European Journal of Taxonomy 834: 94–101 ISSN 2118-9773 https://doi.org/10.5852/ejt.2022.834.1901 www.europeanjournaloftaxonomy.eu 2022 · Habib K. et al. This work is licensed under a Creative Commons Attribution License (CC BY 4.0). R e s e a r c h a r t i c l e 94 Lecaimmeria pakistanica, a new lichen from Azad Jammu and Kashmir, Pakistan Kamran HABIB 1,*, Rizwana ZULFIQAR 2 & Abdul Nasir KHALID 3 1,2,3 Fungal Biology and Systematics Lab, Department of Botany, University of the Punjab, Lahore, Pakistan. * Corresponding author: kamranhabiib@gmail.com 2 Email: rizwanamughal6@gmail.com 3 Email: drankhalid@gmail.com Abstract. A new lichen species Lecaimmeria pakistanica K.Habib, R.Zulfiqar & Khalid sp. nov. is described and illustrated from rocks in the temperate forests of the Himalaya of Azad Jammu and Kashmir, Pakistan. This species is characterized by its yellow-brown to brown thallus having areoles 0.4 to 1.5 mm across, branched and anastomosing paraphyses, a tall hymenium, large ascospores 20–32 × 10–16 μm, and no substance detected by thin layer chromatography. All other species of the genus have ascospore dimensions in the range of 14–22 × 5–14 μm. A phylogenetic analysis is provided based on ITS nrDNA sequences, and supports the separation of the novel species. Photographs and a comparative analysis with related species of Lecaimmeria are provided to confirm the status of the species. Keywords. Lecideaceae, lichenized fungi, taxonomy. Habib K., Zulfiqar R. & Khalid A.N. 2022. Lecaimmeria pakistanica, a new lichen from Azad Jammu and Kashmir, Pakistan. European Journal of Taxonomy 834: 94–101. https://doi.org/10.5852/ejt.2022.834.1901 Introduction The lichen genus Immersaria Rambold & Pietschm. originally included species with both lecideine and lecanorine apothecia (Calatayud & Rambold 1998). Recently, Xie et al. (2022) performed a five-loci phylogenetic analysis (nrITS, nrLSU, RPB1, RPB2 and mtSSU) of the Lecideaceae Chevall. in order to test the monophyly of Immersaria. The analysis showed two clades within Immersaria: one with species with lecideine apothecia, and another with species with lecanorine apothecia. They excluded the lecanorine species from Immersaria and proposed a new genus, Lecaimmeria C.M.Xie, Lu L.Zhang & Li S.Wang to accommodate them (Xie et al. 2022). Lecaimmeria could be distinguished from related genera by its waxy glossy, orange or red-brown thallus with an amyloid medulla, its immersed apothecia with a crypto-thalline margin, its orange epihymenium with an epinecral layer, and its Porpidia-type asci with eight halonate, non-amyloid ascospores. Species of the genus frequently grow on granite or sandstone, with the exception of one species, L. tuberculosa C.M.Xie & Xin Y.Wang, which grows on jade. The genus is represented by 10 species, distributed in alpine areas, high-latitude steppe or high-altitude dessert-steppe areas (Xie et al. 2022). Neither of the two genera had been recorded from Pakistan previously. https://doi.org/10.5852/ejt.2022.834.1901 http://www.europeanjournaloftaxonomy.eu/index.php/ejt/index https://creativecommons.org/licenses/by/4.0/ mailto:kamranhabiib%40gmail.com?subject= mailto:rizwanamughal6%40gmail.com?subject= mailto:drankhalid%40gmail.com?subject= https://doi.org/10.5852/ejt.2022.834.1901 HABIB K. et al., Lecaimmeria pakistanica sp. nov. from Azad Jammu and Kashmir, Pakistan 95 During our study on the lichen biota of the state of Azad Jammu and Kashmir, Pakistan, a novel species of Lecaimmeria was discovered. We present a brief diagnosis, an extensive description, illustrations, and a phylogenetic analysis based on ITS-sequence data. Material and methods Collection and preservation Specimens were collected during surveys in the state of Azad Jammu and Kashmir, Pakistan in 2019. The specimens have been deposited in the LAH herbarium of the Institute of Botany, University of the Punjab, Lahore. Acronyms of herbaria follow Index Herbariorum (Thiers continuously updated). Morphological and chemical characterization Macro- and micromorphology of the specimens was examined under a stereo microscope (Meiji Techno, EMZ-5TR, Japan) and a compound microscope (SWIFT M4000-D). Thalline chemistry was analyzed by spot tests, using 10% potassium hydroxide (K) and calcium hypochlorite (C), and thin layer chromatography (TLC) (solvent C) according to the method proposed by Orange et al. (2001). Anatomical characterization and measurement of anatomical features were done by preparing and observing hand-cut apothecial sections mounted in water, K and Lugol’s solution (IKI) under the compound microscope. Molecular characterization and phylogenetic analysis Genomic DNA was extracted directly from a portion of the thallus with apothecia from each specimen using a modified 2% CTAB method (Gardes & Bruns 1993). The ITS nrDNA region was amplified using the primer pair ITS1F, as forward primer (5’CTTGGTCATTTAGAGGAAGTAA3’) (Gardes & Bruns 1993) and ITS4, as reverse primer (5’TCCTCCGCTTATTGATATGC3’) (White et al. 1990), following the amplification protocol of Khan et al. (2018). The amplified DNA fragments (PCR products) were visualized with the help of 1% agarose gel using ethidium bromide and a gel documentation system (Sambrook & Russel 2001). The amplified products were then sequenced from TsingKe BioTech Company Beijing, China, and the sequences deposited in GenBank. Phylogenetic analysis Bidirectional sequences (ITS1 and ITS4) were assembled by using BioEdit ver. 7.2.5 (Hall 2005). Comparative ITS sequences for the analysis were identified and retrieved from GenBank using the Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1990), evaluating maximum percent identification and query coverage. The two newly generated sequences were aligned with 18 sequences retrieved from GenBank (Table 1) using MAFFT ver. 7 (Katoh et al. 2019). All sequences were trimmed terminally using BioEdit ver. 7.2.5. The phylogenetic tree was constructed by MEGA X (Kumar et al. 2018) using the maximum likelihood (ML) method. The optimal model for nucleotide sequences was estimated by MEGA X (Kumar et al. 2018). The Kimura 2-parameter (K2P) was found to be the best model for a phylogenetic tree construction. Bellemerea alpina (Sommerf.) Clauzade & Cl.Roux and Koerberiella wimmeriana (Körb.) Stein were chosen as an outgroup. Results Phylogenetic analysis The data matrix had 521 unambiguously aligned nucleotide positions of which 347 were conserved, 172 variables, 117 parsimony-informative and 54 were singletons. The new ITS nrDNA sequences nested within the phylogenetic branch of newly proposed genus Lecaimmeria (Fig. 1). The sequences of our new species formed a well-supported (BS 92) separate clade outside a group comprised of L. orbicularis European Journal of Taxonomy 834: 94–101 (2022) 96 C.M.Xie & Lu L.Zhang, L. lygaea C.M.Xie & Lu L.Zhang and L. tibetica C.M.Xie & Xin Y.Wang, demonstrating its status as an independent species. Taxonomic treatment Kingdom Fungi (L.) R.T.Moore Subkingdom Dikarya Hibbett, T.Y.James & Vilgalys Division Ascomycota (Berk.) Caval.Sm. Subdivision Pezizomycotina O.E.Erikss. & Winka Class Lecanoromycetes O.E.Erikss. & Winka Subclass Lecanoromycetidae P.M.Kirk, P.F.Cannon, J.C.David & Stalpers Order Lecideales Vain. Family Lecideaceae Chevall. Genus Lecaimmeria C.M.Xie, Lu L.Zhang & Li S.Wang Lecaimmeria pakistanica K.Habib, R.Zulfiqar & Khalid sp. nov. MB844738 Fig. 2 Diagnosis Distinguished from all the known species of the genus by having large ascospores (20–32 × 10–16 μm), and relatively taller hymenium. All the other species of the genus have ascospore dimensions in the range of 14–22 × 5–14 μm. Also separated from other species of the genus by ITS nrDNA sequence data. Species GenBank accession no. Voucher no. Country Lecaimmeria botryoides MZ227405 KUN 20-66713 China Lecaimmeria botryoides MZ227406 KUN 20-66721A China Immersaria sp. MF149862 Malicek 7717 Macedonia Lecaimmeria iranica KR061347 SDNU 20117663 China Lecaimmeria iranica KR061348 SDNU 20117623 China Lecaimmeria lygaea MZ227458 KUN 20-69054 China Lecaimmeria mongolica MZ227397 SDNU 20117613 China Lecaimmeria mongolica MZ227398 SDNU 20117399 China Lecaimmeria orbicularis MZ227415 KUN 20-66803 China Lecaimmeria orbicularis MZ227414 KUN 20-66801 China Lecaimmeria pakistanica sp. nov. MW508503 LAH-36674 Pakistan Lecaimmeria pakistanica sp. nov. MW508504 LAH-36675 Pakistan Lecaimmeria qinghaiensis MZ227454 KUN 20-68696 China Lecaimmeria qinghaiensis MZ227455 KUN 20-68698 China Lecaimmeria tibetica MZ227474 KUN XY19-1288i China Lecaimmeria tibetica MZ227475 KUN XY19-1288A China Lecaimmeria tuberculosa MZ227476 KUN 18-58856 China Lecaimmeria tuberculosa MZ227477 KUN 18-58857 China Bellemerea alpina AF332117 1999, Hafellner 46531 (GZU) Austria Koerberiella wimmeriana MK812168 O-L-163472 Norway Table 1. Species used in the phylogenetic analysis. Pakistani collections are marked in bold. https://www.mycobank.org/MB/MB844738 HABIB K. et al., Lecaimmeria pakistanica sp. nov. from Azad Jammu and Kashmir, Pakistan 97 Etymology The specific epithet ʻpakistanicaʼ refers to country in which the new species was discovered. Material examined Holotype PAKISTAN • Azad Jammu and Kashmir, Muzaffarabad, Peer Chinasi; 34°23′ N, 73°32′ E; alt. 2924 m; on rocks; 9 Aug. 2018; T. Saifullah and K. Habib leg.; PC-21; LAH[LAH-36674]; GenBank no.: MW508503. Paratype PAKISTAN • Azad Jammu and Kashmir, Muzaffarabad, Peer Chinasi; 34°23′ N, 73°32′ E; alt. 2700 m, on rocks; 22 Jul. 2019; T. Saifullah and K. Habib leg.; PC-22; LAH[LAH-36675]; GenBank no.: MW508504. Description Thallus crustose, areolate, up to 6 cm wide, in section 200–280 μm thick, upper surface yellow-brown to brown, no change when wet. Areoles separate, flat to weakly convex, irregular to angular, slightly Fig. 1. Molecular phylogenetic analysis of Lecaimmeria pakistanica K.Habib, R.Zulfiqar & Khalid sp. nov. by the maximum likelihood method based on nrDNA sequences, including ITS1, 5.8S and ITS2. Numbers below branch node represent ML bootstrap (> 50%) based on 1000 replicates. Sequences generated from Pakistani collections are marked with black circle. European Journal of Taxonomy 834: 94–101 (2022) 98 Fig. 2. Lecaimmeria pakistanica K.Habib, R.Zulfiqar & Khalid sp. nov. A. Areolate thallus. B. Wet thallus. C. Apothecia and areoles. D. Section of areole. E. Section of apothecium. F. Asci. G. Ascospores. HABIB K. et al., Lecaimmeria pakistanica sp. nov. from Azad Jammu and Kashmir, Pakistan 99 pruinose near margin, glossy, adnate, without fissures, marginal areoles slightly larger, up to 1.5 mm across, up to 0.6 mm thick, rarely with whitish margins. Prothallus visible between areoles, blackish. Cortex two layered, ca 40–60 μm thick, paraplectenchymatous, cells 8–12 μm in diam., upper layer paler brown, 10–16 μm thick, lower layer hyaline, 30–40 μm thick, epinecral layer distinct, up to 20 μm high. Algal layer 80–120 μm thick, chlorococcoid, cells globose to subglobose, 10–20 μm in diam. Medulla: hyphae white, 15–30 μm thick, corresponding with areole, IKI+ blue. Apothecia crypto-lecanorine, frequent at center of thallus, 1–4 per areole, immersed, sometimes not completely surrounded by the areole. Disc contiguous to separate, flat to concave, reddish brown, rounded at first becoming irregular, sometimes surrounded by a white rim, up to 0.8 mm diam., thinly to rarely pruinose, margin pruinose. Proper exciple thin, poorly differentiated, reduced, hyaline, 10–25 μm thick. Hymenium hyaline, 130–160 μm tall including the epihymenium, which is pale brown to brown, 10– 15 μm thick, epinecral layer 3–7 μm thick; paraphyses apically branched, anastomosing, 1–2 μm wide, apically slight swollen, apices 2.5–3.5 μm wide. Hypothecium 60–100 μm tall, light grayish brown, containing algal cell in the lower part. Asci Porpidia-type, clavate, 80–130 × 25–45 μm, amyloid wall 4–6 μm thick, 8-spored; ascospores hyaline, ellipsoid to broadly ellipsoid, mature with germ tube, 20–32 × 10–16 μm. Spot tests cortex and medulla K-, C-, KC-; medulla IKI+ blue; TLC none detected. Ecology Growing on sun-exposed rocks in a dense forest at an altitude of 2900 m. Topography is mountainous in Himalayan region. Dominant tree species are Pinus roxburghii Sarg., Pinus wallichiana A.B.Jacks., Cedrus deodara (Roxb.) G.Don, Picea smithiana (Wall.) Boiss, Abies pindrow Royle. Maximum and minimum temperature of 32°C and -8°C, respectively. Annual rainfall varying between 1000–1500 mm. Discussion During recent explorations of lichens from Azad Jammu and Kashmir, Pakistan, we observed specimens that could not be readily assigned to any known species. A phylogenetic analysis of the ITS nrDNA region confirms their position within the genus Lecaimmeria, and morphological data showed their distinctness from other known species of the genus. We therefore describe these specimens as a new species, Lecaimmeria pakistanica sp. nov. Lecaimmeria pakistanica sp. nov. is superficially similar to L. tibetica C.M.Xie & Xin Y.Wang, which was recently described from China (Xie et al. 2022). The species have a similar thallus and apothecia coloration with no substance being detected by TLC, but L. pakistanica differs morphologically in having areoles up to 1.5 mm across (vs 0.3–0.5 mm), and apothecia up to 0.8 mm diam. (vs 0.25–0.5 mm). The anatomical differences between these two species include the size of ascospores and the type of paraphyses. Ascospores are large and wider (20–32 × 10–16 μm) and paraphyses branched and anastomosing in L. pakistanica, whereas in L. tibetica, ascospores are small (12.5–15.0 × 5.0–6.0 μm) and paraphyses are unbranched and not anastomosing. Another superficially similar taxon is L. mongolica C.M.Xie & Lu L.Zhang, which also has the same thallus and apothecia coloration but has small areoles (0.4–0.8 mm), apothecia 0.25–0.75 mm diam., parapahyses unbranched and not anastomosing, small ascospores 10–17.5 × 6.0–7.5 μm and contains gyrophoric acid. The phylogenetically close taxon L. botryoides C.M.Xie & Li S.Wang differs from the new taxon in having a red brown thallus, apothecia densely crowded while immature (3–6 / areolae), paraphyses only branched at the top and not anastomosing, comparatively very small ascospores 7.5–8.0 × 4.0–6.0 μm, and the presence of gyrophoric acid. European Journal of Taxonomy 834: 94–101 (2022) 100 The diagnostic features distinguishing L. pakistanica sp. nov. from the related species of the genus are presented in Table 2. Azad Jammu and Kashmir (AJK) is a state of Pakistan that exhibits a large altitudinal variation, with climatic conditions and a diverse vegetation that supports a diverse and conspicuous lichen biota. The nature reserves have abundant biological resources, it is expected that more new species of lichen may be discovered in the Azad Jammu and Kashmir in the future. Acknowledgements We are grateful to Dr Gerhard Rambold (University of Bayreuth, Germany) for his comments that greatly improved the manuscript and to Dr Xin Yu Wang (Kunming Institute of Botany) for confirmation of the species. References Altschul S.F., Gish W., Miller W., Myers E.W. & Lipman D.J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215 (3): 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2 Calatayud V. & Rambold G. 1998. Two new species of the lichen genus Immersaria (Porpidiaceae). The Lichenologist 30 (3): 231–244. https://doi.org/10.1006/lich.1997.0133 Gardes M. & Bruns T.D. 1993. ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. Molecular Ecology 2 (2): 113–118. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x Characters / species L. pakistanica sp. nov. L. tibetica L. mongolica L. botryoids L. lygaea L. cupreoatra Thallus (colour) yellow-brown to brown orange-brown orange red-brown dark red-brown to dark brown brown Areoles size (mm) up to 1.5 0.3–0.5 0.4–0.8 0.25–1.0 0.5–1.0 0.3–0.8 Size (mm) and shape of apothecial disc up to 0.8 flat to concave 0.25–0.5 flat to slightly convex 0.25–0.75 flat to slightly convex 0.25–1.25 flat to concave 0.25–0.75 flat to concave 0.2–0.4 flat Hymenium (µm) 130–160 105.0–137.5 62.5–82.5 67.5–100.0 (–155.0) 75.0–92.5 100–110 Paraphyses branched and anastomosing unbranched and not anastomosing unbranched and not anastomosing only branched at the top, not anastomosing unbranched, not anastomosing branched and anastomosing Size of asco- spores (µm) 20–32 × 10–16 12.5–15.0 × 5.0–6.0 10.0–17.5 × 6.0–7.5 7.5–8.0 × 4.0–6.0 12.5–20.0 × 5.0–7.5 5–10 × 5–9 Chemistry no substance detected no substance detected gyrophoric acid gyrophoric acid unknown fatty acid gyrophoric acid References this paper Xie et al. (2022) Xie et al. (2022) Xie et al. (2022) Xie et al. (2022) Valadbeigi et al. (2011), https:// italic.units.it/ index.php Table 2. Comparison of L. pakistanica sp. nov. and related species of Lecaimmeria C.M.Xie, Lu L.Zhang & Li S.Wang. https://doi.org/10.1016/S0022-2836(05)80360-2 https://doi.org/10.1006/lich.1997.0133 https://doi.org/10.1111/j.1365-294X.1993.tb00005.x https://italic.units.it/index.php https://italic.units.it/index.php https://italic.units.it/index.php HABIB K. et al., Lecaimmeria pakistanica sp. nov. from Azad Jammu and Kashmir, Pakistan 101 Hall T.A. 2005. Bioedit Version 7.0.4. Department of Microbiology. North Carolina State University. Available from https://bioedit.software.informer.com [accessed 26 Jul. 2022]. Katoh K., Rozewicki J. & Yamada K.D. 2019. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20 (4): 1160–1166. https://doi.org/10.1093/bib/bbx108 Khan M., Khalid A.N. & Lumbsch H.T. 2018. A new species of Lecidea (Lecanorales, Ascomycota) from Pakistan. MycoKeys 38: 25–34. https://doi.org/10.3897/mycokeys.38.26960 Kumar S., Stecher G., Li M., Knyaz C.& Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35 (6): 1547–1549. https://doi.org/10.1093/molbev/msy096 Orange A., James P. & White F.J. 2001. Microchemical Methods for the Identification of Lichens. First Ed. British Lichen Society, London. Sambrook J. & Russell D.W. 2001. Detection of DNA in agarose gels. In: Molecular Cloning. A Laboratory Manual (3rd Ed.): 5–14. Cold Spring Harbor Laboratory Press, New York. Thiers B. continuously updated. Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. Available from http://sweetgum.nybg.org/science/ih/ [accessed 27 Jul. 2022]. Valadbeigi T., Sipman H.J. & Rambold G. 2011. The genus Immersaria (Lecideaceae) in Iran, including I. iranica sp. nov. The Lichenologist 43 (3): 203–208. https://doi.org/10.1017/s0024282911000077 White T.J., Bruns T., Lee S. & Taylor J. 1990. Amplification and direst sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J. & White. J.T. (eds) PCR Protocols. A Guide to the Methods and Applications: 315–322. Academic Press. https://doi.org/10.1016/B978-0-12-372180-8.50042-1 Xie C.M., Wang L.S., Zhao Z.T., Zhang Y.Y., Wang X.Y. & Zhang L.L. 2022. Revision of Immersaria and a new lecanorine genus in Lecideaceae (lichenised Ascomycota, Lecanoromycetes). MycoKeys 87: 99. https://doi.org/10.21203/rs.3.rs-645064/v1 Manuscript received: 24 July 2021 Manuscript accepted: 11 July 2022 Published on: 16 August 2022 Topic editor: Frederik Leliaert Desk editor: Radka Rosenbaumová Printed versions of all papers are also deposited in the libraries of the institutes that are members of the EJT consortium: Muséum national d’histoire naturelle, Paris, France; Meise Botanic Garden, Belgium; Royal Museum for Central Africa, Tervuren, Belgium; Royal Belgian Institute of Natural Sciences, Brussels, Belgium; Natural History Museum of Denmark, Copenhagen, Denmark; Naturalis Biodiversity Center, Leiden, the Netherlands; Museo Nacional de Ciencias Naturales-CSIC, Madrid, Spain; Real Jardín Botánico de Madrid CSIC, Spain; Leibniz Institute for the Analysis of Biodiversity Change, Bonn – Hamburg, Germany; National Museum, Prague, Czech Republic. https://bioedit.software.informer.com https://doi.org/10.1093/bib/bbx108 https://doi.org/10.3897/mycokeys.38.26960 https://doi.org/10.1093/molbev/msy096 http://sweetgum.nybg.org/science/ih/ https://doi.org/10.1017/s0024282911000077 https://doi.org/10.1016/B978-0-12-372180-8.50042-1 https://doi.org/10.21203/rs.3.rs-645064/v1