, the presence of virulence factor genes in E. coli isolates was limited to a specific set. The occur- rence of these factors varied, ranging from 2% for genes sta, slt, and lt, to 55.1% for the ipah gene. The ipah gene encodes Invasion Plasmid Antigen and is closely linked to immune sys- tem modulation in the host and bacterial survival. It is com- monly detected in the majority of EIEC isolates (43). The study has certain limitations. Firstly, it was conducted in a single center, which might restrict the applicability of the results to other populations or settings. Additionally, the sample size was relatively small, warranting larger multi- center studies to validate the findings. The study also lacked detailed information on patients’ antibiotic exposure history and prior hospitalizations, which could have influenced the prevalence of antibiotic resistance. Despite these limitations, the study emphasizes the significant prevalence of antibi- otic resistance in the examined setting and underscores the ongoing need for surveillance and efforts in antibiotic stew- ardship to address this critical public health concern. Further research involving larger sample sizes, multicenter designs, and comprehensive patient data would greatly enhance our understanding and approach toward combating antibiotic resistance in our region. In countries with limited resources such as those in West Africa, more specific socioeconomic and behavioral factors contribute to exacerbating this threat, among others: (i) cer- tain common societal practices such as self-medication; (ii) a failing medical sector with insufficiently trained prescribers and inefficient diagnostic tools; or (iii) an uncontrolled drug chain with over-the-counter, improperly stored, counterfeit, and/or expired antibiotics favor the emergence of resis- tance. This study on the prevalence and characteristics of ESBL and carbapenemase-producing Enterobacteriaceae in pleural effusion in Mali holds great significance for low- and middle-income countries. By providing critical insights into the extent of resistance and molecular epidemiology, this research will facilitate the development of effective strate- gies to combat AMR, improve patient outcomes, and safe- guard public health in Mali. Acknowledgments The authors would like to thank the managers of the molecular biology laboratories of the National Institute of Public Health and the University Clinical Research Center. The authors would also like to express their sincere gratitude to the Fogarty International Center for funding the registration of PhD student Aimé Césaire Kalambry through grant D43TW008652. Their support has been instrumental in the advancement of our understanding in this field and has contributed significantly to the successful completion of this manuscript. Disclosures Conflict of interest: The authors declare no conflict of interest. Financial support: This research is part of a PhD study whose PhD program received financial support from the Fogarty International Center to cover the student’s registration fees only. No specific funds were allocated to this particular research project. The funding agency played no role in the study design, data collection, analysis, decision to publish, or preparation of the manuscript. References 1. Li P, An J, Wang S, et al. Incidence and prognostic role of pleu- ral effusion in patients with pulmonary embolism: a system- atic review and meta-analysis. J Clin Med. 2023:12(6):2315. CrossRef 2. Arnold DT, Hamilton FW, Morris TT, et al. Epidemiology of pleu- ral empyema in English hospitals and the impact of influenza. Eur Respir J. 2021;57(6):57. CrossRef PubMed 3. Brims F, Popowicz N, Rosenstengel A, et al. Bacteriology and clinical outcomes of patients with culture-positive pleural infection in Western Australia: a 6-year analysis. Respirology. 2019;24(2):171-178. CrossRef PubMed 4. White HD, White BAA, Song J, Fader R, Quiroga P, Arroliga AC. Pleural infections: a 9-year review of bacteriology, case char- acteristics and mortality. Am J Med Sci. 2013;345(5):349-354. CrossRef PubMed 5. Markatis E, Perlepe G, Afthinos A, et al. Mortality among hospitalized patients with pleural effusions. a multicenter, observational, prospective study. Front Med (Lausanne). 2022;9:828783. CrossRef PubMed 6. Tapia MD, Sylla M, Driscoll AJ, et al. The etiology of childhood pneumonia in Mali: findings from the Pneumonia Etiology Research for Child Health (PERCH) study. Pediatr Infect Dis J. 2021;40(9S):S18-S28. CrossRef PubMed 7. Singh SR, Teo AKJ, Prem K, et al. Epidemiology of extended- spectrum beta-lactamase and carbapenemase-producing Enterobacterales in the greater mekong subregion: a systematic- review and meta-analysis of risk factors associated with extended-spectrum beta-lactamase and carbapenemase isola- tion. Front Microbiol. 2021;12:695027. CrossRef 8. Mustafai MM, Hafeez M, Munawar S, et al. Prevalence of car- bapenemase and extended-spectrum β-lactamase produc- ing Enterobacteriaceae: a cross-sectional study. Antibiotics (Basel). 2023;12(1):12. CrossRef PubMed https://doi.org/10.3390/jcm12062315 https://doi.org/10.1183/13993003.03546-2020 https://www.ncbi.nlm.nih.gov/pubmed/33334937 https://doi.org/10.1111/resp.13395 https://www.ncbi.nlm.nih.gov/pubmed/30187976 https://doi.org/10.1097/MAJ.0b013e318259bd24 https://www.ncbi.nlm.nih.gov/pubmed/23044652 https://doi.org/10.3389/fmed.2022.828783 https://www.ncbi.nlm.nih.gov/pubmed/35280903 https://doi.org/10.1097/INF.0000000000002767 https://www.ncbi.nlm.nih.gov/pubmed/34448741 https://doi.org/10.3389/fmicb.2021.695027 https://doi.org/10.3390/antibiotics12010148 https://www.ncbi.nlm.nih.gov/pubmed/36671350 Kalambry et al Drug Target Insights 2023; 17: 99 © 2023 The Authors. Published by AboutScience - www.aboutscience.eu 9. Sawa T, Kooguchi K, Moriyama K. Molecular diversity of extended-spectrum β-lactamases and carbapenemases, and antimicrobial resistance. J Intensive Care. 2020;8:13. CrossRef 10. Castanheira M, Simner PJ, Bradford PA. Extended-spectrum β-lactamases: an update on their characteristics, epidemiol- ogy and detection. JAC Antimicrob Resist. 2021;3(3):dlab092. CrossRef 11. World Health Organization. WHO publishes list of bacteria for which new antibiotics are urgently needed. Online. Accessed July 12, 2023. 12. Phungoen P, Sarunyaparit J, Apiratwarakul K, Wonglakorn L, Meesing A, Sawanyawisuth K. The association of ESBL Escherichia coli with mortality in patients with Escherichia coli bacteremia at the emergency department. Drug Target Insights. 2022;16(1):12-16. CrossRef PubMed 13. Shamsrizi P, Gladstone BP, Carrara E, et al. Variation of effect estimates in the analysis of mortality and length of hospital stay in patients with infections caused by bacteria-producing extended-spectrum beta-lactamases: a systematic review and meta-analysis. BMJ Open. 2020;10(1):e030266. CrossRef PubMed 14. Gao Y, Chen M, Cai M, et al. An analysis of risk factors for carbapenem-resistant Enterobacteriaceae infection. J Glob Antimicrob Resist. 2022;30:191-198. CrossRef PubMed 15. Vance MK, Cretella DA, Ward LM, Vijayvargiya P, Garrigos ZE, Wingler MJB. Risk factors for bloodstream infections due to ESBL-producing Escherichia coli, Klebsiella spp., and Proteus mirabilis. Pharmacy (Basel). 2023;11(2):74. CrossRef PubMed 16. Ouchar Mahamat O, Kempf M, Lounnas M, et al. Epidemiology and prevalence of extended-spectrum β-lactamase- and car- bapenemase-producing Enterobacteriaceae in humans, ani- mals and the environment in West and Central Africa. Int J Antimicrob Agents. 2021;57(1):106203. CrossRef PubMed 17. Kalambry A, Gaudré N, Drame BS, et al. Profil de résistance aux bêta-lactamines des entérobactéries isolées des prélèvements urinaires à l’Hôpital du Mali. Rev Mali Infectiol Microbiol. 2019;14(2):6-13. CrossRef 18. Muggeo A, Maiga A, Maiga I, et al. First description of IncX3 NDM-5-producing plasmid within Escherichia coli ST448 in Mali. J Med Microbiol. 2020;69(5):685-688. CrossRef PubMed 19. Sangare SA, Rondinaud E, Maataoui N, et al. Very high prev- alence of extended-spectrum beta-lactamase-producing Enterobacteriaceae in bacteriemic patients hospitalized in teaching hospitals in Bamako, Mali. PLoS One. 2017;12(2): e0172652. CrossRef PubMed 20. Davies HE, Davies RJO, Davies CWH; BTS Pleural Disease Guideline Group. Management of pleural infection in adults: British Thoracic Society pleural disease guideline 2010. Thorax. 2010;65(suppl 2):ii41-ii53. CrossRef PubMed 21. CASFM/EUCAST. 2020. CASFM/EUCAST V1.2 Octobre 2020. Société Française de Microbiologie. Online. Accessed May 11, 2023. 22. Guindo I, Dicko AA, Konaté I, et al. Facteurs de Pathogénicité et Résistance aux Antibiotiques des Souches d’Escherichia coli isolées chez les Enfants Diarrhéiques de 0 à 59 Mois en Milieu Communautaire à Bamako. Health Sci Dis. 2022;23(5):49-56. 23. Berends MS, Luz CF, Friedrich AW, Sinha BNM, Albers CJ, Glasner C. AMR – an R package for working with antimicrobial resistance data. CrossRef. Accessed May 26, 2023. 24. Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug- resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim stan- dard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-281. CrossRef PubMed 25. Kpoda DS, Guessennd N, Bonkoungou JI, et al. Prevalence and resistance profile of extended-spectrum β-lactamases- producing Enterobacteriaceae in Ouagadougou, Burkina Faso. Afr J Microbiol Res. 2017;11(27):1120-1126. CrossRef 26. Bora G, Akgül Ö, Gülaçar E, Sayir F. The molecular analysis of antibiotic resistance and identification of the aerobic bacteria isolated from pleural fluids obtained from patients. Eur Rev Med Pharmacol Sci. 2022;26(19):7236-7244. PubMed 27. Ouedraogo AS, Sanou M, Kissou A, et al. High prevalence of extended-spectrum β-lactamase producing Enterobacteria- ceae among clinical isolates in Burkina Faso. BMC Infect Dis. 2016;16(1):326. CrossRef PubMed 28. Sonda T, Van Zwetselaar M, Alifrangis M, Lund O, Kibiki G, Aarestrup FM. Meta-analysis of proportion estimates of extended-spectrum-beta-lactamase-producing Enterobacteri- aceae in East Africa hospitals. Antimicrob Resist Infect Control. 2016;5:18. CrossRef 29. Garoy EY, Gebreab YB, Achila OO, et al. Methicillin-resistant Staphylococcus aureus (MRSA): prevalence and antimicrobial sensitivity pattern among patients—a multicenter study in Asmara, Eritrea. Can J Infect Dis Med Microbiol. 2019:8321834, 9 pg. CrossRef 30. Bedawi EO, Ricciardi S, Hassan M, et al. ERS/ESTS statement on the management of pleural infection in adults. Eur Respir J. 2023;61(2):61. CrossRef PubMed 31. Shen KR, Bribriesco A, Crabtree T, et al. The American Association for Thoracic Surgery consensus guidelines for the manage- ment of empyema. J Thorac Cardiovasc Surg. 2017;153(6): e129-e146. CrossRef PubMed 32. Dwomoh FP, Kotey FCN, Dayie NTKD, et al. Phenotypic and genotypic detection of carbapenemase-producing Escherichia coli and Klebsiella pneumoniae in Accra, Ghana. PLoS One. 2022;17(12):e0279715. CrossRef PubMed 33. Hackman H, Arhin R, Gordon A, Mensah SNB. Emergence of carbapenem-resistant Enterobacteriaceae among extended- spectrum beta-lactamase producers in Accra, Ghana. 2017;7(24). Online 34. Abubakar U, Tangiisuran B, Elnaem MH, Sulaiman SAS, Khan FU. Mortality and its predictors among hospitalized patients with infections due to extended spectrum beta-lactamase (ESBL) Enterobacteriaceae in Malaysia: a retrospective obser- vational study. Futur J Pharm Sci 2022;8:17:1-8. CrossRef 35. Olowo-Okere A, Ibrahim YKE, Olayinka BO, et al. Phenotypic and genotypic characterization of clinical carbapenem-resis- tant Enterobacteriaceae isolates from Sokoto, northwest Nigeria. New Microbes New Infect. 2020;37:100727. CrossRef PubMed 36. Ballot DE, Bandini R, Nana T, et al. A review of multidrug-resis- tant Enterobacteriaceae in a neonatal unit in Johannesburg, South Africa. BMC Pediatr. 2019;19(1):320. CrossRef PubMed 37. Kotb S, Lyman M, Ismail G, et al. Epidemiology of carbapenem- resistant Enterobacteriaceae in Egyptian intensive care units using National Healthcare-associated Infections Surveillance Data, 2011-2017. Antimicrob Resist Infect Control. 2020;9(1):2. CrossRef PubMed 38. Boyd SE, Holmes A, Peck R, Livermore DM, Hope W. OXA-48- Like β-lactamases: global epidemiology, treatment options, and development pipeline. Antimicrob Agents Chemother. 2022;66(8):e0021622. CrossRef PubMed 39. Jomehzadeh N, Jahangirimehr F, Chegeni SA. Virulence- associated genes analysis of carbapenemase-producing Escherichia coli isolates. PLoS One. 2022;17(5):e0266787. CrossRef PubMed https://doi.org/10.1186/s40560-020-0429-6 https://doi.org/10.1093/jacamr/dlab092 https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed https://doi.org/10.33393/dti.2022.2422 https://www.ncbi.nlm.nih.gov/pubmed/36304435 https://doi.org/10.1136/bmjopen-2019-030266 https://www.ncbi.nlm.nih.gov/pubmed/31964661 https://doi.org/10.1016/j.jgar.2022.04.005 https://www.ncbi.nlm.nih.gov/pubmed/35429666 https://doi.org/10.3390/pharmacy11020074 https://www.ncbi.nlm.nih.gov/pubmed/37104080 https://doi.org/10.1016/j.ijantimicag.2020.106203 https://www.ncbi.nlm.nih.gov/pubmed/33075511 https://doi.org/10.53597/remim.v14i2.1363 https://doi.org/10.1099/jmm.0.001182 https://www.ncbi.nlm.nih.gov/pubmed/32375948 https://doi.org/10.1371/journal.pone.0172652 https://www.ncbi.nlm.nih.gov/pubmed/28245252 https://doi.org/10.1136/thx.2010.137000 https://www.ncbi.nlm.nih.gov/pubmed/20696693 https://www.sfm-microbiologie.org/2020/10/02/casfm-eucast-v1-2-octobre-2020/ https://doi.org/10.1101/810622 https://doi.org/10.1111/j.1469-0691.2011.03570.x https://www.ncbi.nlm.nih.gov/pubmed/21793988 https://doi.org/10.5897/AJMR2017.8598 https://www.ncbi.nlm.nih.gov/pubmed/36263534 https://doi.org/10.1186/s12879-016-1655-3 https://www.ncbi.nlm.nih.gov/pubmed/27400864 https://doi.org/10.1186/s13756-016-0117-4 https://doi.org/10.1155/2019/8321834 https://doi.org/10.1183/13993003.01062-2022 https://www.ncbi.nlm.nih.gov/pubmed/36229045 https://doi.org/10.1016/j.jtcvs.2017.01.030 https://www.ncbi.nlm.nih.gov/pubmed/28274565 https://doi.org/10.1371/journal.pone.0279715 https://www.ncbi.nlm.nih.gov/pubmed/36584159 https://core.ac.uk/download/pdf/234657611.pdf https://core.ac.uk/download/pdf/234657611.pdf https://doi.org/10.1186/s43094-022-00406-8 https://doi.org/10.1016/j.nmni.2020.100727 https://www.ncbi.nlm.nih.gov/pubmed/32939286 https://doi.org/10.1186/s12887-019-1709-y https://www.ncbi.nlm.nih.gov/pubmed/31493789 https://doi.org/10.1186/s13756-019-0639-7 https://www.ncbi.nlm.nih.gov/pubmed/31911830 https://doi.org/10.1128/aac.00216-22 https://www.ncbi.nlm.nih.gov/pubmed/35856662 https://doi.org/10.1371/journal.pone.0266787 https://www.ncbi.nlm.nih.gov/pubmed/35536848 Hôpital du Mali: antibiotic resistance in IPEs100 © 2023 The Authors. Drug Target Insights - ISSN 1177-3928 - www.aboutscience.eu/dti 40. Pilmis B, Jullien V, Tabah A, Zahar JR, Brun-Buisson C. Piperacillin-tazobactam as alternative to carbapenems for ICU patients. Ann Intensive Care. 2017;7(1):113. CrossRef PubMed 41. Gutiérrez-Gutiérrez B, Rodríguez-Baño J. Current options for the treatment of infections due to extended-spectrum beta- lactamase-producing Enterobacteriaceae in different groups of patients. Clin Microbiol Infect. 2019;25(8):932-942. CrossRef PubMed 42. Grabein B, Ebenhoch M, Kühnen E, Thalhammer F. Calculated parenteral initial treatment of bacterial infections: infections with multi-resistant Gram-negative rods—ESBL producers, carbapenemase-producing Enterobacteriaceae, carbapenem- resistant Acinetobacter baumannii. GMS Infect Dis. 2020;8: Doc04. PubMed 43. Dranenko NO, Tutukina MN, Gelfand MS, Kondrashov FA, Bochkareva OO. Chromosome-encoded IpaH ubiquitin ligases indicate non-human enteroinvasive Escherichia. Sci Rep. 2022;12:1-10. CrossRef https://doi.org/10.1186/s13613-017-0334-x https://www.ncbi.nlm.nih.gov/pubmed/29127502 https://doi.org/10.1016/j.cmi.2019.03.030 https://www.ncbi.nlm.nih.gov/pubmed/30986558 https://www.ncbi.nlm.nih.gov/pubmed/32373429 https://doi.org/10.1038/s41598-022-10827-3