id	sid	tid	token	lemma	pos
bam-12761	1	1	layout	layout	NOUN
bam-12761	1	2	1	1	NUM
bam-12761	1	3	thematic	thematic	ADJ
bam-12761	1	4	section	section	NOUN
bam-12761	1	5	:	:	PUNCT
bam-12761	1	6	advances	advance	NOUN
bam-12761	1	7	in	in	ADP
bam-12761	1	8	musculoskeletal	musculoskeletal	ADJ
bam-12761	1	9	and	and	CCONJ
bam-12761	1	10	neuromuscular	neuromuscular	ADJ
bam-12761	1	11	rehabilitation	rehabilitation	NOUN
bam-12761	1	12	|	|	NOUN
bam-12761	1	13	maccarone	maccarone	PROPN
bam-12761	1	14	&	&	CCONJ
bam-12761	1	15	masiero	masiero	PROPN
bam-12761	1	16	eur	eur	PROPN
bam-12761	1	17	j	j	PROPN
bam-12761	1	18	transl	transl	PROPN
bam-12761	1	19	myol	myol	NOUN
bam-12761	1	20	34	34	NUM
bam-12761	1	21	(	(	PUNCT
bam-12761	1	22	4	4	NUM
bam-12761	1	23	)	)	PUNCT
bam-12761	1	24	12761	12761	NUM
bam-12761	1	25	,	,	PUNCT
bam-12761	1	26	2024	2024	NUM
bam-12761	1	27	doi	doi	NOUN
bam-12761	1	28	:	:	PUNCT
bam-12761	1	29	10.4081	10.4081	NUM
bam-12761	1	30	/	/	SYM
bam-12761	1	31	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	1	32	aging	aging	NOUN
bam-12761	1	33	is	be	AUX
bam-12761	1	34	associated	associate	VERB
bam-12761	1	35	with	with	ADP
bam-12761	1	36	a	a	DET
bam-12761	1	37	decrease	decrease	NOUN
bam-12761	1	38	in	in	ADP
bam-12761	1	39	physical	physical	ADJ
bam-12761	1	40	activity	activity	NOUN
bam-12761	1	41	and	and	CCONJ
bam-12761	1	42	functional	functional	ADJ
bam-12761	1	43	capacity	capacity	NOUN
bam-12761	1	44	concomitant	concomitant	ADJ
bam-12761	1	45	with	with	ADP
bam-12761	1	46	increases	increase	NOUN
bam-12761	1	47	in	in	ADP
bam-12761	1	48	fat	fat	ADJ
bam-12761	1	49	mass1	mass1	PROPN
bam-12761	1	50	.	.	PUNCT
bam-12761	2	1	increased	increase	VERB
bam-12761	2	2	secretion	secretion	NOUN
bam-12761	2	3	of	of	ADP
bam-12761	2	4	pro	pro	ADJ
bam-12761	2	5	-	-	ADJ
bam-12761	2	6	inflammatory	inflammatory	ADJ
bam-12761	2	7	cytokines	cytokine	NOUN
bam-12761	2	8	associated	associate	VERB
bam-12761	2	9	with	with	ADP
bam-12761	2	10	aging	aging	NOUN
bam-12761	2	11	can	can	AUX
bam-12761	2	12	disrupt	disrupt	VERB
bam-12761	2	13	insulin	insulin	NOUN
bam-12761	2	14	signaling	signal	VERB
bam-12761	2	15	and	and	CCONJ
bam-12761	2	16	increase	increase	VERB
bam-12761	2	17	systemic	systemic	ADJ
bam-12761	2	18	insulin	insulin	NOUN
bam-12761	2	19	resistance	resistance	NOUN
bam-12761	2	20	,	,	PUNCT
bam-12761	2	21	predisposing	predispose	VERB
bam-12761	2	22	individuals	individual	NOUN
bam-12761	2	23	to	to	ADP
bam-12761	2	24	diabetes.2	diabetes.2	PROPN
bam-12761	2	25	moreover	moreover	ADV
bam-12761	2	26	,	,	PUNCT
bam-12761	2	27	inflammation	inflammation	NOUN
bam-12761	2	28	and	and	CCONJ
bam-12761	2	29	oxidative	oxidative	ADJ
bam-12761	2	30	stress	stress	NOUN
bam-12761	2	31	caused	cause	VERB
bam-12761	2	32	by	by	ADP
bam-12761	2	33	obesity	obesity	NOUN
bam-12761	2	34	and	and	CCONJ
bam-12761	2	35	diabetes	diabetes	NOUN
bam-12761	2	36	act	act	VERB
bam-12761	2	37	as	as	ADP
bam-12761	2	38	regulators	regulator	NOUN
bam-12761	2	39	of	of	ADP
bam-12761	2	40	cell	cell	NOUN
bam-12761	2	41	signaling	signal	VERB
bam-12761	2	42	,	,	PUNCT
bam-12761	2	43	leading	lead	VERB
bam-12761	2	44	to	to	ADP
bam-12761	2	45	increased	increase	VERB
bam-12761	2	46	proteolysis	proteolysis	NOUN
bam-12761	2	47	and	and	CCONJ
bam-12761	2	48	muscle	muscle	NOUN
bam-12761	2	49	atrophy.3	atrophy.3	PROPN
bam-12761	2	50	stem	stem	NOUN
bam-12761	2	51	cells	cell	NOUN
bam-12761	2	52	(	(	PUNCT
bam-12761	2	53	satellite	satellite	NOUN
bam-12761	2	54	cells	cell	NOUN
bam-12761	2	55	)	)	PUNCT
bam-12761	2	56	are	be	AUX
bam-12761	2	57	closely	closely	ADV
bam-12761	2	58	associated	associate	VERB
bam-12761	2	59	with	with	ADP
bam-12761	2	60	muscle	muscle	NOUN
bam-12761	2	61	fiber	fiber	NOUN
bam-12761	2	62	regeneration	regeneration	NOUN
bam-12761	2	63	and	and	CCONJ
bam-12761	2	64	their	their	PRON
bam-12761	2	65	potential	potential	ADJ
bam-12761	2	66	decreases	decrease	NOUN
bam-12761	2	67	with	with	ADP
bam-12761	2	68	increasing	increase	VERB
bam-12761	2	69	age	age	NOUN
bam-12761	2	70	,	,	PUNCT
bam-12761	2	71	leading	lead	VERB
bam-12761	2	72	to	to	ADP
bam-12761	2	73	poor	poor	ADJ
bam-12761	2	74	muscle	muscle	NOUN
bam-12761	2	75	regeneration	regeneration	NOUN
bam-12761	2	76	after	after	ADP
bam-12761	2	77	trauma	trauma	NOUN
bam-12761	2	78	or	or	CCONJ
bam-12761	2	79	muscle	muscle	NOUN
bam-12761	2	80	injury.4	injury.4	VERB
bam-12761	2	81	a	a	DET
bam-12761	2	82	popular	popular	ADJ
bam-12761	2	83	method	method	NOUN
bam-12761	2	84	for	for	ADP
bam-12761	2	85	estimating	estimate	VERB
bam-12761	2	86	satellite	satellite	NOUN
bam-12761	2	87	cells	cell	NOUN
bam-12761	2	88	activity	activity	NOUN
bam-12761	2	89	is	be	AUX
bam-12761	2	90	through	through	ADP
bam-12761	2	91	myogenic	myogenic	ADJ
bam-12761	2	92	regulatory	regulatory	ADJ
bam-12761	2	93	factors	factor	NOUN
bam-12761	2	94	(	(	PUNCT
bam-12761	2	95	mrfs	mrfs	PROPN
bam-12761	2	96	)	)	PUNCT
bam-12761	2	97	,	,	PUNCT
bam-12761	2	98	including	include	VERB
bam-12761	2	99	myod	myod	PROPN
bam-12761	2	100	,	,	PUNCT
bam-12761	2	101	myf5	myf5	NOUN
bam-12761	2	102	,	,	PUNCT
bam-12761	2	103	myogenin	myogenin	ADJ
bam-12761	2	104	,	,	PUNCT
bam-12761	2	105	and	and	CCONJ
bam-12761	2	106	myogenic	myogenic	ADJ
bam-12761	2	107	regulatory	regulatory	ADJ
bam-12761	2	108	factor4	factor4	NOUN
bam-12761	2	109	(	(	PUNCT
bam-12761	2	110	mrf4	mrf4	PROPN
bam-12761	2	111	)	)	PUNCT
bam-12761	2	112	,	,	PUNCT
bam-12761	2	113	which	which	PRON
bam-12761	2	114	can	can	AUX
bam-12761	2	115	provide	provide	VERB
bam-12761	2	116	comparisons	comparison	NOUN
bam-12761	2	117	of	of	ADP
bam-12761	2	118	the	the	DET
bam-12761	2	119	number	number	NOUN
bam-12761	2	120	of	of	ADP
bam-12761	2	121	cells	cell	NOUN
bam-12761	2	122	between	between	ADP
bam-12761	2	123	different	different	ADJ
bam-12761	2	124	situations.5	situations.5	ADJ
bam-12761	2	125	exercise	exercise	NOUN
bam-12761	2	126	training	training	NOUN
bam-12761	2	127	and	and	CCONJ
bam-12761	2	128	nutritional	nutritional	ADJ
bam-12761	2	129	support	support	NOUN
bam-12761	2	130	are	be	AUX
bam-12761	2	131	effective	effective	ADJ
bam-12761	2	132	modulators	modulator	NOUN
bam-12761	2	133	of	of	ADP
bam-12761	2	134	skeletal	skeletal	ADJ
bam-12761	2	135	muscle	muscle	NOUN
bam-12761	2	136	proteins	protein	NOUN
bam-12761	2	137	that	that	PRON
bam-12761	2	138	work	work	VERB
bam-12761	2	139	synergistically	synergistically	ADV
bam-12761	2	140	to	to	PART
bam-12761	2	141	increase	increase	VERB
bam-12761	2	142	skeletal	skeletal	ADJ
bam-12761	2	143	muscle	muscle	NOUN
bam-12761	2	144	mass.6	mass.6	NOUN
bam-12761	2	145	in	in	ADP
bam-12761	2	146	this	this	DET
bam-12761	2	147	regard	regard	NOUN
bam-12761	2	148	,	,	PUNCT
bam-12761	2	149	high	high	ADJ
bam-12761	2	150	-	-	PUNCT
bam-12761	2	151	intensity	intensity	NOUN
bam-12761	2	152	interval	interval	NOUN
bam-12761	2	153	training	training	NOUN
bam-12761	2	154	(	(	PUNCT
bam-12761	2	155	hiit	hiit	PROPN
bam-12761	2	156	)	)	PUNCT
bam-12761	2	157	has	have	AUX
bam-12761	2	158	recently	recently	ADV
bam-12761	2	159	become	become	VERB
bam-12761	2	160	popular	popular	ADJ
bam-12761	2	161	for	for	ADP
bam-12761	2	162	its	its	PRON
bam-12761	2	163	benefits	benefit	NOUN
bam-12761	2	164	in	in	ADP
bam-12761	2	165	clinical	clinical	ADJ
bam-12761	2	166	populations	population	NOUN
bam-12761	2	167	.	.	PUNCT
bam-12761	3	1	as	as	ADP
bam-12761	3	2	for	for	ADP
bam-12761	3	3	diabetes	diabetes	NOUN
bam-12761	3	4	,	,	PUNCT
bam-12761	3	5	a	a	DET
bam-12761	3	6	review	review	NOUN
bam-12761	3	7	by	by	ADP
bam-12761	3	8	arrieta	arrieta	PROPN
bam-12761	3	9	-	-	PUNCT
bam-12761	3	10	leandro	leandro	PROPN
bam-12761	3	11	et	et	PROPN
bam-12761	3	12	al	al	PROPN
bam-12761	3	13	.	.	PROPN
bam-12761	4	1	(	(	PUNCT
bam-12761	4	2	2023	2023	NUM
bam-12761	4	3	)	)	PUNCT
bam-12761	4	4	concluded	conclude	VERB
bam-12761	4	5	that	that	SCONJ
bam-12761	4	6	hiit	hiit	PROPN
bam-12761	4	7	improves	improve	VERB
bam-12761	4	8	glycemic	glycemic	ADJ
bam-12761	4	9	control	control	NOUN
bam-12761	4	10	,	,	PUNCT
bam-12761	4	11	aerobic	aerobic	ADJ
bam-12761	4	12	resistance	resistance	NOUN
bam-12761	4	13	,	,	PUNCT
bam-12761	4	14	and	and	CCONJ
bam-12761	4	15	%	%	INTJ
bam-12761	4	16	fat	fat	ADJ
bam-12761	4	17	and	and	CCONJ
bam-12761	4	18	waist	waist	NOUN
bam-12761	4	19	circumference	circumference	NOUN
bam-12761	4	20	in	in	ADP
bam-12761	4	21	individuals	individual	NOUN
bam-12761	4	22	with	with	ADP
bam-12761	4	23	diabetes.7	diabetes.7	PROPN
bam-12761	4	24	hiit	hiit	PROPN
bam-12761	4	25	has	have	AUX
bam-12761	4	26	also	also	ADV
bam-12761	4	27	been	be	AUX
bam-12761	4	28	shown	show	VERB
bam-12761	4	29	to	to	PART
bam-12761	4	30	improve	improve	VERB
bam-12761	4	31	transcriptional	transcriptional	ADJ
bam-12761	4	32	and	and	CCONJ
bam-12761	4	33	translational	translational	ADJ
bam-12761	4	34	responses	response	NOUN
bam-12761	4	35	of	of	ADP
bam-12761	4	36	muscle	muscle	NOUN
bam-12761	4	37	cells.8	cells.8	ADJ
bam-12761	4	38	considering	consider	VERB
bam-12761	4	39	that	that	SCONJ
bam-12761	4	40	a	a	DET
bam-12761	4	41	single	single	ADJ
bam-12761	4	42	bout	bout	NOUN
bam-12761	4	43	of	of	ADP
bam-12761	4	44	hiit	hiit	PROPN
bam-12761	4	45	increased	increase	VERB
bam-12761	4	46	the	the	DET
bam-12761	4	47	activity	activity	NOUN
bam-12761	4	48	of	of	ADP
bam-12761	4	49	satellite	satellite	NOUN
bam-12761	4	50	cells	cell	NOUN
bam-12761	4	51	(	(	PUNCT
bam-12761	4	52	i.e.	i.e.	X
bam-12761	4	53	,	,	PUNCT
bam-12761	4	54	myod+/pax7	myod+/pax7	ADJ
bam-12761	4	55	+	+	NUM
bam-12761	4	56	cells	cell	NOUN
bam-12761	4	57	)	)	PUNCT
bam-12761	4	58	24	24	NUM
bam-12761	4	59	and	and	CCONJ
bam-12761	4	60	48	48	NUM
bam-12761	4	61	h	h	NOUN
bam-12761	4	62	after	after	ADP
bam-12761	4	63	exercise	exercise	NOUN
bam-12761	4	64	in	in	ADP
bam-12761	4	65	older	old	ADJ
bam-12761	4	66	men,9	men,9	NOUN
bam-12761	4	67	investigating	investigate	VERB
bam-12761	4	68	satellite	satellite	NOUN
bam-12761	4	69	cell	cell	NOUN
bam-12761	4	70	activity	activity	NOUN
bam-12761	4	71	in	in	ADP
bam-12761	4	72	response	response	NOUN
bam-12761	4	73	to	to	ADP
bam-12761	4	74	hiit	hiit	PROPN
bam-12761	4	75	can	can	AUX
bam-12761	4	76	provide	provide	VERB
bam-12761	4	77	mechanistic	mechanistic	ADJ
bam-12761	4	78	insights	insight	NOUN
bam-12761	4	79	into	into	ADP
bam-12761	4	80	the	the	DET
bam-12761	4	81	potential	potential	ADJ
bam-12761	4	82	factors	factor	NOUN
bam-12761	4	83	regulating	regulate	VERB
bam-12761	4	84	skeletal	skeletal	ADJ
bam-12761	4	85	muscle	muscle	NOUN
bam-12761	4	86	regeneration	regeneration	NOUN
bam-12761	4	87	.	.	PUNCT
bam-12761	5	1	spirulina	spirulina	PROPN
bam-12761	5	2	(	(	PUNCT
bam-12761	5	3	sp	sp	NOUN
bam-12761	5	4	)	)	PUNCT
bam-12761	5	5	has	have	AUX
bam-12761	5	6	been	be	AUX
bam-12761	5	7	shown	show	VERB
bam-12761	5	8	to	to	PART
bam-12761	5	9	be	be	AUX
bam-12761	5	10	a	a	DET
bam-12761	5	11	potential	potential	ADJ
bam-12761	5	12	supplement	supplement	NOUN
bam-12761	5	13	for	for	ADP
bam-12761	5	14	controlling	control	VERB
bam-12761	5	15	and	and	CCONJ
bam-12761	5	16	reducing	reduce	VERB
bam-12761	5	17	complications	complication	NOUN
bam-12761	5	18	caused	cause	VERB
bam-12761	5	19	abstract	abstract	ADV
bam-12761	5	20	this	this	DET
bam-12761	5	21	study	study	NOUN
bam-12761	5	22	aimed	aim	VERB
bam-12761	5	23	to	to	PART
bam-12761	5	24	investigate	investigate	VERB
bam-12761	5	25	changes	change	NOUN
bam-12761	5	26	in	in	ADP
bam-12761	5	27	protein	protein	NOUN
bam-12761	5	28	signaling	signal	VERB
bam-12761	5	29	associated	associate	VERB
bam-12761	5	30	with	with	ADP
bam-12761	5	31	muscle	muscle	NOUN
bam-12761	5	32	regeneration	regeneration	NOUN
bam-12761	5	33	in	in	ADP
bam-12761	5	34	aged	aged	ADJ
bam-12761	5	35	rats	rat	NOUN
bam-12761	5	36	with	with	ADP
bam-12761	5	37	obesity	obesity	NOUN
bam-12761	5	38	and	and	CCONJ
bam-12761	5	39	diabetes	diabetes	NOUN
bam-12761	5	40	following	follow	VERB
bam-12761	5	41	high	high	ADJ
bam-12761	5	42	-	-	PUNCT
bam-12761	5	43	intensity	intensity	NOUN
bam-12761	5	44	interval	interval	NOUN
bam-12761	5	45	training	training	NOUN
bam-12761	5	46	(	(	PUNCT
bam-12761	5	47	hiit	hiit	PROPN
bam-12761	5	48	)	)	PUNCT
bam-12761	5	49	and	and	CCONJ
bam-12761	5	50	sp	sp	ADP
bam-12761	5	51	supplementation	supplementation	NOUN
bam-12761	5	52	.	.	PUNCT
bam-12761	6	1	forty	forty	NUM
bam-12761	6	2	male	male	NOUN
bam-12761	6	3	wistar	wistar	PROPN
bam-12761	6	4	rats	rat	NOUN
bam-12761	6	5	weighting	weight	VERB
bam-12761	6	6	280	280	NUM
bam-12761	6	7	-	-	SYM
bam-12761	6	8	325	325	NUM
bam-12761	6	9	g	g	NOUN
bam-12761	6	10	were	be	AUX
bam-12761	6	11	used	use	VERB
bam-12761	6	12	in	in	ADP
bam-12761	6	13	this	this	DET
bam-12761	6	14	study	study	NOUN
bam-12761	6	15	.	.	PUNCT
bam-12761	7	1	obesity	obesity	NOUN
bam-12761	7	2	was	be	AUX
bam-12761	7	3	induced	induce	VERB
bam-12761	7	4	by	by	ADP
bam-12761	7	5	eight	eight	NUM
bam-12761	7	6	weeks	week	NOUN
bam-12761	7	7	of	of	ADP
bam-12761	7	8	a	a	DET
bam-12761	7	9	high	high	ADJ
bam-12761	7	10	-	-	PUNCT
bam-12761	7	11	fat	fat	NOUN
bam-12761	7	12	diet	diet	NOUN
bam-12761	7	13	,	,	PUNCT
bam-12761	7	14	and	and	CCONJ
bam-12761	7	15	diabetes	diabetes	NOUN
bam-12761	7	16	was	be	AUX
bam-12761	7	17	induced	induce	VERB
bam-12761	7	18	by	by	ADP
bam-12761	7	19	intraperitoneal	intraperitoneal	ADJ
bam-12761	7	20	injection	injection	NOUN
bam-12761	7	21	of	of	ADP
bam-12761	7	22	40	40	NUM
bam-12761	7	23	mg	mg	NOUN
bam-12761	7	24	/	/	SYM
bam-12761	7	25	kg	kg	NOUN
bam-12761	7	26	streptozocin	streptozocin	PROPN
bam-12761	7	27	.	.	PUNCT
bam-12761	8	1	rats	rat	NOUN
bam-12761	8	2	were	be	AUX
bam-12761	8	3	randomly	randomly	ADV
bam-12761	8	4	divided	divide	VERB
bam-12761	8	5	into	into	ADP
bam-12761	8	6	control	control	NOUN
bam-12761	8	7	(	(	PUNCT
bam-12761	8	8	con	con	PROPN
bam-12761	8	9	)	)	PUNCT
bam-12761	8	10	,	,	PUNCT
bam-12761	8	11	sham	sham	PROPN
bam-12761	8	12	,	,	PUNCT
bam-12761	8	13	sp	sp	NOUN
bam-12761	8	14	,	,	PUNCT
bam-12761	8	15	hiit	hiit	NOUN
bam-12761	8	16	,	,	PUNCT
bam-12761	8	17	and	and	CCONJ
bam-12761	8	18	hiit+sp	hiit+sp	PUNCT
bam-12761	8	19	groups	group	NOUN
bam-12761	8	20	.	.	PUNCT
bam-12761	9	1	hiit	hiit	PROPN
bam-12761	9	2	was	be	AUX
bam-12761	9	3	performed	perform	VERB
bam-12761	9	4	five	five	NUM
bam-12761	9	5	times	time	NOUN
bam-12761	9	6	per	per	ADP
bam-12761	9	7	week	week	NOUN
bam-12761	9	8	during	during	ADP
bam-12761	9	9	the	the	DET
bam-12761	9	10	8	8	NUM
bam-12761	9	11	-	-	PUNCT
bam-12761	9	12	week	week	NOUN
bam-12761	9	13	period	period	NOUN
bam-12761	9	14	.	.	PUNCT
bam-12761	10	1	sp	sp	ADP
bam-12761	10	2	dose	dose	PROPN
bam-12761	10	3	was	be	AUX
bam-12761	10	4	50	50	NUM
bam-12761	10	5	mg	mg	PROPN
bam-12761	10	6	/	/	SYM
bam-12761	10	7	kg	kg	PROPN
bam-12761	10	8	.	.	PUNCT
bam-12761	11	1	real	real	ADJ
bam-12761	11	2	-	-	PUNCT
bam-12761	11	3	time	time	NOUN
bam-12761	11	4	pcr	pcr	NOUN
bam-12761	11	5	was	be	AUX
bam-12761	11	6	used	use	VERB
bam-12761	11	7	to	to	PART
bam-12761	11	8	evaluate	evaluate	VERB
bam-12761	11	9	the	the	DET
bam-12761	11	10	expression	expression	NOUN
bam-12761	11	11	of	of	ADP
bam-12761	11	12	myogenin	myogenin	ADJ
bam-12761	11	13	,	,	PUNCT
bam-12761	11	14	myod1	myod1	NOUN
bam-12761	11	15	,	,	PUNCT
bam-12761	11	16	and	and	CCONJ
bam-12761	11	17	pax7	pax7	PROPN
bam-12761	11	18	.	.	PUNCT
bam-12761	12	1	the	the	DET
bam-12761	12	2	decreases	decrease	NOUN
bam-12761	12	3	in	in	ADP
bam-12761	12	4	body	body	NOUN
bam-12761	12	5	mass	mass	NOUN
bam-12761	12	6	in	in	ADP
bam-12761	12	7	the	the	DET
bam-12761	12	8	hiit	hiit	NOUN
bam-12761	12	9	,	,	PUNCT
bam-12761	12	10	hiit+sp	hiit+sp	X
bam-12761	12	11	and	and	CCONJ
bam-12761	12	12	sp	sp	ADP
bam-12761	12	13	groups	group	NOUN
bam-12761	12	14	were	be	AUX
bam-12761	12	15	significantly	significantly	ADV
bam-12761	12	16	higher	high	ADJ
bam-12761	12	17	than	than	ADP
bam-12761	12	18	those	those	PRON
bam-12761	12	19	in	in	ADP
bam-12761	12	20	the	the	DET
bam-12761	12	21	sham	sham	NOUN
bam-12761	12	22	and	and	CCONJ
bam-12761	12	23	con	con	NOUN
bam-12761	12	24	groups	group	NOUN
bam-12761	12	25	(	(	PUNCT
bam-12761	12	26	p=0.0001	p=0.0001	PROPN
bam-12761	12	27	)	)	PUNCT
bam-12761	12	28	.	.	PUNCT
bam-12761	13	1	the	the	DET
bam-12761	13	2	soleus	soleus	PROPN
bam-12761	13	3	muscle	muscle	NOUN
bam-12761	13	4	mass	mass	PROPN
bam-12761	13	5	increased	increase	VERB
bam-12761	13	6	significantly	significantly	ADV
bam-12761	13	7	only	only	ADV
bam-12761	13	8	in	in	ADP
bam-12761	13	9	the	the	DET
bam-12761	13	10	hiit	hiit	NOUN
bam-12761	13	11	and	and	CCONJ
bam-12761	13	12	hiit+sp	hiit+sp	PRON
bam-12761	13	13	groups	group	NOUN
bam-12761	13	14	(	(	PUNCT
bam-12761	13	15	p<0.01	p<0.01	PROPN
bam-12761	13	16	)	)	PUNCT
bam-12761	13	17	.	.	PUNCT
bam-12761	14	1	hiit+sp	hiit+sp	X
bam-12761	15	1	improved	improved	ADJ
bam-12761	15	2	fasting	fast	VERB
bam-12761	15	3	blood	blood	NOUN
bam-12761	15	4	glucose	glucose	NOUN
bam-12761	15	5	and	and	CCONJ
bam-12761	15	6	insulin	insulin	NOUN
bam-12761	15	7	levels	level	NOUN
bam-12761	15	8	more	more	ADV
bam-12761	15	9	than	than	ADP
bam-12761	15	10	hiit	hiit	PROPN
bam-12761	15	11	alone	alone	ADJ
bam-12761	15	12	and	and	CCONJ
bam-12761	15	13	sp	sp	ADP
bam-12761	15	14	(	(	PUNCT
bam-12761	15	15	p<0.05	p<0.05	NOUN
bam-12761	15	16	)	)	PUNCT
bam-12761	15	17	,	,	PUNCT
bam-12761	15	18	while	while	SCONJ
bam-12761	15	19	hiit	hiit	PROPN
bam-12761	15	20	increased	increase	VERB
bam-12761	15	21	the	the	DET
bam-12761	15	22	expression	expression	NOUN
bam-12761	15	23	levels	level	NOUN
bam-12761	15	24	of	of	ADP
bam-12761	15	25	myogenic	myogenic	ADJ
bam-12761	15	26	factors	factor	NOUN
bam-12761	15	27	more	more	ADJ
bam-12761	15	28	than	than	ADP
bam-12761	15	29	other	other	ADJ
bam-12761	15	30	groups	group	NOUN
bam-12761	15	31	(	(	PUNCT
bam-12761	15	32	p=0.0001	p=0.0001	PROPN
bam-12761	15	33	)	)	PUNCT
bam-12761	15	34	.	.	PUNCT
bam-12761	16	1	in	in	ADP
bam-12761	16	2	conclusion	conclusion	NOUN
bam-12761	16	3	hiit	hiit	PROPN
bam-12761	16	4	alone	alone	ADV
bam-12761	16	5	had	have	VERB
bam-12761	16	6	a	a	DET
bam-12761	16	7	significant	significant	ADJ
bam-12761	16	8	impact	impact	NOUN
bam-12761	16	9	on	on	ADP
bam-12761	16	10	myogenic	myogenic	ADJ
bam-12761	16	11	factors	factor	NOUN
bam-12761	16	12	,	,	PUNCT
bam-12761	16	13	whereas	whereas	SCONJ
bam-12761	16	14	spirulina	spirulina	PROPN
bam-12761	16	15	had	have	VERB
bam-12761	16	16	an	an	DET
bam-12761	16	17	effect	effect	NOUN
bam-12761	16	18	only	only	ADV
bam-12761	16	19	when	when	SCONJ
bam-12761	16	20	combined	combine	VERB
bam-12761	16	21	with	with	ADP
bam-12761	16	22	hiit	hiit	PROPN
bam-12761	16	23	.	.	PUNCT
bam-12761	17	1	key	key	ADJ
bam-12761	17	2	words	word	NOUN
bam-12761	17	3	:	:	PUNCT
bam-12761	17	4	high	high	ADJ
bam-12761	17	5	-	-	PUNCT
bam-12761	17	6	intensity	intensity	NOUN
bam-12761	17	7	interval	interval	NOUN
bam-12761	17	8	training	training	NOUN
bam-12761	17	9	;	;	PUNCT
bam-12761	17	10	spirulina	spirulina	NOUN
bam-12761	17	11	;	;	PUNCT
bam-12761	17	12	muscle	muscle	NOUN
bam-12761	17	13	regeneration	regeneration	NOUN
bam-12761	17	14	;	;	PUNCT
bam-12761	17	15	rats	rat	NOUN
bam-12761	17	16	;	;	PUNCT
bam-12761	17	17	resistance	resistance	NOUN
bam-12761	17	18	training	training	NOUN
bam-12761	17	19	.	.	PUNCT
bam-12761	18	1	eur	eur	PROPN
bam-12761	18	2	j	j	PROPN
bam-12761	18	3	transl	transl	PROPN
bam-12761	18	4	myol	myol	NOUN
bam-12761	18	5	34	34	NUM
bam-12761	18	6	(	(	PUNCT
bam-12761	18	7	4	4	NUM
bam-12761	18	8	)	)	PUNCT
bam-12761	18	9	12761	12761	NUM
bam-12761	18	10	,	,	PUNCT
bam-12761	18	11	2024	2024	NUM
bam-12761	18	12	doi	doi	NOUN
bam-12761	18	13	:	:	PUNCT
bam-12761	18	14	10.4081	10.4081	NUM
bam-12761	18	15	/	/	SYM
bam-12761	18	16	ejtm.2024.12761	ejtm.2024.12761	ADJ
bam-12761	18	17	high	high	ADJ
bam-12761	18	18	-	-	PUNCT
bam-12761	18	19	intensity	intensity	NOUN
bam-12761	18	20	interval	interval	NOUN
bam-12761	18	21	training	training	NOUN
bam-12761	18	22	,	,	PUNCT
bam-12761	18	23	but	but	CCONJ
bam-12761	18	24	not	not	PART
bam-12761	18	25	spirulina	spirulina	NOUN
bam-12761	18	26	supplementation	supplementation	NOUN
bam-12761	18	27	,	,	PUNCT
bam-12761	18	28	changes	change	VERB
bam-12761	18	29	muscle	muscle	NOUN
bam-12761	18	30	regeneration	regeneration	NOUN
bam-12761	18	31	signaling	signal	VERB
bam-12761	18	32	proteins	protein	NOUN
bam-12761	18	33	in	in	ADP
bam-12761	18	34	aged	aged	ADJ
bam-12761	18	35	rats	rat	NOUN
bam-12761	18	36	with	with	ADP
bam-12761	18	37	obesity	obesity	NOUN
bam-12761	18	38	and	and	CCONJ
bam-12761	18	39	diabetes	diabetes	NOUN
bam-12761	18	40	roya	roya	PROPN
bam-12761	18	41	askari,1	askari,1	PROPN
bam-12761	18	42	marzieh	marzieh	PROPN
bam-12761	18	43	sadat	sadat	VERB
bam-12761	18	44	azarniveh,1,2	azarniveh,1,2	PROPN
bam-12761	18	45	amir	amir	PROPN
bam-12761	18	46	hossein	hossein	PROPN
bam-12761	18	47	haghighi,1	haghighi,1	PROPN
bam-12761	18	48	hadi	hadi	PROPN
bam-12761	18	49	shahrabadi,1	shahrabadi,1	PROPN
bam-12761	18	50	paulo	paulo	PROPN
bam-12761	18	51	gentil3,4	gentil3,4	PROPN
bam-12761	18	52	1department	1department	NUM
bam-12761	18	53	of	of	ADP
bam-12761	18	54	exercise	exercise	NOUN
bam-12761	18	55	physiology	physiology	NOUN
bam-12761	18	56	,	,	PUNCT
bam-12761	18	57	faculty	faculty	NOUN
bam-12761	18	58	of	of	ADP
bam-12761	18	59	sport	sport	NOUN
bam-12761	18	60	sciences	sciences	PROPN
bam-12761	18	61	,	,	PUNCT
bam-12761	18	62	hakim	hakim	PROPN
bam-12761	18	63	sabzevari	sabzevari	PROPN
bam-12761	18	64	university	university	PROPN
bam-12761	18	65	,	,	PUNCT
bam-12761	18	66	sabzevar	sabzevar	NOUN
bam-12761	18	67	,	,	PUNCT
bam-12761	18	68	iran	iran	PROPN
bam-12761	18	69	;	;	PUNCT
bam-12761	18	70	2department	2department	NUM
bam-12761	18	71	of	of	ADP
bam-12761	18	72	sports	sport	NOUN
bam-12761	18	73	sciences	science	NOUN
bam-12761	18	74	,	,	PUNCT
bam-12761	18	75	faculty	faculty	NOUN
bam-12761	18	76	of	of	ADP
bam-12761	18	77	literature	literature	NOUN
bam-12761	18	78	and	and	CCONJ
bam-12761	18	79	humani	humani	NOUN
bam-12761	18	80	-	-	PUNCT
bam-12761	18	81	ties	tie	NOUN
bam-12761	18	82	,	,	PUNCT
bam-12761	18	83	zabol	zabol	NOUN
bam-12761	18	84	university	university	NOUN
bam-12761	18	85	,	,	PUNCT
bam-12761	18	86	zabol	zabol	NOUN
bam-12761	18	87	,	,	PUNCT
bam-12761	18	88	iran	iran	PROPN
bam-12761	18	89	;	;	PUNCT
bam-12761	18	90	3college	3college	NUM
bam-12761	18	91	of	of	ADP
bam-12761	18	92	physical	physical	ADJ
bam-12761	18	93	education	education	NOUN
bam-12761	18	94	and	and	CCONJ
bam-12761	18	95	dance	dance	NOUN
bam-12761	18	96	,	,	PUNCT
bam-12761	18	97	federal	federal	ADJ
bam-12761	18	98	university	university	PROPN
bam-12761	18	99	of	of	ADP
bam-12761	18	100	goias	goias	PROPN
bam-12761	18	101	,	,	PUNCT
bam-12761	18	102	goiânia	goiânia	PROPN
bam-12761	18	103	,	,	PUNCT
bam-12761	18	104	brazil	brazil	PROPN
bam-12761	18	105	;	;	PUNCT
bam-12761	18	106	4hypertension	4hypertension	PROPN
bam-12761	18	107	league	league	PROPN
bam-12761	18	108	federal	federal	PROPN
bam-12761	18	109	university	university	PROPN
bam-12761	18	110	of	of	ADP
bam-12761	18	111	goias	goias	PROPN
bam-12761	18	112	,	,	PUNCT
bam-12761	18	113	goiânia	goiânia	PROPN
bam-12761	18	114	,	,	PUNCT
bam-12761	18	115	brazil	brazil	PROPN
bam-12761	18	116	.	.	PUNCT
bam-12761	19	1	this	this	DET
bam-12761	19	2	article	article	NOUN
bam-12761	19	3	is	be	AUX
bam-12761	19	4	distributed	distribute	VERB
bam-12761	19	5	under	under	ADP
bam-12761	19	6	the	the	DET
bam-12761	19	7	terms	term	NOUN
bam-12761	19	8	of	of	ADP
bam-12761	19	9	the	the	DET
bam-12761	19	10	creative	creative	ADJ
bam-12761	19	11	commons	common	NOUN
bam-12761	19	12	attribution	attribution	NOUN
bam-12761	19	13	noncommercial	noncommercial	ADJ
bam-12761	19	14	license	license	NOUN
bam-12761	19	15	(	(	PUNCT
bam-12761	19	16	cc	cc	NOUN
bam-12761	19	17	by	by	ADP
bam-12761	19	18	-	-	PUNCT
bam-12761	19	19	nc	nc	PROPN
bam-12761	19	20	4.0	4.0	NUM
bam-12761	19	21	)	)	PUNCT
bam-12761	19	22	which	which	PRON
bam-12761	19	23	permits	permit	VERB
bam-12761	19	24	any	any	DET
bam-12761	19	25	noncommercial	noncommercial	ADJ
bam-12761	19	26	use	use	NOUN
bam-12761	19	27	,	,	PUNCT
bam-12761	19	28	distribution	distribution	NOUN
bam-12761	19	29	,	,	PUNCT
bam-12761	19	30	and	and	CCONJ
bam-12761	19	31	reproduction	reproduction	NOUN
bam-12761	19	32	in	in	ADP
bam-12761	19	33	any	any	DET
bam-12761	19	34	medium	medium	NOUN
bam-12761	19	35	,	,	PUNCT
bam-12761	19	36	provided	provide	VERB
bam-12761	19	37	the	the	DET
bam-12761	19	38	original	original	ADJ
bam-12761	19	39	author(s	author(s	NOUN
bam-12761	19	40	)	)	PUNCT
bam-12761	19	41	and	and	CCONJ
bam-12761	19	42	source	source	NOUN
bam-12761	19	43	are	be	AUX
bam-12761	19	44	credited	credit	VERB
bam-12761	19	45	.	.	PUNCT
bam-12761	20	1	25	25	NUM
bam-12761	20	2	non	non	ADJ
bam-12761	20	3	-co	-co	PROPN
bam-12761	20	4	mmerc	mmerc	PROPN
bam-12761	20	5	ial	ial	PROPN
bam-12761	20	6	us	us	PROPN
bam-12761	20	7	e	e	NOUN
bam-12761	20	8	o	o	X
bam-12761	20	9	nly	nly	ADV
bam-12761	20	10	high	high	ADJ
bam-12761	20	11	-	-	PUNCT
bam-12761	20	12	intensity	intensity	NOUN
bam-12761	20	13	interval	interval	NOUN
bam-12761	20	14	training	training	NOUN
bam-12761	20	15	,	,	PUNCT
bam-12761	20	16	but	but	CCONJ
bam-12761	20	17	not	not	PART
bam-12761	20	18	spirulina	spirulina	NOUN
bam-12761	20	19	supplementation	supplementation	NOUN
bam-12761	20	20	,	,	PUNCT
bam-12761	20	21	changes	change	VERB
bam-12761	20	22	muscle	muscle	NOUN
bam-12761	20	23	regeneration	regeneration	NOUN
bam-12761	20	24	signaling	signal	VERB
bam-12761	20	25	proteins	protein	NOUN
bam-12761	20	26	eur	eur	PROPN
bam-12761	20	27	j	j	PROPN
bam-12761	20	28	transl	transl	PROPN
bam-12761	20	29	myol	myol	NOUN
bam-12761	20	30	34	34	NUM
bam-12761	20	31	(	(	PUNCT
bam-12761	20	32	4	4	NUM
bam-12761	20	33	)	)	PUNCT
bam-12761	20	34	12761	12761	NUM
bam-12761	20	35	,	,	PUNCT
bam-12761	20	36	2024	2024	NUM
bam-12761	20	37	doi	doi	NOUN
bam-12761	20	38	:	:	PUNCT
bam-12761	20	39	10.4081	10.4081	NUM
bam-12761	20	40	/	/	SYM
bam-12761	20	41	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	20	42	by	by	ADP
bam-12761	20	43	advanced	advanced	ADJ
bam-12761	20	44	age.10	age.10	NOUN
bam-12761	20	45	sp	sp	NOUN
bam-12761	20	46	could	could	AUX
bam-12761	20	47	have	have	VERB
bam-12761	20	48	antioxidant	antioxidant	ADJ
bam-12761	20	49	effects	effect	NOUN
bam-12761	20	50	,	,	PUNCT
bam-12761	20	51	promote	promote	VERB
bam-12761	20	52	weight	weight	NOUN
bam-12761	20	53	loss,11	loss,11	NOUN
bam-12761	20	54	anti	anti	ADJ
bam-12761	20	55	-	-	ADJ
bam-12761	20	56	inflammatory	inflammatory	ADJ
bam-12761	20	57	effects	effect	NOUN
bam-12761	20	58	,	,	PUNCT
bam-12761	20	59	and	and	CCONJ
bam-12761	20	60	improve	improve	VERB
bam-12761	20	61	glycemic	glycemic	ADJ
bam-12761	20	62	control.12	control.12	NOUN
bam-12761	20	63	a	a	DET
bam-12761	20	64	study	study	NOUN
bam-12761	20	65	on	on	ADP
bam-12761	20	66	rats	rat	NOUN
bam-12761	20	67	showed	show	VERB
bam-12761	20	68	that	that	SCONJ
bam-12761	20	69	sp	sp	ADP
bam-12761	20	70	supplementation	supplementation	NOUN
bam-12761	20	71	,	,	PUNCT
bam-12761	20	72	when	when	SCONJ
bam-12761	20	73	combined	combine	VERB
bam-12761	20	74	with	with	ADP
bam-12761	20	75	resistance	resistance	NOUN
bam-12761	20	76	training	training	NOUN
bam-12761	20	77	,	,	PUNCT
bam-12761	20	78	improved	improve	VERB
bam-12761	20	79	antioxidant	antioxidant	ADJ
bam-12761	20	80	capacity	capacity	NOUN
bam-12761	20	81	and	and	CCONJ
bam-12761	20	82	attenuated	attenuate	VERB
bam-12761	20	83	exercise	exercise	NOUN
bam-12761	20	84	-	-	PUNCT
bam-12761	20	85	induced	induce	VERB
bam-12761	20	86	increases	increase	NOUN
bam-12761	20	87	in	in	ADP
bam-12761	20	88	ros	ros	PROPN
bam-12761	20	89	and	and	CCONJ
bam-12761	20	90	inflammation	inflammation	NOUN
bam-12761	20	91	without	without	ADP
bam-12761	20	92	compromising	compromise	VERB
bam-12761	20	93	the	the	DET
bam-12761	20	94	positive	positive	ADJ
bam-12761	20	95	physiological	physiological	ADJ
bam-12761	20	96	adaptations	adaptation	NOUN
bam-12761	20	97	to	to	PART
bam-12761	20	98	exercise	exercise	VERB
bam-12761	20	99	training.13	training.13	PROPN
bam-12761	20	100	lu	lu	INTJ
bam-12761	20	101	et	et	PROPN
bam-12761	20	102	al	al	PROPN
bam-12761	20	103	.	.	PROPN
bam-12761	21	1	(	(	PUNCT
bam-12761	21	2	2006	2006	NUM
bam-12761	21	3	)	)	PUNCT
bam-12761	21	4	provided	provide	VERB
bam-12761	21	5	sp	sp	ADP
bam-12761	21	6	supplementation	supplementation	NOUN
bam-12761	21	7	for	for	ADP
bam-12761	21	8	three	three	NUM
bam-12761	21	9	weeks	week	NOUN
bam-12761	21	10	before	before	ADP
bam-12761	21	11	a	a	DET
bam-12761	21	12	muscle	muscle	NOUN
bam-12761	21	13	damaging	damage	VERB
bam-12761	21	14	protocol	protocol	NOUN
bam-12761	21	15	and	and	CCONJ
bam-12761	21	16	reported	report	VERB
bam-12761	21	17	a	a	DET
bam-12761	21	18	reduction	reduction	NOUN
bam-12761	21	19	on	on	ADP
bam-12761	21	20	skeletal	skeletal	ADJ
bam-12761	21	21	muscle	muscle	NOUN
bam-12761	21	22	damage	damage	NOUN
bam-12761	21	23	in	in	ADP
bam-12761	21	24	trained	train	VERB
bam-12761	21	25	men.14	men.14	ADP
bam-12761	21	26	a	a	DET
bam-12761	21	27	literature	literature	NOUN
bam-12761	21	28	review	review	NOUN
bam-12761	21	29	by	by	ADP
bam-12761	21	30	calella	calella	PROPN
bam-12761	21	31	et	et	PROPN
bam-12761	21	32	al	al	PROPN
bam-12761	21	33	.	.	PROPN
bam-12761	22	1	(	(	PUNCT
bam-12761	22	2	2022	2022	NUM
bam-12761	22	3	)	)	PUNCT
bam-12761	22	4	concluded	conclude	VERB
bam-12761	22	5	that	that	SCONJ
bam-12761	22	6	sp	sp	ADP
bam-12761	22	7	has	have	VERB
bam-12761	22	8	ergogenic	ergogenic	ADJ
bam-12761	22	9	potential	potential	NOUN
bam-12761	22	10	during	during	ADP
bam-12761	22	11	submaximal	submaximal	ADJ
bam-12761	22	12	exercise	exercise	NOUN
bam-12761	22	13	,	,	PUNCT
bam-12761	22	14	increasing	increase	VERB
bam-12761	22	15	oxygen	oxygen	NOUN
bam-12761	22	16	uptake	uptake	NOUN
bam-12761	22	17	,	,	PUNCT
bam-12761	22	18	and	and	CCONJ
bam-12761	22	19	improving	improve	VERB
bam-12761	22	20	exercise	exercise	NOUN
bam-12761	22	21	tolerance	tolerance	NOUN
bam-12761	22	22	.	.	PUNCT
bam-12761	23	1	however	however	ADV
bam-12761	23	2	,	,	PUNCT
bam-12761	23	3	the	the	DET
bam-12761	23	4	authors	author	NOUN
bam-12761	23	5	highlighted	highlight	VERB
bam-12761	23	6	that	that	SCONJ
bam-12761	23	7	there	there	PRON
bam-12761	23	8	is	be	VERB
bam-12761	23	9	a	a	DET
bam-12761	23	10	lack	lack	NOUN
bam-12761	23	11	of	of	ADP
bam-12761	23	12	evidence	evidence	NOUN
bam-12761	23	13	supporting	support	VERB
bam-12761	23	14	the	the	DET
bam-12761	23	15	benefits	benefit	NOUN
bam-12761	23	16	of	of	ADP
bam-12761	23	17	sp	sp	ADP
bam-12761	23	18	supplementation	supplementation	NOUN
bam-12761	23	19	on	on	ADP
bam-12761	23	20	the	the	DET
bam-12761	23	21	immune	immune	ADJ
bam-12761	23	22	system	system	NOUN
bam-12761	23	23	,	,	PUNCT
bam-12761	23	24	and	and	CCONJ
bam-12761	23	25	the	the	DET
bam-12761	23	26	benefits	benefit	NOUN
bam-12761	23	27	of	of	ADP
bam-12761	23	28	sp	sp	ADP
bam-12761	23	29	supplementation	supplementation	NOUN
bam-12761	23	30	in	in	ADP
bam-12761	23	31	healthy	healthy	ADJ
bam-12761	23	32	people	people	NOUN
bam-12761	23	33	performing	perform	VERB
bam-12761	23	34	physical	physical	ADJ
bam-12761	23	35	exercise	exercise	NOUN
bam-12761	23	36	are	be	AUX
bam-12761	23	37	not	not	PART
bam-12761	23	38	consistent.15	consistent.15	NOUN
bam-12761	23	39	in	in	ADP
bam-12761	23	40	contrast	contrast	NOUN
bam-12761	23	41	,	,	PUNCT
bam-12761	23	42	chauoachi	chauoachi	NOUN
bam-12761	23	43	et	et	PROPN
bam-12761	23	44	al	al	PROPN
bam-12761	23	45	.	.	PROPN
bam-12761	24	1	(	(	PUNCT
bam-12761	24	2	2024	2024	NUM
bam-12761	24	3	)	)	PUNCT
bam-12761	24	4	suggested	suggest	VERB
bam-12761	24	5	positive	positive	ADJ
bam-12761	24	6	effects	effect	NOUN
bam-12761	24	7	of	of	ADP
bam-12761	24	8	sp	sp	ADP
bam-12761	24	9	on	on	ADP
bam-12761	24	10	body	body	NOUN
bam-12761	24	11	composition	composition	NOUN
bam-12761	24	12	,	,	PUNCT
bam-12761	24	13	especially	especially	ADV
bam-12761	24	14	in	in	ADP
bam-12761	24	15	overweight	overweight	ADJ
bam-12761	24	16	and	and	CCONJ
bam-12761	24	17	obese	obese	ADJ
bam-12761	24	18	subjects	subject	NOUN
bam-12761	24	19	,	,	PUNCT
bam-12761	24	20	which	which	PRON
bam-12761	24	21	could	could	AUX
bam-12761	24	22	not	not	PART
bam-12761	24	23	be	be	AUX
bam-12761	24	24	the	the	DET
bam-12761	24	25	case	case	NOUN
bam-12761	24	26	in	in	ADP
bam-12761	24	27	some	some	DET
bam-12761	24	28	pathologies	pathology	NOUN
bam-12761	24	29	.	.	PUNCT
bam-12761	25	1	moreover	moreover	ADV
bam-12761	25	2	,	,	PUNCT
bam-12761	25	3	this	this	DET
bam-12761	25	4	review	review	NOUN
bam-12761	25	5	highlights	highlight	VERB
bam-12761	25	6	the	the	DET
bam-12761	25	7	improvements	improvement	NOUN
bam-12761	25	8	in	in	ADP
bam-12761	25	9	aerobic	aerobic	ADJ
bam-12761	25	10	fitness	fitness	NOUN
bam-12761	25	11	and	and	CCONJ
bam-12761	25	12	muscle	muscle	NOUN
bam-12761	25	13	performance	performance	NOUN
bam-12761	25	14	,	,	PUNCT
bam-12761	25	15	especially	especially	ADV
bam-12761	25	16	in	in	ADP
bam-12761	25	17	untrained	untrained	ADJ
bam-12761	25	18	and	and	CCONJ
bam-12761	25	19	moderately	moderately	ADV
bam-12761	25	20	trained	train	VERB
bam-12761	25	21	subjects	subject	NOUN
bam-12761	25	22	,	,	PUNCT
bam-12761	25	23	and	and	CCONJ
bam-12761	25	24	highlights	highlight	NOUN
bam-12761	25	25	that	that	PRON
bam-12761	25	26	most	most	ADJ
bam-12761	25	27	studies	study	NOUN
bam-12761	25	28	show	show	VERB
bam-12761	25	29	improvements	improvement	NOUN
bam-12761	25	30	in	in	ADP
bam-12761	25	31	antioxidant	antioxidant	ADJ
bam-12761	25	32	status	status	NOUN
bam-12761	25	33	and	and	CCONJ
bam-12761	25	34	a	a	DET
bam-12761	25	35	reduction	reduction	NOUN
bam-12761	25	36	in	in	ADP
bam-12761	25	37	muscle	muscle	NOUN
bam-12761	25	38	damage	damage	NOUN
bam-12761	25	39	in	in	ADP
bam-12761	25	40	accelerated	accelerate	VERB
bam-12761	25	41	recovery.16	recovery.16	NOUN
bam-12761	25	42	in	in	ADP
bam-12761	25	43	addition	addition	NOUN
bam-12761	25	44	to	to	ADP
bam-12761	25	45	the	the	DET
bam-12761	25	46	apparent	apparent	ADJ
bam-12761	25	47	controversy	controversy	NOUN
bam-12761	25	48	,	,	PUNCT
bam-12761	25	49	we	we	PRON
bam-12761	25	50	are	be	AUX
bam-12761	25	51	not	not	PART
bam-12761	25	52	aware	aware	ADJ
bam-12761	25	53	of	of	ADP
bam-12761	25	54	any	any	DET
bam-12761	25	55	studies	study	NOUN
bam-12761	25	56	investigating	investigate	VERB
bam-12761	25	57	the	the	DET
bam-12761	25	58	effects	effect	NOUN
bam-12761	25	59	of	of	ADP
bam-12761	25	60	sp	sp	NOUN
bam-12761	25	61	on	on	ADP
bam-12761	25	62	skeletal	skeletal	ADJ
bam-12761	25	63	muscle	muscle	NOUN
bam-12761	25	64	at	at	ADP
bam-12761	25	65	the	the	DET
bam-12761	25	66	cellular	cellular	ADJ
bam-12761	25	67	and	and	CCONJ
bam-12761	25	68	molecular	molecular	ADJ
bam-12761	25	69	levels	level	NOUN
bam-12761	25	70	in	in	ADP
bam-12761	25	71	clinical	clinical	ADJ
bam-12761	25	72	situations	situation	NOUN
bam-12761	25	73	.	.	PUNCT
bam-12761	26	1	moreover	moreover	ADV
bam-12761	26	2	,	,	PUNCT
bam-12761	26	3	studies	study	NOUN
bam-12761	26	4	investigating	investigate	VERB
bam-12761	26	5	the	the	DET
bam-12761	26	6	interaction	interaction	NOUN
bam-12761	26	7	between	between	ADP
bam-12761	26	8	exercise	exercise	NOUN
bam-12761	26	9	training	training	NOUN
bam-12761	26	10	and	and	CCONJ
bam-12761	26	11	sp	sp	ADP
bam-12761	26	12	supplementation	supplementation	NOUN
bam-12761	26	13	have	have	AUX
bam-12761	26	14	reported	report	VERB
bam-12761	26	15	different	different	ADJ
bam-12761	26	16	results	result	NOUN
bam-12761	26	17	,	,	PUNCT
bam-12761	26	18	with	with	ADP
bam-12761	26	19	either	either	PRON
bam-12761	26	20	improvement17	improvement17	NOUN
bam-12761	26	21	or	or	CCONJ
bam-12761	26	22	no	no	DET
bam-12761	26	23	change18	change18	NOUN
bam-12761	26	24	in	in	ADP
bam-12761	26	25	glycemic	glycemic	ADJ
bam-12761	26	26	and	and	CCONJ
bam-12761	26	27	weight	weight	NOUN
bam-12761	26	28	control	control	NOUN
bam-12761	26	29	.	.	PUNCT
bam-12761	27	1	therefore	therefore	ADV
bam-12761	27	2	,	,	PUNCT
bam-12761	27	3	this	this	DET
bam-12761	27	4	study	study	NOUN
bam-12761	27	5	aimed	aim	VERB
bam-12761	27	6	to	to	PART
bam-12761	27	7	investigate	investigate	VERB
bam-12761	27	8	the	the	DET
bam-12761	27	9	effects	effect	NOUN
bam-12761	27	10	of	of	ADP
bam-12761	27	11	hiit	hiit	PROPN
bam-12761	27	12	and	and	CCONJ
bam-12761	27	13	sp	sp	ADP
bam-12761	27	14	supplementation	supplementation	NOUN
bam-12761	27	15	,	,	PUNCT
bam-12761	27	16	alone	alone	ADV
bam-12761	27	17	or	or	CCONJ
bam-12761	27	18	in	in	ADP
bam-12761	27	19	combination	combination	NOUN
bam-12761	27	20	,	,	PUNCT
bam-12761	27	21	in	in	ADP
bam-12761	27	22	the	the	DET
bam-12761	27	23	expression	expression	NOUN
bam-12761	27	24	of	of	ADP
bam-12761	27	25	myogenic	myogenic	ADJ
bam-12761	27	26	factors	factor	NOUN
bam-12761	27	27	(	(	PUNCT
bam-12761	27	28	i.e.	i.e.	X
bam-12761	27	29	,	,	PUNCT
bam-12761	27	30	myod1	myod1	NOUN
bam-12761	27	31	,	,	PUNCT
bam-12761	27	32	pax7	pax7	PROPN
bam-12761	27	33	,	,	PUNCT
bam-12761	27	34	myogenin	myogenin	ADJ
bam-12761	27	35	,	,	PUNCT
bam-12761	27	36	and	and	CCONJ
bam-12761	27	37	myod1	myod1	PROPN
bam-12761	27	38	/	/	SYM
bam-12761	27	39	pax7	pax7	PROPN
bam-12761	27	40	)	)	PUNCT
bam-12761	27	41	in	in	ADP
bam-12761	27	42	aged	aged	ADJ
bam-12761	27	43	rats	rat	NOUN
bam-12761	27	44	with	with	ADP
bam-12761	27	45	obesity	obesity	NOUN
bam-12761	27	46	and	and	CCONJ
bam-12761	27	47	diabetes	diabetes	NOUN
bam-12761	27	48	.	.	PUNCT
bam-12761	28	1	materials	material	NOUN
bam-12761	28	2	and	and	CCONJ
bam-12761	28	3	methods	method	NOUN
bam-12761	28	4	animals	animal	NOUN
bam-12761	28	5	this	this	DET
bam-12761	28	6	study	study	NOUN
bam-12761	28	7	was	be	AUX
bam-12761	28	8	approved	approve	VERB
bam-12761	28	9	by	by	ADP
bam-12761	28	10	the	the	DET
bam-12761	28	11	research	research	NOUN
bam-12761	28	12	ethics	ethic	NOUN
bam-12761	28	13	committee	committee	PROPN
bam-12761	28	14	of	of	ADP
bam-12761	28	15	hakim	hakim	PROPN
bam-12761	28	16	sabzevari	sabzevari	PROPN
bam-12761	28	17	university	university	PROPN
bam-12761	28	18	(	(	PUNCT
bam-12761	28	19	code	code	PROPN
bam-12761	28	20	ir	ir	PROPN
bam-12761	28	21	.	.	PUNCT
bam-12761	29	1	hsu	hsu	PROPN
bam-12761	29	2	.	.	PUNCT
bam-12761	29	3	rec.1400.007	rec.1400.007	PROPN
bam-12761	29	4	)	)	PUNCT
bam-12761	29	5	.	.	PUNCT
bam-12761	30	1	forty	forty	NUM
bam-12761	30	2	male	male	NOUN
bam-12761	30	3	wistar	wistar	PROPN
bam-12761	30	4	rats	rat	NOUN
bam-12761	30	5	,	,	PUNCT
bam-12761	30	6	aged	aged	ADJ
bam-12761	30	7	20	20	NUM
bam-12761	30	8	-	-	PUNCT
bam-12761	30	9	month	month	NOUN
bam-12761	30	10	and	and	CCONJ
bam-12761	30	11	with	with	SCONJ
bam-12761	30	12	an	an	DET
bam-12761	30	13	average	average	ADJ
bam-12761	30	14	weight	weight	NOUN
bam-12761	30	15	of	of	ADP
bam-12761	30	16	280	280	NUM
bam-12761	30	17	-	-	SYM
bam-12761	30	18	325	325	NUM
bam-12761	30	19	g	g	NOUN
bam-12761	30	20	were	be	AUX
bam-12761	30	21	purchased	purchase	VERB
bam-12761	30	22	and	and	CCONJ
bam-12761	30	23	transferred	transfer	VERB
bam-12761	30	24	to	to	ADP
bam-12761	30	25	the	the	DET
bam-12761	30	26	laboratory	laboratory	NOUN
bam-12761	30	27	environment	environment	NOUN
bam-12761	30	28	.	.	PUNCT
bam-12761	31	1	the	the	DET
bam-12761	31	2	rats	rat	NOUN
bam-12761	31	3	were	be	AUX
bam-12761	31	4	kept	keep	VERB
bam-12761	31	5	at	at	ADP
bam-12761	31	6	a	a	DET
bam-12761	31	7	temperature	temperature	NOUN
bam-12761	31	8	of	of	ADP
bam-12761	31	9	22±2	22±2	NUM
bam-12761	31	10	°	°	NOUN
bam-12761	31	11	c	c	NOUN
bam-12761	31	12	,	,	PUNCT
bam-12761	31	13	humidity	humidity	NOUN
bam-12761	31	14	of	of	ADP
bam-12761	31	15	4050	4050	NUM
bam-12761	31	16	%	%	NOUN
bam-12761	31	17	and	and	CCONJ
bam-12761	31	18	light	light	NOUN
bam-12761	31	19	and	and	CCONJ
bam-12761	31	20	12:12	12:12	NUM
bam-12761	31	21	h.	h.	NOUN
bam-12761	31	22	induction	induction	NOUN
bam-12761	31	23	of	of	ADP
bam-12761	31	24	obesity	obesity	NOUN
bam-12761	31	25	and	and	CCONJ
bam-12761	31	26	diabetes	diabetes	NOUN
bam-12761	31	27	obesity	obesity	NOUN
bam-12761	31	28	was	be	AUX
bam-12761	31	29	induced	induce	VERB
bam-12761	31	30	by	by	ADP
bam-12761	31	31	a	a	DET
bam-12761	31	32	high	high	ADJ
bam-12761	31	33	-	-	PUNCT
bam-12761	31	34	fat	fat	NOUN
bam-12761	31	35	diet	diet	NOUN
bam-12761	31	36	derived	derive	VERB
bam-12761	31	37	from	from	ADP
bam-12761	31	38	soybeans	soybean	NOUN
bam-12761	31	39	and	and	CCONJ
bam-12761	31	40	vegetable	vegetable	NOUN
bam-12761	31	41	oil	oil	NOUN
bam-12761	31	42	(	(	PUNCT
bam-12761	31	43	40	40	NUM
bam-12761	31	44	%	%	NOUN
bam-12761	31	45	fat	fat	NOUN
bam-12761	31	46	,	,	PUNCT
bam-12761	31	47	13	13	NUM
bam-12761	31	48	%	%	NOUN
bam-12761	31	49	protein	protein	NOUN
bam-12761	31	50	,	,	PUNCT
bam-12761	31	51	and	and	CCONJ
bam-12761	31	52	47	47	NUM
bam-12761	31	53	%	%	NOUN
bam-12761	31	54	carbohydrates	carbohydrate	NOUN
bam-12761	31	55	)	)	PUNCT
bam-12761	31	56	,	,	PUNCT
bam-12761	31	57	which	which	PRON
bam-12761	31	58	was	be	AUX
bam-12761	31	59	prepared	prepare	VERB
bam-12761	31	60	and	and	CCONJ
bam-12761	31	61	used	use	VERB
bam-12761	31	62	under	under	ADP
bam-12761	31	63	the	the	DET
bam-12761	31	64	supervision	supervision	NOUN
bam-12761	31	65	of	of	ADP
bam-12761	31	66	livestock	livestock	NOUN
bam-12761	31	67	and	and	CCONJ
bam-12761	31	68	poultry	poultry	NOUN
bam-12761	31	69	specialists	specialist	NOUN
bam-12761	31	70	for	for	ADP
bam-12761	31	71	eight	eight	NUM
bam-12761	31	72	weeks	week	NOUN
bam-12761	31	73	.	.	PUNCT
bam-12761	32	1	rats	rat	NOUN
bam-12761	32	2	required	require	VERB
bam-12761	32	3	10	10	NUM
bam-12761	32	4	g	g	NOUN
bam-12761	32	5	of	of	ADP
bam-12761	32	6	pellets	pellet	NOUN
bam-12761	32	7	and	and	CCONJ
bam-12761	32	8	10	10	NUM
bam-12761	32	9	-	-	SYM
bam-12761	32	10	15	15	NUM
bam-12761	32	11	ml	ml	NOUN
bam-12761	32	12	of	of	ADP
bam-12761	32	13	water	water	NOUN
bam-12761	32	14	per	per	ADP
bam-12761	32	15	100	100	NUM
bam-12761	32	16	g	g	NOUN
bam-12761	32	17	of	of	ADP
bam-12761	32	18	body	body	NOUN
bam-12761	32	19	weight	weight	NOUN
bam-12761	32	20	daily19	daily19	NOUN
bam-12761	32	21	and	and	CCONJ
bam-12761	32	22	had	have	VERB
bam-12761	32	23	free	free	ADJ
bam-12761	32	24	access	access	NOUN
bam-12761	32	25	to	to	ADP
bam-12761	32	26	food	food	NOUN
bam-12761	32	27	and	and	CCONJ
bam-12761	32	28	water	water	NOUN
bam-12761	32	29	.	.	PUNCT
bam-12761	33	1	type	type	NOUN
bam-12761	33	2	1	1	NUM
bam-12761	33	3	diabetes	diabetes	NOUN
bam-12761	33	4	was	be	AUX
bam-12761	33	5	induced	induce	VERB
bam-12761	33	6	after	after	SCONJ
bam-12761	33	7	the	the	DET
bam-12761	33	8	rats	rat	NOUN
bam-12761	33	9	’	'	PUNCT
bam-12761	33	10	weight	weight	NOUN
bam-12761	33	11	exceeded	exceed	VERB
bam-12761	33	12	310	310	NUM
bam-12761	33	13	g	g	NOUN
bam-12761	33	14	by	by	ADP
bam-12761	33	15	an	an	DET
bam-12761	33	16	intraperitoneal	intraperitoneal	ADJ
bam-12761	33	17	single	single	ADJ
bam-12761	33	18	-	-	PUNCT
bam-12761	33	19	dose	dose	NOUN
bam-12761	33	20	injection	injection	NOUN
bam-12761	33	21	of	of	ADP
bam-12761	33	22	streptozotocin	streptozotocin	PROPN
bam-12761	33	23	(	(	PUNCT
bam-12761	33	24	stz	stz	NOUN
bam-12761	33	25	;	;	PUNCT
bam-12761	33	26	sigma	sigma	PROPN
bam-12761	33	27	,	,	PUNCT
bam-12761	33	28	germany	germany	PROPN
bam-12761	33	29	)	)	PUNCT
bam-12761	33	30	.	.	PUNCT
bam-12761	34	1	stz	stz	NOUN
bam-12761	34	2	(	(	PUNCT
bam-12761	34	3	40	40	NUM
bam-12761	34	4	mg	mg	PROPN
bam-12761	34	5	/	/	SYM
bam-12761	34	6	kg	kg	PROPN
bam-12761	34	7	body	body	NOUN
bam-12761	34	8	weight	weight	NOUN
bam-12761	34	9	)	)	PUNCT
bam-12761	34	10	was	be	AUX
bam-12761	34	11	dissolved	dissolve	VERB
bam-12761	34	12	in	in	ADP
bam-12761	34	13	sodium	sodium	NOUN
bam-12761	34	14	citrate	citrate	NOUN
bam-12761	34	15	buffer	buffer	NOUN
bam-12761	34	16	solution	solution	NOUN
bam-12761	34	17	(	(	PUNCT
bam-12761	34	18	ph	ph	NOUN
bam-12761	34	19	4.5	4.5	NUM
bam-12761	34	20	)	)	PUNCT
bam-12761	34	21	and	and	CCONJ
bam-12761	34	22	injected	inject	VERB
bam-12761	34	23	into	into	ADP
bam-12761	34	24	the	the	DET
bam-12761	34	25	rats	rat	NOUN
bam-12761	34	26	after	after	ADP
bam-12761	34	27	a	a	DET
bam-12761	34	28	12	12	NUM
bam-12761	34	29	-	-	PUNCT
bam-12761	34	30	h	h	NOUN
bam-12761	34	31	fasting	fasting	NOUN
bam-12761	34	32	period	period	NOUN
bam-12761	34	33	.	.	PUNCT
bam-12761	35	1	after	after	ADP
bam-12761	35	2	five	five	NUM
bam-12761	35	3	days	day	NOUN
bam-12761	35	4	,	,	PUNCT
bam-12761	35	5	blood	blood	NOUN
bam-12761	35	6	glucose	glucose	NOUN
bam-12761	35	7	levels	level	NOUN
bam-12761	35	8	were	be	AUX
bam-12761	35	9	measured	measure	VERB
bam-12761	35	10	using	use	VERB
bam-12761	35	11	blood	blood	NOUN
bam-12761	35	12	samples	sample	NOUN
bam-12761	35	13	collected	collect	VERB
bam-12761	35	14	from	from	ADP
bam-12761	35	15	the	the	DET
bam-12761	35	16	tails	tail	NOUN
bam-12761	35	17	of	of	ADP
bam-12761	35	18	the	the	DET
bam-12761	35	19	animals	animal	NOUN
bam-12761	35	20	using	use	VERB
bam-12761	35	21	a	a	DET
bam-12761	35	22	glucometer	glucometer	NOUN
bam-12761	35	23	(	(	PUNCT
bam-12761	35	24	beurer	beurer	NOUN
bam-12761	35	25	,	,	PUNCT
bam-12761	35	26	gl42	gl42	PROPN
bam-12761	35	27	,	,	PUNCT
bam-12761	35	28	germany	germany	PROPN
bam-12761	35	29	)	)	PUNCT
bam-12761	35	30	and	and	CCONJ
bam-12761	35	31	the	the	DET
bam-12761	35	32	glucose	glucose	NOUN
bam-12761	35	33	oxidase	oxidase	NOUN
bam-12761	35	34	enzyme	enzyme	NOUN
bam-12761	35	35	method	method	NOUN
bam-12761	35	36	.	.	PUNCT
bam-12761	36	1	rats	rat	NOUN
bam-12761	36	2	were	be	AUX
bam-12761	36	3	diagnosed	diagnose	VERB
bam-12761	36	4	with	with	ADP
bam-12761	36	5	diabetes	diabetes	NOUN
bam-12761	36	6	if	if	SCONJ
bam-12761	36	7	their	their	PRON
bam-12761	36	8	glucose	glucose	NOUN
bam-12761	36	9	concentration	concentration	NOUN
bam-12761	36	10	was	be	AUX
bam-12761	36	11	>	>	X
bam-12761	36	12	200	200	NUM
bam-12761	36	13	mg	mg	NUM
bam-12761	36	14	/	/	SYM
bam-12761	36	15	ml.8	ml.8	PROPN
bam-12761	36	16	they	they	PRON
bam-12761	36	17	were	be	AUX
bam-12761	36	18	then	then	ADV
bam-12761	36	19	weighed	weigh	VERB
bam-12761	36	20	using	use	VERB
bam-12761	36	21	a	a	DET
bam-12761	36	22	digital	digital	ADJ
bam-12761	36	23	scale	scale	NOUN
bam-12761	36	24	(	(	PUNCT
bam-12761	36	25	rat	rat	NOUN
bam-12761	36	26	grimace	grimace	NOUN
bam-12761	36	27	scale	scale	NOUN
bam-12761	36	28	)	)	PUNCT
bam-12761	36	29	with	with	ADP
bam-12761	36	30	an	an	DET
bam-12761	36	31	accuracy	accuracy	NOUN
bam-12761	36	32	of	of	ADP
bam-12761	36	33	0.0001	0.0001	NUM
bam-12761	36	34	g.	g.	NOUN
bam-12761	36	35	the	the	DET
bam-12761	36	36	obese	obese	ADJ
bam-12761	36	37	and	and	CCONJ
bam-12761	36	38	diabetic	diabetic	ADJ
bam-12761	36	39	rats	rat	NOUN
bam-12761	36	40	were	be	AUX
bam-12761	36	41	then	then	ADV
bam-12761	36	42	randomly	randomly	ADV
bam-12761	36	43	divided	divide	VERB
bam-12761	36	44	into	into	ADP
bam-12761	36	45	four	four	NUM
bam-12761	36	46	groups	group	NOUN
bam-12761	36	47	of	of	ADP
bam-12761	36	48	eight	eight	NUM
bam-12761	36	49	:	:	PUNCT
bam-12761	36	50	hiit	hiit	NOUN
bam-12761	36	51	,	,	PUNCT
bam-12761	36	52	sp	sp	NOUN
bam-12761	36	53	,	,	PUNCT
bam-12761	36	54	hiit	hiit	PROPN
bam-12761	36	55	+	+	CCONJ
bam-12761	36	56	sp	sp	ADP
bam-12761	36	57	and	and	CCONJ
bam-12761	36	58	sham	sham	NOUN
bam-12761	36	59	(	(	PUNCT
bam-12761	36	60	normal	normal	ADJ
bam-12761	36	61	saline	saline	NOUN
bam-12761	36	62	)	)	PUNCT
bam-12761	36	63	.	.	PUNCT
bam-12761	37	1	we	we	PRON
bam-12761	37	2	also	also	ADV
bam-12761	37	3	selected	select	VERB
bam-12761	37	4	8	8	NUM
bam-12761	37	5	rats	rat	NOUN
bam-12761	37	6	as	as	ADP
bam-12761	37	7	the	the	DET
bam-12761	37	8	control	control	NOUN
bam-12761	37	9	(	(	PUNCT
bam-12761	37	10	con	con	PROPN
bam-12761	37	11	)	)	PUNCT
bam-12761	37	12	group	group	NOUN
bam-12761	37	13	before	before	ADP
bam-12761	37	14	induction	induction	NOUN
bam-12761	37	15	of	of	ADP
bam-12761	37	16	obesity	obesity	NOUN
bam-12761	37	17	and	and	CCONJ
bam-12761	37	18	diabetes	diabetes	NOUN
bam-12761	37	19	(	(	PUNCT
bam-12761	37	20	basic	basic	ADJ
bam-12761	37	21	con	con	NOUN
bam-12761	37	22	)	)	PUNCT
bam-12761	37	23	.	.	PUNCT
bam-12761	38	1	spirulina	spirulina	PROPN
bam-12761	38	2	and	and	CCONJ
bam-12761	38	3	placebo	placebo	NOUN
bam-12761	38	4	supplementation	supplementation	NOUN
bam-12761	38	5	the	the	DET
bam-12761	38	6	supplement	supplement	NOUN
bam-12761	38	7	was	be	AUX
bam-12761	38	8	sp	sp	ADP
bam-12761	38	9	algae	algae	NOUN
bam-12761	38	10	powder	powder	NOUN
bam-12761	38	11	(	(	PUNCT
bam-12761	38	12	far	far	ADV
bam-12761	38	13	east	east	NOUN
bam-12761	38	14	microalgae	microalgae	NOUN
bam-12761	38	15	,	,	PUNCT
bam-12761	38	16	taiwan	taiwan	PROPN
bam-12761	38	17	)	)	PUNCT
bam-12761	38	18	,	,	PUNCT
bam-12761	38	19	prepared	prepare	VERB
bam-12761	38	20	by	by	ADP
bam-12761	38	21	sina	sina	PROPN
bam-12761	38	22	riz	riz	PROPN
bam-12761	38	23	algae	algae	PROPN
bam-12761	38	24	(	(	PUNCT
bam-12761	38	25	qeshm	qeshm	ADJ
bam-12761	38	26	,	,	PUNCT
bam-12761	38	27	iran	iran	PROPN
bam-12761	38	28	)	)	PUNCT
bam-12761	38	29	.	.	PUNCT
bam-12761	39	1	sp	sp	ADP
bam-12761	39	2	algae	algae	NOUN
bam-12761	39	3	powder	powder	NOUN
bam-12761	39	4	was	be	AUX
bam-12761	39	5	diluted	dilute	VERB
bam-12761	39	6	with	with	ADP
bam-12761	39	7	normal	normal	ADJ
bam-12761	39	8	saline	saline	ADJ
bam-12761	39	9	solution	solution	NOUN
bam-12761	39	10	at	at	ADP
bam-12761	39	11	a	a	DET
bam-12761	39	12	rate	rate	NOUN
bam-12761	39	13	of	of	ADP
bam-12761	39	14	50	50	NUM
bam-12761	39	15	mg	mg	PROPN
bam-12761	39	16	/	/	SYM
bam-12761	39	17	kg	kg	PROPN
bam-12761	39	18	body	body	NOUN
bam-12761	39	19	weight,23	weight,23	NOUN
bam-12761	39	20	and	and	CCONJ
bam-12761	39	21	was	be	AUX
bam-12761	39	22	administered	administer	VERB
bam-12761	39	23	by	by	ADP
bam-12761	39	24	gavage	gavage	NOUN
bam-12761	39	25	to	to	ADP
bam-12761	39	26	the	the	DET
bam-12761	39	27	rats	rat	NOUN
bam-12761	39	28	in	in	ADP
bam-12761	39	29	the	the	DET
bam-12761	39	30	supplement	supplement	NOUN
bam-12761	39	31	-	-	PUNCT
bam-12761	39	32	consuming	consume	VERB
bam-12761	39	33	groups	group	NOUN
bam-12761	39	34	,	,	PUNCT
bam-12761	39	35	five	five	NUM
bam-12761	39	36	days	day	NOUN
bam-12761	39	37	per	per	ADP
bam-12761	39	38	week	week	NOUN
bam-12761	39	39	for	for	ADP
bam-12761	39	40	a	a	DET
bam-12761	39	41	period	period	NOUN
bam-12761	39	42	of	of	ADP
bam-12761	39	43	eight	eight	NUM
bam-12761	39	44	weeks	week	NOUN
bam-12761	39	45	.	.	PUNCT
bam-12761	40	1	to	to	PART
bam-12761	40	2	establish	establish	VERB
bam-12761	40	3	the	the	DET
bam-12761	40	4	same	same	ADJ
bam-12761	40	5	conditions	condition	NOUN
bam-12761	40	6	,	,	PUNCT
bam-12761	40	7	the	the	DET
bam-12761	40	8	same	same	ADJ
bam-12761	40	9	amount	amount	NOUN
bam-12761	40	10	of	of	ADP
bam-12761	40	11	a	a	DET
bam-12761	40	12	normal	normal	ADJ
bam-12761	40	13	saline	saline	NOUN
bam-12761	40	14	solution	solution	NOUN
bam-12761	40	15	was	be	AUX
bam-12761	40	16	used	use	VERB
bam-12761	40	17	as	as	ADP
bam-12761	40	18	a	a	DET
bam-12761	40	19	placebo	placebo	NOUN
bam-12761	40	20	in	in	ADP
bam-12761	40	21	the	the	DET
bam-12761	40	22	groups	group	NOUN
bam-12761	40	23	that	that	PRON
bam-12761	40	24	did	do	AUX
bam-12761	40	25	not	not	PART
bam-12761	40	26	consume	consume	VERB
bam-12761	40	27	sp	sp	NOUN
bam-12761	40	28	.	.	PUNCT
bam-12761	40	29	determination	determination	NOUN
bam-12761	40	30	of	of	ADP
bam-12761	40	31	vo2max	vo2max	NOUN
bam-12761	40	32	and	and	CCONJ
bam-12761	40	33	training	training	NOUN
bam-12761	40	34	protocol	protocol	NOUN
bam-12761	40	35	a	a	DET
bam-12761	40	36	progressive	progressive	ADJ
bam-12761	40	37	test	test	NOUN
bam-12761	40	38	was	be	AUX
bam-12761	40	39	performed	perform	VERB
bam-12761	40	40	to	to	PART
bam-12761	40	41	determine	determine	VERB
bam-12761	40	42	the	the	DET
bam-12761	40	43	vo2max	vo2max	PROPN
bam-12761	40	44	.	.	PROPN
bam-12761	41	1	20	20	NUM
bam-12761	42	1	the	the	DET
bam-12761	42	2	rats	rat	NOUN
bam-12761	42	3	were	be	AUX
bam-12761	42	4	familiarized	familiarize	VERB
bam-12761	42	5	with	with	ADP
bam-12761	42	6	the	the	DET
bam-12761	42	7	treadmill	treadmill	NOUN
bam-12761	42	8	for	for	ADP
bam-12761	42	9	one	one	NUM
bam-12761	42	10	week	week	NOUN
bam-12761	42	11	at	at	ADP
bam-12761	42	12	a	a	DET
bam-12761	42	13	speed	speed	NOUN
bam-12761	42	14	of	of	ADP
bam-12761	42	15	5	5	NUM
bam-12761	42	16	m	m	NOUN
bam-12761	42	17	/	/	SYM
bam-12761	42	18	min	min	PROPN
bam-12761	42	19	for	for	ADP
bam-12761	42	20	5	5	NUM
bam-12761	42	21	min	min	NOUN
bam-12761	42	22	in	in	ADP
bam-12761	42	23	five	five	NUM
bam-12761	42	24	sessions	session	NOUN
bam-12761	42	25	.	.	PUNCT
bam-12761	43	1	the	the	DET
bam-12761	43	2	test	test	NOUN
bam-12761	43	3	began	begin	VERB
bam-12761	43	4	with	with	ADP
bam-12761	43	5	a	a	DET
bam-12761	43	6	warm	warm	NOUN
bam-12761	43	7	-	-	PUNCT
bam-12761	43	8	up	up	NOUN
bam-12761	43	9	for	for	ADP
bam-12761	43	10	10	10	NUM
bam-12761	43	11	min	min	NOUN
bam-12761	43	12	at	at	ADP
bam-12761	43	13	an	an	DET
bam-12761	43	14	intensity	intensity	NOUN
bam-12761	43	15	of	of	ADP
bam-12761	43	16	10	10	NUM
bam-12761	43	17	m	m	PROPN
bam-12761	43	18	/	/	SYM
bam-12761	43	19	min	min	PROPN
bam-12761	43	20	.	.	PROPN
bam-12761	44	1	then	then	ADV
bam-12761	44	2	,	,	PUNCT
bam-12761	44	3	every	every	DET
bam-12761	44	4	2	2	NUM
bam-12761	44	5	min	min	NOUN
bam-12761	44	6	,	,	PUNCT
bam-12761	44	7	the	the	DET
bam-12761	44	8	treadmill	treadmill	NOUN
bam-12761	44	9	speed	speed	NOUN
bam-12761	44	10	was	be	AUX
bam-12761	44	11	automatically	automatically	ADV
bam-12761	44	12	increased	increase	VERB
bam-12761	44	13	by	by	ADP
bam-12761	44	14	3	3	NUM
bam-12761	44	15	m	m	NOUN
bam-12761	44	16	/	/	SYM
bam-12761	44	17	min	min	PROPN
bam-12761	44	18	until	until	SCONJ
bam-12761	44	19	the	the	DET
bam-12761	44	20	rats	rat	NOUN
bam-12761	44	21	were	be	AUX
bam-12761	44	22	unable	unable	ADJ
bam-12761	44	23	to	to	PART
bam-12761	44	24	continue	continue	VERB
bam-12761	44	25	running	run	VERB
bam-12761	44	26	.	.	PUNCT
bam-12761	45	1	the	the	DET
bam-12761	45	2	vo2max	vo2max	PROPN
bam-12761	45	3	was	be	AUX
bam-12761	45	4	calculated	calculate	VERB
bam-12761	45	5	according	accord	VERB
bam-12761	45	6	to	to	ADP
bam-12761	45	7	the	the	DET
bam-12761	45	8	following	follow	VERB
bam-12761	45	9	formula	formula	NOUN
bam-12761	45	10	,	,	PUNCT
bam-12761	45	11	and	and	CCONJ
bam-12761	45	12	the	the	DET
bam-12761	45	13	training	training	NOUN
bam-12761	45	14	intensity	intensity	NOUN
bam-12761	45	15	was	be	AUX
bam-12761	45	16	adjusted	adjust	VERB
bam-12761	45	17	accordingly:21	accordingly:21	PUNCT
bam-12761	45	18	y	y	PROPN
bam-12761	45	19	=	=	SYM
bam-12761	45	20	162	162	NUM
bam-12761	45	21	x	x	X
bam-12761	45	22	-1	-1	X
bam-12761	45	23	y	y	PROPN
bam-12761	45	24	indicates	indicate	VERB
bam-12761	45	25	vo2	vo2	NOUN
bam-12761	45	26	(	(	PUNCT
bam-12761	45	27	ml	ml	PROPN
bam-12761	45	28	/	/	SYM
bam-12761	45	29	kg	kg	PROPN
bam-12761	45	30	/	/	SYM
bam-12761	45	31	m0.75	m0.75	PROPN
bam-12761	45	32	per	per	ADP
bam-12761	45	33	min	min	NOUN
bam-12761	45	34	)	)	PUNCT
bam-12761	45	35	and	and	CCONJ
bam-12761	45	36	x	x	PRON
bam-12761	45	37	indicates	indicate	VERB
bam-12761	45	38	the	the	DET
bam-12761	45	39	treadmill	treadmill	NOUN
bam-12761	45	40	speed	speed	NOUN
bam-12761	45	41	(	(	PUNCT
bam-12761	45	42	m	m	NOUN
bam-12761	45	43	/	/	SYM
bam-12761	45	44	s	s	PART
bam-12761	45	45	)	)	PUNCT
bam-12761	45	46	.	.	PUNCT
bam-12761	46	1	the	the	DET
bam-12761	46	2	maximum	maximum	ADJ
bam-12761	46	3	speed	speed	NOUN
bam-12761	46	4	obtained	obtain	VERB
bam-12761	46	5	in	in	ADP
bam-12761	46	6	the	the	DET
bam-12761	46	7	tests	test	NOUN
bam-12761	46	8	was	be	AUX
bam-12761	46	9	29.41±3.12	29.41±3.12	NUM
bam-12761	46	10	m	m	NOUN
bam-12761	46	11	/	/	SYM
bam-12761	46	12	min	min	PROPN
bam-12761	46	13	.	.	PUNCT
bam-12761	47	1	the	the	DET
bam-12761	47	2	rats	rat	NOUN
bam-12761	47	3	had	have	VERB
bam-12761	47	4	a	a	DET
bam-12761	47	5	one	one	NUM
bam-12761	47	6	-	-	PUNCT
bam-12761	47	7	week	week	NOUN
bam-12761	47	8	exercise	exercise	NOUN
bam-12761	47	9	adaptation	adaptation	NOUN
bam-12761	47	10	period	period	NOUN
bam-12761	47	11	with	with	ADP
bam-12761	47	12	a	a	DET
bam-12761	47	13	progressive	progressive	ADJ
bam-12761	47	14	increase	increase	NOUN
bam-12761	47	15	in	in	ADP
bam-12761	47	16	treadmill	treadmill	ADJ
bam-12761	47	17	speed	speed	NOUN
bam-12761	47	18	before	before	ADP
bam-12761	47	19	starting	start	VERB
bam-12761	47	20	the	the	DET
bam-12761	47	21	training	training	NOUN
bam-12761	47	22	protocol	protocol	NOUN
bam-12761	47	23	.	.	PUNCT
bam-12761	48	1	after	after	ADP
bam-12761	48	2	the	the	DET
bam-12761	48	3	adaptation	adaptation	NOUN
bam-12761	48	4	period	period	NOUN
bam-12761	48	5	,	,	PUNCT
bam-12761	48	6	the	the	DET
bam-12761	48	7	animals	animal	NOUN
bam-12761	48	8	exercised	exercise	VERB
bam-12761	48	9	five	five	NUM
bam-12761	48	10	times	time	NOUN
bam-12761	48	11	per	per	ADP
bam-12761	48	12	week	week	NOUN
bam-12761	48	13	during	during	ADP
bam-12761	48	14	the	the	DET
bam-12761	48	15	8	8	NUM
bam-12761	48	16	-	-	PUNCT
bam-12761	48	17	week	week	NOUN
bam-12761	48	18	period	period	NOUN
bam-12761	48	19	with	with	ADP
bam-12761	48	20	90	90	NUM
bam-12761	48	21	%	%	NOUN
bam-12761	48	22	vo2max	vo2max	NOUN
bam-12761	48	23	for	for	ADP
bam-12761	48	24	30s	30	NOUN
bam-12761	48	25	,	,	PUNCT
bam-12761	48	26	with	with	ADP
bam-12761	48	27	no	no	PRON
bam-12761	48	28	inclination,22	inclination,22	ADV
bam-12761	48	29	interspaced	interspace	VERB
bam-12761	48	30	by	by	ADP
bam-12761	48	31	1	1	NUM
bam-12761	48	32	min	min	NOUN
bam-12761	48	33	of	of	ADP
bam-12761	48	34	active	active	ADJ
bam-12761	48	35	recovery	recovery	NOUN
bam-12761	48	36	at	at	ADP
bam-12761	48	37	8.7	8.7	NUM
bam-12761	48	38	m	m	NOUN
bam-12761	48	39	/	/	SYM
bam-12761	48	40	min	min	PROPN
bam-12761	48	41	.	.	PUNCT
bam-12761	49	1	the	the	DET
bam-12761	49	2	number	number	NOUN
bam-12761	49	3	of	of	ADP
bam-12761	49	4	intervals	interval	NOUN
bam-12761	49	5	started	start	VERB
bam-12761	49	6	at	at	ADP
bam-12761	49	7	five	five	NUM
bam-12761	49	8	and	and	CCONJ
bam-12761	49	9	increased	increase	VERB
bam-12761	49	10	by	by	ADP
bam-12761	49	11	one	one	NUM
bam-12761	49	12	per	per	ADP
bam-12761	49	13	week	week	NOUN
bam-12761	49	14	until	until	SCONJ
bam-12761	49	15	it	it	PRON
bam-12761	49	16	reached	reach	VERB
bam-12761	49	17	12	12	NUM
bam-12761	49	18	in	in	ADP
bam-12761	49	19	the	the	DET
bam-12761	49	20	eighth	eighth	ADJ
bam-12761	49	21	week	week	NOUN
bam-12761	49	22	.	.	PUNCT
bam-12761	50	1	five	five	NUM
bam-12761	50	2	minutes	minute	NOUN
bam-12761	50	3	of	of	ADP
bam-12761	50	4	warm	warm	NOUN
bam-12761	50	5	-	-	PUNCT
bam-12761	50	6	up	up	NOUN
bam-12761	50	7	and	and	CCONJ
bam-12761	50	8	cool	cool	ADJ
bam-12761	50	9	-	-	PUNCT
bam-12761	50	10	down	down	NOUN
bam-12761	50	11	were	be	AUX
bam-12761	50	12	performed	perform	VERB
bam-12761	50	13	at	at	ADP
bam-12761	50	14	40	40	NUM
bam-12761	50	15	–	–	PUNCT
bam-12761	50	16	50	50	NUM
bam-12761	50	17	%	%	NOUN
bam-12761	50	18	and	and	CCONJ
bam-12761	50	19	20–30	20–30	NUM
bam-12761	50	20	%	%	NOUN
bam-12761	50	21	of	of	ADP
bam-12761	50	22	the	the	DET
bam-12761	50	23	maximum	maximum	ADJ
bam-12761	50	24	speed	speed	NOUN
bam-12761	50	25	,	,	PUNCT
bam-12761	50	26	respectively	respectively	ADV
bam-12761	50	27	.	.	PUNCT
bam-12761	51	1	blood	blood	NOUN
bam-12761	51	2	sampling	sampling	NOUN
bam-12761	51	3	,	,	PUNCT
bam-12761	51	4	tissue	tissue	NOUN
bam-12761	51	5	extraction	extraction	NOUN
bam-12761	51	6	and	and	CCONJ
bam-12761	51	7	biochemical	biochemical	ADJ
bam-12761	51	8	monitoring	monitoring	NOUN
bam-12761	51	9	blood	blood	NOUN
bam-12761	51	10	sampling	sampling	NOUN
bam-12761	51	11	was	be	AUX
bam-12761	51	12	performed	perform	VERB
bam-12761	51	13	24	24	NUM
bam-12761	51	14	h	h	NOUN
bam-12761	51	15	after	after	ADP
bam-12761	51	16	the	the	DET
bam-12761	51	17	last	last	ADJ
bam-12761	51	18	training	training	NOUN
bam-12761	51	19	session	session	NOUN
bam-12761	51	20	and	and	CCONJ
bam-12761	51	21	after	after	ADP
bam-12761	51	22	8	8	NUM
bam-12761	51	23	h	h	NOUN
bam-12761	51	24	of	of	ADP
bam-12761	51	25	fasting	fast	VERB
bam-12761	51	26	to	to	PART
bam-12761	51	27	eliminate	eliminate	VERB
bam-12761	51	28	the	the	DET
bam-12761	51	29	acute	acute	ADJ
bam-12761	51	30	effects	effect	NOUN
bam-12761	51	31	of	of	ADP
bam-12761	51	32	exercise	exercise	NOUN
bam-12761	51	33	.	.	PUNCT
bam-12761	52	1	rats	rat	NOUN
bam-12761	52	2	were	be	AUX
bam-12761	52	3	anesthetized	anesthetize	VERB
bam-12761	52	4	by	by	ADP
bam-12761	52	5	intraperitoneal	intraperitoneal	ADJ
bam-12761	52	6	26	26	NUM
bam-12761	52	7	non	non	ADJ
bam-12761	52	8	-co	-co	PROPN
bam-12761	52	9	mmerc	mmerc	PROPN
bam-12761	52	10	ial	ial	PROPN
bam-12761	52	11	us	us	PROPN
bam-12761	52	12	e	e	NOUN
bam-12761	52	13	o	o	X
bam-12761	52	14	nly	nly	ADV
bam-12761	52	15	high	high	ADJ
bam-12761	52	16	-	-	PUNCT
bam-12761	52	17	intensity	intensity	NOUN
bam-12761	52	18	interval	interval	NOUN
bam-12761	52	19	training	training	NOUN
bam-12761	52	20	,	,	PUNCT
bam-12761	52	21	but	but	CCONJ
bam-12761	52	22	not	not	PART
bam-12761	52	23	spirulina	spirulina	NOUN
bam-12761	52	24	supplementation	supplementation	NOUN
bam-12761	52	25	,	,	PUNCT
bam-12761	52	26	changes	change	VERB
bam-12761	52	27	muscle	muscle	NOUN
bam-12761	52	28	regeneration	regeneration	NOUN
bam-12761	52	29	signaling	signal	VERB
bam-12761	52	30	proteins	protein	NOUN
bam-12761	52	31	eur	eur	PROPN
bam-12761	52	32	j	j	PROPN
bam-12761	52	33	transl	transl	PROPN
bam-12761	52	34	myol	myol	NOUN
bam-12761	52	35	34	34	NUM
bam-12761	52	36	(	(	PUNCT
bam-12761	52	37	4	4	NUM
bam-12761	52	38	)	)	PUNCT
bam-12761	52	39	12761	12761	NUM
bam-12761	52	40	,	,	PUNCT
bam-12761	52	41	2024	2024	NUM
bam-12761	52	42	doi	doi	NOUN
bam-12761	52	43	:	:	PUNCT
bam-12761	52	44	10.4081	10.4081	NUM
bam-12761	52	45	/	/	SYM
bam-12761	52	46	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	52	47	injection	injection	NOUN
bam-12761	52	48	of	of	ADP
bam-12761	52	49	xylazine	xylazine	NOUN
bam-12761	52	50	(	(	PUNCT
bam-12761	52	51	10	10	NUM
bam-12761	52	52	mg	mg	NUM
bam-12761	52	53	/	/	SYM
bam-12761	52	54	kg	kg	NOUN
bam-12761	52	55	)	)	PUNCT
bam-12761	52	56	and	and	CCONJ
bam-12761	52	57	ketamine	ketamine	PROPN
bam-12761	52	58	(	(	PUNCT
bam-12761	52	59	90	90	NUM
bam-12761	52	60	mg	mg	NUM
bam-12761	52	61	/	/	SYM
bam-12761	52	62	kg	kg	NOUN
bam-12761	52	63	)	)	PUNCT
bam-12761	52	64	to	to	PART
bam-12761	52	65	collect	collect	VERB
bam-12761	52	66	samples	sample	NOUN
bam-12761	52	67	.	.	PUNCT
bam-12761	53	1	the	the	DET
bam-12761	53	2	chest	chest	NOUN
bam-12761	53	3	of	of	ADP
bam-12761	53	4	the	the	DET
bam-12761	53	5	animal	animal	NOUN
bam-12761	53	6	was	be	AUX
bam-12761	53	7	opened	open	VERB
bam-12761	53	8	after	after	ADP
bam-12761	53	9	complete	complete	ADJ
bam-12761	53	10	anesthesia	anesthesia	NOUN
bam-12761	53	11	and	and	CCONJ
bam-12761	53	12	a	a	DET
bam-12761	53	13	blood	blood	NOUN
bam-12761	53	14	sample	sample	NOUN
bam-12761	53	15	was	be	AUX
bam-12761	53	16	collected	collect	VERB
bam-12761	53	17	directly	directly	ADV
bam-12761	53	18	from	from	ADP
bam-12761	53	19	the	the	DET
bam-12761	53	20	heart	heart	NOUN
bam-12761	53	21	of	of	ADP
bam-12761	53	22	the	the	DET
bam-12761	53	23	animal	animal	NOUN
bam-12761	53	24	.	.	PUNCT
bam-12761	54	1	the	the	DET
bam-12761	54	2	soleus	soleus	PROPN
bam-12761	54	3	muscle	muscle	NOUN
bam-12761	54	4	was	be	AUX
bam-12761	54	5	then	then	ADV
bam-12761	54	6	separated	separate	VERB
bam-12761	54	7	from	from	ADP
bam-12761	54	8	the	the	DET
bam-12761	54	9	left	left	ADJ
bam-12761	54	10	leg	leg	NOUN
bam-12761	54	11	under	under	ADP
bam-12761	54	12	sterile	sterile	ADJ
bam-12761	54	13	conditions	condition	NOUN
bam-12761	54	14	,	,	PUNCT
bam-12761	54	15	washed	wash	VERB
bam-12761	54	16	with	with	ADP
bam-12761	54	17	physiological	physiological	ADJ
bam-12761	54	18	serum	serum	NOUN
bam-12761	54	19	,	,	PUNCT
bam-12761	54	20	and	and	CCONJ
bam-12761	54	21	weighed	weigh	VERB
bam-12761	54	22	.	.	PUNCT
bam-12761	55	1	the	the	DET
bam-12761	55	2	tissue	tissue	NOUN
bam-12761	55	3	was	be	AUX
bam-12761	55	4	frozen	freeze	VERB
bam-12761	55	5	in	in	ADP
bam-12761	55	6	liquid	liquid	ADJ
bam-12761	55	7	nitrogen	nitrogen	NOUN
bam-12761	55	8	and	and	CCONJ
bam-12761	55	9	transferred	transfer	VERB
bam-12761	55	10	to	to	ADP
bam-12761	55	11	a-80	a-80	NOUN
bam-12761	55	12	°	°	ADP
bam-12761	55	13	c	c	NOUN
bam-12761	55	14	freezer	freezer	NOUN
bam-12761	55	15	for	for	ADP
bam-12761	55	16	further	further	ADJ
bam-12761	55	17	measurements	measurement	NOUN
bam-12761	55	18	.	.	PUNCT
bam-12761	56	1	fasting	fast	VERB
bam-12761	56	2	insulin	insulin	NOUN
bam-12761	56	3	levels	level	NOUN
bam-12761	56	4	were	be	AUX
bam-12761	56	5	measured	measure	VERB
bam-12761	56	6	using	use	VERB
bam-12761	56	7	enzyme	enzyme	NOUN
bam-12761	56	8	immunoassay	immunoassay	NOUN
bam-12761	56	9	.	.	PUNCT
bam-12761	57	1	serum	serum	NOUN
bam-12761	57	2	glucose	glucose	NOUN
bam-12761	57	3	levels	level	NOUN
bam-12761	57	4	were	be	AUX
bam-12761	57	5	measured	measure	VERB
bam-12761	57	6	using	use	VERB
bam-12761	57	7	a	a	DET
bam-12761	57	8	biochemical	biochemical	ADJ
bam-12761	57	9	kit	kit	NOUN
bam-12761	57	10	and	and	CCONJ
bam-12761	57	11	an	an	DET
bam-12761	57	12	enzymatic	enzymatic	ADJ
bam-12761	57	13	method	method	NOUN
bam-12761	57	14	(	(	PUNCT
bam-12761	57	15	the	the	DET
bam-12761	57	16	glucose	glucose	NOUN
bam-12761	57	17	oxidase	oxidase	NOUN
bam-12761	57	18	method	method	NOUN
bam-12761	57	19	)	)	PUNCT
bam-12761	57	20	.	.	PUNCT
bam-12761	58	1	homa	homa	NOUN
bam-12761	58	2	-	-	PUNCT
bam-12761	58	3	ir	ir	PROPN
bam-12761	58	4	was	be	AUX
bam-12761	58	5	used	use	VERB
bam-12761	58	6	to	to	PART
bam-12761	58	7	measure	measure	VERB
bam-12761	58	8	insulin	insulin	NOUN
bam-12761	58	9	resistance	resistance	NOUN
bam-12761	58	10	.	.	PUNCT
bam-12761	59	1	the	the	DET
bam-12761	59	2	homa	homa	PROPN
bam-12761	59	3	-	-	PUNCT
bam-12761	59	4	ir	ir	PROPN
bam-12761	59	5	index	index	NOUN
bam-12761	59	6	was	be	AUX
bam-12761	59	7	calculated	calculate	VERB
bam-12761	59	8	as	as	ADP
bam-12761	59	9	[	[	PUNCT
bam-12761	59	10	fasting	fast	VERB
bam-12761	59	11	serum	serum	NOUN
bam-12761	59	12	glucose	glucose	NOUN
bam-12761	59	13	(	(	PUNCT
bam-12761	59	14	mmol	mmol	NOUN
bam-12761	59	15	/	/	SYM
bam-12761	59	16	l	l	NOUN
bam-12761	59	17	)	)	PUNCT
bam-12761	59	18	×	×	NOUN
bam-12761	59	19	fasting	fast	VERB
bam-12761	59	20	serum	serum	NOUN
bam-12761	59	21	insulin	insulin	NOUN
bam-12761	59	22	(	(	PUNCT
bam-12761	59	23	µiu	µiu	ADJ
bam-12761	59	24	/	/	SYM
bam-12761	59	25	ml)/22.5].8	ml)/22.5].8	NOUN
bam-12761	59	26	rna	rna	NOUN
bam-12761	59	27	extraction	extraction	NOUN
bam-12761	59	28	,	,	PUNCT
bam-12761	59	29	cdna	cdna	PROPN
bam-12761	59	30	synthesis	synthesis	NOUN
bam-12761	59	31	and	and	CCONJ
bam-12761	59	32	real	real	ADJ
bam-12761	59	33	-	-	PUNCT
bam-12761	59	34	time	time	NOUN
bam-12761	59	35	pcr	pcr	NOUN
bam-12761	59	36	the	the	DET
bam-12761	59	37	efficiency	efficiency	NOUN
bam-12761	59	38	of	of	ADP
bam-12761	59	39	the	the	DET
bam-12761	59	40	reference	reference	NOUN
bam-12761	59	41	gene	gene	NOUN
bam-12761	59	42	(	(	PUNCT
bam-12761	59	43	gapdh	gapdh	NOUN
bam-12761	59	44	)	)	PUNCT
bam-12761	59	45	was	be	AUX
bam-12761	59	46	evaluated	evaluate	VERB
bam-12761	59	47	based	base	VERB
bam-12761	59	48	on	on	ADP
bam-12761	59	49	the	the	DET
bam-12761	59	50	instructions	instruction	NOUN
bam-12761	59	51	of	of	ADP
bam-12761	59	52	the	the	DET
bam-12761	59	53	real	real	ADJ
bam-12761	59	54	-	-	PUNCT
bam-12761	59	55	time	time	NOUN
bam-12761	59	56	pcr	pcr	ADJ
bam-12761	59	57	technique	technique	NOUN
bam-12761	59	58	.	.	PUNCT
bam-12761	60	1	the	the	DET
bam-12761	60	2	soleus	soleus	PROPN
bam-12761	60	3	muscle	muscle	NOUN
bam-12761	60	4	was	be	AUX
bam-12761	60	5	homogenized	homogenize	VERB
bam-12761	60	6	at	at	ADP
bam-12761	60	7	a	a	DET
bam-12761	60	8	1:10	1:10	NUM
bam-12761	60	9	ratio	ratio	NOUN
bam-12761	60	10	in	in	ADP
bam-12761	60	11	qlazol	qlazol	NOUN
bam-12761	60	12	®	®	NOUN
bam-12761	60	13	lysis	lysis	NOUN
bam-12761	60	14	reagent	reagent	NOUN
bam-12761	60	15	to	to	PART
bam-12761	60	16	extract	extract	VERB
bam-12761	60	17	the	the	DET
bam-12761	60	18	total	total	ADJ
bam-12761	60	19	rna	rna	NOUN
bam-12761	60	20	.	.	PUNCT
bam-12761	61	1	it	it	PRON
bam-12761	61	2	was	be	AUX
bam-12761	61	3	then	then	ADV
bam-12761	61	4	centrifuged	centrifuge	VERB
bam-12761	61	5	at	at	ADP
bam-12761	61	6	a	a	DET
bam-12761	61	7	temperature	temperature	NOUN
bam-12761	61	8	of	of	ADP
bam-12761	61	9	4с	4с	NUM
bam-12761	61	10	for	for	ADP
bam-12761	61	11	10	10	NUM
bam-12761	61	12	min	min	NOUN
bam-12761	61	13	at	at	ADP
bam-12761	61	14	12000	12000	NUM
bam-12761	61	15	rpm	rpm	NOUN
bam-12761	61	16	in	in	ADP
bam-12761	61	17	order	order	NOUN
bam-12761	61	18	to	to	PART
bam-12761	61	19	separate	separate	VERB
bam-12761	61	20	the	the	DET
bam-12761	61	21	protein	protein	NOUN
bam-12761	61	22	components	component	NOUN
bam-12761	61	23	.	.	PUNCT
bam-12761	62	1	the	the	DET
bam-12761	62	2	mixture	mixture	NOUN
bam-12761	62	3	was	be	AUX
bam-12761	62	4	then	then	ADV
bam-12761	62	5	mixed	mix	VERB
bam-12761	62	6	with	with	ADP
bam-12761	62	7	chloroform	chloroform	NOUN
bam-12761	62	8	at	at	ADP
bam-12761	62	9	a	a	DET
bam-12761	62	10	2:1	2:1	NUM
bam-12761	62	11	ratio	ratio	NOUN
bam-12761	62	12	and	and	CCONJ
bam-12761	62	13	shaken	shake	VERB
bam-12761	62	14	vigorously	vigorously	ADV
bam-12761	62	15	for	for	ADP
bam-12761	62	16	15	15	NUM
bam-12761	62	17	s.	s.	NOUN
bam-12761	62	18	the	the	DET
bam-12761	62	19	mixture	mixture	NOUN
bam-12761	62	20	was	be	AUX
bam-12761	62	21	centrifuged	centrifuge	VERB
bam-12761	62	22	at	at	ADP
bam-12761	62	23	a	a	DET
bam-12761	62	24	temperature	temperature	NOUN
bam-12761	62	25	of	of	ADP
bam-12761	62	26	4с	4с	NUM
bam-12761	62	27	for	for	ADP
bam-12761	62	28	15	15	NUM
bam-12761	62	29	min	min	NOUN
bam-12761	62	30	at	at	ADP
bam-12761	62	31	12000	12000	NUM
bam-12761	62	32	rpm	rpm	NOUN
bam-12761	62	33	and	and	CCONJ
bam-12761	62	34	the	the	DET
bam-12761	62	35	mineral	mineral	NOUN
bam-12761	62	36	and	and	CCONJ
bam-12761	62	37	aqueous	aqueous	ADJ
bam-12761	62	38	parts	part	NOUN
bam-12761	62	39	were	be	AUX
bam-12761	62	40	separated	separate	VERB
bam-12761	62	41	.	.	PUNCT
bam-12761	63	1	the	the	DET
bam-12761	63	2	remaining	remain	VERB
bam-12761	63	3	content	content	NOUN
bam-12761	63	4	was	be	AUX
bam-12761	63	5	mixed	mix	VERB
bam-12761	63	6	with	with	ADP
bam-12761	63	7	isopropanol	isopropanol	NOUN
bam-12761	63	8	at	at	ADP
bam-12761	63	9	a	a	DET
bam-12761	63	10	2:1	2:1	NUM
bam-12761	63	11	ratio	ratio	NOUN
bam-12761	63	12	,	,	PUNCT
bam-12761	63	13	incubated	incubate	VERB
bam-12761	63	14	at	at	ADP
bam-12761	63	15	room	room	NOUN
bam-12761	63	16	temperature	temperature	NOUN
bam-12761	63	17	for	for	ADP
bam-12761	63	18	10	10	NUM
bam-12761	63	19	min	min	NOUN
bam-12761	63	20	,	,	PUNCT
bam-12761	63	21	and	and	CCONJ
bam-12761	63	22	centrifuged	centrifuge	VERB
bam-12761	63	23	at	at	ADP
bam-12761	63	24	4с	4с	NUM
bam-12761	63	25	for	for	ADP
bam-12761	63	26	10	10	NUM
bam-12761	63	27	min	min	NOUN
bam-12761	63	28	at	at	ADP
bam-12761	63	29	12000	12000	NUM
bam-12761	63	30	rpm	rpm	NOUN
bam-12761	63	31	.	.	PUNCT
bam-12761	64	1	the	the	DET
bam-12761	64	2	pellet	pellet	NOUN
bam-12761	64	3	containing	contain	VERB
bam-12761	64	4	rna	rna	NOUN
bam-12761	64	5	was	be	AUX
bam-12761	64	6	washed	wash	VERB
bam-12761	64	7	in	in	ADP
bam-12761	64	8	ethanol	ethanol	NOUN
bam-12761	64	9	and	and	CCONJ
bam-12761	64	10	dissolved	dissolve	VERB
bam-12761	64	11	in	in	ADP
bam-12761	64	12	20	20	NUM
bam-12761	64	13	μl	μl	NUM
bam-12761	64	14	rnas	rna	NOUN
bam-12761	64	15	-	-	PUNCT
bam-12761	64	16	free	free	ADJ
bam-12761	64	17	water	water	NOUN
bam-12761	64	18	.	.	PUNCT
bam-12761	65	1	rna	rna	NOUN
bam-12761	65	2	concentration	concentration	NOUN
bam-12761	65	3	was	be	AUX
bam-12761	65	4	measured	measure	VERB
bam-12761	65	5	using	use	VERB
bam-12761	65	6	an	an	DET
bam-12761	65	7	eppendorff	eppendorff	NOUN
bam-12761	65	8	(	(	PUNCT
bam-12761	65	9	germany	germany	PROPN
bam-12761	65	10	)	)	PUNCT
bam-12761	65	11	,	,	PUNCT
bam-12761	65	12	and	and	CCONJ
bam-12761	65	13	a	a	DET
bam-12761	65	14	260:280	260:280	PROPN
bam-12761	65	15	ratio	ratio	NOUN
bam-12761	65	16	between	between	ADP
bam-12761	65	17	1.8	1.8	NUM
bam-12761	65	18	and	and	CCONJ
bam-12761	65	19	2	2	NUM
bam-12761	65	20	was	be	AUX
bam-12761	65	21	defined	define	VERB
bam-12761	65	22	as	as	ADP
bam-12761	65	23	the	the	DET
bam-12761	65	24	optimal	optimal	ADJ
bam-12761	65	25	purity	purity	NOUN
bam-12761	65	26	.	.	PUNCT
bam-12761	66	1	cdna	cdna	PROPN
bam-12761	66	2	synthesis	synthesis	NOUN
bam-12761	66	3	was	be	AUX
bam-12761	66	4	done	do	VERB
bam-12761	66	5	using	use	VERB
bam-12761	66	6	1μg	1μg	PROPN
bam-12761	66	7	of	of	ADP
bam-12761	66	8	rna	rna	PROPN
bam-12761	66	9	,	,	PUNCT
bam-12761	66	10	a	a	DET
bam-12761	66	11	cdna	cdna	PROPN
bam-12761	66	12	synthesis	synthesis	NOUN
bam-12761	66	13	kit	kit	NOUN
bam-12761	66	14	(	(	PUNCT
bam-12761	66	15	thermo	thermo	NOUN
bam-12761	66	16	fisher	fisher	PROPN
bam-12761	66	17	scientific	scientific	PROPN
bam-12761	66	18	,	,	PUNCT
bam-12761	66	19	waltham	waltham	PROPN
bam-12761	66	20	,	,	PUNCT
bam-12761	66	21	ma	ma	PROPN
bam-12761	66	22	,	,	PUNCT
bam-12761	66	23	usa	usa	PROPN
bam-12761	66	24	,	,	PUNCT
bam-12761	66	25	cat	cat	NOUN
bam-12761	67	1	no	no	NOUN
bam-12761	67	2	:	:	PUNCT
bam-12761	67	3	k1621	k1621	PROPN
bam-12761	67	4	)	)	PUNCT
bam-12761	67	5	,	,	PUNCT
bam-12761	67	6	and	and	CCONJ
bam-12761	67	7	mulv	mulv	ADV
bam-12761	67	8	reverse	reverse	VERB
bam-12761	67	9	transcriptase	transcriptase	NOUN
bam-12761	67	10	enzyme	enzyme	NOUN
bam-12761	67	11	.	.	PUNCT
bam-12761	68	1	the	the	DET
bam-12761	68	2	expression	expression	NOUN
bam-12761	68	3	levels	level	NOUN
bam-12761	68	4	of	of	ADP
bam-12761	68	5	myod1	myod1	NOUN
bam-12761	68	6	,	,	PUNCT
bam-12761	68	7	pax7	pax7	NOUN
bam-12761	68	8	,	,	PUNCT
bam-12761	68	9	and	and	CCONJ
bam-12761	68	10	myogenin	myogenin	ADJ
bam-12761	68	11	were	be	AUX
bam-12761	68	12	measured	measure	VERB
bam-12761	68	13	by	by	ADP
bam-12761	68	14	real	real	ADJ
bam-12761	68	15	-	-	PUNCT
bam-12761	68	16	time	time	NOUN
bam-12761	68	17	quantitative	quantitative	ADJ
bam-12761	68	18	pcr	pcr	NOUN
bam-12761	68	19	using	use	VERB
bam-12761	68	20	primix	primix	PROPN
bam-12761	68	21	syber	syber	PROPN
bam-12761	68	22	green	green	PROPN
bam-12761	68	23	ii	ii	PROPN
bam-12761	68	24	(	(	PUNCT
bam-12761	68	25	applied	apply	VERB
bam-12761	68	26	biosystems	biosystem	NOUN
bam-12761	68	27	,	,	PUNCT
bam-12761	68	28	step	step	NOUN
bam-12761	68	29	one	one	NUM
bam-12761	68	30	,	,	PUNCT
bam-12761	68	31	usa	usa	PROPN
bam-12761	68	32	)	)	PUNCT
bam-12761	68	33	.	.	PUNCT
bam-12761	69	1	primers	primer	NOUN
bam-12761	69	2	were	be	AUX
bam-12761	69	3	designed	design	VERB
bam-12761	69	4	based	base	VERB
bam-12761	69	5	on	on	ADP
bam-12761	69	6	the	the	DET
bam-12761	69	7	information	information	NOUN
bam-12761	69	8	on	on	ADP
bam-12761	69	9	myod1	myod1	PROPN
bam-12761	69	10	,	,	PUNCT
bam-12761	69	11	pax7	pax7	PROPN
bam-12761	69	12	,	,	PUNCT
bam-12761	69	13	myogenin	myogenin	ADJ
bam-12761	69	14	,	,	PUNCT
bam-12761	69	15	and	and	CCONJ
bam-12761	69	16	gapdh	gapdh	NOUN
bam-12761	69	17	genes	gene	NOUN
bam-12761	69	18	in	in	ADP
bam-12761	69	19	the	the	DET
bam-12761	69	20	ncbi	ncbi	PROPN
bam-12761	69	21	gene	gene	PROPN
bam-12761	69	22	bank	bank	PROPN
bam-12761	69	23	and	and	CCONJ
bam-12761	69	24	by	by	ADP
bam-12761	69	25	the	the	DET
bam-12761	69	26	macrogen	macrogen	NOUN
bam-12761	69	27	company	company	NOUN
bam-12761	69	28	,	,	PUNCT
bam-12761	69	29	seoul	seoul	PROPN
bam-12761	69	30	,	,	PUNCT
bam-12761	69	31	korea	korea	PROPN
bam-12761	69	32	.	.	PUNCT
bam-12761	70	1	primer	primer	PROPN
bam-12761	70	2	sequences	sequence	NOUN
bam-12761	70	3	used	use	VERB
bam-12761	70	4	are	be	AUX
bam-12761	70	5	listed	list	VERB
bam-12761	70	6	in	in	ADP
bam-12761	70	7	table	table	NOUN
bam-12761	70	8	1	1	NUM
bam-12761	70	9	.	.	PUNCT
bam-12761	71	1	the	the	DET
bam-12761	71	2	temperature	temperature	NOUN
bam-12761	71	3	program	program	NOUN
bam-12761	71	4	used	use	VERB
bam-12761	71	5	in	in	ADP
bam-12761	71	6	real	real	ADJ
bam-12761	71	7	-	-	PUNCT
bam-12761	71	8	time	time	NOUN
bam-12761	71	9	pcr	pcr	NOUN
bam-12761	71	10	was	be	AUX
bam-12761	71	11	95	95	NUM
bam-12761	71	12	°	°	ADP
bam-12761	71	13	c	c	NOUN
bam-12761	71	14	for	for	ADP
bam-12761	71	15	10	10	NUM
bam-12761	71	16	min	min	NOUN
bam-12761	71	17	,	,	PUNCT
bam-12761	71	18	95	95	NUM
bam-12761	71	19	°	°	NUM
bam-12761	71	20	c	c	NOUN
bam-12761	71	21	for	for	ADP
bam-12761	71	22	15	15	NUM
bam-12761	71	23	s	s	NOUN
bam-12761	71	24	,	,	PUNCT
bam-12761	71	25	and	and	CCONJ
bam-12761	71	26	60	60	NUM
bam-12761	71	27	°	°	NOUN
bam-12761	71	28	c	c	NOUN
bam-12761	71	29	for	for	ADP
bam-12761	71	30	1	1	NUM
bam-12761	71	31	min	min	NOUN
bam-12761	71	32	,	,	PUNCT
bam-12761	71	33	and	and	CCONJ
bam-12761	71	34	was	be	AUX
bam-12761	71	35	repeated	repeat	VERB
bam-12761	71	36	for	for	ADP
bam-12761	71	37	40	40	NUM
bam-12761	71	38	cycles	cycle	NOUN
bam-12761	71	39	,	,	PUNCT
bam-12761	71	40	according	accord	VERB
bam-12761	71	41	to	to	ADP
bam-12761	71	42	the	the	DET
bam-12761	71	43	manufacturer	manufacturer	NOUN
bam-12761	71	44	’s	’s	PART
bam-12761	71	45	instructions	instruction	NOUN
bam-12761	71	46	.	.	PUNCT
bam-12761	72	1	the	the	DET
bam-12761	72	2	expression	expression	NOUN
bam-12761	72	3	levels	level	NOUN
bam-12761	72	4	of	of	ADP
bam-12761	72	5	target	target	NOUN
bam-12761	72	6	genes	gene	NOUN
bam-12761	72	7	were	be	AUX
bam-12761	72	8	measured	measure	VERB
bam-12761	72	9	using	use	VERB
bam-12761	72	10	the	the	DET
bam-12761	72	11	2	2	NUM
bam-12761	72	12	-	-	PUNCT
bam-12761	72	13	δδct	δδct	NOUN
bam-12761	72	14	method	method	NOUN
bam-12761	72	15	.	.	PUNCT
bam-12761	73	1	the	the	DET
bam-12761	73	2	primers	primer	NOUN
bam-12761	73	3	used	use	VERB
bam-12761	73	4	are	be	AUX
bam-12761	73	5	listed	list	VERB
bam-12761	73	6	in	in	ADP
bam-12761	73	7	table	table	NOUN
bam-12761	73	8	1	1	NUM
bam-12761	73	9	.	.	PUNCT
bam-12761	74	1	statistical	statistical	ADJ
bam-12761	74	2	analysis	analysis	NOUN
bam-12761	74	3	the	the	DET
bam-12761	74	4	means	mean	NOUN
bam-12761	74	5	and	and	CCONJ
bam-12761	74	6	standard	standard	ADJ
bam-12761	74	7	deviations	deviation	NOUN
bam-12761	74	8	were	be	AUX
bam-12761	74	9	used	use	VERB
bam-12761	74	10	to	to	PART
bam-12761	74	11	describe	describe	VERB
bam-12761	74	12	the	the	DET
bam-12761	74	13	data	datum	NOUN
bam-12761	74	14	.	.	PUNCT
bam-12761	75	1	shapiro	shapiro	PROPN
bam-12761	75	2	-	-	PUNCT
bam-12761	75	3	wilk	wilk	NOUN
bam-12761	75	4	and	and	CCONJ
bam-12761	75	5	levene	levene	NOUN
bam-12761	75	6	tests	test	NOUN
bam-12761	75	7	were	be	AUX
bam-12761	75	8	used	use	VERB
bam-12761	75	9	to	to	PART
bam-12761	75	10	check	check	VERB
bam-12761	75	11	the	the	DET
bam-12761	75	12	normality	normality	NOUN
bam-12761	75	13	of	of	ADP
bam-12761	75	14	the	the	DET
bam-12761	75	15	data	datum	NOUN
bam-12761	75	16	and	and	CCONJ
bam-12761	75	17	homogeneity	homogeneity	NOUN
bam-12761	75	18	of	of	ADP
bam-12761	75	19	variances	variance	NOUN
bam-12761	75	20	,	,	PUNCT
bam-12761	75	21	respectively	respectively	ADV
bam-12761	75	22	.	.	PUNCT
bam-12761	76	1	one	one	NUM
bam-12761	76	2	-	-	PUNCT
bam-12761	76	3	way	way	NOUN
bam-12761	76	4	anova	anova	PROPN
bam-12761	76	5	was	be	AUX
bam-12761	76	6	used	use	VERB
bam-12761	76	7	to	to	PART
bam-12761	76	8	determine	determine	VERB
bam-12761	76	9	the	the	DET
bam-12761	76	10	differences	difference	NOUN
bam-12761	76	11	between	between	ADP
bam-12761	76	12	variables	variable	NOUN
bam-12761	76	13	among	among	ADP
bam-12761	76	14	groups	group	NOUN
bam-12761	76	15	,	,	PUNCT
bam-12761	76	16	and	and	CCONJ
bam-12761	76	17	tukey	tukey	NOUN
bam-12761	76	18	’s	’s	PART
bam-12761	76	19	post	post	ADJ
bam-12761	76	20	-	-	ADJ
bam-12761	76	21	hoc	hoc	ADJ
bam-12761	76	22	test	test	NOUN
bam-12761	76	23	was	be	AUX
bam-12761	76	24	used	use	VERB
bam-12761	76	25	when	when	SCONJ
bam-12761	76	26	necessary	necessary	ADJ
bam-12761	76	27	.	.	PUNCT
bam-12761	77	1	analyses	analysis	NOUN
bam-12761	77	2	were	be	AUX
bam-12761	77	3	performed	perform	VERB
bam-12761	77	4	using	use	VERB
bam-12761	77	5	the	the	DET
bam-12761	77	6	statistical	statistical	ADJ
bam-12761	77	7	software	software	NOUN
bam-12761	77	8	spss	spss	PROPN
bam-12761	77	9	version	version	PROPN
bam-12761	77	10	23	23	NUM
bam-12761	77	11	,	,	PUNCT
bam-12761	77	12	and	and	CCONJ
bam-12761	77	13	the	the	DET
bam-12761	77	14	significance	significance	NOUN
bam-12761	77	15	level	level	NOUN
bam-12761	77	16	was	be	AUX
bam-12761	77	17	set	set	VERB
bam-12761	77	18	at	at	ADP
bam-12761	77	19	p	p	NOUN
bam-12761	77	20	<	<	X
bam-12761	77	21	0.05	0.05	NUM
bam-12761	77	22	.	.	PUNCT
bam-12761	78	1	results	result	NOUN
bam-12761	78	2	table	table	NOUN
bam-12761	78	3	2	2	NUM
bam-12761	78	4	shows	show	VERB
bam-12761	78	5	the	the	DET
bam-12761	78	6	total	total	ADJ
bam-12761	78	7	body	body	NOUN
bam-12761	78	8	and	and	CCONJ
bam-12761	78	9	soleus	soleus	ADJ
bam-12761	78	10	muscle	muscle	NOUN
bam-12761	78	11	mass	mass	PROPN
bam-12761	78	12	before	before	ADV
bam-12761	78	13	and	and	CCONJ
bam-12761	78	14	after	after	ADP
bam-12761	78	15	the	the	DET
bam-12761	78	16	training	training	NOUN
bam-12761	78	17	period	period	NOUN
bam-12761	78	18	,	,	PUNCT
bam-12761	78	19	with	with	SCONJ
bam-12761	78	20	the	the	DET
bam-12761	78	21	soleus	soleus	PROPN
bam-12761	78	22	muscle	muscle	NOUN
bam-12761	78	23	mass	mass	PROPN
bam-12761	78	24	reported	report	VERB
bam-12761	78	25	in	in	ADP
bam-12761	78	26	absolute	absolute	ADJ
bam-12761	78	27	and	and	CCONJ
bam-12761	78	28	relative	relative	ADJ
bam-12761	78	29	terms	term	NOUN
bam-12761	78	30	,	,	PUNCT
bam-12761	78	31	respectively	respectively	ADV
bam-12761	78	32	.	.	PUNCT
bam-12761	79	1	the	the	DET
bam-12761	79	2	results	result	NOUN
bam-12761	79	3	of	of	ADP
bam-12761	79	4	the	the	DET
bam-12761	79	5	statistical	statistical	ADJ
bam-12761	79	6	test	test	NOUN
bam-12761	79	7	for	for	ADP
bam-12761	79	8	body	body	NOUN
bam-12761	79	9	mass	mass	NOUN
bam-12761	79	10	showed	show	VERB
bam-12761	79	11	a	a	DET
bam-12761	79	12	significant	significant	ADJ
bam-12761	79	13	difference	difference	NOUN
bam-12761	79	14	between	between	ADP
bam-12761	79	15	the	the	DET
bam-12761	79	16	studied	study	VERB
bam-12761	79	17	groups	group	NOUN
bam-12761	79	18	(	(	PUNCT
bam-12761	79	19	f=76.808	f=76.808	NOUN
bam-12761	79	20	;	;	PUNCT
bam-12761	79	21	p=0.002	p=0.002	X
bam-12761	79	22	)	)	PUNCT
bam-12761	79	23	,	,	PUNCT
bam-12761	79	24	and	and	CCONJ
bam-12761	79	25	the	the	DET
bam-12761	79	26	results	result	NOUN
bam-12761	79	27	of	of	ADP
bam-12761	79	28	tukey	tukey	NOUN
bam-12761	79	29	’s	’s	PART
bam-12761	79	30	test	test	NOUN
bam-12761	79	31	indicated	indicate	VERB
bam-12761	79	32	a	a	DET
bam-12761	79	33	significant	significant	ADJ
bam-12761	79	34	decrease	decrease	NOUN
bam-12761	79	35	in	in	ADP
bam-12761	79	36	body	body	NOUN
bam-12761	79	37	mass	mass	NOUN
bam-12761	79	38	in	in	ADP
bam-12761	79	39	the	the	DET
bam-12761	79	40	hiit	hiit	NOUN
bam-12761	79	41	,	,	PUNCT
bam-12761	79	42	hiit+sp	hiit+sp	X
bam-12761	79	43	,	,	PUNCT
bam-12761	79	44	and	and	CCONJ
bam-12761	79	45	sp	sp	ADP
bam-12761	79	46	groups	group	NOUN
bam-12761	79	47	compared	compare	VERB
bam-12761	79	48	with	with	ADP
bam-12761	79	49	the	the	DET
bam-12761	79	50	con	con	X
bam-12761	79	51	(	(	PUNCT
bam-12761	79	52	p=0.0001	p=0.0001	PROPN
bam-12761	79	53	)	)	PUNCT
bam-12761	79	54	and	and	CCONJ
bam-12761	79	55	sham	sham	NOUN
bam-12761	79	56	(	(	PUNCT
bam-12761	79	57	p=0.0001	p=0.0001	NOUN
bam-12761	79	58	)	)	PUNCT
bam-12761	79	59	groups	group	NOUN
bam-12761	79	60	.	.	PUNCT
bam-12761	80	1	there	there	PRON
bam-12761	80	2	was	be	VERB
bam-12761	80	3	no	no	DET
bam-12761	80	4	significant	significant	ADJ
bam-12761	80	5	difference	difference	NOUN
bam-12761	80	6	in	in	ADP
bam-12761	80	7	body	body	NOUN
bam-12761	80	8	mass	mass	NOUN
bam-12761	80	9	among	among	ADP
bam-12761	80	10	hiit	hiit	PROPN
bam-12761	80	11	,	,	PUNCT
bam-12761	80	12	hiit+sp	hiit+sp	X
bam-12761	80	13	,	,	PUNCT
bam-12761	80	14	and	and	CCONJ
bam-12761	80	15	sp	sp	ADP
bam-12761	80	16	groups	group	NOUN
bam-12761	80	17	(	(	PUNCT
bam-12761	80	18	p>0.05	p>0.05	PROPN
bam-12761	80	19	)	)	PUNCT
bam-12761	80	20	.	.	PUNCT
bam-12761	81	1	there	there	PRON
bam-12761	81	2	was	be	VERB
bam-12761	81	3	a	a	DET
bam-12761	81	4	significant	significant	ADJ
bam-12761	81	5	difference	difference	NOUN
bam-12761	81	6	in	in	ADP
bam-12761	81	7	the	the	DET
bam-12761	81	8	soleus	soleus	NOUN
bam-12761	81	9	muscle	muscle	NOUN
bam-12761	81	10	mass	mass	NOUN
bam-12761	81	11	between	between	ADP
bam-12761	81	12	the	the	DET
bam-12761	81	13	different	different	ADJ
bam-12761	81	14	groups	group	NOUN
bam-12761	81	15	(	(	PUNCT
bam-12761	81	16	f=4.242	f=4.242	NOUN
bam-12761	81	17	;	;	PUNCT
bam-12761	81	18	p=0.004	p=0.004	NOUN
bam-12761	81	19	)	)	PUNCT
bam-12761	81	20	.	.	PUNCT
bam-12761	82	1	tukey	tukey	PROPN
bam-12761	82	2	’s	’s	PART
bam-12761	82	3	test	test	NOUN
bam-12761	82	4	showed	show	VERB
bam-12761	82	5	a	a	DET
bam-12761	82	6	significant	significant	ADJ
bam-12761	82	7	increase	increase	NOUN
bam-12761	82	8	in	in	ADP
bam-12761	82	9	the	the	DET
bam-12761	82	10	hiit	hiit	NOUN
bam-12761	82	11	(	(	PUNCT
bam-12761	82	12	p=0.002	p=0.002	NOUN
bam-12761	82	13	)	)	PUNCT
bam-12761	82	14	and	and	CCONJ
bam-12761	82	15	hiit+	hiit+	X
bam-12761	82	16	sp	sp	ADP
bam-12761	82	17	(	(	PUNCT
bam-12761	82	18	p=0.010	p=0.010	NOUN
bam-12761	82	19	)	)	PUNCT
bam-12761	82	20	groups	group	NOUN
bam-12761	82	21	compared	compare	VERB
bam-12761	82	22	with	with	ADP
bam-12761	82	23	the	the	DET
bam-12761	82	24	basic	basic	ADJ
bam-12761	82	25	con	con	NOUN
bam-12761	82	26	group	group	NOUN
bam-12761	82	27	,	,	PUNCT
bam-12761	82	28	and	and	CCONJ
bam-12761	82	29	no	no	DET
bam-12761	82	30	significant	significant	ADJ
bam-12761	82	31	difference	difference	NOUN
bam-12761	82	32	was	be	AUX
bam-12761	82	33	observed	observe	VERB
bam-12761	82	34	between	between	ADP
bam-12761	82	35	the	the	DET
bam-12761	82	36	other	other	ADJ
bam-12761	82	37	groups	group	NOUN
bam-12761	82	38	(	(	PUNCT
bam-12761	82	39	p>0.05	p>0.05	PROPN
bam-12761	82	40	)	)	PUNCT
bam-12761	82	41	.	.	PUNCT
bam-12761	83	1	the	the	DET
bam-12761	83	2	glycemic	glycemic	ADJ
bam-12761	83	3	indices	index	NOUN
bam-12761	83	4	are	be	AUX
bam-12761	83	5	presented	present	VERB
bam-12761	83	6	in	in	ADP
bam-12761	83	7	table	table	NOUN
bam-12761	83	8	3	3	NUM
bam-12761	83	9	.	.	PUNCT
bam-12761	84	1	one	one	NUM
bam-12761	84	2	-	-	PUNCT
bam-12761	84	3	way	way	NOUN
bam-12761	84	4	anova	anova	PROPN
bam-12761	84	5	results	result	NOUN
bam-12761	84	6	showed	show	VERB
bam-12761	84	7	significant	significant	ADJ
bam-12761	84	8	differences	difference	NOUN
bam-12761	84	9	in	in	ADP
bam-12761	84	10	fasting	fast	VERB
bam-12761	84	11	glucose	glucose	NOUN
bam-12761	84	12	concentration	concentration	NOUN
bam-12761	84	13	(	(	PUNCT
bam-12761	84	14	f=140.51	f=140.51	NOUN
bam-12761	84	15	;	;	PUNCT
bam-12761	84	16	p=0.0001	p=0.0001	PROPN
bam-12761	84	17	)	)	PUNCT
bam-12761	84	18	,	,	PUNCT
bam-12761	84	19	insulin	insulin	NOUN
bam-12761	84	20	(	(	PUNCT
bam-12761	84	21	f=136.52	f=136.52	ADJ
bam-12761	84	22	;	;	PUNCT
bam-12761	84	23	p=0.0001	p=0.0001	PROPN
bam-12761	84	24	)	)	PUNCT
bam-12761	84	25	,	,	PUNCT
bam-12761	84	26	and	and	CCONJ
bam-12761	84	27	homa	homa	PROPN
bam-12761	84	28	-	-	PUNCT
bam-12761	84	29	ir	ir	PROPN
bam-12761	84	30	(	(	PUNCT
bam-12761	84	31	f=14.04	f=14.04	PROPN
bam-12761	84	32	;	;	PUNCT
bam-12761	84	33	p=0.0001	p=0.0001	PROPN
bam-12761	84	34	)	)	PUNCT
bam-12761	84	35	between	between	ADP
bam-12761	84	36	the	the	DET
bam-12761	84	37	studied	study	VERB
bam-12761	84	38	groups	group	NOUN
bam-12761	84	39	.	.	PUNCT
bam-12761	85	1	tukey	tukey	PROPN
bam-12761	85	2	’s	’s	PART
bam-12761	85	3	post	post	ADJ
bam-12761	85	4	-	-	ADJ
bam-12761	85	5	hoc	hoc	ADJ
bam-12761	85	6	test	test	NOUN
bam-12761	85	7	showed	show	VERB
bam-12761	85	8	that	that	SCONJ
bam-12761	85	9	fasting	fast	VERB
bam-12761	85	10	glucose	glucose	NOUN
bam-12761	85	11	levels	level	NOUN
bam-12761	85	12	in	in	ADP
bam-12761	85	13	the	the	DET
bam-12761	85	14	sp	sp	NOUN
bam-12761	85	15	,	,	PUNCT
bam-12761	85	16	hiit+sp	hiit+sp	X
bam-12761	85	17	,	,	PUNCT
bam-12761	85	18	and	and	CCONJ
bam-12761	85	19	hiit	hiit	PROPN
bam-12761	85	20	groups	group	NOUN
bam-12761	85	21	were	be	AUX
bam-12761	85	22	significantly	significantly	ADV
bam-12761	85	23	lower	low	ADJ
bam-12761	85	24	than	than	ADP
bam-12761	85	25	those	those	PRON
bam-12761	85	26	in	in	ADP
bam-12761	85	27	the	the	DET
bam-12761	85	28	sham	sham	ADJ
bam-12761	85	29	group	group	NOUN
bam-12761	85	30	(	(	PUNCT
bam-12761	85	31	p=0.0001	p=0.0001	PROPN
bam-12761	85	32	)	)	PUNCT
bam-12761	85	33	.	.	PUNCT
bam-12761	86	1	moreover	moreover	ADV
bam-12761	86	2	,	,	PUNCT
bam-12761	86	3	the	the	DET
bam-12761	86	4	values	value	NOUN
bam-12761	86	5	for	for	ADP
bam-12761	86	6	the	the	DET
bam-12761	86	7	hiit+sp	hiit+sp	DET
bam-12761	86	8	group	group	NOUN
bam-12761	86	9	were	be	AUX
bam-12761	86	10	lower	low	ADJ
bam-12761	86	11	than	than	ADP
bam-12761	86	12	those	those	PRON
bam-12761	86	13	for	for	ADP
bam-12761	86	14	the	the	DET
bam-12761	86	15	sham	sham	PROPN
bam-12761	86	16	,	,	PUNCT
bam-12761	86	17	sp	sp	NOUN
bam-12761	86	18	,	,	PUNCT
bam-12761	86	19	and	and	CCONJ
bam-12761	86	20	hiit	hiit	PROPN
bam-12761	86	21	groups	group	NOUN
bam-12761	86	22	(	(	PUNCT
bam-12761	86	23	p<0.05	p<0.05	NOUN
bam-12761	86	24	)	)	PUNCT
bam-12761	86	25	.	.	PUNCT
bam-12761	87	1	27	27	NUM
bam-12761	87	2	table	table	NOUN
bam-12761	87	3	1	1	NUM
bam-12761	87	4	.	.	PUNCT
bam-12761	87	5	sequences	sequence	NOUN
bam-12761	87	6	of	of	ADP
bam-12761	87	7	specific	specific	ADJ
bam-12761	87	8	primers	primer	NOUN
bam-12761	87	9	used	use	VERB
bam-12761	87	10	for	for	ADP
bam-12761	87	11	real	real	ADJ
bam-12761	87	12	-	-	PUNCT
bam-12761	87	13	time	time	NOUN
bam-12761	87	14	pcr	pcr	NOUN
bam-12761	87	15	.	.	PUNCT
bam-12761	88	1	gene	gene	NOUN
bam-12761	88	2	f	f	NOUN
bam-12761	88	3	-	-	PUNCT
bam-12761	88	4	primer	primer	NOUN
bam-12761	88	5	r	r	NOUN
bam-12761	88	6	-	-	PUNCT
bam-12761	88	7	primer	primer	NOUN
bam-12761	88	8	product	product	NOUN
bam-12761	88	9	length	length	NOUN
bam-12761	88	10	myod1	myod1	PROPN
bam-12761	88	11	aagtgaacgaggccttcgag	aagtgaacgaggccttcgag	PROPN
bam-12761	88	12	ccgctgtaatccatcatgcc	ccgctgtaatccatcatgcc	NOUN
bam-12761	88	13	271	271	NUM
bam-12761	88	14	bp	bp	PROPN
bam-12761	88	15	pax7	pax7	PROPN
bam-12761	88	16	taagagggagaaccccggaa	taagagggagaaccccggaa	PROPN
bam-12761	88	17	ggctaatcgaactcactgaggg	ggctaatcgaactcactgaggg	VERB
bam-12761	88	18	104	104	NUM
bam-12761	88	19	bp	bp	PROPN
bam-12761	88	20	myogenin	myogenin	PROPN
bam-12761	88	21	gaagcgcaggctcaagaaag	gaagcgcaggctcaagaaag	NOUN
bam-12761	88	22	gctgcgagcaaatgatctcc	gctgcgagcaaatgatctcc	VERB
bam-12761	88	23	300	300	NUM
bam-12761	88	24	bp	bp	PROPN
bam-12761	88	25	gapdh	gapdh	NOUN
bam-12761	88	26	gcatcttcttgtgcagtgcc	gcatcttcttgtgcagtgcc	NOUN
bam-12761	88	27	gatggtgatgggtttcccgt	gatggtgatgggtttcccgt	PROPN
bam-12761	88	28	262	262	NUM
bam-12761	88	29	bp	bp	PROPN
bam-12761	88	30	non	non	PROPN
bam-12761	89	1	-co	-co	PROPN
bam-12761	89	2	mmerc	mmerc	PROPN
bam-12761	89	3	ial	ial	PROPN
bam-12761	89	4	us	us	PROPN
bam-12761	89	5	e	e	NOUN
bam-12761	89	6	o	o	X
bam-12761	89	7	nly	nly	ADV
bam-12761	89	8	high	high	ADJ
bam-12761	89	9	-	-	PUNCT
bam-12761	89	10	intensity	intensity	NOUN
bam-12761	89	11	interval	interval	NOUN
bam-12761	89	12	training	training	NOUN
bam-12761	89	13	,	,	PUNCT
bam-12761	89	14	but	but	CCONJ
bam-12761	89	15	not	not	PART
bam-12761	89	16	spirulina	spirulina	NOUN
bam-12761	89	17	supplementation	supplementation	NOUN
bam-12761	89	18	,	,	PUNCT
bam-12761	89	19	changes	change	VERB
bam-12761	89	20	muscle	muscle	NOUN
bam-12761	89	21	regeneration	regeneration	NOUN
bam-12761	89	22	signaling	signal	VERB
bam-12761	89	23	proteins	protein	NOUN
bam-12761	89	24	eur	eur	PROPN
bam-12761	89	25	j	j	PROPN
bam-12761	89	26	transl	transl	PROPN
bam-12761	89	27	myol	myol	NOUN
bam-12761	89	28	34	34	NUM
bam-12761	89	29	(	(	PUNCT
bam-12761	89	30	4	4	NUM
bam-12761	89	31	)	)	PUNCT
bam-12761	89	32	12761	12761	NUM
bam-12761	89	33	,	,	PUNCT
bam-12761	89	34	2024	2024	NUM
bam-12761	89	35	doi	doi	NOUN
bam-12761	89	36	:	:	PUNCT
bam-12761	89	37	10.4081	10.4081	NUM
bam-12761	89	38	/	/	SYM
bam-12761	89	39	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	89	40	insulin	insulin	NOUN
bam-12761	89	41	levels	level	NOUN
bam-12761	89	42	were	be	AUX
bam-12761	89	43	higher	high	ADJ
bam-12761	89	44	in	in	ADP
bam-12761	89	45	the	the	DET
bam-12761	89	46	hiit	hiit	NOUN
bam-12761	89	47	and	and	CCONJ
bam-12761	89	48	sp	sp	ADP
bam-12761	89	49	groups	group	NOUN
bam-12761	89	50	than	than	ADP
bam-12761	89	51	those	those	PRON
bam-12761	89	52	in	in	ADP
bam-12761	89	53	the	the	DET
bam-12761	89	54	sham	sham	ADJ
bam-12761	89	55	group	group	NOUN
bam-12761	89	56	(	(	PUNCT
bam-12761	89	57	p=0.0001	p=0.0001	PROPN
bam-12761	89	58	)	)	PUNCT
bam-12761	89	59	,	,	PUNCT
bam-12761	89	60	with	with	ADP
bam-12761	89	61	higher	high	ADJ
bam-12761	89	62	values	value	NOUN
bam-12761	89	63	in	in	ADP
bam-12761	89	64	the	the	DET
bam-12761	89	65	hiit+sp	hiit+sp	ADJ
bam-12761	89	66	group	group	NOUN
bam-12761	89	67	than	than	ADP
bam-12761	89	68	those	those	PRON
bam-12761	89	69	in	in	ADP
bam-12761	89	70	the	the	DET
bam-12761	89	71	hiit	hiit	NOUN
bam-12761	89	72	,	,	PUNCT
bam-12761	89	73	supplement	supplement	NOUN
bam-12761	89	74	,	,	PUNCT
bam-12761	89	75	and	and	CCONJ
bam-12761	89	76	sham	sham	ADJ
bam-12761	89	77	groups	group	NOUN
bam-12761	89	78	(	(	PUNCT
bam-12761	89	79	p=0.0001	p=0.0001	PROPN
bam-12761	89	80	)	)	PUNCT
bam-12761	89	81	.	.	PUNCT
bam-12761	90	1	homa	homa	NOUN
bam-12761	90	2	-	-	PUNCT
bam-12761	90	3	ir	ir	PROPN
bam-12761	90	4	decreased	decrease	VERB
bam-12761	90	5	significantly	significantly	ADV
bam-12761	90	6	in	in	ADP
bam-12761	90	7	the	the	DET
bam-12761	90	8	hiit	hiit	NOUN
bam-12761	90	9	,	,	PUNCT
bam-12761	90	10	sp	sp	NOUN
bam-12761	90	11	,	,	PUNCT
bam-12761	90	12	and	and	CCONJ
bam-12761	90	13	hiit+sp	hiit+sp	NUM
bam-12761	90	14	groups	group	NOUN
bam-12761	90	15	compared	compare	VERB
bam-12761	90	16	with	with	ADP
bam-12761	90	17	that	that	PRON
bam-12761	90	18	in	in	ADP
bam-12761	90	19	the	the	DET
bam-12761	90	20	sham	sham	ADJ
bam-12761	90	21	group	group	NOUN
bam-12761	90	22	(	(	PUNCT
bam-12761	90	23	p<0.05	p<0.05	PROPN
bam-12761	90	24	)	)	PUNCT
bam-12761	90	25	.	.	PUNCT
bam-12761	91	1	there	there	PRON
bam-12761	91	2	was	be	VERB
bam-12761	91	3	no	no	DET
bam-12761	91	4	significant	significant	ADJ
bam-12761	91	5	difference	difference	NOUN
bam-12761	91	6	in	in	ADP
bam-12761	91	7	homair	homair	NOUN
bam-12761	91	8	among	among	ADP
bam-12761	91	9	hiit	hiit	PROPN
bam-12761	91	10	,	,	PUNCT
bam-12761	91	11	hiit+sp	hiit+sp	X
bam-12761	91	12	,	,	PUNCT
bam-12761	91	13	and	and	CCONJ
bam-12761	91	14	sp	sp	ADP
bam-12761	91	15	groups	group	NOUN
bam-12761	91	16	(	(	PUNCT
bam-12761	91	17	p>0.05	p>0.05	PROPN
bam-12761	91	18	)	)	PUNCT
bam-12761	91	19	.	.	PUNCT
bam-12761	92	1	in	in	ADP
bam-12761	92	2	addition	addition	NOUN
bam-12761	92	3	,	,	PUNCT
bam-12761	92	4	a	a	DET
bam-12761	92	5	significant	significant	ADJ
bam-12761	92	6	difference	difference	NOUN
bam-12761	92	7	was	be	AUX
bam-12761	92	8	observed	observe	VERB
bam-12761	92	9	in	in	ADP
bam-12761	92	10	all	all	DET
bam-12761	92	11	glycemic	glycemic	ADJ
bam-12761	92	12	indices	index	NOUN
bam-12761	92	13	between	between	ADP
bam-12761	92	14	the	the	DET
bam-12761	92	15	con	con	NOUN
bam-12761	92	16	and	and	CCONJ
bam-12761	92	17	sham	sham	ADJ
bam-12761	92	18	groups	group	NOUN
bam-12761	92	19	(	(	PUNCT
bam-12761	92	20	p=0.0001	p=0.0001	PROPN
bam-12761	92	21	)	)	PUNCT
bam-12761	92	22	.	.	PUNCT
bam-12761	93	1	there	there	PRON
bam-12761	93	2	were	be	VERB
bam-12761	93	3	significant	significant	ADJ
bam-12761	93	4	differences	difference	NOUN
bam-12761	93	5	in	in	ADP
bam-12761	93	6	myod1	myod1	NOUN
bam-12761	93	7	(	(	PUNCT
bam-12761	93	8	f=50.57	f=50.57	PROPN
bam-12761	93	9	;	;	PUNCT
bam-12761	93	10	p=0.0001	p=0.0001	PROPN
bam-12761	93	11	)	)	PUNCT
bam-12761	93	12	,	,	PUNCT
bam-12761	93	13	myogenin	myogenin	PROPN
bam-12761	93	14	(	(	PUNCT
bam-12761	93	15	f=24.62	f=24.62	NUM
bam-12761	93	16	;	;	PUNCT
bam-12761	93	17	p=0.0001	p=0.0001	PROPN
bam-12761	93	18	)	)	PUNCT
bam-12761	93	19	,	,	PUNCT
bam-12761	93	20	pax7	pax7	NOUN
bam-12761	93	21	(	(	PUNCT
bam-12761	93	22	f=79.95	f=79.95	NOUN
bam-12761	93	23	;	;	PUNCT
bam-12761	93	24	p=0.0001	p=0.0001	PROPN
bam-12761	93	25	)	)	PUNCT
bam-12761	93	26	,	,	PUNCT
bam-12761	93	27	and	and	CCONJ
bam-12761	93	28	myod1	myod1	PROPN
bam-12761	93	29	/	/	SYM
bam-12761	93	30	pax7	pax7	PROPN
bam-12761	93	31	(	(	PUNCT
bam-12761	93	32	f=13.93	f=13.93	PROPN
bam-12761	93	33	;	;	PUNCT
bam-12761	93	34	p=0.0001	p=0.0001	PROPN
bam-12761	93	35	)	)	PUNCT
bam-12761	93	36	gene	gene	NOUN
bam-12761	93	37	expression	expression	NOUN
bam-12761	93	38	levels	level	NOUN
bam-12761	93	39	in	in	ADP
bam-12761	93	40	the	the	DET
bam-12761	93	41	soleus	soleus	ADJ
bam-12761	93	42	muscle	muscle	NOUN
bam-12761	93	43	of	of	ADP
bam-12761	93	44	rats	rat	NOUN
bam-12761	93	45	in	in	ADP
bam-12761	93	46	the	the	DET
bam-12761	93	47	different	different	ADJ
bam-12761	93	48	groups	group	NOUN
bam-12761	93	49	(	(	PUNCT
bam-12761	93	50	figure	figure	NOUN
bam-12761	93	51	1	1	NUM
bam-12761	93	52	)	)	PUNCT
bam-12761	93	53	.	.	PUNCT
bam-12761	94	1	the	the	DET
bam-12761	94	2	post	post	ADJ
bam-12761	94	3	-	-	ADJ
bam-12761	94	4	hoc	hoc	ADJ
bam-12761	94	5	test	test	NOUN
bam-12761	94	6	showed	show	VERB
bam-12761	94	7	that	that	SCONJ
bam-12761	94	8	myod1	myod1	NOUN
bam-12761	94	9	gene	gene	NOUN
bam-12761	94	10	expression	expression	NOUN
bam-12761	94	11	levels	level	NOUN
bam-12761	94	12	in	in	ADP
bam-12761	94	13	the	the	DET
bam-12761	94	14	soleus	soleus	ADJ
bam-12761	94	15	muscle	muscle	NOUN
bam-12761	94	16	of	of	ADP
bam-12761	94	17	the	the	DET
bam-12761	94	18	hiit	hiit	NOUN
bam-12761	94	19	and	and	CCONJ
bam-12761	94	20	hiit+sp	hiit+sp	PUNCT
bam-12761	94	21	groups	group	NOUN
bam-12761	94	22	were	be	AUX
bam-12761	94	23	significantly	significantly	ADV
bam-12761	94	24	higher	high	ADJ
bam-12761	94	25	than	than	ADP
bam-12761	94	26	those	those	PRON
bam-12761	94	27	in	in	ADP
bam-12761	94	28	all	all	DET
bam-12761	94	29	other	other	ADJ
bam-12761	94	30	groups	group	NOUN
bam-12761	94	31	(	(	PUNCT
bam-12761	94	32	p=0.0001	p=0.0001	PROPN
bam-12761	94	33	)	)	PUNCT
bam-12761	94	34	and	and	CCONJ
bam-12761	94	35	were	be	AUX
bam-12761	94	36	higher	high	ADJ
bam-12761	94	37	in	in	ADP
bam-12761	94	38	hiit	hiit	NOUN
bam-12761	94	39	than	than	ADP
bam-12761	94	40	in	in	ADP
bam-12761	94	41	hiit+sp	hiit+sp	PRON
bam-12761	94	42	(	(	PUNCT
bam-12761	94	43	p=0.0001	p=0.0001	PROPN
bam-12761	94	44	)	)	PUNCT
bam-12761	94	45	.	.	PUNCT
bam-12761	95	1	myod1	myod1	NOUN
bam-12761	95	2	gene	gene	NOUN
bam-12761	95	3	expression	expression	NOUN
bam-12761	95	4	levels	level	NOUN
bam-12761	95	5	were	be	AUX
bam-12761	95	6	higher	high	ADJ
bam-12761	95	7	in	in	ADP
bam-12761	95	8	the	the	DET
bam-12761	95	9	sp	sp	NOUN
bam-12761	95	10	group	group	NOUN
bam-12761	95	11	than	than	ADP
bam-12761	95	12	in	in	ADP
bam-12761	95	13	the	the	DET
bam-12761	95	14	con	con	PROPN
bam-12761	95	15	group	group	NOUN
bam-12761	95	16	(	(	PUNCT
bam-12761	95	17	p=0.033	p=0.033	NOUN
bam-12761	95	18	)	)	PUNCT
bam-12761	95	19	.	.	PUNCT
bam-12761	96	1	pax7	pax7	NOUN
bam-12761	96	2	expression	expression	NOUN
bam-12761	96	3	was	be	AUX
bam-12761	96	4	higher	high	ADJ
bam-12761	96	5	in	in	ADP
bam-12761	96	6	the	the	DET
bam-12761	96	7	hiit	hiit	PROPN
bam-12761	96	8	group	group	NOUN
bam-12761	96	9	than	than	ADP
bam-12761	96	10	in	in	ADP
bam-12761	96	11	all	all	DET
bam-12761	96	12	investigated	investigate	VERB
bam-12761	96	13	groups	group	NOUN
bam-12761	96	14	(	(	PUNCT
bam-12761	96	15	p=0.0001	p=0.0001	PROPN
bam-12761	96	16	)	)	PUNCT
bam-12761	96	17	,	,	PUNCT
bam-12761	96	18	whereas	whereas	SCONJ
bam-12761	96	19	the	the	DET
bam-12761	96	20	hiit+sp	hiit+sp	X
bam-12761	96	21	group	group	NOUN
bam-12761	96	22	showed	show	VERB
bam-12761	96	23	a	a	DET
bam-12761	96	24	significant	significant	ADJ
bam-12761	96	25	increase	increase	NOUN
bam-12761	96	26	compared	compare	VERB
bam-12761	96	27	with	with	ADP
bam-12761	96	28	the	the	DET
bam-12761	96	29	sp	sp	NOUN
bam-12761	96	30	(	(	PUNCT
bam-12761	96	31	p=0.030	p=0.030	NUM
bam-12761	96	32	)	)	PUNCT
bam-12761	96	33	,	,	PUNCT
bam-12761	96	34	con	con	X
bam-12761	96	35	(	(	PUNCT
bam-12761	96	36	p=0.020	p=0.020	NOUN
bam-12761	96	37	)	)	PUNCT
bam-12761	96	38	,	,	PUNCT
bam-12761	96	39	and	and	CCONJ
bam-12761	96	40	sham	sham	NOUN
bam-12761	96	41	(	(	PUNCT
bam-12761	96	42	p=0.0001	p=0.0001	NOUN
bam-12761	96	43	)	)	PUNCT
bam-12761	96	44	groups	group	NOUN
bam-12761	96	45	.	.	PUNCT
bam-12761	97	1	no	no	DET
bam-12761	97	2	other	other	ADJ
bam-12761	97	3	significant	significant	ADJ
bam-12761	97	4	differences	difference	NOUN
bam-12761	97	5	were	be	AUX
bam-12761	97	6	observed	observe	VERB
bam-12761	97	7	between	between	ADP
bam-12761	97	8	the	the	DET
bam-12761	97	9	groups	group	NOUN
bam-12761	97	10	(	(	PUNCT
bam-12761	97	11	p>0.05	p>0.05	PROPN
bam-12761	97	12	)	)	PUNCT
bam-12761	97	13	.	.	PUNCT
bam-12761	98	1	according	accord	VERB
bam-12761	98	2	to	to	ADP
bam-12761	98	3	post	post	ADJ
bam-12761	98	4	-	-	ADJ
bam-12761	98	5	hoc	hoc	ADJ
bam-12761	98	6	tests	test	NOUN
bam-12761	98	7	,	,	PUNCT
bam-12761	98	8	myogenin	myogenin	ADJ
bam-12761	98	9	gene	gene	NOUN
bam-12761	98	10	expression	expression	NOUN
bam-12761	98	11	levels	level	NOUN
bam-12761	98	12	in	in	ADP
bam-12761	98	13	the	the	DET
bam-12761	98	14	hiit	hiit	PROPN
bam-12761	98	15	group	group	NOUN
bam-12761	98	16	were	be	AUX
bam-12761	98	17	significantly	significantly	ADV
bam-12761	98	18	higher	high	ADJ
bam-12761	98	19	than	than	ADP
bam-12761	98	20	those	those	PRON
bam-12761	98	21	in	in	ADP
bam-12761	98	22	all	all	DET
bam-12761	98	23	the	the	DET
bam-12761	98	24	investigated	investigate	VERB
bam-12761	98	25	groups	group	NOUN
bam-12761	98	26	(	(	PUNCT
bam-12761	98	27	p=0.0001	p=0.0001	PROPN
bam-12761	98	28	)	)	PUNCT
bam-12761	98	29	.	.	PUNCT
bam-12761	99	1	the	the	DET
bam-12761	99	2	hiit+sp	hiit+sp	NUM
bam-12761	99	3	values	value	NOUN
bam-12761	99	4	were	be	AUX
bam-12761	99	5	higher	high	ADJ
bam-12761	99	6	than	than	ADP
bam-12761	99	7	those	those	PRON
bam-12761	99	8	in	in	ADP
bam-12761	99	9	the	the	DET
bam-12761	99	10	con	con	PROPN
bam-12761	99	11	group	group	NOUN
bam-12761	99	12	(	(	PUNCT
bam-12761	99	13	p=0.004	p=0.004	PROPN
bam-12761	99	14	)	)	PUNCT
bam-12761	99	15	.	.	PUNCT
bam-12761	100	1	the	the	DET
bam-12761	100	2	results	result	NOUN
bam-12761	100	3	of	of	ADP
bam-12761	100	4	the	the	DET
bam-12761	100	5	post	post	ADJ
bam-12761	100	6	-	-	ADJ
bam-12761	100	7	hoc	hoc	ADJ
bam-12761	100	8	test	test	NOUN
bam-12761	100	9	of	of	ADP
bam-12761	100	10	the	the	DET
bam-12761	100	11	myod1	myod1	PROPN
bam-12761	100	12	/	/	SYM
bam-12761	100	13	pax7	pax7	PROPN
bam-12761	100	14	ratio	ratio	NOUN
bam-12761	100	15	28	28	NUM
bam-12761	100	16	table	table	NOUN
bam-12761	100	17	2	2	NUM
bam-12761	100	18	.	.	PUNCT
bam-12761	100	19	changes	change	NOUN
bam-12761	100	20	in	in	ADP
bam-12761	100	21	body	body	NOUN
bam-12761	100	22	mass	mass	NOUN
bam-12761	100	23	and	and	CCONJ
bam-12761	100	24	soleus	soleus	ADJ
bam-12761	100	25	muscle	muscle	NOUN
bam-12761	100	26	mass	mass	PROPN
bam-12761	100	27	before	before	ADV
bam-12761	100	28	and	and	CCONJ
bam-12761	100	29	after	after	ADP
bam-12761	100	30	the	the	DET
bam-12761	100	31	training	training	NOUN
bam-12761	100	32	period	period	NOUN
bam-12761	100	33	in	in	ADP
bam-12761	100	34	the	the	DET
bam-12761	100	35	studied	study	VERB
bam-12761	100	36	groups	group	NOUN
bam-12761	100	37	.	.	PUNCT
bam-12761	101	1	groups	group	NOUN
bam-12761	101	2	hiit+sp	hiit+sp	X
bam-12761	101	3	hiit	hiit	PROPN
bam-12761	101	4	sp	sp	ADP
bam-12761	101	5	con	con	PROPN
bam-12761	101	6	sham	sham	PROPN
bam-12761	101	7	baseline	baseline	PROPN
bam-12761	101	8	body	body	NOUN
bam-12761	101	9	mass(g	mass(g	NOUN
bam-12761	101	10	)	)	PUNCT
bam-12761	101	11	508.18±6.83	508.18±6.83	NUM
bam-12761	101	12	504.55±9.57	504.55±9.57	NUM
bam-12761	102	1	507.48±7.33	507.48±7.33	NUM
bam-12761	102	2	508.54±7.08	508.54±7.08	NUM
bam-12761	102	3	507.65±7.33	507.65±7.33	NUM
bam-12761	102	4	post	post	NOUN
bam-12761	102	5	body	body	NOUN
bam-12761	102	6	mass	mass	NOUN
bam-12761	102	7	(	(	PUNCT
bam-12761	102	8	g	g	NOUN
bam-12761	102	9	)	)	PUNCT
bam-12761	102	10	484.83±7.63b	484.83±7.63b	NOUN
bam-12761	103	1	486.65±8.08b	486.65±8.08b	NUM
bam-12761	104	1	501.38±7.70b	501.38±7.70b	NUM
bam-12761	104	2	569.23±15.36	569.23±15.36	NUM
bam-12761	104	3	568.63±26.59	568.63±26.59	NUM
bam-12761	104	4	soleus	soleus	NOUN
bam-12761	104	5	muscle	muscle	NOUN
bam-12761	104	6	mass	mass	NOUN
bam-12761	104	7	(	(	PUNCT
bam-12761	104	8	g	g	NOUN
bam-12761	104	9	)	)	PUNCT
bam-12761	104	10	0.66±0.05a	0.66±0.05a	NUM
bam-12761	104	11	0.67±0.02a	0.67±0.02a	NUM
bam-12761	104	12	0.64±0.04	0.64±0.04	NOUN
bam-12761	104	13	0.62±0.04	0.62±0.04	ADJ
bam-12761	104	14	0.62±0.05	0.62±0.05	NOUN
bam-12761	104	15	sole	sole	ADJ
bam-12761	104	16	muscle	muscle	NOUN
bam-12761	104	17	mass	mass	NOUN
bam-12761	104	18	ratio	ratio	NOUN
bam-12761	104	19	0.14	0.14	NUM
bam-12761	104	20	0.14	0.14	NUM
bam-12761	104	21	0.13	0.13	NUM
bam-12761	104	22	0.11	0.11	NUM
bam-12761	104	23	0.11	0.11	NUM
bam-12761	104	24	to	to	ADP
bam-12761	104	25	body	body	NOUN
bam-12761	104	26	mass	mass	NOUN
bam-12761	104	27	(	(	PUNCT
bam-12761	104	28	%	%	INTJ
bam-12761	104	29	)	)	PUNCT
bam-12761	104	30	con	con	NOUN
bam-12761	104	31	,	,	PUNCT
bam-12761	104	32	control	control	NOUN
bam-12761	104	33	;	;	PUNCT
bam-12761	104	34	sp	sp	NOUN
bam-12761	104	35	,	,	PUNCT
bam-12761	104	36	spirulina	spirulina	PROPN
bam-12761	104	37	;	;	PUNCT
bam-12761	104	38	hiit	hiit	PROPN
bam-12761	104	39	,	,	PUNCT
bam-12761	104	40	high	high	ADJ
bam-12761	104	41	-	-	PUNCT
bam-12761	104	42	intensity	intensity	NOUN
bam-12761	104	43	interval	interval	NOUN
bam-12761	104	44	training	training	NOUN
bam-12761	104	45	;	;	PUNCT
bam-12761	104	46	hiit	hiit	PROPN
bam-12761	104	47	+	+	CCONJ
bam-12761	104	48	sp	sp	PROPN
bam-12761	104	49	,	,	PUNCT
bam-12761	104	50	high	high	ADJ
bam-12761	104	51	-	-	PUNCT
bam-12761	104	52	intensity	intensity	NOUN
bam-12761	104	53	interval	interval	NOUN
bam-12761	104	54	training	training	NOUN
bam-12761	104	55	combined	combine	VERB
bam-12761	104	56	with	with	ADP
bam-12761	104	57	spirulina	spirulina	PROPN
bam-12761	104	58	.	.	PUNCT
bam-12761	105	1	asignificant	asignificant	ADJ
bam-12761	105	2	differences	difference	NOUN
bam-12761	105	3	compared	compare	VERB
bam-12761	105	4	with	with	ADP
bam-12761	105	5	the	the	DET
bam-12761	105	6	basic	basic	ADJ
bam-12761	105	7	con	con	PROPN
bam-12761	105	8	group	group	NOUN
bam-12761	105	9	.	.	PUNCT
bam-12761	106	1	bsignificant	bsignificant	ADJ
bam-12761	106	2	difference	difference	NOUN
bam-12761	106	3	compared	compare	VERB
bam-12761	106	4	with	with	ADP
bam-12761	106	5	the	the	DET
bam-12761	106	6	con	con	NOUN
bam-12761	106	7	and	and	CCONJ
bam-12761	106	8	sham	sham	ADJ
bam-12761	106	9	groups	group	NOUN
bam-12761	106	10	.	.	PUNCT
bam-12761	107	1	table	table	NOUN
bam-12761	107	2	3	3	NUM
bam-12761	107	3	.	.	PUNCT
bam-12761	107	4	comparison	comparison	NOUN
bam-12761	107	5	of	of	ADP
bam-12761	107	6	glycemic	glycemic	ADJ
bam-12761	107	7	indices	index	NOUN
bam-12761	107	8	between	between	ADP
bam-12761	107	9	the	the	DET
bam-12761	107	10	different	different	ADJ
bam-12761	107	11	groups	group	NOUN
bam-12761	107	12	.	.	PUNCT
bam-12761	108	1	groups	group	NOUN
bam-12761	108	2	fasting	fast	VERB
bam-12761	108	3	blood	blood	NOUN
bam-12761	108	4	glucose	glucose	NOUN
bam-12761	108	5	(	(	PUNCT
bam-12761	108	6	mg	mg	PROPN
bam-12761	108	7	/	/	SYM
bam-12761	108	8	dl	dl	NOUN
bam-12761	108	9	)	)	PUNCT
bam-12761	108	10	insulin	insulin	NOUN
bam-12761	108	11	(	(	PUNCT
bam-12761	108	12	µiu	µiu	ADJ
bam-12761	108	13	/	/	SYM
bam-12761	108	14	ml	ml	NOUN
bam-12761	108	15	)	)	PUNCT
bam-12761	108	16	homa	homa	NOUN
bam-12761	108	17	-	-	PUNCT
bam-12761	108	18	ir	ir	PROPN
bam-12761	108	19	hiit	hiit	PROPN
bam-12761	108	20	201.12±16.84e	201.12±16.84e	PROPN
bam-12761	108	21	7.17±0.14a	7.17±0.14a	NUM
bam-12761	108	22	3.55±0.23c	3.55±0.23c	PRON
bam-12761	108	23	hiit+sp	hiit+sp	NUM
bam-12761	108	24	165.25±18.51d	165.25±18.51d	PROPN
bam-12761	108	25	9.24±0.39d	9.24±0.39d	NOUN
bam-12761	108	26	3.73±0.34a	3.73±0.34a	NUM
bam-12761	108	27	sp	sp	ADP
bam-12761	108	28	230.25±39.23a	230.25±39.23a	NUM
bam-12761	108	29	6.99±0.29a	6.99±0.29a	NUM
bam-12761	108	30	3.98±0.74a	3.98±0.74a	NOUN
bam-12761	108	31	con	con	PROPN
bam-12761	108	32	90.37±8.07	90.37±8.07	NUM
bam-12761	108	33	13.12±1.56	13.12±1.56	NUM
bam-12761	108	34	2.94±0.53	2.94±0.53	NUM
bam-12761	108	35	sham	sham	NOUN
bam-12761	108	36	372.00±28.83b	372.00±28.83b	NUM
bam-12761	108	37	5.13±0.12b	5.13±0.12b	NUM
bam-12761	108	38	4.71±0.39b	4.71±0.39b	NUM
bam-12761	108	39	con	con	NOUN
bam-12761	108	40	,	,	PUNCT
bam-12761	108	41	control	control	NOUN
bam-12761	108	42	;	;	PUNCT
bam-12761	108	43	sp	sp	NOUN
bam-12761	108	44	,	,	PUNCT
bam-12761	108	45	spirulina	spirulina	PROPN
bam-12761	108	46	;	;	PUNCT
bam-12761	108	47	hiit	hiit	PROPN
bam-12761	108	48	,	,	PUNCT
bam-12761	108	49	high	high	ADJ
bam-12761	108	50	-	-	PUNCT
bam-12761	108	51	intensity	intensity	NOUN
bam-12761	108	52	interval	interval	NOUN
bam-12761	108	53	training	training	NOUN
bam-12761	108	54	;	;	PUNCT
bam-12761	108	55	hiit	hiit	PROPN
bam-12761	108	56	+	+	CCONJ
bam-12761	108	57	sp	sp	PROPN
bam-12761	108	58	,	,	PUNCT
bam-12761	108	59	high	high	ADJ
bam-12761	108	60	-	-	PUNCT
bam-12761	108	61	intensity	intensity	NOUN
bam-12761	108	62	interval	interval	NOUN
bam-12761	108	63	training	training	NOUN
bam-12761	108	64	combined	combine	VERB
bam-12761	108	65	with	with	ADP
bam-12761	108	66	spirulina	spirulina	PROPN
bam-12761	108	67	.	.	PUNCT
bam-12761	109	1	asignificant	asignificant	ADJ
bam-12761	109	2	differences	difference	NOUN
bam-12761	109	3	compared	compare	VERB
bam-12761	109	4	to	to	ADP
bam-12761	109	5	the	the	DET
bam-12761	109	6	con	con	NOUN
bam-12761	109	7	and	and	CCONJ
bam-12761	109	8	sham	sham	ADJ
bam-12761	109	9	groups	group	NOUN
bam-12761	109	10	.	.	PUNCT
bam-12761	110	1	bsignificant	bsignificant	ADJ
bam-12761	110	2	difference	difference	NOUN
bam-12761	110	3	compared	compare	VERB
bam-12761	110	4	to	to	ADP
bam-12761	110	5	the	the	DET
bam-12761	110	6	con	con	PROPN
bam-12761	110	7	group	group	NOUN
bam-12761	110	8	;	;	PUNCT
bam-12761	110	9	csignificant	csignificant	ADJ
bam-12761	110	10	difference	difference	NOUN
bam-12761	110	11	compared	compare	VERB
bam-12761	110	12	to	to	ADP
bam-12761	110	13	the	the	DET
bam-12761	110	14	sham	sham	ADJ
bam-12761	110	15	group	group	NOUN
bam-12761	110	16	;	;	PUNCT
bam-12761	110	17	dsignificant	dsignificant	NOUN
bam-12761	110	18	difference	difference	NOUN
bam-12761	110	19	compared	compare	VERB
bam-12761	110	20	to	to	ADP
bam-12761	110	21	all	all	DET
bam-12761	110	22	groups	group	NOUN
bam-12761	110	23	esignificant	esignificant	ADJ
bam-12761	110	24	difference	difference	NOUN
bam-12761	110	25	compared	compare	VERB
bam-12761	110	26	to	to	ADP
bam-12761	110	27	hiit+sp	hiit+sp	NUM
bam-12761	110	28	,	,	PUNCT
bam-12761	110	29	sham	sham	ADJ
bam-12761	110	30	and	and	CCONJ
bam-12761	110	31	con	con	PROPN
bam-12761	110	32	groups	group	NOUN
bam-12761	110	33	.	.	PUNCT
bam-12761	111	1	non	non	ADJ
bam-12761	111	2	-co	-co	PROPN
bam-12761	111	3	mmerc	mmerc	PROPN
bam-12761	111	4	ial	ial	PROPN
bam-12761	111	5	us	us	PROPN
bam-12761	111	6	e	e	NOUN
bam-12761	111	7	o	o	X
bam-12761	111	8	nly	nly	ADV
bam-12761	111	9	high	high	ADJ
bam-12761	111	10	-	-	PUNCT
bam-12761	111	11	intensity	intensity	NOUN
bam-12761	111	12	interval	interval	NOUN
bam-12761	111	13	training	training	NOUN
bam-12761	111	14	,	,	PUNCT
bam-12761	111	15	but	but	CCONJ
bam-12761	111	16	not	not	PART
bam-12761	111	17	spirulina	spirulina	NOUN
bam-12761	111	18	supplementation	supplementation	NOUN
bam-12761	111	19	,	,	PUNCT
bam-12761	111	20	changes	change	VERB
bam-12761	111	21	muscle	muscle	NOUN
bam-12761	111	22	regeneration	regeneration	NOUN
bam-12761	111	23	signaling	signal	VERB
bam-12761	111	24	proteins	protein	NOUN
bam-12761	111	25	eur	eur	PROPN
bam-12761	111	26	j	j	PROPN
bam-12761	111	27	transl	transl	PROPN
bam-12761	111	28	myol	myol	NOUN
bam-12761	111	29	34	34	NUM
bam-12761	111	30	(	(	PUNCT
bam-12761	111	31	4	4	NUM
bam-12761	111	32	)	)	PUNCT
bam-12761	111	33	12761	12761	NUM
bam-12761	111	34	,	,	PUNCT
bam-12761	111	35	2024	2024	NUM
bam-12761	111	36	doi	doi	NOUN
bam-12761	111	37	:	:	PUNCT
bam-12761	111	38	10.4081	10.4081	NUM
bam-12761	111	39	/	/	SYM
bam-12761	111	40	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	111	41	were	be	AUX
bam-12761	111	42	higher	high	ADJ
bam-12761	111	43	in	in	ADP
bam-12761	111	44	the	the	DET
bam-12761	111	45	con	con	PROPN
bam-12761	111	46	group	group	NOUN
bam-12761	111	47	than	than	ADP
bam-12761	111	48	in	in	ADP
bam-12761	111	49	all	all	DET
bam-12761	111	50	other	other	ADJ
bam-12761	111	51	groups	group	NOUN
bam-12761	111	52	(	(	PUNCT
bam-12761	111	53	p<0.05	p<0.05	NOUN
bam-12761	111	54	)	)	PUNCT
bam-12761	111	55	;	;	PUNCT
bam-12761	111	56	however	however	ADV
bam-12761	111	57	,	,	PUNCT
bam-12761	111	58	no	no	DET
bam-12761	111	59	other	other	ADJ
bam-12761	111	60	significant	significant	ADJ
bam-12761	111	61	differences	difference	NOUN
bam-12761	111	62	were	be	AUX
bam-12761	111	63	observed	observe	VERB
bam-12761	111	64	between	between	ADP
bam-12761	111	65	the	the	DET
bam-12761	111	66	groups	group	NOUN
bam-12761	111	67	(	(	PUNCT
bam-12761	111	68	p>0.05	p>0.05	PROPN
bam-12761	111	69	)	)	PUNCT
bam-12761	111	70	.	.	PUNCT
bam-12761	112	1	discussion	discussion	NOUN
bam-12761	112	2	this	this	DET
bam-12761	112	3	study	study	NOUN
bam-12761	112	4	aimed	aim	VERB
bam-12761	112	5	to	to	PART
bam-12761	112	6	investigate	investigate	VERB
bam-12761	112	7	the	the	DET
bam-12761	112	8	changes	change	NOUN
bam-12761	112	9	in	in	ADP
bam-12761	112	10	myogenic	myogenic	ADJ
bam-12761	112	11	signaling	signal	VERB
bam-12761	112	12	proteins	protein	NOUN
bam-12761	112	13	in	in	ADP
bam-12761	112	14	aged	aged	ADJ
bam-12761	112	15	rats	rat	NOUN
bam-12761	112	16	with	with	ADP
bam-12761	112	17	obesity	obesity	NOUN
bam-12761	112	18	and	and	CCONJ
bam-12761	112	19	diabetes	diabetes	NOUN
bam-12761	112	20	following	follow	VERB
bam-12761	112	21	hiit	hiit	PROPN
bam-12761	112	22	or	or	CCONJ
bam-12761	112	23	sp	sp	ADP
bam-12761	112	24	supplementation	supplementation	NOUN
bam-12761	112	25	.	.	PUNCT
bam-12761	113	1	the	the	DET
bam-12761	113	2	results	result	NOUN
bam-12761	113	3	of	of	ADP
bam-12761	113	4	the	the	DET
bam-12761	113	5	present	present	ADJ
bam-12761	113	6	study	study	NOUN
bam-12761	113	7	showed	show	VERB
bam-12761	113	8	that	that	SCONJ
bam-12761	113	9	hiit	hiit	NOUN
bam-12761	113	10	alone	alone	ADV
bam-12761	113	11	(	(	PUNCT
bam-12761	113	12	14	14	NUM
bam-12761	113	13	%	%	NOUN
bam-12761	113	14	)	)	PUNCT
bam-12761	113	15	and	and	CCONJ
bam-12761	113	16	in	in	ADP
bam-12761	113	17	combination	combination	NOUN
bam-12761	113	18	with	with	ADP
bam-12761	113	19	sp	sp	ADP
bam-12761	113	20	(	(	PUNCT
bam-12761	113	21	9	9	NUM
bam-12761	113	22	%	%	NOUN
bam-12761	113	23	)	)	PUNCT
bam-12761	113	24	caused	cause	VERB
bam-12761	113	25	a	a	DET
bam-12761	113	26	significant	significant	ADJ
bam-12761	113	27	decrease	decrease	NOUN
bam-12761	113	28	in	in	ADP
bam-12761	113	29	body	body	NOUN
bam-12761	113	30	mass	mass	NOUN
bam-12761	113	31	.	.	PUNCT
bam-12761	114	1	there	there	PRON
bam-12761	114	2	was	be	VERB
bam-12761	114	3	also	also	ADV
bam-12761	114	4	an	an	DET
bam-12761	114	5	increase	increase	NOUN
bam-12761	114	6	in	in	ADP
bam-12761	114	7	soleus	soleus	ADJ
bam-12761	114	8	muscle	muscle	NOUN
bam-12761	114	9	mass	mass	NOUN
bam-12761	114	10	in	in	ADP
bam-12761	114	11	the	the	DET
bam-12761	114	12	hiit+sp	hiit+sp	X
bam-12761	114	13	(	(	PUNCT
bam-12761	114	14	17.8	17.8	NUM
bam-12761	114	15	%	%	NOUN
bam-12761	114	16	)	)	PUNCT
bam-12761	114	17	and	and	CCONJ
bam-12761	114	18	hiit	hiit	PROPN
bam-12761	114	19	(	(	PUNCT
bam-12761	114	20	19.6	19.6	NUM
bam-12761	114	21	%	%	NOUN
bam-12761	114	22	)	)	PUNCT
bam-12761	114	23	groups	group	NOUN
bam-12761	114	24	compared	compare	VERB
bam-12761	114	25	to	to	ADP
bam-12761	114	26	that	that	PRON
bam-12761	114	27	in	in	ADP
bam-12761	114	28	the	the	DET
bam-12761	114	29	basic	basic	ADJ
bam-12761	114	30	con	con	NOUN
bam-12761	114	31	group	group	NOUN
bam-12761	114	32	.	.	PUNCT
bam-12761	115	1	many	many	ADJ
bam-12761	115	2	studies	study	NOUN
bam-12761	115	3	have	have	AUX
bam-12761	115	4	been	be	AUX
bam-12761	115	5	conducted	conduct	VERB
bam-12761	115	6	on	on	ADP
bam-12761	115	7	the	the	DET
bam-12761	115	8	effect	effect	NOUN
bam-12761	115	9	of	of	ADP
bam-12761	115	10	hiit	hiit	PROPN
bam-12761	115	11	on	on	ADP
bam-12761	115	12	body	body	NOUN
bam-12761	115	13	mass	mass	PROPN
bam-12761	115	14	,	,	PUNCT
bam-12761	115	15	which	which	PRON
bam-12761	115	16	is	be	AUX
bam-12761	115	17	mostly	mostly	ADV
bam-12761	115	18	consistent	consistent	ADJ
bam-12761	115	19	with	with	ADP
bam-12761	115	20	the	the	DET
bam-12761	115	21	present	present	ADJ
bam-12761	115	22	findings	finding	NOUN
bam-12761	115	23	,	,	PUNCT
bam-12761	115	24	indicating	indicate	VERB
bam-12761	115	25	the	the	DET
bam-12761	115	26	effects	effect	NOUN
bam-12761	115	27	of	of	ADP
bam-12761	115	28	weight	weight	NOUN
bam-12761	115	29	loss	loss	NOUN
bam-12761	115	30	following	follow	VERB
bam-12761	115	31	hiit.24,25	hiit.24,25	NOUN
bam-12761	115	32	moreover	moreover	ADV
bam-12761	115	33	,	,	PUNCT
bam-12761	115	34	previous	previous	ADJ
bam-12761	115	35	studies	study	NOUN
bam-12761	115	36	have	have	AUX
bam-12761	115	37	shown	show	VERB
bam-12761	115	38	that	that	SCONJ
bam-12761	115	39	hiit	hiit	PROPN
bam-12761	115	40	is	be	AUX
bam-12761	115	41	likely	likely	ADV
bam-12761	115	42	associated	associate	VERB
bam-12761	115	43	with	with	ADP
bam-12761	115	44	promote	promote	NOUN
bam-12761	115	45	both	both	CCONJ
bam-12761	115	46	anabolic	anabolic	NOUN
bam-12761	115	47	and	and	CCONJ
bam-12761	115	48	anticatabolic	anticatabolic	ADJ
bam-12761	115	49	stimuli	stimulus	NOUN
bam-12761	115	50	and	and	CCONJ
bam-12761	115	51	stimulate	stimulate	VERB
bam-12761	115	52	muscle	muscle	NOUN
bam-12761	115	53	hypertrophy.26	hypertrophy.26	ADJ
bam-12761	115	54	the	the	DET
bam-12761	115	55	results	result	NOUN
bam-12761	115	56	showed	show	VERB
bam-12761	115	57	that	that	SCONJ
bam-12761	115	58	sp	sp	ADP
bam-12761	115	59	alone	alone	ADJ
bam-12761	115	60	and	and	CCONJ
bam-12761	115	61	in	in	ADP
bam-12761	115	62	combination	combination	NOUN
bam-12761	115	63	with	with	ADP
bam-12761	115	64	hiit	hiit	PROPN
bam-12761	115	65	caused	cause	VERB
bam-12761	115	66	weight	weight	NOUN
bam-12761	115	67	loss	loss	NOUN
bam-12761	115	68	,	,	PUNCT
bam-12761	115	69	reduced	reduce	VERB
bam-12761	115	70	fasting	fast	VERB
bam-12761	115	71	blood	blood	NOUN
bam-12761	115	72	glucose	glucose	NOUN
bam-12761	115	73	levels	level	NOUN
bam-12761	115	74	,	,	PUNCT
bam-12761	115	75	increased	increase	VERB
bam-12761	115	76	insulin	insulin	NOUN
bam-12761	115	77	levels	level	NOUN
bam-12761	115	78	,	,	PUNCT
bam-12761	115	79	and	and	CCONJ
bam-12761	115	80	improved	improve	VERB
bam-12761	115	81	insulin	insulin	NOUN
bam-12761	115	82	resistance	resistance	NOUN
bam-12761	115	83	.	.	PUNCT
bam-12761	116	1	notably	notably	ADV
bam-12761	116	2	,	,	PUNCT
bam-12761	116	3	these	these	DET
bam-12761	116	4	changes	change	NOUN
bam-12761	116	5	were	be	AUX
bam-12761	116	6	significantly	significantly	ADV
bam-12761	116	7	higher	high	ADJ
bam-12761	116	8	in	in	ADP
bam-12761	116	9	the	the	DET
bam-12761	116	10	hiit+sp	hiit+sp	ADJ
bam-12761	116	11	group	group	NOUN
bam-12761	116	12	than	than	ADP
bam-12761	116	13	in	in	ADP
bam-12761	116	14	the	the	DET
bam-12761	116	15	sp	sp	NOUN
bam-12761	116	16	group	group	NOUN
bam-12761	116	17	,	,	PUNCT
bam-12761	116	18	indicating	indicate	VERB
bam-12761	116	19	a	a	DET
bam-12761	116	20	synergy	synergy	NOUN
bam-12761	116	21	between	between	ADP
bam-12761	116	22	hiit	hiit	PROPN
bam-12761	116	23	and	and	CCONJ
bam-12761	116	24	sp	sp	ADP
bam-12761	116	25	supplementation	supplementation	NOUN
bam-12761	116	26	.	.	PUNCT
bam-12761	117	1	however	however	ADV
bam-12761	117	2	,	,	PUNCT
bam-12761	117	3	some	some	DET
bam-12761	117	4	studies	study	NOUN
bam-12761	117	5	have	have	AUX
bam-12761	117	6	reported	report	VERB
bam-12761	117	7	results	result	NOUN
bam-12761	117	8	that	that	PRON
bam-12761	117	9	are	be	AUX
bam-12761	117	10	contrary	contrary	ADJ
bam-12761	117	11	to	to	ADP
bam-12761	117	12	those	those	PRON
bam-12761	117	13	of	of	ADP
bam-12761	117	14	the	the	DET
bam-12761	117	15	current	current	ADJ
bam-12761	117	16	study	study	NOUN
bam-12761	117	17	.	.	PUNCT
bam-12761	118	1	for	for	ADP
bam-12761	118	2	example	example	NOUN
bam-12761	118	3	,	,	PUNCT
bam-12761	118	4	lee	lee	PROPN
bam-12761	118	5	et	et	PROPN
bam-12761	118	6	al	al	PROPN
bam-12761	118	7	.	.	PROPN
bam-12761	118	8	(	(	PUNCT
bam-12761	118	9	2008	2008	NUM
bam-12761	118	10	)	)	PUNCT
bam-12761	118	11	indicated	indicate	VERB
bam-12761	118	12	that	that	SCONJ
bam-12761	118	13	there	there	PRON
bam-12761	118	14	was	be	VERB
bam-12761	118	15	no	no	DET
bam-12761	118	16	significant	significant	ADJ
bam-12761	118	17	decrease	decrease	NOUN
bam-12761	118	18	in	in	ADP
bam-12761	118	19	serum	serum	NOUN
bam-12761	118	20	glucose	glucose	NOUN
bam-12761	118	21	and	and	CCONJ
bam-12761	118	22	insulin	insulin	NOUN
bam-12761	118	23	levels	level	NOUN
bam-12761	118	24	in	in	ADP
bam-12761	118	25	diabetic	diabetic	ADJ
bam-12761	118	26	patients	patient	NOUN
bam-12761	118	27	owing	owe	VERB
bam-12761	118	28	to	to	ADP
bam-12761	118	29	supplementation.27	supplementation.27	PROPN
bam-12761	118	30	the	the	DET
bam-12761	118	31	positive	positive	ADJ
bam-12761	118	32	effects	effect	NOUN
bam-12761	118	33	of	of	ADP
bam-12761	118	34	hiit	hiit	NOUN
bam-12761	118	35	on	on	ADP
bam-12761	118	36	diabetes	diabetes	NOUN
bam-12761	118	37	management	management	NOUN
bam-12761	118	38	have	have	AUX
bam-12761	118	39	been	be	AUX
bam-12761	118	40	reported	report	VERB
bam-12761	118	41	in	in	ADP
bam-12761	118	42	several	several	ADJ
bam-12761	118	43	studies12,28,29	studies12,28,29	NOUN
bam-12761	118	44	and	and	CCONJ
bam-12761	118	45	is	be	AUX
bam-12761	118	46	be	be	AUX
bam-12761	118	47	associated	associate	VERB
bam-12761	118	48	with	with	ADP
bam-12761	118	49	improvements	improvement	NOUN
bam-12761	118	50	in	in	ADP
bam-12761	118	51	glucose	glucose	NOUN
bam-12761	118	52	metabolism,29	metabolism,29	NOUN
bam-12761	118	53	changes	change	NOUN
bam-12761	118	54	in	in	ADP
bam-12761	118	55	insulin	insulin	NOUN
bam-12761	118	56	receptor	receptor	NOUN
bam-12761	118	57	signaling	signal	VERB
bam-12761	118	58	,	,	PUNCT
bam-12761	118	59	increased	increase	VERB
bam-12761	118	60	expression	expression	NOUN
bam-12761	118	61	of	of	ADP
bam-12761	118	62	glucose	glucose	NOUN
bam-12761	118	63	transporter	transporter	NOUN
bam-12761	118	64	proteins	protein	NOUN
bam-12761	118	65	,	,	PUNCT
bam-12761	118	66	reduced	reduce	VERB
bam-12761	118	67	release	release	NOUN
bam-12761	118	68	of	of	ADP
bam-12761	118	69	free	free	ADJ
bam-12761	118	70	fatty	fatty	NOUN
bam-12761	118	71	acids	acid	NOUN
bam-12761	118	72	,	,	PUNCT
bam-12761	118	73	and	and	CCONJ
bam-12761	118	74	increased	increase	VERB
bam-12761	118	75	release	release	NOUN
bam-12761	118	76	of	of	ADP
bam-12761	118	77	blood	blood	NOUN
bam-12761	118	78	glucose	glucose	NOUN
bam-12761	118	79	into	into	ADP
bam-12761	118	80	the	the	DET
bam-12761	118	81	muscle.28	muscle.28	NOUN
bam-12761	118	82	sp	sp	NOUN
bam-12761	118	83	has	have	AUX
bam-12761	118	84	also	also	ADV
bam-12761	118	85	been	be	AUX
bam-12761	118	86	found	find	VERB
bam-12761	118	87	to	to	PART
bam-12761	118	88	improve	improve	VERB
bam-12761	118	89	diabetes	diabetes	NOUN
bam-12761	118	90	control	control	NOUN
bam-12761	118	91	by	by	ADP
bam-12761	118	92	reducing	reduce	VERB
bam-12761	118	93	the	the	DET
bam-12761	118	94	weight	weight	NOUN
bam-12761	118	95	and	and	CCONJ
bam-12761	118	96	production	production	NOUN
bam-12761	118	97	of	of	ADP
bam-12761	118	98	proinflammatory	proinflammatory	ADJ
bam-12761	118	99	cytokines.12	cytokines.12	NOUN
bam-12761	118	100	the	the	DET
bam-12761	118	101	effectiveness	effectiveness	NOUN
bam-12761	118	102	of	of	ADP
bam-12761	118	103	sp	sp	NOUN
bam-12761	118	104	is	be	AUX
bam-12761	118	105	mainly	mainly	ADV
bam-12761	118	106	attributed	attribute	VERB
bam-12761	118	107	to	to	ADP
bam-12761	118	108	the	the	DET
bam-12761	118	109	water	water	NOUN
bam-12761	118	110	-	-	PUNCT
bam-12761	118	111	soluble	soluble	ADJ
bam-12761	118	112	part	part	NOUN
bam-12761	118	113	of	of	ADP
bam-12761	118	114	this	this	DET
bam-12761	118	115	alga	alga	NOUN
bam-12761	118	116	,	,	PUNCT
bam-12761	118	117	which	which	PRON
bam-12761	118	118	consists	consist	VERB
bam-12761	118	119	of	of	ADP
bam-12761	118	120	a	a	DET
bam-12761	118	121	protein	protein	NOUN
bam-12761	118	122	called	call	VERB
bam-12761	118	123	phycocyanin	phycocyanin	ADV
bam-12761	118	124	,	,	PUNCT
bam-12761	118	125	and	and	CCONJ
bam-12761	118	126	is	be	AUX
bam-12761	118	127	considered	consider	VERB
bam-12761	118	128	a	a	DET
bam-12761	118	129	blood	blood	NOUN
bam-12761	118	130	glucose	glucose	NOUN
bam-12761	118	131	-	-	PUNCT
bam-12761	118	132	lowering	lower	VERB
bam-12761	118	133	agent	agent	NOUN
bam-12761	118	134	.	.	PUNCT
bam-12761	119	1	furthermore	furthermore	ADV
bam-12761	119	2	,	,	PUNCT
bam-12761	119	3	other	other	ADJ
bam-12761	119	4	factors	factor	NOUN
bam-12761	119	5	that	that	PRON
bam-12761	119	6	have	have	AUX
bam-12761	119	7	been	be	AUX
bam-12761	119	8	associated	associate	VERB
bam-12761	119	9	with	with	ADP
bam-12761	119	10	the	the	DET
bam-12761	119	11	effects	effect	NOUN
bam-12761	119	12	of	of	ADP
bam-12761	119	13	sp	sp	NOUN
bam-12761	119	14	on	on	ADP
bam-12761	119	15	glycemic	glycemic	ADJ
bam-12761	119	16	control	control	NOUN
bam-12761	119	17	are	be	AUX
bam-12761	119	18	the	the	DET
bam-12761	119	19	high	high	ADJ
bam-12761	119	20	fiber	fiber	NOUN
bam-12761	119	21	content	content	NOUN
bam-12761	119	22	,	,	PUNCT
bam-12761	119	23	which	which	PRON
bam-12761	119	24	reduces	reduce	VERB
bam-12761	119	25	the	the	DET
bam-12761	119	26	absorption	absorption	NOUN
bam-12761	119	27	of	of	ADP
bam-12761	119	28	glucose	glucose	NOUN
bam-12761	119	29	in	in	ADP
bam-12761	119	30	the	the	DET
bam-12761	119	31	digestive	digestive	ADJ
bam-12761	119	32	system,30	system,30	NUM
bam-12761	119	33	and	and	CCONJ
bam-12761	119	34	vitamin	vitamin	NOUN
bam-12761	119	35	b6	b6	NOUN
bam-12761	119	36	,	,	PUNCT
bam-12761	119	37	which	which	PRON
bam-12761	119	38	helps	help	VERB
bam-12761	119	39	in	in	ADP
bam-12761	119	40	insulin	insulin	NOUN
bam-12761	119	41	production.31	production.31	NOUN
bam-12761	119	42	an	an	DET
bam-12761	119	43	important	important	ADJ
bam-12761	119	44	goal	goal	NOUN
bam-12761	119	45	of	of	ADP
bam-12761	119	46	the	the	DET
bam-12761	119	47	present	present	ADJ
bam-12761	119	48	study	study	NOUN
bam-12761	119	49	was	be	AUX
bam-12761	119	50	to	to	PART
bam-12761	119	51	investigate	investigate	VERB
bam-12761	119	52	the	the	DET
bam-12761	119	53	effects	effect	NOUN
bam-12761	119	54	of	of	ADP
bam-12761	119	55	hiit	hiit	PROPN
bam-12761	119	56	and	and	CCONJ
bam-12761	119	57	sp	sp	ADP
bam-12761	119	58	supplementation	supplementation	NOUN
bam-12761	119	59	on	on	ADP
bam-12761	119	60	the	the	DET
bam-12761	119	61	expression	expression	NOUN
bam-12761	119	62	of	of	ADP
bam-12761	119	63	myogenic	myogenic	ADJ
bam-12761	119	64	proteins	protein	NOUN
bam-12761	119	65	in	in	ADP
bam-12761	119	66	the	the	DET
bam-12761	119	67	soleus	soleus	ADJ
bam-12761	119	68	muscle	muscle	NOUN
bam-12761	119	69	.	.	PUNCT
bam-12761	120	1	the	the	DET
bam-12761	120	2	results	result	NOUN
bam-12761	120	3	showed	show	VERB
bam-12761	120	4	that	that	SCONJ
bam-12761	120	5	the	the	DET
bam-12761	120	6	expression	expression	NOUN
bam-12761	120	7	of	of	ADP
bam-12761	120	8	myogenin	myogenin	PROPN
bam-12761	120	9	,	,	PUNCT
bam-12761	120	10	myod1	myod1	NOUN
bam-12761	120	11	and	and	CCONJ
bam-12761	120	12	pax7	pax7	PROPN
bam-12761	120	13	increased	increase	VERB
bam-12761	120	14	more	more	ADV
bam-12761	120	15	in	in	ADP
bam-12761	120	16	the	the	DET
bam-12761	120	17	hiit	hiit	PROPN
bam-12761	120	18	group	group	NOUN
bam-12761	120	19	than	than	ADP
bam-12761	120	20	in	in	ADP
bam-12761	120	21	other	other	ADJ
bam-12761	120	22	groups	group	NOUN
bam-12761	120	23	and	and	CCONJ
bam-12761	120	24	the	the	DET
bam-12761	120	25	myod1	myod1	PROPN
bam-12761	120	26	/	/	SYM
bam-12761	120	27	pax7	pax7	PROPN
bam-12761	120	28	ratio	ratio	NOUN
bam-12761	120	29	in	in	ADP
bam-12761	120	30	all	all	DET
bam-12761	120	31	groups	group	NOUN
bam-12761	120	32	was	be	AUX
bam-12761	120	33	lower	low	ADJ
bam-12761	120	34	than	than	ADP
bam-12761	120	35	the	the	DET
bam-12761	120	36	con	con	NOUN
bam-12761	120	37	.	.	PUNCT
bam-12761	121	1	this	this	DET
bam-12761	121	2	increase	increase	NOUN
bam-12761	121	3	in	in	ADP
bam-12761	121	4	myogenin	myogenin	ADJ
bam-12761	121	5	expression	expression	NOUN
bam-12761	121	6	is	be	AUX
bam-12761	121	7	consistent	consistent	ADJ
bam-12761	121	8	with	with	ADP
bam-12761	121	9	the	the	DET
bam-12761	121	10	results	result	NOUN
bam-12761	121	11	of	of	ADP
bam-12761	121	12	some	some	PRON
bam-12761	121	13	studies.8,32	studies.8,32	VERB
bam-12761	121	14	however	however	ADV
bam-12761	121	15	,	,	PUNCT
bam-12761	121	16	there	there	PRON
bam-12761	121	17	are	be	VERB
bam-12761	121	18	others	other	NOUN
bam-12761	121	19	that	that	PRON
bam-12761	121	20	do	do	AUX
bam-12761	121	21	not	not	PART
bam-12761	121	22	show	show	VERB
bam-12761	121	23	significant	significant	ADJ
bam-12761	121	24	changes.33,34	changes.33,34	NOUN
bam-12761	121	25	the	the	DET
bam-12761	121	26	increase	increase	NOUN
bam-12761	121	27	in	in	ADP
bam-12761	121	28	pax7	pax7	NOUN
bam-12761	121	29	expression	expression	NOUN
bam-12761	121	30	and	and	CCONJ
bam-12761	121	31	decrease	decrease	NOUN
bam-12761	121	32	in	in	ADP
bam-12761	121	33	the	the	DET
bam-12761	121	34	myod1	myod1	PROPN
bam-12761	121	35	/	/	SYM
bam-12761	121	36	pax7	pax7	PROPN
bam-12761	121	37	ratio	ratio	NOUN
bam-12761	121	38	in	in	ADP
bam-12761	121	39	the	the	DET
bam-12761	121	40	intervention	intervention	NOUN
bam-12761	121	41	29	29	NUM
bam-12761	121	42	figure	figure	NOUN
bam-12761	121	43	1	1	NUM
bam-12761	121	44	.	.	PUNCT
bam-12761	122	1	changes	change	NOUN
bam-12761	122	2	in	in	ADP
bam-12761	122	3	muscle	muscle	NOUN
bam-12761	122	4	regeneration	regeneration	NOUN
bam-12761	122	5	signaling	signal	VERB
bam-12761	122	6	proteins	protein	NOUN
bam-12761	122	7	in	in	ADP
bam-12761	122	8	the	the	DET
bam-12761	122	9	studied	study	VERB
bam-12761	122	10	groups	group	NOUN
bam-12761	122	11	.	.	PUNCT
bam-12761	123	1	a	a	DET
bam-12761	123	2	,	,	PUNCT
bam-12761	123	3	significant	significant	ADJ
bam-12761	123	4	difference	difference	NOUN
bam-12761	123	5	compared	compare	VERB
bam-12761	123	6	to	to	ADP
bam-12761	123	7	the	the	DET
bam-12761	123	8	hiit	hiit	PROPN
bam-12761	123	9	group	group	NOUN
bam-12761	123	10	.	.	PUNCT
bam-12761	124	1	b	b	X
bam-12761	124	2	,	,	PUNCT
bam-12761	124	3	significant	significant	ADJ
bam-12761	124	4	difference	difference	NOUN
bam-12761	124	5	compared	compare	VERB
bam-12761	124	6	to	to	ADP
bam-12761	124	7	the	the	DET
bam-12761	124	8	hiit+sp	hiit+sp	NOUN
bam-12761	124	9	group	group	NOUN
bam-12761	124	10	;	;	PUNCT
bam-12761	124	11	c	c	X
bam-12761	124	12	,	,	PUNCT
bam-12761	124	13	significant	significant	ADJ
bam-12761	124	14	difference	difference	NOUN
bam-12761	124	15	compared	compare	VERB
bam-12761	124	16	to	to	ADP
bam-12761	124	17	the	the	DET
bam-12761	124	18	sp	sp	NOUN
bam-12761	124	19	group	group	NOUN
bam-12761	124	20	;	;	PUNCT
bam-12761	124	21	d	d	X
bam-12761	124	22	,	,	PUNCT
bam-12761	124	23	significant	significant	ADJ
bam-12761	124	24	difference	difference	NOUN
bam-12761	124	25	compared	compare	VERB
bam-12761	124	26	to	to	ADP
bam-12761	124	27	the	the	DET
bam-12761	124	28	sham	sham	ADJ
bam-12761	124	29	group	group	NOUN
bam-12761	124	30	.	.	PUNCT
bam-12761	125	1	non	non	ADJ
bam-12761	126	1	-co	-co	PROPN
bam-12761	126	2	mmerc	mmerc	PROPN
bam-12761	126	3	ial	ial	PROPN
bam-12761	126	4	us	us	PROPN
bam-12761	126	5	e	e	NOUN
bam-12761	126	6	o	o	X
bam-12761	126	7	nly	nly	ADV
bam-12761	126	8	high	high	ADJ
bam-12761	126	9	-	-	PUNCT
bam-12761	126	10	intensity	intensity	NOUN
bam-12761	126	11	interval	interval	NOUN
bam-12761	126	12	training	training	NOUN
bam-12761	126	13	,	,	PUNCT
bam-12761	126	14	but	but	CCONJ
bam-12761	126	15	not	not	PART
bam-12761	126	16	spirulina	spirulina	NOUN
bam-12761	126	17	supplementation	supplementation	NOUN
bam-12761	126	18	,	,	PUNCT
bam-12761	126	19	changes	change	VERB
bam-12761	126	20	muscle	muscle	NOUN
bam-12761	126	21	regeneration	regeneration	NOUN
bam-12761	126	22	signaling	signal	VERB
bam-12761	126	23	proteins	protein	NOUN
bam-12761	126	24	eur	eur	PROPN
bam-12761	126	25	j	j	PROPN
bam-12761	126	26	transl	transl	PROPN
bam-12761	126	27	myol	myol	NOUN
bam-12761	126	28	34	34	NUM
bam-12761	126	29	(	(	PUNCT
bam-12761	126	30	4	4	NUM
bam-12761	126	31	)	)	PUNCT
bam-12761	126	32	12761	12761	NUM
bam-12761	126	33	,	,	PUNCT
bam-12761	126	34	2024	2024	NUM
bam-12761	126	35	doi	doi	NOUN
bam-12761	126	36	:	:	PUNCT
bam-12761	126	37	10.4081	10.4081	NUM
bam-12761	126	38	/	/	SYM
bam-12761	126	39	ejtm.2024.12761	ejtm.2024.12761	NOUN
bam-12761	126	40	groups	group	NOUN
bam-12761	126	41	in	in	ADP
bam-12761	126	42	the	the	DET
bam-12761	126	43	present	present	ADJ
bam-12761	126	44	study	study	NOUN
bam-12761	126	45	are	be	AUX
bam-12761	126	46	in	in	ADP
bam-12761	126	47	agreement	agreement	NOUN
bam-12761	126	48	with	with	ADP
bam-12761	126	49	the	the	DET
bam-12761	126	50	results	result	NOUN
bam-12761	126	51	of	of	ADP
bam-12761	126	52	previous	previous	ADJ
bam-12761	126	53	study,35	study,35	NOUN
bam-12761	126	54	whereas	whereas	SCONJ
bam-12761	126	55	the	the	DET
bam-12761	126	56	increase	increase	NOUN
bam-12761	126	57	in	in	ADP
bam-12761	126	58	myod1	myod1	NOUN
bam-12761	126	59	expression	expression	NOUN
bam-12761	126	60	is	be	AUX
bam-12761	126	61	in	in	ADP
bam-12761	126	62	line	line	NOUN
bam-12761	126	63	with	with	ADP
bam-12761	126	64	studies	study	NOUN
bam-12761	126	65	using	use	VERB
bam-12761	126	66	different	different	ADJ
bam-12761	126	67	exercise	exercise	NOUN
bam-12761	126	68	modes	mode	NOUN
bam-12761	126	69	(	(	PUNCT
bam-12761	126	70	e.g.	e.g.	ADV
bam-12761	126	71	,	,	PUNCT
bam-12761	126	72	hiit	hiit	NOUN
bam-12761	126	73	,	,	PUNCT
bam-12761	126	74	resistance	resistance	NOUN
bam-12761	126	75	,	,	PUNCT
bam-12761	126	76	and	and	CCONJ
bam-12761	126	77	endurance	endurance	NOUN
bam-12761	127	1	training).33,36	training).33,36	NOUN
bam-12761	128	1	although	although	SCONJ
bam-12761	128	2	the	the	DET
bam-12761	128	3	present	present	ADJ
bam-12761	128	4	study	study	NOUN
bam-12761	128	5	did	do	AUX
bam-12761	128	6	not	not	PART
bam-12761	128	7	directly	directly	ADV
bam-12761	128	8	test	test	VERB
bam-12761	128	9	for	for	ADP
bam-12761	128	10	some	some	DET
bam-12761	128	11	mechanisms	mechanism	NOUN
bam-12761	128	12	associated	associate	VERB
bam-12761	128	13	with	with	ADP
bam-12761	128	14	changes	change	NOUN
bam-12761	128	15	in	in	ADP
bam-12761	128	16	myogenic	myogenic	ADJ
bam-12761	128	17	factors	factor	NOUN
bam-12761	128	18	,	,	PUNCT
bam-12761	128	19	there	there	PRON
bam-12761	128	20	are	be	VERB
bam-12761	128	21	some	some	DET
bam-12761	128	22	potential	potential	ADJ
bam-12761	128	23	changes	change	NOUN
bam-12761	128	24	that	that	PRON
bam-12761	128	25	could	could	AUX
bam-12761	128	26	be	be	AUX
bam-12761	128	27	presented	present	VERB
bam-12761	128	28	,	,	PUNCT
bam-12761	128	29	such	such	ADJ
bam-12761	128	30	as	as	ADP
bam-12761	128	31	muscle	muscle	NOUN
bam-12761	128	32	damage	damage	NOUN
bam-12761	128	33	,	,	PUNCT
bam-12761	128	34	stimulation	stimulation	NOUN
bam-12761	128	35	of	of	ADP
bam-12761	128	36	growth	growth	NOUN
bam-12761	128	37	factors	factor	NOUN
bam-12761	128	38	,	,	PUNCT
bam-12761	128	39	and	and	CCONJ
bam-12761	128	40	inhibition	inhibition	NOUN
bam-12761	128	41	of	of	ADP
bam-12761	128	42	myostatin	myostatin	NOUN
bam-12761	128	43	following	follow	VERB
bam-12761	128	44	hiit	hiit	PROPN
bam-12761	128	45	,	,	PUNCT
bam-12761	128	46	which	which	PRON
bam-12761	128	47	help	help	AUX
bam-12761	128	48	activate	activate	VERB
bam-12761	128	49	satellite	satellite	NOUN
bam-12761	128	50	cells.37,38	cells.37,38	NOUN
bam-12761	128	51	moreover	moreover	ADV
bam-12761	128	52	,	,	PUNCT
bam-12761	128	53	exercise	exercise	NOUN
bam-12761	128	54	training	training	NOUN
bam-12761	128	55	has	have	AUX
bam-12761	128	56	been	be	AUX
bam-12761	128	57	shown	show	VERB
bam-12761	128	58	to	to	PART
bam-12761	128	59	increase	increase	VERB
bam-12761	128	60	the	the	DET
bam-12761	128	61	expression	expression	NOUN
bam-12761	128	62	of	of	ADP
bam-12761	128	63	mrfs	mrfs	PROPN
bam-12761	128	64	,	,	PUNCT
bam-12761	128	65	especially	especially	ADV
bam-12761	128	66	myogenin	myogenin	ADJ
bam-12761	128	67	,	,	PUNCT
bam-12761	128	68	via	via	ADP
bam-12761	128	69	the	the	DET
bam-12761	128	70	activation	activation	NOUN
bam-12761	128	71	of	of	ADP
bam-12761	128	72	the	the	DET
bam-12761	128	73	igf-1	igf-1	NOUN
bam-12761	128	74	/	/	SYM
bam-12761	128	75	pi3k	pi3k	NOUN
bam-12761	128	76	/	/	SYM
bam-12761	128	77	akt	akt	PROPN
bam-12761	128	78	pathway.38	pathway.38	PROPN
bam-12761	128	79	another	another	DET
bam-12761	128	80	possible	possible	ADJ
bam-12761	128	81	mechanism	mechanism	NOUN
bam-12761	128	82	for	for	ADP
bam-12761	128	83	changing	change	VERB
bam-12761	128	84	satellite	satellite	NOUN
bam-12761	128	85	cells	cell	NOUN
bam-12761	128	86	is	be	AUX
bam-12761	128	87	calcium	calcium	NOUN
bam-12761	128	88	stimulation	stimulation	NOUN
bam-12761	128	89	,	,	PUNCT
bam-12761	128	90	which	which	PRON
bam-12761	128	91	activates	activate	VERB
bam-12761	128	92	calcineurin	calcineurin	NOUN
bam-12761	128	93	and	and	CCONJ
bam-12761	128	94	mef2	mef2	NOUN
bam-12761	128	95	signals	signal	NOUN
bam-12761	128	96	,	,	PUNCT
bam-12761	128	97	ultimately	ultimately	ADV
bam-12761	128	98	leading	lead	VERB
bam-12761	128	99	to	to	ADP
bam-12761	128	100	the	the	DET
bam-12761	128	101	stimulation	stimulation	NOUN
bam-12761	128	102	of	of	ADP
bam-12761	128	103	myogenin	myogenin	ADJ
bam-12761	128	104	transcription.39	transcription.39	NOUN
bam-12761	128	105	diabetes	diabetes	NOUN
bam-12761	128	106	affects	affect	VERB
bam-12761	128	107	protein	protein	NOUN
bam-12761	128	108	homeostasis	homeostasis	NOUN
bam-12761	128	109	by	by	ADP
bam-12761	128	110	causing	cause	VERB
bam-12761	128	111	insulin	insulin	NOUN
bam-12761	128	112	resistance	resistance	NOUN
bam-12761	128	113	,	,	PUNCT
bam-12761	128	114	leading	lead	VERB
bam-12761	128	115	to	to	ADP
bam-12761	128	116	disruption	disruption	NOUN
bam-12761	128	117	of	of	ADP
bam-12761	128	118	protein	protein	NOUN
bam-12761	128	119	synthesis	synthesis	NOUN
bam-12761	128	120	through	through	ADP
bam-12761	128	121	the	the	DET
bam-12761	128	122	pi3k	pi3k	PROPN
bam-12761	128	123	/	/	SYM
bam-12761	128	124	akt	akt	PROPN
bam-12761	128	125	pathway.40	pathway.40	NOUN
bam-12761	128	126	as	as	ADP
bam-12761	128	127	a	a	DET
bam-12761	128	128	result	result	NOUN
bam-12761	128	129	,	,	PUNCT
bam-12761	128	130	there	there	PRON
bam-12761	128	131	is	be	VERB
bam-12761	128	132	an	an	DET
bam-12761	128	133	interference	interference	NOUN
bam-12761	128	134	in	in	ADP
bam-12761	128	135	insulin	insulin	NOUN
bam-12761	128	136	signaling	signaling	NOUN
bam-12761	128	137	and	and	CCONJ
bam-12761	128	138	reduction	reduction	NOUN
bam-12761	128	139	in	in	ADP
bam-12761	128	140	the	the	DET
bam-12761	128	141	transport	transport	NOUN
bam-12761	128	142	of	of	ADP
bam-12761	128	143	amino	amino	ADJ
bam-12761	128	144	acids	acid	NOUN
bam-12761	128	145	into	into	ADP
bam-12761	128	146	muscle	muscle	NOUN
bam-12761	128	147	cells	cell	NOUN
bam-12761	128	148	and	and	CCONJ
bam-12761	128	149	decreases	decrease	NOUN
bam-12761	128	150	in	in	ADP
bam-12761	128	151	protein	protein	NOUN
bam-12761	128	152	synthesis.41	synthesis.41	NOUN
bam-12761	128	153	the	the	DET
bam-12761	128	154	results	result	NOUN
bam-12761	128	155	of	of	ADP
bam-12761	128	156	some	some	DET
bam-12761	128	157	studies	study	NOUN
bam-12761	128	158	confirm	confirm	VERB
bam-12761	128	159	the	the	DET
bam-12761	128	160	current	current	ADJ
bam-12761	128	161	findings	finding	NOUN
bam-12761	128	162	that	that	PRON
bam-12761	128	163	hiit	hiit	PROPN
bam-12761	128	164	improves	improve	VERB
bam-12761	128	165	glycemic	glycemic	ADJ
bam-12761	128	166	status	status	NOUN
bam-12761	128	167	and	and	CCONJ
bam-12761	128	168	protein	protein	NOUN
bam-12761	128	169	synthesis	synthesis	NOUN
bam-12761	128	170	in	in	ADP
bam-12761	128	171	patients	patient	NOUN
bam-12761	128	172	with	with	ADP
bam-12761	128	173	diabetes	diabetes	NOUN
bam-12761	128	174	via	via	ADP
bam-12761	128	175	the	the	DET
bam-12761	128	176	activation	activation	NOUN
bam-12761	128	177	of	of	ADP
bam-12761	128	178	the	the	DET
bam-12761	128	179	akt	akt	PROPN
bam-12761	128	180	/	/	SYM
bam-12761	128	181	mtor/4ebp1	mtor/4ebp1	PROPN
bam-12761	128	182	pathway.42	pathway.42	VERB
bam-12761	128	183	from	from	ADP
bam-12761	128	184	a	a	DET
bam-12761	128	185	practical	practical	ADJ
bam-12761	128	186	standpoint	standpoint	NOUN
bam-12761	128	187	,	,	PUNCT
bam-12761	128	188	it	it	PRON
bam-12761	128	189	is	be	AUX
bam-12761	128	190	important	important	ADJ
bam-12761	128	191	to	to	PART
bam-12761	128	192	note	note	VERB
bam-12761	128	193	that	that	SCONJ
bam-12761	128	194	hiit	hiit	PROPN
bam-12761	128	195	may	may	AUX
bam-12761	128	196	be	be	AUX
bam-12761	128	197	adapted	adapt	VERB
bam-12761	128	198	for	for	ADP
bam-12761	128	199	different	different	ADJ
bam-12761	128	200	populations	population	NOUN
bam-12761	128	201	,	,	PUNCT
bam-12761	128	202	including	include	VERB
bam-12761	128	203	older	old	ADJ
bam-12761	128	204	people	people	NOUN
bam-12761	128	205	with	with	ADP
bam-12761	128	206	obesity	obesity	NOUN
bam-12761	128	207	and	and	CCONJ
bam-12761	128	208	diabetes	diabetes	NOUN
bam-12761	128	209	,	,	PUNCT
bam-12761	128	210	due	due	ADP
bam-12761	128	211	to	to	ADP
bam-12761	128	212	the	the	DET
bam-12761	128	213	diverse	diverse	ADJ
bam-12761	128	214	possibilities	possibility	NOUN
bam-12761	128	215	and	and	CCONJ
bam-12761	128	216	variables	variable	NOUN
bam-12761	128	217	involved	involve	VERB
bam-12761	128	218	in	in	ADP
bam-12761	128	219	interval	interval	NOUN
bam-12761	128	220	training.43	training.43	NUM
bam-12761	128	221	for	for	ADP
bam-12761	128	222	example	example	NOUN
bam-12761	128	223	,	,	PUNCT
bam-12761	128	224	in	in	SCONJ
bam-12761	128	225	light	light	NOUN
bam-12761	128	226	of	of	ADP
bam-12761	128	227	musculoskeletal	musculoskeletal	ADJ
bam-12761	128	228	limitations	limitation	NOUN
bam-12761	128	229	,	,	PUNCT
bam-12761	128	230	cycling	cycling	NOUN
bam-12761	128	231	and	and	CCONJ
bam-12761	128	232	even	even	ADV
bam-12761	128	233	water	water	NOUN
bam-12761	128	234	activities	activity	NOUN
bam-12761	128	235	can	can	AUX
bam-12761	128	236	be	be	AUX
bam-12761	128	237	used	use	VERB
bam-12761	128	238	.	.	PUNCT
bam-12761	129	1	intensity	intensity	NOUN
bam-12761	129	2	should	should	AUX
bam-12761	129	3	also	also	ADV
bam-12761	129	4	be	be	AUX
bam-12761	129	5	individualized	individualize	VERB
bam-12761	129	6	;	;	PUNCT
bam-12761	129	7	for	for	ADP
bam-12761	129	8	example	example	NOUN
bam-12761	129	9	,	,	PUNCT
bam-12761	129	10	for	for	ADP
bam-12761	129	11	frail	frail	ADJ
bam-12761	129	12	people	people	NOUN
bam-12761	129	13	,	,	PUNCT
bam-12761	129	14	high	high	ADJ
bam-12761	129	15	intensity	intensity	NOUN
bam-12761	129	16	can	can	AUX
bam-12761	129	17	be	be	AUX
bam-12761	129	18	achieved	achieve	VERB
bam-12761	129	19	with	with	ADP
bam-12761	129	20	slow	slow	ADJ
bam-12761	129	21	walking.44	walking.44	NOUN
bam-12761	129	22	when	when	SCONJ
bam-12761	129	23	observing	observe	VERB
bam-12761	129	24	this	this	PRON
bam-12761	129	25	,	,	PUNCT
bam-12761	129	26	previous	previous	ADJ
bam-12761	129	27	studies	study	NOUN
bam-12761	129	28	have	have	AUX
bam-12761	129	29	shown	show	VERB
bam-12761	129	30	that	that	SCONJ
bam-12761	129	31	hiit	hiit	PROPN
bam-12761	129	32	brought	bring	VERB
bam-12761	129	33	higher	high	ADJ
bam-12761	129	34	improvements	improvement	NOUN
bam-12761	129	35	,	,	PUNCT
bam-12761	129	36	when	when	SCONJ
bam-12761	129	37	compared	compare	VERB
bam-12761	129	38	to	to	ADP
bam-12761	129	39	milder	mild	ADJ
bam-12761	129	40	activities	activity	NOUN
bam-12761	129	41	,	,	PUNCT
bam-12761	129	42	in	in	ADP
bam-12761	129	43	health	health	NOUN
bam-12761	129	44	markers	marker	NOUN
bam-12761	129	45	,	,	PUNCT
bam-12761	129	46	glycemic	glycemic	ADJ
bam-12761	129	47	control	control	NOUN
bam-12761	129	48	and	and	CCONJ
bam-12761	129	49	weight	weight	NOUN
bam-12761	129	50	management	management	NOUN
bam-12761	129	51	in	in	ADP
bam-12761	129	52	different	different	ADJ
bam-12761	129	53	populations.44,45	populations.44,45	NOUN
bam-12761	129	54	specifically	specifically	ADV
bam-12761	129	55	in	in	ADP
bam-12761	129	56	older	old	ADJ
bam-12761	129	57	people	people	NOUN
bam-12761	129	58	,	,	PUNCT
bam-12761	129	59	a	a	DET
bam-12761	129	60	systematic	systematic	ADJ
bam-12761	129	61	review	review	NOUN
bam-12761	129	62	and	and	CCONJ
bam-12761	129	63	metaanalysis	metaanalysis	NOUN
bam-12761	129	64	concluded	conclude	VERB
bam-12761	129	65	that	that	SCONJ
bam-12761	129	66	hiit	hiit	PROPN
bam-12761	129	67	is	be	AUX
bam-12761	129	68	more	more	ADV
bam-12761	129	69	effective	effective	ADJ
bam-12761	129	70	than	than	ADP
bam-12761	129	71	moderate	moderate	ADJ
bam-12761	129	72	-	-	PUNCT
bam-12761	129	73	intensity	intensity	NOUN
bam-12761	129	74	exercise	exercise	NOUN
bam-12761	129	75	in	in	ADP
bam-12761	129	76	improving	improve	VERB
bam-12761	129	77	glucose	glucose	NOUN
bam-12761	129	78	metabolism.46	metabolism.46	NOUN
bam-12761	129	79	this	this	DET
bam-12761	129	80	study	study	NOUN
bam-12761	129	81	had	have	VERB
bam-12761	129	82	some	some	DET
bam-12761	129	83	important	important	ADJ
bam-12761	129	84	limitations	limitation	NOUN
bam-12761	129	85	that	that	PRON
bam-12761	129	86	should	should	AUX
bam-12761	129	87	be	be	AUX
bam-12761	129	88	addressed	address	VERB
bam-12761	129	89	.	.	PUNCT
bam-12761	130	1	the	the	DET
bam-12761	130	2	soleus	soleus	PROPN
bam-12761	130	3	muscle	muscle	NOUN
bam-12761	130	4	is	be	AUX
bam-12761	130	5	predominantly	predominantly	ADV
bam-12761	130	6	(	(	PUNCT
bam-12761	130	7	~75	~75	ADJ
bam-12761	130	8	%	%	NOUN
bam-12761	130	9	)	)	PUNCT
bam-12761	130	10	composed	compose	VERB
bam-12761	130	11	of	of	ADP
bam-12761	130	12	type	type	NOUN
bam-12761	130	13	i	i	PRON
bam-12761	130	14	fibers,47	fibers,47	NUM
bam-12761	130	15	and	and	CCONJ
bam-12761	130	16	the	the	DET
bam-12761	130	17	responses	response	NOUN
bam-12761	130	18	could	could	AUX
bam-12761	130	19	be	be	AUX
bam-12761	130	20	associated	associate	VERB
bam-12761	130	21	with	with	ADP
bam-12761	130	22	be	be	AUX
bam-12761	130	23	different	different	ADJ
bam-12761	130	24	in	in	ADP
bam-12761	130	25	muscles	muscle	NOUN
bam-12761	130	26	with	with	ADP
bam-12761	130	27	different	different	ADJ
bam-12761	130	28	compositions	composition	NOUN
bam-12761	130	29	.	.	PUNCT
bam-12761	131	1	however	however	ADV
bam-12761	131	2	,	,	PUNCT
bam-12761	131	3	we	we	PRON
bam-12761	131	4	opted	opt	VERB
bam-12761	131	5	for	for	ADP
bam-12761	131	6	a	a	DET
bam-12761	131	7	muscle	muscle	NOUN
bam-12761	131	8	predominantly	predominantly	ADV
bam-12761	131	9	composed	compose	VERB
bam-12761	131	10	of	of	ADP
bam-12761	131	11	type	type	NOUN
bam-12761	131	12	i	i	PRON
bam-12761	131	13	fibers	fiber	VERB
bam-12761	131	14	to	to	PART
bam-12761	131	15	better	well	ADV
bam-12761	131	16	reflect	reflect	VERB
bam-12761	131	17	aging	aging	NOUN
bam-12761	131	18	,	,	PUNCT
bam-12761	131	19	as	as	SCONJ
bam-12761	131	20	aging	age	VERB
bam-12761	131	21	in	in	ADP
bam-12761	131	22	humans	human	NOUN
bam-12761	131	23	is	be	AUX
bam-12761	131	24	associated	associate	VERB
bam-12761	131	25	with	with	ADP
bam-12761	131	26	an	an	DET
bam-12761	131	27	increase	increase	NOUN
bam-12761	131	28	in	in	ADP
bam-12761	131	29	type	type	NOUN
bam-12761	131	30	1	1	NUM
bam-12761	131	31	and	and	CCONJ
bam-12761	131	32	a	a	DET
bam-12761	131	33	decrease	decrease	NOUN
bam-12761	131	34	in	in	ADP
bam-12761	131	35	the	the	DET
bam-12761	131	36	proportion	proportion	NOUN
bam-12761	131	37	of	of	ADP
bam-12761	131	38	type	type	NOUN
bam-12761	131	39	2	2	NUM
bam-12761	131	40	fibers.48	fibers.48	NOUN
bam-12761	131	41	another	another	DET
bam-12761	131	42	important	important	ADJ
bam-12761	131	43	limitation	limitation	NOUN
bam-12761	131	44	is	be	AUX
bam-12761	131	45	the	the	DET
bam-12761	131	46	lack	lack	NOUN
bam-12761	131	47	of	of	ADP
bam-12761	131	48	a	a	DET
bam-12761	131	49	more	more	ADV
bam-12761	131	50	robust	robust	ADJ
bam-12761	131	51	analysis	analysis	NOUN
bam-12761	131	52	of	of	ADP
bam-12761	131	53	molecular	molecular	ADJ
bam-12761	131	54	mechanisms	mechanism	NOUN
bam-12761	131	55	,	,	PUNCT
bam-12761	131	56	pcr	pcr	NOUN
bam-12761	131	57	,	,	PUNCT
bam-12761	131	58	and	and	CCONJ
bam-12761	131	59	histological	histological	ADJ
bam-12761	131	60	data	datum	NOUN
bam-12761	131	61	,	,	PUNCT
bam-12761	131	62	which	which	PRON
bam-12761	131	63	are	be	AUX
bam-12761	131	64	not	not	PART
bam-12761	131	65	possible	possible	ADJ
bam-12761	131	66	due	due	ADJ
bam-12761	131	67	to	to	ADP
bam-12761	131	68	logistical	logistical	ADJ
bam-12761	131	69	and	and	CCONJ
bam-12761	131	70	financial	financial	ADJ
bam-12761	131	71	constraints	constraint	NOUN
bam-12761	131	72	.	.	PUNCT
bam-12761	132	1	based	base	VERB
bam-12761	132	2	on	on	ADP
bam-12761	132	3	the	the	DET
bam-12761	132	4	present	present	ADJ
bam-12761	132	5	results	result	NOUN
bam-12761	132	6	,	,	PUNCT
bam-12761	132	7	we	we	PRON
bam-12761	132	8	conclude	conclude	VERB
bam-12761	132	9	that	that	SCONJ
bam-12761	132	10	the	the	DET
bam-12761	132	11	combination	combination	NOUN
bam-12761	132	12	of	of	ADP
bam-12761	132	13	hiit	hiit	PROPN
bam-12761	132	14	and	and	CCONJ
bam-12761	132	15	sp	sp	ADP
bam-12761	132	16	supplementation	supplementation	NOUN
bam-12761	132	17	and/or	and/or	CCONJ
bam-12761	132	18	hiit	hiit	PROPN
bam-12761	132	19	alone	alone	ADV
bam-12761	132	20	could	could	AUX
bam-12761	132	21	be	be	AUX
bam-12761	132	22	used	use	VERB
bam-12761	132	23	to	to	PART
bam-12761	132	24	manage	manage	VERB
bam-12761	132	25	obesity	obesity	NOUN
bam-12761	132	26	and	and	CCONJ
bam-12761	132	27	diabetes	diabetes	NOUN
bam-12761	132	28	in	in	ADP
bam-12761	132	29	older	old	ADJ
bam-12761	132	30	people	people	NOUN
bam-12761	132	31	.	.	PUNCT
bam-12761	133	1	nevertheless	nevertheless	ADV
bam-12761	133	2	,	,	PUNCT
bam-12761	133	3	future	future	ADJ
bam-12761	133	4	studies	study	NOUN
bam-12761	133	5	can	can	AUX
bam-12761	133	6	be	be	AUX
bam-12761	133	7	of	of	ADP
bam-12761	133	8	great	great	ADJ
bam-12761	133	9	help	help	NOUN
bam-12761	133	10	in	in	ADP
bam-12761	133	11	expanding	expand	VERB
bam-12761	133	12	our	our	PRON
bam-12761	133	13	understanding	understanding	NOUN
bam-12761	133	14	of	of	ADP
bam-12761	133	15	this	this	DET
bam-12761	133	16	issue	issue	NOUN
bam-12761	133	17	,	,	PUNCT
bam-12761	133	18	with	with	ADP
bam-12761	133	19	more	more	ADV
bam-12761	133	20	robust	robust	ADJ
bam-12761	133	21	molecular	molecular	ADJ
bam-12761	133	22	analysis	analysis	NOUN
bam-12761	133	23	involving	involve	VERB
bam-12761	133	24	other	other	ADJ
bam-12761	133	25	muscles	muscle	NOUN
bam-12761	133	26	,	,	PUNCT
bam-12761	133	27	with	with	ADP
bam-12761	133	28	different	different	ADJ
bam-12761	133	29	fiber	fiber	NOUN
bam-12761	133	30	type	type	NOUN
bam-12761	133	31	distribution	distribution	NOUN
bam-12761	133	32	.	.	PUNCT
bam-12761	134	1	list	list	NOUN
bam-12761	134	2	of	of	ADP
bam-12761	134	3	acronyms	acronyms	PROPN
bam-12761	134	4	hiit	hiit	PROPN
bam-12761	134	5	,	,	PUNCT
bam-12761	134	6	high	high	ADJ
bam-12761	134	7	-	-	PUNCT
bam-12761	134	8	intensity	intensity	NOUN
bam-12761	134	9	interval	interval	NOUN
bam-12761	134	10	training	training	NOUN
bam-12761	134	11	con	con	NOUN
bam-12761	134	12	,	,	PUNCT
bam-12761	134	13	control	control	NOUN
bam-12761	134	14	sp	sp	PROPN
bam-12761	134	15	,	,	PUNCT
bam-12761	134	16	spirulina	spirulina	PROPN
bam-12761	134	17	mrfs	mrfs	PROPN
bam-12761	134	18	,	,	PUNCT
bam-12761	134	19	myogenic	myogenic	ADJ
bam-12761	134	20	regulatory	regulatory	ADJ
bam-12761	134	21	factors	factor	NOUN
bam-12761	134	22	ros	ros	PROPN
bam-12761	134	23	,	,	PUNCT
bam-12761	134	24	reactive	reactive	ADJ
bam-12761	134	25	oxygen	oxygen	NOUN
bam-12761	134	26	species	specie	NOUN
bam-12761	134	27	akt	akt	PROPN
bam-12761	134	28	,	,	PUNCT
bam-12761	134	29	protein	protein	NOUN
bam-12761	134	30	kinase	kinase	NOUN
bam-12761	134	31	b	b	PROPN
bam-12761	134	32	pi3k	pi3k	PROPN
bam-12761	134	33	,	,	PUNCT
bam-12761	134	34	phosphatidylinositol	phosphatidylinositol	NOUN
bam-12761	134	35	3	3	NUM
bam-12761	134	36	-	-	PUNCT
bam-12761	134	37	kinase	kinase	PROPN
bam-12761	134	38	mtor	mtor	NOUN
bam-12761	134	39	,	,	PUNCT
bam-12761	134	40	mammalian	mammalian	ADJ
bam-12761	134	41	target	target	NOUN
bam-12761	134	42	of	of	ADP
bam-12761	134	43	rapamycin	rapamycin	NOUN
bam-12761	134	44	4ebp1	4ebp1	NUM
bam-12761	134	45	,	,	PUNCT
bam-12761	134	46	eukaryotic	eukaryotic	ADJ
bam-12761	134	47	translation	translation	NOUN
bam-12761	134	48	initiation	initiation	NOUN
bam-12761	134	49	factor	factor	NOUN
bam-12761	134	50	4e	4e	NOUN
bam-12761	134	51	-	-	PUNCT
bam-12761	134	52	binding	bind	VERB
bam-12761	134	53	protein	protein	NOUN
bam-12761	134	54	1	1	NUM
bam-12761	134	55	myod1	myod1	NOUN
bam-12761	134	56	,	,	PUNCT
bam-12761	134	57	myoblast	myoblast	ADJ
bam-12761	134	58	determination	determination	NOUN
bam-12761	134	59	protein	protein	NOUN
bam-12761	134	60	1	1	NUM
bam-12761	134	61	mef2	mef2	PROPN
bam-12761	134	62	,	,	PUNCT
bam-12761	134	63	myocyte	myocyte	NOUN
bam-12761	134	64	enhancer	enhancer	NOUN
bam-12761	134	65	factor	factor	NOUN
bam-12761	134	66	2	2	NUM
bam-12761	134	67	homa	homa	NOUN
bam-12761	134	68	-	-	PUNCT
bam-12761	134	69	ir	ir	NOUN
bam-12761	134	70	,	,	PUNCT
bam-12761	134	71	homeostatic	homeostatic	ADJ
bam-12761	134	72	model	model	NOUN
bam-12761	134	73	assessment	assessment	NOUN
bam-12761	134	74	for	for	ADP
bam-12761	134	75	insulin	insulin	NOUN
bam-12761	134	76	resistance	resistance	NOUN
bam-12761	134	77	gapdh	gapdh	NOUN
bam-12761	134	78	,	,	PUNCT
bam-12761	134	79	glyceraldehyde-3	glyceraldehyde-3	VERB
bam-12761	134	80	-	-	ADJ
bam-12761	134	81	phosphate	phosphate	ADJ
bam-12761	134	82	dehydrogenase	dehydrogenase	NOUN
bam-12761	134	83	vo2max	vo2max	NOUN
bam-12761	134	84	,	,	PUNCT
bam-12761	134	85	maximal	maximal	ADJ
bam-12761	134	86	oxygen	oxygen	NOUN
bam-12761	134	87	consumption	consumption	NOUN
bam-12761	134	88	contributions	contribution	NOUN
bam-12761	134	89	of	of	ADP
bam-12761	134	90	authors	author	NOUN
bam-12761	134	91	conceptualization	conceptualization	NOUN
bam-12761	134	92	and	and	CCONJ
bam-12761	134	93	supervision	supervision	NOUN
bam-12761	134	94	,	,	PUNCT
bam-12761	134	95	ra	ra	PROPN
bam-12761	134	96	;	;	PUNCT
bam-12761	134	97	writing	write	VERB
bam-12761	134	98	(	(	PUNCT
bam-12761	134	99	original	original	ADJ
bam-12761	134	100	draft	draft	NOUN
bam-12761	134	101	,	,	PUNCT
bam-12761	134	102	and	and	CCONJ
bam-12761	134	103	formal	formal	ADJ
bam-12761	134	104	analyses	analysis	NOUN
bam-12761	134	105	)	)	PUNCT
bam-12761	134	106	,	,	PUNCT
bam-12761	134	107	msa	msa	PROPN
bam-12761	134	108	and	and	CCONJ
bam-12761	134	109	hs	hs	PROPN
bam-12761	134	110	;	;	PUNCT
bam-12761	134	111	data	datum	NOUN
bam-12761	134	112	curation	curation	NOUN
bam-12761	134	113	and	and	CCONJ
bam-12761	134	114	investigation	investigation	NOUN
bam-12761	134	115	,	,	PUNCT
bam-12761	134	116	msa	msa	PROPN
bam-12761	134	117	;	;	PUNCT
bam-12761	134	118	methodology	methodology	NOUN
bam-12761	134	119	,	,	PUNCT
bam-12761	134	120	project	project	NOUN
bam-12761	134	121	and	and	CCONJ
bam-12761	134	122	administration	administration	NOUN
bam-12761	134	123	,	,	PUNCT
bam-12761	134	124	ahh	ahh	PROPN
bam-12761	134	125	;	;	PUNCT
bam-12761	134	126	resources	resource	NOUN
bam-12761	134	127	,	,	PUNCT
bam-12761	134	128	msa	msa	PROPN
bam-12761	134	129	and	and	CCONJ
bam-12761	134	130	hs	hs	PROPN
bam-12761	134	131	;	;	PUNCT
bam-12761	134	132	review	review	NOUN
bam-12761	134	133	&	&	CCONJ
bam-12761	134	134	editing	editing	NOUN
bam-12761	134	135	and	and	CCONJ
bam-12761	134	136	validation	validation	NOUN
bam-12761	134	137	,	,	PUNCT
bam-12761	134	138	pg	pg	INTJ
bam-12761	134	139	;	;	PUNCT
bam-12761	134	140	visualization	visualization	NOUN
bam-12761	134	141	,	,	PUNCT
bam-12761	134	142	pg	pg	PROPN
bam-12761	134	143	and	and	CCONJ
bam-12761	134	144	ahh	ahh	INTJ
bam-12761	134	145	.	.	PUNCT
bam-12761	135	1	all	all	DET
bam-12761	135	2	the	the	DET
bam-12761	135	3	authors	author	NOUN
bam-12761	135	4	have	have	AUX
bam-12761	135	5	read	read	VERB
bam-12761	135	6	and	and	CCONJ
bam-12761	135	7	agreed	agree	VERB
bam-12761	135	8	to	to	ADP
bam-12761	135	9	the	the	DET
bam-12761	135	10	published	publish	VERB
bam-12761	135	11	version	version	NOUN
bam-12761	135	12	of	of	ADP
bam-12761	135	13	the	the	DET
bam-12761	135	14	manuscript	manuscript	NOUN
bam-12761	135	15	.	.	PUNCT
bam-12761	136	1	funding	fund	VERB
bam-12761	136	2	this	this	DET
bam-12761	136	3	study	study	NOUN
bam-12761	136	4	received	receive	VERB
bam-12761	136	5	no	no	DET
bam-12761	136	6	external	external	ADJ
bam-12761	136	7	funding	funding	NOUN
bam-12761	136	8	.	.	PUNCT
bam-12761	137	1	conflict	conflict	NOUN
bam-12761	137	2	of	of	ADP
bam-12761	137	3	interest	interest	NOUN
bam-12761	137	4	the	the	DET
bam-12761	137	5	authors	author	NOUN
bam-12761	137	6	declare	declare	VERB
bam-12761	137	7	no	no	DET
bam-12761	137	8	financial	financial	ADJ
bam-12761	137	9	,	,	PUNCT
bam-12761	137	10	personal	personal	ADJ
bam-12761	137	11	,	,	PUNCT
bam-12761	137	12	or	or	CCONJ
bam-12761	137	13	other	other	ADJ
bam-12761	137	14	conflicts	conflict	NOUN
bam-12761	137	15	of	of	ADP
bam-12761	137	16	interest	interest	NOUN
bam-12761	137	17	.	.	PUNCT
bam-12761	138	1	ethics	ethic	NOUN
bam-12761	138	2	approval	approval	NOUN
bam-12761	138	3	this	this	DET
bam-12761	138	4	study	study	NOUN
bam-12761	138	5	was	be	AUX
bam-12761	138	6	approved	approve	VERB
bam-12761	138	7	by	by	ADP
bam-12761	138	8	the	the	DET
bam-12761	138	9	research	research	NOUN
bam-12761	138	10	ethics	ethic	NOUN
bam-12761	138	11	committee	committee	PROPN
bam-12761	138	12	of	of	ADP
bam-12761	138	13	hakim	hakim	PROPN
bam-12761	138	14	sabzevari	sabzevari	PROPN
bam-12761	138	15	university	university	PROPN
bam-12761	138	16	(	(	PUNCT
bam-12761	138	17	code	code	PROPN
bam-12761	139	1	ir	ir	AUX
bam-12761	139	2	.	.	PUNCT
bam-12761	139	3	hsu	hsu	PROPN
bam-12761	139	4	.	.	PROPN
bam-12761	139	5	rec.1400.007	rec.1400.007	PROPN
bam-12761	139	6	)	)	PUNCT
bam-12761	139	7	.	.	PUNCT
bam-12761	140	1	the	the	DET
bam-12761	140	2	study	study	NOUN
bam-12761	140	3	is	be	AUX
bam-12761	140	4	conformed	conform	VERB
bam-12761	140	5	with	with	ADP
bam-12761	140	6	the	the	DET
bam-12761	140	7	helsinki	helsinki	PROPN
bam-12761	140	8	declaration	declaration	NOUN
bam-12761	140	9	of	of	ADP
bam-12761	140	10	1964	1964	NUM
bam-12761	140	11	,	,	PUNCT
bam-12761	140	12	as	as	SCONJ
bam-12761	140	13	revised	revise	VERB
bam-12761	140	14	in	in	ADP
bam-12761	140	15	2013	2013	NUM
bam-12761	140	16	,	,	PUNCT
bam-12761	140	17	concerning	concern	VERB
bam-12761	140	18	human	human	ADJ
bam-12761	140	19	and	and	CCONJ
bam-12761	140	20	animal	animal	NOUN
bam-12761	140	21	rights	right	NOUN
bam-12761	140	22	.	.	PUNCT
bam-12761	141	1	availability	availability	NOUN
bam-12761	141	2	of	of	ADP
bam-12761	141	3	data	datum	NOUN
bam-12761	141	4	and	and	CCONJ
bam-12761	141	5	materials	material	NOUN
bam-12761	141	6	all	all	DET
bam-12761	141	7	data	datum	NOUN
bam-12761	141	8	generated	generate	VERB
bam-12761	141	9	or	or	CCONJ
bam-12761	141	10	analyzed	analyze	VERB
bam-12761	141	11	during	during	ADP
bam-12761	141	12	this	this	DET
bam-12761	141	13	study	study	NOUN
bam-12761	141	14	are	be	AUX
bam-12761	141	15	included	include	VERB
bam-12761	141	16	in	in	ADP
bam-12761	141	17	this	this	DET
bam-12761	141	18	published	publish	VERB
bam-12761	141	19	article	article	NOUN
bam-12761	141	20	.	.	PUNCT
bam-12761	142	1	corresponding	correspond	VERB
bam-12761	142	2	author	author	NOUN
bam-12761	142	3	paulo	paulo	PROPN
bam-12761	142	4	gentil	gentil	PROPN
bam-12761	142	5	,	,	PUNCT
bam-12761	142	6	phd	phd	PROPN
bam-12761	142	7	.	.	PUNCT
bam-12761	142	8	college	college	PROPN
bam-12761	142	9	of	of	ADP
bam-12761	142	10	physical	physical	ADJ
bam-12761	142	11	education	education	NOUN
bam-12761	142	12	and	and	CCONJ
bam-12761	142	13	dance	dance	NOUN
bam-12761	142	14	,	,	PUNCT
bam-12761	142	15	federal	federal	ADJ
bam-12761	142	16	university	university	PROPN
bam-12761	142	17	of	of	ADP
bam-12761	142	18	goias	goias	PROPN
bam-12761	142	19	,	,	PUNCT
bam-12761	142	20	goiânia	goiânia	PROPN
bam-12761	142	21	,	,	PUNCT
bam-12761	142	22	74690	74690	NUM
bam-12761	142	23	-	-	SYM
bam-12761	142	24	900	900	NUM
bam-12761	142	25	,	,	PUNCT
bam-12761	142	26	brazil	brazil	PROPN
bam-12761	142	27	.	.	PUNCT
bam-12761	143	1	tel./fax	tel./fax	NOUN
bam-12761	143	2	:	:	PUNCT
bam-12761	144	1	+55	+55	PROPN
bam-12761	144	2	62	62	NUM
bam-12761	144	3	3521	3521	NUM
bam-12761	144	4	-	-	PUNCT
bam-12761	144	5	1141	1141	NUM
bam-12761	144	6	.	.	PUNCT
bam-12761	145	1	orcid	orcid	NOUN
bam-12761	146	1	i	i	PRON
bam-12761	146	2	d	d	NOUN
bam-12761	146	3	:	:	PUNCT
bam-12761	146	4	0000	0000	NUM
bam-12761	146	5	-	-	PUNCT
bam-12761	146	6	0003	0003	NUM
bam-12761	146	7	-	-	PUNCT
bam-12761	146	8	2459	2459	NUM
bam-12761	146	9	-	-	SYM
bam-12761	146	10	497	497	NUM
bam-12761	146	11	e	e	NOUN
bam-12761	146	12	-	-	NOUN
bam-12761	146	13	mail	mail	NOUN
bam-12761	146	14	:	:	PUNCT
bam-12761	147	1	paulogentil@hotmail.com	paulogentil@hotmail.com	X
bam-12761	147	2	30	30	NUM
bam-12761	147	3	non	non	ADJ
bam-12761	147	4	-co	-co	PROPN
bam-12761	147	5	mmerc	mmerc	PROPN
bam-12761	147	6	ial	ial	PROPN
bam-12761	147	7	us	us	PROPN
bam-12761	147	8	e	e	NOUN
bam-12761	147	9	o	o	PROPN
bam-12761	147	10	nly	nly	ADV
bam-12761	147	11	mailto:paulogentil@hotmail.com	mailto:paulogentil@hotmail.com	X
bam-12761	147	12	high	high	ADJ
bam-12761	147	13	-	-	PUNCT
bam-12761	147	14	intensity	intensity	NOUN
bam-12761	147	15	interval	interval	NOUN
bam-12761	147	16	training	training	NOUN
bam-12761	147	17	,	,	PUNCT
bam-12761	147	18	but	but	CCONJ
bam-12761	147	19	not	not	PART
bam-12761	147	20	spirulina	spirulina	NOUN
bam-12761	147	21	supplementation	supplementation	NOUN
bam-12761	147	22	,	,	PUNCT
bam-12761	147	23	changes	change	VERB
bam-12761	147	24	muscle	muscle	NOUN
bam-12761	147	25	regeneration	regeneration	NOUN
bam-12761	147	26	signaling	signal	VERB
bam-12761	147	27	proteins	protein	NOUN
bam-12761	147	28	eur	eur	PROPN
bam-12761	147	29	j	j	PROPN
bam-12761	147	30	transl	transl	PROPN
bam-12761	147	31	myol	myol	NOUN
bam-12761	147	32	34	34	NUM
bam-12761	147	33	(	(	PUNCT
bam-12761	147	34	4	4	NUM
bam-12761	147	35	)	)	PUNCT
bam-12761	147	36	12761	12761	NUM
bam-12761	147	37	,	,	PUNCT
bam-12761	147	38	2024	2024	NUM
bam-12761	147	39	doi	doi	NOUN
bam-12761	147	40	:	:	PUNCT
bam-12761	147	41	10.4081	10.4081	NUM
bam-12761	147	42	/	/	SYM
bam-12761	147	43	ejtm.2024.12761	ejtm.2024.12761	ADJ
bam-12761	147	44	roya	roya	NOUN
bam-12761	147	45	askari	askari	NOUN
bam-12761	147	46	:	:	PUNCT
bam-12761	147	47	orcid	orcid	PROPN
bam-12761	147	48	i	i	NOUN
bam-12761	147	49	d	d	NOUN
bam-12761	147	50	:	:	PUNCT
bam-12761	147	51	0000	0000	NUM
bam-12761	147	52	-	-	PUNCT
bam-12761	147	53	0003	0003	NUM
bam-12761	147	54	-	-	PUNCT
bam-12761	147	55	4331	4331	NUM
bam-12761	147	56	-	-	PUNCT
bam-12761	147	57	2293	2293	NUM
bam-12761	147	58	e	e	NOUN
bam-12761	147	59	-	-	NOUN
bam-12761	147	60	mail	mail	NOUN
bam-12761	147	61	:	:	PUNCT
bam-12761	147	62	r.askari@hsu.ac.ir	r.askari@hsu.ac.ir	ADJ
bam-12761	147	63	marzie	marzie	NOUN
bam-12761	147	64	sadat	sadat	PROPN
bam-12761	147	65	azarnive	azarnive	ADJ
bam-12761	147	66	orcid	orcid	NOUN
bam-12761	148	1	i	i	PRON
bam-12761	148	2	d	d	NOUN
bam-12761	148	3	:	:	PUNCT
bam-12761	148	4	0000	0000	NUM
bam-12761	148	5	-	-	PUNCT
bam-12761	148	6	0003	0003	NUM
bam-12761	148	7	-	-	PUNCT
bam-12761	148	8	2655	2655	NUM
bam-12761	148	9	-	-	SYM
bam-12761	148	10	5947	5947	NUM
bam-12761	148	11	e	e	NOUN
bam-12761	148	12	-	-	NOUN
bam-12761	148	13	mail	mail	NOUN
bam-12761	148	14	:	:	PUNCT
bam-12761	149	1	m.azarnive@uoz.ac.ir	m.azarnive@uoz.ac.ir	PROPN
bam-12761	149	2	amir	amir	PROPN
bam-12761	149	3	hossein	hossein	PROPN
bam-12761	149	4	haghighi	haghighi	PROPN
bam-12761	149	5	orcid	orcid	PROPN
bam-12761	149	6	i	i	PRON
bam-12761	149	7	d	d	NOUN
bam-12761	149	8	:	:	PUNCT
bam-12761	149	9	0000	0000	NUM
bam-12761	149	10	-	-	PUNCT
bam-12761	149	11	0002	0002	NUM
bam-12761	149	12	-	-	PUNCT
bam-12761	149	13	7258	7258	NUM
bam-12761	149	14	-	-	SYM
bam-12761	149	15	9737	9737	NUM
bam-12761	149	16	e	e	NOUN
bam-12761	149	17	-	-	NOUN
bam-12761	149	18	mail	mail	NOUN
bam-12761	149	19	:	:	PUNCT
bam-12761	149	20	ah.haghighi@hsu.ac.ir	ah.haghighi@hsu.ac.ir	PROPN
bam-12761	149	21	hadi	hadi	PROPN
bam-12761	149	22	shahrabadi	shahrabadi	PROPN
bam-12761	149	23	orcid	orcid	PROPN
bam-12761	150	1	i	i	PRON
bam-12761	150	2	d	d	PROPN
bam-12761	150	3	:	:	PUNCT
bam-12761	150	4	https://orcid.org/0000-0001-8404-6927	https://orcid.org/0000-0001-8404-6927	PROPN
bam-12761	150	5	e	e	NOUN
bam-12761	150	6	-	-	NOUN
bam-12761	150	7	mail	mail	NOUN
bam-12761	150	8	:	:	PUNCT
bam-12761	150	9	h.shahrabadi@gmail.com	h.shahrabadi@gmail.com	NOUN
bam-12761	150	10	references	reference	NOUN
bam-12761	150	11	1	1	NUM
bam-12761	150	12	.	.	PUNCT
bam-12761	151	1	izquierdo	izquierdo	PROPN
bam-12761	151	2	m	m	PROPN
bam-12761	151	3	,	,	PUNCT
bam-12761	151	4	merchant	merchant	PROPN
bam-12761	151	5	ra	ra	PROPN
bam-12761	151	6	,	,	PUNCT
bam-12761	151	7	morley	morley	PROPN
bam-12761	151	8	je	je	PROPN
bam-12761	151	9	,	,	PUNCT
bam-12761	151	10	et	et	PROPN
bam-12761	151	11	al	al	PROPN
bam-12761	151	12	.	.	PUNCT
bam-12761	152	1	international	international	ADJ
bam-12761	152	2	exercise	exercise	NOUN
bam-12761	152	3	recommendations	recommendation	NOUN
bam-12761	152	4	in	in	ADP
bam-12761	152	5	older	old	ADJ
bam-12761	152	6	adults	adult	NOUN
bam-12761	152	7	(	(	PUNCT
bam-12761	152	8	icfsr	icfsr	NOUN
bam-12761	152	9	):	):	PUNCT
bam-12761	152	10	expert	expert	ADJ
bam-12761	152	11	consensus	consensus	NOUN
bam-12761	152	12	guidelines	guideline	NOUN
bam-12761	152	13	.	.	PUNCT
bam-12761	153	1	j	j	PROPN
bam-12761	153	2	nutr	nutr	PROPN
bam-12761	153	3	health	health	NOUN
bam-12761	153	4	aging	age	VERB
bam-12761	153	5	2021;25:824	2021;25:824	NOUN
bam-12761	153	6	-	-	SYM
bam-12761	153	7	853	853	NUM
bam-12761	153	8	.	.	PUNCT
bam-12761	154	1	2	2	X
bam-12761	154	2	.	.	X
bam-12761	154	3	kalyani	kalyani	PROPN
bam-12761	154	4	rr	rr	PROPN
bam-12761	154	5	,	,	PUNCT
bam-12761	154	6	corriere	corriere	PROPN
bam-12761	154	7	m	m	PROPN
bam-12761	154	8	,	,	PUNCT
bam-12761	154	9	ferrucci	ferrucci	PROPN
bam-12761	154	10	l.	l.	PROPN
bam-12761	154	11	age	age	PROPN
bam-12761	154	12	-	-	PUNCT
bam-12761	154	13	related	relate	VERB
bam-12761	154	14	and	and	CCONJ
bam-12761	154	15	disease	disease	NOUN
bam-12761	154	16	-	-	PUNCT
bam-12761	154	17	related	relate	VERB
bam-12761	154	18	muscle	muscle	NOUN
bam-12761	154	19	loss	loss	NOUN
bam-12761	154	20	:	:	PUNCT
bam-12761	154	21	the	the	DET
bam-12761	154	22	effect	effect	NOUN
bam-12761	154	23	of	of	ADP
bam-12761	154	24	diabetes	diabetes	NOUN
bam-12761	154	25	,	,	PUNCT
bam-12761	154	26	obesity	obesity	NOUN
bam-12761	154	27	,	,	PUNCT
bam-12761	154	28	and	and	CCONJ
bam-12761	154	29	other	other	ADJ
bam-12761	154	30	diseases	disease	NOUN
bam-12761	154	31	.	.	PUNCT
bam-12761	155	1	lancet	lancet	NOUN
bam-12761	155	2	diabetes	diabetes	NOUN
bam-12761	155	3	endocrinol	endocrinol	VERB
bam-12761	155	4	2014;2:819	2014;2:819	NOUN
bam-12761	155	5	-	-	SYM
bam-12761	155	6	29	29	NUM
bam-12761	155	7	.	.	PUNCT
bam-12761	156	1	3	3	X
bam-12761	156	2	.	.	X
bam-12761	156	3	perry	perry	PROPN
bam-12761	156	4	bd	bd	PROPN
bam-12761	156	5	,	,	PUNCT
bam-12761	156	6	caldow	caldow	PROPN
bam-12761	156	7	mk	mk	PROPN
bam-12761	156	8	,	,	PUNCT
bam-12761	156	9	brennan	brennan	PROPN
bam-12761	156	10	-	-	PUNCT
bam-12761	156	11	speranza	speranza	PROPN
bam-12761	156	12	tc	tc	PROPN
bam-12761	156	13	,	,	PUNCT
bam-12761	156	14	et	et	PROPN
bam-12761	156	15	al	al	PROPN
bam-12761	156	16	.	.	PROPN
bam-12761	156	17	muscle	muscle	NOUN
bam-12761	156	18	atrophy	atrophy	NOUN
bam-12761	156	19	in	in	ADP
bam-12761	156	20	patients	patient	NOUN
bam-12761	156	21	with	with	ADP
bam-12761	156	22	type	type	NOUN
bam-12761	156	23	2	2	NUM
bam-12761	156	24	diabetes	diabetes	NOUN
bam-12761	156	25	mellitus	mellitus	NOUN
bam-12761	156	26	:	:	PUNCT
bam-12761	156	27	roles	role	NOUN
bam-12761	156	28	of	of	ADP
bam-12761	156	29	inflammatory	inflammatory	ADJ
bam-12761	156	30	pathways	pathway	NOUN
bam-12761	156	31	,	,	PUNCT
bam-12761	156	32	physical	physical	ADJ
bam-12761	156	33	activity	activity	NOUN
bam-12761	156	34	and	and	CCONJ
bam-12761	156	35	exercise	exercise	NOUN
bam-12761	156	36	.	.	PUNCT
bam-12761	157	1	exerc	exerc	PROPN
bam-12761	157	2	immunol	immunol	NOUN
bam-12761	157	3	rev	rev	VERB
bam-12761	157	4	2016;22:94	2016;22:94	NUM
bam-12761	157	5	-	-	SYM
bam-12761	157	6	109	109	NUM
bam-12761	157	7	.	.	NOUN
bam-12761	158	1	4	4	NUM
bam-12761	158	2	.	.	X
bam-12761	158	3	snijders	snijders	PROPN
bam-12761	158	4	t	t	PROPN
bam-12761	158	5	,	,	PUNCT
bam-12761	158	6	nederveen	nederveen	NOUN
bam-12761	158	7	jp	jp	PROPN
bam-12761	158	8	,	,	PUNCT
bam-12761	158	9	bell	bell	PROPN
bam-12761	158	10	ke	ke	PROPN
bam-12761	158	11	,	,	PUNCT
bam-12761	158	12	et	et	PROPN
bam-12761	158	13	al	al	PROPN
bam-12761	158	14	.	.	PROPN
bam-12761	159	1	prolonged	prolonged	ADJ
bam-12761	159	2	exercise	exercise	NOUN
bam-12761	159	3	training	training	NOUN
bam-12761	159	4	improves	improve	VERB
bam-12761	159	5	the	the	DET
bam-12761	159	6	acute	acute	ADJ
bam-12761	159	7	type	type	NOUN
bam-12761	159	8	ii	ii	PROPN
bam-12761	159	9	muscle	muscle	NOUN
bam-12761	159	10	fibre	fibre	NOUN
bam-12761	159	11	satellite	satellite	NOUN
bam-12761	159	12	cell	cell	NOUN
bam-12761	159	13	response	response	NOUN
bam-12761	159	14	in	in	ADP
bam-12761	159	15	healthy	healthy	ADJ
bam-12761	159	16	older	old	ADJ
bam-12761	159	17	men	man	NOUN
bam-12761	159	18	.	.	PUNCT
bam-12761	160	1	j	j	PROPN
bam-12761	160	2	physiol	physiol	PROPN
bam-12761	160	3	2019;597:105	2019;597:105	PROPN
bam-12761	160	4	-	-	SYM
bam-12761	160	5	19	19	NUM
bam-12761	160	6	.	.	NOUN
bam-12761	160	7	5	5	NUM
bam-12761	160	8	.	.	X
bam-12761	160	9	hernández	hernández	PROPN
bam-12761	160	10	-	-	PUNCT
bam-12761	160	11	hernández	hernández	PROPN
bam-12761	160	12	jm	jm	PROPN
bam-12761	160	13	,	,	PUNCT
bam-12761	160	14	garcía	garcía	NOUN
bam-12761	160	15	-	-	PUNCT
bam-12761	160	16	gonzález	gonzález	PROPN
bam-12761	160	17	eg	eg	NOUN
bam-12761	160	18	,	,	PUNCT
bam-12761	160	19	brun	brun	PROPN
bam-12761	160	20	ce	ce	PROPN
bam-12761	160	21	,	,	PUNCT
bam-12761	160	22	rudnicki	rudnicki	PROPN
bam-12761	160	23	ma	ma	PROPN
bam-12761	160	24	.	.	PUNCT
bam-12761	161	1	the	the	DET
bam-12761	161	2	myogenic	myogenic	ADJ
bam-12761	161	3	regulatory	regulatory	ADJ
bam-12761	161	4	factors	factor	NOUN
bam-12761	161	5	,	,	PUNCT
bam-12761	161	6	determinants	determinant	NOUN
bam-12761	161	7	of	of	ADP
bam-12761	161	8	muscle	muscle	NOUN
bam-12761	161	9	development	development	NOUN
bam-12761	161	10	,	,	PUNCT
bam-12761	161	11	cell	cell	NOUN
bam-12761	161	12	identity	identity	NOUN
bam-12761	161	13	and	and	CCONJ
bam-12761	161	14	regeneration	regeneration	NOUN
bam-12761	161	15	.	.	PUNCT
bam-12761	162	1	semin	semin	PROPN
bam-12761	162	2	cell	cell	PROPN
bam-12761	162	3	dev	dev	PROPN
bam-12761	162	4	biol	biol	PROPN
bam-12761	162	5	2017;72:10	2017;72:10	NUM
bam-12761	162	6	-	-	SYM
bam-12761	162	7	8	8	NUM
bam-12761	162	8	.	.	NOUN
bam-12761	163	1	6	6	NUM
bam-12761	163	2	.	.	PUNCT
bam-12761	163	3	stokes	stokes	PROPN
bam-12761	163	4	t	t	PROPN
bam-12761	163	5	,	,	PUNCT
bam-12761	163	6	hector	hector	PROPN
bam-12761	163	7	aj	aj	PROPN
bam-12761	163	8	,	,	PUNCT
bam-12761	163	9	morton	morton	PROPN
bam-12761	163	10	rw	rw	PROPN
bam-12761	163	11	,	,	PUNCT
bam-12761	163	12	et	et	PROPN
bam-12761	163	13	al	al	PROPN
bam-12761	163	14	.	.	PUNCT
bam-12761	164	1	recent	recent	ADJ
bam-12761	164	2	perspectives	perspective	NOUN
bam-12761	164	3	regarding	regard	VERB
bam-12761	164	4	the	the	DET
bam-12761	164	5	role	role	NOUN
bam-12761	164	6	of	of	ADP
bam-12761	164	7	dietary	dietary	ADJ
bam-12761	164	8	protein	protein	NOUN
bam-12761	164	9	for	for	ADP
bam-12761	164	10	the	the	DET
bam-12761	164	11	promotion	promotion	NOUN
bam-12761	164	12	of	of	ADP
bam-12761	164	13	muscle	muscle	NOUN
bam-12761	164	14	hypertrophy	hypertrophy	NOUN
bam-12761	164	15	with	with	ADP
bam-12761	164	16	resistance	resistance	NOUN
bam-12761	164	17	exercise	exercise	NOUN
bam-12761	164	18	training	training	NOUN
bam-12761	164	19	.	.	PUNCT
bam-12761	165	1	nutrients	nutrient	NOUN
bam-12761	166	1	2018;10:180	2018;10:180	ADJ
bam-12761	166	2	.	.	PROPN
bam-12761	166	3	7	7	X
bam-12761	166	4	.	.	X
bam-12761	166	5	arrieta	arrieta	PROPN
bam-12761	166	6	-	-	PUNCT
bam-12761	166	7	leandro	leandro	PROPN
bam-12761	166	8	mc	mc	PROPN
bam-12761	166	9	,	,	PUNCT
bam-12761	166	10	moncada	moncada	PROPN
bam-12761	166	11	-	-	PUNCT
bam-12761	166	12	jiménez	jiménez	PROPN
bam-12761	166	13	j	j	PROPN
bam-12761	166	14	,	,	PUNCT
bam-12761	166	15	moralesscholz	moralesscholz	VERB
bam-12761	166	16	mg	mg	PROPN
bam-12761	166	17	,	,	PUNCT
bam-12761	166	18	hernández	hernández	PROPN
bam-12761	166	19	-	-	PUNCT
bam-12761	166	20	elizondo	elizondo	PROPN
bam-12761	166	21	j.	j.	PROPN
bam-12761	166	22	the	the	DET
bam-12761	166	23	effect	effect	NOUN
bam-12761	166	24	of	of	ADP
bam-12761	166	25	chronic	chronic	ADJ
bam-12761	166	26	high	high	ADJ
bam-12761	166	27	-	-	PUNCT
bam-12761	166	28	intensity	intensity	NOUN
bam-12761	166	29	interval	interval	NOUN
bam-12761	166	30	training	training	NOUN
bam-12761	166	31	programs	program	NOUN
bam-12761	166	32	on	on	ADP
bam-12761	166	33	glycaemic	glycaemic	ADJ
bam-12761	166	34	control	control	NOUN
bam-12761	166	35	,	,	PUNCT
bam-12761	166	36	aerobic	aerobic	ADJ
bam-12761	166	37	resistance	resistance	NOUN
bam-12761	166	38	,	,	PUNCT
bam-12761	166	39	and	and	CCONJ
bam-12761	166	40	body	body	NOUN
bam-12761	166	41	composition	composition	NOUN
bam-12761	166	42	in	in	ADP
bam-12761	166	43	type	type	NOUN
bam-12761	166	44	2	2	NUM
bam-12761	166	45	diabetic	diabetic	ADJ
bam-12761	166	46	patients	patient	NOUN
bam-12761	166	47	:	:	PUNCT
bam-12761	166	48	a	a	DET
bam-12761	166	49	meta	meta	ADJ
bam-12761	166	50	-	-	PUNCT
bam-12761	166	51	analysis	analysis	NOUN
bam-12761	166	52	.	.	PUNCT
bam-12761	167	1	j	j	PROPN
bam-12761	167	2	endocrinol	endocrinol	NOUN
bam-12761	167	3	invest	invest	VERB
bam-12761	167	4	2023;46:2423	2023;46:2423	NUM
bam-12761	167	5	-	-	SYM
bam-12761	167	6	43	43	NUM
bam-12761	167	7	.	.	NOUN
bam-12761	168	1	8	8	NUM
bam-12761	168	2	.	.	X
bam-12761	168	3	badri	badri	PROPN
bam-12761	168	4	z	z	PROPN
bam-12761	168	5	,	,	PUNCT
bam-12761	168	6	delfan	delfan	PROPN
bam-12761	168	7	m	m	PROPN
bam-12761	168	8	,	,	PUNCT
bam-12761	168	9	danesh	danesh	PROPN
bam-12761	168	10	-	-	PUNCT
bam-12761	168	11	yar	yar	PROPN
bam-12761	168	12	s.	s.	PROPN
bam-12761	168	13	the	the	DET
bam-12761	168	14	combined	combined	ADJ
bam-12761	168	15	effect	effect	NOUN
bam-12761	168	16	of	of	ADP
bam-12761	168	17	high	high	ADJ
bam-12761	168	18	-	-	PUNCT
bam-12761	168	19	intensity	intensity	NOUN
bam-12761	168	20	interval	interval	NOUN
bam-12761	168	21	training	training	NOUN
bam-12761	168	22	and	and	CCONJ
bam-12761	168	23	metformin	metformin	NOUN
bam-12761	168	24	on	on	ADP
bam-12761	168	25	gene	gene	NOUN
bam-12761	168	26	expression	expression	NOUN
bam-12761	168	27	of	of	ADP
bam-12761	168	28	myogenin	myogenin	PROPN
bam-12761	168	29	and	and	CCONJ
bam-12761	168	30	myostatin	myostatin	NOUN
bam-12761	168	31	in	in	ADP
bam-12761	168	32	skeletal	skeletal	ADJ
bam-12761	168	33	muscle	muscle	NOUN
bam-12761	168	34	of	of	ADP
bam-12761	168	35	type	type	NOUN
bam-12761	168	36	2	2	NUM
bam-12761	168	37	diabetic	diabetic	ADJ
bam-12761	168	38	mice	mouse	NOUN
bam-12761	168	39	.	.	PUNCT
bam-12761	169	1	ijdld	ijdld	PROPN
bam-12761	169	2	2022;22:199	2022;22:199	PROPN
bam-12761	169	3	-	-	PUNCT
bam-12761	169	4	212	212	NUM
bam-12761	169	5	.	.	PUNCT
bam-12761	170	1	9	9	X
bam-12761	170	2	.	.	X
bam-12761	170	3	nederveen	nederveen	PROPN
bam-12761	170	4	jp	jp	PROPN
bam-12761	170	5	,	,	PUNCT
bam-12761	170	6	joanisse	joanisse	ADP
bam-12761	170	7	s	s	PROPN
bam-12761	170	8	,	,	PUNCT
bam-12761	170	9	séguin	séguin	PROPN
bam-12761	170	10	cm	cm	PROPN
bam-12761	170	11	,	,	PUNCT
bam-12761	170	12	et	et	PROPN
bam-12761	170	13	al	al	PROPN
bam-12761	170	14	.	.	PUNCT
bam-12761	171	1	the	the	DET
bam-12761	171	2	effect	effect	NOUN
bam-12761	171	3	of	of	ADP
bam-12761	171	4	exercise	exercise	NOUN
bam-12761	171	5	mode	mode	NOUN
bam-12761	171	6	on	on	ADP
bam-12761	171	7	the	the	DET
bam-12761	171	8	acute	acute	ADJ
bam-12761	171	9	response	response	NOUN
bam-12761	171	10	of	of	ADP
bam-12761	171	11	satellite	satellite	NOUN
bam-12761	171	12	cells	cell	NOUN
bam-12761	171	13	in	in	ADP
bam-12761	171	14	old	old	ADJ
bam-12761	171	15	men	man	NOUN
bam-12761	171	16	.	.	PUNCT
bam-12761	172	1	acta	acta	PROPN
bam-12761	172	2	physiol	physiol	PROPN
bam-12761	172	3	(	(	PUNCT
bam-12761	172	4	oxf	oxf	PROPN
bam-12761	172	5	)	)	PUNCT
bam-12761	172	6	2015;215:177	2015;215:177	NUM
bam-12761	172	7	-	-	SYM
bam-12761	172	8	90	90	NUM
bam-12761	172	9	.	.	PUNCT
bam-12761	172	10	10	10	NUM
bam-12761	172	11	.	.	PUNCT
bam-12761	173	1	hernández	hernández	PROPN
bam-12761	173	2	-	-	PUNCT
bam-12761	173	3	lepe	lepe	PROPN
bam-12761	173	4	ma	ma	PROPN
bam-12761	173	5	,	,	PUNCT
bam-12761	173	6	manríquez	manríquez	PROPN
bam-12761	173	7	-	-	PUNCT
bam-12761	173	8	torres	torre	VERB
bam-12761	173	9	jj	jj	PROPN
bam-12761	173	10	,	,	PUNCT
bam-12761	173	11	ramoslopez	ramoslopez	PROPN
bam-12761	173	12	o	o	PROPN
bam-12761	173	13	,	,	PUNCT
bam-12761	173	14	et	et	PROPN
bam-12761	173	15	al	al	PROPN
bam-12761	173	16	.	.	PROPN
bam-12761	173	17	impact	impact	NOUN
bam-12761	173	18	of	of	ADP
bam-12761	173	19	spirulina	spirulina	PROPN
bam-12761	173	20	maxima	maxima	PROPN
bam-12761	173	21	intake	intake	NOUN
bam-12761	173	22	and	and	CCONJ
bam-12761	173	23	exercise	exercise	NOUN
bam-12761	173	24	(	(	PUNCT
bam-12761	173	25	sie	sie	PROPN
bam-12761	173	26	)	)	PUNCT
bam-12761	173	27	on	on	ADP
bam-12761	173	28	metabolic	metabolic	NOUN
bam-12761	173	29	and	and	CCONJ
bam-12761	173	30	fitness	fitness	NOUN
bam-12761	173	31	parameters	parameter	NOUN
bam-12761	173	32	in	in	ADP
bam-12761	173	33	sedentary	sedentary	ADJ
bam-12761	173	34	older	old	ADJ
bam-12761	173	35	adults	adult	NOUN
bam-12761	173	36	with	with	ADP
bam-12761	173	37	excessive	excessive	ADJ
bam-12761	173	38	body	body	NOUN
bam-12761	173	39	mass	mass	NOUN
bam-12761	173	40	:	:	PUNCT
bam-12761	173	41	study	study	NOUN
bam-12761	173	42	protocol	protocol	NOUN
bam-12761	173	43	of	of	ADP
bam-12761	173	44	a	a	DET
bam-12761	173	45	randomized	randomized	ADJ
bam-12761	173	46	controlled	control	VERB
bam-12761	173	47	trial	trial	NOUN
bam-12761	173	48	.	.	PUNCT
bam-12761	174	1	int	int	PROPN
bam-12761	175	1	j	j	PROPN
bam-12761	175	2	environ	environ	PROPN
bam-12761	175	3	res	res	PROPN
bam-12761	175	4	public	public	ADJ
bam-12761	175	5	health	health	NOUN
bam-12761	175	6	2021;18:1605	2021;18:1605	NUM
bam-12761	175	7	.	.	PROPN
bam-12761	175	8	11	11	NUM
bam-12761	175	9	.	.	X
bam-12761	176	1	gómez	gómez	NOUN
bam-12761	176	2	-	-	PUNCT
bam-12761	176	3	téllez	téllez	PROPN
bam-12761	176	4	a	a	PRON
bam-12761	176	5	,	,	PUNCT
bam-12761	176	6	sierra	sierra	PROPN
bam-12761	176	7	-	-	PUNCT
bam-12761	176	8	puente	puente	PROPN
bam-12761	176	9	d	d	PROPN
bam-12761	176	10	,	,	PUNCT
bam-12761	176	11	muñoz	muñoz	PROPN
bam-12761	176	12	-	-	PUNCT
bam-12761	176	13	gómez	gómez	NOUN
bam-12761	176	14	r	r	NOUN
bam-12761	176	15	,	,	PUNCT
bam-12761	176	16	et	et	PROPN
bam-12761	176	17	al	al	PROPN
bam-12761	176	18	.	.	PUNCT
bam-12761	176	19	effects	effect	NOUN
bam-12761	176	20	of	of	ADP
bam-12761	176	21	a	a	DET
bam-12761	176	22	low	low	ADJ
bam-12761	176	23	-	-	PUNCT
bam-12761	176	24	dose	dose	NOUN
bam-12761	176	25	spirulina	spirulina	NOUN
bam-12761	176	26	/	/	SYM
bam-12761	176	27	turmeric	turmeric	ADJ
bam-12761	176	28	supplement	supplement	NOUN
bam-12761	176	29	on	on	ADP
bam-12761	176	30	cardiometabolic	cardiometabolic	NOUN
bam-12761	176	31	and	and	CCONJ
bam-12761	176	32	antioxidant	antioxidant	ADJ
bam-12761	176	33	serum	serum	NOUN
bam-12761	176	34	markers	marker	NOUN
bam-12761	176	35	of	of	ADP
bam-12761	176	36	patients	patient	NOUN
bam-12761	176	37	with	with	ADP
bam-12761	176	38	abdominal	abdominal	ADJ
bam-12761	176	39	obesity	obesity	NOUN
bam-12761	176	40	.	.	PUNCT
bam-12761	177	1	front	front	ADJ
bam-12761	177	2	nutr	nutr	PROPN
bam-12761	177	3	2020;7:65	2020;7:65	NOUN
bam-12761	177	4	.	.	PUNCT
bam-12761	178	1	12	12	NUM
bam-12761	178	2	.	.	PUNCT
bam-12761	179	1	hatami	hatami	PROPN
bam-12761	179	2	e	e	PROPN
bam-12761	179	3	,	,	PUNCT
bam-12761	179	4	ghalishourani	ghalishourani	PROPN
bam-12761	179	5	ss	ss	PROPN
bam-12761	179	6	,	,	PUNCT
bam-12761	179	7	najafgholizadeh	najafgholizadeh	ADP
bam-12761	179	8	a	a	PRON
bam-12761	179	9	,	,	PUNCT
bam-12761	179	10	et	et	PROPN
bam-12761	179	11	al	al	PROPN
bam-12761	179	12	.	.	PUNCT
bam-12761	180	1	the	the	DET
bam-12761	180	2	effect	effect	NOUN
bam-12761	180	3	of	of	ADP
bam-12761	180	4	spirulina	spirulina	NOUN
bam-12761	180	5	on	on	ADP
bam-12761	180	6	type	type	NOUN
bam-12761	180	7	2	2	NUM
bam-12761	180	8	diabetes	diabetes	NOUN
bam-12761	180	9	:	:	PUNCT
bam-12761	180	10	a	a	DET
bam-12761	180	11	systematic	systematic	ADJ
bam-12761	180	12	review	review	NOUN
bam-12761	180	13	and	and	CCONJ
bam-12761	180	14	meta	meta	ADJ
bam-12761	180	15	-	-	PUNCT
bam-12761	180	16	analysis	analysis	NOUN
bam-12761	180	17	.	.	PUNCT
bam-12761	181	1	j	j	PROPN
bam-12761	181	2	diabetes	diabete	VERB
bam-12761	181	3	metab	metab	PROPN
bam-12761	181	4	disord	disord	NOUN
bam-12761	181	5	2021;20:883	2021;20:883	PROPN
bam-12761	181	6	-	-	SYM
bam-12761	181	7	92	92	NUM
bam-12761	181	8	.	.	PUNCT
bam-12761	182	1	13	13	NUM
bam-12761	182	2	.	.	PUNCT
bam-12761	183	1	brito	brito	PROPN
bam-12761	183	2	af	af	PROPN
bam-12761	183	3	,	,	PUNCT
bam-12761	183	4	silva	silva	PROPN
bam-12761	183	5	as	as	ADP
bam-12761	183	6	,	,	PUNCT
bam-12761	183	7	de	de	PROPN
bam-12761	183	8	oliveira	oliveira	PROPN
bam-12761	183	9	cvc	cvc	PROPN
bam-12761	183	10	,	,	PUNCT
bam-12761	183	11	et	et	PROPN
bam-12761	183	12	al	al	PROPN
bam-12761	183	13	.	.	PROPN
bam-12761	183	14	spirulina	spirulina	PROPN
bam-12761	183	15	platensis	platensis	PROPN
bam-12761	183	16	prevents	prevent	VERB
bam-12761	183	17	oxidative	oxidative	ADJ
bam-12761	183	18	stress	stress	NOUN
bam-12761	183	19	and	and	CCONJ
bam-12761	183	20	inflammation	inflammation	NOUN
bam-12761	183	21	promoted	promote	VERB
bam-12761	183	22	by	by	ADP
bam-12761	183	23	strength	strength	NOUN
bam-12761	183	24	training	training	NOUN
bam-12761	183	25	in	in	ADP
bam-12761	183	26	rats	rat	NOUN
bam-12761	183	27	:	:	PUNCT
bam-12761	183	28	dose	dose	NOUN
bam-12761	183	29	-	-	PUNCT
bam-12761	183	30	response	response	NOUN
bam-12761	183	31	relation	relation	NOUN
bam-12761	183	32	study	study	NOUN
bam-12761	183	33	.	.	PUNCT
bam-12761	184	1	sci	sci	PROPN
bam-12761	184	2	rep	rep	PROPN
bam-12761	184	3	2020;10:6382	2020;10:6382	NUM
bam-12761	184	4	.	.	PROPN
bam-12761	184	5	14	14	NUM
bam-12761	184	6	.	.	PUNCT
bam-12761	185	1	lu	lu	PROPN
bam-12761	185	2	hk	hk	PROPN
bam-12761	185	3	,	,	PUNCT
bam-12761	185	4	hsieh	hsieh	PROPN
bam-12761	185	5	cc	cc	PROPN
bam-12761	185	6	,	,	PUNCT
bam-12761	185	7	hsu	hsu	PROPN
bam-12761	185	8	jj	jj	PROPN
bam-12761	185	9	,	,	PUNCT
bam-12761	185	10	et	et	PROPN
bam-12761	185	11	al	al	PROPN
bam-12761	185	12	.	.	PUNCT
bam-12761	186	1	preventive	preventive	ADJ
bam-12761	186	2	effects	effect	NOUN
bam-12761	186	3	of	of	ADP
bam-12761	186	4	spirulina	spirulina	NOUN
bam-12761	186	5	platensis	platensis	NOUN
bam-12761	186	6	on	on	ADP
bam-12761	186	7	skeletal	skeletal	ADJ
bam-12761	186	8	muscle	muscle	NOUN
bam-12761	186	9	damage	damage	NOUN
bam-12761	186	10	under	under	ADP
bam-12761	186	11	exercise	exercise	NOUN
bam-12761	186	12	-	-	PUNCT
bam-12761	186	13	induced	induce	VERB
bam-12761	186	14	oxidative	oxidative	ADJ
bam-12761	186	15	stress	stress	NOUN
bam-12761	186	16	.	.	PUNCT
bam-12761	187	1	eur	eur	PROPN
bam-12761	187	2	j	j	PROPN
bam-12761	187	3	appl	appl	PROPN
bam-12761	187	4	physiol	physiol	PROPN
bam-12761	187	5	2006;98:220	2006;98:220	PROPN
bam-12761	187	6	-	-	PUNCT
bam-12761	187	7	6	6	NUM
bam-12761	187	8	.	.	NOUN
bam-12761	187	9	15	15	NUM
bam-12761	187	10	.	.	PUNCT
bam-12761	188	1	calella	calella	PROPN
bam-12761	188	2	p	p	PROPN
bam-12761	188	3	,	,	PUNCT
bam-12761	188	4	cerullo	cerullo	ADJ
bam-12761	188	5	g	g	PROPN
bam-12761	188	6	,	,	PUNCT
bam-12761	188	7	di	di	X
bam-12761	188	8	dio	dio	PROPN
bam-12761	188	9	m	m	PROPN
bam-12761	188	10	,	,	PUNCT
bam-12761	188	11	et	et	PROPN
bam-12761	188	12	al	al	PROPN
bam-12761	188	13	.	.	PROPN
bam-12761	188	14	antioxidant	antioxidant	PROPN
bam-12761	188	15	,	,	PUNCT
bam-12761	188	16	antiinflammatory	antiinflammatory	NOUN
bam-12761	188	17	and	and	CCONJ
bam-12761	188	18	immunomodulatory	immunomodulatory	ADJ
bam-12761	188	19	effects	effect	NOUN
bam-12761	188	20	of	of	ADP
bam-12761	188	21	spirulina	spirulina	NOUN
bam-12761	188	22	in	in	ADP
bam-12761	188	23	exercise	exercise	NOUN
bam-12761	188	24	and	and	CCONJ
bam-12761	188	25	sport	sport	NOUN
bam-12761	188	26	:	:	PUNCT
bam-12761	188	27	a	a	DET
bam-12761	188	28	systematic	systematic	ADJ
bam-12761	188	29	review	review	NOUN
bam-12761	188	30	.	.	PUNCT
bam-12761	189	1	front	front	NOUN
bam-12761	189	2	nutr	nutr	PROPN
bam-12761	189	3	2022;9:1048258	2022;9:1048258	NUM
bam-12761	189	4	.	.	PUNCT
bam-12761	190	1	16	16	NUM
bam-12761	190	2	.	.	PUNCT
bam-12761	191	1	chaouachi	chaouachi	PROPN
bam-12761	191	2	m	m	PROPN
bam-12761	191	3	,	,	PUNCT
bam-12761	191	4	vincent	vincent	PROPN
bam-12761	191	5	s	s	PROPN
bam-12761	191	6	,	,	PUNCT
bam-12761	191	7	groussard	groussard	PROPN
bam-12761	191	8	c.	c.	PROPN
bam-12761	191	9	a	a	DET
bam-12761	191	10	review	review	NOUN
bam-12761	191	11	of	of	ADP
bam-12761	191	12	the	the	DET
bam-12761	191	13	health	health	NOUN
bam-12761	191	14	-	-	PUNCT
bam-12761	191	15	promoting	promote	VERB
bam-12761	191	16	properties	property	NOUN
bam-12761	191	17	of	of	ADP
bam-12761	191	18	spirulina	spirulina	NOUN
bam-12761	191	19	with	with	ADP
bam-12761	191	20	a	a	DET
bam-12761	191	21	focus	focus	NOUN
bam-12761	191	22	on	on	ADP
bam-12761	191	23	athletes	athlete	NOUN
bam-12761	191	24	’	'	PUNCT
bam-12761	191	25	performance	performance	NOUN
bam-12761	191	26	and	and	CCONJ
bam-12761	191	27	recovery	recovery	NOUN
bam-12761	191	28	.	.	PUNCT
bam-12761	192	1	j	j	PROPN
bam-12761	192	2	diet	diet	PROPN
bam-12761	192	3	suppl	suppl	PROPN
bam-12761	192	4	2024;21:210	2024;21:210	PROPN
bam-12761	192	5	-	-	SYM
bam-12761	192	6	41	41	NUM
bam-12761	192	7	.	.	PUNCT
bam-12761	193	1	17	17	NUM
bam-12761	193	2	.	.	PUNCT
bam-12761	193	3	hernández	hernández	PROPN
bam-12761	193	4	-	-	PUNCT
bam-12761	193	5	lepe	lepe	PROPN
bam-12761	193	6	ma	ma	PROPN
bam-12761	193	7	,	,	PUNCT
bam-12761	193	8	lópez	lópez	NOUN
bam-12761	193	9	-	-	PUNCT
bam-12761	193	10	díaz	díaz	PROPN
bam-12761	193	11	ja	ja	PROPN
bam-12761	193	12	,	,	PUNCT
bam-12761	193	13	juárez	juárez	NOUN
bam-12761	193	14	-	-	PUNCT
bam-12761	193	15	oropeza	oropeza	PROPN
bam-12761	193	16	ma	ma	PROPN
bam-12761	193	17	,	,	PUNCT
bam-12761	193	18	et	et	PROPN
bam-12761	193	19	al	al	PROPN
bam-12761	193	20	.	.	PROPN
bam-12761	193	21	effect	effect	NOUN
bam-12761	193	22	of	of	ADP
bam-12761	193	23	arthrospira	arthrospira	PROPN
bam-12761	193	24	(	(	PUNCT
bam-12761	193	25	spirulina	spirulina	NOUN
bam-12761	193	26	)	)	PUNCT
bam-12761	193	27	maxima	maxima	NOUN
bam-12761	193	28	supplementation	supplementation	NOUN
bam-12761	193	29	and	and	CCONJ
bam-12761	193	30	a	a	DET
bam-12761	193	31	systematic	systematic	ADJ
bam-12761	193	32	physical	physical	ADJ
bam-12761	193	33	exercise	exercise	NOUN
bam-12761	193	34	program	program	NOUN
bam-12761	193	35	on	on	ADP
bam-12761	193	36	the	the	DET
bam-12761	193	37	body	body	NOUN
bam-12761	193	38	composition	composition	NOUN
bam-12761	193	39	and	and	CCONJ
bam-12761	193	40	cardiorespiratory	cardiorespiratory	NOUN
bam-12761	193	41	fitness	fitness	NOUN
bam-12761	193	42	of	of	ADP
bam-12761	193	43	overweight	overweight	ADJ
bam-12761	193	44	or	or	CCONJ
bam-12761	193	45	obese	obese	ADJ
bam-12761	193	46	subjects	subject	NOUN
bam-12761	193	47	:	:	PUNCT
bam-12761	193	48	a	a	DET
bam-12761	193	49	double	double	ADJ
bam-12761	193	50	-	-	PUNCT
bam-12761	193	51	blind	blind	ADJ
bam-12761	193	52	,	,	PUNCT
bam-12761	193	53	randomized	randomize	VERB
bam-12761	193	54	,	,	PUNCT
bam-12761	193	55	and	and	CCONJ
bam-12761	193	56	crossover	crossover	VERB
bam-12761	193	57	controlled	control	VERB
bam-12761	193	58	trial	trial	NOUN
bam-12761	193	59	.	.	PUNCT
bam-12761	194	1	mar	mar	PROPN
bam-12761	194	2	drugs	drugs	PROPN
bam-12761	194	3	2018;16:364	2018;16:364	PROPN
bam-12761	194	4	.	.	PROPN
bam-12761	194	5	18	18	NUM
bam-12761	194	6	.	.	PUNCT
bam-12761	194	7	moura	moura	PROPN
bam-12761	194	8	lp	lp	PROPN
bam-12761	194	9	,	,	PUNCT
bam-12761	194	10	gurjão	gurjão	PROPN
bam-12761	194	11	al	al	PROPN
bam-12761	194	12	,	,	PUNCT
bam-12761	194	13	jambassi	jambassi	PROPN
bam-12761	194	14	filho	filho	PROPN
bam-12761	194	15	jc	jc	PROPN
bam-12761	194	16	,	,	PUNCT
bam-12761	194	17	et	et	PROPN
bam-12761	194	18	al	al	PROPN
bam-12761	194	19	.	.	PROPN
bam-12761	194	20	spirulina	spirulina	PROPN
bam-12761	194	21	,	,	PUNCT
bam-12761	194	22	exercício	exercício	PROPN
bam-12761	194	23	e	e	PROPN
bam-12761	194	24	controle	controle	PROPN
bam-12761	194	25	da	da	PROPN
bam-12761	194	26	glicemia	glicemia	PROPN
bam-12761	194	27	em	em	PRON
bam-12761	194	28	ratos	rato	VERB
bam-12761	194	29	diabéticos	diabéticos	PROPN
bam-12761	194	30	[	[	X
bam-12761	194	31	spirulina	spirulina	NOUN
bam-12761	194	32	,	,	PUNCT
bam-12761	194	33	exercise	exercise	NOUN
bam-12761	194	34	and	and	CCONJ
bam-12761	194	35	serum	serum	NOUN
bam-12761	194	36	glucose	glucose	NOUN
bam-12761	194	37	control	control	NOUN
bam-12761	194	38	in	in	ADP
bam-12761	194	39	diabetic	diabetic	ADJ
bam-12761	194	40	rats	rat	NOUN
bam-12761	194	41	]	]	PUNCT
bam-12761	194	42	.	.	PUNCT
bam-12761	195	1	arq	arq	PROPN
bam-12761	195	2	bras	bras	PROPN
bam-12761	195	3	endocrinol	endocrinol	VERB
bam-12761	195	4	metabol	metabol	NOUN
bam-12761	195	5	2012;56:25	2012;56:25	NUM
bam-12761	195	6	-	-	SYM
bam-12761	195	7	32	32	NUM
bam-12761	195	8	.	.	PUNCT
bam-12761	196	1	19	19	NUM
bam-12761	196	2	.	.	PUNCT
bam-12761	196	3	jalali	jalali	PROPN
bam-12761	196	4	s	s	PROPN
bam-12761	196	5	,	,	PUNCT
bam-12761	196	6	jafari	jafari	ADJ
bam-12761	196	7	m.	m.	NOUN
bam-12761	196	8	effects	effect	NOUN
bam-12761	196	9	of	of	ADP
bam-12761	196	10	high	high	ADJ
bam-12761	196	11	intensity	intensity	NOUN
bam-12761	196	12	interval	interval	NOUN
bam-12761	196	13	(	(	PUNCT
bam-12761	196	14	hit	hit	NOUN
bam-12761	196	15	)	)	PUNCT
bam-12761	196	16	versus	versus	ADP
bam-12761	196	17	continuous	continuous	ADJ
bam-12761	196	18	trainings	training	NOUN
bam-12761	196	19	on	on	ADP
bam-12761	196	20	abcg5	abcg5	NOUN
bam-12761	196	21	and	and	CCONJ
bam-12761	196	22	abcg8	abcg8	NOUN
bam-12761	196	23	genes	gene	NOUN
bam-12761	196	24	expression	expression	NOUN
bam-12761	196	25	in	in	ADP
bam-12761	196	26	male	male	PROPN
bam-12761	196	27	wistar	wistar	PROPN
bam-12761	196	28	rats	rat	NOUN
bam-12761	196	29	after	after	ADP
bam-12761	196	30	high	high	ADJ
bam-12761	196	31	fat	fat	ADJ
bam-12761	196	32	diet	diet	NOUN
bam-12761	196	33	.	.	PUNCT
bam-12761	197	1	res	re	NOUN
bam-12761	197	2	med	me	VERB
bam-12761	197	3	2019;43:216–21	2019;43:216–21	PROPN
bam-12761	197	4	.	.	PROPN
bam-12761	198	1	20	20	NUM
bam-12761	198	2	.	.	PUNCT
bam-12761	198	3	bedford	bedford	PROPN
bam-12761	198	4	tg	tg	PROPN
bam-12761	198	5	,	,	PUNCT
bam-12761	198	6	tipton	tipton	PROPN
bam-12761	198	7	cm	cm	PROPN
bam-12761	198	8	,	,	PUNCT
bam-12761	198	9	wilson	wilson	PROPN
bam-12761	198	10	nc	nc	PROPN
bam-12761	198	11	,	,	PUNCT
bam-12761	198	12	et	et	PROPN
bam-12761	198	13	al	al	PROPN
bam-12761	198	14	.	.	PUNCT
bam-12761	199	1	maximum	maximum	ADJ
bam-12761	199	2	oxygen	oxygen	NOUN
bam-12761	199	3	consumption	consumption	NOUN
bam-12761	199	4	of	of	ADP
bam-12761	199	5	rats	rat	NOUN
bam-12761	199	6	and	and	CCONJ
bam-12761	199	7	its	its	PRON
bam-12761	199	8	changes	change	NOUN
bam-12761	199	9	with	with	ADP
bam-12761	199	10	various	various	ADJ
bam-12761	199	11	experimental	experimental	ADJ
bam-12761	199	12	procedures	procedure	NOUN
bam-12761	199	13	.	.	PUNCT
bam-12761	200	1	j	j	PROPN
bam-12761	200	2	appl	appl	PROPN
bam-12761	200	3	physiol	physiol	PROPN
bam-12761	200	4	respir	respir	VERB
bam-12761	200	5	environ	environ	X
bam-12761	200	6	exerc	exerc	PROPN
bam-12761	200	7	physiol	physiol	PROPN
bam-12761	200	8	1979;47:1278	1979;47:1278	PROPN
bam-12761	200	9	-	-	SYM
bam-12761	200	10	83	83	NUM
bam-12761	200	11	.	.	PUNCT
bam-12761	201	1	21	21	NUM
bam-12761	201	2	.	.	PUNCT
bam-12761	202	1	høydal	høydal	PROPN
bam-12761	202	2	ma	ma	PROPN
bam-12761	202	3	,	,	PUNCT
bam-12761	202	4	wisløff	wisløff	VERB
bam-12761	202	5	u	u	PROPN
bam-12761	202	6	,	,	PUNCT
bam-12761	202	7	kemi	kemi	PROPN
bam-12761	202	8	oj	oj	PROPN
bam-12761	202	9	,	,	PUNCT
bam-12761	202	10	ellingsen	ellingsen	NOUN
bam-12761	202	11	o.	o.	NOUN
bam-12761	202	12	running	run	VERB
bam-12761	202	13	speed	speed	NOUN
bam-12761	202	14	and	and	CCONJ
bam-12761	202	15	maximal	maximal	ADJ
bam-12761	202	16	oxygen	oxygen	NOUN
bam-12761	202	17	uptake	uptake	NOUN
bam-12761	202	18	in	in	ADP
bam-12761	202	19	rats	rat	NOUN
bam-12761	202	20	and	and	CCONJ
bam-12761	202	21	mice	mouse	NOUN
bam-12761	202	22	:	:	PUNCT
bam-12761	202	23	practical	practical	ADJ
bam-12761	202	24	implications	implication	NOUN
bam-12761	202	25	for	for	ADP
bam-12761	202	26	exercise	exercise	NOUN
bam-12761	202	27	training	training	NOUN
bam-12761	202	28	.	.	PUNCT
bam-12761	203	1	eur	eur	PROPN
bam-12761	203	2	j	j	PROPN
bam-12761	203	3	cardiovasc	cardiovasc	PROPN
bam-12761	203	4	prev	prev	PROPN
bam-12761	203	5	rehabil	rehabil	VERB
bam-12761	203	6	2007;14:753	2007;14:753	PROPN
bam-12761	203	7	-	-	SYM
bam-12761	203	8	60	60	NUM
bam-12761	203	9	.	.	PUNCT
bam-12761	204	1	22	22	NUM
bam-12761	204	2	.	.	PUNCT
bam-12761	205	1	toti	toti	PROPN
bam-12761	205	2	l	l	PROPN
bam-12761	205	3	,	,	PUNCT
bam-12761	205	4	bartalucci	bartalucci	PROPN
bam-12761	205	5	a	a	PRON
bam-12761	205	6	,	,	PUNCT
bam-12761	205	7	ferrucci	ferrucci	NOUN
bam-12761	205	8	m	m	PROPN
bam-12761	205	9	,	,	PUNCT
bam-12761	205	10	et	et	PROPN
bam-12761	205	11	al	al	PROPN
bam-12761	205	12	.	.	PROPN
bam-12761	206	1	high	high	ADJ
bam-12761	206	2	-	-	PUNCT
bam-12761	206	3	intensity	intensity	NOUN
bam-12761	206	4	exercise	exercise	NOUN
bam-12761	206	5	training	training	NOUN
bam-12761	206	6	induces	induce	VERB
bam-12761	206	7	morphological	morphological	ADJ
bam-12761	206	8	and	and	CCONJ
bam-12761	206	9	biochemical	biochemical	ADJ
bam-12761	206	10	changes	change	NOUN
bam-12761	206	11	in	in	ADP
bam-12761	206	12	skeletal	skeletal	ADJ
bam-12761	206	13	muscles	muscle	NOUN
bam-12761	206	14	.	.	PUNCT
bam-12761	207	1	biol	biol	PROPN
bam-12761	207	2	sport	sport	NOUN
bam-12761	207	3	2013;30	2013;30	NOUN
bam-12761	207	4	:	:	PUNCT
bam-12761	207	5	301	301	NUM
bam-12761	207	6	-	-	SYM
bam-12761	207	7	9	9	NUM
bam-12761	207	8	.	.	NOUN
bam-12761	207	9	23	23	NUM
bam-12761	207	10	.	.	PUNCT
bam-12761	208	1	simon	simon	PROPN
bam-12761	208	2	jp	jp	PROPN
bam-12761	208	3	,	,	PUNCT
bam-12761	208	4	baskaran	baskaran	ADJ
bam-12761	208	5	ul	ul	INTJ
bam-12761	208	6	,	,	PUNCT
bam-12761	208	7	shallauddin	shallauddin	PROPN
bam-12761	208	8	kb	kb	PROPN
bam-12761	208	9	,	,	PUNCT
bam-12761	208	10	et	et	PROPN
bam-12761	208	11	al	al	PROPN
bam-12761	208	12	.	.	PROPN
bam-12761	208	13	evidence	evidence	NOUN
bam-12761	208	14	of	of	ADP
bam-12761	208	15	antidiabetic	antidiabetic	ADJ
bam-12761	208	16	activity	activity	NOUN
bam-12761	208	17	of	of	ADP
bam-12761	208	18	spirulina	spirulina	PROPN
bam-12761	208	19	fusiformis	fusiformis	PROPN
bam-12761	208	20	against	against	ADP
bam-12761	208	21	streptozotocin	streptozotocin	NOUN
bam-12761	208	22	-	-	PUNCT
bam-12761	208	23	induced	induce	VERB
bam-12761	208	24	diabetic	diabetic	ADJ
bam-12761	208	25	wistar	wistar	PROPN
bam-12761	208	26	albino	albino	PROPN
bam-12761	208	27	rats	rat	NOUN
bam-12761	208	28	.	.	PUNCT
bam-12761	209	1	3	3	NUM
bam-12761	209	2	biotech	biotech	NOUN
bam-12761	209	3	2018;8:129	2018;8:129	NUM
bam-12761	209	4	.	.	PUNCT
bam-12761	210	1	24	24	NUM
bam-12761	210	2	.	.	PUNCT
bam-12761	211	1	shen	shen	PROPN
bam-12761	212	1	y	y	PROPN
bam-12761	212	2	,	,	PUNCT
bam-12761	212	3	xu	xu	PROPN
bam-12761	213	1	x	x	PROPN
bam-12761	213	2	,	,	PUNCT
bam-12761	213	3	yue	yue	PROPN
bam-12761	213	4	k	k	PROPN
bam-12761	213	5	,	,	PUNCT
bam-12761	213	6	xu	xu	PROPN
bam-12761	213	7	g.	g.	PROPN
bam-12761	213	8	effect	effect	NOUN
bam-12761	213	9	of	of	ADP
bam-12761	213	10	different	different	ADJ
bam-12761	213	11	exer31	exer31	NOUN
bam-12761	214	1	non	non	ADP
bam-12761	214	2	-co	-co	PROPN
bam-12761	214	3	mmerc	mmerc	PROPN
bam-12761	214	4	ial	ial	PROPN
bam-12761	214	5	us	us	PROPN
bam-12761	214	6	e	e	NOUN
bam-12761	214	7	o	o	NOUN
bam-12761	214	8	nly	nly	ADV
bam-12761	214	9	mailto:r.askari@hsu.ac.ir	mailto:r.askari@hsu.ac.ir	PROPN
bam-12761	214	10	mailto:m.azarnive@uoz.ac.ir	mailto:m.azarnive@uoz.ac.ir	PROPN
bam-12761	214	11	mailto:ah.haghighi@hsu.ac.ir	mailto:ah.haghighi@hsu.ac.ir	ADJ
bam-12761	214	12	https://orcid.org/0000-0001-8404-6927	https://orcid.org/0000-0001-8404-6927	PROPN
bam-12761	214	13	mailto:h.shahrabadi@gmail.com	mailto:h.shahrabadi@gmail.com	PROPN
bam-12761	214	14	high	high	ADJ
bam-12761	214	15	-	-	PUNCT
bam-12761	214	16	intensity	intensity	NOUN
bam-12761	214	17	interval	interval	NOUN
bam-12761	214	18	training	training	NOUN
bam-12761	214	19	,	,	PUNCT
bam-12761	214	20	but	but	CCONJ
bam-12761	214	21	not	not	PART
bam-12761	214	22	spirulina	spirulina	NOUN
bam-12761	214	23	supplementation	supplementation	NOUN
bam-12761	214	24	,	,	PUNCT
bam-12761	214	25	changes	change	VERB
bam-12761	214	26	muscle	muscle	NOUN
bam-12761	214	27	regeneration	regeneration	NOUN
bam-12761	214	28	signaling	signal	VERB
bam-12761	214	29	proteins	protein	NOUN
bam-12761	214	30	eur	eur	PROPN
bam-12761	214	31	j	j	PROPN
bam-12761	214	32	transl	transl	PROPN
bam-12761	214	33	myol	myol	NOUN
bam-12761	214	34	34	34	NUM
bam-12761	214	35	(	(	PUNCT
bam-12761	214	36	4	4	NUM
bam-12761	214	37	)	)	PUNCT
bam-12761	214	38	12761	12761	NUM
bam-12761	214	39	,	,	PUNCT
bam-12761	214	40	2024	2024	NUM
bam-12761	214	41	doi	doi	NOUN
bam-12761	214	42	:	:	PUNCT
bam-12761	214	43	10.4081	10.4081	NUM
bam-12761	214	44	/	/	SYM
bam-12761	214	45	ejtm.2024.12761	ejtm.2024.12761	ADJ
bam-12761	214	46	cise	cise	NOUN
bam-12761	214	47	protocols	protocol	NOUN
bam-12761	214	48	on	on	ADP
bam-12761	214	49	metabolic	metabolic	NOUN
bam-12761	214	50	profiles	profile	NOUN
bam-12761	214	51	and	and	CCONJ
bam-12761	214	52	fatty	fatty	NOUN
bam-12761	214	53	acid	acid	ADJ
bam-12761	214	54	metabolism	metabolism	NOUN
bam-12761	214	55	in	in	ADP
bam-12761	214	56	skeletal	skeletal	ADJ
bam-12761	214	57	muscle	muscle	NOUN
bam-12761	214	58	in	in	ADP
bam-12761	214	59	high	high	ADJ
bam-12761	214	60	-	-	PUNCT
bam-12761	214	61	fat	fat	NOUN
bam-12761	214	62	diet	diet	NOUN
bam-12761	214	63	-	-	PUNCT
bam-12761	214	64	fed	feed	VERB
bam-12761	214	65	rats	rat	NOUN
bam-12761	214	66	.	.	PUNCT
bam-12761	215	1	obesity	obesity	NOUN
bam-12761	215	2	(	(	PUNCT
bam-12761	215	3	silver	silver	NOUN
bam-12761	215	4	spring	spring	NOUN
bam-12761	215	5	)	)	PUNCT
bam-12761	215	6	2015;23:1000	2015;23:1000	NUM
bam-12761	215	7	-	-	SYM
bam-12761	215	8	6	6	NUM
bam-12761	215	9	.	.	NOUN
bam-12761	215	10	25	25	NUM
bam-12761	215	11	.	.	PUNCT
bam-12761	216	1	naves	naves	PROPN
bam-12761	216	2	jpa	jpa	PROPN
bam-12761	216	3	,	,	PUNCT
bam-12761	216	4	rebelo	rebelo	PROPN
bam-12761	216	5	acs	acs	PROPN
bam-12761	216	6	,	,	PUNCT
bam-12761	216	7	silva	silva	PROPN
bam-12761	216	8	lrbe	lrbe	PROPN
bam-12761	216	9	,	,	PUNCT
bam-12761	216	10	et	et	PROPN
bam-12761	216	11	al	al	PROPN
bam-12761	216	12	.	.	PROPN
bam-12761	217	1	cardiorespiratory	cardiorespiratory	PROPN
bam-12761	217	2	and	and	CCONJ
bam-12761	217	3	perceptual	perceptual	ADJ
bam-12761	217	4	responses	response	NOUN
bam-12761	217	5	of	of	ADP
bam-12761	217	6	two	two	NUM
bam-12761	217	7	interval	interval	NOUN
bam-12761	217	8	training	training	NOUN
bam-12761	217	9	and	and	CCONJ
bam-12761	217	10	a	a	DET
bam-12761	217	11	continuous	continuous	ADJ
bam-12761	217	12	training	training	NOUN
bam-12761	217	13	protocol	protocol	NOUN
bam-12761	217	14	in	in	ADP
bam-12761	217	15	healthy	healthy	ADJ
bam-12761	217	16	young	young	ADJ
bam-12761	217	17	men	man	NOUN
bam-12761	217	18	.	.	PUNCT
bam-12761	218	1	eur	eur	PROPN
bam-12761	218	2	j	j	PROPN
bam-12761	218	3	sport	sport	PROPN
bam-12761	218	4	sci	sci	PROPN
bam-12761	218	5	2019;19:653	2019;19:653	PROPN
bam-12761	218	6	-	-	SYM
bam-12761	218	7	60	60	NUM
bam-12761	218	8	.	.	PUNCT
bam-12761	218	9	26	26	NUM
bam-12761	218	10	.	.	PUNCT
bam-12761	219	1	ozaki	ozaki	PROPN
bam-12761	219	2	h	h	PROPN
bam-12761	219	3	,	,	PUNCT
bam-12761	219	4	loenneke	loenneke	PROPN
bam-12761	219	5	jp	jp	PROPN
bam-12761	219	6	,	,	PUNCT
bam-12761	219	7	thiebaud	thiebaud	NOUN
bam-12761	219	8	rs	rs	PROPN
bam-12761	219	9	,	,	PUNCT
bam-12761	219	10	abe	abe	PROPN
bam-12761	219	11	t.	t.	NOUN
bam-12761	219	12	cycle	cycle	NOUN
bam-12761	219	13	training	training	NOUN
bam-12761	219	14	induces	induce	VERB
bam-12761	219	15	muscle	muscle	NOUN
bam-12761	219	16	hypertrophy	hypertrophy	NOUN
bam-12761	219	17	and	and	CCONJ
bam-12761	219	18	strength	strength	NOUN
bam-12761	219	19	gain	gain	NOUN
bam-12761	219	20	:	:	PUNCT
bam-12761	219	21	strategies	strategy	NOUN
bam-12761	219	22	and	and	CCONJ
bam-12761	219	23	mechanisms	mechanism	NOUN
bam-12761	219	24	.	.	PUNCT
bam-12761	220	1	acta	acta	PROPN
bam-12761	220	2	physiol	physiol	PROPN
bam-12761	220	3	hung	hang	VERB
bam-12761	220	4	2015;102:1	2015;102:1	NUM
bam-12761	220	5	-	-	SYM
bam-12761	220	6	22	22	NUM
bam-12761	220	7	.	.	PUNCT
bam-12761	221	1	27	27	NUM
bam-12761	221	2	.	.	PUNCT
bam-12761	222	1	lee	lee	PROPN
bam-12761	222	2	eh	eh	INTJ
bam-12761	222	3	,	,	PUNCT
bam-12761	222	4	park	park	PROPN
bam-12761	222	5	je	je	PROPN
bam-12761	222	6	,	,	PUNCT
bam-12761	222	7	choi	choi	PROPN
bam-12761	222	8	yj	yj	PROPN
bam-12761	222	9	,	,	PUNCT
bam-12761	222	10	huh	huh	INTJ
bam-12761	222	11	kb	kb	PROPN
bam-12761	222	12	,	,	PUNCT
bam-12761	222	13	kim	kim	PROPN
bam-12761	222	14	wy	wy	PROPN
bam-12761	222	15	.	.	PROPN
bam-12761	223	1	a	a	DET
bam-12761	223	2	randomized	randomized	ADJ
bam-12761	223	3	study	study	NOUN
bam-12761	223	4	to	to	PART
bam-12761	223	5	establish	establish	VERB
bam-12761	223	6	the	the	DET
bam-12761	223	7	effects	effect	NOUN
bam-12761	223	8	of	of	ADP
bam-12761	223	9	spirulina	spirulina	NOUN
bam-12761	223	10	in	in	ADP
bam-12761	223	11	type	type	NOUN
bam-12761	223	12	2	2	NUM
bam-12761	223	13	diabetes	diabetes	NOUN
bam-12761	223	14	mellitus	mellitus	NOUN
bam-12761	223	15	patients	patient	NOUN
bam-12761	223	16	.	.	PUNCT
bam-12761	224	1	nutr	nutr	PROPN
bam-12761	224	2	res	res	PROPN
bam-12761	224	3	pract	pract	PROPN
bam-12761	224	4	2008;2:295	2008;2:295	NUM
bam-12761	224	5	-	-	SYM
bam-12761	224	6	300	300	NUM
bam-12761	224	7	.	.	PUNCT
bam-12761	224	8	28	28	NUM
bam-12761	224	9	.	.	PUNCT
bam-12761	225	1	ghadery	ghadery	PROPN
bam-12761	225	2	b	b	PROPN
bam-12761	225	3	,	,	PUNCT
bam-12761	225	4	ghazalian	ghazalian	ADJ
bam-12761	225	5	f	f	PROPN
bam-12761	225	6	,	,	PUNCT
bam-12761	225	7	hosseini	hosseini	PROPN
bam-12761	225	8	sa	sa	PROPN
bam-12761	225	9	,	,	PUNCT
bam-12761	225	10	et	et	PROPN
bam-12761	225	11	al	al	PROPN
bam-12761	225	12	.	.	PROPN
bam-12761	225	13	effect	effect	NOUN
bam-12761	225	14	of	of	ADP
bam-12761	225	15	high	high	ADJ
bam-12761	225	16	-	-	PUNCT
bam-12761	225	17	intensity	intensity	NOUN
bam-12761	225	18	interval	interval	NOUN
bam-12761	225	19	training	training	NOUN
bam-12761	225	20	with	with	ADP
bam-12761	225	21	eryngium	eryngium	NOUN
bam-12761	225	22	campestre	campestre	NOUN
bam-12761	225	23	on	on	ADP
bam-12761	225	24	lipid	lipid	NOUN
bam-12761	225	25	profile	profile	NOUN
bam-12761	225	26	and	and	CCONJ
bam-12761	225	27	glycemic	glycemic	ADJ
bam-12761	225	28	indices	index	NOUN
bam-12761	225	29	in	in	ADP
bam-12761	225	30	high	high	ADJ
bam-12761	225	31	-	-	PUNCT
bam-12761	225	32	fat	fat	NOUN
bam-12761	225	33	diet	diet	NOUN
bam-12761	225	34	-	-	PUNCT
bam-12761	225	35	induced	induce	VERB
bam-12761	225	36	obese	obese	ADJ
bam-12761	225	37	rats	rat	NOUN
bam-12761	225	38	.	.	PUNCT
bam-12761	226	1	hormozgan	hormozgan	PROPN
bam-12761	226	2	med	med	PROPN
bam-12761	226	3	j	j	PROPN
bam-12761	226	4	2020;24	2020;24	NUM
bam-12761	226	5	:	:	PUNCT
bam-12761	226	6	e98982	e98982	PROPN
bam-12761	226	7	.	.	PROPN
bam-12761	226	8	29	29	NUM
bam-12761	226	9	.	.	PUNCT
bam-12761	227	1	goodwin	goodwin	PROPN
bam-12761	227	2	ml	ml	PROPN
bam-12761	227	3	.	.	PUNCT
bam-12761	228	1	blood	blood	NOUN
bam-12761	228	2	glucose	glucose	NOUN
bam-12761	228	3	regulation	regulation	NOUN
bam-12761	228	4	during	during	ADP
bam-12761	228	5	prolonged	prolonged	ADJ
bam-12761	228	6	,	,	PUNCT
bam-12761	228	7	submaximal	submaximal	ADJ
bam-12761	228	8	,	,	PUNCT
bam-12761	228	9	continuous	continuous	ADJ
bam-12761	228	10	exercise	exercise	NOUN
bam-12761	228	11	:	:	PUNCT
bam-12761	228	12	a	a	DET
bam-12761	228	13	guide	guide	NOUN
bam-12761	228	14	for	for	ADP
bam-12761	228	15	clinicians	clinician	NOUN
bam-12761	228	16	.	.	PUNCT
bam-12761	229	1	j	j	PROPN
bam-12761	229	2	diabetes	diabete	VERB
bam-12761	229	3	sci	sci	PROPN
bam-12761	229	4	technol	technol	PROPN
bam-12761	229	5	2010;4:694	2010;4:694	PROPN
bam-12761	229	6	-	-	PUNCT
bam-12761	229	7	705	705	NUM
bam-12761	229	8	.	.	PUNCT
bam-12761	229	9	30	30	NUM
bam-12761	229	10	.	.	PUNCT
bam-12761	230	1	ambrosi	ambrosi	PROPN
bam-12761	230	2	ma	ma	PROPN
bam-12761	230	3	,	,	PUNCT
bam-12761	230	4	reinehr	reinehr	PROPN
bam-12761	230	5	co	co	NOUN
bam-12761	230	6	,	,	PUNCT
bam-12761	230	7	bertolin	bertolin	PROPN
bam-12761	230	8	te	te	PROPN
bam-12761	230	9	,	,	PUNCT
bam-12761	230	10	et	et	PROPN
bam-12761	230	11	al	al	PROPN
bam-12761	230	12	.	.	PROPN
bam-12761	231	1	propriedades	propriedades	PROPN
bam-12761	231	2	de	de	PROPN
bam-12761	231	3	saúde	saúde	PROPN
bam-12761	231	4	de	de	PROPN
bam-12761	231	5	spirulina	spirulina	PROPN
bam-12761	231	6	spp	spp	PROPN
bam-12761	231	7	.	.	PUNCT
bam-12761	232	1	rev	rev	PROPN
bam-12761	232	2	ciênc	ciênc	PROPN
bam-12761	232	3	farm	farm	PROPN
bam-12761	232	4	básica	básica	PROPN
bam-12761	232	5	apl	apl	PROPN
bam-12761	232	6	2008;29:109	2008;29:109	PROPN
bam-12761	232	7	-	-	PUNCT
bam-12761	232	8	117	117	NUM
bam-12761	232	9	.	.	PUNCT
bam-12761	232	10	31	31	NUM
bam-12761	232	11	.	.	PUNCT
bam-12761	233	1	karkos	karkos	PROPN
bam-12761	233	2	pd	pd	PROPN
bam-12761	233	3	,	,	PUNCT
bam-12761	233	4	leong	leong	PROPN
bam-12761	233	5	sc	sc	PROPN
bam-12761	233	6	,	,	PUNCT
bam-12761	233	7	karkos	karkos	PROPN
bam-12761	233	8	cd	cd	PROPN
bam-12761	233	9	,	,	PUNCT
bam-12761	233	10	et	et	PROPN
bam-12761	233	11	al	al	PROPN
bam-12761	233	12	.	.	PROPN
bam-12761	233	13	spirulina	spirulina	PROPN
bam-12761	234	1	in	in	ADP
bam-12761	234	2	clinical	clinical	ADJ
bam-12761	234	3	practice	practice	NOUN
bam-12761	234	4	:	:	PUNCT
bam-12761	234	5	evidence	evidence	NOUN
bam-12761	234	6	-	-	PUNCT
bam-12761	234	7	based	base	VERB
bam-12761	234	8	human	human	ADJ
bam-12761	234	9	applications	application	NOUN
bam-12761	234	10	.	.	PUNCT
bam-12761	235	1	evid	evid	PROPN
bam-12761	235	2	based	base	VERB
bam-12761	235	3	complement	complement	PROPN
bam-12761	235	4	alternat	alternat	NOUN
bam-12761	235	5	med	me	VERB
bam-12761	235	6	2011;2011	2011;2011	NUM
bam-12761	235	7	:	:	PUNCT
bam-12761	235	8	531053	531053	NUM
bam-12761	235	9	.	.	PUNCT
bam-12761	236	1	32	32	NUM
bam-12761	236	2	.	.	PUNCT
bam-12761	237	1	azhir	azhir	PROPN
bam-12761	237	2	s	s	PROPN
bam-12761	237	3	,	,	PUNCT
bam-12761	237	4	alijani	alijani	PROPN
bam-12761	237	5	e	e	PROPN
bam-12761	237	6	,	,	PUNCT
bam-12761	237	7	martínez	martínez	NOUN
bam-12761	237	8	-	-	PUNCT
bam-12761	237	9	huenchullán	huenchullán	NOUN
bam-12761	237	10	sf	sf	PROPN
bam-12761	237	11	,	,	PUNCT
bam-12761	237	12	et	et	PROPN
bam-12761	237	13	al	al	PROPN
bam-12761	237	14	.	.	PUNCT
bam-12761	237	15	effects	effect	NOUN
bam-12761	237	16	of	of	ADP
bam-12761	237	17	exercise	exercise	NOUN
bam-12761	237	18	intensity	intensity	NOUN
bam-12761	237	19	on	on	ADP
bam-12761	237	20	soleus	soleus	ADJ
bam-12761	237	21	muscle	muscle	NOUN
bam-12761	237	22	myostatin	myostatin	NOUN
bam-12761	237	23	and	and	CCONJ
bam-12761	237	24	follistatin	follistatin	NOUN
bam-12761	237	25	levels	level	NOUN
bam-12761	237	26	ofhyperglycaemic	ofhyperglycaemic	ADJ
bam-12761	237	27	rats	rat	NOUN
bam-12761	237	28	.	.	PUNCT
bam-12761	238	1	retos	reto	NOUN
bam-12761	238	2	:	:	PUNCT
bam-12761	238	3	nuevas	nuevas	PROPN
bam-12761	238	4	tendencias	tendencias	PROPN
bam-12761	238	5	en	en	PROPN
bam-12761	238	6	educación	educación	PROPN
bam-12761	238	7	física	física	PROPN
bam-12761	238	8	,	,	PUNCT
bam-12761	238	9	deporte	deporte	PROPN
bam-12761	238	10	y	y	PROPN
bam-12761	238	11	recreación	recreación	NOUN
bam-12761	238	12	.	.	PROPN
bam-12761	238	13	2022	2022	NUM
bam-12761	238	14	;	;	PUNCT
bam-12761	238	15	889–896	889–896	NUM
bam-12761	238	16	.	.	PUNCT
bam-12761	239	1	33	33	NUM
bam-12761	239	2	.	.	PUNCT
bam-12761	240	1	mathers	mathers	PROPN
bam-12761	240	2	jl	jl	PROPN
bam-12761	240	3	,	,	PUNCT
bam-12761	240	4	farnfield	farnfield	NOUN
bam-12761	240	5	mm	mm	PROPN
bam-12761	240	6	,	,	PUNCT
bam-12761	240	7	garnham	garnham	PROPN
bam-12761	240	8	ap	ap	PROPN
bam-12761	240	9	,	,	PUNCT
bam-12761	240	10	et	et	PROPN
bam-12761	240	11	al	al	PROPN
bam-12761	240	12	early	early	ADV
bam-12761	240	13	inflammatory	inflammatory	ADJ
bam-12761	240	14	and	and	CCONJ
bam-12761	240	15	myogenic	myogenic	ADJ
bam-12761	240	16	responses	response	NOUN
bam-12761	240	17	to	to	ADP
bam-12761	240	18	resistance	resistance	NOUN
bam-12761	240	19	exercise	exercise	NOUN
bam-12761	240	20	in	in	ADP
bam-12761	240	21	the	the	DET
bam-12761	240	22	elderly	elderly	ADJ
bam-12761	240	23	.	.	PUNCT
bam-12761	241	1	muscle	muscle	NOUN
bam-12761	241	2	nerve	nerve	NOUN
bam-12761	241	3	2012;46:407	2012;46:407	PROPN
bam-12761	241	4	-	-	SYM
bam-12761	241	5	12	12	NUM
bam-12761	241	6	.	.	PUNCT
bam-12761	242	1	34	34	NUM
bam-12761	242	2	.	.	PUNCT
bam-12761	243	1	drummond	drummond	PROPN
bam-12761	243	2	mj	mj	PROPN
bam-12761	243	3	,	,	PUNCT
bam-12761	243	4	bell	bell	PROPN
bam-12761	243	5	ja	ja	PROPN
bam-12761	243	6	,	,	PUNCT
bam-12761	243	7	fujita	fujita	PROPN
bam-12761	243	8	s	s	PROPN
bam-12761	243	9	,	,	PUNCT
bam-12761	243	10	et	et	PROPN
bam-12761	243	11	al	al	PROPN
bam-12761	243	12	.	.	PROPN
bam-12761	244	1	amino	amino	ADJ
bam-12761	244	2	acids	acid	NOUN
bam-12761	244	3	are	be	AUX
bam-12761	244	4	necessary	necessary	ADJ
bam-12761	244	5	for	for	ADP
bam-12761	244	6	the	the	DET
bam-12761	244	7	insulin	insulin	NOUN
bam-12761	244	8	-	-	PUNCT
bam-12761	244	9	induced	induce	VERB
bam-12761	244	10	activation	activation	NOUN
bam-12761	244	11	of	of	ADP
bam-12761	244	12	mtor	mtor	NOUN
bam-12761	244	13	/	/	SYM
bam-12761	244	14	s6k1	s6k1	NOUN
bam-12761	244	15	signaling	signal	VERB
bam-12761	244	16	and	and	CCONJ
bam-12761	244	17	protein	protein	NOUN
bam-12761	244	18	synthesis	synthesis	NOUN
bam-12761	244	19	in	in	ADP
bam-12761	244	20	healthy	healthy	ADJ
bam-12761	244	21	and	and	CCONJ
bam-12761	244	22	insulin	insulin	NOUN
bam-12761	244	23	resistant	resistant	ADJ
bam-12761	244	24	human	human	ADJ
bam-12761	244	25	skeletal	skeletal	ADJ
bam-12761	244	26	muscle	muscle	NOUN
bam-12761	244	27	.	.	PUNCT
bam-12761	245	1	clin	clin	PROPN
bam-12761	245	2	nutr	nutr	PROPN
bam-12761	245	3	2008;27:447	2008;27:447	PROPN
bam-12761	245	4	-	-	SYM
bam-12761	245	5	56	56	NUM
bam-12761	245	6	.	.	NOUN
bam-12761	245	7	35	35	NUM
bam-12761	245	8	.	.	PUNCT
bam-12761	245	9	hyatt	hyatt	PROPN
bam-12761	245	10	jp	jp	PROPN
bam-12761	245	11	,	,	PUNCT
bam-12761	245	12	mccall	mccall	PROPN
bam-12761	245	13	ge	ge	PROPN
bam-12761	245	14	,	,	PUNCT
bam-12761	245	15	kander	kander	PROPN
bam-12761	245	16	em	em	PRON
bam-12761	245	17	,	,	PUNCT
bam-12761	245	18	et	et	PROPN
bam-12761	245	19	al	al	PROPN
bam-12761	245	20	.	.	PUNCT
bam-12761	246	1	pax3/7	pax3/7	ADJ
bam-12761	246	2	expression	expression	NOUN
bam-12761	246	3	coincides	coincide	VERB
bam-12761	246	4	with	with	ADP
bam-12761	246	5	myod	myod	NOUN
bam-12761	246	6	during	during	ADP
bam-12761	246	7	chronic	chronic	ADJ
bam-12761	246	8	skeletal	skeletal	ADJ
bam-12761	246	9	muscle	muscle	NOUN
bam-12761	246	10	overload	overload	NOUN
bam-12761	246	11	.	.	PUNCT
bam-12761	247	1	muscle	muscle	NOUN
bam-12761	247	2	nerve	nerve	NOUN
bam-12761	247	3	2008;38:861	2008;38:861	PROPN
bam-12761	247	4	-	-	PUNCT
bam-12761	247	5	6	6	NUM
bam-12761	247	6	.	.	NUM
bam-12761	247	7	36	36	NUM
bam-12761	247	8	.	.	PUNCT
bam-12761	248	1	raue	raue	PROPN
bam-12761	248	2	u	u	PROPN
bam-12761	248	3	,	,	PUNCT
bam-12761	248	4	slivka	slivka	NOUN
bam-12761	248	5	d	d	PROPN
bam-12761	248	6	,	,	PUNCT
bam-12761	248	7	jemiolo	jemiolo	PROPN
bam-12761	248	8	b	b	PROPN
bam-12761	248	9	,	,	PUNCT
bam-12761	248	10	et	et	PROPN
bam-12761	248	11	al	al	PROPN
bam-12761	248	12	.	.	PROPN
bam-12761	248	13	myogenic	myogenic	ADJ
bam-12761	248	14	gene	gene	NOUN
bam-12761	248	15	expression	expression	NOUN
bam-12761	248	16	at	at	ADP
bam-12761	248	17	rest	rest	NOUN
bam-12761	248	18	and	and	CCONJ
bam-12761	248	19	after	after	ADP
bam-12761	248	20	a	a	DET
bam-12761	248	21	bout	bout	NOUN
bam-12761	248	22	of	of	ADP
bam-12761	248	23	resistance	resistance	NOUN
bam-12761	248	24	exercise	exercise	NOUN
bam-12761	248	25	in	in	ADP
bam-12761	248	26	young	young	ADJ
bam-12761	248	27	(	(	PUNCT
bam-12761	248	28	18	18	NUM
bam-12761	248	29	-	-	SYM
bam-12761	248	30	30	30	NUM
bam-12761	248	31	yr	yr	NOUN
bam-12761	248	32	)	)	PUNCT
bam-12761	248	33	and	and	CCONJ
bam-12761	248	34	old	old	ADJ
bam-12761	248	35	(	(	PUNCT
bam-12761	248	36	80	80	NUM
bam-12761	248	37	-	-	SYM
bam-12761	248	38	89	89	NUM
bam-12761	248	39	yr	yr	NOUN
bam-12761	248	40	)	)	PUNCT
bam-12761	248	41	women	woman	NOUN
bam-12761	248	42	.	.	PUNCT
bam-12761	249	1	j	j	PROPN
bam-12761	249	2	appl	appl	PROPN
bam-12761	249	3	physiol	physiol	PROPN
bam-12761	249	4	(	(	PUNCT
bam-12761	249	5	1985	1985	NUM
bam-12761	249	6	)	)	PUNCT
bam-12761	249	7	2006;101:53	2006;101:53	NOUN
bam-12761	249	8	-	-	SYM
bam-12761	249	9	9	9	NUM
bam-12761	249	10	.	.	NOUN
bam-12761	249	11	37	37	NUM
bam-12761	249	12	.	.	PUNCT
bam-12761	250	1	biglari	biglari	PROPN
bam-12761	250	2	s	s	PROPN
bam-12761	250	3	,	,	PUNCT
bam-12761	250	4	gaeini	gaeini	PROPN
bam-12761	250	5	aa	aa	PROPN
bam-12761	250	6	,	,	PUNCT
bam-12761	250	7	kordi	kordi	PROPN
bam-12761	250	8	mr	mr	PROPN
bam-12761	250	9	,	,	PUNCT
bam-12761	250	10	ghardashi	ghardashi	PROPN
bam-12761	250	11	-	-	PUNCT
bam-12761	250	12	afousi	afousi	PROPN
bam-12761	250	13	a.	a.	NOUN
bam-12761	250	14	the	the	DET
bam-12761	250	15	effect	effect	NOUN
bam-12761	250	16	of	of	ADP
bam-12761	250	17	8	8	NUM
bam-12761	250	18	weeks	week	NOUN
bam-12761	250	19	high	high	ADJ
bam-12761	250	20	-	-	PUNCT
bam-12761	250	21	intensity	intensity	NOUN
bam-12761	250	22	interval	interval	NOUN
bam-12761	250	23	training	training	NOUN
bam-12761	250	24	on	on	ADP
bam-12761	250	25	myostatin	myostatin	NOUN
bam-12761	250	26	and	and	CCONJ
bam-12761	250	27	follistatin	follistatin	NOUN
bam-12761	250	28	gene	gene	NOUN
bam-12761	250	29	expression	expression	NOUN
bam-12761	250	30	in	in	ADP
bam-12761	250	31	gastrocnemius	gastrocnemius	ADJ
bam-12761	250	32	muscle	muscle	NOUN
bam-12761	250	33	of	of	ADP
bam-12761	250	34	the	the	DET
bam-12761	250	35	rats	rat	NOUN
bam-12761	250	36	.	.	PUNCT
bam-12761	251	1	j	j	PROPN
bam-12761	251	2	arak	arak	PROPN
bam-12761	251	3	uni	uni	PROPN
bam-12761	251	4	med	med	PROPN
bam-12761	251	5	sci	sci	PROPN
bam-12761	251	6	2018;21:1	2018;21:1	NUM
bam-12761	251	7	-	-	SYM
bam-12761	251	8	10	10	NUM
bam-12761	251	9	.	.	PUNCT
bam-12761	252	1	38	38	NUM
bam-12761	252	2	.	.	PUNCT
bam-12761	253	1	zhao	zhao	PROPN
bam-12761	253	2	y	y	PROPN
bam-12761	253	3	,	,	PUNCT
bam-12761	253	4	chen	chen	PROPN
bam-12761	253	5	m	m	PROPN
bam-12761	253	6	,	,	PUNCT
bam-12761	253	7	lian	lian	PROPN
bam-12761	253	8	d	d	NOUN
bam-12761	253	9	,	,	PUNCT
bam-12761	253	10	et	et	PROPN
bam-12761	253	11	al	al	PROPN
bam-12761	253	12	.	.	PUNCT
bam-12761	254	1	non	non	ADJ
bam-12761	254	2	-	-	ADJ
bam-12761	254	3	coding	code	VERB
bam-12761	254	4	rna	rna	NOUN
bam-12761	254	5	regulates	regulate	VERB
bam-12761	254	6	the	the	DET
bam-12761	254	7	myogenesis	myogenesis	NOUN
bam-12761	254	8	of	of	ADP
bam-12761	254	9	skeletal	skeletal	ADJ
bam-12761	254	10	muscle	muscle	NOUN
bam-12761	254	11	satellite	satellite	NOUN
bam-12761	254	12	cells	cell	NOUN
bam-12761	254	13	,	,	PUNCT
bam-12761	254	14	injury	injury	NOUN
bam-12761	254	15	repair	repair	NOUN
bam-12761	254	16	and	and	CCONJ
bam-12761	254	17	diseases	disease	NOUN
bam-12761	254	18	.	.	PUNCT
bam-12761	255	1	cells	cell	NOUN
bam-12761	255	2	2019;8:988	2019;8:988	NUM
bam-12761	255	3	.	.	PROPN
bam-12761	255	4	39	39	NUM
bam-12761	255	5	.	.	PUNCT
bam-12761	256	1	gundersen	gundersen	PROPN
bam-12761	256	2	k.	k.	PROPN
bam-12761	256	3	excitation	excitation	NOUN
bam-12761	256	4	-	-	PUNCT
bam-12761	256	5	transcription	transcription	NOUN
bam-12761	256	6	coupling	coupling	NOUN
bam-12761	256	7	in	in	ADP
bam-12761	256	8	skeletal	skeletal	ADJ
bam-12761	256	9	muscle	muscle	NOUN
bam-12761	256	10	:	:	PUNCT
bam-12761	256	11	the	the	DET
bam-12761	256	12	molecular	molecular	ADJ
bam-12761	256	13	pathways	pathway	NOUN
bam-12761	256	14	of	of	ADP
bam-12761	256	15	exercise	exercise	NOUN
bam-12761	256	16	.	.	PUNCT
bam-12761	257	1	biol	biol	PROPN
bam-12761	257	2	rev	rev	PROPN
bam-12761	257	3	camb	camb	PROPN
bam-12761	257	4	philos	philos	PROPN
bam-12761	257	5	soc	soc	PROPN
bam-12761	257	6	2011;86:564	2011;86:564	NUM
bam-12761	257	7	-	-	SYM
bam-12761	257	8	600	600	NUM
bam-12761	257	9	.	.	PUNCT
bam-12761	258	1	40	40	NUM
bam-12761	258	2	.	.	PUNCT
bam-12761	259	1	krook	krook	PROPN
bam-12761	259	2	a	a	PROPN
bam-12761	259	3	,	,	PUNCT
bam-12761	259	4	roth	roth	PROPN
bam-12761	259	5	ra	ra	PROPN
bam-12761	259	6	,	,	PUNCT
bam-12761	259	7	jiang	jiang	PROPN
bam-12761	259	8	xj	xj	PROPN
bam-12761	259	9	,	,	PUNCT
bam-12761	259	10	et	et	PROPN
bam-12761	259	11	al	al	PROPN
bam-12761	259	12	.	.	PUNCT
bam-12761	260	1	insulin	insulin	NOUN
bam-12761	260	2	-	-	PUNCT
bam-12761	260	3	stimulated	stimulate	VERB
bam-12761	260	4	akt	akt	PROPN
bam-12761	260	5	kinase	kinase	PROPN
bam-12761	260	6	activity	activity	NOUN
bam-12761	260	7	is	be	AUX
bam-12761	260	8	reduced	reduce	VERB
bam-12761	260	9	in	in	ADP
bam-12761	260	10	skeletal	skeletal	ADJ
bam-12761	260	11	muscle	muscle	NOUN
bam-12761	260	12	from	from	ADP
bam-12761	260	13	niddm	niddm	PROPN
bam-12761	260	14	subjects	subject	NOUN
bam-12761	260	15	.	.	PUNCT
bam-12761	261	1	diabetes	diabetes	NOUN
bam-12761	261	2	1998;47:1281	1998;47:1281	NUM
bam-12761	261	3	-	-	SYM
bam-12761	261	4	6	6	NUM
bam-12761	261	5	.	.	NOUN
bam-12761	261	6	41	41	NUM
bam-12761	261	7	.	.	PUNCT
bam-12761	262	1	callahan	callahan	PROPN
bam-12761	262	2	mj	mj	PROPN
bam-12761	262	3	,	,	PUNCT
bam-12761	262	4	parr	parr	PROPN
bam-12761	262	5	eb	eb	PROPN
bam-12761	262	6	,	,	PUNCT
bam-12761	262	7	hawley	hawley	PROPN
bam-12761	262	8	ja	ja	PROPN
bam-12761	262	9	,	,	PUNCT
bam-12761	262	10	camera	camera	NOUN
bam-12761	262	11	dm	dm	PROPN
bam-12761	262	12	.	.	PUNCT
bam-12761	263	1	can	can	AUX
bam-12761	263	2	high	high	ADJ
bam-12761	263	3	-	-	PUNCT
bam-12761	263	4	intensity	intensity	NOUN
bam-12761	263	5	interval	interval	NOUN
bam-12761	263	6	training	training	NOUN
bam-12761	263	7	promote	promote	VERB
bam-12761	263	8	skeletal	skeletal	ADJ
bam-12761	263	9	muscle	muscle	NOUN
bam-12761	263	10	anabolism	anabolism	NOUN
bam-12761	263	11	?	?	PUNCT
bam-12761	264	1	sports	sport	NOUN
bam-12761	264	2	med	me	VERB
bam-12761	264	3	2021;51:405	2021;51:405	PROPN
bam-12761	264	4	-	-	PUNCT
bam-12761	264	5	21	21	NUM
bam-12761	264	6	.	.	PUNCT
bam-12761	265	1	42	42	NUM
bam-12761	265	2	.	.	PUNCT
bam-12761	265	3	mao	mao	PROPN
bam-12761	266	1	z	z	PROPN
bam-12761	266	2	,	,	PUNCT
bam-12761	266	3	zhang	zhang	PROPN
bam-12761	266	4	w.	w.	PROPN
bam-12761	266	5	role	role	NOUN
bam-12761	266	6	of	of	ADP
bam-12761	266	7	mtor	mtor	NOUN
bam-12761	266	8	in	in	ADP
bam-12761	266	9	glucose	glucose	NOUN
bam-12761	266	10	and	and	CCONJ
bam-12761	266	11	lipid	lipid	NOUN
bam-12761	266	12	metabolism	metabolism	NOUN
bam-12761	266	13	.	.	PUNCT
bam-12761	267	1	int	int	PROPN
bam-12761	267	2	j	j	PROPN
bam-12761	267	3	mol	mol	ADP
bam-12761	267	4	sci	sci	PROPN
bam-12761	267	5	2018;19:2043	2018;19:2043	NUM
bam-12761	267	6	.	.	PUNCT
bam-12761	268	1	43	43	NUM
bam-12761	268	2	.	.	PUNCT
bam-12761	269	1	morgan	morgan	PROPN
bam-12761	269	2	a	a	PROPN
bam-12761	269	3	,	,	PUNCT
bam-12761	269	4	noguchi	noguchi	PROPN
bam-12761	269	5	ks	ks	PROPN
bam-12761	269	6	,	,	PUNCT
bam-12761	269	7	tang	tang	PROPN
bam-12761	269	8	a	a	PROPN
bam-12761	269	9	,	,	PUNCT
bam-12761	269	10	et	et	PROPN
bam-12761	269	11	al	al	PROPN
bam-12761	269	12	.	.	PROPN
bam-12761	270	1	physical	physical	ADJ
bam-12761	270	2	and	and	CCONJ
bam-12761	270	3	cognitive	cognitive	ADJ
bam-12761	270	4	effects	effect	NOUN
bam-12761	270	5	of	of	ADP
bam-12761	270	6	high	high	ADJ
bam-12761	270	7	-	-	PUNCT
bam-12761	270	8	intensity	intensity	NOUN
bam-12761	270	9	interval	interval	NOUN
bam-12761	270	10	or	or	CCONJ
bam-12761	270	11	circuitbased	circuitbase	VERB
bam-12761	270	12	strength	strength	NOUN
bam-12761	270	13	training	training	NOUN
bam-12761	270	14	for	for	ADP
bam-12761	270	15	community	community	NOUN
bam-12761	270	16	-	-	PUNCT
bam-12761	270	17	dwelling	dwell	VERB
bam-12761	270	18	older	old	ADJ
bam-12761	270	19	adults	adult	NOUN
bam-12761	270	20	:	:	PUNCT
bam-12761	270	21	a	a	DET
bam-12761	270	22	systematic	systematic	ADJ
bam-12761	270	23	review	review	NOUN
bam-12761	270	24	.	.	PUNCT
bam-12761	271	1	j	j	NOUN
bam-12761	271	2	aging	age	VERB
bam-12761	271	3	phys	phy	NOUN
bam-12761	271	4	act	act	VERB
bam-12761	271	5	2023;31	2023;31	NUM
bam-12761	271	6	:	:	PUNCT
bam-12761	271	7	1051	1051	NUM
bam-12761	271	8	-	-	SYM
bam-12761	271	9	74	74	NUM
bam-12761	271	10	.	.	PUNCT
bam-12761	272	1	44	44	NUM
bam-12761	272	2	.	.	PUNCT
bam-12761	273	1	coswig	coswig	PROPN
bam-12761	273	2	vs	vs	ADP
bam-12761	273	3	,	,	PUNCT
bam-12761	273	4	barbalho	barbalho	PROPN
bam-12761	273	5	m	m	PROPN
bam-12761	273	6	,	,	PUNCT
bam-12761	273	7	raiol	raiol	PROPN
bam-12761	273	8	r	r	NOUN
bam-12761	273	9	,	,	PUNCT
bam-12761	273	10	et	et	PROPN
bam-12761	273	11	al	al	PROPN
bam-12761	273	12	.	.	PUNCT
bam-12761	273	13	effects	effect	NOUN
bam-12761	273	14	of	of	ADP
bam-12761	273	15	high	high	ADJ
bam-12761	273	16	vs	vs	ADP
bam-12761	273	17	moderate	moderate	ADJ
bam-12761	273	18	-	-	PUNCT
bam-12761	273	19	intensity	intensity	NOUN
bam-12761	273	20	intermittent	intermittent	ADJ
bam-12761	273	21	training	training	NOUN
bam-12761	273	22	on	on	ADP
bam-12761	273	23	functionality	functionality	NOUN
bam-12761	273	24	,	,	PUNCT
bam-12761	273	25	resting	rest	VERB
bam-12761	273	26	heart	heart	NOUN
bam-12761	273	27	rate	rate	NOUN
bam-12761	273	28	and	and	CCONJ
bam-12761	273	29	blood	blood	NOUN
bam-12761	273	30	pressure	pressure	NOUN
bam-12761	273	31	of	of	ADP
bam-12761	273	32	elderly	elderly	ADJ
bam-12761	273	33	women	woman	NOUN
bam-12761	273	34	.	.	PUNCT
bam-12761	274	1	j	j	PROPN
bam-12761	274	2	transl	transl	PROPN
bam-12761	274	3	med	me	VERB
bam-12761	274	4	2020;18:88	2020;18:88	NUM
bam-12761	274	5	.	.	PUNCT
bam-12761	275	1	45	45	NUM
bam-12761	275	2	.	.	PUNCT
bam-12761	275	3	gentil	gentil	PROPN
bam-12761	275	4	p	p	PROPN
bam-12761	275	5	,	,	PUNCT
bam-12761	275	6	silva	silva	PROPN
bam-12761	275	7	lrbe	lrbe	PROPN
bam-12761	275	8	,	,	PUNCT
bam-12761	275	9	antunes	antunes	PROPN
bam-12761	275	10	de	de	PROPN
bam-12761	275	11	,	,	PUNCT
bam-12761	275	12	et	et	PROPN
bam-12761	275	13	al	al	PROPN
bam-12761	275	14	.	.	PUNCT
bam-12761	276	1	the	the	DET
bam-12761	276	2	effects	effect	NOUN
bam-12761	276	3	of	of	ADP
bam-12761	276	4	three	three	NUM
bam-12761	276	5	different	different	ADJ
bam-12761	276	6	low	low	ADJ
bam-12761	276	7	-	-	PUNCT
bam-12761	276	8	volume	volume	NOUN
bam-12761	276	9	aerobic	aerobic	ADJ
bam-12761	276	10	training	training	NOUN
bam-12761	276	11	protocols	protocol	NOUN
bam-12761	276	12	on	on	ADP
bam-12761	276	13	cardiometabolic	cardiometabolic	ADJ
bam-12761	276	14	parameters	parameter	NOUN
bam-12761	276	15	of	of	ADP
bam-12761	276	16	type	type	NOUN
bam-12761	276	17	2	2	NUM
bam-12761	276	18	diabetes	diabetes	NOUN
bam-12761	276	19	patients	patient	NOUN
bam-12761	276	20	:	:	PUNCT
bam-12761	276	21	a	a	DET
bam-12761	276	22	randomized	randomized	ADJ
bam-12761	276	23	clinical	clinical	ADJ
bam-12761	276	24	trial	trial	NOUN
bam-12761	276	25	.	.	PUNCT
bam-12761	277	1	front	front	ADJ
bam-12761	277	2	endocrinol	endocrinol	NOUN
bam-12761	277	3	(	(	PUNCT
bam-12761	277	4	lausanne	lausanne	PROPN
bam-12761	277	5	)	)	PUNCT
bam-12761	277	6	2023;14:985404	2023;14:985404	PROPN
bam-12761	277	7	.	.	PROPN
bam-12761	277	8	46	46	NUM
bam-12761	277	9	.	.	PUNCT
bam-12761	277	10	portela	portela	PROPN
bam-12761	277	11	pfm	pfm	PROPN
bam-12761	277	12	,	,	PUNCT
bam-12761	277	13	neto	neto	NOUN
bam-12761	277	14	vgc	vgc	PROPN
bam-12761	277	15	,	,	PUNCT
bam-12761	277	16	monteiro	monteiro	PROPN
bam-12761	277	17	er	er	INTJ
bam-12761	277	18	,	,	PUNCT
bam-12761	277	19	et	et	PROPN
bam-12761	277	20	al	al	PROPN
bam-12761	277	21	.	.	PUNCT
bam-12761	278	1	hiit	hiit	PROPN
bam-12761	278	2	is	be	AUX
bam-12761	278	3	most	most	ADV
bam-12761	278	4	effective	effective	ADJ
bam-12761	278	5	than	than	ADP
bam-12761	278	6	mict	mict	ADJ
bam-12761	278	7	on	on	ADP
bam-12761	278	8	glycemic	glycemic	ADJ
bam-12761	278	9	control	control	NOUN
bam-12761	278	10	of	of	ADP
bam-12761	278	11	older	old	ADJ
bam-12761	278	12	people	people	NOUN
bam-12761	278	13	with	with	ADP
bam-12761	278	14	glucose	glucose	NOUN
bam-12761	278	15	metabolism	metabolism	NOUN
bam-12761	278	16	impairments	impairment	NOUN
bam-12761	278	17	:	:	PUNCT
bam-12761	278	18	a	a	DET
bam-12761	278	19	systematic	systematic	ADJ
bam-12761	278	20	review	review	NOUN
bam-12761	278	21	and	and	CCONJ
bam-12761	278	22	metanalysis	metanalysis	NOUN
bam-12761	278	23	.	.	PUNCT
bam-12761	279	1	prim	prim	ADJ
bam-12761	279	2	care	care	NOUN
bam-12761	279	3	diabetes	diabetes	NOUN
bam-12761	279	4	2023;17:129	2023;17:129	NUM
bam-12761	279	5	-	-	SYM
bam-12761	279	6	36	36	NUM
bam-12761	279	7	.	.	PUNCT
bam-12761	280	1	47	47	NUM
bam-12761	280	2	.	.	PUNCT
bam-12761	281	1	lynch	lynch	PROPN
bam-12761	281	2	gs	gs	PROPN
bam-12761	281	3	,	,	PUNCT
bam-12761	281	4	cuffe	cuffe	VERB
bam-12761	281	5	sa	sa	PROPN
bam-12761	281	6	,	,	PUNCT
bam-12761	281	7	plant	plant	PROPN
bam-12761	281	8	dr	dr	PROPN
bam-12761	281	9	,	,	PUNCT
bam-12761	281	10	gregorevic	gregorevic	PROPN
bam-12761	281	11	p.	p.	PROPN
bam-12761	281	12	igf	igf	PROPN
bam-12761	281	13	-	-	PROPN
bam-12761	281	14	i	i	PRON
bam-12761	281	15	treatment	treatment	NOUN
bam-12761	281	16	improves	improve	VERB
bam-12761	281	17	the	the	DET
bam-12761	281	18	functional	functional	ADJ
bam-12761	281	19	properties	property	NOUN
bam-12761	281	20	of	of	ADP
bam-12761	281	21	fast	fast	ADJ
bam-12761	281	22	and	and	CCONJ
bam-12761	281	23	slow	slow	ADJ
bam-12761	281	24	-	-	PUNCT
bam-12761	281	25	twitch	twitch	VERB
bam-12761	281	26	skeletal	skeletal	ADJ
bam-12761	281	27	muscles	muscle	NOUN
bam-12761	281	28	from	from	ADP
bam-12761	281	29	dystrophic	dystrophic	ADJ
bam-12761	281	30	mice	mouse	NOUN
bam-12761	281	31	.	.	PUNCT
bam-12761	282	1	neuromuscul	neuromuscul	PROPN
bam-12761	282	2	disord	disord	PROPN
bam-12761	282	3	2001;11:260	2001;11:260	NOUN
bam-12761	282	4	-	-	SYM
bam-12761	282	5	8	8	NUM
bam-12761	282	6	.	.	PUNCT
bam-12761	283	1	48	48	NUM
bam-12761	283	2	.	.	PUNCT
bam-12761	284	1	meznaric	meznaric	PROPN
bam-12761	284	2	m	m	PROPN
bam-12761	284	3	,	,	PUNCT
bam-12761	284	4	eržen	eržen	VERB
bam-12761	284	5	i	i	PROPN
bam-12761	284	6	,	,	PUNCT
bam-12761	284	7	karen	karen	PROPN
bam-12761	284	8	p	p	PROPN
bam-12761	284	9	,	,	PUNCT
bam-12761	284	10	cvetko	cvetko	PROPN
bam-12761	284	11	e.	e.	PROPN
bam-12761	284	12	effect	effect	PROPN
bam-12761	284	13	of	of	ADP
bam-12761	284	14	ageing	age	VERB
bam-12761	284	15	on	on	ADP
bam-12761	284	16	the	the	DET
bam-12761	284	17	myosin	myosin	NOUN
bam-12761	284	18	heavy	heavy	PROPN
bam-12761	284	19	chain	chain	NOUN
bam-12761	284	20	composition	composition	NOUN
bam-12761	284	21	of	of	ADP
bam-12761	284	22	the	the	DET
bam-12761	284	23	human	human	PROPN
bam-12761	284	24	sternocleidomastoid	sternocleidomastoid	PROPN
bam-12761	284	25	muscle	muscle	PROPN
bam-12761	284	26	.	.	PUNCT
bam-12761	285	1	ann	ann	PROPN
bam-12761	285	2	anat	anat	PROPN
bam-12761	285	3	2018	2018	NUM
bam-12761	285	4	;	;	PUNCT
bam-12761	285	5	216:95	216:95	NUM
bam-12761	285	6	-	-	SYM
bam-12761	285	7	99	99	NUM
bam-12761	285	8	.	.	PUNCT
bam-12761	286	1	disclaimer	disclaimer	PROPN
bam-12761	286	2	all	all	DET
bam-12761	286	3	claims	claim	NOUN
bam-12761	286	4	expressed	express	VERB
bam-12761	286	5	in	in	ADP
bam-12761	286	6	this	this	DET
bam-12761	286	7	article	article	NOUN
bam-12761	286	8	are	be	AUX
bam-12761	286	9	solely	solely	ADV
bam-12761	286	10	those	those	PRON
bam-12761	286	11	of	of	ADP
bam-12761	286	12	the	the	DET
bam-12761	286	13	authors	author	NOUN
bam-12761	286	14	and	and	CCONJ
bam-12761	286	15	do	do	AUX
bam-12761	286	16	not	not	PART
bam-12761	286	17	necessarily	necessarily	ADV
bam-12761	286	18	represent	represent	VERB
bam-12761	286	19	those	those	PRON
bam-12761	286	20	of	of	ADP
bam-12761	286	21	their	their	PRON
bam-12761	286	22	affiliated	affiliated	ADJ
bam-12761	286	23	organizations	organization	NOUN
bam-12761	286	24	,	,	PUNCT
bam-12761	286	25	or	or	CCONJ
bam-12761	286	26	those	those	PRON
bam-12761	286	27	of	of	ADP
bam-12761	286	28	the	the	DET
bam-12761	286	29	publisher	publisher	NOUN
bam-12761	286	30	,	,	PUNCT
bam-12761	286	31	the	the	DET
bam-12761	286	32	editors	editor	NOUN
bam-12761	286	33	and	and	CCONJ
bam-12761	286	34	the	the	DET
bam-12761	286	35	reviewers	reviewer	NOUN
bam-12761	286	36	.	.	PUNCT
bam-12761	287	1	any	any	DET
bam-12761	287	2	product	product	NOUN
bam-12761	287	3	that	that	PRON
bam-12761	287	4	may	may	AUX
bam-12761	287	5	be	be	AUX
bam-12761	287	6	evaluated	evaluate	VERB
bam-12761	287	7	in	in	ADP
bam-12761	287	8	this	this	DET
bam-12761	287	9	article	article	NOUN
bam-12761	287	10	or	or	CCONJ
bam-12761	287	11	claim	claim	NOUN
bam-12761	287	12	that	that	PRON
bam-12761	287	13	may	may	AUX
bam-12761	287	14	be	be	AUX
bam-12761	287	15	made	make	VERB
bam-12761	287	16	by	by	ADP
bam-12761	287	17	its	its	PRON
bam-12761	287	18	manufacturer	manufacturer	NOUN
bam-12761	287	19	is	be	AUX
bam-12761	287	20	not	not	PART
bam-12761	287	21	guaranteed	guarantee	VERB
bam-12761	287	22	or	or	CCONJ
bam-12761	287	23	endorsed	endorse	VERB
bam-12761	287	24	by	by	ADP
bam-12761	287	25	the	the	DET
bam-12761	287	26	publisher	publisher	NOUN
bam-12761	287	27	.	.	PUNCT
bam-12761	288	1	submitted	submit	VERB
bam-12761	288	2	:	:	PUNCT
bam-12761	288	3	30	30	NUM
bam-12761	288	4	june	june	PROPN
bam-12761	288	5	2024	2024	NUM
bam-12761	288	6	.	.	PUNCT
bam-12761	289	1	accepted	accept	VERB
bam-12761	289	2	:	:	PUNCT
bam-12761	289	3	5	5	NUM
bam-12761	289	4	august	august	PROPN
bam-12761	289	5	2024	2024	NUM
bam-12761	289	6	.	.	PUNCT
bam-12761	290	1	early	early	ADJ
bam-12761	290	2	access	access	NOUN
bam-12761	290	3	:	:	PUNCT
bam-12761	290	4	9	9	NUM
bam-12761	290	5	october	october	NOUN
bam-12761	290	6	2024	2024	NUM
bam-12761	290	7	.	.	PUNCT
bam-12761	291	1	32	32	NUM
bam-12761	291	2	non	non	X
bam-12761	291	3	-co	-co	PROPN
bam-12761	291	4	mmerc	mmerc	PROPN
bam-12761	291	5	ial	ial	PROPN
bam-12761	291	6	us	us	PROPN
bam-12761	291	7	e	e	NOUN
bam-12761	291	8	o	o	NOUN
bam-12761	291	9	nly	nly	ADV