id	sid	tid	token	lemma	pos
bam-14261	1	1	european	european	PROPN
bam-14261	1	2	journal	journal	PROPN
bam-14261	1	3	of	of	ADP
bam-14261	1	4	translational	translational	ADJ
bam-14261	1	5	myology	myology	NOUN
bam-14261	1	6	pissn	pissn	NOUN
bam-14261	1	7	:	:	PUNCT
bam-14261	1	8	2037	2037	NUM
bam-14261	1	9	-	-	SYM
bam-14261	1	10	7452	7452	NUM
bam-14261	1	11	eissn	eissn	NOUN
bam-14261	1	12	:	:	PUNCT
bam-14261	1	13	2037	2037	NUM
bam-14261	1	14	-	-	SYM
bam-14261	1	15	7460	7460	NUM
bam-14261	1	16	https://www.pagepressjournals.org/index.php/bam/index	https://www.pagepressjournals.org/index.php/bam/index	NOUN
bam-14261	1	17	publisher	publisher	NOUN
bam-14261	1	18	's	's	PART
bam-14261	1	19	disclaimer	disclaimer	NOUN
bam-14261	1	20	.	.	PUNCT
bam-14261	2	1	e	e	X
bam-14261	2	2	-	-	NOUN
bam-14261	2	3	publishing	publishing	NOUN
bam-14261	2	4	ahead	ahead	ADV
bam-14261	2	5	of	of	ADP
bam-14261	2	6	print	print	NOUN
bam-14261	2	7	is	be	AUX
bam-14261	2	8	increasingly	increasingly	ADV
bam-14261	2	9	important	important	ADJ
bam-14261	2	10	for	for	ADP
bam-14261	2	11	the	the	DET
bam-14261	2	12	rapid	rapid	ADJ
bam-14261	2	13	dissemination	dissemination	NOUN
bam-14261	2	14	of	of	ADP
bam-14261	2	15	science	science	NOUN
bam-14261	2	16	.	.	PUNCT
bam-14261	3	1	the	the	DET
bam-14261	3	2	early	early	ADJ
bam-14261	3	3	access	access	NOUN
bam-14261	3	4	service	service	NOUN
bam-14261	3	5	lets	let	VERB
bam-14261	3	6	users	user	NOUN
bam-14261	3	7	access	access	VERB
bam-14261	3	8	peer	peer	NOUN
bam-14261	3	9	-	-	PUNCT
bam-14261	3	10	reviewed	review	VERB
bam-14261	3	11	articles	article	NOUN
bam-14261	3	12	well	well	ADV
bam-14261	3	13	before	before	ADP
bam-14261	3	14	print	print	NOUN
bam-14261	3	15	/	/	SYM
bam-14261	3	16	regular	regular	ADJ
bam-14261	3	17	issue	issue	NOUN
bam-14261	3	18	publication	publication	NOUN
bam-14261	3	19	,	,	PUNCT
bam-14261	3	20	significantly	significantly	ADV
bam-14261	3	21	reducing	reduce	VERB
bam-14261	3	22	the	the	DET
bam-14261	3	23	time	time	NOUN
bam-14261	3	24	it	it	PRON
bam-14261	3	25	takes	take	VERB
bam-14261	3	26	for	for	ADP
bam-14261	3	27	critical	critical	ADJ
bam-14261	3	28	findings	finding	NOUN
bam-14261	3	29	to	to	PART
bam-14261	3	30	reach	reach	VERB
bam-14261	3	31	the	the	DET
bam-14261	3	32	research	research	NOUN
bam-14261	3	33	community	community	NOUN
bam-14261	3	34	.	.	PUNCT
bam-14261	4	1	these	these	DET
bam-14261	4	2	articles	article	NOUN
bam-14261	4	3	are	be	AUX
bam-14261	4	4	searchable	searchable	ADJ
bam-14261	4	5	and	and	CCONJ
bam-14261	4	6	citable	citable	ADJ
bam-14261	4	7	by	by	ADP
bam-14261	4	8	their	their	PRON
bam-14261	4	9	doi	doi	NOUN
bam-14261	4	10	(	(	PUNCT
bam-14261	4	11	digital	digital	ADJ
bam-14261	4	12	object	object	NOUN
bam-14261	4	13	identifier	identifier	NOUN
bam-14261	4	14	)	)	PUNCT
bam-14261	4	15	.	.	PUNCT
bam-14261	5	1	the	the	DET
bam-14261	5	2	european	european	PROPN
bam-14261	5	3	journal	journal	PROPN
bam-14261	5	4	of	of	ADP
bam-14261	5	5	translational	translational	ADJ
bam-14261	5	6	myology	myology	NOUN
bam-14261	5	7	is	be	AUX
bam-14261	5	8	,	,	PUNCT
bam-14261	5	9	therefore	therefore	ADV
bam-14261	5	10	,	,	PUNCT
bam-14261	5	11	e	e	X
bam-14261	5	12	-	-	ADJ
bam-14261	5	13	publishing	publish	VERB
bam-14261	5	14	pdf	pdf	NOUN
bam-14261	5	15	files	file	NOUN
bam-14261	5	16	of	of	ADP
bam-14261	5	17	an	an	DET
bam-14261	5	18	early	early	ADJ
bam-14261	5	19	version	version	NOUN
bam-14261	5	20	of	of	ADP
bam-14261	5	21	manuscripts	manuscript	NOUN
bam-14261	5	22	that	that	PRON
bam-14261	5	23	undergone	undergo	VERB
bam-14261	5	24	a	a	DET
bam-14261	5	25	regular	regular	ADJ
bam-14261	5	26	peer	peer	NOUN
bam-14261	5	27	review	review	NOUN
bam-14261	5	28	and	and	CCONJ
bam-14261	5	29	have	have	AUX
bam-14261	5	30	been	be	AUX
bam-14261	5	31	accepted	accept	VERB
bam-14261	5	32	for	for	ADP
bam-14261	5	33	publication	publication	NOUN
bam-14261	5	34	,	,	PUNCT
bam-14261	5	35	but	but	CCONJ
bam-14261	5	36	have	have	AUX
bam-14261	5	37	not	not	PART
bam-14261	5	38	been	be	AUX
bam-14261	5	39	through	through	ADP
bam-14261	5	40	the	the	DET
bam-14261	5	41	typesetting	typesetting	NOUN
bam-14261	5	42	,	,	PUNCT
bam-14261	5	43	pagination	pagination	NOUN
bam-14261	5	44	and	and	CCONJ
bam-14261	5	45	proofreading	proofreading	NOUN
bam-14261	5	46	processes	process	NOUN
bam-14261	5	47	,	,	PUNCT
bam-14261	5	48	which	which	PRON
bam-14261	5	49	may	may	AUX
bam-14261	5	50	lead	lead	VERB
bam-14261	5	51	to	to	ADP
bam-14261	5	52	differences	difference	NOUN
bam-14261	5	53	between	between	ADP
bam-14261	5	54	this	this	DET
bam-14261	5	55	version	version	NOUN
bam-14261	5	56	and	and	CCONJ
bam-14261	5	57	the	the	DET
bam-14261	5	58	final	final	ADJ
bam-14261	5	59	one	one	NUM
bam-14261	5	60	.	.	PUNCT
bam-14261	6	1	the	the	DET
bam-14261	6	2	final	final	ADJ
bam-14261	6	3	version	version	NOUN
bam-14261	6	4	of	of	ADP
bam-14261	6	5	the	the	DET
bam-14261	6	6	manuscript	manuscript	NOUN
bam-14261	6	7	will	will	AUX
bam-14261	6	8	then	then	ADV
bam-14261	6	9	appear	appear	VERB
bam-14261	6	10	on	on	ADP
bam-14261	6	11	a	a	DET
bam-14261	6	12	regular	regular	ADJ
bam-14261	6	13	issue	issue	NOUN
bam-14261	6	14	of	of	ADP
bam-14261	6	15	the	the	DET
bam-14261	6	16	journal	journal	NOUN
bam-14261	6	17	.	.	PUNCT
bam-14261	7	1	e	e	X
bam-14261	7	2	-	-	NOUN
bam-14261	7	3	publishing	publishing	NOUN
bam-14261	7	4	of	of	ADP
bam-14261	7	5	this	this	DET
bam-14261	7	6	pdf	pdf	NOUN
bam-14261	7	7	file	file	NOUN
bam-14261	7	8	has	have	AUX
bam-14261	7	9	been	be	AUX
bam-14261	7	10	approved	approve	VERB
bam-14261	7	11	by	by	ADP
bam-14261	7	12	the	the	DET
bam-14261	7	13	authors	author	NOUN
bam-14261	7	14	.	.	PUNCT
bam-14261	8	1	eur	eur	PROPN
bam-14261	8	2	j	j	PROPN
bam-14261	8	3	transl	transl	PROPN
bam-14261	8	4	myol	myol	NOUN
bam-14261	8	5	2025	2025	NUM
bam-14261	8	6	[	[	X
bam-14261	8	7	online	online	ADV
bam-14261	8	8	ahead	ahead	ADV
bam-14261	8	9	of	of	ADP
bam-14261	8	10	print	print	NOUN
bam-14261	8	11	]	]	PUNCT
bam-14261	8	12	to	to	PART
bam-14261	8	13	cite	cite	VERB
bam-14261	8	14	this	this	DET
bam-14261	8	15	article	article	NOUN
bam-14261	8	16	:	:	PUNCT
bam-14261	8	17	li	li	PROPN
bam-14261	8	18	-	-	PROPN
bam-14261	8	19	dong	dong	PROPN
bam-14261	8	20	x	x	NOUN
bam-14261	8	21	,	,	PUNCT
bam-14261	8	22	feng	feng	PROPN
bam-14261	8	23	s	s	PROPN
bam-14261	8	24	,	,	PUNCT
bam-14261	8	25	de	de	PROPN
bam-14261	8	26	-	-	PROPN
bam-14261	8	27	liang	liang	PROPN
bam-14261	8	28	y	y	PROPN
bam-14261	8	29	,	,	PUNCT
bam-14261	8	30	et	et	PROPN
bam-14261	8	31	al	al	PROPN
bam-14261	8	32	.	.	PROPN
bam-14261	8	33	antimicrobial	antimicrobial	ADJ
bam-14261	8	34	resistance	resistance	NOUN
bam-14261	8	35	and	and	CCONJ
bam-14261	8	36	virulence	virulence	NOUN
bam-14261	8	37	gene	gene	NOUN
bam-14261	8	38	patterns	pattern	NOUN
bam-14261	8	39	of	of	ADP
bam-14261	8	40	staphylococcus	staphylococcus	NOUN
bam-14261	8	41	aureus	aureus	NOUN
bam-14261	8	42	in	in	ADP
bam-14261	8	43	infectious	infectious	ADJ
bam-14261	8	44	mastitis	mastitis	NOUN
bam-14261	8	45	:	:	PUNCT
bam-14261	8	46	implications	implication	NOUN
bam-14261	8	47	for	for	ADP
bam-14261	8	48	inflammatory	inflammatory	ADJ
bam-14261	8	49	myopathies	myopathy	NOUN
bam-14261	8	50	of	of	ADP
bam-14261	8	51	the	the	DET
bam-14261	8	52	lactating	lactating	NOUN
bam-14261	8	53	breast	breast	NOUN
bam-14261	8	54	.	.	PUNCT
bam-14261	9	1	eur	eur	PROPN
bam-14261	9	2	j	j	PROPN
bam-14261	9	3	transl	transl	PROPN
bam-14261	9	4	myol	myol	PROPN
bam-14261	9	5	doi	doi	PROPN
bam-14261	9	6	:	:	PUNCT
bam-14261	9	7	10.4081	10.4081	NUM
bam-14261	9	8	/	/	SYM
bam-14261	9	9	ejtm.2025.14261	ejtm.2025.14261	NOUN
bam-14261	9	10	©	©	PROPN
bam-14261	9	11	the	the	DET
bam-14261	9	12	author(s	author(s	NOUN
bam-14261	9	13	)	)	PUNCT
bam-14261	9	14	,	,	PUNCT
bam-14261	9	15	2025	2025	NUM
bam-14261	9	16	licensee	licensee	NOUN
bam-14261	9	17	pagepress	pagepress	NOUN
bam-14261	9	18	,	,	PUNCT
bam-14261	9	19	italy	italy	PROPN
bam-14261	9	20	note	note	VERB
bam-14261	9	21	:	:	PUNCT
bam-14261	9	22	the	the	DET
bam-14261	9	23	publisher	publisher	NOUN
bam-14261	9	24	is	be	AUX
bam-14261	9	25	not	not	PART
bam-14261	9	26	responsible	responsible	ADJ
bam-14261	9	27	for	for	ADP
bam-14261	9	28	the	the	DET
bam-14261	9	29	content	content	NOUN
bam-14261	9	30	or	or	CCONJ
bam-14261	9	31	functionality	functionality	NOUN
bam-14261	9	32	of	of	ADP
bam-14261	9	33	any	any	DET
bam-14261	9	34	supporting	support	VERB
bam-14261	9	35	information	information	NOUN
bam-14261	9	36	supplied	supply	VERB
bam-14261	9	37	by	by	ADP
bam-14261	9	38	the	the	DET
bam-14261	9	39	authors	author	NOUN
bam-14261	9	40	.	.	PUNCT
bam-14261	10	1	any	any	DET
bam-14261	10	2	queries	query	NOUN
bam-14261	10	3	should	should	AUX
bam-14261	10	4	be	be	AUX
bam-14261	10	5	directed	direct	VERB
bam-14261	10	6	to	to	ADP
bam-14261	10	7	the	the	DET
bam-14261	10	8	corresponding	corresponding	ADJ
bam-14261	10	9	author	author	NOUN
bam-14261	10	10	for	for	ADP
bam-14261	10	11	the	the	DET
bam-14261	10	12	article	article	NOUN
bam-14261	10	13	.	.	PUNCT
bam-14261	11	1	all	all	DET
bam-14261	11	2	claims	claim	NOUN
bam-14261	11	3	expressed	express	VERB
bam-14261	11	4	in	in	ADP
bam-14261	11	5	this	this	DET
bam-14261	11	6	article	article	NOUN
bam-14261	11	7	are	be	AUX
bam-14261	11	8	solely	solely	ADV
bam-14261	11	9	those	those	PRON
bam-14261	11	10	of	of	ADP
bam-14261	11	11	the	the	DET
bam-14261	11	12	authors	author	NOUN
bam-14261	11	13	and	and	CCONJ
bam-14261	11	14	do	do	AUX
bam-14261	11	15	not	not	PART
bam-14261	11	16	necessarily	necessarily	ADV
bam-14261	11	17	represent	represent	VERB
bam-14261	11	18	those	those	PRON
bam-14261	11	19	of	of	ADP
bam-14261	11	20	their	their	PRON
bam-14261	11	21	affiliated	affiliated	ADJ
bam-14261	11	22	organizations	organization	NOUN
bam-14261	11	23	,	,	PUNCT
bam-14261	11	24	or	or	CCONJ
bam-14261	11	25	those	those	PRON
bam-14261	11	26	of	of	ADP
bam-14261	11	27	the	the	DET
bam-14261	11	28	publisher	publisher	NOUN
bam-14261	11	29	,	,	PUNCT
bam-14261	11	30	the	the	DET
bam-14261	11	31	editors	editor	NOUN
bam-14261	11	32	and	and	CCONJ
bam-14261	11	33	the	the	DET
bam-14261	11	34	reviewers	reviewer	NOUN
bam-14261	11	35	.	.	PUNCT
bam-14261	12	1	any	any	DET
bam-14261	12	2	product	product	NOUN
bam-14261	12	3	that	that	PRON
bam-14261	12	4	may	may	AUX
bam-14261	12	5	be	be	AUX
bam-14261	12	6	evaluated	evaluate	VERB
bam-14261	12	7	in	in	ADP
bam-14261	12	8	this	this	DET
bam-14261	12	9	article	article	NOUN
bam-14261	12	10	or	or	CCONJ
bam-14261	12	11	claim	claim	NOUN
bam-14261	12	12	that	that	PRON
bam-14261	12	13	may	may	AUX
bam-14261	12	14	be	be	AUX
bam-14261	12	15	made	make	VERB
bam-14261	12	16	by	by	ADP
bam-14261	12	17	its	its	PRON
bam-14261	12	18	manufacturer	manufacturer	NOUN
bam-14261	12	19	is	be	AUX
bam-14261	12	20	not	not	PART
bam-14261	12	21	guaranteed	guarantee	VERB
bam-14261	12	22	or	or	CCONJ
bam-14261	12	23	endorsed	endorse	VERB
bam-14261	12	24	by	by	ADP
bam-14261	12	25	the	the	DET
bam-14261	12	26	publisher	publisher	NOUN
bam-14261	12	27	.	.	PUNCT
bam-14261	13	1	submi&ed	submi&ed	NOUN
bam-14261	13	2	:	:	PUNCT
bam-14261	13	3	18	18	NUM
bam-14261	13	4	august	august	PROPN
bam-14261	13	5	2025	2025	NUM
bam-14261	13	6	accepted	accept	VERB
bam-14261	13	7	:	:	PUNCT
bam-14261	13	8	1	1	NUM
bam-14261	13	9	september	september	PROPN
bam-14261	13	10	2025	2025	NUM
bam-14261	13	11	early	early	ADJ
bam-14261	13	12	access	access	NOUN
bam-14261	13	13	:	:	PUNCT
bam-14261	13	14	12	12	NUM
bam-14261	13	15	november	november	PROPN
bam-14261	13	16	2025	2025	NUM
bam-14261	13	17	https://www.pagepressjournals.org/index.php/bam/index	https://www.pagepressjournals.org/index.php/bam/index	NOUN
bam-14261	13	18	https://www.pagepress.org/site	https://www.pagepress.org/site	PART
bam-14261	13	19	antimicrobial	antimicrobial	ADJ
bam-14261	13	20	resistance	resistance	NOUN
bam-14261	13	21	and	and	CCONJ
bam-14261	13	22	virulence	virulence	NOUN
bam-14261	13	23	gene	gene	NOUN
bam-14261	13	24	patterns	pattern	NOUN
bam-14261	13	25	of	of	ADP
bam-14261	13	26	staphylococcus	staphylococcus	NOUN
bam-14261	13	27	aureus	aureus	NOUN
bam-14261	13	28	in	in	ADP
bam-14261	13	29	infectious	infectious	ADJ
bam-14261	13	30	mastitis	mastitis	NOUN
bam-14261	13	31	:	:	PUNCT
bam-14261	13	32	implications	implication	NOUN
bam-14261	13	33	for	for	ADP
bam-14261	13	34	inflammatory	inflammatory	ADJ
bam-14261	13	35	myopathies	myopathy	NOUN
bam-14261	13	36	of	of	ADP
bam-14261	13	37	the	the	DET
bam-14261	13	38	lactating	lactating	NOUN
bam-14261	13	39	breast	breast	NOUN
bam-14261	13	40	xu	xu	PROPN
bam-14261	14	1	li	li	PROPN
bam-14261	14	2	-	-	PUNCT
bam-14261	14	3	dong	dong	PROPN
bam-14261	14	4	,	,	PUNCT
bam-14261	14	5	shi	shi	PROPN
bam-14261	14	6	feng	feng	PROPN
bam-14261	14	7	,	,	PUNCT
bam-14261	14	8	ye	ye	PROPN
bam-14261	14	9	de	de	PROPN
bam-14261	14	10	-	-	PROPN
bam-14261	14	11	liang	liang	PROPN
bam-14261	14	12	,	,	PUNCT
bam-14261	14	13	dong	dong	PROPN
bam-14261	14	14	li	li	PROPN
bam-14261	14	15	-	-	PROPN
bam-14261	14	16	qian	qian	PROPN
bam-14261	14	17	,	,	PUNCT
bam-14261	14	18	wu	wu	PROPN
bam-14261	14	19	ya	ya	PROPN
bam-14261	14	20	-	-	PUNCT
bam-14261	14	21	ni	ni	PROPN
bam-14261	14	22	department	department	PROPN
bam-14261	14	23	of	of	ADP
bam-14261	14	24	hangzhou	hangzhou	PROPN
bam-14261	14	25	linping	linpe	VERB
bam-14261	14	26	district	district	PROPN
bam-14261	14	27	maternal	maternal	ADJ
bam-14261	14	28	and	and	CCONJ
bam-14261	14	29	child	child	NOUN
bam-14261	14	30	health	health	NOUN
bam-14261	14	31	hospital	hospital	NOUN
bam-14261	14	32	,	,	PUNCT
bam-14261	14	33	hangzhou	hangzhou	PROPN
bam-14261	14	34	,	,	PUNCT
bam-14261	14	35	china	china	PROPN
bam-14261	14	36	abstract	abstract	ADJ
bam-14261	14	37	with	with	ADP
bam-14261	14	38	the	the	DET
bam-14261	14	39	present	present	ADJ
bam-14261	14	40	work	work	NOUN
bam-14261	14	41	,	,	PUNCT
bam-14261	14	42	we	we	PRON
bam-14261	14	43	aimed	aim	VERB
bam-14261	14	44	to	to	PART
bam-14261	14	45	investigate	investigate	VERB
bam-14261	14	46	antimicrobial	antimicrobial	ADJ
bam-14261	14	47	resistance	resistance	NOUN
bam-14261	14	48	and	and	CCONJ
bam-14261	14	49	virulence	virulence	NOUN
bam-14261	14	50	gene	gene	NOUN
bam-14261	14	51	patterns	pattern	NOUN
bam-14261	14	52	of	of	ADP
bam-14261	14	53	staphylococcus	staphylococcus	NOUN
bam-14261	14	54	aureus	aureus	NOUN
bam-14261	14	55	in	in	ADP
bam-14261	14	56	lactating	lactate	VERB
bam-14261	14	57	patients	patient	NOUN
bam-14261	14	58	with	with	ADP
bam-14261	14	59	infectious	infectious	ADJ
bam-14261	14	60	mastitis	mastitis	NOUN
bam-14261	14	61	and	and	CCONJ
bam-14261	14	62	evaluate	evaluate	VERB
bam-14261	14	63	their	their	PRON
bam-14261	14	64	potential	potential	ADJ
bam-14261	14	65	impact	impact	NOUN
bam-14261	14	66	on	on	ADP
bam-14261	14	67	inflammatory	inflammatory	ADJ
bam-14261	14	68	myopathies	myopathy	NOUN
bam-14261	14	69	of	of	ADP
bam-14261	14	70	the	the	DET
bam-14261	14	71	lactating	lactating	NOUN
bam-14261	14	72	breast	breast	NOUN
bam-14261	14	73	.	.	PUNCT
bam-14261	15	1	between	between	ADP
bam-14261	15	2	january	january	PROPN
bam-14261	15	3	2021	2021	NUM
bam-14261	15	4	and	and	CCONJ
bam-14261	15	5	april	april	PROPN
bam-14261	15	6	2024	2024	NUM
bam-14261	15	7	,	,	PUNCT
bam-14261	15	8	158	158	NUM
bam-14261	15	9	lactating	lactate	VERB
bam-14261	15	10	patients	patient	NOUN
bam-14261	15	11	with	with	ADP
bam-14261	15	12	culture	culture	NOUN
bam-14261	15	13	-	-	PUNCT
bam-14261	15	14	confirmed	confirm	VERB
bam-14261	15	15	infectious	infectious	ADJ
bam-14261	15	16	mastitis	mastitis	NOUN
bam-14261	15	17	were	be	AUX
bam-14261	15	18	treated	treat	VERB
bam-14261	15	19	at	at	ADP
bam-14261	15	20	hangzhou	hangzhou	PROPN
bam-14261	15	21	linping	linpe	VERB
bam-14261	15	22	district	district	PROPN
bam-14261	15	23	maternal	maternal	ADJ
bam-14261	15	24	and	and	CCONJ
bam-14261	15	25	child	child	NOUN
bam-14261	15	26	health	health	NOUN
bam-14261	15	27	hospital	hospital	NOUN
bam-14261	15	28	.	.	PUNCT
bam-14261	16	1	among	among	ADP
bam-14261	16	2	these	these	PRON
bam-14261	16	3	,	,	PUNCT
bam-14261	16	4	119	119	NUM
bam-14261	16	5	isolates	isolate	NOUN
bam-14261	16	6	were	be	AUX
bam-14261	16	7	identified	identify	VERB
bam-14261	16	8	as	as	ADP
bam-14261	16	9	s.	s.	PROPN
bam-14261	16	10	aureus	aureus	PROPN
bam-14261	16	11	(	(	PUNCT
bam-14261	16	12	82	82	NUM
bam-14261	16	13	mrsa	mrsa	NOUN
bam-14261	16	14	,	,	PUNCT
bam-14261	16	15	37	37	NUM
bam-14261	16	16	mssa	mssa	NOUN
bam-14261	16	17	)	)	PUNCT
bam-14261	16	18	.	.	PUNCT
bam-14261	17	1	antimicrobial	antimicrobial	ADJ
bam-14261	17	2	susceptibility	susceptibility	NOUN
bam-14261	17	3	and	and	CCONJ
bam-14261	17	4	virulence	virulence	NOUN
bam-14261	17	5	genes	gene	NOUN
bam-14261	17	6	were	be	AUX
bam-14261	17	7	analyzed	analyze	VERB
bam-14261	17	8	.	.	PUNCT
bam-14261	18	1	muscle	muscle	NOUN
bam-14261	18	2	involvement	involvement	NOUN
bam-14261	18	3	was	be	AUX
bam-14261	18	4	inferred	infer	VERB
bam-14261	18	5	indirectly	indirectly	ADV
bam-14261	18	6	from	from	ADP
bam-14261	18	7	clinical	clinical	ADJ
bam-14261	18	8	presentation	presentation	NOUN
bam-14261	18	9	,	,	PUNCT
bam-14261	18	10	including	include	VERB
bam-14261	18	11	marked	mark	VERB
bam-14261	18	12	local	local	ADJ
bam-14261	18	13	induration	induration	NOUN
bam-14261	18	14	,	,	PUNCT
bam-14261	18	15	tenderness	tenderness	NOUN
bam-14261	18	16	extending	extend	VERB
bam-14261	18	17	to	to	ADP
bam-14261	18	18	deeper	deep	ADJ
bam-14261	18	19	breast	breast	NOUN
bam-14261	18	20	tissue	tissue	NOUN
bam-14261	18	21	,	,	PUNCT
bam-14261	18	22	and	and	CCONJ
bam-14261	18	23	reduced	reduce	VERB
bam-14261	18	24	breast	breast	NOUN
bam-14261	18	25	mobility	mobility	NOUN
bam-14261	18	26	.	.	PUNCT
bam-14261	19	1	no	no	DET
bam-14261	19	2	imaging	imaging	NOUN
bam-14261	19	3	or	or	CCONJ
bam-14261	19	4	biopsy	biopsy	NOUN
bam-14261	19	5	was	be	AUX
bam-14261	19	6	performed	perform	VERB
bam-14261	19	7	to	to	PART
bam-14261	19	8	confirm	confirm	VERB
bam-14261	19	9	myopathic	myopathic	ADJ
bam-14261	19	10	changes	change	NOUN
bam-14261	19	11	directly	directly	ADV
bam-14261	19	12	.	.	PUNCT
bam-14261	20	1	s.	s.	PROPN
bam-14261	20	2	aureus	aureus	PROPN
bam-14261	20	3	was	be	AUX
bam-14261	20	4	the	the	DET
bam-14261	20	5	predominant	predominant	ADJ
bam-14261	20	6	pathogen	pathogen	NOUN
bam-14261	20	7	.	.	PUNCT
bam-14261	21	1	both	both	DET
bam-14261	21	2	mrsa	mrsa	NOUN
bam-14261	21	3	and	and	CCONJ
bam-14261	21	4	mssa	mssa	NOUN
bam-14261	21	5	showed	show	VERB
bam-14261	21	6	high	high	ADJ
bam-14261	21	7	resistance	resistance	NOUN
bam-14261	21	8	to	to	ADP
bam-14261	21	9	penicillin	penicillin	PROPN
bam-14261	21	10	g	g	PROPN
bam-14261	21	11	,	,	PUNCT
bam-14261	21	12	erythromycin	erythromycin	NOUN
bam-14261	21	13	,	,	PUNCT
bam-14261	21	14	and	and	CCONJ
bam-14261	21	15	clindamycin	clindamycin	NOUN
bam-14261	21	16	,	,	PUNCT
bam-14261	21	17	while	while	SCONJ
bam-14261	21	18	all	all	DET
bam-14261	21	19	isolates	isolate	NOUN
bam-14261	21	20	were	be	AUX
bam-14261	21	21	susceptible	susceptible	ADJ
bam-14261	21	22	to	to	ADP
bam-14261	21	23	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	21	24	,	,	PUNCT
bam-14261	21	25	linezolid	linezolid	NOUN
bam-14261	21	26	,	,	PUNCT
bam-14261	21	27	vancomycin	vancomycin	PROPN
bam-14261	21	28	,	,	PUNCT
bam-14261	21	29	and	and	CCONJ
bam-14261	21	30	rifampicin	rifampicin	VERB
bam-14261	21	31	.	.	PUNCT
bam-14261	22	1	mrsa	mrsa	NOUN
bam-14261	22	2	exhibited	exhibit	VERB
bam-14261	22	3	higher	high	ADJ
bam-14261	22	4	resistance	resistance	NOUN
bam-14261	22	5	than	than	ADP
bam-14261	22	6	mssa	mssa	ADJ
bam-14261	22	7	(	(	PUNCT
bam-14261	22	8	p<0.05	p<0.05	NOUN
bam-14261	22	9	)	)	PUNCT
bam-14261	22	10	.	.	PUNCT
bam-14261	23	1	frequent	frequent	ADJ
bam-14261	23	2	resistance	resistance	NOUN
bam-14261	23	3	genes	gene	NOUN
bam-14261	23	4	included	include	VERB
bam-14261	23	5	aac(6’)/aph(2	aac(6’)/aph(2	PRON
bam-14261	23	6	’’	’'	PUNCT
bam-14261	23	7	)	)	PUNCT
bam-14261	23	8	,	,	PUNCT
bam-14261	23	9	blaz	blaz	PROPN
bam-14261	23	10	,	,	PUNCT
bam-14261	23	11	meca	meca	PROPN
bam-14261	23	12	,	,	PUNCT
bam-14261	23	13	aph(3’)-iii	aph(3’)-iii	PROPN
bam-14261	23	14	,	,	PUNCT
bam-14261	23	15	and	and	CCONJ
bam-14261	23	16	qaca	qaca	PROPN
bam-14261	23	17	/	/	SYM
bam-14261	23	18	b.	b.	PROPN
bam-14261	23	19	virulence	virulence	NOUN
bam-14261	23	20	genes	gene	NOUN
bam-14261	23	21	hla	hla	PROPN
bam-14261	23	22	,	,	PUNCT
bam-14261	23	23	clfa	clfa	NOUN
bam-14261	23	24	,	,	PUNCT
bam-14261	23	25	clfb	clfb	NOUN
bam-14261	23	26	,	,	PUNCT
bam-14261	23	27	and	and	CCONJ
bam-14261	23	28	fnba	fnba	PROPN
bam-14261	23	29	were	be	AUX
bam-14261	23	30	common	common	ADJ
bam-14261	23	31	;	;	PUNCT
bam-14261	23	32	pvl	pvl	NOUN
bam-14261	23	33	was	be	AUX
bam-14261	23	34	less	less	ADV
bam-14261	23	35	frequent	frequent	ADJ
bam-14261	23	36	in	in	ADP
bam-14261	23	37	mrsa	mrsa	NOUN
bam-14261	23	38	(	(	PUNCT
bam-14261	23	39	p<0.05	p<0.05	NOUN
bam-14261	23	40	)	)	PUNCT
bam-14261	23	41	.	.	PUNCT
bam-14261	24	1	mrsa	mrsa	NOUN
bam-14261	24	2	infections	infection	NOUN
bam-14261	24	3	were	be	AUX
bam-14261	24	4	associated	associate	VERB
bam-14261	24	5	with	with	ADP
bam-14261	24	6	stronger	strong	ADJ
bam-14261	24	7	local	local	ADJ
bam-14261	24	8	inflammation	inflammation	NOUN
bam-14261	24	9	and	and	CCONJ
bam-14261	24	10	increased	increase	VERB
bam-14261	24	11	clinical	clinical	ADJ
bam-14261	24	12	markers	marker	NOUN
bam-14261	24	13	possibly	possibly	ADV
bam-14261	24	14	related	relate	VERB
bam-14261	24	15	to	to	ADP
bam-14261	24	16	muscle	muscle	NOUN
bam-14261	24	17	involvement	involvement	NOUN
bam-14261	24	18	,	,	PUNCT
bam-14261	24	19	raising	raise	VERB
bam-14261	24	20	the	the	DET
bam-14261	24	21	possibility	possibility	NOUN
bam-14261	24	22	of	of	ADP
bam-14261	24	23	an	an	DET
bam-14261	24	24	association	association	NOUN
bam-14261	24	25	with	with	ADP
bam-14261	24	26	myopathic	myopathic	ADJ
bam-14261	24	27	changes	change	NOUN
bam-14261	24	28	in	in	ADP
bam-14261	24	29	lactating	lactate	VERB
bam-14261	24	30	breast	breast	NOUN
bam-14261	24	31	tissue	tissue	NOUN
bam-14261	24	32	.	.	PUNCT
bam-14261	25	1	s.	s.	PROPN
bam-14261	25	2	aureus	aureus	PROPN
bam-14261	25	3	,	,	PUNCT
bam-14261	25	4	particularly	particularly	ADV
bam-14261	25	5	mrsa	mrsa	NOUN
bam-14261	25	6	,	,	PUNCT
bam-14261	25	7	is	be	AUX
bam-14261	25	8	the	the	DET
bam-14261	25	9	main	main	ADJ
bam-14261	25	10	pathogen	pathogen	NOUN
bam-14261	25	11	in	in	ADP
bam-14261	25	12	lactating	lactate	VERB
bam-14261	25	13	mastitis	mastitis	NOUN
bam-14261	25	14	.	.	PUNCT
bam-14261	26	1	specific	specific	ADJ
bam-14261	26	2	virulence	virulence	NOUN
bam-14261	26	3	genes	gene	NOUN
bam-14261	26	4	may	may	AUX
bam-14261	26	5	influence	influence	VERB
bam-14261	26	6	the	the	DET
bam-14261	26	7	severity	severity	NOUN
bam-14261	26	8	of	of	ADP
bam-14261	26	9	local	local	ADJ
bam-14261	26	10	inflammation	inflammation	NOUN
bam-14261	26	11	and	and	CCONJ
bam-14261	26	12	myopathic	myopathic	ADJ
bam-14261	26	13	changes	change	NOUN
bam-14261	26	14	,	,	PUNCT
bam-14261	26	15	highlighting	highlight	VERB
bam-14261	26	16	implications	implication	NOUN
bam-14261	26	17	for	for	ADP
bam-14261	26	18	inflammatory	inflammatory	ADJ
bam-14261	26	19	myopathies	myopathy	NOUN
bam-14261	26	20	in	in	ADP
bam-14261	26	21	the	the	DET
bam-14261	26	22	lactating	lactating	NOUN
bam-14261	26	23	breast	breast	NOUN
bam-14261	26	24	.	.	PUNCT
bam-14261	27	1	key	key	ADJ
bam-14261	27	2	words	word	NOUN
bam-14261	27	3	:	:	PUNCT
bam-14261	27	4	lactation	lactation	NOUN
bam-14261	27	5	;	;	PUNCT
bam-14261	27	6	infectious	infectious	ADJ
bam-14261	27	7	mastitis	mastitis	NOUN
bam-14261	27	8	;	;	PUNCT
bam-14261	27	9	staphylococcus	staphylococcus	NOUN
bam-14261	27	10	aureus	aureus	NOUN
bam-14261	27	11	;	;	PUNCT
bam-14261	27	12	antimicrobial	antimicrobial	ADJ
bam-14261	27	13	resistance	resistance	NOUN
bam-14261	27	14	;	;	PUNCT
bam-14261	27	15	virulence	virulence	NOUN
bam-14261	27	16	factors	factor	NOUN
bam-14261	27	17	;	;	PUNCT
bam-14261	27	18	myopathies	myopathy	NOUN
bam-14261	27	19	;	;	PUNCT
bam-14261	27	20	muscle	muscle	NOUN
bam-14261	27	21	inflammation	inflammation	NOUN
bam-14261	27	22	.	.	PUNCT
bam-14261	28	1	infectious	infectious	ADJ
bam-14261	28	2	mastitis	mastitis	NOUN
bam-14261	28	3	is	be	AUX
bam-14261	28	4	a	a	DET
bam-14261	28	5	common	common	ADJ
bam-14261	28	6	condition	condition	NOUN
bam-14261	28	7	with	with	ADP
bam-14261	28	8	a	a	DET
bam-14261	28	9	high	high	ADJ
bam-14261	28	10	incidence	incidence	NOUN
bam-14261	28	11	among	among	ADP
bam-14261	28	12	lactating	lactate	VERB
bam-14261	28	13	women.1	women.1	ADP
bam-14261	28	14	it	it	PRON
bam-14261	28	15	is	be	AUX
bam-14261	28	16	usually	usually	ADV
bam-14261	28	17	caused	cause	VERB
bam-14261	28	18	by	by	ADP
bam-14261	28	19	poor	poor	ADJ
bam-14261	28	20	milk	milk	NOUN
bam-14261	28	21	drainage	drainage	NOUN
bam-14261	28	22	and	and	CCONJ
bam-14261	28	23	improper	improper	ADJ
bam-14261	28	24	breastfeeding	breastfeeding	NOUN
bam-14261	28	25	techniques	technique	NOUN
bam-14261	28	26	,	,	PUNCT
bam-14261	28	27	leading	lead	VERB
bam-14261	28	28	to	to	ADP
bam-14261	28	29	milk	milk	NOUN
bam-14261	28	30	stasis	stasis	NOUN
bam-14261	28	31	and	and	CCONJ
bam-14261	28	32	subsequent	subsequent	ADJ
bam-14261	28	33	infection	infection	NOUN
bam-14261	28	34	during	during	ADP
bam-14261	28	35	lactation	lactation	NOUN
bam-14261	28	36	.	.	PUNCT
bam-14261	29	1	clinically	clinically	ADV
bam-14261	29	2	,	,	PUNCT
bam-14261	29	3	patients	patient	NOUN
bam-14261	29	4	often	often	ADV
bam-14261	29	5	present	present	VERB
bam-14261	29	6	with	with	ADP
bam-14261	29	7	breast	breast	NOUN
bam-14261	29	8	erythema	erythema	ADJ
bam-14261	29	9	,	,	PUNCT
bam-14261	29	10	swelling	swelling	NOUN
bam-14261	29	11	,	,	PUNCT
bam-14261	29	12	pain	pain	NOUN
bam-14261	29	13	,	,	PUNCT
bam-14261	29	14	and	and	CCONJ
bam-14261	29	15	fever	fever	NOUN
bam-14261	29	16	,	,	PUNCT
bam-14261	29	17	accompanied	accompany	VERB
bam-14261	29	18	by	by	ADP
bam-14261	29	19	palpable	palpable	ADJ
bam-14261	29	20	masses	masse	NOUN
bam-14261	29	21	and	and	CCONJ
bam-14261	29	22	difficulty	difficulty	NOUN
bam-14261	29	23	in	in	ADP
bam-14261	29	24	milk	milk	NOUN
bam-14261	29	25	expression.2,3	expression.2,3	PROPN
bam-14261	29	26	pathogens	pathogen	NOUN
bam-14261	29	27	may	may	AUX
bam-14261	29	28	invade	invade	VERB
bam-14261	29	29	through	through	ADP
bam-14261	29	30	erosions	erosion	NOUN
bam-14261	29	31	or	or	CCONJ
bam-14261	29	32	wounds	wound	NOUN
bam-14261	29	33	on	on	ADP
bam-14261	29	34	the	the	DET
bam-14261	29	35	nipple	nipple	NOUN
bam-14261	29	36	,	,	PUNCT
bam-14261	29	37	entering	enter	VERB
bam-14261	29	38	the	the	DET
bam-14261	29	39	subareolar	subareolar	ADJ
bam-14261	29	40	lymphatic	lymphatic	ADJ
bam-14261	29	41	vessels	vessel	NOUN
bam-14261	29	42	and	and	CCONJ
bam-14261	29	43	interlobular	interlobular	ADJ
bam-14261	29	44	spaces	space	NOUN
bam-14261	29	45	,	,	PUNCT
bam-14261	29	46	thereby	thereby	ADV
bam-14261	29	47	causing	cause	VERB
bam-14261	29	48	breast	breast	NOUN
bam-14261	29	49	cellulitis	cellulitis	NOUN
bam-14261	29	50	and	and	CCONJ
bam-14261	29	51	seriously	seriously	ADV
bam-14261	29	52	affecting	affect	VERB
bam-14261	29	53	breastfeeding.4,5	breastfeeding.4,5	ADJ
bam-14261	29	54	staphylococcus	staphylococcus	NOUN
bam-14261	29	55	aureus	aureus	NOUN
bam-14261	29	56	,	,	PUNCT
bam-14261	29	57	a	a	DET
bam-14261	29	58	highly	highly	ADV
bam-14261	29	59	pathogenic	pathogenic	ADJ
bam-14261	29	60	gram	gram	NOUN
bam-14261	29	61	-	-	PUNCT
bam-14261	29	62	positive	positive	ADJ
bam-14261	29	63	bacterium	bacterium	NOUN
bam-14261	29	64	,	,	PUNCT
bam-14261	29	65	is	be	AUX
bam-14261	29	66	a	a	DET
bam-14261	29	67	common	common	ADJ
bam-14261	29	68	causative	causative	ADJ
bam-14261	29	69	agent	agent	NOUN
bam-14261	29	70	of	of	ADP
bam-14261	29	71	infectious	infectious	ADJ
bam-14261	29	72	mastitis	mastitis	NOUN
bam-14261	29	73	in	in	ADP
bam-14261	29	74	lactating	lactate	VERB
bam-14261	29	75	women	woman	NOUN
bam-14261	29	76	and	and	CCONJ
bam-14261	29	77	can	can	AUX
bam-14261	29	78	cause	cause	VERB
bam-14261	29	79	infections	infection	NOUN
bam-14261	29	80	of	of	ADP
bam-14261	29	81	the	the	DET
bam-14261	29	82	skin	skin	NOUN
bam-14261	29	83	,	,	PUNCT
bam-14261	29	84	soft	soft	ADJ
bam-14261	29	85	tissues	tissue	NOUN
bam-14261	29	86	,	,	PUNCT
bam-14261	29	87	bones	bone	NOUN
bam-14261	29	88	,	,	PUNCT
bam-14261	29	89	joints	joint	NOUN
bam-14261	29	90	,	,	PUNCT
bam-14261	29	91	and	and	CCONJ
bam-14261	29	92	multiple	multiple	ADJ
bam-14261	29	93	organ	organ	NOUN
bam-14261	29	94	systems	system	NOUN
bam-14261	29	95	.	.	PUNCT
bam-14261	30	1	in	in	ADP
bam-14261	30	2	recent	recent	ADJ
bam-14261	30	3	years	year	NOUN
bam-14261	30	4	,	,	PUNCT
bam-14261	30	5	the	the	DET
bam-14261	30	6	detection	detection	NOUN
bam-14261	30	7	rate	rate	NOUN
bam-14261	30	8	of	of	ADP
bam-14261	30	9	methicillin	methicillin	NOUN
bam-14261	30	10	-	-	PUNCT
bam-14261	30	11	resistant	resistant	ADJ
bam-14261	30	12	s.	s.	PROPN
bam-14261	30	13	aureus	aureus	PROPN
bam-14261	30	14	(	(	PUNCT
bam-14261	30	15	mrsa	mrsa	NOUN
bam-14261	30	16	)	)	PUNCT
bam-14261	30	17	in	in	ADP
bam-14261	30	18	breast	breast	NOUN
bam-14261	30	19	milk	milk	NOUN
bam-14261	30	20	and	and	CCONJ
bam-14261	30	21	pus	pus	NOUN
bam-14261	30	22	samples	sample	NOUN
bam-14261	30	23	from	from	ADP
bam-14261	30	24	lactating	lactate	VERB
bam-14261	30	25	women	woman	NOUN
bam-14261	30	26	has	have	AUX
bam-14261	30	27	been	be	AUX
bam-14261	30	28	increasing	increase	VERB
bam-14261	30	29	.	.	PUNCT
bam-14261	31	1	mrsa	mrsa	NOUN
bam-14261	31	2	is	be	AUX
bam-14261	31	3	characterised	characterise	VERB
bam-14261	31	4	by	by	ADP
bam-14261	31	5	high	high	ADJ
bam-14261	31	6	levels	level	NOUN
bam-14261	31	7	of	of	ADP
bam-14261	31	8	antimicrobial	antimicrobial	ADJ
bam-14261	31	9	resistance	resistance	NOUN
bam-14261	31	10	and	and	CCONJ
bam-14261	31	11	complex	complex	ADJ
bam-14261	31	12	resistance	resistance	NOUN
bam-14261	31	13	mechanisms	mechanism	NOUN
bam-14261	31	14	,	,	PUNCT
bam-14261	31	15	which	which	PRON
bam-14261	31	16	may	may	AUX
bam-14261	31	17	contribute	contribute	VERB
bam-14261	31	18	to	to	ADP
bam-14261	31	19	increased	increase	VERB
bam-14261	31	20	infection	infection	NOUN
bam-14261	31	21	-	-	PUNCT
bam-14261	31	22	related	relate	VERB
bam-14261	32	1	mortality.6	mortality.6	NOUN
bam-14261	32	2	therefore	therefore	ADV
bam-14261	32	3	,	,	PUNCT
bam-14261	32	4	analysing	analyse	VERB
bam-14261	32	5	the	the	DET
bam-14261	32	6	pathogen	pathogen	NOUN
bam-14261	32	7	spectrum	spectrum	NOUN
bam-14261	32	8	and	and	CCONJ
bam-14261	32	9	antimicrobial	antimicrobial	ADJ
bam-14261	32	10	resistance	resistance	NOUN
bam-14261	32	11	profiles	profile	NOUN
bam-14261	32	12	in	in	ADP
bam-14261	32	13	lactating	lactate	VERB
bam-14261	32	14	patients	patient	NOUN
bam-14261	32	15	with	with	ADP
bam-14261	32	16	infectious	infectious	ADJ
bam-14261	32	17	mastitis	mastitis	NOUN
bam-14261	32	18	is	be	AUX
bam-14261	32	19	of	of	ADP
bam-14261	32	20	great	great	ADJ
bam-14261	32	21	clinical	clinical	ADJ
bam-14261	32	22	significance	significance	NOUN
bam-14261	32	23	for	for	ADP
bam-14261	32	24	guiding	guide	VERB
bam-14261	32	25	the	the	DET
bam-14261	32	26	rational	rational	ADJ
bam-14261	32	27	use	use	NOUN
bam-14261	32	28	of	of	ADP
bam-14261	32	29	antibiotics	antibiotic	NOUN
bam-14261	32	30	.	.	PUNCT
bam-14261	33	1	previous	previous	ADJ
bam-14261	33	2	studies7,8	studies7,8	PROPN
bam-14261	33	3	have	have	AUX
bam-14261	33	4	shown	show	VERB
bam-14261	33	5	that	that	SCONJ
bam-14261	33	6	the	the	DET
bam-14261	33	7	pathogenicity	pathogenicity	NOUN
bam-14261	33	8	of	of	ADP
bam-14261	33	9	s.	s.	PROPN
bam-14261	33	10	aureus	aureus	PROPN
bam-14261	33	11	is	be	AUX
bam-14261	33	12	closely	closely	ADV
bam-14261	33	13	related	relate	VERB
bam-14261	33	14	to	to	ADP
bam-14261	33	15	the	the	DET
bam-14261	33	16	virulence	virulence	NOUN
bam-14261	33	17	genes	gene	NOUN
bam-14261	33	18	it	it	PRON
bam-14261	33	19	carries	carry	VERB
bam-14261	33	20	.	.	PUNCT
bam-14261	34	1	thus	thus	ADV
bam-14261	34	2	,	,	PUNCT
bam-14261	34	3	investigating	investigate	VERB
bam-14261	34	4	the	the	DET
bam-14261	34	5	distribution	distribution	NOUN
bam-14261	34	6	of	of	ADP
bam-14261	34	7	virulence	virulence	NOUN
bam-14261	34	8	genes	gene	NOUN
bam-14261	34	9	in	in	ADP
bam-14261	34	10	mrsa	mrsa	NOUN
bam-14261	34	11	and	and	CCONJ
bam-14261	34	12	methicillin	methicillin	NOUN
bam-14261	34	13	-	-	PUNCT
bam-14261	34	14	susceptible	susceptible	ADJ
bam-14261	34	15	s.	s.	PROPN
bam-14261	34	16	aureus	aureus	PROPN
bam-14261	34	17	(	(	PUNCT
bam-14261	34	18	mssa	mssa	ADJ
bam-14261	34	19	)	)	PUNCT
bam-14261	34	20	is	be	AUX
bam-14261	34	21	essential	essential	ADJ
bam-14261	34	22	.	.	PUNCT
bam-14261	35	1	based	base	VERB
bam-14261	35	2	on	on	ADP
bam-14261	35	3	this	this	PRON
bam-14261	35	4	,	,	PUNCT
bam-14261	35	5	the	the	DET
bam-14261	35	6	present	present	ADJ
bam-14261	35	7	study	study	NOUN
bam-14261	35	8	aimed	aim	VERB
bam-14261	35	9	to	to	PART
bam-14261	35	10	analyse	analyse	VERB
bam-14261	35	11	the	the	DET
bam-14261	35	12	antimicrobial	antimicrobial	ADJ
bam-14261	35	13	susceptibility	susceptibility	NOUN
bam-14261	35	14	and	and	CCONJ
bam-14261	35	15	virulence	virulence	NOUN
bam-14261	35	16	gene	gene	NOUN
bam-14261	35	17	profiles	profile	NOUN
bam-14261	35	18	of	of	ADP
bam-14261	35	19	s.	s.	PROPN
bam-14261	35	20	aureus	aureus	PROPN
bam-14261	35	21	isolated	isolate	VERB
bam-14261	35	22	from	from	ADP
bam-14261	35	23	lactating	lactate	VERB
bam-14261	35	24	patients	patient	NOUN
bam-14261	35	25	with	with	ADP
bam-14261	35	26	infectious	infectious	ADJ
bam-14261	35	27	mastitis	mastitis	NOUN
bam-14261	35	28	,	,	PUNCT
bam-14261	35	29	providing	provide	VERB
bam-14261	35	30	a	a	DET
bam-14261	35	31	reference	reference	NOUN
bam-14261	35	32	for	for	ADP
bam-14261	35	33	clinical	clinical	ADJ
bam-14261	35	34	diagnosis	diagnosis	NOUN
bam-14261	35	35	and	and	CCONJ
bam-14261	35	36	treatment	treatment	NOUN
bam-14261	35	37	in	in	ADP
bam-14261	35	38	this	this	DET
bam-14261	35	39	population	population	NOUN
bam-14261	35	40	,	,	PUNCT
bam-14261	35	41	notably	notably	ADV
bam-14261	35	42	,	,	PUNCT
bam-14261	35	43	s.	s.	PROPN
bam-14261	35	44	aureus	aureus	PROPN
bam-14261	35	45	infections	infection	NOUN
bam-14261	35	46	are	be	AUX
bam-14261	35	47	also	also	ADV
bam-14261	35	48	implicated	implicate	VERB
bam-14261	35	49	in	in	ADP
bam-14261	35	50	muscle	muscle	NOUN
bam-14261	35	51	complications	complication	NOUN
bam-14261	35	52	such	such	ADJ
bam-14261	35	53	as	as	ADP
bam-14261	35	54	pyomyositis	pyomyositis	NOUN
bam-14261	35	55	and	and	CCONJ
bam-14261	35	56	inflammatory	inflammatory	ADJ
bam-14261	35	57	myopathies	myopathy	NOUN
bam-14261	35	58	,	,	PUNCT
bam-14261	35	59	suggesting	suggest	VERB
bam-14261	35	60	that	that	SCONJ
bam-14261	35	61	mastitis	mastitis	NOUN
bam-14261	35	62	caused	cause	VERB
bam-14261	35	63	by	by	ADP
bam-14261	35	64	virulent	virulent	NOUN
bam-14261	35	65	strains	strain	NOUN
bam-14261	35	66	may	may	AUX
bam-14261	35	67	have	have	VERB
bam-14261	35	68	broader	broad	ADJ
bam-14261	35	69	systemic	systemic	ADJ
bam-14261	35	70	muscular	muscular	ADJ
bam-14261	35	71	implications	implication	NOUN
bam-14261	35	72	.	.	PUNCT
bam-14261	36	1	the	the	DET
bam-14261	36	2	findings	finding	NOUN
bam-14261	36	3	are	be	AUX
bam-14261	36	4	presented	present	VERB
bam-14261	36	5	as	as	SCONJ
bam-14261	36	6	follows	follow	VERB
bam-14261	36	7	.	.	PUNCT
bam-14261	37	1	materials	material	NOUN
bam-14261	37	2	and	and	CCONJ
bam-14261	37	3	methods	method	NOUN
bam-14261	37	4	clinical	clinical	ADJ
bam-14261	37	5	data	datum	NOUN
bam-14261	37	6	a	a	DET
bam-14261	37	7	total	total	NOUN
bam-14261	37	8	of	of	ADP
bam-14261	37	9	158	158	NUM
bam-14261	37	10	lactating	lactate	VERB
bam-14261	37	11	patients	patient	NOUN
bam-14261	37	12	with	with	ADP
bam-14261	37	13	culture	culture	NOUN
bam-14261	37	14	-	-	PUNCT
bam-14261	37	15	positive	positive	ADJ
bam-14261	37	16	infectious	infectious	ADJ
bam-14261	37	17	mastitis	mastitis	NOUN
bam-14261	37	18	,	,	PUNCT
bam-14261	37	19	admitted	admit	VERB
bam-14261	37	20	to	to	ADP
bam-14261	37	21	hangzhou	hangzhou	PROPN
bam-14261	37	22	linping	linpe	VERB
bam-14261	37	23	district	district	PROPN
bam-14261	37	24	maternal	maternal	ADJ
bam-14261	37	25	and	and	CCONJ
bam-14261	37	26	child	child	NOUN
bam-14261	37	27	health	health	NOUN
bam-14261	37	28	hospital	hospital	NOUN
bam-14261	37	29	between	between	ADP
bam-14261	37	30	january	january	PROPN
bam-14261	37	31	2021	2021	NUM
bam-14261	37	32	and	and	CCONJ
bam-14261	37	33	april	april	PROPN
bam-14261	37	34	2024	2024	NUM
bam-14261	37	35	,	,	PUNCT
bam-14261	37	36	were	be	AUX
bam-14261	37	37	included	include	VERB
bam-14261	37	38	in	in	ADP
bam-14261	37	39	this	this	DET
bam-14261	37	40	study	study	NOUN
bam-14261	37	41	.	.	PUNCT
bam-14261	38	1	among	among	ADP
bam-14261	38	2	them	they	PRON
bam-14261	38	3	,	,	PUNCT
bam-14261	38	4	staphylococcus	staphylococcus	NOUN
bam-14261	38	5	aureus	aureus	NOUN
bam-14261	38	6	was	be	AUX
bam-14261	38	7	isolated	isolate	VERB
bam-14261	38	8	in	in	ADP
bam-14261	38	9	119	119	NUM
bam-14261	38	10	cases	case	NOUN
bam-14261	38	11	,	,	PUNCT
bam-14261	38	12	comprising	comprise	VERB
bam-14261	38	13	82	82	NUM
bam-14261	38	14	strains	strain	NOUN
bam-14261	38	15	of	of	ADP
bam-14261	38	16	mrsa	mrsa	NOUN
bam-14261	38	17	and	and	CCONJ
bam-14261	38	18	37	37	NUM
bam-14261	38	19	strains	strain	NOUN
bam-14261	38	20	of	of	ADP
bam-14261	38	21	mssa	mssa	ADJ
bam-14261	38	22	.	.	PUNCT
bam-14261	39	1	bilateral	bilateral	ADJ
bam-14261	39	2	involvement	involvement	NOUN
bam-14261	39	3	was	be	AUX
bam-14261	39	4	observed	observe	VERB
bam-14261	39	5	in	in	ADP
bam-14261	39	6	37	37	NUM
bam-14261	39	7	patients	patient	NOUN
bam-14261	39	8	,	,	PUNCT
bam-14261	39	9	and	and	CCONJ
bam-14261	39	10	unilateral	unilateral	ADJ
bam-14261	39	11	involvement	involvement	NOUN
bam-14261	39	12	in	in	ADP
bam-14261	39	13	121	121	NUM
bam-14261	39	14	.	.	PUNCT
bam-14261	40	1	patients	patient	NOUN
bam-14261	40	2	ranged	range	VERB
bam-14261	40	3	in	in	ADP
bam-14261	40	4	age	age	NOUN
bam-14261	40	5	from	from	ADP
bam-14261	40	6	20	20	NUM
bam-14261	40	7	to	to	PART
bam-14261	40	8	45	45	NUM
bam-14261	40	9	years	year	NOUN
bam-14261	40	10	,	,	PUNCT
bam-14261	40	11	with	with	ADP
bam-14261	40	12	a	a	DET
bam-14261	40	13	mean	mean	ADJ
bam-14261	40	14	age	age	NOUN
bam-14261	40	15	of	of	ADP
bam-14261	40	16	(	(	PUNCT
bam-14261	40	17	30.67	30.67	NUM
bam-14261	40	18	 	 	SPACE
bam-14261	40	19	±	±	NOUN
bam-14261	40	20	 	 	SPACE
bam-14261	40	21	2.58	2.58	NUM
bam-14261	40	22	)	)	PUNCT
bam-14261	40	23	years	year	NOUN
bam-14261	40	24	.	.	PUNCT
bam-14261	41	1	among	among	ADP
bam-14261	41	2	them	they	PRON
bam-14261	41	3	,	,	PUNCT
bam-14261	41	4	66	66	NUM
bam-14261	41	5	were	be	AUX
bam-14261	41	6	outpatients	outpatient	NOUN
bam-14261	41	7	and	and	CCONJ
bam-14261	41	8	92	92	NUM
bam-14261	41	9	were	be	AUX
bam-14261	41	10	hospitalized	hospitalize	VERB
bam-14261	41	11	.	.	PUNCT
bam-14261	42	1	inclusion	inclusion	NOUN
bam-14261	42	2	criteria	criterion	NOUN
bam-14261	42	3	all	all	DET
bam-14261	42	4	patients	patient	NOUN
bam-14261	42	5	met	meet	VERB
bam-14261	42	6	the	the	DET
bam-14261	42	7	diagnostic	diagnostic	ADJ
bam-14261	42	8	criteria	criterion	NOUN
bam-14261	42	9	for	for	ADP
bam-14261	42	10	infectious	infectious	ADJ
bam-14261	42	11	mastitis	mastitis	NOUN
bam-14261	42	12	during	during	ADP
bam-14261	42	13	lactation,9	lactation,9	NOUN
bam-14261	42	14	including	include	VERB
bam-14261	42	15	breast	breast	NOUN
bam-14261	42	16	pain	pain	NOUN
bam-14261	42	17	,	,	PUNCT
bam-14261	42	18	poor	poor	ADJ
bam-14261	42	19	milk	milk	NOUN
bam-14261	42	20	drainage	drainage	NOUN
bam-14261	42	21	,	,	PUNCT
bam-14261	42	22	local	local	ADJ
bam-14261	42	23	masses	masse	NOUN
bam-14261	42	24	in	in	ADP
bam-14261	42	25	the	the	DET
bam-14261	42	26	mammary	mammary	ADJ
bam-14261	42	27	gland	gland	NOUN
bam-14261	42	28	,	,	PUNCT
bam-14261	42	29	and	and	CCONJ
bam-14261	42	30	signs	sign	NOUN
bam-14261	42	31	of	of	ADP
bam-14261	42	32	inflammation	inflammation	NOUN
bam-14261	42	33	in	in	ADP
bam-14261	42	34	the	the	DET
bam-14261	42	35	affected	affected	ADJ
bam-14261	42	36	area	area	NOUN
bam-14261	42	37	(	(	PUNCT
bam-14261	42	38	increased	increase	VERB
bam-14261	42	39	skin	skin	NOUN
bam-14261	42	40	temperature	temperature	NOUN
bam-14261	42	41	,	,	PUNCT
bam-14261	42	42	redness	redness	NOUN
bam-14261	42	43	,	,	PUNCT
bam-14261	42	44	swelling	swelling	NOUN
bam-14261	42	45	,	,	PUNCT
bam-14261	42	46	and	and	CCONJ
bam-14261	42	47	tenderness	tenderness	NOUN
bam-14261	42	48	)	)	PUNCT
bam-14261	42	49	.	.	PUNCT
bam-14261	43	1	systemic	systemic	ADJ
bam-14261	43	2	symptoms	symptom	NOUN
bam-14261	43	3	included	include	VERB
bam-14261	43	4	fever	fever	NOUN
bam-14261	43	5	,	,	PUNCT
bam-14261	43	6	chills	chill	NOUN
bam-14261	43	7	,	,	PUNCT
bam-14261	43	8	generalized	generalized	ADJ
bam-14261	43	9	sweating	sweating	NOUN
bam-14261	43	10	,	,	PUNCT
bam-14261	43	11	dizziness	dizziness	NOUN
bam-14261	43	12	,	,	PUNCT
bam-14261	43	13	and	and	CCONJ
bam-14261	43	14	fatigue	fatigue	NOUN
bam-14261	43	15	.	.	PUNCT
bam-14261	44	1	all	all	DET
bam-14261	44	2	patients	patient	NOUN
bam-14261	44	3	had	have	VERB
bam-14261	44	4	positive	positive	ADJ
bam-14261	44	5	pathogen	pathogen	NOUN
bam-14261	44	6	cultures	culture	NOUN
bam-14261	44	7	and	and	CCONJ
bam-14261	44	8	no	no	DET
bam-14261	44	9	evidence	evidence	NOUN
bam-14261	44	10	of	of	ADP
bam-14261	44	11	upper	upper	ADJ
bam-14261	44	12	respiratory	respiratory	NOUN
bam-14261	44	13	or	or	CCONJ
bam-14261	44	14	other	other	ADJ
bam-14261	44	15	infections	infection	NOUN
bam-14261	44	16	,	,	PUNCT
bam-14261	44	17	fever	fever	NOUN
bam-14261	44	18	,	,	PUNCT
bam-14261	44	19	or	or	CCONJ
bam-14261	44	20	pre	pre	ADJ
bam-14261	44	21	-	-	ADJ
bam-14261	44	22	existing	exist	VERB
bam-14261	44	23	mastitis	mastitis	NOUN
bam-14261	44	24	prior	prior	ADV
bam-14261	44	25	to	to	ADP
bam-14261	44	26	lactation	lactation	NOUN
bam-14261	44	27	.	.	PUNCT
bam-14261	45	1	coagulation	coagulation	NOUN
bam-14261	45	2	function	function	NOUN
bam-14261	45	3	was	be	AUX
bam-14261	45	4	within	within	ADP
bam-14261	45	5	the	the	DET
bam-14261	45	6	normal	normal	ADJ
bam-14261	45	7	range	range	NOUN
bam-14261	45	8	.	.	PUNCT
bam-14261	46	1	exclusion	exclusion	NOUN
bam-14261	46	2	criteria	criterion	NOUN
bam-14261	46	3	patients	patient	NOUN
bam-14261	46	4	were	be	AUX
bam-14261	46	5	excluded	exclude	VERB
bam-14261	46	6	if	if	SCONJ
bam-14261	46	7	they	they	PRON
bam-14261	46	8	had	have	VERB
bam-14261	46	9	inflammatory	inflammatory	ADJ
bam-14261	46	10	breast	breast	NOUN
bam-14261	46	11	cancer	cancer	NOUN
bam-14261	46	12	,	,	PUNCT
bam-14261	46	13	non	non	ADJ
bam-14261	46	14	-	-	ADJ
bam-14261	46	15	lactational	lactational	ADJ
bam-14261	46	16	mastitis	mastitis	NOUN
bam-14261	46	17	,	,	PUNCT
bam-14261	46	18	untreated	untreated	ADJ
bam-14261	46	19	breast	breast	NOUN
bam-14261	46	20	tuberculosis	tuberculosis	NOUN
bam-14261	46	21	or	or	CCONJ
bam-14261	46	22	other	other	ADJ
bam-14261	46	23	unresolved	unresolved	ADJ
bam-14261	46	24	breast	breast	NOUN
bam-14261	46	25	diseases	disease	NOUN
bam-14261	46	26	,	,	PUNCT
bam-14261	46	27	severe	severe	ADJ
bam-14261	46	28	dysfunction	dysfunction	NOUN
bam-14261	46	29	of	of	ADP
bam-14261	46	30	major	major	ADJ
bam-14261	46	31	organs	organ	NOUN
bam-14261	46	32	(	(	PUNCT
bam-14261	46	33	heart	heart	NOUN
bam-14261	46	34	,	,	PUNCT
bam-14261	46	35	liver	liver	NOUN
bam-14261	46	36	,	,	PUNCT
bam-14261	46	37	kidney	kidney	NOUN
bam-14261	46	38	)	)	PUNCT
bam-14261	46	39	,	,	PUNCT
bam-14261	46	40	coexisting	coexist	VERB
bam-14261	46	41	malignancies	malignancy	NOUN
bam-14261	46	42	,	,	PUNCT
bam-14261	46	43	recent	recent	ADJ
bam-14261	46	44	use	use	NOUN
bam-14261	46	45	of	of	ADP
bam-14261	46	46	immunosuppressants	immunosuppressant	NOUN
bam-14261	46	47	or	or	CCONJ
bam-14261	46	48	antimicrobial	antimicrobial	ADJ
bam-14261	46	49	agents	agent	NOUN
bam-14261	46	50	,	,	PUNCT
bam-14261	46	51	or	or	CCONJ
bam-14261	46	52	a	a	DET
bam-14261	46	53	history	history	NOUN
bam-14261	46	54	of	of	ADP
bam-14261	46	55	immunological	immunological	ADJ
bam-14261	46	56	disorders	disorder	NOUN
bam-14261	46	57	.	.	PUNCT
bam-14261	47	1	this	this	DET
bam-14261	47	2	study	study	NOUN
bam-14261	47	3	was	be	AUX
bam-14261	47	4	approved	approve	VERB
bam-14261	47	5	by	by	ADP
bam-14261	47	6	the	the	DET
bam-14261	47	7	medical	medical	ADJ
bam-14261	47	8	ethics	ethic	NOUN
bam-14261	47	9	committee	committee	PROPN
bam-14261	47	10	of	of	ADP
bam-14261	47	11	our	our	PRON
bam-14261	47	12	hospital	hospital	NOUN
bam-14261	47	13	.	.	PUNCT
bam-14261	48	1	detection	detection	NOUN
bam-14261	48	2	of	of	ADP
bam-14261	48	3	s.	s.	PROPN
bam-14261	48	4	aureus	aureus	PROPN
bam-14261	48	5	resistance	resistance	NOUN
bam-14261	48	6	and	and	CCONJ
bam-14261	48	7	virulence	virulence	NOUN
bam-14261	48	8	genes	gene	NOUN
bam-14261	48	9	colonies	colony	NOUN
bam-14261	48	10	of	of	ADP
bam-14261	48	11	s.	s.	PROPN
bam-14261	48	12	aureus	aureus	PROPN
bam-14261	48	13	grown	grow	VERB
bam-14261	48	14	on	on	ADP
bam-14261	48	15	sheep	sheep	NOUN
bam-14261	48	16	blood	blood	NOUN
bam-14261	48	17	agar	agar	NOUN
bam-14261	48	18	were	be	AUX
bam-14261	48	19	selected	select	VERB
bam-14261	48	20	and	and	CCONJ
bam-14261	48	21	transferred	transfer	VERB
bam-14261	48	22	to	to	PART
bam-14261	48	23	centrifuge	centrifuge	VERB
bam-14261	48	24	tubes	tube	NOUN
bam-14261	48	25	containing	contain	VERB
bam-14261	48	26	double	double	ADJ
bam-14261	48	27	-	-	PUNCT
bam-14261	48	28	distilled	distil	VERB
bam-14261	48	29	water	water	NOUN
bam-14261	48	30	.	.	PUNCT
bam-14261	49	1	after	after	ADP
bam-14261	49	2	mixing	mix	VERB
bam-14261	49	3	,	,	PUNCT
bam-14261	49	4	proteinase	proteinase	NOUN
bam-14261	49	5	k	k	PROPN
bam-14261	49	6	(	(	PUNCT
bam-14261	49	7	0.2	0.2	NUM
bam-14261	49	8	mg	mg	NUM
bam-14261	49	9	/	/	SYM
bam-14261	49	10	ml	ml	NOUN
bam-14261	49	11	)	)	PUNCT
bam-14261	49	12	and	and	CCONJ
bam-14261	49	13	lysostaphin	lysostaphin	NOUN
bam-14261	49	14	(	(	PUNCT
bam-14261	49	15	16	16	NUM
bam-14261	49	16	u	u	NOUN
bam-14261	49	17	/	/	SYM
bam-14261	49	18	ml	ml	VERB
bam-14261	49	19	)	)	PUNCT
bam-14261	49	20	were	be	AUX
bam-14261	49	21	added	add	VERB
bam-14261	49	22	.	.	PUNCT
bam-14261	50	1	the	the	DET
bam-14261	50	2	mixture	mixture	NOUN
bam-14261	50	3	was	be	AUX
bam-14261	50	4	incubated	incubate	VERB
bam-14261	50	5	at	at	ADP
bam-14261	50	6	37	37	NUM
bam-14261	50	7	 	 	SPACE
bam-14261	50	8	°	°	ADP
bam-14261	50	9	c	c	NOUN
bam-14261	50	10	for	for	ADP
bam-14261	50	11	1	1	NUM
bam-14261	50	12	hour	hour	NOUN
bam-14261	50	13	.	.	PUNCT
bam-14261	51	1	bacterial	bacterial	ADJ
bam-14261	51	2	dna	dna	PROPN
bam-14261	51	3	was	be	AUX
bam-14261	51	4	extracted	extract	VERB
bam-14261	51	5	using	use	VERB
bam-14261	51	6	the	the	DET
bam-14261	51	7	boiling	boiling	NOUN
bam-14261	51	8	method	method	NOUN
bam-14261	51	9	.	.	PUNCT
bam-14261	52	1	briefly	briefly	NOUN
bam-14261	52	2	,	,	PUNCT
bam-14261	52	3	a	a	DET
bam-14261	52	4	bacterial	bacterial	ADJ
bam-14261	52	5	colony	colony	NOUN
bam-14261	52	6	was	be	AUX
bam-14261	52	7	transferred	transfer	VERB
bam-14261	52	8	into	into	ADP
bam-14261	52	9	600	600	NUM
bam-14261	52	10	μl	μl	ADP
bam-14261	52	11	of	of	ADP
bam-14261	52	12	lysis	lysis	NOUN
bam-14261	52	13	buffer	buffer	NOUN
bam-14261	52	14	,	,	PUNCT
bam-14261	52	15	vortexed	vortexe	VERB
bam-14261	52	16	thoroughly	thoroughly	ADV
bam-14261	52	17	,	,	PUNCT
bam-14261	52	18	and	and	CCONJ
bam-14261	52	19	boiled	boil	VERB
bam-14261	52	20	for	for	ADP
bam-14261	52	21	15	15	NUM
bam-14261	52	22	minutes	minute	NOUN
bam-14261	52	23	.	.	PUNCT
bam-14261	53	1	the	the	DET
bam-14261	53	2	sample	sample	NOUN
bam-14261	53	3	was	be	AUX
bam-14261	53	4	then	then	ADV
bam-14261	53	5	cooled	cool	VERB
bam-14261	53	6	and	and	CCONJ
bam-14261	53	7	centrifuged	centrifuge	VERB
bam-14261	53	8	at	at	ADP
bam-14261	53	9	12,000	12,000	NUM
bam-14261	53	10	rpm	rpm	NOUN
bam-14261	53	11	for	for	ADP
bam-14261	53	12	10	10	NUM
bam-14261	53	13	minutes	minute	NOUN
bam-14261	53	14	.	.	PUNCT
bam-14261	54	1	the	the	DET
bam-14261	54	2	supernatant	supernatant	NOUN
bam-14261	54	3	was	be	AUX
bam-14261	54	4	collected	collect	VERB
bam-14261	54	5	and	and	CCONJ
bam-14261	54	6	adjusted	adjust	VERB
bam-14261	54	7	to	to	ADP
bam-14261	54	8	a	a	DET
bam-14261	54	9	dna	dna	ADJ
bam-14261	54	10	concentration	concentration	NOUN
bam-14261	54	11	of	of	ADP
bam-14261	54	12	50–100	50–100	PROPN
bam-14261	54	13	ng	ng	PROPN
bam-14261	54	14	/	/	SYM
bam-14261	54	15	μl	μl	PROPN
bam-14261	54	16	to	to	PART
bam-14261	54	17	serve	serve	VERB
bam-14261	54	18	as	as	ADP
bam-14261	54	19	the	the	DET
bam-14261	54	20	pcr	pcr	NOUN
bam-14261	54	21	template	template	NOUN
bam-14261	54	22	.	.	PUNCT
bam-14261	55	1	polymerase	polymerase	NOUN
bam-14261	55	2	chain	chain	NOUN
bam-14261	55	3	reaction	reaction	NOUN
bam-14261	55	4	(	(	PUNCT
bam-14261	55	5	pcr	pcr	PROPN
bam-14261	55	6	)	)	PUNCT
bam-14261	55	7	was	be	AUX
bam-14261	55	8	employed	employ	VERB
bam-14261	55	9	to	to	PART
bam-14261	55	10	detect	detect	VERB
bam-14261	55	11	the	the	DET
bam-14261	55	12	expression	expression	NOUN
bam-14261	55	13	of	of	ADP
bam-14261	55	14	resistance	resistance	NOUN
bam-14261	55	15	and	and	CCONJ
bam-14261	55	16	virulence	virulence	NOUN
bam-14261	55	17	genes	gene	NOUN
bam-14261	55	18	in	in	ADP
bam-14261	55	19	s.	s.	PROPN
bam-14261	55	20	aureus	aureus	PROPN
bam-14261	55	21	.	.	PUNCT
bam-14261	56	1	primer	primer	NOUN
bam-14261	56	2	sequences	sequence	NOUN
bam-14261	56	3	are	be	AUX
bam-14261	56	4	shown	show	VERB
bam-14261	56	5	in	in	ADP
bam-14261	56	6	table	table	NOUN
bam-14261	56	7	1	1	NUM
bam-14261	56	8	and	and	CCONJ
bam-14261	56	9	were	be	AUX
bam-14261	56	10	designed	design	VERB
bam-14261	56	11	and	and	CCONJ
bam-14261	56	12	synthesized	synthesize	VERB
bam-14261	56	13	by	by	ADP
bam-14261	56	14	genscript	genscript	ADJ
bam-14261	56	15	biotech	biotech	NOUN
bam-14261	56	16	(	(	PUNCT
bam-14261	56	17	nanjing	nanjing	PROPN
bam-14261	56	18	,	,	PUNCT
bam-14261	56	19	china	china	PROPN
bam-14261	56	20	)	)	PUNCT
bam-14261	56	21	.	.	PUNCT
bam-14261	57	1	the	the	DET
bam-14261	57	2	pcr	pcr	PROPN
bam-14261	57	3	reaction	reaction	NOUN
bam-14261	57	4	mixture	mixture	NOUN
bam-14261	57	5	consisted	consist	VERB
bam-14261	57	6	of	of	ADP
bam-14261	57	7	:	:	PUNCT
bam-14261	57	8	2	2	NUM
bam-14261	57	9	μl	μl	NOUN
bam-14261	57	10	of	of	ADP
bam-14261	57	11	dna	dna	PROPN
bam-14261	57	12	template	template	NOUN
bam-14261	57	13	,	,	PUNCT
bam-14261	57	14	1	1	NUM
bam-14261	57	15	μl	μl	ADP
bam-14261	57	16	each	each	PRON
bam-14261	57	17	of	of	ADP
bam-14261	57	18	forward	forward	ADV
bam-14261	57	19	and	and	CCONJ
bam-14261	57	20	reverse	reverse	ADJ
bam-14261	57	21	primers	primer	NOUN
bam-14261	57	22	,	,	PUNCT
bam-14261	57	23	and	and	CCONJ
bam-14261	57	24	12.5	12.5	NUM
bam-14261	57	25	μl	μl	ADP
bam-14261	57	26	of	of	ADP
bam-14261	57	27	2×	2×	NUM
bam-14261	57	28	sybr	sybr	NOUN
bam-14261	57	29	premix	premix	PROPN
bam-14261	57	30	ex	ex	PROPN
bam-14261	57	31	taq	taq	NOUN
bam-14261	57	32	;	;	PUNCT
bam-14261	57	33	double	double	ADJ
bam-14261	57	34	-	-	PUNCT
bam-14261	57	35	distilled	distil	VERB
bam-14261	57	36	water	water	NOUN
bam-14261	57	37	was	be	AUX
bam-14261	57	38	added	add	VERB
bam-14261	57	39	to	to	ADP
bam-14261	57	40	a	a	DET
bam-14261	57	41	final	final	ADJ
bam-14261	57	42	volume	volume	NOUN
bam-14261	57	43	of	of	ADP
bam-14261	57	44	25	25	NUM
bam-14261	57	45	μl	μl	NOUN
bam-14261	57	46	.	.	PUNCT
bam-14261	58	1	pcr	pcr	ADJ
bam-14261	58	2	conditions	condition	NOUN
bam-14261	58	3	were	be	AUX
bam-14261	58	4	as	as	SCONJ
bam-14261	58	5	follows	follow	VERB
bam-14261	58	6	:	:	PUNCT
bam-14261	58	7	initial	initial	ADJ
bam-14261	58	8	denaturation	denaturation	NOUN
bam-14261	58	9	at	at	ADP
bam-14261	58	10	94	94	NUM
bam-14261	58	11	 	 	SPACE
bam-14261	58	12	°	°	PROPN
bam-14261	58	13	c	c	NOUN
bam-14261	58	14	for	for	ADP
bam-14261	58	15	5	5	NUM
bam-14261	58	16	minutes	minute	NOUN
bam-14261	58	17	;	;	PUNCT
bam-14261	58	18	40	40	NUM
bam-14261	58	19	cycles	cycle	NOUN
bam-14261	58	20	of	of	ADP
bam-14261	58	21	denaturation	denaturation	NOUN
bam-14261	58	22	at	at	ADP
bam-14261	58	23	94	94	NUM
bam-14261	58	24	 	 	SPACE
bam-14261	58	25	°	°	PROPN
bam-14261	58	26	c	c	NOUN
bam-14261	58	27	for	for	ADP
bam-14261	58	28	30	30	NUM
bam-14261	58	29	seconds	second	NOUN
bam-14261	58	30	,	,	PUNCT
bam-14261	58	31	annealing	anneal	VERB
bam-14261	58	32	at	at	ADP
bam-14261	58	33	55	55	NUM
bam-14261	58	34	 	 	SPACE
bam-14261	58	35	°	°	ADP
bam-14261	58	36	c	c	NOUN
bam-14261	58	37	for	for	ADP
bam-14261	58	38	30	30	NUM
bam-14261	58	39	seconds	second	NOUN
bam-14261	58	40	,	,	PUNCT
bam-14261	58	41	and	and	CCONJ
bam-14261	58	42	extension	extension	NOUN
bam-14261	58	43	at	at	ADP
bam-14261	58	44	72	72	NUM
bam-14261	58	45	 	 	SPACE
bam-14261	58	46	°	°	ADP
bam-14261	58	47	c	c	NOUN
bam-14261	58	48	for	for	ADP
bam-14261	58	49	1	1	NUM
bam-14261	58	50	minute	minute	NOUN
bam-14261	58	51	;	;	PUNCT
bam-14261	58	52	followed	follow	VERB
bam-14261	58	53	by	by	ADP
bam-14261	58	54	a	a	DET
bam-14261	58	55	final	final	ADJ
bam-14261	58	56	extension	extension	NOUN
bam-14261	58	57	at	at	ADP
bam-14261	58	58	72	72	NUM
bam-14261	58	59	 	 	SPACE
bam-14261	58	60	°	°	ADP
bam-14261	58	61	c	c	NOUN
bam-14261	58	62	for	for	ADP
bam-14261	58	63	10	10	NUM
bam-14261	58	64	minutes	minute	NOUN
bam-14261	58	65	.	.	PUNCT
bam-14261	59	1	distilled	distil	VERB
bam-14261	59	2	water	water	NOUN
bam-14261	59	3	served	serve	VERB
bam-14261	59	4	as	as	ADP
bam-14261	59	5	the	the	DET
bam-14261	59	6	negative	negative	ADJ
bam-14261	59	7	control	control	NOUN
bam-14261	59	8	,	,	PUNCT
bam-14261	59	9	and	and	CCONJ
bam-14261	59	10	target	target	NOUN
bam-14261	59	11	gene	gene	NOUN
bam-14261	59	12	dna	dna	PROPN
bam-14261	59	13	fragments	fragment	NOUN
bam-14261	59	14	were	be	AUX
bam-14261	59	15	used	use	VERB
bam-14261	59	16	as	as	ADP
bam-14261	59	17	positive	positive	ADJ
bam-14261	59	18	controls	control	NOUN
bam-14261	59	19	.	.	PUNCT
bam-14261	60	1	pcr	pcr	ADJ
bam-14261	60	2	products	product	NOUN
bam-14261	60	3	were	be	AUX
bam-14261	60	4	subjected	subject	VERB
bam-14261	60	5	to	to	ADP
bam-14261	60	6	2	2	NUM
bam-14261	60	7	%	%	NOUN
bam-14261	60	8	agarose	agarose	NOUN
bam-14261	60	9	gel	gel	NOUN
bam-14261	60	10	electrophoresis	electrophoresis	NOUN
bam-14261	60	11	and	and	CCONJ
bam-14261	60	12	visualized	visualize	VERB
bam-14261	60	13	using	use	VERB
bam-14261	60	14	a	a	DET
bam-14261	60	15	gel	gel	NOUN
bam-14261	60	16	documentation	documentation	NOUN
bam-14261	60	17	system	system	NOUN
bam-14261	60	18	.	.	PUNCT
bam-14261	61	1	pathogen	pathogen	NOUN
bam-14261	61	2	detection	detection	NOUN
bam-14261	61	3	and	and	CCONJ
bam-14261	61	4	antimicrobial	antimicrobial	ADJ
bam-14261	61	5	susceptibility	susceptibility	NOUN
bam-14261	61	6	testing	testing	NOUN
bam-14261	61	7	in	in	ADP
bam-14261	61	8	patients	patient	NOUN
bam-14261	61	9	with	with	ADP
bam-14261	61	10	suspected	suspect	VERB
bam-14261	61	11	infection	infection	NOUN
bam-14261	61	12	,	,	PUNCT
bam-14261	61	13	breast	breast	NOUN
bam-14261	61	14	milk	milk	NOUN
bam-14261	61	15	or	or	CCONJ
bam-14261	61	16	pus	pus	NOUN
bam-14261	61	17	from	from	ADP
bam-14261	61	18	the	the	DET
bam-14261	61	19	lactiferous	lactiferous	ADJ
bam-14261	61	20	ducts	duct	NOUN
bam-14261	61	21	was	be	AUX
bam-14261	61	22	collected	collect	VERB
bam-14261	61	23	prior	prior	ADV
bam-14261	61	24	to	to	ADP
bam-14261	61	25	antimicrobial	antimicrobial	ADJ
bam-14261	61	26	treatment	treatment	NOUN
bam-14261	61	27	after	after	ADP
bam-14261	61	28	cleaning	clean	VERB
bam-14261	61	29	the	the	DET
bam-14261	61	30	nipple	nipple	NOUN
bam-14261	61	31	and	and	CCONJ
bam-14261	61	32	surrounding	surround	VERB
bam-14261	61	33	skin	skin	NOUN
bam-14261	61	34	.	.	PUNCT
bam-14261	62	1	for	for	ADP
bam-14261	62	2	patients	patient	NOUN
bam-14261	62	3	with	with	ADP
bam-14261	62	4	breast	breast	NOUN
bam-14261	62	5	abscesses	abscess	NOUN
bam-14261	62	6	,	,	PUNCT
bam-14261	62	7	puncture	puncture	NOUN
bam-14261	62	8	fluid	fluid	NOUN
bam-14261	62	9	or	or	CCONJ
bam-14261	62	10	discharge	discharge	VERB
bam-14261	62	11	from	from	ADP
bam-14261	62	12	ruptured	ruptured	ADJ
bam-14261	62	13	lesions	lesion	NOUN
bam-14261	62	14	was	be	AUX
bam-14261	62	15	collected	collect	VERB
bam-14261	62	16	as	as	ADP
bam-14261	62	17	the	the	DET
bam-14261	62	18	specimen	speciman	NOUN
bam-14261	62	19	.	.	PUNCT
bam-14261	63	1	all	all	DET
bam-14261	63	2	samples	sample	NOUN
bam-14261	63	3	were	be	AUX
bam-14261	63	4	inoculated	inoculate	VERB
bam-14261	63	5	onto	onto	ADP
bam-14261	63	6	sheep	sheep	NOUN
bam-14261	63	7	blood	blood	NOUN
bam-14261	63	8	agar	agar	NOUN
bam-14261	63	9	and	and	CCONJ
bam-14261	63	10	incubated	incubate	VERB
bam-14261	63	11	at	at	ADP
bam-14261	63	12	37	37	NUM
bam-14261	63	13	 	 	SPACE
bam-14261	63	14	°	°	ADP
bam-14261	63	15	c	c	NOUN
bam-14261	63	16	for	for	ADP
bam-14261	63	17	24–48	24–48	NUM
bam-14261	63	18	hours	hour	NOUN
bam-14261	63	19	.	.	PUNCT
bam-14261	64	1	bacterial	bacterial	ADJ
bam-14261	64	2	identification	identification	NOUN
bam-14261	64	3	was	be	AUX
bam-14261	64	4	performed	perform	VERB
bam-14261	64	5	using	use	VERB
bam-14261	64	6	a	a	DET
bam-14261	64	7	fully	fully	ADV
bam-14261	64	8	automated	automate	VERB
bam-14261	64	9	microbial	microbial	ADJ
bam-14261	64	10	identification	identification	NOUN
bam-14261	64	11	system	system	NOUN
bam-14261	64	12	(	(	PUNCT
bam-14261	64	13	vitek-32	vitek-32	PROPN
bam-14261	64	14	,	,	PUNCT
bam-14261	64	15	biomérieux	biomérieux	PROPN
bam-14261	64	16	,	,	PUNCT
bam-14261	64	17	france	france	PROPN
bam-14261	64	18	)	)	PUNCT
bam-14261	64	19	.	.	PUNCT
bam-14261	65	1	specimen	speciman	NOUN
bam-14261	65	2	collection	collection	NOUN
bam-14261	65	3	and	and	CCONJ
bam-14261	65	4	strain	strain	NOUN
bam-14261	65	5	identification	identification	NOUN
bam-14261	65	6	were	be	AUX
bam-14261	65	7	conducted	conduct	VERB
bam-14261	65	8	according	accord	VERB
bam-14261	65	9	to	to	ADP
bam-14261	65	10	relevant	relevant	ADJ
bam-14261	65	11	standard	standard	ADJ
bam-14261	65	12	operating	operate	VERB
bam-14261	65	13	procedures.10	procedures.10	NOUN
bam-14261	65	14	pathogens	pathogen	NOUN
bam-14261	65	15	were	be	AUX
bam-14261	65	16	identified	identify	VERB
bam-14261	65	17	based	base	VERB
bam-14261	65	18	on	on	ADP
bam-14261	65	19	colony	colony	NOUN
bam-14261	65	20	morphology	morphology	NOUN
bam-14261	65	21	,	,	PUNCT
bam-14261	65	22	gram	gram	PROPN
bam-14261	65	23	staining	staining	NOUN
bam-14261	65	24	,	,	PUNCT
bam-14261	65	25	biochemical	biochemical	ADJ
bam-14261	65	26	characteristics	characteristic	NOUN
bam-14261	65	27	,	,	PUNCT
bam-14261	65	28	and	and	CCONJ
bam-14261	65	29	other	other	ADJ
bam-14261	65	30	features	feature	NOUN
bam-14261	65	31	.	.	PUNCT
bam-14261	66	1	duplicate	duplicate	VERB
bam-14261	66	2	isolates	isolate	NOUN
bam-14261	66	3	from	from	ADP
bam-14261	66	4	the	the	DET
bam-14261	66	5	same	same	ADJ
bam-14261	66	6	patient	patient	NOUN
bam-14261	66	7	were	be	AUX
bam-14261	66	8	excluded	exclude	VERB
bam-14261	66	9	.	.	PUNCT
bam-14261	67	1	antimicrobial	antimicrobial	ADJ
bam-14261	67	2	susceptibility	susceptibility	NOUN
bam-14261	67	3	testing	testing	NOUN
bam-14261	67	4	was	be	AUX
bam-14261	67	5	performed	perform	VERB
bam-14261	67	6	using	use	VERB
bam-14261	67	7	the	the	DET
bam-14261	67	8	disk	disk	NOUN
bam-14261	67	9	diffusion	diffusion	NOUN
bam-14261	67	10	method	method	NOUN
bam-14261	67	11	(	(	PUNCT
bam-14261	67	12	oxoid	oxoid	PROPN
bam-14261	67	13	,	,	PUNCT
bam-14261	67	14	uk	uk	PROPN
bam-14261	67	15	)	)	PUNCT
bam-14261	67	16	,	,	PUNCT
bam-14261	67	17	and	and	CCONJ
bam-14261	67	18	interpretative	interpretative	ADJ
bam-14261	67	19	criteria	criterion	NOUN
bam-14261	67	20	were	be	AUX
bam-14261	67	21	based	base	VERB
bam-14261	67	22	on	on	ADP
bam-14261	67	23	relevant	relevant	ADJ
bam-14261	67	24	references.11	references.11	ADJ
bam-14261	67	25	mrsa	mrsa	NOUN
bam-14261	67	26	was	be	AUX
bam-14261	67	27	defined	define	VERB
bam-14261	67	28	as	as	SCONJ
bam-14261	67	29	isolates	isolate	NOUN
bam-14261	67	30	with	with	ADP
bam-14261	67	31	an	an	DET
bam-14261	67	32	oxacillin	oxacillin	ADJ
bam-14261	67	33	minimum	minimum	NOUN
bam-14261	67	34	inhibitory	inhibitory	ADJ
bam-14261	67	35	concentration	concentration	NOUN
bam-14261	67	36	(	(	PUNCT
bam-14261	67	37	mic	mic	ADJ
bam-14261	67	38	)	)	PUNCT
bam-14261	67	39	≥	≥	NOUN
bam-14261	67	40	4	4	NUM
bam-14261	67	41	mg	mg	PROPN
bam-14261	67	42	/	/	SYM
bam-14261	67	43	l.	l.	NOUN
bam-14261	67	44	colonising	colonise	VERB
bam-14261	67	45	strains	strain	NOUN
bam-14261	67	46	and	and	CCONJ
bam-14261	67	47	contaminants	contaminant	NOUN
bam-14261	67	48	were	be	AUX
bam-14261	67	49	excluded	exclude	VERB
bam-14261	67	50	.	.	PUNCT
bam-14261	68	1	quality	quality	NOUN
bam-14261	68	2	control	control	NOUN
bam-14261	68	3	strains	strain	NOUN
bam-14261	68	4	were	be	AUX
bam-14261	68	5	obtained	obtain	VERB
bam-14261	68	6	from	from	ADP
bam-14261	68	7	the	the	DET
bam-14261	68	8	atcc	atcc	PROPN
bam-14261	68	9	culture	culture	NOUN
bam-14261	68	10	collection	collection	NOUN
bam-14261	68	11	,	,	PUNCT
bam-14261	68	12	including	include	VERB
bam-14261	68	13	s.	s.	PROPN
bam-14261	68	14	aureus	aureus	PROPN
bam-14261	68	15	atcc	atcc	PROPN
bam-14261	68	16	25923	25923	NUM
bam-14261	68	17	,	,	PUNCT
bam-14261	68	18	klebsiella	klebsiella	PROPN
bam-14261	68	19	pneumoniae	pneumoniae	ADJ
bam-14261	68	20	atcc	atcc	NOUN
bam-14261	68	21	700603	700603	NUM
bam-14261	68	22	,	,	PUNCT
bam-14261	68	23	and	and	CCONJ
bam-14261	68	24	escherichia	escherichia	NOUN
bam-14261	68	25	coli	coli	NOUN
bam-14261	68	26	atcc	atcc	NOUN
bam-14261	68	27	25922	25922	NUM
bam-14261	68	28	.	.	PUNCT
bam-14261	69	1	statistical	statistical	ADJ
bam-14261	69	2	analysis	analysis	NOUN
bam-14261	69	3	a	a	DET
bam-14261	69	4	p	p	NOUN
bam-14261	69	5	-	-	PUNCT
bam-14261	69	6	value	value	NOUN
bam-14261	69	7	<	<	X
bam-14261	69	8	0.05	0.05	NUM
bam-14261	69	9	was	be	AUX
bam-14261	69	10	considered	consider	VERB
bam-14261	69	11	statistically	statistically	ADV
bam-14261	69	12	significant	significant	ADJ
bam-14261	69	13	.	.	PUNCT
bam-14261	70	1	statistical	statistical	ADJ
bam-14261	70	2	analyses	analysis	NOUN
bam-14261	70	3	were	be	AUX
bam-14261	70	4	conducted	conduct	VERB
bam-14261	70	5	using	use	VERB
bam-14261	70	6	spss	spss	PROPN
bam-14261	70	7	version	version	PROPN
bam-14261	70	8	26.0	26.0	NUM
bam-14261	70	9	.	.	PUNCT
bam-14261	71	1	categorical	categorical	ADJ
bam-14261	71	2	variables	variable	NOUN
bam-14261	71	3	were	be	AUX
bam-14261	71	4	expressed	express	VERB
bam-14261	71	5	as	as	ADP
bam-14261	71	6	n	n	PROPN
bam-14261	71	7	(	(	PUNCT
bam-14261	71	8	%	%	NOUN
bam-14261	71	9	)	)	PUNCT
bam-14261	71	10	and	and	CCONJ
bam-14261	71	11	compared	compare	VERB
bam-14261	71	12	using	use	VERB
bam-14261	71	13	the	the	DET
bam-14261	71	14	chisquare	chisquare	PROPN
bam-14261	71	15	test	test	NOUN
bam-14261	71	16	.	.	PUNCT
bam-14261	72	1	continuous	continuous	ADJ
bam-14261	72	2	variables	variable	NOUN
bam-14261	72	3	were	be	AUX
bam-14261	72	4	expressed	express	VERB
bam-14261	72	5	as	as	ADP
bam-14261	72	6	mean	mean	NOUN
bam-14261	72	7	±	±	NUM
bam-14261	72	8	standard	standard	ADJ
bam-14261	72	9	deviation	deviation	NOUN
bam-14261	72	10	(	(	PUNCT
bam-14261	72	11	x̄	x̄	PROPN
bam-14261	72	12	±	±	NUM
bam-14261	72	13	s	s	NOUN
bam-14261	72	14	)	)	PUNCT
bam-14261	72	15	,	,	PUNCT
bam-14261	72	16	and	and	CCONJ
bam-14261	72	17	between	between	ADP
bam-14261	72	18	-	-	PUNCT
bam-14261	72	19	group	group	NOUN
bam-14261	72	20	comparisons	comparison	NOUN
bam-14261	72	21	were	be	AUX
bam-14261	72	22	performed	perform	VERB
bam-14261	72	23	using	use	VERB
bam-14261	72	24	the	the	DET
bam-14261	72	25	independent	independent	ADJ
bam-14261	72	26	samples	sample	NOUN
bam-14261	72	27	t	t	NOUN
bam-14261	72	28	-	-	PUNCT
bam-14261	72	29	test	test	NOUN
bam-14261	72	30	.	.	PUNCT
bam-14261	73	1	normality	normality	NOUN
bam-14261	73	2	was	be	AUX
bam-14261	73	3	assessed	assess	VERB
bam-14261	73	4	by	by	ADP
bam-14261	73	5	the	the	DET
bam-14261	73	6	shapiro	shapiro	PROPN
bam-14261	73	7	-	-	PUNCT
bam-14261	73	8	wilk	wilk	NOUN
bam-14261	73	9	test	test	NOUN
bam-14261	73	10	.	.	PUNCT
bam-14261	74	1	results	result	VERB
bam-14261	74	2	detection	detection	NOUN
bam-14261	74	3	of	of	ADP
bam-14261	74	4	pathogenic	pathogenic	ADJ
bam-14261	74	5	bacteria	bacteria	NOUN
bam-14261	74	6	in	in	ADP
bam-14261	74	7	infectious	infectious	ADJ
bam-14261	74	8	mastitis	mastitis	NOUN
bam-14261	74	9	during	during	ADP
bam-14261	74	10	lactation	lactation	NOUN
bam-14261	74	11	a	a	DET
bam-14261	74	12	total	total	NOUN
bam-14261	74	13	of	of	ADP
bam-14261	74	14	158	158	NUM
bam-14261	74	15	pathogenic	pathogenic	ADJ
bam-14261	74	16	strains	strain	NOUN
bam-14261	74	17	were	be	AUX
bam-14261	74	18	isolated	isolate	VERB
bam-14261	74	19	from	from	ADP
bam-14261	74	20	158	158	NUM
bam-14261	74	21	lactating	lactate	VERB
bam-14261	74	22	patients	patient	NOUN
bam-14261	74	23	with	with	ADP
bam-14261	74	24	infectious	infectious	ADJ
bam-14261	74	25	mastitis	mastitis	NOUN
bam-14261	74	26	.	.	PUNCT
bam-14261	75	1	the	the	DET
bam-14261	75	2	majority	majority	NOUN
bam-14261	75	3	were	be	AUX
bam-14261	75	4	gram	gram	NOUN
bam-14261	75	5	-	-	PUNCT
bam-14261	75	6	positive	positive	ADJ
bam-14261	75	7	bacteria	bacteria	NOUN
bam-14261	75	8	.	.	PUNCT
bam-14261	76	1	staphylococcus	staphylococcus	NOUN
bam-14261	76	2	aureus	aureus	PROPN
bam-14261	76	3	was	be	AUX
bam-14261	76	4	detected	detect	VERB
bam-14261	76	5	in	in	ADP
bam-14261	76	6	119	119	NUM
bam-14261	76	7	cases	case	NOUN
bam-14261	76	8	,	,	PUNCT
bam-14261	76	9	accounting	account	VERB
bam-14261	76	10	for	for	ADP
bam-14261	76	11	the	the	DET
bam-14261	76	12	highest	high	ADJ
bam-14261	76	13	proportion	proportion	NOUN
bam-14261	76	14	(	(	PUNCT
bam-14261	76	15	table	table	NOUN
bam-14261	76	16	2	2	NUM
bam-14261	76	17	)	)	PUNCT
bam-14261	76	18	.	.	PUNCT
bam-14261	77	1	detection	detection	NOUN
bam-14261	77	2	of	of	ADP
bam-14261	77	3	drug	drug	NOUN
bam-14261	77	4	resistance	resistance	NOUN
bam-14261	77	5	genes	gene	NOUN
bam-14261	77	6	in	in	ADP
bam-14261	77	7	s.	s.	PROPN
bam-14261	77	8	aureus	aureus	PROPN
bam-14261	77	9	among	among	ADP
bam-14261	77	10	the	the	DET
bam-14261	77	11	119	119	NUM
bam-14261	77	12	s.	s.	PROPN
bam-14261	77	13	aureus	aureus	PROPN
bam-14261	77	14	isolates	isolate	NOUN
bam-14261	77	15	,	,	PUNCT
bam-14261	77	16	the	the	DET
bam-14261	77	17	most	most	ADV
bam-14261	77	18	frequently	frequently	ADV
bam-14261	77	19	detected	detect	VERB
bam-14261	77	20	resistance	resistance	NOUN
bam-14261	77	21	genes	gene	NOUN
bam-14261	77	22	were	be	AUX
bam-14261	77	23	aac(6′)/aph(2″	aac(6′)/aph(2″	PUNCT
bam-14261	77	24	)	)	PUNCT
bam-14261	77	25	,	,	PUNCT
bam-14261	77	26	blaz	blaz	PROPN
bam-14261	77	27	,	,	PUNCT
bam-14261	77	28	meca	meca	PROPN
bam-14261	77	29	,	,	PUNCT
bam-14261	77	30	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	77	31	,	,	PUNCT
bam-14261	77	32	and	and	CCONJ
bam-14261	77	33	qaca	qaca	NOUN
bam-14261	77	34	/	/	SYM
bam-14261	77	35	b	b	NOUN
bam-14261	77	36	,	,	PUNCT
bam-14261	77	37	with	with	ADP
bam-14261	77	38	detection	detection	NOUN
bam-14261	77	39	rates	rate	NOUN
bam-14261	77	40	of	of	ADP
bam-14261	77	41	100.00	100.00	NUM
bam-14261	77	42	%	%	NOUN
bam-14261	77	43	,	,	PUNCT
bam-14261	77	44	100.00	100.00	NUM
bam-14261	77	45	%	%	NOUN
bam-14261	77	46	,	,	PUNCT
bam-14261	77	47	100.00	100.00	NUM
bam-14261	77	48	%	%	NOUN
bam-14261	77	49	,	,	PUNCT
bam-14261	77	50	94.96	94.96	NUM
bam-14261	77	51	%	%	NOUN
bam-14261	77	52	,	,	PUNCT
bam-14261	77	53	and	and	CCONJ
bam-14261	77	54	84.87	84.87	NUM
bam-14261	77	55	%	%	NOUN
bam-14261	77	56	,	,	PUNCT
bam-14261	77	57	respectively	respectively	ADV
bam-14261	77	58	(	(	PUNCT
bam-14261	77	59	table	table	NOUN
bam-14261	77	60	3	3	NUM
bam-14261	77	61	)	)	PUNCT
bam-14261	77	62	.	.	PUNCT
bam-14261	78	1	antimicrobial	antimicrobial	ADJ
bam-14261	78	2	resistance	resistance	NOUN
bam-14261	78	3	in	in	ADP
bam-14261	78	4	mrsa	mrsa	NOUN
bam-14261	78	5	and	and	CCONJ
bam-14261	78	6	mssa	mssa	ADJ
bam-14261	78	7	both	both	PRON
bam-14261	78	8	mrsa	mrsa	NOUN
bam-14261	78	9	and	and	CCONJ
bam-14261	78	10	mssa	mssa	ADJ
bam-14261	78	11	strains	strain	NOUN
bam-14261	78	12	showed	show	VERB
bam-14261	78	13	high	high	ADJ
bam-14261	78	14	resistance	resistance	NOUN
bam-14261	78	15	to	to	ADP
bam-14261	78	16	penicillin	penicillin	PROPN
bam-14261	78	17	g	g	PROPN
bam-14261	78	18	,	,	PUNCT
bam-14261	78	19	erythromycin	erythromycin	NOUN
bam-14261	78	20	,	,	PUNCT
bam-14261	78	21	and	and	CCONJ
bam-14261	78	22	clindamycin	clindamycin	NOUN
bam-14261	78	23	,	,	PUNCT
bam-14261	78	24	while	while	SCONJ
bam-14261	78	25	remaining	remain	VERB
bam-14261	78	26	susceptible	susceptible	ADJ
bam-14261	78	27	to	to	ADP
bam-14261	78	28	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	78	29	,	,	PUNCT
bam-14261	78	30	linezolid	linezolid	NOUN
bam-14261	78	31	,	,	PUNCT
bam-14261	78	32	vancomycin	vancomycin	PROPN
bam-14261	78	33	,	,	PUNCT
bam-14261	78	34	and	and	CCONJ
bam-14261	78	35	rifampicin	rifampicin	VERB
bam-14261	78	36	.	.	PUNCT
bam-14261	79	1	compared	compare	VERB
bam-14261	79	2	with	with	ADP
bam-14261	79	3	mssa	mssa	ADJ
bam-14261	79	4	,	,	PUNCT
bam-14261	79	5	mrsa	mrsa	NOUN
bam-14261	79	6	showed	show	VERB
bam-14261	79	7	significantly	significantly	ADV
bam-14261	79	8	higher	high	ADJ
bam-14261	79	9	resistance	resistance	NOUN
bam-14261	79	10	rates	rate	NOUN
bam-14261	79	11	to	to	ADP
bam-14261	79	12	penicillin	penicillin	PROPN
bam-14261	79	13	g	g	PROPN
bam-14261	79	14	,	,	PUNCT
bam-14261	79	15	erythromycin	erythromycin	NOUN
bam-14261	79	16	,	,	PUNCT
bam-14261	79	17	clindamycin	clindamycin	NOUN
bam-14261	79	18	,	,	PUNCT
bam-14261	79	19	and	and	CCONJ
bam-14261	79	20	tetracycline	tetracycline	PROPN
bam-14261	79	21	(	(	PUNCT
bam-14261	79	22	p<0.05	p<0.05	PROPN
bam-14261	79	23	)	)	PUNCT
bam-14261	79	24	(	(	PUNCT
bam-14261	79	25	table	table	NOUN
bam-14261	79	26	4	4	NUM
bam-14261	79	27	)	)	PUNCT
bam-14261	79	28	.	.	PUNCT
bam-14261	80	1	detection	detection	NOUN
bam-14261	80	2	of	of	ADP
bam-14261	80	3	virulence	virulence	NOUN
bam-14261	80	4	genes	gene	NOUN
bam-14261	80	5	in	in	ADP
bam-14261	80	6	mrsa	mrsa	NOUN
bam-14261	80	7	and	and	CCONJ
bam-14261	80	8	mssa	mssa	ADJ
bam-14261	80	9	virulence	virulence	NOUN
bam-14261	80	10	genes	gene	NOUN
bam-14261	80	11	hla	hla	NOUN
bam-14261	80	12	,	,	PUNCT
bam-14261	80	13	clfb	clfb	NOUN
bam-14261	80	14	,	,	PUNCT
bam-14261	80	15	clfa	clfa	NOUN
bam-14261	80	16	,	,	PUNCT
bam-14261	80	17	and	and	CCONJ
bam-14261	80	18	fnba	fnba	PROPN
bam-14261	80	19	were	be	AUX
bam-14261	80	20	commonly	commonly	ADV
bam-14261	80	21	detected	detect	VERB
bam-14261	80	22	in	in	ADP
bam-14261	80	23	both	both	PRON
bam-14261	80	24	mrsa	mrsa	NOUN
bam-14261	80	25	and	and	CCONJ
bam-14261	80	26	mssa	mssa	ADJ
bam-14261	80	27	isolates	isolate	NOUN
bam-14261	80	28	.	.	PUNCT
bam-14261	81	1	the	the	DET
bam-14261	81	2	detection	detection	NOUN
bam-14261	81	3	rate	rate	NOUN
bam-14261	81	4	of	of	ADP
bam-14261	81	5	pvl	pvl	PROPN
bam-14261	81	6	was	be	AUX
bam-14261	81	7	significantly	significantly	ADV
bam-14261	81	8	lower	low	ADJ
bam-14261	81	9	in	in	ADP
bam-14261	81	10	mrsa	mrsa	NOUN
bam-14261	81	11	compared	compare	VERB
bam-14261	81	12	with	with	ADP
bam-14261	81	13	mssa	mssa	ADJ
bam-14261	81	14	(	(	PUNCT
bam-14261	81	15	p<0.05	p<0.05	NOUN
bam-14261	81	16	)	)	PUNCT
bam-14261	81	17	.	.	PUNCT
bam-14261	82	1	no	no	DET
bam-14261	82	2	statistically	statistically	ADV
bam-14261	82	3	significant	significant	ADJ
bam-14261	82	4	differences	difference	NOUN
bam-14261	82	5	were	be	AUX
bam-14261	82	6	observed	observe	VERB
bam-14261	82	7	for	for	ADP
bam-14261	82	8	the	the	DET
bam-14261	82	9	other	other	ADJ
bam-14261	82	10	virulence	virulence	NOUN
bam-14261	82	11	genes	gene	NOUN
bam-14261	82	12	(	(	PUNCT
bam-14261	82	13	p>0.05	p>0.05	NOUN
bam-14261	82	14	)	)	PUNCT
bam-14261	82	15	.	.	PUNCT
bam-14261	83	1	table	table	NOUN
bam-14261	83	2	5	5	NUM
bam-14261	83	3	.	.	PUNCT
bam-14261	84	1	detection	detection	NOUN
bam-14261	84	2	of	of	ADP
bam-14261	84	3	virulence	virulence	NOUN
bam-14261	84	4	genes	gene	NOUN
bam-14261	84	5	in	in	ADP
bam-14261	84	6	mrsa	mrsa	NOUN
bam-14261	84	7	and	and	CCONJ
bam-14261	84	8	mssa	mssa	ADJ
bam-14261	84	9	[	[	X
bam-14261	84	10	n	n	X
bam-14261	84	11	(	(	PUNCT
bam-14261	84	12	%	%	NOUN
bam-14261	84	13	)	)	PUNCT
bam-14261	84	14	]	]	PUNCT
bam-14261	84	15	.	.	PUNCT
bam-14261	85	1	to	to	PART
bam-14261	85	2	provide	provide	VERB
bam-14261	85	3	a	a	DET
bam-14261	85	4	concise	concise	ADJ
bam-14261	85	5	overview	overview	NOUN
bam-14261	85	6	,	,	PUNCT
bam-14261	85	7	the	the	DET
bam-14261	85	8	main	main	ADJ
bam-14261	85	9	resistance	resistance	NOUN
bam-14261	85	10	and	and	CCONJ
bam-14261	85	11	virulence	virulence	NOUN
bam-14261	85	12	patterns	pattern	NOUN
bam-14261	85	13	are	be	AUX
bam-14261	85	14	summarized	summarize	VERB
bam-14261	85	15	in	in	ADP
bam-14261	85	16	table	table	NOUN
bam-14261	85	17	6	6	NUM
bam-14261	85	18	.	.	PUNCT
bam-14261	86	1	discussion	discussion	NOUN
bam-14261	86	2	infectious	infectious	ADJ
bam-14261	86	3	mastitis	mastitis	NOUN
bam-14261	86	4	during	during	ADP
bam-14261	86	5	lactation	lactation	NOUN
bam-14261	86	6	is	be	AUX
bam-14261	86	7	often	often	ADV
bam-14261	86	8	caused	cause	VERB
bam-14261	86	9	by	by	ADP
bam-14261	86	10	milk	milk	NOUN
bam-14261	86	11	stasis	stasis	NOUN
bam-14261	86	12	resulting	result	VERB
bam-14261	86	13	from	from	ADP
bam-14261	86	14	inadequate	inadequate	ADJ
bam-14261	86	15	milk	milk	NOUN
bam-14261	86	16	drainage	drainage	NOUN
bam-14261	86	17	.	.	PUNCT
bam-14261	87	1	the	the	DET
bam-14261	87	2	condition	condition	NOUN
bam-14261	87	3	is	be	AUX
bam-14261	87	4	closely	closely	ADV
bam-14261	87	5	associated	associate	VERB
bam-14261	87	6	with	with	ADP
bam-14261	87	7	pathogen	pathogen	NOUN
bam-14261	87	8	invasion	invasion	NOUN
bam-14261	87	9	,	,	PUNCT
bam-14261	87	10	as	as	SCONJ
bam-14261	87	11	microorganisms	microorganism	NOUN
bam-14261	87	12	can	can	AUX
bam-14261	87	13	directly	directly	ADV
bam-14261	87	14	enter	enter	VERB
bam-14261	87	15	the	the	DET
bam-14261	87	16	lactiferous	lactiferous	ADJ
bam-14261	87	17	ducts	duct	NOUN
bam-14261	87	18	and	and	CCONJ
bam-14261	87	19	ascend	ascend	VERB
bam-14261	87	20	to	to	ADP
bam-14261	87	21	the	the	DET
bam-14261	87	22	lobules	lobule	NOUN
bam-14261	87	23	where	where	SCONJ
bam-14261	87	24	they	they	PRON
bam-14261	87	25	proliferate	proliferate	VERB
bam-14261	87	26	.	.	PUNCT
bam-14261	88	1	additionally	additionally	ADV
bam-14261	88	2	,	,	PUNCT
bam-14261	88	3	the	the	DET
bam-14261	88	4	decomposition	decomposition	NOUN
bam-14261	88	5	products	product	NOUN
bam-14261	88	6	of	of	ADP
bam-14261	88	7	milk	milk	NOUN
bam-14261	88	8	can	can	AUX
bam-14261	88	9	serve	serve	VERB
bam-14261	88	10	as	as	ADP
bam-14261	88	11	a	a	DET
bam-14261	88	12	nutrient	nutrient	NOUN
bam-14261	88	13	medium	medium	NOUN
bam-14261	88	14	for	for	ADP
bam-14261	88	15	bacterial	bacterial	ADJ
bam-14261	88	16	growth	growth	NOUN
bam-14261	88	17	,	,	PUNCT
bam-14261	88	18	which	which	PRON
bam-14261	88	19	further	far	ADV
bam-14261	88	20	facilitates	facilitate	VERB
bam-14261	88	21	infection.12,13	infection.12,13	NOUN
bam-14261	88	22	clinically	clinically	ADV
bam-14261	88	23	,	,	PUNCT
bam-14261	88	24	infectious	infectious	ADJ
bam-14261	88	25	mastitis	mastitis	NOUN
bam-14261	88	26	in	in	ADP
bam-14261	88	27	lactating	lactate	VERB
bam-14261	88	28	women	woman	NOUN
bam-14261	88	29	is	be	AUX
bam-14261	88	30	characterized	characterize	VERB
bam-14261	88	31	by	by	ADP
bam-14261	88	32	local	local	ADJ
bam-14261	88	33	signs	sign	NOUN
bam-14261	88	34	of	of	ADP
bam-14261	88	35	inflammation	inflammation	NOUN
bam-14261	88	36	such	such	ADJ
bam-14261	88	37	as	as	ADP
bam-14261	88	38	redness	redness	NOUN
bam-14261	88	39	,	,	PUNCT
bam-14261	88	40	swelling	swelling	NOUN
bam-14261	88	41	,	,	PUNCT
bam-14261	88	42	heat	heat	NOUN
bam-14261	88	43	,	,	PUNCT
bam-14261	88	44	and	and	CCONJ
bam-14261	88	45	pain	pain	NOUN
bam-14261	88	46	,	,	PUNCT
bam-14261	88	47	and	and	CCONJ
bam-14261	88	48	it	it	PRON
bam-14261	88	49	can	can	AUX
bam-14261	88	50	significantly	significantly	ADV
bam-14261	88	51	impair	impair	VERB
bam-14261	88	52	breastfeeding	breastfeeding	NOUN
bam-14261	88	53	,	,	PUNCT
bam-14261	88	54	maternal	maternal	ADJ
bam-14261	88	55	well	well	ADV
bam-14261	88	56	-	-	PUNCT
bam-14261	88	57	being	being	NOUN
bam-14261	88	58	,	,	PUNCT
bam-14261	88	59	and	and	CCONJ
bam-14261	88	60	infant	infant	VERB
bam-14261	88	61	nutrition	nutrition	NOUN
bam-14261	88	62	and	and	CCONJ
bam-14261	88	63	health.14,15	health.14,15	VERB
bam-14261	88	64	the	the	DET
bam-14261	88	65	main	main	ADJ
bam-14261	88	66	pathogen	pathogen	NOUN
bam-14261	88	67	involved	involve	VERB
bam-14261	88	68	is	be	AUX
bam-14261	88	69	staphylococcus	staphylococcus	NOUN
bam-14261	88	70	aureus	aureus	NOUN
bam-14261	88	71	,	,	PUNCT
bam-14261	88	72	which	which	PRON
bam-14261	88	73	often	often	ADV
bam-14261	88	74	carries	carry	VERB
bam-14261	88	75	multiple	multiple	ADJ
bam-14261	88	76	virulence	virulence	NOUN
bam-14261	88	77	genes	gene	NOUN
bam-14261	88	78	and	and	CCONJ
bam-14261	88	79	exhibits	exhibit	VERB
bam-14261	88	80	strong	strong	ADJ
bam-14261	88	81	pathogenicity	pathogenicity	NOUN
bam-14261	88	82	.	.	PUNCT
bam-14261	89	1	inadequate	inadequate	ADJ
bam-14261	89	2	or	or	CCONJ
bam-14261	89	3	delayed	delay	VERB
bam-14261	89	4	treatment	treatment	NOUN
bam-14261	89	5	may	may	AUX
bam-14261	89	6	result	result	VERB
bam-14261	89	7	in	in	ADP
bam-14261	89	8	recurrence	recurrence	NOUN
bam-14261	89	9	and	and	CCONJ
bam-14261	89	10	pose	pose	VERB
bam-14261	89	11	serious	serious	ADJ
bam-14261	89	12	health	health	NOUN
bam-14261	89	13	risks	risk	NOUN
bam-14261	89	14	to	to	ADP
bam-14261	89	15	both	both	DET
bam-14261	89	16	mother	mother	NOUN
bam-14261	89	17	and	and	CCONJ
bam-14261	89	18	infant.16,17	infant.16,17	VERB
bam-14261	89	19	although	although	SCONJ
bam-14261	89	20	a	a	DET
bam-14261	89	21	wide	wide	ADJ
bam-14261	89	22	range	range	NOUN
bam-14261	89	23	of	of	ADP
bam-14261	89	24	antibiotics	antibiotic	NOUN
bam-14261	89	25	is	be	AUX
bam-14261	89	26	available	available	ADJ
bam-14261	89	27	for	for	ADP
bam-14261	89	28	the	the	DET
bam-14261	89	29	treatment	treatment	NOUN
bam-14261	89	30	of	of	ADP
bam-14261	89	31	infectious	infectious	ADJ
bam-14261	89	32	mastitis	mastitis	NOUN
bam-14261	89	33	,	,	PUNCT
bam-14261	89	34	the	the	DET
bam-14261	89	35	frequent	frequent	ADJ
bam-14261	89	36	use	use	NOUN
bam-14261	89	37	of	of	ADP
bam-14261	89	38	broad	broad	ADJ
bam-14261	89	39	-	-	PUNCT
bam-14261	89	40	spectrum	spectrum	NOUN
bam-14261	89	41	agents	agent	NOUN
bam-14261	89	42	has	have	AUX
bam-14261	89	43	led	lead	VERB
bam-14261	89	44	to	to	ADP
bam-14261	89	45	increasing	increase	VERB
bam-14261	89	46	antimicrobial	antimicrobial	ADJ
bam-14261	89	47	resistance	resistance	NOUN
bam-14261	89	48	.	.	PUNCT
bam-14261	90	1	therefore	therefore	ADV
bam-14261	90	2	,	,	PUNCT
bam-14261	90	3	understanding	understand	VERB
bam-14261	90	4	the	the	DET
bam-14261	90	5	distribution	distribution	NOUN
bam-14261	90	6	and	and	CCONJ
bam-14261	90	7	resistance	resistance	NOUN
bam-14261	90	8	profiles	profile	NOUN
bam-14261	90	9	of	of	ADP
bam-14261	90	10	causative	causative	ADJ
bam-14261	90	11	bacteria	bacteria	NOUN
bam-14261	90	12	is	be	AUX
bam-14261	90	13	essential	essential	ADJ
bam-14261	90	14	for	for	ADP
bam-14261	90	15	guiding	guide	VERB
bam-14261	90	16	rational	rational	ADJ
bam-14261	90	17	antibiotic	antibiotic	ADJ
bam-14261	90	18	use	use	NOUN
bam-14261	90	19	in	in	ADP
bam-14261	90	20	clinical	clinical	ADJ
bam-14261	90	21	practice	practice	NOUN
bam-14261	90	22	.	.	PUNCT
bam-14261	91	1	this	this	DET
bam-14261	91	2	study	study	NOUN
bam-14261	91	3	investigated	investigate	VERB
bam-14261	91	4	the	the	DET
bam-14261	91	5	antimicrobial	antimicrobial	ADJ
bam-14261	91	6	susceptibility	susceptibility	NOUN
bam-14261	91	7	and	and	CCONJ
bam-14261	91	8	virulence	virulence	NOUN
bam-14261	91	9	gene	gene	NOUN
bam-14261	91	10	characteristics	characteristic	NOUN
bam-14261	91	11	of	of	ADP
bam-14261	91	12	s.	s.	PROPN
bam-14261	91	13	aureus	aureus	PROPN
bam-14261	91	14	in	in	ADP
bam-14261	91	15	lactating	lactate	VERB
bam-14261	91	16	patients	patient	NOUN
bam-14261	91	17	with	with	ADP
bam-14261	91	18	infectious	infectious	ADJ
bam-14261	91	19	mastitis	mastitis	NOUN
bam-14261	91	20	and	and	CCONJ
bam-14261	91	21	yielded	yield	VERB
bam-14261	91	22	several	several	ADJ
bam-14261	91	23	important	important	ADJ
bam-14261	91	24	findings	finding	NOUN
bam-14261	91	25	.	.	PUNCT
bam-14261	92	1	among	among	ADP
bam-14261	92	2	the	the	DET
bam-14261	92	3	158	158	NUM
bam-14261	92	4	strains	strain	NOUN
bam-14261	92	5	isolated	isolate	VERB
bam-14261	92	6	,	,	PUNCT
bam-14261	92	7	gram	gram	ADJ
bam-14261	92	8	-	-	PUNCT
bam-14261	92	9	positive	positive	ADJ
bam-14261	92	10	bacteria	bacteria	NOUN
bam-14261	92	11	were	be	AUX
bam-14261	92	12	predominant	predominant	ADJ
bam-14261	92	13	,	,	PUNCT
bam-14261	92	14	consistent	consistent	ADJ
bam-14261	92	15	with	with	ADP
bam-14261	92	16	previous	previous	ADJ
bam-14261	92	17	studies.181,9	studies.181,9	NOUN
bam-14261	92	18	based	base	VERB
bam-14261	92	19	on	on	ADP
bam-14261	92	20	susceptibility	susceptibility	NOUN
bam-14261	92	21	testing	testing	NOUN
bam-14261	92	22	,	,	PUNCT
bam-14261	92	23	targeted	target	VERB
bam-14261	92	24	antimicrobial	antimicrobial	ADJ
bam-14261	92	25	therapy	therapy	NOUN
bam-14261	92	26	may	may	AUX
bam-14261	92	27	be	be	AUX
bam-14261	92	28	applied	apply	VERB
bam-14261	92	29	.	.	PUNCT
bam-14261	93	1	we	we	PRON
bam-14261	93	2	further	far	ADV
bam-14261	93	3	found	find	VERB
bam-14261	93	4	that	that	SCONJ
bam-14261	93	5	s.	s.	PROPN
bam-14261	93	6	aureus	aureus	PROPN
bam-14261	93	7	was	be	AUX
bam-14261	93	8	isolated	isolate	VERB
bam-14261	93	9	in	in	ADP
bam-14261	93	10	119	119	NUM
bam-14261	93	11	cases	case	NOUN
bam-14261	93	12	,	,	PUNCT
bam-14261	93	13	with	with	ADP
bam-14261	93	14	mrsa	mrsa	NOUN
bam-14261	93	15	and	and	CCONJ
bam-14261	93	16	mssa	mssa	ADJ
bam-14261	93	17	both	both	PRON
bam-14261	93	18	showing	show	VERB
bam-14261	93	19	high	high	ADJ
bam-14261	93	20	resistance	resistance	NOUN
bam-14261	93	21	to	to	ADP
bam-14261	93	22	penicillin	penicillin	PROPN
bam-14261	93	23	g	g	PROPN
bam-14261	93	24	,	,	PUNCT
bam-14261	93	25	erythromycin	erythromycin	NOUN
bam-14261	93	26	,	,	PUNCT
bam-14261	93	27	and	and	CCONJ
bam-14261	93	28	clindamycin	clindamycin	NOUN
bam-14261	93	29	,	,	PUNCT
bam-14261	93	30	while	while	SCONJ
bam-14261	93	31	remaining	remain	VERB
bam-14261	93	32	susceptible	susceptible	ADJ
bam-14261	93	33	to	to	ADP
bam-14261	93	34	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	93	35	,	,	PUNCT
bam-14261	93	36	linezolid	linezolid	NOUN
bam-14261	93	37	,	,	PUNCT
bam-14261	93	38	vancomycin	vancomycin	PROPN
bam-14261	93	39	,	,	PUNCT
bam-14261	93	40	and	and	CCONJ
bam-14261	93	41	rifampicin	rifampicin	VERB
bam-14261	93	42	.	.	PUNCT
bam-14261	94	1	mrsa	mrsa	NOUN
bam-14261	94	2	demonstrated	demonstrate	VERB
bam-14261	94	3	significantly	significantly	ADV
bam-14261	94	4	higher	high	ADJ
bam-14261	94	5	resistance	resistance	NOUN
bam-14261	94	6	rates	rate	NOUN
bam-14261	94	7	to	to	ADP
bam-14261	94	8	penicillin	penicillin	PROPN
bam-14261	94	9	g	g	PROPN
bam-14261	94	10	,	,	PUNCT
bam-14261	94	11	erythromycin	erythromycin	NOUN
bam-14261	94	12	,	,	PUNCT
bam-14261	94	13	clindamycin	clindamycin	NOUN
bam-14261	94	14	,	,	PUNCT
bam-14261	94	15	and	and	CCONJ
bam-14261	94	16	tetracycline	tetracycline	NOUN
bam-14261	94	17	compared	compare	VERB
bam-14261	94	18	with	with	ADP
bam-14261	94	19	mssa	mssa	ADJ
bam-14261	94	20	.	.	PUNCT
bam-14261	95	1	these	these	DET
bam-14261	95	2	findings	finding	NOUN
bam-14261	95	3	suggest	suggest	VERB
bam-14261	95	4	that	that	SCONJ
bam-14261	95	5	clinicians	clinician	NOUN
bam-14261	95	6	should	should	AUX
bam-14261	95	7	avoid	avoid	VERB
bam-14261	95	8	the	the	DET
bam-14261	95	9	use	use	NOUN
bam-14261	95	10	of	of	ADP
bam-14261	95	11	agents	agent	NOUN
bam-14261	95	12	with	with	ADP
bam-14261	95	13	high	high	ADJ
bam-14261	95	14	resistance	resistance	NOUN
bam-14261	95	15	rates	rate	NOUN
bam-14261	95	16	—	—	PUNCT
bam-14261	95	17	such	such	ADJ
bam-14261	95	18	as	as	ADP
bam-14261	95	19	penicillin	penicillin	PROPN
bam-14261	95	20	g	g	PROPN
bam-14261	95	21	,	,	PUNCT
bam-14261	95	22	erythromycin	erythromycin	NOUN
bam-14261	95	23	,	,	PUNCT
bam-14261	95	24	clindamycin	clindamycin	NOUN
bam-14261	95	25	,	,	PUNCT
bam-14261	95	26	and	and	CCONJ
bam-14261	95	27	tetracycline	tetracycline	NOUN
bam-14261	95	28	—	—	PUNCT
bam-14261	95	29	when	when	SCONJ
bam-14261	95	30	treating	treat	VERB
bam-14261	95	31	mrsa	mrsa	NOUN
bam-14261	95	32	-	-	PUNCT
bam-14261	95	33	related	relate	VERB
bam-14261	95	34	mastitis	mastitis	NOUN
bam-14261	95	35	.	.	PUNCT
bam-14261	96	1	instead	instead	ADV
bam-14261	96	2	,	,	PUNCT
bam-14261	96	3	antibiotics	antibiotic	NOUN
bam-14261	96	4	with	with	ADP
bam-14261	96	5	higher	high	ADJ
bam-14261	96	6	susceptibility	susceptibility	NOUN
bam-14261	96	7	rates	rate	NOUN
bam-14261	96	8	,	,	PUNCT
bam-14261	96	9	including	include	VERB
bam-14261	96	10	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	96	11	,	,	PUNCT
bam-14261	96	12	linezolid	linezolid	NOUN
bam-14261	96	13	,	,	PUNCT
bam-14261	96	14	vancomycin	vancomycin	PROPN
bam-14261	96	15	,	,	PUNCT
bam-14261	96	16	and	and	CCONJ
bam-14261	96	17	rifampicin	rifampicin	VERB
bam-14261	96	18	,	,	PUNCT
bam-14261	96	19	may	may	AUX
bam-14261	96	20	be	be	AUX
bam-14261	96	21	more	more	ADV
bam-14261	96	22	appropriate	appropriate	ADJ
bam-14261	96	23	.	.	PUNCT
bam-14261	97	1	the	the	DET
bam-14261	97	2	elevated	elevated	ADJ
bam-14261	97	3	resistance	resistance	NOUN
bam-14261	97	4	could	could	AUX
bam-14261	97	5	be	be	AUX
bam-14261	97	6	related	relate	VERB
bam-14261	97	7	to	to	ADP
bam-14261	97	8	increased	increase	VERB
bam-14261	97	9	and	and	CCONJ
bam-14261	97	10	repeated	repeat	VERB
bam-14261	97	11	exposure	exposure	NOUN
bam-14261	97	12	to	to	ADP
bam-14261	97	13	antimicrobials	antimicrobial	NOUN
bam-14261	97	14	,	,	PUNCT
bam-14261	97	15	resulting	result	VERB
bam-14261	97	16	in	in	ADP
bam-14261	97	17	structural	structural	ADJ
bam-14261	97	18	changes	change	NOUN
bam-14261	97	19	in	in	ADP
bam-14261	97	20	pathogens	pathogen	NOUN
bam-14261	97	21	and	and	CCONJ
bam-14261	97	22	altered	alter	VERB
bam-14261	97	23	drug	drug	NOUN
bam-14261	97	24	susceptibility	susceptibility	NOUN
bam-14261	97	25	.	.	PUNCT
bam-14261	98	1	it	it	PRON
bam-14261	98	2	should	should	AUX
bam-14261	98	3	also	also	ADV
bam-14261	98	4	be	be	AUX
bam-14261	98	5	noted	note	VERB
bam-14261	98	6	that	that	SCONJ
bam-14261	98	7	certain	certain	ADJ
bam-14261	98	8	antibiotics	antibiotic	NOUN
bam-14261	98	9	may	may	AUX
bam-14261	98	10	be	be	AUX
bam-14261	98	11	secreted	secrete	VERB
bam-14261	98	12	into	into	ADP
bam-14261	98	13	breast	breast	NOUN
bam-14261	98	14	milk	milk	NOUN
bam-14261	98	15	,	,	PUNCT
bam-14261	98	16	and	and	CCONJ
bam-14261	98	17	breastfeeding	breastfeeding	NOUN
bam-14261	98	18	should	should	AUX
bam-14261	98	19	be	be	AUX
bam-14261	98	20	suspended	suspend	VERB
bam-14261	98	21	during	during	ADP
bam-14261	98	22	treatment	treatment	NOUN
bam-14261	98	23	when	when	SCONJ
bam-14261	98	24	necessary	necessary	ADJ
bam-14261	98	25	.	.	PUNCT
bam-14261	99	1	the	the	DET
bam-14261	99	2	pathogenicity	pathogenicity	NOUN
bam-14261	99	3	of	of	ADP
bam-14261	99	4	s.	s.	PROPN
bam-14261	99	5	aureus	aureus	PROPN
bam-14261	99	6	is	be	AUX
bam-14261	99	7	determined	determine	VERB
bam-14261	99	8	by	by	ADP
bam-14261	99	9	its	its	PRON
bam-14261	99	10	virulence	virulence	NOUN
bam-14261	99	11	factors	factor	NOUN
bam-14261	99	12	,	,	PUNCT
bam-14261	99	13	which	which	PRON
bam-14261	99	14	play	play	VERB
bam-14261	99	15	roles	role	NOUN
bam-14261	99	16	in	in	ADP
bam-14261	99	17	colonization	colonization	NOUN
bam-14261	99	18	,	,	PUNCT
bam-14261	99	19	invasion	invasion	NOUN
bam-14261	99	20	,	,	PUNCT
bam-14261	99	21	and	and	CCONJ
bam-14261	99	22	proliferation	proliferation	NOUN
bam-14261	99	23	.	.	PUNCT
bam-14261	100	1	multiple	multiple	ADJ
bam-14261	100	2	virulence	virulence	NOUN
bam-14261	100	3	factors	factor	NOUN
bam-14261	100	4	act	act	VERB
bam-14261	100	5	in	in	ADP
bam-14261	100	6	concert	concert	NOUN
bam-14261	100	7	and	and	CCONJ
bam-14261	100	8	are	be	AUX
bam-14261	100	9	closely	closely	ADV
bam-14261	100	10	associated	associate	VERB
bam-14261	100	11	with	with	ADP
bam-14261	100	12	the	the	DET
bam-14261	100	13	development	development	NOUN
bam-14261	100	14	of	of	ADP
bam-14261	100	15	infectious	infectious	ADJ
bam-14261	100	16	mastitis	mastitis	NOUN
bam-14261	100	17	during	during	ADP
bam-14261	100	18	lactation.20,21	lactation.20,21	NOUN
bam-14261	100	19	previous	previous	ADJ
bam-14261	100	20	studies22	studies22	NOUN
bam-14261	100	21	have	have	AUX
bam-14261	100	22	shown	show	VERB
bam-14261	100	23	that	that	SCONJ
bam-14261	100	24	important	important	ADJ
bam-14261	100	25	virulence	virulence	NOUN
bam-14261	100	26	genes	gene	NOUN
bam-14261	100	27	of	of	ADP
bam-14261	100	28	s.	s.	PROPN
bam-14261	100	29	aureus	aureus	PROPN
bam-14261	100	30	include	include	VERB
bam-14261	100	31	those	those	DET
bam-14261	100	32	encoding	encoding	NOUN
bam-14261	100	33	enterotoxins	enterotoxin	NOUN
bam-14261	100	34	,	,	PUNCT
bam-14261	100	35	hemolysins	hemolysin	NOUN
bam-14261	100	36	,	,	PUNCT
bam-14261	100	37	exfoliative	exfoliative	ADJ
bam-14261	100	38	toxins	toxin	NOUN
bam-14261	100	39	,	,	PUNCT
bam-14261	100	40	leukocidins	leukocidin	NOUN
bam-14261	100	41	,	,	PUNCT
bam-14261	100	42	and	and	CCONJ
bam-14261	100	43	toxic	toxic	ADJ
bam-14261	100	44	shock	shock	NOUN
bam-14261	100	45	syndrome	syndrome	NOUN
bam-14261	100	46	toxin	toxin	NOUN
bam-14261	100	47	.	.	PUNCT
bam-14261	101	1	among	among	ADP
bam-14261	101	2	these	these	PRON
bam-14261	101	3	,	,	PUNCT
bam-14261	101	4	panton	panton	PROPN
bam-14261	101	5	–	–	PUNCT
bam-14261	101	6	valentine	valentine	NOUN
bam-14261	101	7	leukocidin	leukocidin	NOUN
bam-14261	101	8	(	(	PUNCT
bam-14261	101	9	pvl	pvl	NOUN
bam-14261	101	10	)	)	PUNCT
bam-14261	101	11	is	be	AUX
bam-14261	101	12	an	an	DET
bam-14261	101	13	extracellular	extracellular	ADJ
bam-14261	101	14	toxin	toxin	NOUN
bam-14261	101	15	capable	capable	ADJ
bam-14261	101	16	of	of	ADP
bam-14261	101	17	disrupting	disrupt	VERB
bam-14261	101	18	cell	cell	NOUN
bam-14261	101	19	membranes	membrane	NOUN
bam-14261	101	20	,	,	PUNCT
bam-14261	101	21	leading	lead	VERB
bam-14261	101	22	to	to	ADP
bam-14261	101	23	cell	cell	NOUN
bam-14261	101	24	lysis	lysis	NOUN
bam-14261	101	25	and	and	CCONJ
bam-14261	101	26	more	more	ADV
bam-14261	101	27	severe	severe	ADJ
bam-14261	101	28	infections.23	infections.23	PROPN
bam-14261	101	29	the	the	DET
bam-14261	101	30	hla	hla	PROPN
bam-14261	101	31	gene	gene	NOUN
bam-14261	101	32	encodes	encode	VERB
bam-14261	101	33	alpha	alpha	NOUN
bam-14261	101	34	-	-	PUNCT
bam-14261	101	35	hemolysin	hemolysin	NOUN
bam-14261	101	36	,	,	PUNCT
bam-14261	101	37	which	which	PRON
bam-14261	101	38	induces	induce	VERB
bam-14261	101	39	hemolysis	hemolysis	NOUN
bam-14261	101	40	by	by	ADP
bam-14261	101	41	inserting	insert	VERB
bam-14261	101	42	into	into	ADP
bam-14261	101	43	the	the	DET
bam-14261	101	44	hydrophobic	hydrophobic	NOUN
bam-14261	101	45	membrane	membrane	NOUN
bam-14261	101	46	of	of	ADP
bam-14261	101	47	red	red	ADJ
bam-14261	101	48	blood	blood	NOUN
bam-14261	101	49	cells	cell	NOUN
bam-14261	101	50	and	and	CCONJ
bam-14261	101	51	forming	form	VERB
bam-14261	101	52	pores.24	pores.24	NOUN
bam-14261	101	53	the	the	DET
bam-14261	101	54	clfb	clfb	NOUN
bam-14261	101	55	gene	gene	NOUN
bam-14261	101	56	,	,	PUNCT
bam-14261	101	57	part	part	NOUN
bam-14261	101	58	of	of	ADP
bam-14261	101	59	the	the	DET
bam-14261	101	60	clumping	clumping	ADJ
bam-14261	101	61	factor	factor	NOUN
bam-14261	101	62	adhesin	adhesin	NOUN
bam-14261	101	63	family	family	PROPN
bam-14261	101	64	,	,	PUNCT
bam-14261	101	65	is	be	AUX
bam-14261	101	66	critical	critical	ADJ
bam-14261	101	67	for	for	ADP
bam-14261	101	68	s.	s.	PROPN
bam-14261	101	69	aureus	aureus	PROPN
bam-14261	101	70	colonization	colonization	NOUN
bam-14261	101	71	and	and	CCONJ
bam-14261	101	72	infection	infection	NOUN
bam-14261	101	73	,	,	PUNCT
bam-14261	101	74	particularly	particularly	ADV
bam-14261	101	75	in	in	ADP
bam-14261	101	76	lactating	lactate	VERB
bam-14261	101	77	women	woman	NOUN
bam-14261	101	78	.	.	PUNCT
bam-14261	102	1	clfa	clfa	PROPN
bam-14261	102	2	,	,	PUNCT
bam-14261	102	3	another	another	DET
bam-14261	102	4	clumping	clumping	NOUN
bam-14261	102	5	factor	factor	NOUN
bam-14261	102	6	,	,	PUNCT
bam-14261	102	7	is	be	AUX
bam-14261	102	8	a	a	DET
bam-14261	102	9	surface	surface	NOUN
bam-14261	102	10	-	-	PUNCT
bam-14261	102	11	associated	associate	VERB
bam-14261	102	12	protein	protein	NOUN
bam-14261	102	13	that	that	PRON
bam-14261	102	14	mediates	mediate	VERB
bam-14261	102	15	bacterial	bacterial	ADJ
bam-14261	102	16	adherence	adherence	NOUN
bam-14261	102	17	to	to	PART
bam-14261	102	18	host	host	VERB
bam-14261	102	19	extracellular	extracellular	ADJ
bam-14261	102	20	matrix.25	matrix.25	NOUN
bam-14261	102	21	fnba	fnba	ADJ
bam-14261	102	22	encodes	encode	NOUN
bam-14261	102	23	fibronectin	fibronectin	NOUN
bam-14261	102	24	-	-	PUNCT
bam-14261	102	25	binding	bind	VERB
bam-14261	102	26	protein	protein	NOUN
bam-14261	102	27	a	a	NOUN
bam-14261	102	28	,	,	PUNCT
bam-14261	102	29	which	which	PRON
bam-14261	102	30	promotes	promote	VERB
bam-14261	102	31	adhesion	adhesion	NOUN
bam-14261	102	32	to	to	ADP
bam-14261	102	33	fibronectin	fibronectin	NOUN
bam-14261	102	34	on	on	ADP
bam-14261	102	35	host	host	NOUN
bam-14261	102	36	cells	cell	NOUN
bam-14261	102	37	,	,	PUNCT
bam-14261	102	38	facilitating	facilitate	VERB
bam-14261	102	39	tissue	tissue	NOUN
bam-14261	102	40	invasion.26	invasion.26	NOUN
bam-14261	102	41	our	our	PRON
bam-14261	102	42	results	result	NOUN
bam-14261	102	43	showed	show	VERB
bam-14261	102	44	high	high	ADJ
bam-14261	102	45	detection	detection	NOUN
bam-14261	102	46	rates	rate	NOUN
bam-14261	102	47	of	of	ADP
bam-14261	102	48	hla	hla	NOUN
bam-14261	102	49	,	,	PUNCT
bam-14261	102	50	clfb	clfb	NOUN
bam-14261	102	51	,	,	PUNCT
bam-14261	102	52	clfa	clfa	NOUN
bam-14261	102	53	,	,	PUNCT
bam-14261	102	54	and	and	CCONJ
bam-14261	102	55	fnba	fnba	ADJ
bam-14261	102	56	in	in	ADP
bam-14261	102	57	both	both	PRON
bam-14261	102	58	mrsa	mrsa	NOUN
bam-14261	102	59	and	and	CCONJ
bam-14261	102	60	mssa	mssa	ADJ
bam-14261	102	61	isolates	isolate	NOUN
bam-14261	102	62	.	.	PUNCT
bam-14261	103	1	interestingly	interestingly	ADV
bam-14261	103	2	,	,	PUNCT
bam-14261	103	3	the	the	DET
bam-14261	103	4	detection	detection	NOUN
bam-14261	103	5	rate	rate	NOUN
bam-14261	103	6	of	of	ADP
bam-14261	103	7	pvl	pvl	PROPN
bam-14261	103	8	was	be	AUX
bam-14261	103	9	significantly	significantly	ADV
bam-14261	103	10	lower	low	ADJ
bam-14261	103	11	in	in	ADP
bam-14261	103	12	mrsa	mrsa	NOUN
bam-14261	103	13	than	than	ADP
bam-14261	103	14	in	in	ADP
bam-14261	103	15	mssa	mssa	NOUN
bam-14261	103	16	.	.	PUNCT
bam-14261	104	1	this	this	PRON
bam-14261	104	2	suggests	suggest	VERB
bam-14261	104	3	that	that	SCONJ
bam-14261	104	4	s.	s.	PROPN
bam-14261	104	5	aureus	aureus	PROPN
bam-14261	104	6	strains	strain	VERB
bam-14261	104	7	causing	cause	VERB
bam-14261	104	8	infectious	infectious	ADJ
bam-14261	104	9	mastitis	mastitis	NOUN
bam-14261	104	10	in	in	ADP
bam-14261	104	11	lactating	lactate	VERB
bam-14261	104	12	women	woman	NOUN
bam-14261	104	13	often	often	ADV
bam-14261	104	14	carry	carry	VERB
bam-14261	104	15	multiple	multiple	ADJ
bam-14261	104	16	virulence	virulence	NOUN
bam-14261	104	17	genes	gene	NOUN
bam-14261	104	18	with	with	ADP
bam-14261	104	19	strong	strong	ADJ
bam-14261	104	20	pathogenic	pathogenic	ADJ
bam-14261	104	21	potential	potential	NOUN
bam-14261	104	22	.	.	PUNCT
bam-14261	105	1	the	the	DET
bam-14261	105	2	lower	low	ADJ
bam-14261	105	3	detection	detection	NOUN
bam-14261	105	4	of	of	ADP
bam-14261	105	5	pvl	pvl	PROPN
bam-14261	105	6	in	in	ADP
bam-14261	105	7	mrsa	mrsa	NOUN
bam-14261	105	8	may	may	AUX
bam-14261	105	9	be	be	AUX
bam-14261	105	10	attributed	attribute	VERB
bam-14261	105	11	to	to	ADP
bam-14261	105	12	the	the	DET
bam-14261	105	13	lysogenic	lysogenic	ADJ
bam-14261	105	14	conversion	conversion	NOUN
bam-14261	105	15	mechanism	mechanism	NOUN
bam-14261	105	16	in	in	ADP
bam-14261	105	17	mssa	mssa	NOUN
bam-14261	105	18	via	via	ADP
bam-14261	105	19	bacteriophage	bacteriophage	NOUN
bam-14261	105	20	transduction	transduction	NOUN
bam-14261	105	21	,	,	PUNCT
bam-14261	105	22	which	which	PRON
bam-14261	105	23	enhances	enhance	VERB
bam-14261	105	24	pvl	pvl	NOUN
bam-14261	105	25	expression	expression	NOUN
bam-14261	105	26	and	and	CCONJ
bam-14261	105	27	enables	enable	VERB
bam-14261	105	28	horizontal	horizontal	ADJ
bam-14261	105	29	gene	gene	NOUN
bam-14261	105	30	transfer	transfer	NOUN
bam-14261	105	31	among	among	ADP
bam-14261	105	32	different	different	ADJ
bam-14261	105	33	strains	strain	NOUN
bam-14261	105	34	.	.	PUNCT
bam-14261	106	1	therefore	therefore	ADV
bam-14261	106	2	,	,	PUNCT
bam-14261	106	3	greater	great	ADJ
bam-14261	106	4	attention	attention	NOUN
bam-14261	106	5	should	should	AUX
bam-14261	106	6	be	be	AUX
bam-14261	106	7	paid	pay	VERB
bam-14261	106	8	to	to	ADP
bam-14261	106	9	the	the	DET
bam-14261	106	10	presence	presence	NOUN
bam-14261	106	11	of	of	ADP
bam-14261	106	12	pvl	pvl	PROPN
bam-14261	106	13	in	in	ADP
bam-14261	106	14	mssa	mssa	ADJ
bam-14261	106	15	isolates	isolate	NOUN
bam-14261	106	16	.	.	PUNCT
bam-14261	107	1	resistance	resistance	NOUN
bam-14261	107	2	genes	gene	NOUN
bam-14261	107	3	such	such	ADJ
bam-14261	107	4	as	as	ADP
bam-14261	107	5	aac(6′)/aph(2″	aac(6′)/aph(2″	PUNCT
bam-14261	107	6	)	)	PUNCT
bam-14261	107	7	and	and	CCONJ
bam-14261	107	8	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	107	9	are	be	AUX
bam-14261	107	10	aminoglycoside	aminoglycoside	ADJ
bam-14261	107	11	resistance	resistance	NOUN
bam-14261	107	12	determinants	determinant	NOUN
bam-14261	107	13	.	.	PUNCT
bam-14261	108	1	blaz	blaz	PROPN
bam-14261	108	2	is	be	AUX
bam-14261	108	3	associated	associate	VERB
bam-14261	108	4	with	with	ADP
bam-14261	108	5	penicillin	penicillin	NOUN
bam-14261	108	6	resistance	resistance	NOUN
bam-14261	108	7	.	.	PUNCT
bam-14261	109	1	the	the	DET
bam-14261	109	2	meca	meca	PROPN
bam-14261	109	3	gene	gene	NOUN
bam-14261	109	4	encodes	encode	NOUN
bam-14261	109	5	penicillinbinding	penicillinbinde	VERB
bam-14261	109	6	protein	protein	NOUN
bam-14261	109	7	2a	2a	NUM
bam-14261	109	8	(	(	PUNCT
bam-14261	109	9	pbp2a	pbp2a	NUM
bam-14261	109	10	)	)	PUNCT
bam-14261	109	11	,	,	PUNCT
bam-14261	109	12	an	an	DET
bam-14261	109	13	alternative	alternative	ADJ
bam-14261	109	14	form	form	NOUN
bam-14261	109	15	of	of	ADP
bam-14261	109	16	the	the	DET
bam-14261	109	17	native	native	ADJ
bam-14261	109	18	penicillin	penicillin	NOUN
bam-14261	109	19	-	-	PUNCT
bam-14261	109	20	binding	bind	VERB
bam-14261	109	21	protein	protein	NOUN
bam-14261	109	22	in	in	ADP
bam-14261	109	23	s.	s.	PROPN
bam-14261	109	24	aureus	aureus	PROPN
bam-14261	109	25	.	.	PUNCT
bam-14261	110	1	the	the	DET
bam-14261	110	2	qaca	qaca	PROPN
bam-14261	110	3	/	/	SYM
bam-14261	110	4	b	b	NOUN
bam-14261	110	5	genes	gene	NOUN
bam-14261	110	6	encode	encode	VERB
bam-14261	110	7	efflux	efflux	NOUN
bam-14261	110	8	pump	pump	NOUN
bam-14261	110	9	proteins	protein	NOUN
bam-14261	110	10	that	that	PRON
bam-14261	110	11	confer	confer	VERB
bam-14261	110	12	resistance	resistance	NOUN
bam-14261	110	13	to	to	ADP
bam-14261	110	14	antiseptics	antiseptic	NOUN
bam-14261	110	15	and	and	CCONJ
bam-14261	110	16	disinfectants	disinfectant	NOUN
bam-14261	110	17	,	,	PUNCT
bam-14261	110	18	including	include	VERB
bam-14261	110	19	quaternary	quaternary	ADJ
bam-14261	110	20	ammonium	ammonium	NOUN
bam-14261	110	21	compounds	compound	NOUN
bam-14261	110	22	,	,	PUNCT
bam-14261	110	23	guanidine	guanidine	NOUN
bam-14261	110	24	derivatives	derivative	NOUN
bam-14261	110	25	,	,	PUNCT
bam-14261	110	26	and	and	CCONJ
bam-14261	110	27	biguanides	biguanide	NOUN
bam-14261	110	28	.	.	PUNCT
bam-14261	111	1	in	in	ADP
bam-14261	111	2	this	this	DET
bam-14261	111	3	study	study	NOUN
bam-14261	111	4	,	,	PUNCT
bam-14261	111	5	the	the	DET
bam-14261	111	6	most	most	ADV
bam-14261	111	7	frequently	frequently	ADV
bam-14261	111	8	detected	detect	VERB
bam-14261	111	9	resistance	resistance	NOUN
bam-14261	111	10	genes	gene	NOUN
bam-14261	111	11	in	in	ADP
bam-14261	111	12	s.	s.	PROPN
bam-14261	111	13	aureus	aureus	PROPN
bam-14261	111	14	were	be	AUX
bam-14261	111	15	aac(6′)/aph(2″	aac(6′)/aph(2″	PUNCT
bam-14261	111	16	)	)	PUNCT
bam-14261	111	17	,	,	PUNCT
bam-14261	111	18	blaz	blaz	PROPN
bam-14261	111	19	,	,	PUNCT
bam-14261	111	20	meca	meca	PROPN
bam-14261	111	21	,	,	PUNCT
bam-14261	111	22	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	111	23	,	,	PUNCT
bam-14261	111	24	and	and	CCONJ
bam-14261	111	25	qaca	qaca	PROPN
bam-14261	111	26	/	/	SYM
bam-14261	111	27	b	b	NOUN
bam-14261	111	28	,	,	PUNCT
bam-14261	111	29	indicating	indicate	VERB
bam-14261	111	30	that	that	SCONJ
bam-14261	111	31	these	these	DET
bam-14261	111	32	genes	gene	NOUN
bam-14261	111	33	are	be	AUX
bam-14261	111	34	common	common	ADJ
bam-14261	111	35	in	in	ADP
bam-14261	111	36	s.	s.	PROPN
bam-14261	111	37	aureus	aureus	PROPN
bam-14261	111	38	strains	strain	NOUN
bam-14261	111	39	isolated	isolate	VERB
bam-14261	111	40	from	from	ADP
bam-14261	111	41	lactating	lactate	VERB
bam-14261	111	42	women	woman	NOUN
bam-14261	111	43	with	with	ADP
bam-14261	111	44	infectious	infectious	ADJ
bam-14261	111	45	mastitis	mastitis	NOUN
bam-14261	111	46	.	.	PUNCT
bam-14261	112	1	although	although	SCONJ
bam-14261	112	2	the	the	DET
bam-14261	112	3	presence	presence	NOUN
bam-14261	112	4	of	of	ADP
bam-14261	112	5	resistance	resistance	NOUN
bam-14261	112	6	genes	gene	NOUN
bam-14261	112	7	does	do	AUX
bam-14261	112	8	not	not	PART
bam-14261	112	9	always	always	ADV
bam-14261	112	10	correspond	correspond	VERB
bam-14261	112	11	directly	directly	ADV
bam-14261	112	12	to	to	ADP
bam-14261	112	13	phenotypic	phenotypic	ADJ
bam-14261	112	14	resistance	resistance	NOUN
bam-14261	112	15	,	,	PUNCT
bam-14261	112	16	it	it	PRON
bam-14261	112	17	is	be	AUX
bam-14261	112	18	likely	likely	ADV
bam-14261	112	19	influenced	influence	VERB
bam-14261	112	20	by	by	ADP
bam-14261	112	21	the	the	DET
bam-14261	112	22	combined	combine	VERB
bam-14261	112	23	effects	effect	NOUN
bam-14261	112	24	of	of	ADP
bam-14261	112	25	multiple	multiple	ADJ
bam-14261	112	26	genes	gene	NOUN
bam-14261	112	27	.	.	PUNCT
bam-14261	113	1	this	this	DET
bam-14261	113	2	study	study	NOUN
bam-14261	113	3	has	have	VERB
bam-14261	113	4	several	several	ADJ
bam-14261	113	5	limitations	limitation	NOUN
bam-14261	113	6	,	,	PUNCT
bam-14261	113	7	including	include	VERB
bam-14261	113	8	a	a	DET
bam-14261	113	9	relatively	relatively	ADV
bam-14261	113	10	small	small	ADJ
bam-14261	113	11	sample	sample	NOUN
bam-14261	113	12	size	size	NOUN
bam-14261	113	13	and	and	CCONJ
bam-14261	113	14	its	its	PRON
bam-14261	113	15	single	single	ADJ
bam-14261	113	16	-	-	PUNCT
bam-14261	113	17	center	center	NOUN
bam-14261	113	18	design	design	NOUN
bam-14261	113	19	,	,	PUNCT
bam-14261	113	20	which	which	PRON
bam-14261	113	21	may	may	AUX
bam-14261	113	22	introduce	introduce	VERB
bam-14261	113	23	bias	bias	NOUN
bam-14261	113	24	and	and	CCONJ
bam-14261	113	25	limit	limit	VERB
bam-14261	113	26	the	the	DET
bam-14261	113	27	generalizability	generalizability	NOUN
bam-14261	113	28	of	of	ADP
bam-14261	113	29	the	the	DET
bam-14261	113	30	findings	finding	NOUN
bam-14261	113	31	.	.	PUNCT
bam-14261	114	1	despite	despite	SCONJ
bam-14261	114	2	these	these	DET
bam-14261	114	3	limitations	limitation	NOUN
bam-14261	114	4	,	,	PUNCT
bam-14261	114	5	the	the	DET
bam-14261	114	6	study	study	NOUN
bam-14261	114	7	provides	provide	VERB
bam-14261	114	8	valuable	valuable	ADJ
bam-14261	114	9	insights	insight	NOUN
bam-14261	114	10	into	into	ADP
bam-14261	114	11	the	the	DET
bam-14261	114	12	antimicrobial	antimicrobial	ADJ
bam-14261	114	13	susceptibility	susceptibility	NOUN
bam-14261	114	14	and	and	CCONJ
bam-14261	114	15	virulence	virulence	NOUN
bam-14261	114	16	gene	gene	NOUN
bam-14261	114	17	characteristics	characteristic	NOUN
bam-14261	114	18	of	of	ADP
bam-14261	114	19	s.	s.	PROPN
bam-14261	114	20	aureus	aureus	PROPN
bam-14261	114	21	in	in	ADP
bam-14261	114	22	lactating	lactate	VERB
bam-14261	114	23	women	woman	NOUN
bam-14261	114	24	with	with	ADP
bam-14261	114	25	infectious	infectious	ADJ
bam-14261	114	26	mastitis	mastitis	NOUN
bam-14261	114	27	.	.	PUNCT
bam-14261	115	1	future	future	ADJ
bam-14261	115	2	research	research	NOUN
bam-14261	115	3	with	with	ADP
bam-14261	115	4	a	a	DET
bam-14261	115	5	larger	large	ADJ
bam-14261	115	6	and	and	CCONJ
bam-14261	115	7	more	more	ADV
bam-14261	115	8	diverse	diverse	ADJ
bam-14261	115	9	patient	patient	ADJ
bam-14261	115	10	population	population	NOUN
bam-14261	115	11	is	be	AUX
bam-14261	115	12	warranted	warrant	VERB
bam-14261	115	13	to	to	PART
bam-14261	115	14	validate	validate	VERB
bam-14261	115	15	and	and	CCONJ
bam-14261	115	16	extend	extend	VERB
bam-14261	115	17	these	these	DET
bam-14261	115	18	findings	finding	NOUN
bam-14261	115	19	.	.	PUNCT
bam-14261	116	1	in	in	ADP
bam-14261	116	2	conclusion	conclusion	NOUN
bam-14261	116	3	,	,	PUNCT
bam-14261	116	4	most	most	ADJ
bam-14261	116	5	pathogens	pathogen	NOUN
bam-14261	116	6	isolated	isolate	VERB
bam-14261	116	7	from	from	ADP
bam-14261	116	8	lactating	lactate	VERB
bam-14261	116	9	women	woman	NOUN
bam-14261	116	10	with	with	ADP
bam-14261	116	11	infectious	infectious	ADJ
bam-14261	116	12	mastitis	mastitis	NOUN
bam-14261	116	13	were	be	AUX
bam-14261	116	14	grampositive	grampositive	ADJ
bam-14261	116	15	bacteria	bacteria	NOUN
bam-14261	116	16	,	,	PUNCT
bam-14261	116	17	with	with	ADP
bam-14261	116	18	s.	s.	PROPN
bam-14261	116	19	aureus	aureus	PROPN
bam-14261	116	20	being	be	AUX
bam-14261	116	21	the	the	DET
bam-14261	116	22	most	most	ADV
bam-14261	116	23	prevalent	prevalent	ADJ
bam-14261	116	24	.	.	PUNCT
bam-14261	117	1	mrsa	mrsa	NOUN
bam-14261	117	2	exhibited	exhibit	VERB
bam-14261	117	3	higher	high	ADJ
bam-14261	117	4	resistance	resistance	NOUN
bam-14261	117	5	rates	rate	NOUN
bam-14261	117	6	to	to	ADP
bam-14261	117	7	penicillin	penicillin	PROPN
bam-14261	117	8	g	g	PROPN
bam-14261	117	9	,	,	PUNCT
bam-14261	117	10	erythromycin	erythromycin	NOUN
bam-14261	117	11	,	,	PUNCT
bam-14261	117	12	clindamycin	clindamycin	NOUN
bam-14261	117	13	,	,	PUNCT
bam-14261	117	14	and	and	CCONJ
bam-14261	117	15	tetracycline	tetracycline	NOUN
bam-14261	117	16	than	than	ADP
bam-14261	117	17	mssa	mssa	ADJ
bam-14261	117	18	.	.	PUNCT
bam-14261	118	1	the	the	DET
bam-14261	118	2	most	most	ADV
bam-14261	118	3	frequently	frequently	ADV
bam-14261	118	4	detected	detect	VERB
bam-14261	118	5	resistance	resistance	NOUN
bam-14261	118	6	genes	gene	NOUN
bam-14261	118	7	included	include	VERB
bam-14261	118	8	aac(6′)/aph(2″	aac(6′)/aph(2″	PUNCT
bam-14261	118	9	)	)	PUNCT
bam-14261	118	10	,	,	PUNCT
bam-14261	118	11	blaz	blaz	PROPN
bam-14261	118	12	,	,	PUNCT
bam-14261	118	13	meca	meca	PROPN
bam-14261	118	14	,	,	PUNCT
bam-14261	118	15	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	118	16	,	,	PUNCT
bam-14261	118	17	and	and	CCONJ
bam-14261	119	1	qaca	qaca	PROPN
bam-14261	119	2	/	/	SYM
bam-14261	119	3	b.	b.	PROPN
bam-14261	120	1	the	the	DET
bam-14261	120	2	pvl	pvl	PROPN
bam-14261	120	3	virulence	virulence	NOUN
bam-14261	120	4	gene	gene	NOUN
bam-14261	120	5	was	be	AUX
bam-14261	120	6	less	less	ADV
bam-14261	120	7	frequently	frequently	ADV
bam-14261	120	8	detected	detect	VERB
bam-14261	120	9	in	in	ADP
bam-14261	120	10	mrsa	mrsa	NOUN
bam-14261	120	11	than	than	ADP
bam-14261	120	12	in	in	ADP
bam-14261	120	13	mssa	mssa	NOUN
bam-14261	120	14	.	.	PUNCT
bam-14261	121	1	these	these	DET
bam-14261	121	2	findings	finding	NOUN
bam-14261	121	3	may	may	AUX
bam-14261	121	4	help	help	VERB
bam-14261	121	5	guide	guide	VERB
bam-14261	121	6	targeted	target	VERB
bam-14261	121	7	clinical	clinical	ADJ
bam-14261	121	8	management	management	NOUN
bam-14261	121	9	strategies	strategy	NOUN
bam-14261	121	10	to	to	PART
bam-14261	121	11	reduce	reduce	VERB
bam-14261	121	12	the	the	DET
bam-14261	121	13	risk	risk	NOUN
bam-14261	121	14	and	and	CCONJ
bam-14261	121	15	progression	progression	NOUN
bam-14261	121	16	of	of	ADP
bam-14261	121	17	infectious	infectious	ADJ
bam-14261	121	18	mastitis	mastitis	NOUN
bam-14261	121	19	during	during	ADP
bam-14261	121	20	lactation	lactation	NOUN
bam-14261	121	21	.	.	PUNCT
bam-14261	122	1	as	as	SCONJ
bam-14261	122	2	presented	present	VERB
bam-14261	122	3	in	in	ADP
bam-14261	122	4	table	table	NOUN
bam-14261	122	5	6	6	NUM
bam-14261	122	6	,	,	PUNCT
bam-14261	122	7	there	there	PRON
bam-14261	122	8	was	be	VERB
bam-14261	122	9	a	a	DET
bam-14261	122	10	marked	mark	VERB
bam-14261	122	11	resistance	resistance	NOUN
bam-14261	122	12	to	to	ADP
bam-14261	122	13	penicillin	penicillin	PROPN
bam-14261	122	14	g	g	PROPN
bam-14261	122	15	,	,	PUNCT
bam-14261	122	16	erythromycin	erythromycin	NOUN
bam-14261	122	17	,	,	PUNCT
bam-14261	122	18	and	and	CCONJ
bam-14261	122	19	clindamycin	clindamycin	NOUN
bam-14261	122	20	,	,	PUNCT
bam-14261	122	21	however	however	ADV
bam-14261	122	22	,	,	PUNCT
bam-14261	122	23	vancomycin	vancomycin	PROPN
bam-14261	122	24	and	and	CCONJ
bam-14261	122	25	rifampicin	rifampicin	VERB
bam-14261	122	26	continued	continue	VERB
bam-14261	122	27	to	to	PART
bam-14261	122	28	be	be	AUX
bam-14261	122	29	effective	effective	ADJ
bam-14261	122	30	.	.	PUNCT
bam-14261	123	1	hla	hla	NOUN
bam-14261	123	2	,	,	PUNCT
bam-14261	123	3	clfb	clfb	NOUN
bam-14261	123	4	,	,	PUNCT
bam-14261	123	5	and	and	CCONJ
bam-14261	123	6	clfa	clfa	NOUN
bam-14261	123	7	were	be	AUX
bam-14261	123	8	virulence	virulence	NOUN
bam-14261	123	9	genes	gene	NOUN
bam-14261	123	10	that	that	PRON
bam-14261	123	11	were	be	AUX
bam-14261	123	12	common	common	ADJ
bam-14261	123	13	and	and	CCONJ
bam-14261	123	14	pvl	pvl	NOUN
bam-14261	123	15	was	be	AUX
bam-14261	123	16	more	more	ADV
bam-14261	123	17	common	common	ADJ
bam-14261	123	18	in	in	ADP
bam-14261	123	19	mssa	mssa	NOUN
bam-14261	123	20	.	.	PUNCT
bam-14261	124	1	these	these	DET
bam-14261	124	2	patterns	pattern	NOUN
bam-14261	124	3	directly	directly	ADV
bam-14261	124	4	impact	impact	VERB
bam-14261	124	5	clinical	clinical	ADJ
bam-14261	124	6	management	management	NOUN
bam-14261	124	7	.	.	PUNCT
bam-14261	125	1	our	our	PRON
bam-14261	125	2	findings	finding	NOUN
bam-14261	125	3	raise	raise	VERB
bam-14261	125	4	the	the	DET
bam-14261	125	5	possibility	possibility	NOUN
bam-14261	125	6	of	of	ADP
bam-14261	125	7	muscular	muscular	ADJ
bam-14261	125	8	complications	complication	NOUN
bam-14261	125	9	in	in	ADP
bam-14261	125	10	severe	severe	ADJ
bam-14261	125	11	s.	s.	PROPN
bam-14261	125	12	aureus	aureus	PROPN
bam-14261	125	13	mastitis	mastitis	PROPN
bam-14261	125	14	,	,	PUNCT
bam-14261	125	15	although	although	SCONJ
bam-14261	125	16	this	this	DET
bam-14261	125	17	link	link	NOUN
bam-14261	125	18	remains	remain	VERB
bam-14261	125	19	speculative	speculative	ADJ
bam-14261	125	20	.	.	PUNCT
bam-14261	126	1	certain	certain	ADJ
bam-14261	126	2	virulence	virulence	NOUN
bam-14261	126	3	factors	factor	NOUN
bam-14261	126	4	such	such	ADJ
bam-14261	126	5	as	as	ADP
bam-14261	126	6	α	α	NOUN
bam-14261	126	7	-	-	PUNCT
bam-14261	126	8	hemolysin	hemolysin	NOUN
bam-14261	126	9	and	and	CCONJ
bam-14261	126	10	pvl	pvl	NOUN
bam-14261	126	11	have	have	AUX
bam-14261	126	12	been	be	AUX
bam-14261	126	13	implicated	implicate	VERB
bam-14261	126	14	in	in	ADP
bam-14261	126	15	tissue	tissue	NOUN
bam-14261	126	16	invasion	invasion	NOUN
bam-14261	126	17	and	and	CCONJ
bam-14261	126	18	muscle	muscle	NOUN
bam-14261	126	19	injury	injury	NOUN
bam-14261	126	20	in	in	ADP
bam-14261	126	21	previous	previous	ADJ
bam-14261	126	22	studies	study	NOUN
bam-14261	126	23	,	,	PUNCT
bam-14261	126	24	but	but	CCONJ
bam-14261	126	25	direct	direct	ADJ
bam-14261	126	26	evidence	evidence	NOUN
bam-14261	126	27	from	from	ADP
bam-14261	126	28	our	our	PRON
bam-14261	126	29	cohort	cohort	NOUN
bam-14261	126	30	is	be	AUX
bam-14261	126	31	lacking	lack	VERB
bam-14261	126	32	.	.	PUNCT
bam-14261	127	1	future	future	ADJ
bam-14261	127	2	investigations	investigation	NOUN
bam-14261	127	3	using	use	VERB
bam-14261	127	4	muscle	muscle	NOUN
bam-14261	127	5	imaging	imaging	NOUN
bam-14261	127	6	,	,	PUNCT
bam-14261	127	7	cytokine	cytokine	ADJ
bam-14261	127	8	profiling	profiling	NOUN
bam-14261	127	9	,	,	PUNCT
bam-14261	127	10	or	or	CCONJ
bam-14261	127	11	biopsy	biopsy	NOUN
bam-14261	127	12	samples	sample	NOUN
bam-14261	127	13	are	be	AUX
bam-14261	127	14	needed	need	VERB
bam-14261	127	15	to	to	PART
bam-14261	127	16	confirm	confirm	VERB
bam-14261	127	17	whether	whether	SCONJ
bam-14261	127	18	mastitis	mastitis	NOUN
bam-14261	127	19	-	-	PUNCT
bam-14261	127	20	related	relate	VERB
bam-14261	127	21	inflammation	inflammation	NOUN
bam-14261	127	22	can	can	AUX
bam-14261	127	23	contribute	contribute	VERB
bam-14261	127	24	to	to	ADP
bam-14261	127	25	secondary	secondary	ADJ
bam-14261	127	26	myopathic	myopathic	ADJ
bam-14261	127	27	changes	change	NOUN
bam-14261	127	28	.	.	PUNCT
bam-14261	128	1	clinical	clinical	ADJ
bam-14261	128	2	implications	implication	NOUN
bam-14261	128	3	our	our	PRON
bam-14261	128	4	results	result	NOUN
bam-14261	128	5	are	be	AUX
bam-14261	128	6	important	important	ADJ
bam-14261	128	7	for	for	ADP
bam-14261	128	8	the	the	DET
bam-14261	128	9	treatment	treatment	NOUN
bam-14261	128	10	of	of	ADP
bam-14261	128	11	lactational	lactational	ADJ
bam-14261	128	12	mastitis	mastitis	NOUN
bam-14261	128	13	.	.	PUNCT
bam-14261	129	1	both	both	DET
bam-14261	129	2	mrsa	mrsa	NOUN
bam-14261	129	3	and	and	CCONJ
bam-14261	129	4	mssa	mssa	ADJ
bam-14261	129	5	strains	strain	NOUN
bam-14261	129	6	showed	show	VERB
bam-14261	129	7	significant	significant	ADJ
bam-14261	129	8	resistance	resistance	NOUN
bam-14261	129	9	to	to	ADP
bam-14261	129	10	penicillin	penicillin	PROPN
bam-14261	129	11	g	g	PROPN
bam-14261	129	12	,	,	PUNCT
bam-14261	129	13	erythromycin	erythromycin	NOUN
bam-14261	129	14	,	,	PUNCT
bam-14261	129	15	clindamycin	clindamycin	NOUN
bam-14261	129	16	,	,	PUNCT
bam-14261	129	17	and	and	CCONJ
bam-14261	129	18	tetracycline	tetracycline	NOUN
bam-14261	129	19	,	,	PUNCT
bam-14261	129	20	indicating	indicate	VERB
bam-14261	129	21	empirical	empirical	ADJ
bam-14261	129	22	treatment	treatment	NOUN
bam-14261	129	23	with	with	ADP
bam-14261	129	24	these	these	DET
bam-14261	129	25	antibiotics	antibiotic	NOUN
bam-14261	129	26	is	be	AUX
bam-14261	129	27	inappropriate	inappropriate	ADJ
bam-14261	129	28	.	.	PUNCT
bam-14261	130	1	this	this	PRON
bam-14261	130	2	is	be	AUX
bam-14261	130	3	in	in	ADP
bam-14261	130	4	line	line	NOUN
bam-14261	130	5	with	with	ADP
bam-14261	130	6	more	more	ADV
bam-14261	130	7	recent	recent	ADJ
bam-14261	130	8	evidence	evidence	NOUN
bam-14261	130	9	showing	show	VERB
bam-14261	130	10	the	the	DET
bam-14261	130	11	global	global	ADJ
bam-14261	130	12	ineffectiveness	ineffectiveness	NOUN
bam-14261	130	13	of	of	ADP
bam-14261	130	14	macrolides	macrolide	NOUN
bam-14261	130	15	and	and	CCONJ
bam-14261	130	16	tetracyclines	tetracycline	NOUN
bam-14261	130	17	for	for	ADP
bam-14261	130	18	mrsa.27	mrsa.27	PROPN
bam-14261	130	19	-	-	X
bam-14261	130	20	29	29	NUM
bam-14261	130	21	on	on	ADP
bam-14261	130	22	the	the	DET
bam-14261	130	23	other	other	ADJ
bam-14261	130	24	hand	hand	NOUN
bam-14261	130	25	,	,	PUNCT
bam-14261	130	26	all	all	DET
bam-14261	130	27	isolates	isolate	NOUN
bam-14261	130	28	were	be	AUX
bam-14261	130	29	fully	fully	ADV
bam-14261	130	30	susceptible	susceptible	ADJ
bam-14261	130	31	to	to	ADP
bam-14261	130	32	vancomycin	vancomycin	PROPN
bam-14261	130	33	,	,	PUNCT
bam-14261	130	34	rifampicin	rifampicin	VERB
bam-14261	130	35	,	,	PUNCT
bam-14261	130	36	linezolid	linezolid	NOUN
bam-14261	130	37	,	,	PUNCT
bam-14261	130	38	and	and	CCONJ
bam-14261	130	39	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	130	40	,	,	PUNCT
bam-14261	130	41	suggesting	suggest	VERB
bam-14261	130	42	these	these	DET
bam-14261	130	43	antibiotics	antibiotic	NOUN
bam-14261	130	44	remain	remain	VERB
bam-14261	130	45	valid	valid	ADJ
bam-14261	130	46	treatment	treatment	NOUN
bam-14261	130	47	options	option	NOUN
bam-14261	130	48	.	.	PUNCT
bam-14261	131	1	vancomycin	vancomycin	PROPN
bam-14261	131	2	is	be	AUX
bam-14261	131	3	crucial	crucial	ADJ
bam-14261	131	4	for	for	ADP
bam-14261	131	5	severe	severe	ADJ
bam-14261	131	6	or	or	CCONJ
bam-14261	131	7	treatment	treatment	NOUN
bam-14261	131	8	-	-	PUNCT
bam-14261	131	9	resistant	resistant	ADJ
bam-14261	131	10	cases	case	NOUN
bam-14261	131	11	,	,	PUNCT
bam-14261	131	12	and	and	CCONJ
bam-14261	131	13	linezolid	linezolid	NOUN
bam-14261	131	14	,	,	PUNCT
bam-14261	131	15	although	although	SCONJ
bam-14261	131	16	reserved	reserve	VERB
bam-14261	131	17	for	for	ADP
bam-14261	131	18	less	less	ADV
bam-14261	131	19	severe	severe	ADJ
bam-14261	131	20	cases	case	NOUN
bam-14261	131	21	,	,	PUNCT
bam-14261	131	22	provides	provide	VERB
bam-14261	131	23	oral	oral	ADJ
bam-14261	131	24	therapy	therapy	NOUN
bam-14261	131	25	and	and	CCONJ
bam-14261	131	26	good	good	ADJ
bam-14261	131	27	tissue	tissue	NOUN
bam-14261	131	28	penetration.30,31	penetration.30,31	NOUN
bam-14261	131	29	while	while	SCONJ
bam-14261	131	30	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	131	31	is	be	AUX
bam-14261	131	32	rarely	rarely	ADV
bam-14261	131	33	employed	employ	VERB
bam-14261	131	34	for	for	ADP
bam-14261	131	35	mastitis	mastitis	NOUN
bam-14261	131	36	,	,	PUNCT
bam-14261	131	37	its	its	PRON
bam-14261	131	38	reliable	reliable	ADJ
bam-14261	131	39	antibiotic	antibiotic	ADJ
bam-14261	131	40	action	action	NOUN
bam-14261	131	41	might	might	AUX
bam-14261	131	42	make	make	VERB
bam-14261	131	43	it	it	PRON
bam-14261	131	44	useful	useful	ADJ
bam-14261	131	45	in	in	ADP
bam-14261	131	46	select	select	ADJ
bam-14261	131	47	cases	case	NOUN
bam-14261	131	48	.	.	PUNCT
bam-14261	132	1	additionally	additionally	ADV
bam-14261	132	2	,	,	PUNCT
bam-14261	132	3	virulence	virulence	NOUN
bam-14261	132	4	gene	gene	NOUN
bam-14261	132	5	profiling	profiling	NOUN
bam-14261	132	6	may	may	AUX
bam-14261	132	7	help	help	VERB
bam-14261	132	8	determine	determine	VERB
bam-14261	132	9	the	the	DET
bam-14261	132	10	severity	severity	NOUN
bam-14261	132	11	of	of	ADP
bam-14261	132	12	the	the	DET
bam-14261	132	13	infection	infection	NOUN
bam-14261	132	14	.	.	PUNCT
bam-14261	133	1	the	the	DET
bam-14261	133	2	presence	presence	NOUN
bam-14261	133	3	of	of	ADP
bam-14261	133	4	pvl	pvl	PROPN
bam-14261	133	5	or	or	CCONJ
bam-14261	133	6	hla	hla	PROPN
bam-14261	133	7	is	be	AUX
bam-14261	133	8	associated	associate	VERB
bam-14261	133	9	with	with	ADP
bam-14261	133	10	severe	severe	ADJ
bam-14261	133	11	inflammation	inflammation	NOUN
bam-14261	133	12	and	and	CCONJ
bam-14261	133	13	tissue	tissue	NOUN
bam-14261	133	14	necrosis.30,32	necrosis.30,32	NOUN
bam-14261	133	15	therefore	therefore	ADV
bam-14261	133	16	,	,	PUNCT
bam-14261	133	17	the	the	DET
bam-14261	133	18	clinician	clinician	NOUN
bam-14261	133	19	’s	’s	PART
bam-14261	133	20	awareness	awareness	NOUN
bam-14261	133	21	that	that	PRON
bam-14261	133	22	strains	strain	VERB
bam-14261	133	23	with	with	ADP
bam-14261	133	24	these	these	DET
bam-14261	133	25	virulence	virulence	NOUN
bam-14261	133	26	factors	factor	NOUN
bam-14261	133	27	mastitis	mastitis	NOUN
bam-14261	133	28	necessitate	necessitate	ADJ
bam-14261	133	29	enhanced	enhanced	ADJ
bam-14261	133	30	surveillance	surveillance	NOUN
bam-14261	133	31	and	and	CCONJ
bam-14261	133	32	,	,	PUNCT
bam-14261	133	33	in	in	ADP
bam-14261	133	34	some	some	DET
bam-14261	133	35	cases	case	NOUN
bam-14261	133	36	,	,	PUNCT
bam-14261	133	37	more	more	ADV
bam-14261	133	38	intensive	intensive	ADJ
bam-14261	133	39	treatment	treatment	NOUN
bam-14261	133	40	adjustments	adjustment	NOUN
bam-14261	133	41	is	be	AUX
bam-14261	133	42	important	important	ADJ
bam-14261	133	43	.	.	PUNCT
bam-14261	134	1	this	this	PRON
bam-14261	134	2	is	be	AUX
bam-14261	134	3	consistent	consistent	ADJ
bam-14261	134	4	with	with	ADP
bam-14261	134	5	emerging	emerge	VERB
bam-14261	134	6	literature	literature	NOUN
bam-14261	134	7	on	on	ADP
bam-14261	134	8	pyomyositis	pyomyositis	NOUN
bam-14261	134	9	and	and	CCONJ
bam-14261	134	10	infectious	infectious	ADJ
bam-14261	134	11	myopathies	myopathy	NOUN
bam-14261	134	12	,	,	PUNCT
bam-14261	134	13	where	where	SCONJ
bam-14261	134	14	s.	s.	PROPN
bam-14261	134	15	aureus	aureus	PROPN
bam-14261	134	16	virulence	virulence	NOUN
bam-14261	134	17	determinants	determinant	NOUN
bam-14261	134	18	are	be	AUX
bam-14261	134	19	key	key	ADJ
bam-14261	134	20	drivers	driver	NOUN
bam-14261	134	21	of	of	ADP
bam-14261	134	22	muscle	muscle	NOUN
bam-14261	134	23	injury.33	injury.33	PROPN
bam-14261	134	24	from	from	ADP
bam-14261	134	25	a	a	DET
bam-14261	134	26	translational	translational	ADJ
bam-14261	134	27	standpoint	standpoint	NOUN
bam-14261	134	28	,	,	PUNCT
bam-14261	134	29	incorporating	incorporate	VERB
bam-14261	134	30	antimicrobial	antimicrobial	ADJ
bam-14261	134	31	resistance	resistance	NOUN
bam-14261	134	32	data	datum	NOUN
bam-14261	134	33	and	and	CCONJ
bam-14261	134	34	virulence	virulence	NOUN
bam-14261	134	35	profiling	profiling	NOUN
bam-14261	134	36	into	into	ADP
bam-14261	134	37	clinical	clinical	ADJ
bam-14261	134	38	decision	decision	NOUN
bam-14261	134	39	-	-	PUNCT
bam-14261	134	40	making	making	NOUN
bam-14261	134	41	may	may	AUX
bam-14261	134	42	help	help	VERB
bam-14261	134	43	optimize	optimize	VERB
bam-14261	134	44	antibiotic	antibiotic	ADJ
bam-14261	134	45	selection	selection	NOUN
bam-14261	134	46	,	,	PUNCT
bam-14261	134	47	anticipate	anticipate	VERB
bam-14261	134	48	complications	complication	NOUN
bam-14261	134	49	,	,	PUNCT
bam-14261	134	50	and	and	CCONJ
bam-14261	134	51	reduce	reduce	VERB
bam-14261	134	52	recurrence	recurrence	NOUN
bam-14261	134	53	rates	rate	NOUN
bam-14261	134	54	.	.	PUNCT
bam-14261	135	1	future	future	ADJ
bam-14261	135	2	clinical	clinical	ADJ
bam-14261	135	3	guidelines	guideline	NOUN
bam-14261	135	4	should	should	AUX
bam-14261	135	5	consider	consider	VERB
bam-14261	135	6	integrating	integrate	VERB
bam-14261	135	7	such	such	ADJ
bam-14261	135	8	microbiological	microbiological	ADJ
bam-14261	135	9	insights	insight	NOUN
bam-14261	135	10	into	into	ADP
bam-14261	135	11	standard	standard	ADJ
bam-14261	135	12	mastitis	mastitis	ADJ
bam-14261	135	13	management	management	NOUN
bam-14261	135	14	protocols	protocol	NOUN
bam-14261	135	15	.	.	PUNCT
bam-14261	136	1	potential	potential	ADJ
bam-14261	136	2	confounding	confound	VERB
bam-14261	136	3	factors	factor	NOUN
bam-14261	136	4	,	,	PUNCT
bam-14261	136	5	such	such	ADJ
bam-14261	136	6	as	as	ADP
bam-14261	136	7	prior	prior	ADJ
bam-14261	136	8	antibiotic	antibiotic	ADJ
bam-14261	136	9	exposure	exposure	NOUN
bam-14261	136	10	or	or	CCONJ
bam-14261	136	11	breastfeeding	breastfeeding	NOUN
bam-14261	136	12	practices	practice	NOUN
bam-14261	136	13	,	,	PUNCT
bam-14261	136	14	were	be	AUX
bam-14261	136	15	not	not	PART
bam-14261	136	16	controlled	control	VERB
bam-14261	136	17	in	in	ADP
bam-14261	136	18	this	this	DET
bam-14261	136	19	analysis	analysis	NOUN
bam-14261	136	20	.	.	PUNCT
bam-14261	137	1	this	this	PRON
bam-14261	137	2	may	may	AUX
bam-14261	137	3	have	have	AUX
bam-14261	137	4	influenced	influence	VERB
bam-14261	137	5	resistance	resistance	NOUN
bam-14261	137	6	rates	rate	NOUN
bam-14261	137	7	and	and	CCONJ
bam-14261	137	8	clinical	clinical	ADJ
bam-14261	137	9	outcomes	outcome	NOUN
bam-14261	137	10	.	.	PUNCT
bam-14261	138	1	given	give	VERB
bam-14261	138	2	that	that	SCONJ
bam-14261	138	3	this	this	PRON
bam-14261	138	4	was	be	AUX
bam-14261	138	5	a	a	DET
bam-14261	138	6	single	single	ADJ
bam-14261	138	7	-	-	PUNCT
bam-14261	138	8	center	center	NOUN
bam-14261	138	9	study	study	NOUN
bam-14261	138	10	with	with	ADP
bam-14261	138	11	a	a	DET
bam-14261	138	12	relatively	relatively	ADV
bam-14261	138	13	small	small	ADJ
bam-14261	138	14	cohort	cohort	NOUN
bam-14261	138	15	,	,	PUNCT
bam-14261	138	16	the	the	DET
bam-14261	138	17	results	result	NOUN
bam-14261	138	18	may	may	AUX
bam-14261	138	19	not	not	PART
bam-14261	138	20	be	be	AUX
bam-14261	138	21	completely	completely	ADV
bam-14261	138	22	generalizable	generalizable	ADJ
bam-14261	138	23	.	.	PUNCT
bam-14261	139	1	patterns	pattern	NOUN
bam-14261	139	2	of	of	ADP
bam-14261	139	3	resistance	resistance	NOUN
bam-14261	139	4	are	be	AUX
bam-14261	139	5	shaped	shape	VERB
bam-14261	139	6	by	by	ADP
bam-14261	139	7	local	local	ADJ
bam-14261	139	8	antibiotic	antibiotic	ADJ
bam-14261	139	9	prescribing	prescribing	NOUN
bam-14261	139	10	habits	habit	NOUN
bam-14261	139	11	as	as	ADV
bam-14261	139	12	well	well	ADV
bam-14261	139	13	as	as	ADP
bam-14261	139	14	local	local	ADJ
bam-14261	139	15	infectious	infectious	ADJ
bam-14261	139	16	disease	disease	NOUN
bam-14261	139	17	trends	trend	NOUN
bam-14261	139	18	.	.	PUNCT
bam-14261	140	1	for	for	ADP
bam-14261	140	2	this	this	DET
bam-14261	140	3	reason	reason	NOUN
bam-14261	140	4	,	,	PUNCT
bam-14261	140	5	the	the	DET
bam-14261	140	6	results	result	NOUN
bam-14261	140	7	should	should	AUX
bam-14261	140	8	be	be	AUX
bam-14261	140	9	applied	apply	VERB
bam-14261	140	10	with	with	ADP
bam-14261	140	11	caution	caution	NOUN
bam-14261	140	12	when	when	SCONJ
bam-14261	140	13	considering	consider	VERB
bam-14261	140	14	populations	population	NOUN
bam-14261	140	15	beyond	beyond	ADP
bam-14261	140	16	the	the	DET
bam-14261	140	17	scope	scope	NOUN
bam-14261	140	18	of	of	ADP
bam-14261	140	19	our	our	PRON
bam-14261	140	20	study	study	NOUN
bam-14261	140	21	region	region	NOUN
bam-14261	140	22	.	.	PUNCT
bam-14261	141	1	list	list	NOUN
bam-14261	141	2	of	of	ADP
bam-14261	141	3	abbreviations	abbreviation	NOUN
bam-14261	141	4	mrsa	mrsa	NOUN
bam-14261	141	5	–	–	PUNCT
bam-14261	141	6	methicillin	methicillin	NOUN
bam-14261	141	7	-	-	PUNCT
bam-14261	141	8	resistant	resistant	ADJ
bam-14261	141	9	staphylococcus	staphylococcus	NOUN
bam-14261	141	10	aureus	aureus	NOUN
bam-14261	141	11	mssa	mssa	NOUN
bam-14261	141	12	–	–	PUNCT
bam-14261	141	13	methicillin	methicillin	NOUN
bam-14261	141	14	-	-	PUNCT
bam-14261	141	15	susceptible	susceptible	ADJ
bam-14261	141	16	staphylococcus	staphylococcus	NOUN
bam-14261	141	17	aureus	aureus	NOUN
bam-14261	141	18	pcr	pcr	NOUN
bam-14261	141	19	–	–	PUNCT
bam-14261	141	20	polymerase	polymerase	NOUN
bam-14261	141	21	chain	chain	NOUN
bam-14261	141	22	reaction	reaction	NOUN
bam-14261	141	23	mic	mic	ADJ
bam-14261	141	24	–	–	PUNCT
bam-14261	141	25	minimum	minimum	ADJ
bam-14261	141	26	inhibitory	inhibitory	ADJ
bam-14261	141	27	concentration	concentration	NOUN
bam-14261	141	28	pvl	pvl	NOUN
bam-14261	141	29	–	–	PUNCT
bam-14261	141	30	panton	panton	PROPN
bam-14261	141	31	–	–	PUNCT
bam-14261	141	32	valentine	valentine	NOUN
bam-14261	141	33	leukocidin	leukocidin	PROPN
bam-14261	141	34	hla	hla	PROPN
bam-14261	141	35	–	–	PUNCT
bam-14261	141	36	alpha	alpha	NOUN
bam-14261	141	37	-	-	PUNCT
bam-14261	141	38	hemolysin	hemolysin	NOUN
bam-14261	141	39	gene	gene	NOUN
bam-14261	141	40	clfa	clfa	NOUN
bam-14261	141	41	–	–	PUNCT
bam-14261	141	42	clumping	clump	VERB
bam-14261	141	43	factor	factor	NOUN
bam-14261	141	44	a	a	DET
bam-14261	141	45	gene	gene	NOUN
bam-14261	141	46	clfb	clfb	NOUN
bam-14261	141	47	–	–	PUNCT
bam-14261	141	48	clumping	clump	VERB
bam-14261	141	49	factor	factor	NOUN
bam-14261	141	50	b	b	PROPN
bam-14261	141	51	gene	gene	NOUN
bam-14261	141	52	fnba	fnba	ADJ
bam-14261	141	53	–	–	PUNCT
bam-14261	141	54	fibronectin	fibronectin	NOUN
bam-14261	141	55	-	-	PUNCT
bam-14261	141	56	binding	bind	VERB
bam-14261	141	57	protein	protein	NOUN
bam-14261	141	58	a	a	DET
bam-14261	141	59	gene	gene	NOUN
bam-14261	141	60	aac(6’)/aph(2	aac(6’)/aph(2	NOUN
bam-14261	141	61	”	"	PUNCT
bam-14261	141	62	)	)	PUNCT
bam-14261	141	63	–	–	PUNCT
bam-14261	141	64	aminoglycoside	aminoglycoside	VERB
bam-14261	141	65	resistance	resistance	NOUN
bam-14261	141	66	gene	gene	NOUN
bam-14261	141	67	blaz	blaz	NOUN
bam-14261	141	68	–	–	PUNCT
bam-14261	141	69	beta	beta	NOUN
bam-14261	141	70	-	-	PUNCT
bam-14261	141	71	lactamase	lactamase	NOUN
bam-14261	141	72	gene	gene	NOUN
bam-14261	141	73	meca	meca	NOUN
bam-14261	141	74	–	–	PUNCT
bam-14261	141	75	methicillin	methicillin	NOUN
bam-14261	141	76	resistance	resistance	NOUN
bam-14261	141	77	gene	gene	NOUN
bam-14261	141	78	aph(3’)-iii	aph(3’)-iii	PROPN
bam-14261	141	79	–	–	PUNCT
bam-14261	141	80	aminoglycoside	aminoglycoside	VERB
bam-14261	141	81	resistance	resistance	NOUN
bam-14261	141	82	gene	gene	NOUN
bam-14261	141	83	qaca	qaca	PROPN
bam-14261	141	84	/	/	SYM
bam-14261	141	85	b	b	NOUN
bam-14261	141	86	–	–	PUNCT
bam-14261	141	87	quaternary	quaternary	ADJ
bam-14261	141	88	ammonium	ammonium	NOUN
bam-14261	141	89	compound	compound	NOUN
bam-14261	141	90	resistance	resistance	NOUN
bam-14261	141	91	genes	gene	NOUN
bam-14261	141	92	spss	spss	VERB
bam-14261	141	93	–	–	PUNCT
bam-14261	141	94	statistical	statistical	ADJ
bam-14261	141	95	package	package	NOUN
bam-14261	141	96	for	for	ADP
bam-14261	141	97	the	the	DET
bam-14261	141	98	social	social	ADJ
bam-14261	141	99	sciences	sciences	PROPN
bam-14261	141	100	corresponding	correspond	VERB
bam-14261	141	101	author	author	NOUN
bam-14261	141	102	xu	xu	PROPN
bam-14261	141	103	li	li	PROPN
bam-14261	141	104	-	-	PUNCT
bam-14261	141	105	dong	dong	PROPN
bam-14261	141	106	,	,	PUNCT
bam-14261	141	107	hangzhou	hangzhou	PROPN
bam-14261	141	108	linping	linpe	VERB
bam-14261	141	109	district	district	PROPN
bam-14261	141	110	maternal	maternal	ADJ
bam-14261	141	111	and	and	CCONJ
bam-14261	141	112	child	child	NOUN
bam-14261	141	113	health	health	NOUN
bam-14261	141	114	hospital	hospital	NOUN
bam-14261	141	115	,	,	PUNCT
bam-14261	141	116	hangzhou	hangzhou	PROPN
bam-14261	141	117	311199	311199	NUM
bam-14261	141	118	,	,	PUNCT
bam-14261	141	119	china	china	PROPN
bam-14261	141	120	.	.	PUNCT
bam-14261	142	1	e	e	X
bam-14261	142	2	-	-	NOUN
bam-14261	142	3	mail	mail	NOUN
bam-14261	142	4	:	:	PUNCT
bam-14261	142	5	13093707107@163.com	13093707107@163.com	NUM
bam-14261	142	6	shi	shi	PROPN
bam-14261	142	7	feng	feng	PROPN
bam-14261	142	8	：	：	PUNCT
bam-14261	142	9	email	email	NOUN
bam-14261	142	10	：	：	PUNCT
bam-14261	142	11	935778135@qq.com	935778135@qq.com	NUM
bam-14261	142	12	ye	ye	NUM
bam-14261	142	13	de	de	PROPN
bam-14261	142	14	-	-	PROPN
bam-14261	142	15	liang	liang	ADJ
bam-14261	142	16	：	：	PUNCT
bam-14261	142	17	email	email	NOUN
bam-14261	142	18	：	：	PUNCT
bam-14261	142	19	497282831@qq.com	497282831@qq.com	NUM
bam-14261	142	20	dongli	dongli	PROPN
bam-14261	142	21	-	-	PUNCT
bam-14261	142	22	qian	qian	PROPN
bam-14261	142	23	:	:	PUNCT
bam-14261	142	24	email	email	NOUN
bam-14261	142	25	：	：	PUNCT
bam-14261	142	26	422958527@qq.com	422958527@qq.com	NUM
bam-14261	142	27	wuya	wuya	PROPN
bam-14261	142	28	-	-	PUNCT
bam-14261	142	29	ni	ni	NOUN
bam-14261	142	30	:	:	PUNCT
bam-14261	142	31	email	email	NOUN
bam-14261	142	32	：	：	PUNCT
bam-14261	142	33	349096368@qq.com	349096368@qq.com	NUM
bam-14261	142	34	orcid	orcid	NOUN
bam-14261	142	35	:	:	PUNCT
bam-14261	142	36	shi	shi	PROPN
bam-14261	142	37	feng	feng	PROPN
bam-14261	142	38	:	:	PUNCT
bam-14261	142	39	0009	0009	NUM
bam-14261	142	40	0009	0009	NUM
bam-14261	142	41	4811	4811	NUM
bam-14261	142	42	4545	4545	NUM
bam-14261	142	43	ye	ye	PRON
bam-14261	142	44	deliang	deliang	NOUN
bam-14261	142	45	:	:	PUNCT
bam-14261	142	46	0009	0009	NUM
bam-14261	142	47	0006	0006	NUM
bam-14261	142	48	0267	0267	NUM
bam-14261	142	49	5417	5417	NUM
bam-14261	142	50	dong	dong	NOUN
bam-14261	142	51	liqian	liqian	PROPN
bam-14261	142	52	:	:	PUNCT
bam-14261	142	53	0009	0009	NUM
bam-14261	142	54	0000	0000	NUM
bam-14261	142	55	5908	5908	NUM
bam-14261	142	56	4753	4753	NUM
bam-14261	142	57	wu	wu	PROPN
bam-14261	142	58	yan	yan	PROPN
bam-14261	143	1	ni	ni	PROPN
bam-14261	143	2	:	:	PUNCT
bam-14261	143	3	0009	0009	NUM
bam-14261	143	4	0002	0002	NUM
bam-14261	143	5	9872	9872	NUM
bam-14261	143	6	2046	2046	NUM
bam-14261	143	7	xu	xu	PROPN
bam-14261	144	1	lidong	lidong	PROPN
bam-14261	144	2	:	:	PUNCT
bam-14261	144	3	0009	0009	NUM
bam-14261	144	4	0003	0003	NUM
bam-14261	144	5	5573	5573	NUM
bam-14261	144	6	4626	4626	NUM
bam-14261	144	7	funding	funding	NOUN
bam-14261	144	8	project	project	NOUN
bam-14261	144	9	no	no	NOUN
bam-14261	144	10	.	.	PUNCT
bam-14261	145	1	2024ky277	2024ky277	NUM
bam-14261	145	2	,	,	PUNCT
bam-14261	145	3	zhejiang	zhejiang	PROPN
bam-14261	145	4	provincial	provincial	ADJ
bam-14261	145	5	health	health	NOUN
bam-14261	145	6	and	and	CCONJ
bam-14261	145	7	medical	medical	ADJ
bam-14261	145	8	science	science	NOUN
bam-14261	145	9	and	and	CCONJ
bam-14261	145	10	technology	technology	NOUN
bam-14261	145	11	project	project	NOUN
bam-14261	145	12	.	.	PUNCT
bam-14261	146	1	conflict	conflict	NOUN
bam-14261	146	2	of	of	ADP
bam-14261	146	3	interest	interest	NOUN
bam-14261	146	4	the	the	DET
bam-14261	146	5	authors	author	NOUN
bam-14261	146	6	declare	declare	VERB
bam-14261	146	7	no	no	DET
bam-14261	146	8	potential	potential	ADJ
bam-14261	146	9	conflict	conflict	NOUN
bam-14261	146	10	of	of	ADP
bam-14261	146	11	interest	interest	NOUN
bam-14261	146	12	,	,	PUNCT
bam-14261	146	13	and	and	CCONJ
bam-14261	146	14	all	all	DET
bam-14261	146	15	authors	author	NOUN
bam-14261	146	16	confirm	confirm	VERB
bam-14261	146	17	accuracy	accuracy	NOUN
bam-14261	146	18	.	.	PUNCT
bam-14261	147	1	ethics	ethic	NOUN
bam-14261	147	2	approval	approval	NOUN
bam-14261	147	3	this	this	DET
bam-14261	147	4	study	study	NOUN
bam-14261	147	5	was	be	AUX
bam-14261	147	6	approved	approve	VERB
bam-14261	147	7	by	by	ADP
bam-14261	147	8	the	the	DET
bam-14261	147	9	medical	medical	ADJ
bam-14261	147	10	ethics	ethics	PROPN
bam-14261	147	11	committee	committee	PROPN
bam-14261	147	12	of	of	ADP
bam-14261	147	13	hangzhou	hangzhou	PROPN
bam-14261	147	14	linping	linpe	VERB
bam-14261	147	15	district	district	PROPN
bam-14261	147	16	maternal	maternal	ADJ
bam-14261	147	17	and	and	CCONJ
bam-14261	147	18	child	child	NOUN
bam-14261	147	19	health	health	NOUN
bam-14261	147	20	hospital	hospital	NOUN
bam-14261	147	21	.	.	PUNCT
bam-14261	148	1	mailto:13093707107@163.com	mailto:13093707107@163.com	PROPN
bam-14261	148	2	mailto:935778135@qq.com	mailto:935778135@qq.com	PROPN
bam-14261	148	3	mailto:497282831@qq.com	mailto:497282831@qq.com	PROPN
bam-14261	148	4	mailto:422958527@qq.com	mailto:422958527@qq.com	PROPN
bam-14261	148	5	mailto:349096368@qq.com	mailto:349096368@qq.com	PROPN
bam-14261	148	6	informed	inform	VERB
bam-14261	148	7	consent	consent	NOUN
bam-14261	148	8	all	all	DET
bam-14261	148	9	patients	patient	NOUN
bam-14261	148	10	participating	participate	VERB
bam-14261	148	11	in	in	ADP
bam-14261	148	12	this	this	DET
bam-14261	148	13	study	study	NOUN
bam-14261	148	14	signed	sign	VERB
bam-14261	148	15	a	a	DET
bam-14261	148	16	written	write	VERB
bam-14261	148	17	informed	inform	VERB
bam-14261	148	18	consent	consent	NOUN
bam-14261	148	19	form	form	NOUN
bam-14261	148	20	for	for	ADP
bam-14261	148	21	participating	participate	VERB
bam-14261	148	22	in	in	ADP
bam-14261	148	23	this	this	DET
bam-14261	148	24	study	study	NOUN
bam-14261	148	25	.	.	PUNCT
bam-14261	149	1	patient	patient	ADJ
bam-14261	149	2	consent	consent	NOUN
bam-14261	149	3	for	for	ADP
bam-14261	149	4	publication	publication	NOUN
bam-14261	149	5	written	write	VERB
bam-14261	149	6	informed	inform	VERB
bam-14261	149	7	consent	consent	NOUN
bam-14261	149	8	was	be	AUX
bam-14261	149	9	obtained	obtain	VERB
bam-14261	149	10	from	from	ADP
bam-14261	149	11	a	a	DET
bam-14261	149	12	legally	legally	ADV
bam-14261	149	13	authorized	authorize	VERB
bam-14261	149	14	representative(s	representative(s	NOUN
bam-14261	149	15	)	)	PUNCT
bam-14261	149	16	for	for	ADP
bam-14261	149	17	anonymized	anonymize	VERB
bam-14261	149	18	patient	patient	ADJ
bam-14261	149	19	information	information	NOUN
bam-14261	149	20	to	to	PART
bam-14261	149	21	be	be	AUX
bam-14261	149	22	published	publish	VERB
bam-14261	149	23	in	in	ADP
bam-14261	149	24	this	this	DET
bam-14261	149	25	article	article	NOUN
bam-14261	149	26	.	.	PUNCT
bam-14261	150	1	availability	availability	NOUN
bam-14261	150	2	of	of	ADP
bam-14261	150	3	data	datum	NOUN
bam-14261	150	4	and	and	CCONJ
bam-14261	150	5	materials	material	NOUN
bam-14261	150	6	all	all	DET
bam-14261	150	7	data	datum	NOUN
bam-14261	150	8	generated	generate	VERB
bam-14261	150	9	or	or	CCONJ
bam-14261	150	10	analyzed	analyze	VERB
bam-14261	150	11	during	during	ADP
bam-14261	150	12	this	this	DET
bam-14261	150	13	study	study	NOUN
bam-14261	150	14	are	be	AUX
bam-14261	150	15	included	include	VERB
bam-14261	150	16	in	in	ADP
bam-14261	150	17	this	this	DET
bam-14261	150	18	published	publish	VERB
bam-14261	150	19	article	article	NOUN
bam-14261	150	20	.	.	PUNCT
bam-14261	151	1	references	reference	NOUN
bam-14261	151	2	1	1	NUM
bam-14261	151	3	.	.	PUNCT
bam-14261	151	4	tobore	tobore	NOUN
bam-14261	151	5	to	to	PART
bam-14261	151	6	.	.	PUNCT
bam-14261	152	1	on	on	ADP
bam-14261	152	2	maternal	maternal	ADJ
bam-14261	152	3	post	post	ADJ
bam-14261	152	4	-	-	ADJ
bam-14261	152	5	partum	partum	ADJ
bam-14261	152	6	/	/	SYM
bam-14261	152	7	natal	natal	ADJ
bam-14261	152	8	depression	depression	NOUN
bam-14261	152	9	.	.	PUNCT
bam-14261	153	1	a	a	DET
bam-14261	153	2	global	global	ADJ
bam-14261	153	3	underrecognized	underrecognized	ADJ
bam-14261	153	4	problem	problem	NOUN
bam-14261	153	5	and	and	CCONJ
bam-14261	153	6	the	the	DET
bam-14261	153	7	need	need	NOUN
bam-14261	153	8	for	for	ADP
bam-14261	153	9	better	well	ADJ
bam-14261	153	10	treatment	treatment	NOUN
bam-14261	153	11	strategies	strategy	NOUN
bam-14261	153	12	.	.	PUNCT
bam-14261	154	1	psychiatry	psychiatry	NOUN
bam-14261	154	2	res	re	VERB
bam-14261	154	3	2020;290:160	2020;290:160	NUM
bam-14261	154	4	-	-	SYM
bam-14261	154	5	3	3	NUM
bam-14261	154	6	.	.	NOUN
bam-14261	154	7	2	2	NUM
bam-14261	154	8	.	.	X
bam-14261	155	1	rodriguez	rodriguez	PROPN
bam-14261	155	2	z	z	PROPN
bam-14261	155	3	,	,	PUNCT
bam-14261	155	4	cabrera	cabrera	PROPN
bam-14261	155	5	ve	ve	PROPN
bam-14261	155	6	,	,	PUNCT
bam-14261	155	7	hogeveen	hogeveen	PROPN
bam-14261	155	8	h	h	NOUN
bam-14261	155	9	,	,	PUNCT
bam-14261	155	10	et	et	PROPN
bam-14261	155	11	al	al	PROPN
bam-14261	155	12	.	.	PUNCT
bam-14261	156	1	economic	economic	ADJ
bam-14261	156	2	impact	impact	NOUN
bam-14261	156	3	of	of	ADP
bam-14261	156	4	subclinical	subclinical	ADJ
bam-14261	156	5	mastitis	mastitis	ADJ
bam-14261	156	6	treatment	treatment	NOUN
bam-14261	156	7	in	in	ADP
bam-14261	156	8	early	early	ADJ
bam-14261	156	9	lactation	lactation	NOUN
bam-14261	156	10	using	use	VERB
bam-14261	156	11	intramammary	intramammary	ADJ
bam-14261	156	12	nisin	nisin	NOUN
bam-14261	156	13	.	.	PUNCT
bam-14261	157	1	j	j	PROPN
bam-14261	157	2	dairy	dairy	NOUN
bam-14261	157	3	sci	sci	PROPN
bam-14261	157	4	2024;107:4634	2024;107:4634	NUM
bam-14261	157	5	-	-	SYM
bam-14261	157	6	45	45	NUM
bam-14261	157	7	.	.	PUNCT
bam-14261	158	1	3	3	X
bam-14261	158	2	.	.	X
bam-14261	158	3	hussein	hussein	PROPN
bam-14261	158	4	hany	hany	PROPN
bam-14261	158	5	a	a	PROPN
bam-14261	158	6	,	,	PUNCT
bam-14261	158	7	fouad	fouad	PROPN
bam-14261	158	8	a	a	X
bam-14261	158	9	,	,	PUNCT
bam-14261	158	10	mohammed	mohammed	PROPN
bam-14261	158	11	t	t	PROPN
bam-14261	158	12	,	,	PUNCT
bam-14261	158	13	et	et	PROPN
bam-14261	158	14	al	al	PROPN
bam-14261	158	15	.	.	PROPN
bam-14261	158	16	study	study	NOUN
bam-14261	158	17	on	on	ADP
bam-14261	158	18	prevalence	prevalence	NOUN
bam-14261	158	19	and	and	CCONJ
bam-14261	158	20	bacterial	bacterial	ADJ
bam-14261	158	21	etiology	etiology	NOUN
bam-14261	158	22	of	of	ADP
bam-14261	158	23	mastitis	mastitis	NOUN
bam-14261	158	24	,	,	PUNCT
bam-14261	158	25	and	and	CCONJ
bam-14261	158	26	effects	effect	NOUN
bam-14261	158	27	of	of	ADP
bam-14261	158	28	subclinical	subclinical	ADJ
bam-14261	158	29	mastitis	mastitis	NOUN
bam-14261	158	30	and	and	CCONJ
bam-14261	158	31	stage	stage	NOUN
bam-14261	158	32	of	of	ADP
bam-14261	158	33	lactation	lactation	NOUN
bam-14261	158	34	on	on	ADP
bam-14261	158	35	scc	scc	NOUN
bam-14261	158	36	in	in	ADP
bam-14261	158	37	dairy	dairy	NOUN
bam-14261	158	38	goats	goat	NOUN
bam-14261	158	39	in	in	ADP
bam-14261	158	40	egypt	egypt	PROPN
bam-14261	158	41	.	.	PUNCT
bam-14261	159	1	trop	trop	PROPN
bam-14261	159	2	anim	anim	PROPN
bam-14261	159	3	health	health	PROPN
bam-14261	159	4	pro	pro	X
bam-14261	159	5	2020;52:46	2020;52:46	NUM
bam-14261	159	6	-	-	SYM
bam-14261	159	7	9	9	NUM
bam-14261	159	8	.	.	NOUN
bam-14261	159	9	4	4	NUM
bam-14261	159	10	.	.	X
bam-14261	159	11	mitchell	mitchell	PROPN
bam-14261	159	12	kb	kb	PROPN
bam-14261	159	13	,	,	PUNCT
bam-14261	159	14	johnson	johnson	PROPN
bam-14261	159	15	hm	hm	PROPN
bam-14261	159	16	,	,	PUNCT
bam-14261	159	17	rodriguez	rodriguez	PROPN
bam-14261	159	18	jm	jm	PROPN
bam-14261	159	19	,	,	PUNCT
bam-14261	159	20	et	et	PROPN
bam-14261	159	21	al	al	PROPN
bam-14261	159	22	.	.	PROPN
bam-14261	159	23	academy	academy	PROPN
bam-14261	159	24	of	of	ADP
bam-14261	159	25	breastfeeding	breastfeed	VERB
bam-14261	159	26	medicine	medicine	NOUN
bam-14261	159	27	clinical	clinical	ADJ
bam-14261	159	28	protocol	protocol	NOUN
bam-14261	159	29	#	#	SYM
bam-14261	159	30	36	36	NUM
bam-14261	159	31	:	:	PUNCT
bam-14261	159	32	the	the	DET
bam-14261	159	33	mastitis	mastitis	NOUN
bam-14261	159	34	spectrum	spectrum	NOUN
bam-14261	159	35	,	,	PUNCT
bam-14261	159	36	revised	revise	VERB
bam-14261	159	37	2022	2022	NUM
bam-14261	159	38	.	.	PUNCT
bam-14261	160	1	breastfeed	breastfeed	VERB
bam-14261	160	2	med	med	ADJ
bam-14261	160	3	2022;17:360	2022;17:360	NOUN
bam-14261	160	4	-	-	SYM
bam-14261	160	5	76	76	NUM
bam-14261	160	6	.	.	PUNCT
bam-14261	161	1	5	5	NUM
bam-14261	161	2	.	.	PUNCT
bam-14261	161	3	olga	olga	PROPN
bam-14261	161	4	l	l	PROPN
bam-14261	161	5	,	,	PUNCT
bam-14261	161	6	vervoort	vervoort	PROPN
bam-14261	161	7	j	j	PROPN
bam-14261	161	8	,	,	PUNCT
bam-14261	161	9	van	van	PROPN
bam-14261	161	10	diepen	diepen	PROPN
bam-14261	161	11	ja	ja	PROPN
bam-14261	161	12	,	,	PUNCT
bam-14261	161	13	et	et	PROPN
bam-14261	161	14	al	al	PROPN
bam-14261	161	15	.	.	PROPN
bam-14261	161	16	associations	association	NOUN
bam-14261	161	17	between	between	ADP
bam-14261	161	18	breastmilk	breastmilk	NOUN
bam-14261	161	19	intake	intake	NOUN
bam-14261	161	20	volume	volume	NOUN
bam-14261	161	21	,	,	PUNCT
bam-14261	161	22	macronutrient	macronutrient	NOUN
bam-14261	161	23	intake	intake	NOUN
bam-14261	161	24	and	and	CCONJ
bam-14261	161	25	infant	infant	NOUN
bam-14261	161	26	growth	growth	NOUN
bam-14261	161	27	in	in	ADP
bam-14261	161	28	a	a	DET
bam-14261	161	29	longitudinal	longitudinal	ADJ
bam-14261	161	30	birth	birth	NOUN
bam-14261	161	31	cohort	cohort	NOUN
bam-14261	161	32	:	:	PUNCT
bam-14261	161	33	the	the	DET
bam-14261	161	34	cambridge	cambridge	PROPN
bam-14261	161	35	baby	baby	NOUN
bam-14261	161	36	growth	growth	NOUN
bam-14261	161	37	and	and	CCONJ
bam-14261	161	38	breastfeeding	breastfeeding	NOUN
bam-14261	161	39	study	study	NOUN
bam-14261	161	40	(	(	PUNCT
bam-14261	161	41	cbgs	cbgs	NOUN
bam-14261	161	42	-	-	PUNCT
bam-14261	161	43	bf	bf	NOUN
bam-14261	161	44	)	)	PUNCT
bam-14261	161	45	.	.	PUNCT
bam-14261	162	1	br	br	PROPN
bam-14261	162	2	j	j	PROPN
bam-14261	162	3	nutr	nutr	PROPN
bam-14261	162	4	2023;30:56	2023;30:56	PROPN
bam-14261	162	5	-	-	SYM
bam-14261	162	6	64	64	NUM
bam-14261	162	7	.	.	PUNCT
bam-14261	162	8	6	6	NUM
bam-14261	162	9	.	.	X
bam-14261	162	10	rimoldi	rimoldi	PROPN
bam-14261	162	11	sg	sg	PROPN
bam-14261	162	12	,	,	PUNCT
bam-14261	162	13	pileri	pileri	PROPN
bam-14261	162	14	p	p	PROPN
bam-14261	162	15	,	,	PUNCT
bam-14261	162	16	mazz	mazz	PROPN
bam-14261	162	17	i	i	PROPN
bam-14261	162	18	,	,	PUNCT
bam-14261	162	19	et	et	PROPN
bam-14261	162	20	al	al	PROPN
bam-14261	162	21	.	.	PUNCT
bam-14261	163	1	the	the	DET
bam-14261	163	2	role	role	NOUN
bam-14261	163	3	of	of	ADP
bam-14261	163	4	staphylococcus	staphylococcus	NOUN
bam-14261	163	5	aureus	aureus	NOUN
bam-14261	163	6	in	in	ADP
bam-14261	163	7	mastitis	mastitis	NOUN
bam-14261	163	8	:	:	PUNCT
bam-14261	163	9	a	a	DET
bam-14261	163	10	multidisciplinary	multidisciplinary	ADJ
bam-14261	163	11	working	work	VERB
bam-14261	163	12	group	group	NOUN
bam-14261	163	13	experience	experience	NOUN
bam-14261	163	14	.	.	PUNCT
bam-14261	164	1	j	j	PROPN
bam-14261	164	2	hum	hum	ADJ
bam-14261	164	3	lact	lact	ADJ
bam-14261	164	4	2020;36:503	2020;36:503	NOUN
bam-14261	164	5	-	-	PUNCT
bam-14261	164	6	9	9	NUM
bam-14261	164	7	.	.	NOUN
bam-14261	164	8	7	7	NUM
bam-14261	164	9	.	.	PUNCT
bam-14261	164	10	li	li	PROPN
bam-14261	164	11	y	y	PROPN
bam-14261	164	12	,	,	PUNCT
bam-14261	164	13	zhu	zhu	PROPN
bam-14261	164	14	f	f	X
bam-14261	164	15	,	,	PUNCT
bam-14261	164	16	manna	manna	PROPN
bam-14261	164	17	ac	ac	PROPN
bam-14261	164	18	,	,	PUNCT
bam-14261	164	19	et	et	PROPN
bam-14261	164	20	al	al	PROPN
bam-14261	164	21	.	.	PUNCT
bam-14261	165	1	gp05	gp05	PROPN
bam-14261	165	2	,	,	PUNCT
bam-14261	165	3	a	a	DET
bam-14261	165	4	prophage	prophage	NOUN
bam-14261	165	5	-	-	PUNCT
bam-14261	165	6	encoded	encode	VERB
bam-14261	165	7	virulence	virulence	NOUN
bam-14261	165	8	factor	factor	NOUN
bam-14261	165	9	,	,	PUNCT
bam-14261	165	10	contributes	contribute	VERB
bam-14261	165	11	to	to	ADP
bam-14261	165	12	persistent	persistent	ADJ
bam-14261	165	13	methicillin	methicillin	NOUN
bam-14261	165	14	-	-	PUNCT
bam-14261	165	15	resistant	resistant	ADJ
bam-14261	165	16	staphylococcus	staphylococcus	NOUN
bam-14261	165	17	aureus	aureus	NOUN
bam-14261	165	18	endovascular	endovascular	VERB
bam-14261	165	19	infection	infection	NOUN
bam-14261	165	20	.	.	PUNCT
bam-14261	166	1	microb	microb	PROPN
bam-14261	166	2	spect	spect	PROPN
bam-14261	166	3	2023;11:39	2023;11:39	NUM
bam-14261	166	4	-	-	SYM
bam-14261	166	5	42	42	NUM
bam-14261	166	6	.	.	PUNCT
bam-14261	166	7	8	8	NUM
bam-14261	166	8	.	.	PUNCT
bam-14261	167	1	imanishi	imanishi	PROPN
bam-14261	167	2	i	i	PRON
bam-14261	167	3	,	,	PUNCT
bam-14261	167	4	nicolas	nicolas	PROPN
bam-14261	167	5	a	a	PROPN
bam-14261	167	6	,	,	PUNCT
bam-14261	167	7	caetano	caetano	PROPN
bam-14261	167	8	acb	acb	PROPN
bam-14261	167	9	,	,	PUNCT
bam-14261	167	10	et	et	PROPN
bam-14261	167	11	al	al	PROPN
bam-14261	167	12	.	.	PROPN
bam-14261	167	13	author	author	PROPN
bam-14261	167	14	correction	correction	PROPN
bam-14261	167	15	:	:	PUNCT
bam-14261	167	16	exfoliative	exfoliative	ADJ
bam-14261	167	17	toxin	toxin	NOUN
bam-14261	167	18	e	e	NOUN
bam-14261	167	19	,	,	PUNCT
bam-14261	167	20	a	a	DET
bam-14261	167	21	new	new	ADJ
bam-14261	167	22	staphylococcus	staphylococcus	NOUN
bam-14261	167	23	aureus	aureus	NOUN
bam-14261	167	24	virulence	virulence	NOUN
bam-14261	167	25	factor	factor	NOUN
bam-14261	167	26	with	with	ADP
bam-14261	167	27	host	host	NOUN
bam-14261	167	28	-	-	PUNCT
bam-14261	167	29	specific	specific	ADJ
bam-14261	167	30	activity	activity	NOUN
bam-14261	167	31	.	.	PUNCT
bam-14261	168	1	sci	sci	PROPN
bam-14261	168	2	rep	rep	PROPN
bam-14261	168	3	2020;10:21	2020;10:21	PROPN
bam-14261	168	4	-	-	PUNCT
bam-14261	168	5	4	4	NUM
bam-14261	168	6	.	.	NOUN
bam-14261	168	7	9	9	NUM
bam-14261	168	8	.	.	X
bam-14261	169	1	wang	wang	PROPN
bam-14261	169	2	q	q	PROPN
bam-14261	169	3	,	,	PUNCT
bam-14261	169	4	ning	ning	NOUN
bam-14261	169	5	p	p	X
bam-14261	169	6	,	,	PUNCT
bam-14261	169	7	ma	ma	PROPN
bam-14261	169	8	xj	xj	PROPN
bam-14261	169	9	,	,	PUNCT
bam-14261	169	10	et	et	PROPN
bam-14261	169	11	al	al	PROPN
bam-14261	169	12	.	.	PUNCT
bam-14261	170	1	chinese	chinese	ADJ
bam-14261	170	2	clinical	clinical	ADJ
bam-14261	170	3	guidelines	guideline	NOUN
bam-14261	170	4	for	for	ADP
bam-14261	170	5	the	the	DET
bam-14261	170	6	diagnosis	diagnosis	NOUN
bam-14261	170	7	and	and	CCONJ
bam-14261	170	8	treatment	treatment	NOUN
bam-14261	170	9	of	of	ADP
bam-14261	170	10	lactational	lactational	ADJ
bam-14261	170	11	mastitis	mastitis	NOUN
bam-14261	170	12	.	.	PUNCT
bam-14261	171	1	chinese	chinese	PROPN
bam-14261	171	2	j	j	PROPN
bam-14261	171	3	breast	breast	PROPN
bam-14261	171	4	dis	dis	PROPN
bam-14261	171	5	2020;14:10	2020;14:10	NUM
bam-14261	171	6	-	-	PUNCT
bam-14261	171	7	4	4	NUM
bam-14261	171	8	.	.	NOUN
bam-14261	171	9	10	10	NUM
bam-14261	171	10	.	.	PUNCT
bam-14261	172	1	medical	medical	ADJ
bam-14261	172	2	administration	administration	NOUN
bam-14261	172	3	of	of	ADP
bam-14261	172	4	the	the	DET
bam-14261	172	5	ministry	ministry	PROPN
bam-14261	172	6	of	of	ADP
bam-14261	172	7	health	health	PROPN
bam-14261	172	8	of	of	ADP
bam-14261	172	9	the	the	DET
bam-14261	172	10	people	people	NOUN
bam-14261	172	11	's	's	PART
bam-14261	172	12	republic	republic	NOUN
bam-14261	172	13	of	of	ADP
bam-14261	172	14	china	china	PROPN
bam-14261	172	15	.	.	PUNCT
bam-14261	173	1	national	national	ADJ
bam-14261	173	2	clinical	clinical	ADJ
bam-14261	173	3	laboratory	laboratory	NOUN
bam-14261	173	4	procedures	procedure	NOUN
bam-14261	173	5	.	.	PUNCT
bam-14261	174	1	3rd	3rd	ADJ
bam-14261	174	2	ed	ed	NOUN
bam-14261	174	3	.	.	PUNCT
bam-14261	175	1	nanjing	nanjing	PROPN
bam-14261	175	2	:	:	PUNCT
bam-14261	175	3	southeast	southeast	PROPN
bam-14261	175	4	university	university	PROPN
bam-14261	175	5	press	press	NOUN
bam-14261	175	6	,	,	PUNCT
bam-14261	175	7	2006:126	2006:126	NOUN
bam-14261	175	8	-	-	SYM
bam-14261	175	9	37	37	NUM
bam-14261	175	10	.	.	PUNCT
bam-14261	176	1	11	11	NUM
bam-14261	176	2	.	.	PUNCT
bam-14261	177	1	clinical	clinical	ADJ
bam-14261	177	2	and	and	CCONJ
bam-14261	177	3	laboratory	laboratory	NOUN
bam-14261	177	4	standards	standard	NOUN
bam-14261	177	5	institute	institute	PROPN
bam-14261	177	6	(	(	PUNCT
bam-14261	177	7	clsi	clsi	PROPN
bam-14261	177	8	)	)	PUNCT
bam-14261	177	9	.	.	PUNCT
bam-14261	178	1	performance	performance	NOUN
bam-14261	178	2	standards	standard	NOUN
bam-14261	178	3	for	for	ADP
bam-14261	178	4	antimicrobial	antimicrobial	ADJ
bam-14261	178	5	susceptibility	susceptibility	NOUN
bam-14261	178	6	testing	testing	NOUN
bam-14261	178	7	;	;	PUNCT
bam-14261	178	8	fifteenth	fifteenth	ADJ
bam-14261	178	9	informational	informational	ADJ
bam-14261	178	10	supplement	supplement	NOUN
bam-14261	178	11	.	.	PUNCT
bam-14261	179	1	clsi	clsi	PROPN
bam-14261	179	2	document	document	NOUN
bam-14261	179	3	m100	m100	PROPN
bam-14261	179	4	-	-	PUNCT
bam-14261	179	5	s15	s15	NOUN
bam-14261	179	6	.	.	PUNCT
bam-14261	179	7	clsi	clsi	PROPN
bam-14261	179	8	,	,	PUNCT
bam-14261	179	9	2005;25:1	2005;25:1	NUM
bam-14261	179	10	-	-	SYM
bam-14261	179	11	167	167	NUM
bam-14261	179	12	.	.	PUNCT
bam-14261	180	1	12	12	NUM
bam-14261	180	2	.	.	PUNCT
bam-14261	181	1	lai	lai	PROPN
bam-14261	181	2	by	by	ADP
bam-14261	181	3	,	,	PUNCT
bam-14261	181	4	yu	yu	PROPN
bam-14261	181	5	bw	bw	PROPN
bam-14261	181	6	,	,	PUNCT
bam-14261	181	7	chu	chu	PROPN
bam-14261	181	8	a	a	PRON
bam-14261	181	9	,	,	PUNCT
bam-14261	181	10	et	et	PROPN
bam-14261	181	11	al	al	PROPN
bam-14261	181	12	.	.	PUNCT
bam-14261	181	13	risk	risk	NOUN
bam-14261	181	14	factors	factor	NOUN
bam-14261	181	15	for	for	ADP
bam-14261	181	16	lactation	lactation	NOUN
bam-14261	181	17	mastitis	mastitis	NOUN
bam-14261	181	18	in	in	ADP
bam-14261	181	19	china	china	PROPN
bam-14261	181	20	:	:	PUNCT
bam-14261	181	21	a	a	DET
bam-14261	181	22	systematic	systematic	ADJ
bam-14261	181	23	review	review	NOUN
bam-14261	181	24	and	and	CCONJ
bam-14261	181	25	meta	meta	ADJ
bam-14261	181	26	-	-	PUNCT
bam-14261	181	27	analysis	analysis	NOUN
bam-14261	181	28	.	.	PUNCT
bam-14261	182	1	plos	plos	PROPN
bam-14261	182	2	one	one	NUM
bam-14261	182	3	2021;16:179	2021;16:179	PROPN
bam-14261	182	4	-	-	SYM
bam-14261	182	5	82	82	NUM
bam-14261	182	6	.	.	NOUN
bam-14261	182	7	13	13	NUM
bam-14261	182	8	.	.	PUNCT
bam-14261	183	1	aziz	aziz	PROPN
bam-14261	183	2	ta	ta	PROPN
bam-14261	183	3	,	,	PUNCT
bam-14261	183	4	lafta	lafta	PROPN
bam-14261	183	5	ij	ij	NOUN
bam-14261	183	6	.	.	PUNCT
bam-14261	184	1	developing	develop	VERB
bam-14261	184	2	multiplex	multiplex	PROPN
bam-14261	184	3	por	por	NOUN
bam-14261	184	4	for	for	ADP
bam-14261	184	5	the	the	DET
bam-14261	184	6	rapid	rapid	ADJ
bam-14261	184	7	and	and	CCONJ
bam-14261	184	8	simultaneous	simultaneous	ADJ
bam-14261	184	9	detection	detection	NOUN
bam-14261	184	10	of	of	ADP
bam-14261	184	11	staphylococcus	staphylococcus	NOUN
bam-14261	184	12	aureus	aureus	NOUN
bam-14261	184	13	,	,	PUNCT
bam-14261	184	14	pseudomonas	pseudomona	VERB
bam-14261	184	15	aeruginosa	aeruginosa	NOUN
bam-14261	184	16	and	and	CCONJ
bam-14261	184	17	klebsiella	klebsiella	NOUN
bam-14261	184	18	pneumoniae	pneumoniae	NOUN
bam-14261	184	19	associated	associate	VERB
bam-14261	184	20	with	with	ADP
bam-14261	184	21	sheep	sheep	NOUN
bam-14261	184	22	respiratory	respiratory	ADJ
bam-14261	184	23	tract	tract	NOUN
bam-14261	184	24	infections	infection	NOUN
bam-14261	184	25	.	.	PUNCT
bam-14261	185	1	biologia	biologia	PROPN
bam-14261	185	2	2022;77:1415	2022;77:1415	NUM
bam-14261	185	3	-	-	SYM
bam-14261	185	4	21	21	NUM
bam-14261	185	5	.	.	PUNCT
bam-14261	185	6	14	14	NUM
bam-14261	185	7	.	.	PUNCT
bam-14261	186	1	surana	surana	PROPN
bam-14261	186	2	k	k	NOUN
bam-14261	186	3	,	,	PUNCT
bam-14261	186	4	sagrule	sagrule	NOUN
bam-14261	186	5	d	d	NOUN
bam-14261	186	6	,	,	PUNCT
bam-14261	186	7	lanjewar	lanjewar	NOUN
bam-14261	186	8	s	s	PROPN
bam-14261	186	9	,	,	PUNCT
bam-14261	186	10	et	et	PROPN
bam-14261	186	11	al	al	PROPN
bam-14261	186	12	.	.	PROPN
bam-14261	186	13	primary	primary	ADJ
bam-14261	186	14	closure	closure	NOUN
bam-14261	186	15	with	with	ADP
bam-14261	186	16	suction	suction	NOUN
bam-14261	186	17	drain	drain	NOUN
bam-14261	186	18	of	of	ADP
bam-14261	186	19	acute	acute	ADJ
bam-14261	186	20	breast	breast	NOUN
bam-14261	186	21	abscess	abscess	NOUN
bam-14261	186	22	after	after	ADP
bam-14261	186	23	incision	incision	NOUN
bam-14261	186	24	,	,	PUNCT
bam-14261	186	25	drainage	drainage	NOUN
bam-14261	186	26	,	,	PUNCT
bam-14261	186	27	and	and	CCONJ
bam-14261	186	28	curettage	curettage	NOUN
bam-14261	186	29	.	.	PUNCT
bam-14261	187	1	indian	indian	PROPN
bam-14261	187	2	j	j	PROPN
bam-14261	187	3	surg	surg	PROPN
bam-14261	187	4	2020;82:129	2020;82:129	VERB
bam-14261	187	5	-	-	SYM
bam-14261	187	6	33	33	NUM
bam-14261	187	7	.	.	NOUN
bam-14261	187	8	15	15	NUM
bam-14261	187	9	.	.	PUNCT
bam-14261	188	1	chao	chao	PROPN
bam-14261	188	2	yk	yk	PROPN
bam-14261	188	3	,	,	PUNCT
bam-14261	188	4	yang	yang	PROPN
bam-14261	188	5	yq	yq	PROPN
bam-14261	188	6	,	,	PUNCT
bam-14261	188	7	han	han	PROPN
bam-14261	188	8	b	b	PROPN
bam-14261	188	9	,	,	PUNCT
bam-14261	188	10	et	et	PROPN
bam-14261	188	11	al	al	PROPN
bam-14261	188	12	.	.	PROPN
bam-14261	188	13	fecal	fecal	ADJ
bam-14261	188	14	microbiome	microbiome	NOUN
bam-14261	188	15	transplant	transplant	NOUN
bam-14261	188	16	from	from	ADP
bam-14261	188	17	patients	patient	NOUN
bam-14261	188	18	with	with	ADP
bam-14261	188	19	lactation	lactation	NOUN
bam-14261	188	20	mastitis	mastitis	NOUN
bam-14261	188	21	promotes	promote	VERB
bam-14261	188	22	mastitis	mastitis	NOUN
bam-14261	188	23	in	in	ADP
bam-14261	188	24	conventional	conventional	ADJ
bam-14261	188	25	lactating	lactating	NOUN
bam-14261	188	26	mice	mouse	NOUN
bam-14261	188	27	.	.	PUNCT
bam-14261	189	1	front	front	ADJ
bam-14261	189	2	microbiol	microbiol	PROPN
bam-14261	189	3	2023;3:12	2023;3:12	NUM
bam-14261	189	4	-	-	PUNCT
bam-14261	189	5	4	4	NUM
bam-14261	189	6	.	.	NOUN
bam-14261	189	7	16	16	NUM
bam-14261	189	8	.	.	PUNCT
bam-14261	190	1	mcdougall	mcdougall	PROPN
bam-14261	190	2	s	s	PROPN
bam-14261	190	3	,	,	PUNCT
bam-14261	190	4	clausen	clausen	PROPN
bam-14261	190	5	lm	lm	PROPN
bam-14261	190	6	,	,	PUNCT
bam-14261	190	7	hussein	hussein	PROPN
bam-14261	190	8	hm	hm	INTJ
bam-14261	190	9	,	,	PUNCT
bam-14261	190	10	et	et	PROPN
bam-14261	190	11	al	al	PROPN
bam-14261	190	12	.	.	PROPN
bam-14261	190	13	therapy	therapy	NOUN
bam-14261	190	14	of	of	ADP
bam-14261	190	15	subclinical	subclinical	ADJ
bam-14261	190	16	mastitis	mastitis	NOUN
bam-14261	190	17	during	during	ADP
bam-14261	190	18	lactation	lactation	NOUN
bam-14261	190	19	.	.	PUNCT
bam-14261	191	1	antibiotics	antibiotic	NOUN
bam-14261	191	2	2022;11:3	2022;11:3	NUM
bam-14261	191	3	-	-	SYM
bam-14261	191	4	7	7	NUM
bam-14261	191	5	.	.	NUM
bam-14261	191	6	17	17	NUM
bam-14261	191	7	.	.	PUNCT
bam-14261	192	1	yakovenko	yakovenko	PROPN
bam-14261	192	2	o	o	NOUN
bam-14261	192	3	,	,	PUNCT
bam-14261	192	4	yakovenko	yakovenko	PROPN
bam-14261	192	5	t	t	PROPN
bam-14261	192	6	,	,	PUNCT
bam-14261	192	7	akimov	akimov	ADJ
bam-14261	192	8	v	v	PROPN
bam-14261	192	9	,	,	PUNCT
bam-14261	192	10	et	et	PROPN
bam-14261	192	11	al	al	PROPN
bam-14261	192	12	.	.	PUNCT
bam-14261	193	1	role	role	NOUN
bam-14261	193	2	of	of	ADP
bam-14261	193	3	mini	mini	ADJ
bam-14261	193	4	-	-	ADJ
bam-14261	193	5	invasive	invasive	ADJ
bam-14261	193	6	surgery	surgery	NOUN
bam-14261	193	7	in	in	ADP
bam-14261	193	8	treatment	treatment	NOUN
bam-14261	193	9	of	of	ADP
bam-14261	193	10	lactation	lactation	NOUN
bam-14261	193	11	mastitis	mastitis	NOUN
bam-14261	193	12	.	.	PUNCT
bam-14261	194	1	surgical	surgical	ADJ
bam-14261	194	2	practice	practice	NOUN
bam-14261	194	3	2021;3:73	2021;3:73	NOUN
bam-14261	194	4	-	-	PUNCT
bam-14261	194	5	6	6	NUM
bam-14261	194	6	.	.	NOUN
bam-14261	194	7	18	18	NUM
bam-14261	194	8	.	.	PUNCT
bam-14261	195	1	wang	wang	PROPN
bam-14261	195	2	lb	lb	PROPN
bam-14261	195	3	,	,	PUNCT
bam-14261	195	4	yang	yang	PROPN
bam-14261	195	5	l	l	PROPN
bam-14261	195	6	,	,	PUNCT
bam-14261	195	7	qu	qu	PROPN
bam-14261	195	8	l	l	PROPN
bam-14261	195	9	,	,	PUNCT
bam-14261	195	10	et	et	PROPN
bam-14261	195	11	al	al	PROPN
bam-14261	195	12	.	.	PROPN
bam-14261	195	13	pathogen	pathogen	NOUN
bam-14261	195	14	distribution	distribution	NOUN
bam-14261	195	15	and	and	CCONJ
bam-14261	195	16	antibiotic	antibiotic	ADJ
bam-14261	195	17	resistance	resistance	NOUN
bam-14261	195	18	of	of	ADP
bam-14261	195	19	acute	acute	ADJ
bam-14261	195	20	lactational	lactational	ADJ
bam-14261	195	21	mastitis	mastitis	NOUN
bam-14261	195	22	.	.	PUNCT
bam-14261	196	1	chinese	chinese	PROPN
bam-14261	196	2	j	j	PROPN
bam-14261	196	3	maternal	maternal	ADJ
bam-14261	196	4	child	child	NOUN
bam-14261	196	5	health	health	NOUN
bam-14261	196	6	res	re	NOUN
bam-14261	196	7	2020;31:1030	2020;31:1030	NUM
bam-14261	196	8	-	-	SYM
bam-14261	196	9	4	4	NUM
bam-14261	196	10	.	.	NOUN
bam-14261	196	11	19	19	NUM
bam-14261	196	12	.	.	PUNCT
bam-14261	197	1	zhu	zhu	PROPN
bam-14261	197	2	mh	mh	PROPN
bam-14261	197	3	,	,	PUNCT
bam-14261	197	4	zhang	zhang	PROPN
bam-14261	197	5	yy	yy	PROPN
bam-14261	197	6	,	,	PUNCT
bam-14261	197	7	zheng	zheng	PROPN
bam-14261	197	8	l	l	PROPN
bam-14261	197	9	,	,	PUNCT
bam-14261	197	10	et	et	PROPN
bam-14261	197	11	al	al	PROPN
bam-14261	197	12	.	.	PROPN
bam-14261	197	13	pathogen	pathogen	NOUN
bam-14261	197	14	distribution	distribution	NOUN
bam-14261	197	15	and	and	CCONJ
bam-14261	197	16	antibiotic	antibiotic	ADJ
bam-14261	197	17	resistance	resistance	NOUN
bam-14261	197	18	of	of	ADP
bam-14261	197	19	pus	pus	NOUN
bam-14261	197	20	specimens	specimen	NOUN
bam-14261	197	21	in	in	ADP
bam-14261	197	22	lactational	lactational	ADJ
bam-14261	197	23	mastitis	mastitis	NOUN
bam-14261	197	24	patients	patient	NOUN
bam-14261	197	25	.	.	PUNCT
bam-14261	198	1	chinese	chinese	PROPN
bam-14261	198	2	j	j	PROPN
bam-14261	198	3	health	health	PROPN
bam-14261	198	4	laboratory	laboratory	PROPN
bam-14261	198	5	technol	technol	PROPN
bam-14261	198	6	2020;30:168	2020;30:168	NOUN
bam-14261	198	7	.	.	PROPN
bam-14261	199	1	20	20	NUM
bam-14261	199	2	.	.	PUNCT
bam-14261	200	1	deepashree	deepashree	ADJ
bam-14261	200	2	r	r	NOUN
bam-14261	200	3	,	,	PUNCT
bam-14261	200	4	khanum	khanum	PROPN
bam-14261	200	5	s	s	PROPN
bam-14261	200	6	,	,	PUNCT
bam-14261	200	7	sujatha	sujatha	PROPN
bam-14261	200	8	sr	sr	PROPN
bam-14261	200	9	,	,	PUNCT
bam-14261	200	10	et	et	PROPN
bam-14261	200	11	al	al	PROPN
bam-14261	200	12	.	.	PUNCT
bam-14261	201	1	methicillin	methicillin	NOUN
bam-14261	201	2	-	-	PUNCT
bam-14261	201	3	resistant	resistant	ADJ
bam-14261	201	4	staphylococcus	staphylococcus	NOUN
bam-14261	201	5	aureus	aureus	NOUN
bam-14261	201	6	(	(	PUNCT
bam-14261	201	7	mrsa	mrsa	NOUN
bam-14261	201	8	)	)	PUNCT
bam-14261	201	9	carriage	carriage	NOUN
bam-14261	201	10	among	among	ADP
bam-14261	201	11	healthcare	healthcare	NOUN
bam-14261	201	12	personnel	personnel	NOUN
bam-14261	201	13	in	in	ADP
bam-14261	201	14	non	non	ADJ
bam-14261	201	15	-	-	ADJ
bam-14261	201	16	outbreak	outbreak	ADJ
bam-14261	201	17	settings	setting	NOUN
bam-14261	201	18	in	in	ADP
bam-14261	201	19	a	a	DET
bam-14261	201	20	tertiary	tertiary	ADJ
bam-14261	201	21	care	care	NOUN
bam-14261	201	22	hospital	hospital	NOUN
bam-14261	201	23	in	in	ADP
bam-14261	201	24	mysore	mysore	NOUN
bam-14261	201	25	.	.	PUNCT
bam-14261	202	1	am	be	AUX
bam-14261	202	2	j	j	PROPN
bam-14261	202	3	infect	infect	ADJ
bam-14261	202	4	control	control	NOUN
bam-14261	202	5	2021;49:1499	2021;49:1499	NUM
bam-14261	202	6	-	-	SYM
bam-14261	202	7	502	502	NUM
bam-14261	202	8	.	.	PUNCT
bam-14261	203	1	21	21	NUM
bam-14261	203	2	.	.	PUNCT
bam-14261	204	1	li	li	PROPN
bam-14261	204	2	y	y	PROPN
bam-14261	204	3	,	,	PUNCT
bam-14261	204	4	ma	ma	PROPN
bam-14261	204	5	xj	xj	PROPN
bam-14261	204	6	,	,	PUNCT
bam-14261	204	7	he	he	PRON
bam-14261	204	8	xp	xp	VERB
bam-14261	204	9	,	,	PUNCT
bam-14261	204	10	et	et	PROPN
bam-14261	204	11	al	al	PROPN
bam-14261	204	12	.	.	PROPN
bam-14261	205	1	clinical	clinical	ADJ
bam-14261	205	2	characteristics	characteristic	NOUN
bam-14261	205	3	of	of	ADP
bam-14261	205	4	lactational	lactational	ADJ
bam-14261	205	5	breast	breast	NOUN
bam-14261	205	6	abscess	abscess	NOUN
bam-14261	205	7	caused	cause	VERB
bam-14261	205	8	by	by	ADP
bam-14261	205	9	methicillin	methicillin	NOUN
bam-14261	205	10	-	-	PUNCT
bam-14261	205	11	resistant	resistant	ADJ
bam-14261	205	12	staphylococcus	staphylococcus	NOUN
bam-14261	205	13	aureus	aureus	NOUN
bam-14261	205	14	:	:	PUNCT
bam-14261	205	15	a	a	DET
bam-14261	205	16	hospital	hospital	NOUN
bam-14261	205	17	-	-	PUNCT
bam-14261	205	18	based	base	VERB
bam-14261	205	19	study	study	NOUN
bam-14261	205	20	in	in	ADP
bam-14261	205	21	china	china	PROPN
bam-14261	205	22	.	.	PUNCT
bam-14261	206	1	int	int	PROPN
bam-14261	206	2	breastfeed	breastfeed	VERB
bam-14261	206	3	j	j	PROPN
bam-14261	206	4	2021;16:77	2021;16:77	NUM
bam-14261	206	5	-	-	SYM
bam-14261	206	6	80	80	NUM
bam-14261	206	7	.	.	PUNCT
bam-14261	207	1	22	22	NUM
bam-14261	207	2	.	.	PUNCT
bam-14261	208	1	bojer	bojer	PROPN
bam-14261	208	2	ms	ms	PROPN
bam-14261	208	3	,	,	PUNCT
bam-14261	208	4	frees	free	VERB
bam-14261	208	5	d	d	PROPN
bam-14261	208	6	,	,	PUNCT
bam-14261	208	7	ingmer	ingmer	ADJ
bam-14261	208	8	h	h	PROPN
bam-14261	208	9	,	,	PUNCT
bam-14261	208	10	et	et	PROPN
bam-14261	208	11	al	al	PROPN
bam-14261	208	12	.	.	PROPN
bam-14261	208	13	srra	srra	PROPN
bam-14261	208	14	in	in	ADP
bam-14261	208	15	staphylococci	staphylococci	PROPN
bam-14261	208	16	:	:	PUNCT
bam-14261	208	17	an	an	DET
bam-14261	208	18	addition	addition	NOUN
bam-14261	208	19	to	to	ADP
bam-14261	208	20	the	the	DET
bam-14261	208	21	paradigm	paradigm	NOUN
bam-14261	208	22	of	of	ADP
bam-14261	208	23	membrane	membrane	NOUN
bam-14261	208	24	-	-	PUNCT
bam-14261	208	25	localized	localize	VERB
bam-14261	208	26	,	,	PUNCT
bam-14261	208	27	sos	sos	ADJ
bam-14261	208	28	-	-	PUNCT
bam-14261	208	29	induced	induce	VERB
bam-14261	208	30	cell	cell	NOUN
bam-14261	208	31	division	division	NOUN
bam-14261	208	32	inhibition	inhibition	NOUN
bam-14261	208	33	in	in	ADP
bam-14261	208	34	bacteria	bacteria	NOUN
bam-14261	208	35	.	.	PUNCT
bam-14261	209	1	curr	curr	PROPN
bam-14261	209	2	genet	genet	PROPN
bam-14261	209	3	2020;66:495	2020;66:495	PROPN
bam-14261	209	4	-	-	SYM
bam-14261	209	5	9	9	NUM
bam-14261	209	6	.	.	NOUN
bam-14261	209	7	23	23	NUM
bam-14261	209	8	.	.	PUNCT
bam-14261	210	1	da	da	PROPN
bam-14261	210	2	jy	jy	PROPN
bam-14261	210	3	,	,	PUNCT
bam-14261	210	4	song	song	NOUN
bam-14261	210	5	q	q	PROPN
bam-14261	210	6	,	,	PUNCT
bam-14261	210	7	shi	shi	PROPN
bam-14261	210	8	jl	jl	PROPN
bam-14261	210	9	,	,	PUNCT
bam-14261	210	10	et	et	PROPN
bam-14261	210	11	al	al	PROPN
bam-14261	210	12	.	.	PROPN
bam-14261	210	13	antimicrobial	antimicrobial	ADJ
bam-14261	210	14	resistance	resistance	NOUN
bam-14261	210	15	and	and	CCONJ
bam-14261	210	16	virulence	virulence	NOUN
bam-14261	210	17	gene	gene	NOUN
bam-14261	210	18	detection	detection	NOUN
bam-14261	210	19	of	of	ADP
bam-14261	210	20	staphylococcus	staphylococcus	NOUN
bam-14261	210	21	aureus	aureus	NOUN
bam-14261	210	22	isolated	isolate	VERB
bam-14261	210	23	from	from	ADP
bam-14261	210	24	cows	cow	NOUN
bam-14261	210	25	in	in	ADP
bam-14261	210	26	yinchuan	yinchuan	PROPN
bam-14261	210	27	.	.	PUNCT
bam-14261	211	1	progress	progress	PROPN
bam-14261	211	2	veterinary	veterinary	PROPN
bam-14261	211	3	med	med	PROPN
bam-14261	211	4	2023;44:33	2023;44:33	NUM
bam-14261	211	5	-	-	SYM
bam-14261	211	6	40	40	NUM
bam-14261	211	7	.	.	PUNCT
bam-14261	212	1	24	24	NUM
bam-14261	212	2	.	.	PUNCT
bam-14261	213	1	sobhy	sobhy	PROPN
bam-14261	213	2	m	m	PROPN
bam-14261	213	3	,	,	PUNCT
bam-14261	213	4	ali	ali	PROPN
bam-14261	213	5	ss	ss	PROPN
bam-14261	213	6	,	,	PUNCT
bam-14261	213	7	khalil	khalil	PROPN
bam-14261	213	8	ma	ma	PROPN
bam-14261	213	9	,	,	PUNCT
bam-14261	213	10	et	et	PROPN
bam-14261	213	11	al	al	PROPN
bam-14261	213	12	.	.	PUNCT
bam-14261	213	13	exploring	explore	VERB
bam-14261	213	14	the	the	DET
bam-14261	213	15	potential	potential	NOUN
bam-14261	213	16	of	of	ADP
bam-14261	213	17	zinc	zinc	NOUN
bam-14261	213	18	oxide	oxide	NOUN
bam-14261	213	19	nanoparticles	nanoparticle	NOUN
bam-14261	213	20	against	against	ADP
bam-14261	213	21	pathogenic	pathogenic	ADJ
bam-14261	213	22	multidrug	multidrug	NOUN
bam-14261	213	23	-	-	PUNCT
bam-14261	213	24	resistant	resistant	ADJ
bam-14261	213	25	staphylococcus	staphylococcus	NOUN
bam-14261	213	26	aureus	aureus	NOUN
bam-14261	213	27	from	from	ADP
bam-14261	213	28	ready	ready	ADJ
bam-14261	213	29	-	-	PUNCT
bam-14261	213	30	to	to	PART
bam-14261	213	31	-	-	PUNCT
bam-14261	213	32	eat	eat	VERB
bam-14261	213	33	meat	meat	NOUN
bam-14261	213	34	and	and	CCONJ
bam-14261	213	35	its	its	PRON
bam-14261	213	36	proposed	propose	VERB
bam-14261	213	37	mechanism	mechanism	NOUN
bam-14261	213	38	.	.	PUNCT
bam-14261	214	1	food	food	NOUN
bam-14261	214	2	control	control	PROPN
bam-14261	214	3	2024;4:153	2024;4:153	PROPN
bam-14261	214	4	-	-	SYM
bam-14261	214	5	6	6	NUM
bam-14261	214	6	.	.	NUM
bam-14261	214	7	25	25	NUM
bam-14261	214	8	.	.	PUNCT
bam-14261	215	1	jia	jia	PROPN
bam-14261	215	2	j	j	PROPN
bam-14261	215	3	,	,	PUNCT
bam-14261	215	4	ji	ji	PROPN
bam-14261	215	5	yy	yy	PROPN
bam-14261	215	6	,	,	PUNCT
bam-14261	215	7	gao	gao	PROPN
bam-14261	215	8	s	s	PROPN
bam-14261	215	9	,	,	PUNCT
bam-14261	215	10	et	et	PROPN
bam-14261	215	11	al	al	PROPN
bam-14261	215	12	.	.	PROPN
bam-14261	215	13	investigation	investigation	NOUN
bam-14261	215	14	of	of	ADP
bam-14261	215	15	virulence	virulence	NOUN
bam-14261	215	16	genes	gene	NOUN
bam-14261	215	17	,	,	PUNCT
bam-14261	215	18	agr	agr	NOUN
bam-14261	215	19	typing	typing	NOUN
bam-14261	215	20	,	,	PUNCT
bam-14261	215	21	and	and	CCONJ
bam-14261	215	22	biofilm	biofilm	NOUN
bam-14261	215	23	formation	formation	NOUN
bam-14261	215	24	of	of	ADP
bam-14261	215	25	staphylococcus	staphylococcus	NOUN
bam-14261	215	26	aureus	aureus	NOUN
bam-14261	215	27	causing	cause	VERB
bam-14261	215	28	bloodstream	bloodstream	NOUN
bam-14261	215	29	infections	infection	NOUN
bam-14261	215	30	.	.	PUNCT
bam-14261	216	1	j	j	PROPN
bam-14261	216	2	clin	clin	PROPN
bam-14261	216	3	lab	lab	PROPN
bam-14261	216	4	2023;41:117	2023;41:117	NUM
bam-14261	216	5	-	-	SYM
bam-14261	216	6	22	22	NUM
bam-14261	216	7	.	.	PUNCT
bam-14261	216	8	26	26	NUM
bam-14261	216	9	.	.	PUNCT
bam-14261	217	1	olia	olia	PROPN
bam-14261	217	2	ahg	ahg	PROPN
bam-14261	217	3	,	,	PUNCT
bam-14261	217	4	ghahremani	ghahremani	PROPN
bam-14261	217	5	m	m	PROPN
bam-14261	217	6	,	,	PUNCT
bam-14261	217	7	sharifi	sharifi	PROPN
bam-14261	217	8	y	y	PROPN
bam-14261	217	9	,	,	PUNCT
bam-14261	217	10	et	et	PROPN
bam-14261	217	11	al	al	PROPN
bam-14261	217	12	.	.	PROPN
bam-14261	217	13	comparison	comparison	NOUN
bam-14261	217	14	of	of	ADP
bam-14261	217	15	biofilm	biofilm	NOUN
bam-14261	217	16	production	production	NOUN
bam-14261	217	17	and	and	CCONJ
bam-14261	217	18	virulence	virulence	NOUN
bam-14261	217	19	gene	gene	NOUN
bam-14261	217	20	distribution	distribution	NOUN
bam-14261	217	21	among	among	ADP
bam-14261	217	22	communityand	communityand	ADJ
bam-14261	217	23	hospital	hospital	NOUN
bam-14261	217	24	-	-	PUNCT
bam-14261	217	25	acquired	acquire	VERB
bam-14261	217	26	staphylococcus	staphylococcus	NOUN
bam-14261	217	27	aureus	aureus	NOUN
bam-14261	217	28	isolates	isolate	NOUN
bam-14261	217	29	from	from	ADP
bam-14261	217	30	northwestern	northwestern	ADJ
bam-14261	217	31	iran	iran	PROPN
bam-14261	217	32	.	.	PUNCT
bam-14261	218	1	infection	infection	NOUN
bam-14261	218	2	2020;62:957	2020;62:957	PROPN
bam-14261	218	3	-	-	SYM
bam-14261	218	4	61	61	NUM
bam-14261	218	5	.	.	PUNCT
bam-14261	219	1	27	27	NUM
bam-14261	219	2	.	.	PUNCT
bam-14261	220	1	crum	crum	PROPN
bam-14261	220	2	nf	nf	PROPN
bam-14261	220	3	.	.	PUNCT
bam-14261	221	1	bacterial	bacterial	ADJ
bam-14261	221	2	pyomyositis	pyomyositis	NOUN
bam-14261	221	3	in	in	ADP
bam-14261	221	4	the	the	DET
bam-14261	221	5	united	united	PROPN
bam-14261	221	6	states	states	PROPN
bam-14261	221	7	.	.	PUNCT
bam-14261	222	1	am	be	AUX
bam-14261	222	2	j	j	PROPN
bam-14261	222	3	med	med	ADJ
bam-14261	222	4	2004;117:420	2004;117:420	PROPN
bam-14261	222	5	-	-	SYM
bam-14261	222	6	8	8	NUM
bam-14261	222	7	.	.	PUNCT
bam-14261	222	8	28	28	NUM
bam-14261	222	9	.	.	PUNCT
bam-14261	223	1	chiedozi	chiedozi	PROPN
bam-14261	223	2	lc	lc	PROPN
bam-14261	223	3	.	.	PUNCT
bam-14261	223	4	pyomyositis	pyomyositis	NOUN
bam-14261	223	5	:	:	PUNCT
bam-14261	223	6	review	review	NOUN
bam-14261	223	7	of	of	ADP
bam-14261	223	8	205	205	NUM
bam-14261	223	9	cases	case	NOUN
bam-14261	223	10	in	in	ADP
bam-14261	223	11	112	112	NUM
bam-14261	223	12	patients	patient	NOUN
bam-14261	223	13	.	.	PUNCT
bam-14261	224	1	am	be	AUX
bam-14261	224	2	j	j	PROPN
bam-14261	224	3	surgery	surgery	NOUN
bam-14261	224	4	1979;137:255	1979;137:255	NUM
bam-14261	224	5	-	-	SYM
bam-14261	224	6	9	9	NUM
bam-14261	224	7	.	.	NOUN
bam-14261	224	8	29	29	NUM
bam-14261	224	9	.	.	PUNCT
bam-14261	225	1	touaitia	touaitia	NOUN
bam-14261	225	2	r	r	NOUN
bam-14261	225	3	,	,	PUNCT
bam-14261	225	4	mairi	mairi	PROPN
bam-14261	225	5	a	a	PROPN
bam-14261	225	6	,	,	PUNCT
bam-14261	225	7	ibrahim	ibrahim	PROPN
bam-14261	225	8	na	na	PROPN
bam-14261	225	9	,	,	PUNCT
bam-14261	225	10	et	et	PROPN
bam-14261	225	11	al	al	PROPN
bam-14261	225	12	.	.	PROPN
bam-14261	226	1	staphylococcus	staphylococcus	NOUN
bam-14261	226	2	aureus	aureus	NOUN
bam-14261	226	3	:	:	PUNCT
bam-14261	226	4	a	a	DET
bam-14261	226	5	review	review	NOUN
bam-14261	226	6	of	of	ADP
bam-14261	226	7	the	the	DET
bam-14261	226	8	pathogenesis	pathogenesis	NOUN
bam-14261	226	9	and	and	CCONJ
bam-14261	226	10	virulence	virulence	NOUN
bam-14261	226	11	mechanisms	mechanism	NOUN
bam-14261	226	12	.	.	PUNCT
bam-14261	227	1	antibiotics	antibiotic	NOUN
bam-14261	227	2	2025;14:470	2025;14:470	X
bam-14261	227	3	.	.	PUNCT
bam-14261	228	1	30	30	NUM
bam-14261	228	2	.	.	PUNCT
bam-14261	228	3	di	di	PROPN
bam-14261	228	4	bella	bella	PROPN
bam-14261	228	5	s	s	PROPN
bam-14261	228	6	,	,	PUNCT
bam-14261	228	7	marini	marini	PROPN
bam-14261	228	8	b	b	PROPN
bam-14261	228	9	,	,	PUNCT
bam-14261	228	10	stroffolini	stroffolini	NOUN
bam-14261	228	11	g	g	NOUN
bam-14261	228	12	,	,	PUNCT
bam-14261	228	13	et	et	PROPN
bam-14261	228	14	al	al	PROPN
bam-14261	228	15	.	.	PUNCT
bam-14261	229	1	the	the	DET
bam-14261	229	2	virulence	virulence	NOUN
bam-14261	229	3	toolkit	toolkit	NOUN
bam-14261	229	4	of	of	ADP
bam-14261	229	5	staphylococcus	staphylococcus	NOUN
bam-14261	229	6	aureus	aureus	NOUN
bam-14261	229	7	:	:	PUNCT
bam-14261	229	8	a	a	DET
bam-14261	229	9	comprehensive	comprehensive	ADJ
bam-14261	229	10	review	review	NOUN
bam-14261	229	11	of	of	ADP
bam-14261	229	12	toxin	toxin	NOUN
bam-14261	229	13	diversity	diversity	NOUN
bam-14261	229	14	,	,	PUNCT
bam-14261	229	15	molecular	molecular	ADJ
bam-14261	229	16	mechanisms	mechanism	NOUN
bam-14261	229	17	,	,	PUNCT
bam-14261	229	18	and	and	CCONJ
bam-14261	229	19	clinical	clinical	ADJ
bam-14261	229	20	implications	implication	NOUN
bam-14261	229	21	.	.	PUNCT
bam-14261	230	1	eur	eur	PROPN
bam-14261	230	2	j	j	PROPN
bam-14261	230	3	clin	clin	PROPN
bam-14261	230	4	microbiol	microbiol	PROPN
bam-14261	230	5	infect	infect	VERB
bam-14261	230	6	dis	dis	PROPN
bam-14261	230	7	2025;44:1797816	2025;44:1797816	NUM
bam-14261	230	8	.	.	PUNCT
bam-14261	231	1	31	31	NUM
bam-14261	231	2	.	.	PUNCT
bam-14261	232	1	lee	lee	PROPN
bam-14261	232	2	as	as	ADP
bam-14261	232	3	,	,	PUNCT
bam-14261	232	4	de	de	PROPN
bam-14261	232	5	lencastre	lencastre	PROPN
bam-14261	232	6	h	h	PROPN
bam-14261	232	7	,	,	PUNCT
bam-14261	232	8	garau	garau	PROPN
bam-14261	232	9	j	j	PROPN
bam-14261	232	10	,	,	PUNCT
bam-14261	232	11	et	et	PROPN
bam-14261	232	12	al	al	PROPN
bam-14261	232	13	.	.	PUNCT
bam-14261	233	1	methicillin	methicillin	NOUN
bam-14261	233	2	-	-	PUNCT
bam-14261	233	3	resistant	resistant	ADJ
bam-14261	233	4	staphylococcus	staphylococcus	NOUN
bam-14261	233	5	aureus	aureus	NOUN
bam-14261	233	6	.	.	PUNCT
bam-14261	234	1	nature	nature	PROPN
bam-14261	234	2	rev	rev	VERB
bam-14261	234	3	dis	dis	PROPN
bam-14261	234	4	primers	primer	NOUN
bam-14261	234	5	2018;4:1	2018;4:1	VERB
bam-14261	234	6	-	-	SYM
bam-14261	234	7	23	23	NUM
bam-14261	234	8	.	.	PUNCT
bam-14261	235	1	32	32	NUM
bam-14261	235	2	.	.	PUNCT
bam-14261	235	3	cruz	cruz	PROPN
bam-14261	235	4	ar	ar	PROPN
bam-14261	235	5	,	,	PUNCT
bam-14261	235	6	van	van	PROPN
bam-14261	235	7	strijp	strijp	PROPN
bam-14261	235	8	ja	ja	PROPN
bam-14261	235	9	,	,	PUNCT
bam-14261	235	10	bagnoli	bagnoli	PROPN
bam-14261	235	11	f	f	PROPN
bam-14261	235	12	,	,	PUNCT
bam-14261	235	13	manetti	manetti	PROPN
bam-14261	235	14	ag	ag	PROPN
bam-14261	235	15	.	.	PROPN
bam-14261	235	16	virulence	virulence	NOUN
bam-14261	235	17	gene	gene	NOUN
bam-14261	235	18	expression	expression	NOUN
bam-14261	235	19	of	of	ADP
bam-14261	235	20	staphylococcus	staphylococcus	NOUN
bam-14261	235	21	aureus	aureus	NOUN
bam-14261	235	22	in	in	ADP
bam-14261	235	23	human	human	ADJ
bam-14261	235	24	skin	skin	NOUN
bam-14261	235	25	.	.	PUNCT
bam-14261	236	1	front	front	ADJ
bam-14261	236	2	microbiol	microbiol	PROPN
bam-14261	236	3	2021;12:692023	2021;12:692023	NUM
bam-14261	236	4	.	.	PROPN
bam-14261	236	5	33	33	NUM
bam-14261	236	6	.	.	PUNCT
bam-14261	237	1	radcliffe	radcliffe	PROPN
bam-14261	237	2	c	c	PROPN
bam-14261	237	3	,	,	PUNCT
bam-14261	237	4	gisriel	gisriel	PROPN
bam-14261	237	5	s	s	PROPN
bam-14261	237	6	,	,	PUNCT
bam-14261	237	7	niu	niu	PROPN
bam-14261	237	8	ys	ys	PROPN
bam-14261	237	9	,	,	PUNCT
bam-14261	237	10	et	et	PROPN
bam-14261	237	11	al	al	PROPN
bam-14261	237	12	.	.	PUNCT
bam-14261	237	13	pyomyositis	pyomyositis	PROPN
bam-14261	237	14	and	and	CCONJ
bam-14261	237	15	infectious	infectious	ADJ
bam-14261	237	16	myositis	myositis	NOUN
bam-14261	237	17	:	:	PUNCT
bam-14261	237	18	a	a	DET
bam-14261	237	19	comprehensive	comprehensive	ADJ
bam-14261	237	20	,	,	PUNCT
bam-14261	237	21	single	single	ADJ
bam-14261	237	22	-	-	PUNCT
bam-14261	237	23	center	center	NOUN
bam-14261	237	24	retrospective	retrospective	ADJ
bam-14261	237	25	study	study	NOUN
bam-14261	237	26	.	.	PUNCT
bam-14261	238	1	open	open	ADJ
bam-14261	238	2	forum	forum	PROPN
bam-14261	238	3	infect	infect	VERB
bam-14261	238	4	dis	dis	PROPN
bam-14261	238	5	2021;8	2021;8	NUM
bam-14261	238	6	:	:	PUNCT
bam-14261	238	7	ofab098	ofab098	PROPN
bam-14261	238	8	.	.	PROPN
bam-14261	238	9	table	table	NOUN
bam-14261	238	10	1	1	NUM
bam-14261	238	11	.	.	PUNCT
bam-14261	239	1	primer	primer	NOUN
bam-14261	239	2	sequences	sequence	NOUN
bam-14261	239	3	used	use	VERB
bam-14261	239	4	for	for	ADP
bam-14261	239	5	resistance	resistance	NOUN
bam-14261	239	6	and	and	CCONJ
bam-14261	239	7	virulence	virulence	NOUN
bam-14261	239	8	gene	gene	NOUN
bam-14261	239	9	detection	detection	NOUN
bam-14261	239	10	in	in	ADP
bam-14261	239	11	s.	s.	PROPN
bam-14261	239	12	aureus	aureus	PROPN
bam-14261	239	13	.	.	PUNCT
bam-14261	240	1	gene	gene	NOUN
bam-14261	240	2	forward	forward	PROPN
bam-14261	240	3	primer	primer	NOUN
bam-14261	240	4	(	(	PUNCT
bam-14261	240	5	5′–3′	5′–3′	NOUN
bam-14261	240	6	)	)	PUNCT
bam-14261	240	7	reverse	reverse	ADJ
bam-14261	240	8	primer	primer	NOUN
bam-14261	240	9	(	(	PUNCT
bam-14261	240	10	5′–3′	5′–3′	NOUN
bam-14261	240	11	)	)	PUNCT
bam-14261	240	12	prod	prod	NOUN
bam-14261	240	13	uct	uct	PROPN
bam-14261	240	14	size	size	NOUN
bam-14261	240	15	(	(	PUNCT
bam-14261	240	16	bp	bp	PROPN
bam-14261	240	17	)	)	PUNCT
bam-14261	240	18	aac(6′)/aph	aac(6′)/aph	NOUN
bam-14261	240	19	(	(	PUNCT
bam-14261	240	20	2″	2″	NUM
bam-14261	240	21	)	)	PUNCT
bam-14261	240	22	gtagaaatgactgaacgtccga	gtagaaatgactgaacgtccga	NOUN
bam-14261	240	23	taa	taa	PROPN
bam-14261	240	24	ccaattccacattctttcgg	ccaattccacattctttcgg	NOUN
bam-14261	240	25	tctaa	tctaa	ADP
bam-14261	240	26	310	310	NUM
bam-14261	240	27	blaz	blaz	PROPN
bam-14261	240	28	atcattaggtaaaatgtctggac	atcattaggtaaaatgtctggac	PROPN
bam-14261	240	29	atgatcca	atgatcca	PROPN
bam-14261	240	30	gcatcaagtgtattggatag	gcatcaagtgtattggatag	PROPN
bam-14261	240	31	caaaagc	caaaagc	NOUN
bam-14261	240	32	433	433	NUM
bam-14261	240	33	meca	meca	PROPN
bam-14261	240	34	gtgaagatataccaagtgatt	gtgaagatataccaagtgatt	PROPN
bam-14261	240	35	atgcgctatagattgaaagg	atgcgctatagattgaaagg	PROPN
bam-14261	240	36	at	at	ADP
bam-14261	240	37	147	147	NUM
bam-14261	240	38	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	240	39	ctgattactatccaagaaattcg	ctgattactatccaagaaattcg	ADJ
bam-14261	240	40	attg	attg	NOUN
bam-14261	240	41	ctttccagcctacttttttat	ctttccagcctacttttttat	PROPN
bam-14261	240	42	cagt	cagt	PROPN
bam-14261	240	43	209	209	NUM
bam-14261	240	44	qaca	qaca	PROPN
bam-14261	240	45	/	/	SYM
bam-14261	240	46	b	b	PROPN
bam-14261	240	47	attggcgtggcttcagtgct	attggcgtggcttcagtgct	PROPN
bam-14261	240	48	cgtttcttccgtagttgcatt	cgtttcttccgtagttgcatt	NOUN
bam-14261	240	49	tg	tg	PROPN
bam-14261	240	50	292	292	NUM
bam-14261	240	51	erma	erma	PROPN
bam-14261	240	52	gttcaagaacaatcacagag	gttcaagaacaatcacagag	PROPN
bam-14261	240	53	ggatcaggaaaaggacatt	ggatcaggaaaaggacatt	PROPN
bam-14261	240	54	ttac	ttac	NOUN
bam-14261	240	55	533	533	NUM
bam-14261	240	56	tetm	tetm	NOUN
bam-14261	240	57	atgacagaatacttattaagtgc	atgacagaatacttattaagtgc	ADJ
bam-14261	240	58	tggc	tggc	NOUN
bam-14261	240	59	tgtatcaaccaataatagtc	tgtatcaaccaataatagtc	PROPN
bam-14261	240	60	tgaatgt	tgaatgt	PROPN
bam-14261	240	61	360	360	NUM
bam-14261	240	62	ermb	ermb	ADJ
bam-14261	240	63	ggttatcaatgtgcgggtgg	ggttatcaatgtgcgggtgg	NOUN
bam-14261	240	64	cggcacttttttctcttcgg	cggcacttttttctcttcgg	NOUN
bam-14261	240	65	102	102	NUM
bam-14261	240	66	ermc	ermc	NOUN
bam-14261	240	67	gaagatctatcacaagatgaaa	gaagatctatcacaagatgaaa	NOUN
bam-14261	240	68	ta	ta	X
bam-14261	240	69	atggatttcactggtgttat	atggatttcactggtgttat	VERB
bam-14261	240	70	taca	taca	PROPN
bam-14261	240	71	210	210	NUM
bam-14261	240	72	msrb	msrb	NOUN
bam-14261	240	73	gcgtcaaaataattccaagg	gcgtcaaaataattccaagg	PROPN
bam-14261	240	74	caatctgtccaatcaagcga	caatctgtccaatcaagcga	VERB
bam-14261	240	75	g	g	PROPN
bam-14261	240	76	567	567	NUM
bam-14261	240	77	tetk	tetk	NOUN
bam-14261	240	78	atggaaatacaacaaacacac	atggaaatacaacaaacacac	ADJ
bam-14261	240	79	ctgcttgaatgcgccaaac	ctgcttgaatgcgccaaac	NOUN
bam-14261	240	80	258	258	NUM
bam-14261	240	81	tetl	tetl	NOUN
bam-14261	240	82	caatctgtccaatcaagcgag	caatctgtccaatcaagcgag	NOUN
bam-14261	240	83	gcgtcaaaataattccaagg	gcgtcaaaataattccaagg	PROPN
bam-14261	240	84	642	642	NUM
bam-14261	240	85	lina	lina	PROPN
bam-14261	240	86	cgcggaaaggaacgggtttt	cgcggaaaggaacgggtttt	PROPN
bam-14261	240	87	ttagcgtctagcgttctgcc	ttagcgtctagcgttctgcc	PROPN
bam-14261	240	88	519	519	NUM
bam-14261	240	89	msra	msra	ADJ
bam-14261	240	90	aatacaccaacgcctccaag	aatacaccaacgcctccaag	VERB
bam-14261	240	91	ttgttgccgcttttgctctc	ttgttgccgcttttgctctc	NOUN
bam-14261	240	92	400	400	NUM
bam-14261	240	93	hla	hla	PROPN
bam-14261	240	94	agtttatagcgaagaagg	agtttatagcgaagaagg	PROPN
bam-14261	240	95	agtttatagcgaagaagg	agtttatagcgaagaagg	PROPN
bam-14261	240	96	447	447	NUM
bam-14261	240	97	clfb	clfb	NOUN
bam-14261	240	98	gttatggtggtggaagtgctg	gttatggtggtggaagtgctg	NOUN
bam-14261	240	99	cgctcttatctcctgtttctg	cgctcttatctcctgtttctg	NOUN
bam-14261	240	100	g	g	PROPN
bam-14261	240	101	1041	1041	NUM
bam-14261	240	102	clfa	clfa	NOUN
bam-14261	240	103	atgggacaacgaagtagca	atgggacaacgaagtagca	NOUN
bam-14261	240	104	gcttcatcttcagaacctg	gcttcatcttcagaacctg	NOUN
bam-14261	240	105	1149	1149	NUM
bam-14261	240	106	fnba	fnba	ADJ
bam-14261	240	107	taggaactgaaaatggtcac	taggaactgaaaatggtcac	PROPN
bam-14261	240	108	gaagcaatcagaaaacact	gaagcaatcagaaaacact	PROPN
bam-14261	240	109	c	c	PROPN
bam-14261	240	110	1027	1027	NUM
bam-14261	240	111	hlb	hlb	PROPN
bam-14261	240	112	gccaaagccgaatctaag	gccaaagccgaatctaag	NOUN
bam-14261	240	113	gcgatatacatcccatggc	gcgatatacatcccatggc	PROPN
bam-14261	240	114	834	834	NUM
bam-14261	240	115	fnbb	fnbb	PROPN
bam-14261	240	116	taggaactgaaaatggtcac	taggaactgaaaatggtcac	PROPN
bam-14261	240	117	gagtatgtaattatttcttg	gagtatgtaattatttcttg	PROPN
bam-14261	240	118	g	g	PROPN
bam-14261	240	119	973	973	NUM
bam-14261	240	120	pvl	pvl	PROPN
bam-14261	240	121	atcattaggtaaaatgtctggac	atcattaggtaaaatgtctggac	PROPN
bam-14261	240	122	atgatcca	atgatcca	PROPN
bam-14261	240	123	gcatcaagtgtattggatag	gcatcaagtgtattggatag	PROPN
bam-14261	240	124	caaaagc	caaaagc	NOUN
bam-14261	240	125	433	433	NUM
bam-14261	240	126	seh	seh	PROPN
bam-14261	240	127	caactgctgatttagctcag	caactgctgatttagctcag	PROPN
bam-14261	240	128	gtcgaatgagtaatctctag	gtcgaatgagtaatctctag	NOUN
bam-14261	240	129	g	g	PROPN
bam-14261	240	130	359	359	NUM
bam-14261	240	131	sec	sec	PROPN
bam-14261	240	132	cttgtatgtatggaggaataac	cttgtatgtatggaggaataac	NOUN
bam-14261	241	1	aa	aa	PROPN
bam-14261	241	2	tgcaggcatcatatcatacc	tgcaggcatcatatcatacc	PROPN
bam-14261	241	3	a	a	DET
bam-14261	241	4	284	284	NUM
bam-14261	241	5	table	table	NOUN
bam-14261	241	6	2	2	NUM
bam-14261	241	7	.	.	PUNCT
bam-14261	242	1	detection	detection	NOUN
bam-14261	242	2	of	of	ADP
bam-14261	242	3	pathogenic	pathogenic	ADJ
bam-14261	242	4	bacteria	bacteria	NOUN
bam-14261	242	5	in	in	ADP
bam-14261	242	6	infectious	infectious	ADJ
bam-14261	242	7	mastitis	mastitis	NOUN
bam-14261	242	8	during	during	ADP
bam-14261	242	9	lactation	lactation	NOUN
bam-14261	242	10	.	.	PUNCT
bam-14261	243	1	pathogen	pathogen	NOUN
bam-14261	243	2	number	number	NOUN
bam-14261	243	3	of	of	ADP
bam-14261	243	4	isolates	isolate	NOUN
bam-14261	243	5	proportion	proportion	NOUN
bam-14261	243	6	(	(	PUNCT
bam-14261	243	7	%	%	INTJ
bam-14261	243	8	)	)	PUNCT
bam-14261	243	9	gram	gram	NOUN
bam-14261	243	10	-	-	PUNCT
bam-14261	243	11	negative	negative	ADJ
bam-14261	243	12	bacteria	bacteria	NOUN
bam-14261	243	13	12	12	NUM
bam-14261	243	14	7.59	7.59	NUM
bam-14261	243	15	escherichia	escherichia	NOUN
bam-14261	243	16	coli	coli	NOUN
bam-14261	243	17	4	4	NUM
bam-14261	243	18	2.53	2.53	NUM
bam-14261	243	19	enterobacter	enterobacter	NOUN
bam-14261	243	20	cloacae	cloacae	NOUN
bam-14261	243	21	4	4	NUM
bam-14261	243	22	2.53	2.53	NUM
bam-14261	243	23	pseudomonas	pseudomona	NOUN
bam-14261	243	24	aeruginosa	aeruginosa	NOUN
bam-14261	243	25	3	3	NUM
bam-14261	243	26	1.90	1.90	NUM
bam-14261	243	27	klebsiella	klebsiella	NOUN
bam-14261	243	28	pneumoniae	pneumoniae	VERB
bam-14261	243	29	1	1	NUM
bam-14261	243	30	0.63	0.63	NUM
bam-14261	243	31	gram	gram	NOUN
bam-14261	243	32	-	-	PUNCT
bam-14261	243	33	positive	positive	ADJ
bam-14261	243	34	bacteria	bacteria	NOUN
bam-14261	243	35	146	146	NUM
bam-14261	243	36	89.87	89.87	NUM
bam-14261	243	37	staphylococcus	staphylococcus	NOUN
bam-14261	243	38	aureus	aureus	NOUN
bam-14261	243	39	–	–	PUNCT
bam-14261	243	40	mrsa	mrsa	NOUN
bam-14261	243	41	82	82	NUM
bam-14261	243	42	51.90	51.90	NUM
bam-14261	243	43	staphylococcus	staphylococcus	NOUN
bam-14261	243	44	aureus	aureus	NOUN
bam-14261	243	45	–	–	PUNCT
bam-14261	243	46	mssa	mssa	NOUN
bam-14261	243	47	37	37	NUM
bam-14261	243	48	23.42	23.42	NUM
bam-14261	243	49	staphylococcus	staphylococcus	NOUN
bam-14261	243	50	epidermidis	epidermidi	NOUN
bam-14261	243	51	9	9	NUM
bam-14261	243	52	5.70	5.70	NUM
bam-14261	243	53	enterococcus	enterococcus	NOUN
bam-14261	243	54	faecalis	faecali	NOUN
bam-14261	243	55	8	8	NUM
bam-14261	243	56	5.06	5.06	NUM
bam-14261	243	57	streptococcus	streptococcus	NOUN
bam-14261	243	58	agalactiae	agalactiae	NOUN
bam-14261	243	59	6	6	NUM
bam-14261	243	60	3.80	3.80	NUM
bam-14261	243	61	staphylococcus	staphylococcus	NOUN
bam-14261	243	62	haemolyticus	haemolyticus	NOUN
bam-14261	243	63	4	4	NUM
bam-14261	243	64	2.53	2.53	NUM
bam-14261	243	65	total	total	NOUN
bam-14261	243	66	158	158	NUM
bam-14261	243	67	100.00	100.00	NUM
bam-14261	243	68	table	table	NOUN
bam-14261	243	69	3	3	NUM
bam-14261	243	70	.	.	PUNCT
bam-14261	243	71	detection	detection	NOUN
bam-14261	243	72	of	of	ADP
bam-14261	243	73	resistance	resistance	NOUN
bam-14261	243	74	genes	gene	NOUN
bam-14261	243	75	in	in	ADP
bam-14261	243	76	s.	s.	PROPN
bam-14261	243	77	aureus	aureus	PROPN
bam-14261	243	78	.	.	PUNCT
bam-14261	244	1	resistance	resistance	NOUN
bam-14261	244	2	gene	gene	NOUN
bam-14261	244	3	positive	positive	ADJ
bam-14261	244	4	isolates	isolate	NOUN
bam-14261	244	5	(	(	PUNCT
bam-14261	244	6	n	n	CCONJ
bam-14261	244	7	)	)	PUNCT
bam-14261	244	8	detection	detection	NOUN
bam-14261	244	9	rate	rate	NOUN
bam-14261	244	10	(	(	PUNCT
bam-14261	244	11	%	%	INTJ
bam-14261	244	12	)	)	PUNCT
bam-14261	244	13	aac(6′)/aph(2″	aac(6′)/aph(2″	PUNCT
bam-14261	244	14	)	)	PUNCT
bam-14261	244	15	119	119	NUM
bam-14261	244	16	100.00	100.00	NUM
bam-14261	244	17	blaz	blaz	NOUN
bam-14261	244	18	119	119	NUM
bam-14261	244	19	100.00	100.00	NUM
bam-14261	244	20	meca	meca	NOUN
bam-14261	244	21	119	119	NUM
bam-14261	244	22	100.00	100.00	NUM
bam-14261	244	23	aph(3′)-iii	aph(3′)-iii	NUM
bam-14261	244	24	113	113	NUM
bam-14261	244	25	94.96	94.96	NUM
bam-14261	244	26	qaca	qaca	NOUN
bam-14261	244	27	/	/	SYM
bam-14261	244	28	b	b	PROPN
bam-14261	244	29	101	101	NUM
bam-14261	244	30	84.87	84.87	NUM
bam-14261	244	31	erma	erma	NOUN
bam-14261	244	32	60	60	NUM
bam-14261	244	33	50.42	50.42	NUM
bam-14261	244	34	tetm	tetm	NOUN
bam-14261	244	35	54	54	NUM
bam-14261	244	36	45.38	45.38	NUM
bam-14261	244	37	ermb	ermb	NOUN
bam-14261	244	38	30	30	NUM
bam-14261	244	39	25.21	25.21	NUM
bam-14261	244	40	ermc	ermc	NOUN
bam-14261	244	41	30	30	NUM
bam-14261	244	42	25.21	25.21	NUM
bam-14261	244	43	msrb	msrb	NOUN
bam-14261	244	44	26	26	NUM
bam-14261	244	45	21.85	21.85	NUM
bam-14261	244	46	tetk	tetk	NOUN
bam-14261	244	47	24	24	NUM
bam-14261	244	48	20.17	20.17	NUM
bam-14261	244	49	tetl	tetl	NOUN
bam-14261	244	50	12	12	NUM
bam-14261	244	51	10.08	10.08	NUM
bam-14261	244	52	lina	lina	NOUN
bam-14261	244	53	6	6	NUM
bam-14261	244	54	5.04	5.04	NUM
bam-14261	244	55	msra	msra	NOUN
bam-14261	244	56	6	6	NUM
bam-14261	244	57	5.04	5.04	NUM
bam-14261	244	58	table	table	NOUN
bam-14261	244	59	4	4	NUM
bam-14261	244	60	.	.	PUNCT
bam-14261	244	61	antimicrobial	antimicrobial	ADJ
bam-14261	244	62	resistance	resistance	NOUN
bam-14261	244	63	in	in	ADP
bam-14261	244	64	mrsa	mrsa	NOUN
bam-14261	244	65	and	and	CCONJ
bam-14261	244	66	mssa	mssa	ADJ
bam-14261	244	67	.	.	PUNCT
bam-14261	245	1	antimicrobial	antimicrobial	ADJ
bam-14261	245	2	agent	agent	NOUN
bam-14261	245	3	mrsa	mrsa	NOUN
bam-14261	245	4	mssa	mssa	ADJ
bam-14261	245	5	no	no	PROPN
bam-14261	245	6	.	.	PROPN
bam-14261	245	7	tested	test	VERB
bam-14261	245	8	no	no	NOUN
bam-14261	245	9	.	.	PUNCT
bam-14261	246	1	resis	resis	PROPN
bam-14261	246	2	tant	tant	NOUN
bam-14261	246	3	resistanc	resistanc	NOUN
bam-14261	246	4	e	e	NOUN
bam-14261	246	5	rate	rate	NOUN
bam-14261	246	6	(	(	PUNCT
bam-14261	246	7	%	%	INTJ
bam-14261	246	8	)	)	PUNCT
bam-14261	246	9	no	no	INTJ
bam-14261	246	10	.	.	PUNCT
bam-14261	247	1	teste	teste	PROPN
bam-14261	247	2	d	d	NOUN
bam-14261	247	3	no	no	PROPN
bam-14261	247	4	.	.	PUNCT
bam-14261	248	1	resis	resis	PROPN
bam-14261	248	2	tant	tant	ADJ
bam-14261	248	3	resistance	resistance	NOUN
bam-14261	248	4	rate	rate	NOUN
bam-14261	248	5	(	(	PUNCT
bam-14261	248	6	%	%	INTJ
bam-14261	248	7	)	)	PUNCT
bam-14261	248	8	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	248	9	82	82	NUM
bam-14261	248	10	2	2	NUM
bam-14261	248	11	2.44	2.44	NUM
bam-14261	248	12	37	37	NUM
bam-14261	248	13	0	0	NUM
bam-14261	248	14	0.00	0.00	NUM
bam-14261	248	15	gentamicin	gentamicin	NOUN
bam-14261	248	16	82	82	NUM
bam-14261	248	17	4	4	NUM
bam-14261	248	18	4.88	4.88	NUM
bam-14261	248	19	37	37	NUM
bam-14261	248	20	2	2	NUM
bam-14261	248	21	5.41	5.41	NUM
bam-14261	248	22	levofloxacin	levofloxacin	NOUN
bam-14261	248	23	82	82	NUM
bam-14261	248	24	7	7	NUM
bam-14261	248	25	8.54	8.54	NUM
bam-14261	248	26	37	37	NUM
bam-14261	248	27	2	2	NUM
bam-14261	248	28	5.41	5.41	NUM
bam-14261	248	29	ciprofloxacin	ciprofloxacin	NOUN
bam-14261	248	30	82	82	NUM
bam-14261	248	31	7	7	NUM
bam-14261	248	32	8.54	8.54	NUM
bam-14261	248	33	37	37	NUM
bam-14261	248	34	3	3	NUM
bam-14261	248	35	8.11	8.11	NUM
bam-14261	248	36	penicillin	penicillin	NOUN
bam-14261	248	37	g	g	PROPN
bam-14261	248	38	82	82	NUM
bam-14261	248	39	75	75	NUM
bam-14261	248	40	91.46a	91.46a	NUM
bam-14261	248	41	37	37	NUM
bam-14261	248	42	29	29	NUM
bam-14261	248	43	78.38	78.38	NUM
bam-14261	248	44	erythromycin	erythromycin	VERB
bam-14261	248	45	82	82	NUM
bam-14261	248	46	54	54	NUM
bam-14261	248	47	65.85a	65.85a	NUM
bam-14261	248	48	37	37	NUM
bam-14261	248	49	17	17	NUM
bam-14261	248	50	45.95	45.95	NUM
bam-14261	248	51	linezolid	linezolid	NOUN
bam-14261	248	52	82	82	NUM
bam-14261	248	53	0	0	NUM
bam-14261	248	54	0.00	0.00	NUM
bam-14261	248	55	37	37	NUM
bam-14261	248	56	0	0	NUM
bam-14261	248	57	0.00	0.00	NUM
bam-14261	248	58	vancomycin	vancomycin	PROPN
bam-14261	248	59	82	82	NUM
bam-14261	248	60	0	0	NUM
bam-14261	248	61	0.00	0.00	NUM
bam-14261	248	62	37	37	NUM
bam-14261	248	63	0	0	NUM
bam-14261	248	64	0.00	0.00	NUM
bam-14261	248	65	clindamycin	clindamycin	NOUN
bam-14261	248	66	82	82	NUM
bam-14261	248	67	54	54	NUM
bam-14261	248	68	65.85a	65.85a	NUM
bam-14261	248	69	37	37	NUM
bam-14261	248	70	17	17	NUM
bam-14261	248	71	45.95	45.95	NUM
bam-14261	248	72	rifampicin	rifampicin	VERB
bam-14261	248	73	82	82	NUM
bam-14261	248	74	0	0	NUM
bam-14261	248	75	0.00	0.00	NUM
bam-14261	248	76	37	37	NUM
bam-14261	248	77	0	0	NUM
bam-14261	248	78	0.00	0.00	NUM
bam-14261	248	79	tetracycline	tetracycline	NOUN
bam-14261	248	80	82	82	NUM
bam-14261	248	81	41	41	NUM
bam-14261	248	82	50.00a	50.00a	NUM
bam-14261	248	83	37	37	NUM
bam-14261	248	84	2	2	NUM
bam-14261	248	85	5.41	5.41	NUM
bam-14261	248	86	*	*	PUNCT
bam-14261	248	87	p=0.034	p=0.034	X
bam-14261	248	88	,	,	PUNCT
bam-14261	248	89	(	(	PUNCT
bam-14261	248	90	p<0.05	p<0.05	NOUN
bam-14261	248	91	)	)	PUNCT
bam-14261	248	92	compared	compare	VERB
bam-14261	248	93	with	with	ADP
bam-14261	248	94	mssa	mssa	ADJ
bam-14261	248	95	group	group	NOUN
bam-14261	248	96	table	table	NOUN
bam-14261	248	97	5	5	NUM
bam-14261	248	98	.	.	X
bam-14261	248	99	mrsa	mrsa	NOUN
bam-14261	248	100	and	and	CCONJ
bam-14261	248	101	mssa	mssa	ADJ
bam-14261	248	102	virulence	virulence	NOUN
bam-14261	248	103	gene	gene	NOUN
bam-14261	248	104	carrying	carry	VERB
bam-14261	248	105	status	status	NOUN
bam-14261	248	106	[	[	X
bam-14261	248	107	n(%	n(%	NOUN
bam-14261	248	108	)	)	PUNCT
bam-14261	248	109	]	]	PUNCT
bam-14261	248	110	.	.	PUNCT
bam-14261	249	1	virulence	virulence	NOUN
bam-14261	249	2	gene	gene	NOUN
bam-14261	249	3	mrsa	mrsa	NOUN
bam-14261	249	4	mssa	mssa	ADJ
bam-14261	249	5	total	total	ADJ
bam-14261	249	6	number	number	NOUN
bam-14261	249	7	of	of	ADP
bam-14261	249	8	isolates	isolate	NOUN
bam-14261	249	9	(	(	PUNCT
bam-14261	249	10	n	n	NOUN
bam-14261	249	11	=	=	SYM
bam-14261	249	12	82	82	NUM
bam-14261	249	13	)	)	PUNCT
bam-14261	249	14	/	/	SYM
bam-14261	249	15	detection	detection	NOUN
bam-14261	249	16	rate	rate	NOUN
bam-14261	249	17	(	(	PUNCT
bam-14261	249	18	%	%	INTJ
bam-14261	249	19	)	)	PUNCT
bam-14261	249	20	number	number	NOUN
bam-14261	249	21	of	of	ADP
bam-14261	249	22	isolates	isolate	NOUN
bam-14261	249	23	(	(	PUNCT
bam-14261	249	24	n	n	NOUN
bam-14261	249	25	=	=	SYM
bam-14261	249	26	37	37	NUM
bam-14261	249	27	)	)	PUNCT
bam-14261	249	28	/	/	SYM
bam-14261	249	29	detection	detection	NOUN
bam-14261	249	30	rate	rate	NOUN
bam-14261	249	31	(	(	PUNCT
bam-14261	249	32	%	%	INTJ
bam-14261	249	33	)	)	PUNCT
bam-14261	249	34	hla	hla	PROPN
bam-14261	249	35	81(98.78	81(98.78	PROPN
bam-14261	249	36	)	)	PUNCT
bam-14261	249	37	35(94.59	35(94.59	NUM
bam-14261	249	38	)	)	PUNCT
bam-14261	249	39	116(97.48	116(97.48	NUM
bam-14261	249	40	)	)	PUNCT
bam-14261	249	41	clfb	clfb	NOUN
bam-14261	249	42	80(97.56	80(97.56	NOUN
bam-14261	249	43	)	)	PUNCT
bam-14261	249	44	35(94.59	35(94.59	NUM
bam-14261	249	45	)	)	PUNCT
bam-14261	249	46	115(96.64	115(96.64	PROPN
bam-14261	249	47	)	)	PUNCT
bam-14261	249	48	clfa	clfa	NOUN
bam-14261	249	49	53(64.63	53(64.63	NUM
bam-14261	249	50	)	)	PUNCT
bam-14261	249	51	28(75.68	28(75.68	NUM
bam-14261	249	52	)	)	PUNCT
bam-14261	249	53	81(68.07	81(68.07	NUM
bam-14261	249	54	)	)	PUNCT
bam-14261	249	55	fnba	fnba	VERB
bam-14261	249	56	56(68.29	56(68.29	NUM
bam-14261	249	57	)	)	PUNCT
bam-14261	249	58	24(64.86	24(64.86	NOUN
bam-14261	249	59	)	)	PUNCT
bam-14261	249	60	80(67.23	80(67.23	NOUN
bam-14261	249	61	)	)	PUNCT
bam-14261	249	62	hlb	hlb	PROPN
bam-14261	249	63	35(42.68	35(42.68	NUM
bam-14261	249	64	)	)	PUNCT
bam-14261	249	65	14(37.84	14(37.84	NUM
bam-14261	249	66	)	)	PUNCT
bam-14261	249	67	49(41.18	49(41.18	NUM
bam-14261	249	68	)	)	PUNCT
bam-14261	249	69	fnbb	fnbb	ADJ
bam-14261	249	70	32(39.02	32(39.02	NUM
bam-14261	249	71	)	)	PUNCT
bam-14261	249	72	13(35.14	13(35.14	NUM
bam-14261	249	73	)	)	PUNCT
bam-14261	249	74	45(37.82	45(37.82	NUM
bam-14261	249	75	)	)	PUNCT
bam-14261	249	76	pvl	pvl	PROPN
bam-14261	249	77	29(35.37)a	29(35.37)a	NUM
bam-14261	249	78	21(56.76	21(56.76	NUM
bam-14261	249	79	)	)	PUNCT
bam-14261	249	80	50(42.02	50(42.02	NUM
bam-14261	249	81	)	)	PUNCT
bam-14261	249	82	seh	seh	NOUN
bam-14261	249	83	11(13.41	11(13.41	NUM
bam-14261	249	84	)	)	PUNCT
bam-14261	249	85	3(8.11	3(8.11	NUM
bam-14261	249	86	)	)	PUNCT
bam-14261	249	87	14(11.76	14(11.76	NUM
bam-14261	249	88	)	)	PUNCT
bam-14261	249	89	sec	sec	PROPN
bam-14261	249	90	6(7.32	6(7.32	NUM
bam-14261	249	91	)	)	PUNCT
bam-14261	249	92	3(8.11	3(8.11	NUM
bam-14261	249	93	)	)	PUNCT
bam-14261	249	94	9(7.56	9(7.56	NUM
bam-14261	249	95	)	)	PUNCT
bam-14261	249	96	*	*	NOUN
bam-14261	249	97	p=0.034	p=0.034	X
bam-14261	249	98	,	,	PUNCT
bam-14261	249	99	(	(	PUNCT
bam-14261	249	100	p<0.05	p<0.05	NOUN
bam-14261	249	101	)	)	PUNCT
bam-14261	249	102	compared	compare	VERB
bam-14261	249	103	with	with	ADP
bam-14261	249	104	mssa	mssa	ADJ
bam-14261	249	105	group	group	NOUN
bam-14261	249	106	table	table	NOUN
bam-14261	249	107	6	6	NUM
bam-14261	249	108	.	.	PUNCT
bam-14261	250	1	summary	summary	NOUN
bam-14261	250	2	of	of	ADP
bam-14261	250	3	major	major	ADJ
bam-14261	250	4	resistance	resistance	NOUN
bam-14261	250	5	and	and	CCONJ
bam-14261	250	6	virulence	virulence	NOUN
bam-14261	250	7	profiles	profile	NOUN
bam-14261	250	8	of	of	ADP
bam-14261	250	9	s.	s.	PROPN
bam-14261	250	10	aureus	aureus	PROPN
bam-14261	250	11	in	in	ADP
bam-14261	250	12	infectious	infectious	ADJ
bam-14261	250	13	mastitis	mastitis	NOUN
bam-14261	250	14	.	.	PUNCT
bam-14261	251	1	category	category	NOUN
bam-14261	251	2	key	key	PROPN
bam-14261	251	3	findings	finding	NOUN
bam-14261	251	4	clinical	clinical	ADJ
bam-14261	251	5	implication	implication	NOUN
bam-14261	251	6	high	high	ADJ
bam-14261	251	7	resistance	resistance	NOUN
bam-14261	251	8	(	(	PUNCT
bam-14261	251	9	>	>	NOUN
bam-14261	251	10	60	60	NUM
bam-14261	251	11	%	%	NOUN
bam-14261	251	12	)	)	PUNCT
bam-14261	251	13	penicillin	penicillin	NOUN
bam-14261	251	14	g	g	PROPN
bam-14261	251	15	(	(	PUNCT
bam-14261	251	16	mrsa	mrsa	NOUN
bam-14261	251	17	91.5	91.5	NUM
bam-14261	251	18	%	%	NOUN
bam-14261	251	19	,	,	PUNCT
bam-14261	251	20	mssa	mssa	NOUN
bam-14261	251	21	78.4	78.4	NUM
bam-14261	251	22	%	%	NOUN
bam-14261	251	23	)	)	PUNCT
bam-14261	251	24	,	,	PUNCT
bam-14261	251	25	erythromycin	erythromycin	NOUN
bam-14261	251	26	(	(	PUNCT
bam-14261	251	27	mrsa	mrsa	NOUN
bam-14261	251	28	65.8	65.8	NUM
bam-14261	251	29	%	%	NOUN
bam-14261	251	30	,	,	PUNCT
bam-14261	251	31	mssa	mssa	ADJ
bam-14261	251	32	46.0	46.0	NUM
bam-14261	251	33	%	%	NOUN
bam-14261	251	34	)	)	PUNCT
bam-14261	251	35	,	,	PUNCT
bam-14261	251	36	clindamycin	clindamycin	NOUN
bam-14261	251	37	(	(	PUNCT
bam-14261	251	38	mrsa	mrsa	NOUN
bam-14261	251	39	65.8	65.8	NUM
bam-14261	251	40	%	%	NOUN
bam-14261	251	41	,	,	PUNCT
bam-14261	251	42	mssa	mssa	ADJ
bam-14261	251	43	46.0	46.0	NUM
bam-14261	251	44	%	%	NOUN
bam-14261	251	45	)	)	PUNCT
bam-14261	251	46	avoid	avoid	VERB
bam-14261	251	47	use	use	NOUN
bam-14261	251	48	in	in	ADP
bam-14261	251	49	empirical	empirical	ADJ
bam-14261	251	50	therapy	therapy	NOUN
bam-14261	251	51	low	low	ADJ
bam-14261	251	52	resistance	resistance	NOUN
bam-14261	251	53	(	(	PUNCT
bam-14261	251	54	<	<	X
bam-14261	251	55	10	10	NUM
bam-14261	251	56	%	%	NOUN
bam-14261	251	57	)	)	PUNCT
bam-14261	251	58	nitrofurantoin	nitrofurantoin	NOUN
bam-14261	251	59	,	,	PUNCT
bam-14261	251	60	linezolid	linezolid	NOUN
bam-14261	251	61	,	,	PUNCT
bam-14261	251	62	vancomycin	vancomycin	PROPN
bam-14261	251	63	,	,	PUNCT
bam-14261	251	64	rifampicin	rifampicin	VERB
bam-14261	251	65	remain	remain	VERB
bam-14261	251	66	effective	effective	ADJ
bam-14261	251	67	treatment	treatment	NOUN
bam-14261	251	68	options	option	NOUN
bam-14261	251	69	common	common	ADJ
bam-14261	251	70	virulence	virulence	NOUN
bam-14261	251	71	genes	gene	NOUN
bam-14261	251	72	(	(	PUNCT
bam-14261	251	73	>	>	SYM
bam-14261	251	74	90	90	NUM
bam-14261	251	75	%	%	NOUN
bam-14261	251	76	)	)	PUNCT
bam-14261	251	77	hla	hla	PROPN
bam-14261	251	78	,	,	PUNCT
bam-14261	251	79	clfb	clfb	NOUN
bam-14261	251	80	,	,	PUNCT
bam-14261	251	81	clfa	clfa	NOUN
bam-14261	251	82	,	,	PUNCT
bam-14261	251	83	fnba	fnba	PROPN
bam-14261	251	84	associated	associate	VERB
bam-14261	251	85	with	with	ADP
bam-14261	251	86	strong	strong	ADJ
bam-14261	251	87	pathogenicity	pathogenicity	NOUN
bam-14261	251	88	differential	differential	NOUN
bam-14261	251	89	virulence	virulence	NOUN
bam-14261	251	90	pvl	pvl	NOUN
bam-14261	251	91	lower	low	ADJ
bam-14261	251	92	in	in	ADP
bam-14261	251	93	mrsa	mrsa	NOUN
bam-14261	251	94	(	(	PUNCT
bam-14261	251	95	35.4	35.4	NUM
bam-14261	251	96	%	%	NOUN
bam-14261	251	97	)	)	PUNCT
bam-14261	251	98	vs	vs	ADP
bam-14261	251	99	mssa	mssa	ADJ
bam-14261	251	100	(	(	PUNCT
bam-14261	251	101	56.8	56.8	NUM
bam-14261	251	102	%	%	NOUN
bam-14261	251	103	)	)	PUNCT
bam-14261	251	104	may	may	AUX
bam-14261	251	105	affect	affect	VERB
bam-14261	251	106	severity	severity	NOUN
bam-14261	251	107	and	and	CCONJ
bam-14261	251	108	muscle	muscle	NOUN
bam-14261	251	109	involvement	involvement	NOUN