id	sid	tid	token	lemma	pos
bam-6406	1	1	muscle	muscle	NOUN
bam-6406	1	2	denervation	denervation	NOUN
bam-6406	1	3	atrophy	atrophy	NOUN
bam-6406	1	4	is	be	AUX
bam-6406	1	5	not	not	PART
bam-6406	1	6	related	relate	VERB
bam-6406	1	7	to	to	PART
bam-6406	1	8	oxidative	oxidative	VERB
bam-6406	1	9	stress	stress	NOUN
bam-6406	1	10	eur	eur	PROPN
bam-6406	1	11	j	j	PROPN
bam-6406	1	12	transl	transl	PROPN
bam-6406	1	13	myol	myol	NOUN
bam-6406	1	14	2017	2017	NUM
bam-6406	1	15	;	;	PUNCT
bam-6406	1	16	27	27	NUM
bam-6406	1	17	(	(	PUNCT
bam-6406	1	18	1	1	NUM
bam-6406	1	19	):	):	PUNCT
bam-6406	1	20	43	43	NUM
bam-6406	1	21	-	-	SYM
bam-6406	1	22	50	50	NUM
bam-6406	1	23	43	43	NUM
bam-6406	1	24	denervation	denervation	NOUN
bam-6406	1	25	does	do	AUX
bam-6406	1	26	not	not	PART
bam-6406	1	27	induce	induce	VERB
bam-6406	1	28	muscle	muscle	NOUN
bam-6406	1	29	atrophy	atrophy	NOUN
bam-6406	1	30	through	through	ADP
bam-6406	1	31	oxidative	oxidative	ADJ
bam-6406	1	32	stress	stress	NOUN
bam-6406	1	33	eva	eva	PROPN
bam-6406	1	34	pigna	pigna	PROPN
bam-6406	1	35	(	(	PUNCT
bam-6406	1	36	1	1	NUM
bam-6406	1	37	)	)	PUNCT
bam-6406	1	38	,	,	PUNCT
bam-6406	1	39	emanuela	emanuela	PROPN
bam-6406	1	40	greco	greco	PROPN
bam-6406	1	41	(	(	PUNCT
bam-6406	1	42	1	1	NUM
bam-6406	1	43	)	)	PUNCT
bam-6406	1	44	,	,	PUNCT
bam-6406	1	45	giulio	giulio	PROPN
bam-6406	1	46	morozzi	morozzi	NOUN
bam-6406	1	47	(	(	PUNCT
bam-6406	1	48	2	2	NUM
bam-6406	1	49	)	)	PUNCT
bam-6406	1	50	,	,	PUNCT
bam-6406	1	51	silvia	silvia	PROPN
bam-6406	1	52	grottelli	grottelli	X
bam-6406	1	53	(	(	PUNCT
bam-6406	1	54	2	2	NUM
bam-6406	1	55	)	)	PUNCT
bam-6406	1	56	,	,	PUNCT
bam-6406	1	57	alessio	alessio	PROPN
bam-6406	1	58	rotini	rotini	X
bam-6406	1	59	(	(	PUNCT
bam-6406	1	60	3	3	NUM
bam-6406	1	61	)	)	PUNCT
bam-6406	1	62	,	,	PUNCT
bam-6406	1	63	alba	alba	PROPN
bam-6406	1	64	minelli	minelli	PROPN
bam-6406	1	65	(	(	PUNCT
bam-6406	1	66	2	2	NUM
bam-6406	1	67	)	)	PUNCT
bam-6406	1	68	,	,	PUNCT
bam-6406	1	69	stefania	stefania	NOUN
bam-6406	1	70	fulle	fulle	ADV
bam-6406	1	71	(	(	PUNCT
bam-6406	1	72	3	3	NUM
bam-6406	1	73	)	)	PUNCT
bam-6406	1	74	,	,	PUNCT
bam-6406	1	75	sergio	sergio	PROPN
bam-6406	1	76	adamo	adamo	PROPN
bam-6406	1	77	(	(	PUNCT
bam-6406	1	78	1	1	NUM
bam-6406	1	79	)	)	PUNCT
bam-6406	1	80	*	*	PUNCT
bam-6406	1	81	,	,	PUNCT
bam-6406	1	82	rosa	rosa	PROPN
bam-6406	1	83	mancinelli	mancinelli	PROPN
bam-6406	1	84	(	(	PUNCT
bam-6406	1	85	3	3	NUM
bam-6406	1	86	)	)	PUNCT
bam-6406	1	87	,	,	PUNCT
bam-6406	1	88	ilaria	ilaria	PROPN
bam-6406	1	89	bellezza	bellezza	PROPN
bam-6406	1	90	(	(	PUNCT
bam-6406	1	91	2	2	NUM
bam-6406	1	92	)	)	PUNCT
bam-6406	1	93	,	,	PUNCT
bam-6406	1	94	viviana	viviana	PROPN
bam-6406	1	95	moresi	moresi	PROPN
bam-6406	1	96	(	(	PUNCT
bam-6406	1	97	1	1	NUM
bam-6406	1	98	)	)	PUNCT
bam-6406	1	99	(	(	PUNCT
bam-6406	1	100	1	1	X
bam-6406	1	101	)	)	PUNCT
bam-6406	1	102	dahfmo	dahfmo	NOUN
bam-6406	1	103	unit	unit	NOUN
bam-6406	1	104	of	of	ADP
bam-6406	1	105	histology	histology	NOUN
bam-6406	1	106	and	and	CCONJ
bam-6406	1	107	medical	medical	ADJ
bam-6406	1	108	embryology	embryology	PROPN
bam-6406	1	109	,	,	PUNCT
bam-6406	1	110	interuniversity	interuniversity	NOUN
bam-6406	1	111	institute	institute	PROPN
bam-6406	1	112	of	of	ADP
bam-6406	1	113	myology	myology	NOUN
bam-6406	1	114	,	,	PUNCT
bam-6406	1	115	sapienza	sapienza	PROPN
bam-6406	1	116	university	university	PROPN
bam-6406	1	117	of	of	ADP
bam-6406	1	118	rome	rome	PROPN
bam-6406	1	119	,	,	PUNCT
bam-6406	1	120	rome	rome	PROPN
bam-6406	1	121	,	,	PUNCT
bam-6406	1	122	italy	italy	PROPN
bam-6406	1	123	;	;	PUNCT
bam-6406	1	124	(	(	PUNCT
bam-6406	1	125	2	2	X
bam-6406	1	126	)	)	PUNCT
bam-6406	1	127	department	department	NOUN
bam-6406	1	128	of	of	ADP
bam-6406	1	129	experimental	experimental	ADJ
bam-6406	1	130	medicine	medicine	NOUN
bam-6406	1	131	,	,	PUNCT
bam-6406	1	132	university	university	PROPN
bam-6406	1	133	of	of	ADP
bam-6406	1	134	perugia	perugia	PROPN
bam-6406	1	135	,	,	PUNCT
bam-6406	1	136	perugia	perugia	PROPN
bam-6406	1	137	,	,	PUNCT
bam-6406	1	138	italy	italy	PROPN
bam-6406	1	139	;	;	PUNCT
bam-6406	1	140	(	(	PUNCT
bam-6406	1	141	3	3	X
bam-6406	1	142	)	)	PUNCT
bam-6406	1	143	department	department	NOUN
bam-6406	1	144	of	of	ADP
bam-6406	1	145	neuroscience	neuroscience	NOUN
bam-6406	1	146	imaging	imaging	NOUN
bam-6406	1	147	and	and	CCONJ
bam-6406	1	148	clinical	clinical	ADJ
bam-6406	1	149	sciences	science	NOUN
bam-6406	1	150	–	–	PUNCT
bam-6406	1	151	section	section	NOUN
bam-6406	1	152	of	of	ADP
bam-6406	1	153	physiology	physiology	NOUN
bam-6406	1	154	and	and	CCONJ
bam-6406	1	155	physiopathology	physiopathology	NOUN
bam-6406	1	156	,	,	PUNCT
bam-6406	1	157	university	university	NOUN
bam-6406	1	158	“	"	PUNCT
bam-6406	1	159	g.	g.	PROPN
bam-6406	1	160	d’annunzio	d’annunzio	PROPN
bam-6406	1	161	”	"	PUNCT
bam-6406	1	162	chietipescara	chietipescara	NOUN
bam-6406	1	163	,	,	PUNCT
bam-6406	1	164	chieti	chieti	PROPN
bam-6406	1	165	,	,	PUNCT
bam-6406	1	166	italy	italy	PROPN
bam-6406	1	167	.	.	PUNCT
bam-6406	2	1	*	*	PUNCT
bam-6406	2	2	corresponding	correspond	VERB
bam-6406	2	3	author	author	NOUN
bam-6406	2	4	this	this	DET
bam-6406	2	5	article	article	NOUN
bam-6406	2	6	is	be	AUX
bam-6406	2	7	distributed	distribute	VERB
bam-6406	2	8	under	under	ADP
bam-6406	2	9	the	the	DET
bam-6406	2	10	terms	term	NOUN
bam-6406	2	11	of	of	ADP
bam-6406	2	12	the	the	DET
bam-6406	2	13	creative	creative	ADJ
bam-6406	2	14	commons	common	NOUN
bam-6406	2	15	attribution	attribution	NOUN
bam-6406	2	16	noncommercial	noncommercial	ADJ
bam-6406	2	17	license	license	NOUN
bam-6406	2	18	(	(	PUNCT
bam-6406	2	19	cc	cc	NOUN
bam-6406	2	20	by	by	ADP
bam-6406	2	21	-	-	PUNCT
bam-6406	2	22	nc	nc	PROPN
bam-6406	2	23	4.0	4.0	NUM
bam-6406	2	24	)	)	PUNCT
bam-6406	2	25	which	which	PRON
bam-6406	2	26	permits	permit	VERB
bam-6406	2	27	any	any	DET
bam-6406	2	28	noncommercial	noncommercial	ADJ
bam-6406	2	29	use	use	NOUN
bam-6406	2	30	,	,	PUNCT
bam-6406	2	31	distribution	distribution	NOUN
bam-6406	2	32	,	,	PUNCT
bam-6406	2	33	and	and	CCONJ
bam-6406	2	34	reproduction	reproduction	NOUN
bam-6406	2	35	in	in	ADP
bam-6406	2	36	any	any	DET
bam-6406	2	37	medium	medium	NOUN
bam-6406	2	38	,	,	PUNCT
bam-6406	2	39	provided	provide	VERB
bam-6406	2	40	the	the	DET
bam-6406	2	41	original	original	ADJ
bam-6406	2	42	author(s	author(s	NOUN
bam-6406	2	43	)	)	PUNCT
bam-6406	2	44	and	and	CCONJ
bam-6406	2	45	source	source	NOUN
bam-6406	2	46	are	be	AUX
bam-6406	2	47	credited	credit	VERB
bam-6406	2	48	.	.	PUNCT
bam-6406	3	1	abstract	abstract	ADJ
bam-6406	3	2	denervation	denervation	NOUN
bam-6406	3	3	leads	lead	VERB
bam-6406	3	4	to	to	ADP
bam-6406	3	5	the	the	DET
bam-6406	3	6	activation	activation	NOUN
bam-6406	3	7	of	of	ADP
bam-6406	3	8	the	the	DET
bam-6406	3	9	catabolic	catabolic	ADJ
bam-6406	3	10	pathways	pathway	NOUN
bam-6406	3	11	,	,	PUNCT
bam-6406	3	12	such	such	ADJ
bam-6406	3	13	as	as	ADP
bam-6406	3	14	the	the	DET
bam-6406	3	15	ubiquitin	ubiquitin	NOUN
bam-6406	3	16	-	-	PUNCT
bam-6406	3	17	proteasome	proteasome	NOUN
bam-6406	3	18	and	and	CCONJ
bam-6406	3	19	autophagy	autophagy	VERB
bam-6406	3	20	,	,	PUNCT
bam-6406	3	21	resulting	result	VERB
bam-6406	3	22	in	in	ADP
bam-6406	3	23	skeletal	skeletal	ADJ
bam-6406	3	24	muscle	muscle	NOUN
bam-6406	3	25	atrophy	atrophy	NOUN
bam-6406	3	26	and	and	CCONJ
bam-6406	3	27	weakness	weakness	NOUN
bam-6406	3	28	.	.	PUNCT
bam-6406	4	1	furthermore	furthermore	ADV
bam-6406	4	2	,	,	PUNCT
bam-6406	4	3	denervation	denervation	NOUN
bam-6406	4	4	induces	induce	VERB
bam-6406	4	5	oxidative	oxidative	ADJ
bam-6406	4	6	stress	stress	NOUN
bam-6406	4	7	in	in	ADP
bam-6406	4	8	skeletal	skeletal	ADJ
bam-6406	4	9	muscle	muscle	NOUN
bam-6406	4	10	,	,	PUNCT
bam-6406	4	11	which	which	PRON
bam-6406	4	12	is	be	AUX
bam-6406	4	13	thought	think	VERB
bam-6406	4	14	to	to	PART
bam-6406	4	15	contribute	contribute	VERB
bam-6406	4	16	to	to	ADP
bam-6406	4	17	the	the	DET
bam-6406	4	18	induction	induction	NOUN
bam-6406	4	19	of	of	ADP
bam-6406	4	20	skeletal	skeletal	ADJ
bam-6406	4	21	muscle	muscle	NOUN
bam-6406	4	22	atrophy	atrophy	NOUN
bam-6406	4	23	.	.	PUNCT
bam-6406	5	1	several	several	ADJ
bam-6406	5	2	muscle	muscle	NOUN
bam-6406	5	3	diseases	disease	NOUN
bam-6406	5	4	are	be	AUX
bam-6406	5	5	characterized	characterize	VERB
bam-6406	5	6	by	by	ADP
bam-6406	5	7	denervation	denervation	NOUN
bam-6406	5	8	,	,	PUNCT
bam-6406	5	9	but	but	CCONJ
bam-6406	5	10	the	the	DET
bam-6406	5	11	molecular	molecular	ADJ
bam-6406	5	12	pathways	pathway	NOUN
bam-6406	5	13	contributing	contribute	VERB
bam-6406	5	14	to	to	AUX
bam-6406	5	15	muscle	muscle	NOUN
bam-6406	5	16	atrophy	atrophy	NOUN
bam-6406	5	17	have	have	AUX
bam-6406	5	18	been	be	AUX
bam-6406	5	19	only	only	ADV
bam-6406	5	20	partially	partially	ADV
bam-6406	5	21	described	describe	VERB
bam-6406	5	22	.	.	PUNCT
bam-6406	6	1	our	our	PRON
bam-6406	6	2	study	study	NOUN
bam-6406	6	3	delineates	delineate	VERB
bam-6406	6	4	the	the	DET
bam-6406	6	5	kinetics	kinetic	NOUN
bam-6406	6	6	of	of	ADP
bam-6406	6	7	activation	activation	NOUN
bam-6406	6	8	of	of	ADP
bam-6406	6	9	oxidative	oxidative	ADJ
bam-6406	6	10	stress	stress	NOUN
bam-6406	6	11	response	response	NOUN
bam-6406	6	12	in	in	ADP
bam-6406	6	13	skeletal	skeletal	ADJ
bam-6406	6	14	muscle	muscle	NOUN
bam-6406	6	15	following	follow	VERB
bam-6406	6	16	denervation	denervation	NOUN
bam-6406	6	17	.	.	PUNCT
bam-6406	7	1	despite	despite	SCONJ
bam-6406	7	2	the	the	DET
bam-6406	7	3	denervation	denervation	NOUN
bam-6406	7	4	-	-	PUNCT
bam-6406	7	5	dependent	dependent	ADJ
bam-6406	7	6	induction	induction	NOUN
bam-6406	7	7	of	of	ADP
bam-6406	7	8	oxidative	oxidative	ADJ
bam-6406	7	9	stress	stress	NOUN
bam-6406	7	10	in	in	ADP
bam-6406	7	11	skeletal	skeletal	ADJ
bam-6406	7	12	muscle	muscle	NOUN
bam-6406	7	13	,	,	PUNCT
bam-6406	7	14	treatments	treatment	NOUN
bam-6406	7	15	with	with	ADP
bam-6406	7	16	anti	anti	ADJ
bam-6406	7	17	-	-	ADJ
bam-6406	7	18	oxidant	oxidant	ADJ
bam-6406	7	19	drugs	drug	NOUN
bam-6406	7	20	do	do	AUX
bam-6406	7	21	not	not	PART
bam-6406	7	22	prevent	prevent	VERB
bam-6406	7	23	the	the	DET
bam-6406	7	24	reduction	reduction	NOUN
bam-6406	7	25	of	of	ADP
bam-6406	7	26	muscle	muscle	NOUN
bam-6406	7	27	mass	mass	PROPN
bam-6406	7	28	.	.	PUNCT
bam-6406	8	1	our	our	PRON
bam-6406	8	2	results	result	NOUN
bam-6406	8	3	indicate	indicate	VERB
bam-6406	8	4	that	that	SCONJ
bam-6406	8	5	,	,	PUNCT
bam-6406	8	6	although	although	SCONJ
bam-6406	8	7	oxidative	oxidative	ADJ
bam-6406	8	8	stress	stress	NOUN
bam-6406	8	9	may	may	AUX
bam-6406	8	10	contribute	contribute	VERB
bam-6406	8	11	to	to	ADP
bam-6406	8	12	the	the	DET
bam-6406	8	13	activation	activation	NOUN
bam-6406	8	14	of	of	ADP
bam-6406	8	15	the	the	DET
bam-6406	8	16	response	response	NOUN
bam-6406	8	17	to	to	ADP
bam-6406	8	18	denervation	denervation	NOUN
bam-6406	8	19	,	,	PUNCT
bam-6406	8	20	it	it	PRON
bam-6406	8	21	is	be	AUX
bam-6406	8	22	not	not	PART
bam-6406	8	23	responsible	responsible	ADJ
bam-6406	8	24	by	by	ADP
bam-6406	8	25	itself	itself	PRON
bam-6406	8	26	of	of	ADP
bam-6406	8	27	oxidative	oxidative	ADJ
bam-6406	8	28	damage	damage	NOUN
bam-6406	8	29	or	or	CCONJ
bam-6406	8	30	neurogenic	neurogenic	ADJ
bam-6406	8	31	muscle	muscle	NOUN
bam-6406	8	32	atrophy	atrophy	NOUN
bam-6406	8	33	.	.	PUNCT
bam-6406	9	1	key	key	ADJ
bam-6406	9	2	words	word	NOUN
bam-6406	9	3	:	:	PUNCT
bam-6406	9	4	denervation	denervation	NOUN
bam-6406	9	5	,	,	PUNCT
bam-6406	9	6	oxidative	oxidative	ADJ
bam-6406	9	7	stress	stress	NOUN
bam-6406	9	8	,	,	PUNCT
bam-6406	9	9	antioxidant	antioxidant	ADJ
bam-6406	9	10	drug	drug	NOUN
bam-6406	9	11	,	,	PUNCT
bam-6406	9	12	neurogenic	neurogenic	ADJ
bam-6406	9	13	muscle	muscle	NOUN
bam-6406	9	14	atrophy	atrophy	NOUN
bam-6406	9	15	.	.	PUNCT
bam-6406	10	1	eur	eur	PROPN
bam-6406	10	2	j	j	PROPN
bam-6406	10	3	transl	transl	PROPN
bam-6406	10	4	myol	myol	NOUN
bam-6406	10	5	2017	2017	NUM
bam-6406	10	6	;	;	PUNCT
bam-6406	10	7	27	27	NUM
bam-6406	10	8	(	(	PUNCT
bam-6406	10	9	1	1	NUM
bam-6406	10	10	):	):	PUNCT
bam-6406	10	11	43	43	NUM
bam-6406	10	12	-	-	SYM
bam-6406	10	13	50	50	NUM
bam-6406	10	14	loss	loss	NOUN
bam-6406	10	15	of	of	ADP
bam-6406	10	16	motoneuron	motoneuron	NOUN
bam-6406	10	17	innervation	innervation	NOUN
bam-6406	10	18	severely	severely	ADV
bam-6406	10	19	compromises	compromise	VERB
bam-6406	10	20	skeletal	skeletal	ADJ
bam-6406	10	21	muscle	muscle	NOUN
bam-6406	10	22	mass	mass	NOUN
bam-6406	10	23	and	and	CCONJ
bam-6406	10	24	function	function	NOUN
bam-6406	10	25	.	.	PUNCT
bam-6406	11	1	neurogenic	neurogenic	ADJ
bam-6406	11	2	atrophy	atrophy	NOUN
bam-6406	11	3	is	be	AUX
bam-6406	11	4	caused	cause	VERB
bam-6406	11	5	by	by	ADP
bam-6406	11	6	peripheral	peripheral	ADJ
bam-6406	11	7	neuropathies	neuropathy	NOUN
bam-6406	11	8	or	or	CCONJ
bam-6406	11	9	motor	motor	NOUN
bam-6406	11	10	neuron	neuron	NOUN
bam-6406	11	11	diseases	disease	NOUN
bam-6406	11	12	.	.	PUNCT
bam-6406	12	1	muscle	muscle	NOUN
bam-6406	12	2	atrophy	atrophy	NOUN
bam-6406	12	3	results	result	NOUN
bam-6406	12	4	from	from	ADP
bam-6406	12	5	increasing	increase	VERB
bam-6406	12	6	catabolism	catabolism	NOUN
bam-6406	12	7	of	of	ADP
bam-6406	12	8	skeletal	skeletal	ADJ
bam-6406	12	9	muscle	muscle	NOUN
bam-6406	12	10	proteins	protein	NOUN
bam-6406	12	11	often	often	ADV
bam-6406	12	12	coupled	couple	VERB
bam-6406	12	13	with	with	ADP
bam-6406	12	14	reduced	reduce	VERB
bam-6406	12	15	rates	rate	NOUN
bam-6406	12	16	of	of	ADP
bam-6406	12	17	protein	protein	NOUN
bam-6406	12	18	synthesis	synthesis	NOUN
bam-6406	12	19	.	.	PUNCT
bam-6406	13	1	1	1	NUM
bam-6406	13	2	oxidative	oxidative	ADJ
bam-6406	13	3	stress	stress	NOUN
bam-6406	13	4	(	(	PUNCT
bam-6406	13	5	os	os	NOUN
bam-6406	13	6	)	)	PUNCT
bam-6406	13	7	has	have	AUX
bam-6406	13	8	been	be	AUX
bam-6406	13	9	implicated	implicate	VERB
bam-6406	13	10	in	in	ADP
bam-6406	13	11	many	many	ADJ
bam-6406	13	12	pathological	pathological	ADJ
bam-6406	13	13	conditions	condition	NOUN
bam-6406	13	14	,	,	PUNCT
bam-6406	13	15	including	include	VERB
bam-6406	13	16	sarcopenia	sarcopenia	PROPN
bam-6406	13	17	2	2	NUM
bam-6406	13	18	,	,	PUNCT
bam-6406	13	19	unloading	unload	VERB
bam-6406	13	20	3	3	NUM
bam-6406	13	21	amyotrophic	amyotrophic	ADJ
bam-6406	13	22	lateral	lateral	ADJ
bam-6406	13	23	sclerosis	sclerosis	NOUN
bam-6406	13	24	,	,	PUNCT
bam-6406	13	25	4	4	NUM
bam-6406	13	26	and	and	CCONJ
bam-6406	13	27	is	be	AUX
bam-6406	13	28	now	now	ADV
bam-6406	13	29	widely	widely	ADV
bam-6406	13	30	considered	consider	VERB
bam-6406	13	31	a	a	DET
bam-6406	13	32	major	major	ADJ
bam-6406	13	33	trigger	trigger	NOUN
bam-6406	13	34	of	of	ADP
bam-6406	13	35	the	the	DET
bam-6406	13	36	imbalance	imbalance	NOUN
bam-6406	13	37	between	between	ADP
bam-6406	13	38	protein	protein	NOUN
bam-6406	13	39	synthesis	synthesis	NOUN
bam-6406	13	40	and	and	CCONJ
bam-6406	13	41	degradation	degradation	NOUN
bam-6406	13	42	.	.	PUNCT
bam-6406	14	1	5,6	5,6	NUM
bam-6406	14	2	how	how	SCONJ
bam-6406	14	3	is	be	AUX
bam-6406	14	4	os	os	ADV
bam-6406	14	5	thought	think	VERB
bam-6406	14	6	to	to	PART
bam-6406	14	7	contribute	contribute	VERB
bam-6406	14	8	to	to	ADP
bam-6406	14	9	muscle	muscle	NOUN
bam-6406	14	10	atrophy	atrophy	NOUN
bam-6406	14	11	?	?	PUNCT
bam-6406	15	1	on	on	ADP
bam-6406	15	2	one	one	NUM
bam-6406	15	3	hand	hand	NOUN
bam-6406	15	4	ros	ros	PROPN
bam-6406	15	5	directly	directly	ADV
bam-6406	15	6	or	or	CCONJ
bam-6406	15	7	indirectly	indirectly	ADV
bam-6406	15	8	damage	damage	NOUN
bam-6406	15	9	mitochondria	mitochondria	NOUN
bam-6406	15	10	and	and	CCONJ
bam-6406	15	11	cellular	cellular	ADJ
bam-6406	15	12	components	component	NOUN
bam-6406	15	13	,	,	PUNCT
bam-6406	15	14	triggering	trigger	VERB
bam-6406	15	15	autophagy	autophagy	NOUN
bam-6406	15	16	,	,	PUNCT
bam-6406	15	17	one	one	NUM
bam-6406	15	18	of	of	ADP
bam-6406	15	19	the	the	DET
bam-6406	15	20	main	main	ADJ
bam-6406	15	21	catabolic	catabolic	ADJ
bam-6406	15	22	pathway	pathway	NOUN
bam-6406	15	23	.	.	PUNCT
bam-6406	16	1	7	7	NUM
bam-6406	16	2	changes	change	NOUN
bam-6406	16	3	in	in	ADP
bam-6406	16	4	mitochondrial	mitochondrial	ADJ
bam-6406	16	5	shape	shape	NOUN
bam-6406	16	6	also	also	ADV
bam-6406	16	7	activate	activate	VERB
bam-6406	16	8	ampk	ampk	NOUN
bam-6406	16	9	,	,	PUNCT
bam-6406	16	10	which	which	PRON
bam-6406	16	11	in	in	ADP
bam-6406	16	12	turn	turn	NOUN
bam-6406	16	13	positively	positively	ADV
bam-6406	16	14	regulates	regulate	VERB
bam-6406	16	15	foxo3	foxo3	PROPN
bam-6406	16	16	,	,	PUNCT
bam-6406	16	17	8,9	8,9	NUM
bam-6406	16	18	leading	lead	VERB
bam-6406	16	19	to	to	ADP
bam-6406	16	20	muscle	muscle	NOUN
bam-6406	16	21	atrophy	atrophy	NOUN
bam-6406	16	22	via	via	ADP
bam-6406	16	23	the	the	DET
bam-6406	16	24	autophagic	autophagic	NOUN
bam-6406	16	25	and	and	CCONJ
bam-6406	16	26	ubiquitin	ubiquitin	ADJ
bam-6406	16	27	-	-	PUNCT
bam-6406	16	28	proteasome	proteasome	NOUN
bam-6406	16	29	system	system	NOUN
bam-6406	16	30	.	.	PUNCT
bam-6406	17	1	together	together	ADV
bam-6406	17	2	with	with	ADP
bam-6406	17	3	an	an	DET
bam-6406	17	4	increase	increase	NOUN
bam-6406	17	5	in	in	ADP
bam-6406	17	6	muscle	muscle	NOUN
bam-6406	17	7	proteolysis	proteolysis	NOUN
bam-6406	17	8	,	,	PUNCT
bam-6406	17	9	muscle	muscle	NOUN
bam-6406	17	10	atrophy	atrophy	NOUN
bam-6406	17	11	is	be	AUX
bam-6406	17	12	the	the	DET
bam-6406	17	13	result	result	NOUN
bam-6406	17	14	of	of	ADP
bam-6406	17	15	decreased	decrease	VERB
bam-6406	17	16	regenerative	regenerative	ADJ
bam-6406	17	17	ability	ability	NOUN
bam-6406	17	18	.	.	PUNCT
bam-6406	18	1	os	os	NOUN
bam-6406	18	2	and	and	CCONJ
bam-6406	18	3	impaired	impaired	ADJ
bam-6406	18	4	antioxidant	antioxidant	ADJ
bam-6406	18	5	activity	activity	NOUN
bam-6406	18	6	negatively	negatively	ADV
bam-6406	18	7	affect	affect	VERB
bam-6406	18	8	the	the	DET
bam-6406	18	9	differentiation	differentiation	NOUN
bam-6406	18	10	of	of	ADP
bam-6406	18	11	satellite	satellite	NOUN
bam-6406	18	12	cells	cell	NOUN
bam-6406	18	13	,	,	PUNCT
bam-6406	18	14	2,10	2,10	NUM
bam-6406	18	15	the	the	DET
bam-6406	18	16	muscle	muscle	NOUN
bam-6406	18	17	progenitor	progenitor	NOUN
bam-6406	18	18	cells	cell	NOUN
bam-6406	18	19	,	,	PUNCT
bam-6406	18	20	responsible	responsible	ADJ
bam-6406	18	21	for	for	ADP
bam-6406	18	22	the	the	DET
bam-6406	18	23	repair	repair	NOUN
bam-6406	18	24	or	or	CCONJ
bam-6406	18	25	growth	growth	NOUN
bam-6406	18	26	of	of	ADP
bam-6406	18	27	adult	adult	NOUN
bam-6406	18	28	skeletal	skeletal	ADJ
bam-6406	18	29	muscle	muscle	NOUN
bam-6406	18	30	.	.	PUNCT
bam-6406	19	1	since	since	SCONJ
bam-6406	19	2	excessive	excessive	ADJ
bam-6406	19	3	os	os	NOUN
bam-6406	19	4	contributes	contribute	VERB
bam-6406	19	5	to	to	ADP
bam-6406	19	6	muscle	muscle	NOUN
bam-6406	19	7	damage	damage	NOUN
bam-6406	19	8	,	,	PUNCT
bam-6406	19	9	a	a	DET
bam-6406	19	10	proper	proper	ADJ
bam-6406	19	11	response	response	NOUN
bam-6406	19	12	is	be	AUX
bam-6406	19	13	critical	critical	ADJ
bam-6406	19	14	to	to	PART
bam-6406	19	15	maintain	maintain	VERB
bam-6406	19	16	cell	cell	NOUN
bam-6406	19	17	homeostasis	homeostasis	NOUN
bam-6406	19	18	.	.	PUNCT
bam-6406	20	1	several	several	ADJ
bam-6406	20	2	transcription	transcription	NOUN
bam-6406	20	3	factors	factor	NOUN
bam-6406	20	4	are	be	AUX
bam-6406	20	5	activated	activate	VERB
bam-6406	20	6	in	in	ADP
bam-6406	20	7	response	response	NOUN
bam-6406	20	8	to	to	ADP
bam-6406	20	9	os	os	VERB
bam-6406	20	10	and	and	CCONJ
bam-6406	20	11	can	can	AUX
bam-6406	20	12	trigger	trigger	VERB
bam-6406	20	13	either	either	CCONJ
bam-6406	20	14	cell	cell	NOUN
bam-6406	20	15	protection	protection	NOUN
bam-6406	20	16	or	or	CCONJ
bam-6406	20	17	cell	cell	NOUN
bam-6406	20	18	death	death	NOUN
bam-6406	20	19	,	,	PUNCT
bam-6406	20	20	depending	depend	VERB
bam-6406	20	21	on	on	ADP
bam-6406	20	22	ros	ros	PROPN
bam-6406	20	23	levels	level	NOUN
bam-6406	20	24	.	.	PUNCT
bam-6406	21	1	intracellular	intracellular	ADJ
bam-6406	21	2	oxidative	oxidative	ADJ
bam-6406	21	3	stress	stress	NOUN
bam-6406	21	4	is	be	AUX
bam-6406	21	5	sensed	sense	VERB
bam-6406	21	6	by	by	ADP
bam-6406	21	7	nf	nf	NOUN
bam-6406	21	8	-	-	PUNCT
bam-6406	21	9	e2	e2	NOUN
bam-6406	21	10	p45related	p45relate	VERB
bam-6406	21	11	factor	factor	NOUN
bam-6406	21	12	2	2	NUM
bam-6406	21	13	(	(	PUNCT
bam-6406	21	14	nfe2l2	nfe2l2	PROPN
bam-6406	21	15	)	)	PUNCT
bam-6406	21	16	,	,	PUNCT
bam-6406	21	17	a	a	DET
bam-6406	21	18	transcription	transcription	NOUN
bam-6406	21	19	factor	factor	NOUN
bam-6406	21	20	which	which	PRON
bam-6406	21	21	induces	induce	VERB
bam-6406	21	22	the	the	DET
bam-6406	21	23	expression	expression	NOUN
bam-6406	21	24	of	of	ADP
bam-6406	21	25	phase	phase	NOUN
bam-6406	21	26	ii	ii	PROPN
bam-6406	21	27	antioxidant	antioxidant	NOUN
bam-6406	21	28	genes	gene	NOUN
bam-6406	21	29	.	.	PUNCT
bam-6406	22	1	11,12	11,12	NUM
bam-6406	22	2	antioxidant	antioxidant	ADJ
bam-6406	22	3	enzymes	enzyme	NOUN
bam-6406	22	4	regulated	regulate	VERB
bam-6406	22	5	by	by	ADP
bam-6406	22	6	nfe2l2	nfe2l2	PROPN
bam-6406	22	7	include	include	VERB
bam-6406	22	8	:	:	PUNCT
bam-6406	22	9	heme	heme	NOUN
bam-6406	22	10	oxygenase-1	oxygenase-1	PROPN
bam-6406	22	11	(	(	PUNCT
bam-6406	22	12	hmox1	hmox1	NOUN
bam-6406	22	13	)	)	PUNCT
bam-6406	22	14	,	,	PUNCT
bam-6406	22	15	nad(p)h	nad(p)h	NOUN
bam-6406	22	16	:	:	PUNCT
bam-6406	22	17	quinone	quinone	NOUN
bam-6406	22	18	oxidoreductase	oxidoreductase	NOUN
bam-6406	22	19	(	(	PUNCT
bam-6406	22	20	nqo1	nqo1	PROPN
bam-6406	22	21	)	)	PUNCT
bam-6406	22	22	,	,	PUNCT
bam-6406	22	23	thioredoxin	thioredoxin	PROPN
bam-6406	22	24	reductase	reductase	NOUN
bam-6406	22	25	1	1	NUM
bam-6406	22	26	(	(	PUNCT
bam-6406	22	27	txn	txn	NOUN
bam-6406	22	28	1	1	NUM
bam-6406	22	29	)	)	PUNCT
bam-6406	22	30	,	,	PUNCT
bam-6406	22	31	glutamate	glutamate	NOUN
bam-6406	22	32	-	-	PUNCT
bam-6406	22	33	cysteine	cysteine	NOUN
bam-6406	22	34	ligase	ligase	NOUN
bam-6406	22	35	modifier	modifier	NOUN
bam-6406	22	36	subunit	subunit	NOUN
bam-6406	22	37	(	(	PUNCT
bam-6406	22	38	gclm	gclm	PROPN
bam-6406	22	39	)	)	PUNCT
bam-6406	22	40	and	and	CCONJ
bam-6406	22	41	glutamate	glutamate	NOUN
bam-6406	22	42	-	-	PUNCT
bam-6406	22	43	cysteine	cysteine	NOUN
bam-6406	22	44	ligase	ligase	NOUN
bam-6406	22	45	catalytic	catalytic	ADJ
bam-6406	22	46	subunit	subunit	NOUN
bam-6406	22	47	(	(	PUNCT
bam-6406	22	48	gclc	gclc	PROPN
bam-6406	22	49	)	)	PUNCT
bam-6406	22	50	.	.	PUNCT
bam-6406	23	1	12	12	NUM
bam-6406	23	2	-	-	SYM
bam-6406	23	3	14	14	NUM
bam-6406	23	4	increased	increase	VERB
bam-6406	23	5	levels	level	NOUN
bam-6406	23	6	of	of	ADP
bam-6406	23	7	ros	ros	PROPN
bam-6406	23	8	can	can	AUX
bam-6406	23	9	also	also	ADV
bam-6406	23	10	be	be	AUX
bam-6406	23	11	sensed	sense	VERB
bam-6406	23	12	by	by	ADP
bam-6406	23	13	nfκb	nfκb	PROPN
bam-6406	23	14	.	.	PROPN
bam-6406	24	1	nfκb	nfκb	PROPN
bam-6406	24	2	has	have	VERB
bam-6406	24	3	a	a	DET
bam-6406	24	4	dual	dual	ADJ
bam-6406	24	5	role	role	NOUN
bam-6406	24	6	in	in	ADP
bam-6406	24	7	the	the	DET
bam-6406	24	8	os	os	NOUN
bam-6406	24	9	response	response	NOUN
bam-6406	24	10	because	because	SCONJ
bam-6406	24	11	,	,	PUNCT
bam-6406	24	12	on	on	ADP
bam-6406	24	13	one	one	NUM
bam-6406	24	14	hand	hand	NOUN
bam-6406	24	15	,	,	PUNCT
bam-6406	24	16	nfκb	nfκb	NOUN
bam-6406	24	17	activates	activate	VERB
bam-6406	24	18	several	several	ADJ
bam-6406	24	19	genes	gene	NOUN
bam-6406	24	20	that	that	PRON
bam-6406	24	21	play	play	VERB
bam-6406	24	22	a	a	DET
bam-6406	24	23	major	major	ADJ
bam-6406	24	24	role	role	NOUN
bam-6406	24	25	in	in	ADP
bam-6406	24	26	antioxidant	antioxidant	ADJ
bam-6406	24	27	defense	defense	NOUN
bam-6406	24	28	(	(	PUNCT
bam-6406	24	29	e.g.	e.g.	ADV
bam-6406	24	30	manganese	manganese	ADJ
bam-6406	24	31	superoxide	superoxide	NOUN
bam-6406	24	32	dismutase	dismutase	NOUN
bam-6406	24	33	mnsod	mnsod	NOUN
bam-6406	24	34	,	,	PUNCT
bam-6406	24	35	nqo1	nqo1	NOUN
bam-6406	24	36	,	,	PUNCT
bam-6406	24	37	glutathione	glutathione	NOUN
bam-6406	24	38	oxidoreductase-1	oxidoreductase-1	PROPN
bam-6406	24	39	gpx1	gpx1	NOUN
bam-6406	24	40	)	)	PUNCT
bam-6406	24	41	,	,	PUNCT
bam-6406	24	42	on	on	ADP
bam-6406	24	43	the	the	DET
bam-6406	24	44	other	other	ADJ
bam-6406	24	45	hand	hand	NOUN
bam-6406	24	46	,	,	PUNCT
bam-6406	24	47	other	other	ADJ
bam-6406	24	48	nfκb	nfκb	NOUN
bam-6406	24	49	-	-	PUNCT
bam-6406	24	50	targets	target	NOUN
bam-6406	24	51	are	be	AUX
bam-6406	24	52	involved	involve	VERB
bam-6406	24	53	in	in	ADP
bam-6406	24	54	ros	ros	PROPN
bam-6406	24	55	generation	generation	NOUN
bam-6406	24	56	(	(	PUNCT
bam-6406	24	57	e.g.	e.g.	ADV
bam-6406	24	58	nadph	nadph	ADJ
bam-6406	24	59	oxidase	oxidase	NOUN
bam-6406	24	60	2	2	NUM
bam-6406	24	61	–	–	PUNCT
bam-6406	24	62	cybb	cybb	NOUN
bam-6406	24	63	,	,	PUNCT
bam-6406	24	64	inducible	inducible	ADJ
bam-6406	24	65	nitric	nitric	ADJ
bam-6406	24	66	oxide	oxide	NOUN
bam-6406	24	67	muscle	muscle	NOUN
bam-6406	24	68	denervation	denervation	NOUN
bam-6406	24	69	atrophy	atrophy	NOUN
bam-6406	24	70	is	be	AUX
bam-6406	24	71	not	not	PART
bam-6406	24	72	related	relate	VERB
bam-6406	24	73	to	to	PART
bam-6406	24	74	oxidative	oxidative	VERB
bam-6406	24	75	stress	stress	NOUN
bam-6406	24	76	eur	eur	PROPN
bam-6406	24	77	j	j	PROPN
bam-6406	24	78	transl	transl	PROPN
bam-6406	24	79	myol	myol	NOUN
bam-6406	24	80	2017	2017	NUM
bam-6406	24	81	;	;	PUNCT
bam-6406	24	82	27	27	NUM
bam-6406	24	83	(	(	PUNCT
bam-6406	24	84	1	1	NUM
bam-6406	24	85	):	):	PUNCT
bam-6406	24	86	43	43	NUM
bam-6406	24	87	-	-	SYM
bam-6406	24	88	50	50	NUM
bam-6406	24	89	44	44	NUM
bam-6406	24	90	synthase	synthase	NOUN
bam-6406	24	91	–	–	PUNCT
bam-6406	24	92	inos	ino	NOUN
bam-6406	24	93	,	,	PUNCT
bam-6406	24	94	cyclooxygenase-2	cyclooxygenase-2	NUM
bam-6406	24	95	–	–	PUNCT
bam-6406	24	96	cox2	cox2	NOUN
bam-6406	24	97	)	)	PUNCT
bam-6406	24	98	and	and	CCONJ
bam-6406	24	99	skeletal	skeletal	ADJ
bam-6406	24	100	muscle	muscle	NOUN
bam-6406	24	101	atrophy	atrophy	NOUN
bam-6406	24	102	(	(	PUNCT
bam-6406	24	103	murf1	murf1	NOUN
bam-6406	24	104	)	)	PUNCT
bam-6406	24	105	.	.	PUNCT
bam-6406	25	1	moreover	moreover	ADV
bam-6406	25	2	,	,	PUNCT
bam-6406	25	3	a	a	DET
bam-6406	25	4	cross	cross	NOUN
bam-6406	25	5	talk	talk	NOUN
bam-6406	25	6	between	between	ADP
bam-6406	25	7	nfe2l2	nfe2l2	PROPN
bam-6406	25	8	and	and	CCONJ
bam-6406	25	9	nfκb	nfκb	NOUN
bam-6406	25	10	has	have	AUX
bam-6406	25	11	been	be	AUX
bam-6406	25	12	demonstrated	demonstrate	VERB
bam-6406	25	13	in	in	ADP
bam-6406	25	14	several	several	ADJ
bam-6406	25	15	experimental	experimental	ADJ
bam-6406	25	16	models	model	NOUN
bam-6406	25	17	.	.	PUNCT
bam-6406	26	1	indeed	indeed	ADV
bam-6406	26	2	,	,	PUNCT
bam-6406	26	3	as	as	ADP
bam-6406	26	4	redoxsensitive	redoxsensitive	ADJ
bam-6406	26	5	transcription	transcription	NOUN
bam-6406	26	6	factors	factor	NOUN
bam-6406	26	7	,	,	PUNCT
bam-6406	26	8	depending	depend	VERB
bam-6406	26	9	on	on	ADP
bam-6406	26	10	the	the	DET
bam-6406	26	11	levels	level	NOUN
bam-6406	26	12	of	of	ADP
bam-6406	26	13	ros	ros	PROPN
bam-6406	26	14	,	,	PUNCT
bam-6406	26	15	nfe2l2	nfe2l2	PROPN
bam-6406	26	16	and	and	CCONJ
bam-6406	26	17	nfκb	nfκb	NOUN
bam-6406	26	18	are	be	AUX
bam-6406	26	19	activated	activate	VERB
bam-6406	26	20	,	,	PUNCT
bam-6406	26	21	coordinating	coordinate	VERB
bam-6406	26	22	distinct	distinct	ADJ
bam-6406	26	23	biological	biological	ADJ
bam-6406	26	24	responses	response	NOUN
bam-6406	26	25	.	.	PUNCT
bam-6406	27	1	11,12,15,16	11,12,15,16	NUM
bam-6406	27	2	an	an	DET
bam-6406	27	3	increase	increase	NOUN
bam-6406	27	4	in	in	ADP
bam-6406	27	5	mitochondrial	mitochondrial	ADJ
bam-6406	27	6	-	-	PUNCT
bam-6406	27	7	derived	derive	VERB
bam-6406	27	8	reactive	reactive	ADJ
bam-6406	27	9	oxygen	oxygen	NOUN
bam-6406	27	10	species	specie	NOUN
bam-6406	27	11	(	(	PUNCT
bam-6406	27	12	ros	ros	PROPN
bam-6406	27	13	)	)	PUNCT
bam-6406	27	14	has	have	AUX
bam-6406	27	15	been	be	AUX
bam-6406	27	16	reported	report	VERB
bam-6406	27	17	following	follow	VERB
bam-6406	27	18	denervation	denervation	NOUN
bam-6406	27	19	,	,	PUNCT
bam-6406	27	20	correlating	correlate	VERB
bam-6406	27	21	with	with	ADP
bam-6406	27	22	a	a	DET
bam-6406	27	23	decrease	decrease	NOUN
bam-6406	27	24	in	in	ADP
bam-6406	27	25	mitochondrial	mitochondrial	ADJ
bam-6406	27	26	respiration	respiration	NOUN
bam-6406	27	27	rate	rate	NOUN
bam-6406	27	28	,	,	PUNCT
bam-6406	27	29	17	17	NUM
bam-6406	27	30	but	but	CCONJ
bam-6406	27	31	its	its	PRON
bam-6406	27	32	biological	biological	ADJ
bam-6406	27	33	relevance	relevance	NOUN
bam-6406	27	34	has	have	AUX
bam-6406	27	35	not	not	PART
bam-6406	27	36	been	be	AUX
bam-6406	27	37	addressed	address	VERB
bam-6406	27	38	yet	yet	ADV
bam-6406	27	39	.	.	PUNCT
bam-6406	28	1	the	the	DET
bam-6406	28	2	aim	aim	NOUN
bam-6406	28	3	of	of	ADP
bam-6406	28	4	the	the	DET
bam-6406	28	5	present	present	ADJ
bam-6406	28	6	study	study	NOUN
bam-6406	28	7	is	be	AUX
bam-6406	28	8	to	to	PART
bam-6406	28	9	delineate	delineate	VERB
bam-6406	28	10	the	the	DET
bam-6406	28	11	kinetics	kinetic	NOUN
bam-6406	28	12	of	of	ADP
bam-6406	28	13	activation	activation	NOUN
bam-6406	28	14	of	of	ADP
bam-6406	28	15	os	os	NOUN
bam-6406	28	16	and	and	CCONJ
bam-6406	28	17	os	os	ADJ
bam-6406	28	18	-	-	PUNCT
bam-6406	28	19	response	response	NOUN
bam-6406	28	20	in	in	ADP
bam-6406	28	21	murine	murine	ADJ
bam-6406	28	22	skeletal	skeletal	ADJ
bam-6406	28	23	muscle	muscle	NOUN
bam-6406	28	24	following	follow	VERB
bam-6406	28	25	denervation	denervation	NOUN
bam-6406	28	26	,	,	PUNCT
bam-6406	28	27	and	and	CCONJ
bam-6406	28	28	to	to	PART
bam-6406	28	29	assess	assess	VERB
bam-6406	28	30	the	the	DET
bam-6406	28	31	contribution	contribution	NOUN
bam-6406	28	32	of	of	ADP
bam-6406	28	33	os	os	NOUN
bam-6406	28	34	to	to	ADP
bam-6406	28	35	neurogenic	neurogenic	ADJ
bam-6406	28	36	muscle	muscle	NOUN
bam-6406	28	37	atrophy	atrophy	NOUN
bam-6406	28	38	in	in	ADP
bam-6406	28	39	vivo	vivo	NOUN
bam-6406	28	40	.	.	PUNCT
bam-6406	29	1	material	material	NOUN
bam-6406	29	2	and	and	CCONJ
bam-6406	29	3	methods	method	NOUN
bam-6406	29	4	ethical	ethical	ADJ
bam-6406	29	5	approval	approval	NOUN
bam-6406	29	6	mice	mouse	NOUN
bam-6406	29	7	were	be	AUX
bam-6406	29	8	treated	treat	VERB
bam-6406	29	9	in	in	ADP
bam-6406	29	10	strict	strict	ADJ
bam-6406	29	11	accordance	accordance	NOUN
bam-6406	29	12	with	with	ADP
bam-6406	29	13	the	the	DET
bam-6406	29	14	guidelines	guideline	NOUN
bam-6406	29	15	of	of	ADP
bam-6406	29	16	the	the	DET
bam-6406	29	17	institutional	institutional	ADJ
bam-6406	29	18	animal	animal	NOUN
bam-6406	29	19	care	care	NOUN
bam-6406	29	20	and	and	CCONJ
bam-6406	29	21	use	use	VERB
bam-6406	29	22	committee	committee	NOUN
bam-6406	29	23	and	and	CCONJ
bam-6406	29	24	to	to	ADP
bam-6406	29	25	national	national	ADJ
bam-6406	29	26	and	and	CCONJ
bam-6406	29	27	european	european	ADJ
bam-6406	29	28	legislation	legislation	NOUN
bam-6406	29	29	,	,	PUNCT
bam-6406	29	30	throughout	throughout	ADP
bam-6406	29	31	the	the	DET
bam-6406	29	32	experiments	experiment	NOUN
bam-6406	29	33	(	(	PUNCT
bam-6406	29	34	permit	permit	NOUN
bam-6406	29	35	number	number	NOUN
bam-6406	29	36	80/2014	80/2014	NUM
bam-6406	29	37	-	-	PUNCT
bam-6406	29	38	b	b	NOUN
bam-6406	29	39	of	of	ADP
bam-6406	29	40	03/06/2014	03/06/2014	NUM
bam-6406	29	41	)	)	PUNCT
bam-6406	29	42	.	.	PUNCT
bam-6406	30	1	adult	adult	NOUN
bam-6406	30	2	(	(	PUNCT
bam-6406	30	3	2.5	2.5	NUM
bam-6406	30	4	month	month	NOUN
bam-6406	30	5	-	-	PUNCT
bam-6406	30	6	old	old	ADJ
bam-6406	30	7	)	)	PUNCT
bam-6406	30	8	c57bl/6	c57bl/6	NOUN
bam-6406	30	9	female	female	ADJ
bam-6406	30	10	mice	mouse	NOUN
bam-6406	30	11	were	be	AUX
bam-6406	30	12	used	use	VERB
bam-6406	30	13	throughout	throughout	ADP
bam-6406	30	14	the	the	DET
bam-6406	30	15	experiments	experiment	NOUN
bam-6406	30	16	.	.	PUNCT
bam-6406	31	1	denervation	denervation	NOUN
bam-6406	31	2	adult	adult	NOUN
bam-6406	31	3	mice	mouse	NOUN
bam-6406	31	4	were	be	AUX
bam-6406	31	5	anesthetized	anesthetize	VERB
bam-6406	31	6	,	,	PUNCT
bam-6406	31	7	and	and	CCONJ
bam-6406	31	8	a	a	DET
bam-6406	31	9	3	3	NUM
bam-6406	31	10	mm	mm	NOUN
bam-6406	31	11	segment	segment	NOUN
bam-6406	31	12	of	of	ADP
bam-6406	31	13	the	the	DET
bam-6406	31	14	left	left	ADJ
bam-6406	31	15	limb	limb	NOUN
bam-6406	31	16	sciatic	sciatic	ADJ
bam-6406	31	17	nerve	nerve	NOUN
bam-6406	31	18	was	be	AUX
bam-6406	31	19	excised	excise	VERB
bam-6406	31	20	.	.	PUNCT
bam-6406	32	1	the	the	DET
bam-6406	32	2	nondenervated	nondenervate	VERB
bam-6406	32	3	contralateral	contralateral	ADJ
bam-6406	32	4	limb	limb	NOUN
bam-6406	32	5	was	be	AUX
bam-6406	32	6	used	use	VERB
bam-6406	32	7	as	as	ADP
bam-6406	32	8	control	control	NOUN
bam-6406	32	9	.	.	PUNCT
bam-6406	33	1	when	when	SCONJ
bam-6406	33	2	antioxidants	antioxidant	NOUN
bam-6406	33	3	were	be	AUX
bam-6406	33	4	administered	administer	VERB
bam-6406	33	5	,	,	PUNCT
bam-6406	33	6	mice	mouse	NOUN
bam-6406	33	7	were	be	AUX
bam-6406	33	8	treated	treat	VERB
bam-6406	33	9	daily	daily	ADV
bam-6406	33	10	,	,	PUNCT
bam-6406	33	11	starting	start	VERB
bam-6406	33	12	from	from	ADP
bam-6406	33	13	the	the	DET
bam-6406	33	14	day	day	NOUN
bam-6406	33	15	of	of	ADP
bam-6406	33	16	denervation	denervation	NOUN
bam-6406	33	17	,	,	PUNCT
bam-6406	33	18	by	by	ADP
bam-6406	33	19	an	an	DET
bam-6406	33	20	intraperitoneal	intraperitoneal	NOUN
bam-6406	33	21	(	(	PUNCT
bam-6406	33	22	i.p	i.p	PROPN
bam-6406	33	23	.	.	PROPN
bam-6406	33	24	)	)	PUNCT
bam-6406	33	25	injection	injection	NOUN
bam-6406	33	26	of	of	ADP
bam-6406	33	27	15	15	NUM
bam-6406	33	28	mg	mg	NUM
bam-6406	33	29	/	/	SYM
bam-6406	33	30	kg	kg	PROPN
bam-6406	33	31	trolox	trolox	NOUN
bam-6406	33	32	(	(	PUNCT
bam-6406	33	33	sigma	sigma	PROPN
bam-6406	33	34	)	)	PUNCT
bam-6406	33	35	in	in	ADP
bam-6406	33	36	40	40	NUM
bam-6406	33	37	%	%	NOUN
bam-6406	33	38	naoh	naoh	NOUN
bam-6406	33	39	in	in	ADP
bam-6406	33	40	physiologic	physiologic	ADJ
bam-6406	33	41	solution	solution	NOUN
bam-6406	33	42	,	,	PUNCT
bam-6406	33	43	or	or	CCONJ
bam-6406	33	44	50	50	NUM
bam-6406	33	45	mg	mg	NUM
bam-6406	33	46	/	/	SYM
bam-6406	33	47	kg	kg	PROPN
bam-6406	33	48	resveratrol	resveratrol	NOUN
bam-6406	33	49	(	(	PUNCT
bam-6406	33	50	sigma	sigma	PROPN
bam-6406	33	51	)	)	PUNCT
bam-6406	33	52	in	in	ADP
bam-6406	33	53	1	1	NUM
bam-6406	33	54	%	%	NOUN
bam-6406	33	55	etoh	etoh	NOUN
bam-6406	33	56	in	in	ADP
bam-6406	33	57	physiologic	physiologic	ADJ
bam-6406	33	58	solution	solution	NOUN
bam-6406	33	59	.	.	PUNCT
bam-6406	34	1	vehicle	vehicle	NOUN
bam-6406	34	2	-	-	PUNCT
bam-6406	34	3	treated	treat	VERB
bam-6406	34	4	animals	animal	NOUN
bam-6406	34	5	were	be	AUX
bam-6406	34	6	used	use	VERB
bam-6406	34	7	as	as	ADP
bam-6406	34	8	controls	control	NOUN
bam-6406	34	9	.	.	PUNCT
bam-6406	35	1	histological	histological	ADJ
bam-6406	35	2	analyses	analysis	NOUN
bam-6406	35	3	tibialis	tibialis	PROPN
bam-6406	35	4	anterior	anterior	ADJ
bam-6406	35	5	(	(	PUNCT
bam-6406	35	6	ta	ta	NOUN
bam-6406	35	7	)	)	PUNCT
bam-6406	35	8	muscles	muscle	NOUN
bam-6406	35	9	were	be	AUX
bam-6406	35	10	dissected	dissect	VERB
bam-6406	35	11	,	,	PUNCT
bam-6406	35	12	embedded	embed	VERB
bam-6406	35	13	in	in	ADP
bam-6406	35	14	tissue	tissue	NOUN
bam-6406	35	15	freezing	freeze	VERB
bam-6406	35	16	medium	medium	ADJ
bam-6406	35	17	(	(	PUNCT
bam-6406	35	18	leica	leica	PROPN
bam-6406	35	19	,	,	PUNCT
bam-6406	35	20	wetzlar	wetzlar	ADJ
bam-6406	35	21	,	,	PUNCT
bam-6406	35	22	germany	germany	PROPN
bam-6406	35	23	)	)	PUNCT
bam-6406	35	24	and	and	CCONJ
bam-6406	35	25	frozen	freeze	VERB
bam-6406	35	26	in	in	ADP
bam-6406	35	27	liquid	liquid	ADJ
bam-6406	35	28	nitrogen	nitrogen	NOUN
bam-6406	35	29	pre	pre	ADJ
bam-6406	35	30	-	-	ADJ
bam-6406	35	31	cooled	cooled	ADJ
bam-6406	35	32	isopentane	isopentane	NOUN
bam-6406	35	33	.	.	PUNCT
bam-6406	36	1	cryosections	cryosection	NOUN
bam-6406	36	2	(	(	PUNCT
bam-6406	36	3	8	8	NUM
bam-6406	36	4	μm	μm	NUM
bam-6406	36	5	)	)	PUNCT
bam-6406	36	6	were	be	AUX
bam-6406	36	7	obtained	obtain	VERB
bam-6406	36	8	by	by	ADP
bam-6406	36	9	using	use	VERB
bam-6406	36	10	a	a	DET
bam-6406	36	11	leica	leica	PROPN
bam-6406	36	12	cryostat	cryostat	NOUN
bam-6406	36	13	.	.	PUNCT
bam-6406	37	1	dihydrohetidium	dihydrohetidium	NOUN
bam-6406	37	2	(	(	PUNCT
bam-6406	37	3	dhe	dhe	NOUN
bam-6406	37	4	)	)	PUNCT
bam-6406	37	5	staining	stain	VERB
bam-6406	37	6	was	be	AUX
bam-6406	37	7	performed	perform	VERB
bam-6406	37	8	on	on	ADP
bam-6406	37	9	transverse	transverse	NOUN
bam-6406	37	10	cryosections	cryosection	NOUN
bam-6406	37	11	of	of	ADP
bam-6406	37	12	ta	ta	ADP
bam-6406	37	13	muscles	muscle	NOUN
bam-6406	37	14	.	.	PUNCT
bam-6406	38	1	unfixed	unfixed	ADJ
bam-6406	38	2	cryosections	cryosection	NOUN
bam-6406	38	3	were	be	AUX
bam-6406	38	4	incubated	incubate	VERB
bam-6406	38	5	with	with	ADP
bam-6406	38	6	0,002	0,002	NUM
bam-6406	38	7	mm	mm	PROPN
bam-6406	38	8	dhe	dhe	X
bam-6406	38	9	(	(	PUNCT
bam-6406	38	10	molecular	molecular	ADJ
bam-6406	38	11	probes	probe	NOUN
bam-6406	38	12	d1168	d1168	NOUN
bam-6406	38	13	)	)	PUNCT
bam-6406	38	14	in	in	ADP
bam-6406	38	15	dmso	dmso	NOUN
bam-6406	38	16	for	for	ADP
bam-6406	38	17	30	30	NUM
bam-6406	38	18	minutes	minute	NOUN
bam-6406	38	19	at	at	ADP
bam-6406	38	20	37	37	NUM
bam-6406	38	21	°	°	ADP
bam-6406	38	22	c.	c.	NOUN
bam-6406	38	23	coverslips	coverslip	NOUN
bam-6406	38	24	were	be	AUX
bam-6406	38	25	mounted	mount	VERB
bam-6406	38	26	with	with	ADP
bam-6406	38	27	60	60	NUM
bam-6406	38	28	%	%	NOUN
bam-6406	38	29	glycerol	glycerol	NOUN
bam-6406	38	30	in	in	ADP
bam-6406	38	31	tris	tris	NOUN
bam-6406	38	32	hcl	hcl	PROPN
bam-6406	38	33	0.2	0.2	NUM
bam-6406	38	34	m	m	NOUN
bam-6406	38	35	ph	ph	PROPN
bam-6406	38	36	9.3	9.3	NUM
bam-6406	38	37	.	.	PUNCT
bam-6406	39	1	dhe	dhe	PROPN
bam-6406	39	2	intensity	intensity	PROPN
bam-6406	39	3	was	be	AUX
bam-6406	39	4	quantified	quantify	VERB
bam-6406	39	5	by	by	ADP
bam-6406	39	6	measuring	measure	VERB
bam-6406	39	7	the	the	DET
bam-6406	39	8	signal	signal	NOUN
bam-6406	39	9	in	in	ADP
bam-6406	39	10	10	10	NUM
bam-6406	39	11	fields	field	NOUN
bam-6406	39	12	for	for	ADP
bam-6406	39	13	each	each	DET
bam-6406	39	14	sample	sample	NOUN
bam-6406	39	15	,	,	PUNCT
bam-6406	39	16	using	use	VERB
bam-6406	39	17	image	image	NOUN
bam-6406	39	18	j	j	PROPN
bam-6406	39	19	software	software	NOUN
bam-6406	39	20	.	.	PUNCT
bam-6406	40	1	hematoxylin	hematoxylin	NOUN
bam-6406	40	2	and	and	CCONJ
bam-6406	40	3	eosin	eosin	NOUN
bam-6406	40	4	staining	stain	VERB
bam-6406	40	5	was	be	AUX
bam-6406	40	6	performed	perform	VERB
bam-6406	40	7	according	accord	VERB
bam-6406	40	8	to	to	ADP
bam-6406	40	9	the	the	DET
bam-6406	40	10	sigma	sigma	PROPN
bam-6406	40	11	manufacturer	manufacturer	NOUN
bam-6406	40	12	’s	’s	PART
bam-6406	40	13	instructions	instruction	NOUN
bam-6406	40	14	.	.	PUNCT
bam-6406	41	1	for	for	ADP
bam-6406	41	2	immunofluorescences	immunofluorescence	NOUN
bam-6406	41	3	,	,	PUNCT
bam-6406	41	4	ta	ta	ADP
bam-6406	41	5	cryosections	cryosection	NOUN
bam-6406	41	6	were	be	AUX
bam-6406	41	7	fixed	fix	VERB
bam-6406	41	8	in	in	ADP
bam-6406	41	9	4	4	NUM
bam-6406	41	10	%	%	NOUN
bam-6406	41	11	paraformaldehyde	paraformaldehyde	NOUN
bam-6406	41	12	,	,	PUNCT
bam-6406	41	13	then	then	ADV
bam-6406	41	14	permeabilized	permeabilize	VERB
bam-6406	41	15	with	with	ADP
bam-6406	41	16	0,2	0,2	NUM
bam-6406	41	17	%	%	NOUN
bam-6406	41	18	triton	triton	NOUN
bam-6406	41	19	(	(	PUNCT
bam-6406	41	20	sigma	sigma	PROPN
bam-6406	41	21	)	)	PUNCT
bam-6406	41	22	in	in	ADP
bam-6406	41	23	phosphate	phosphate	NOUN
bam-6406	41	24	-	-	PUNCT
bam-6406	41	25	buffered	buffer	VERB
bam-6406	41	26	saline	saline	NOUN
bam-6406	41	27	(	(	PUNCT
bam-6406	41	28	pbs	pbs	PROPN
bam-6406	41	29	)	)	PUNCT
bam-6406	41	30	and	and	CCONJ
bam-6406	41	31	blocked	block	VERB
bam-6406	41	32	with	with	ADP
bam-6406	41	33	10	10	NUM
bam-6406	41	34	%	%	NOUN
bam-6406	41	35	bsa	bsa	NOUN
bam-6406	41	36	(	(	PUNCT
bam-6406	41	37	sigma	sigma	PROPN
bam-6406	41	38	)	)	PUNCT
bam-6406	41	39	in	in	ADP
bam-6406	41	40	pbs	pbs	PROPN
bam-6406	41	41	.	.	PUNCT
bam-6406	42	1	samples	sample	NOUN
bam-6406	42	2	were	be	AUX
bam-6406	42	3	then	then	ADV
bam-6406	42	4	incubated	incubate	VERB
bam-6406	42	5	with	with	ADP
bam-6406	42	6	1:50	1:50	NUM
bam-6406	42	7	dilution	dilution	NOUN
bam-6406	42	8	of	of	ADP
bam-6406	42	9	nfe2l2	nfe2l2	PROPN
bam-6406	42	10	(	(	PUNCT
bam-6406	42	11	santa	santa	PROPN
bam-6406	42	12	cruz	cruz	PROPN
bam-6406	42	13	(	(	PUNCT
bam-6406	42	14	c-20	c-20	NOUN
bam-6406	42	15	)	)	PUNCT
bam-6406	42	16	sc722	sc722	NOUN
bam-6406	42	17	)	)	PUNCT
bam-6406	42	18	,	,	PUNCT
bam-6406	42	19	followed	follow	VERB
bam-6406	42	20	by	by	ADP
bam-6406	42	21	incubation	incubation	NOUN
bam-6406	42	22	with	with	ADP
bam-6406	42	23	1:500	1:500	NUM
bam-6406	42	24	dilution	dilution	NOUN
bam-6406	42	25	of	of	ADP
bam-6406	42	26	alexa	alexa	ADJ
bam-6406	42	27	fluor	fluor	NOUN
bam-6406	42	28	®	®	NOUN
bam-6406	42	29	488	488	NUM
bam-6406	42	30	conjugate	conjugate	ADJ
bam-6406	42	31	secondary	secondary	ADJ
bam-6406	42	32	antibody	antibody	NOUN
bam-6406	42	33	(	(	PUNCT
bam-6406	42	34	a11008	a11008	NOUN
bam-6406	42	35	)	)	PUNCT
bam-6406	42	36	.	.	PUNCT
bam-6406	43	1	hoechst	hoechst	PROPN
bam-6406	43	2	33342	33342	NUM
bam-6406	43	3	(	(	PUNCT
bam-6406	43	4	sigma	sigma	PROPN
bam-6406	43	5	)	)	PUNCT
bam-6406	43	6	was	be	AUX
bam-6406	43	7	used	use	VERB
bam-6406	43	8	to	to	PART
bam-6406	43	9	stain	stain	NOUN
bam-6406	43	10	nuclei	nucleus	NOUN
bam-6406	43	11	.	.	PUNCT
bam-6406	44	1	rna	rna	NOUN
bam-6406	44	2	extraction	extraction	NOUN
bam-6406	44	3	and	and	CCONJ
bam-6406	44	4	real	real	ADJ
bam-6406	44	5	-	-	PUNCT
bam-6406	44	6	time	time	NOUN
bam-6406	44	7	pcr	pcr	PROPN
bam-6406	44	8	total	total	NOUN
bam-6406	44	9	rna	rna	NOUN
bam-6406	44	10	was	be	AUX
bam-6406	44	11	isolated	isolate	VERB
bam-6406	44	12	and	and	CCONJ
bam-6406	44	13	purified	purify	VERB
bam-6406	44	14	from	from	ADP
bam-6406	44	15	30	30	NUM
bam-6406	44	16	-	-	SYM
bam-6406	44	17	50	50	NUM
bam-6406	44	18	mg	mg	NOUN
bam-6406	44	19	of	of	ADP
bam-6406	44	20	ta	ta	ADP
bam-6406	44	21	muscles	muscle	NOUN
bam-6406	44	22	by	by	ADP
bam-6406	44	23	using	use	VERB
bam-6406	44	24	trizol	trizol	PROPN
bam-6406	44	25	(	(	PUNCT
bam-6406	44	26	invitrogen	invitrogen	PROPN
bam-6406	44	27	)	)	PUNCT
bam-6406	44	28	,	,	PUNCT
bam-6406	44	29	following	follow	VERB
bam-6406	44	30	the	the	DET
bam-6406	44	31	manufacturer	manufacturer	NOUN
bam-6406	44	32	's	's	PART
bam-6406	44	33	protocol	protocol	NOUN
bam-6406	44	34	.	.	PUNCT
bam-6406	45	1	one	one	NUM
bam-6406	45	2	microgram	microgram	NOUN
bam-6406	45	3	of	of	ADP
bam-6406	45	4	total	total	ADJ
bam-6406	45	5	rna	rna	NOUN
bam-6406	45	6	was	be	AUX
bam-6406	45	7	converted	convert	VERB
bam-6406	45	8	to	to	ADP
bam-6406	45	9	cdna	cdna	PROPN
bam-6406	45	10	by	by	ADP
bam-6406	45	11	using	use	VERB
bam-6406	45	12	the	the	DET
bam-6406	45	13	quantitect	quantitect	ADJ
bam-6406	45	14	reverse	reverse	NOUN
bam-6406	45	15	transcription	transcription	NOUN
bam-6406	45	16	kit	kit	NOUN
bam-6406	45	17	(	(	PUNCT
bam-6406	45	18	qiagen	qiagen	PROPN
bam-6406	45	19	)	)	PUNCT
bam-6406	45	20	.	.	PUNCT
bam-6406	46	1	real	real	ADJ
bam-6406	46	2	-	-	PUNCT
bam-6406	46	3	time	time	NOUN
bam-6406	46	4	pcr	pcr	NOUN
bam-6406	46	5	was	be	AUX
bam-6406	46	6	performed	perform	VERB
bam-6406	46	7	with	with	ADP
bam-6406	46	8	the	the	DET
bam-6406	46	9	sds	sds	PROPN
bam-6406	46	10	-	-	PUNCT
bam-6406	46	11	abi	abi	PROPN
bam-6406	46	12	prism	prism	NOUN
bam-6406	46	13	7500	7500	NUM
bam-6406	46	14	(	(	PUNCT
bam-6406	46	15	applied	applied	ADJ
bam-6406	46	16	biosystem	biosystem	NOUN
bam-6406	46	17	)	)	PUNCT
bam-6406	46	18	,	,	PUNCT
bam-6406	46	19	by	by	ADP
bam-6406	46	20	using	use	VERB
bam-6406	46	21	the	the	DET
bam-6406	46	22	sybr	sybr	ADJ
bam-6406	46	23	green	green	ADJ
bam-6406	46	24	reaction	reaction	NOUN
bam-6406	46	25	mix	mix	NOUN
bam-6406	46	26	(	(	PUNCT
bam-6406	46	27	applied	apply	VERB
bam-6406	46	28	biosystem	biosystem	NOUN
bam-6406	46	29	)	)	PUNCT
bam-6406	46	30	.	.	PUNCT
bam-6406	47	1	primers	primer	NOUN
bam-6406	47	2	are	be	AUX
bam-6406	47	3	listed	list	VERB
bam-6406	47	4	in	in	ADP
bam-6406	47	5	table	table	NOUN
bam-6406	47	6	1	1	NUM
bam-6406	47	7	.	.	PUNCT
bam-6406	47	8	rna	rna	NOUN
bam-6406	47	9	extraction	extraction	NOUN
bam-6406	47	10	and	and	CCONJ
bam-6406	47	11	real	real	ADJ
bam-6406	47	12	-	-	PUNCT
bam-6406	47	13	time	time	NOUN
bam-6406	47	14	pcr	pcr	PROPN
bam-6406	47	15	total	total	NOUN
bam-6406	47	16	rna	rna	NOUN
bam-6406	47	17	was	be	AUX
bam-6406	47	18	isolated	isolate	VERB
bam-6406	47	19	and	and	CCONJ
bam-6406	47	20	purified	purify	VERB
bam-6406	47	21	from	from	ADP
bam-6406	47	22	30	30	NUM
bam-6406	47	23	-	-	SYM
bam-6406	47	24	50	50	NUM
bam-6406	47	25	mg	mg	NOUN
bam-6406	47	26	of	of	ADP
bam-6406	47	27	ta	ta	ADP
bam-6406	47	28	muscles	muscle	NOUN
bam-6406	47	29	by	by	ADP
bam-6406	47	30	using	use	VERB
bam-6406	47	31	trizol	trizol	PROPN
bam-6406	47	32	(	(	PUNCT
bam-6406	47	33	invitrogen	invitrogen	PROPN
bam-6406	47	34	)	)	PUNCT
bam-6406	47	35	,	,	PUNCT
bam-6406	47	36	following	follow	VERB
bam-6406	47	37	the	the	DET
bam-6406	47	38	manufacturer	manufacturer	NOUN
bam-6406	47	39	's	's	PART
bam-6406	47	40	protocol	protocol	NOUN
bam-6406	47	41	.	.	PUNCT
bam-6406	48	1	one	one	NUM
bam-6406	48	2	microgram	microgram	NOUN
bam-6406	48	3	of	of	ADP
bam-6406	48	4	total	total	ADJ
bam-6406	48	5	rna	rna	NOUN
bam-6406	48	6	was	be	AUX
bam-6406	48	7	converted	convert	VERB
bam-6406	48	8	to	to	ADP
bam-6406	48	9	cdna	cdna	PROPN
bam-6406	48	10	by	by	ADP
bam-6406	48	11	using	use	VERB
bam-6406	48	12	the	the	DET
bam-6406	48	13	quantitect	quantitect	ADJ
bam-6406	48	14	reverse	reverse	NOUN
bam-6406	48	15	transcription	transcription	NOUN
bam-6406	48	16	kit	kit	NOUN
bam-6406	48	17	(	(	PUNCT
bam-6406	48	18	qiagen	qiagen	PROPN
bam-6406	48	19	)	)	PUNCT
bam-6406	48	20	.	.	PUNCT
bam-6406	49	1	real	real	ADJ
bam-6406	49	2	-	-	PUNCT
bam-6406	49	3	time	time	NOUN
bam-6406	49	4	pcr	pcr	NOUN
bam-6406	49	5	was	be	AUX
bam-6406	49	6	performed	perform	VERB
bam-6406	49	7	with	with	ADP
bam-6406	49	8	the	the	DET
bam-6406	49	9	sds	sds	PROPN
bam-6406	49	10	-	-	PUNCT
bam-6406	49	11	abi	abi	PROPN
bam-6406	49	12	prism	prism	NOUN
bam-6406	49	13	7500	7500	NUM
bam-6406	49	14	(	(	PUNCT
bam-6406	49	15	applied	applied	ADJ
bam-6406	49	16	biosystem	biosystem	NOUN
bam-6406	49	17	)	)	PUNCT
bam-6406	49	18	,	,	PUNCT
bam-6406	49	19	by	by	ADP
bam-6406	49	20	using	use	VERB
bam-6406	49	21	the	the	DET
bam-6406	49	22	sybr	sybr	ADJ
bam-6406	49	23	green	green	ADJ
bam-6406	49	24	reaction	reaction	NOUN
bam-6406	49	25	mix	mix	NOUN
bam-6406	49	26	(	(	PUNCT
bam-6406	49	27	applied	apply	VERB
bam-6406	49	28	biosystem	biosystem	NOUN
bam-6406	49	29	)	)	PUNCT
bam-6406	49	30	.	.	PUNCT
bam-6406	50	1	primers	primer	NOUN
bam-6406	50	2	are	be	AUX
bam-6406	50	3	listed	list	VERB
bam-6406	50	4	in	in	ADP
bam-6406	50	5	table	table	NOUN
bam-6406	50	6	1	1	NUM
bam-6406	50	7	.	.	PUNCT
bam-6406	50	8	protein	protein	NOUN
bam-6406	50	9	extraction	extraction	NOUN
bam-6406	50	10	and	and	CCONJ
bam-6406	50	11	western	western	ADJ
bam-6406	50	12	blot	blot	NOUN
bam-6406	50	13	analyses	analysis	NOUN
bam-6406	50	14	ta	ta	ADP
bam-6406	50	15	muscles	muscle	NOUN
bam-6406	50	16	were	be	AUX
bam-6406	50	17	dissected	dissect	VERB
bam-6406	50	18	,	,	PUNCT
bam-6406	50	19	minced	mince	VERB
bam-6406	50	20	,	,	PUNCT
bam-6406	50	21	and	and	CCONJ
bam-6406	50	22	homogenized	homogenize	VERB
bam-6406	50	23	in	in	ADP
bam-6406	50	24	lysis	lysis	NOUN
bam-6406	50	25	buffer	buffer	NOUN
bam-6406	50	26	(	(	PUNCT
bam-6406	50	27	50	50	NUM
bam-6406	50	28	mm	mm	NOUN
bam-6406	50	29	tris	tris	PROPN
bam-6406	50	30	-	-	PUNCT
bam-6406	50	31	hcl	hcl	NOUN
bam-6406	50	32	ph	ph	VERB
bam-6406	50	33	7.4	7.4	NUM
bam-6406	50	34	,	,	PUNCT
bam-6406	50	35	1	1	NUM
bam-6406	50	36	mm	mm	NUM
bam-6406	50	37	edta	edta	NOUN
bam-6406	50	38	,	,	PUNCT
bam-6406	50	39	150	150	NUM
bam-6406	50	40	mm	mm	NOUN
bam-6406	50	41	nacl	nacl	NOUN
bam-6406	50	42	,	,	PUNCT
bam-6406	50	43	1	1	NUM
bam-6406	50	44	%	%	NOUN
bam-6406	50	45	triton	triton	NOUN
bam-6406	50	46	)	)	PUNCT
bam-6406	50	47	supplemented	supplement	VERB
bam-6406	50	48	with	with	ADP
bam-6406	50	49	table	table	NOUN
bam-6406	50	50	1	1	NUM
bam-6406	50	51	.	.	PUNCT
bam-6406	50	52	table	table	NOUN
bam-6406	50	53	1	1	NUM
bam-6406	50	54	.	.	PUNCT
bam-6406	50	55	list	list	NOUN
bam-6406	50	56	of	of	ADP
bam-6406	50	57	the	the	DET
bam-6406	50	58	primers	primer	NOUN
bam-6406	50	59	used	use	VERB
bam-6406	50	60	in	in	ADP
bam-6406	50	61	real	real	ADJ
bam-6406	50	62	-	-	PUNCT
bam-6406	50	63	time	time	NOUN
bam-6406	50	64	pcr	pcr	ADJ
bam-6406	50	65	gene	gene	NOUN
bam-6406	50	66	forward	forward	ADV
bam-6406	50	67	reverse	reverse	ADJ
bam-6406	50	68	cybb	cybb	NOUN
bam-6406	51	1	tcctatgttcctgtacctttgtg	tcctatgttcctgtacctttgtg	INTJ
bam-6406	51	2	gtcccacctccatcttgaatc	gtcccacctccatcttgaatc	PROPN
bam-6406	51	3	nfe2l2	nfe2l2	PROPN
bam-6406	51	4	ttggcagagacattcccatttg	ttggcagagacattcccatttg	PROPN
bam-6406	51	5	aaacttgctccatgtcctgctcta	aaacttgctccatgtcctgctcta	PROPN
bam-6406	51	6	gclc	gclc	PROPN
bam-6406	51	7	ggcgatgttcttgagactctgc	ggcgatgttcttgagactctgc	VERB
bam-6406	51	8	ttccttcgatcatgtaactccc	ttccttcgatcatgtaactccc	PRON
bam-6406	51	9	gclm	gclm	PROPN
bam-6406	51	10	cacaggtaaaacccaatagtaaccaagt	cacaggtaaaacccaatagtaaccaagt	PROPN
bam-6406	51	11	gtgagtcagtagctgtatgtcaaattgtt	gtgagtcagtagctgtatgtcaaattgtt	PROPN
bam-6406	51	12	cybb	cybb	PROPN
bam-6406	52	1	tcctatgttcctgtacctttgtg	tcctatgttcctgtacctttgtg	INTJ
bam-6406	52	2	gtcccacctccatcttgaatc	gtcccacctccatcttgaatc	PROPN
bam-6406	52	3	hmox1	hmox1	PROPN
bam-6406	52	4	agccccaccaagttcaaaca	agccccaccaagttcaaaca	PROPN
bam-6406	52	5	gcagtatcttgcacca	gcagtatcttgcacca	PROPN
bam-6406	52	6	nqo1	nqo1	PROPN
bam-6406	52	7	cattctgaaaggctggtttga	cattctgaaaggctggtttga	VERB
bam-6406	52	8	ctagctttgatctggttgtca	ctagctttgatctggttgtca	NOUN
bam-6406	52	9	g	g	PROPN
bam-6406	52	10	nfe2l2	nfe2l2	PROPN
bam-6406	52	11	ttggcagagacattcccatttg	ttggcagagacattcccatttg	PROPN
bam-6406	52	12	aaacttgctccatgtcctgctcta	aaacttgctccatgtcctgctcta	PROPN
bam-6406	52	13	cat	cat	PROPN
bam-6406	52	14	tgagaagcctaagaacgcaat	tgagaagcctaagaacgcaat	PUNCT
bam-6406	52	15	cccttcgcabgccatgtg	cccttcgcabgccatgtg	VERB
bam-6406	52	16	txn	txn	PROPN
bam-6406	52	17	1	1	NUM
bam-6406	52	18	gtcgtggtggacttctctgcta	gtcgtggtggacttctctgcta	PROPN
bam-6406	52	19	ttgtcacagagggaatggaaga	ttgtcacagagggaatggaaga	PROPN
bam-6406	52	20	gapdh	gapdh	NOUN
bam-6406	52	21	acccagaagactgtggatgg	acccagaagactgtggatgg	NOUN
bam-6406	52	22	cacattgggggtaggaacac	cacattgggggtaggaacac	PROPN
bam-6406	52	23	muscle	muscle	NOUN
bam-6406	52	24	denervation	denervation	NOUN
bam-6406	52	25	atrophy	atrophy	NOUN
bam-6406	52	26	is	be	AUX
bam-6406	52	27	not	not	PART
bam-6406	52	28	related	relate	VERB
bam-6406	52	29	to	to	PART
bam-6406	52	30	oxidative	oxidative	VERB
bam-6406	52	31	stress	stress	NOUN
bam-6406	52	32	eur	eur	PROPN
bam-6406	52	33	j	j	PROPN
bam-6406	52	34	transl	transl	PROPN
bam-6406	52	35	myol	myol	NOUN
bam-6406	52	36	2017	2017	NUM
bam-6406	52	37	;	;	PUNCT
bam-6406	52	38	27	27	NUM
bam-6406	52	39	(	(	PUNCT
bam-6406	52	40	1	1	NUM
bam-6406	52	41	):	):	PUNCT
bam-6406	52	42	43	43	NUM
bam-6406	52	43	-	-	SYM
bam-6406	52	44	50	50	NUM
bam-6406	52	45	45	45	NUM
bam-6406	52	46	protease	protease	NOUN
bam-6406	52	47	and	and	CCONJ
bam-6406	52	48	phosphatase	phosphatase	NOUN
bam-6406	52	49	inhibitors	inhibitor	NOUN
bam-6406	52	50	(	(	PUNCT
bam-6406	52	51	complete	complete	VERB
bam-6406	52	52	mini	mini	ADJ
bam-6406	52	53	edta	edta	NOUN
bam-6406	52	54	-	-	PUNCT
bam-6406	52	55	free	free	ADJ
bam-6406	52	56	and	and	CCONJ
bam-6406	52	57	phosstop	phosstop	NOUN
bam-6406	52	58	,	,	PUNCT
bam-6406	52	59	roche	roche	NOUN
bam-6406	52	60	)	)	PUNCT
bam-6406	52	61	.	.	PUNCT
bam-6406	53	1	proteins	protein	NOUN
bam-6406	53	2	(	(	PUNCT
bam-6406	53	3	30	30	NUM
bam-6406	53	4	-	-	SYM
bam-6406	53	5	50	50	NUM
bam-6406	53	6	micrograms	microgram	NOUN
bam-6406	53	7	)	)	PUNCT
bam-6406	53	8	were	be	AUX
bam-6406	53	9	separated	separate	VERB
bam-6406	53	10	by	by	ADP
bam-6406	53	11	sds	sds	PROPN
bam-6406	53	12	-	-	PUNCT
bam-6406	53	13	page	page	NOUN
bam-6406	53	14	and	and	CCONJ
bam-6406	53	15	transferred	transfer	VERB
bam-6406	53	16	to	to	ADP
bam-6406	53	17	pvdf	pvdf	PROPN
bam-6406	53	18	membrane	membrane	NOUN
bam-6406	53	19	(	(	PUNCT
bam-6406	53	20	invitrogen	invitrogen	PROPN
bam-6406	53	21	)	)	PUNCT
bam-6406	53	22	.	.	PUNCT
bam-6406	54	1	unspecific	unspecific	ADJ
bam-6406	54	2	binding	binding	NOUN
bam-6406	54	3	was	be	AUX
bam-6406	54	4	blocked	block	VERB
bam-6406	54	5	in	in	ADP
bam-6406	54	6	5	5	NUM
bam-6406	54	7	%	%	NOUN
bam-6406	54	8	not	not	PART
bam-6406	54	9	fat	fat	ADJ
bam-6406	54	10	dry	dry	ADJ
bam-6406	54	11	milk	milk	NOUN
bam-6406	54	12	in	in	ADP
bam-6406	54	13	tbst	tbst	ADJ
bam-6406	54	14	buffer	buffer	NOUN
bam-6406	54	15	(	(	PUNCT
bam-6406	54	16	20	20	NUM
bam-6406	54	17	mm	mm	NOUN
bam-6406	54	18	tris	tris	NOUN
bam-6406	54	19	hcl	hcl	PROPN
bam-6406	54	20	ph	ph	VERB
bam-6406	54	21	7.6	7.6	NUM
bam-6406	54	22	,	,	PUNCT
bam-6406	54	23	137	137	NUM
bam-6406	54	24	mm	mm	NOUN
bam-6406	54	25	nacl	nacl	NOUN
bam-6406	54	26	,	,	PUNCT
bam-6406	54	27	0.5	0.5	NUM
bam-6406	54	28	%	%	NOUN
bam-6406	54	29	tween	tween	NOUN
bam-6406	54	30	20	20	NUM
bam-6406	54	31	)	)	PUNCT
bam-6406	54	32	.	.	PUNCT
bam-6406	55	1	the	the	DET
bam-6406	55	2	membranes	membrane	NOUN
bam-6406	55	3	were	be	AUX
bam-6406	55	4	incubated	incubate	VERB
bam-6406	55	5	overnight	overnight	ADV
bam-6406	55	6	,	,	PUNCT
bam-6406	55	7	with	with	ADP
bam-6406	55	8	the	the	DET
bam-6406	55	9	appropriate	appropriate	ADJ
bam-6406	55	10	primary	primary	ADJ
bam-6406	55	11	antibody	antibody	NOUN
bam-6406	55	12	diluted	dilute	VERB
bam-6406	55	13	in	in	ADP
bam-6406	55	14	5	5	NUM
bam-6406	55	15	%	%	NOUN
bam-6406	55	16	bsa	bsa	NOUN
bam-6406	55	17	(	(	PUNCT
bam-6406	55	18	sigma	sigma	PROPN
bam-6406	55	19	)	)	PUNCT
bam-6406	55	20	in	in	ADP
bam-6406	55	21	tbst	tbst	NOUN
bam-6406	55	22	.	.	PUNCT
bam-6406	56	1	after	after	ADP
bam-6406	56	2	washing	wash	VERB
bam-6406	56	3	in	in	ADP
bam-6406	56	4	tbst	tbst	NOUN
bam-6406	56	5	,	,	PUNCT
bam-6406	56	6	membranes	membrane	NOUN
bam-6406	56	7	were	be	AUX
bam-6406	56	8	incubated	incubate	VERB
bam-6406	56	9	with	with	ADP
bam-6406	56	10	secondary	secondary	ADJ
bam-6406	56	11	antibodies	antibody	NOUN
bam-6406	56	12	hrp	hrp	NOUN
bam-6406	56	13	-	-	PUNCT
bam-6406	56	14	conjugate	conjugate	ADJ
bam-6406	56	15	(	(	PUNCT
bam-6406	56	16	bio	bio	NOUN
bam-6406	56	17	-	-	ADJ
bam-6406	56	18	rad	rad	ADJ
bam-6406	56	19	170	170	NUM
bam-6406	56	20	-	-	SYM
bam-6406	56	21	6515	6515	NUM
bam-6406	56	22	or	or	CCONJ
bam-6406	56	23	170	170	NUM
bam-6406	56	24	-	-	SYM
bam-6406	56	25	6516	6516	NUM
bam-6406	56	26	)	)	PUNCT
bam-6406	56	27	and	and	CCONJ
bam-6406	56	28	signals	signal	NOUN
bam-6406	56	29	were	be	AUX
bam-6406	56	30	detected	detect	VERB
bam-6406	56	31	by	by	ADP
bam-6406	56	32	using	use	VERB
bam-6406	56	33	ecl	ecl	PROPN
bam-6406	56	34	chemistry	chemistry	NOUN
bam-6406	56	35	(	(	PUNCT
bam-6406	56	36	advansta	advansta	PROPN
bam-6406	56	37	)	)	PUNCT
bam-6406	56	38	.	.	PUNCT
bam-6406	57	1	images	image	NOUN
bam-6406	57	2	were	be	AUX
bam-6406	57	3	aquired	aquire	VERB
bam-6406	57	4	using	use	VERB
bam-6406	57	5	films	film	NOUN
bam-6406	57	6	or	or	CCONJ
bam-6406	57	7	chemidoc	chemidoc	PROPN
bam-6406	57	8	mp	mp	PROPN
bam-6406	57	9	imaging	imaging	NOUN
bam-6406	57	10	system	system	NOUN
bam-6406	57	11	(	(	PUNCT
bam-6406	57	12	bio	bio	NOUN
bam-6406	57	13	-	-	NOUN
bam-6406	57	14	rad	rad	NOUN
bam-6406	57	15	)	)	PUNCT
bam-6406	57	16	.	.	PUNCT
bam-6406	58	1	densitometric	densitometric	ADJ
bam-6406	58	2	analyses	analysis	NOUN
bam-6406	58	3	were	be	AUX
bam-6406	58	4	performed	perform	VERB
bam-6406	58	5	by	by	ADP
bam-6406	58	6	measuring	measure	VERB
bam-6406	58	7	band	band	NOUN
bam-6406	58	8	intensity	intensity	NOUN
bam-6406	58	9	for	for	ADP
bam-6406	58	10	each	each	DET
bam-6406	58	11	sample	sample	NOUN
bam-6406	58	12	using	use	VERB
bam-6406	58	13	image	image	NOUN
bam-6406	58	14	j	j	PROPN
bam-6406	58	15	software	software	NOUN
bam-6406	58	16	.	.	PUNCT
bam-6406	59	1	the	the	DET
bam-6406	59	2	following	following	ADJ
bam-6406	59	3	primary	primary	ADJ
bam-6406	59	4	antibodies	antibody	NOUN
bam-6406	59	5	were	be	AUX
bam-6406	59	6	used	use	VERB
bam-6406	59	7	:	:	PUNCT
bam-6406	59	8	gapdh	gapdh	NOUN
bam-6406	59	9	(	(	PUNCT
bam-6406	59	10	santa	santa	PROPN
bam-6406	59	11	cruz	cruz	PROPN
bam-6406	59	12	sc-32233	sc-32233	PROPN
bam-6406	59	13	)	)	PUNCT
bam-6406	59	14	,	,	PUNCT
bam-6406	59	15	cybb	cybb	NOUN
bam-6406	59	16	(	(	PUNCT
bam-6406	59	17	bd	bd	PROPN
bam-6406	59	18	bioscience	bioscience	PROPN
bam-6406	59	19	611414	611414	NUM
bam-6406	59	20	)	)	PUNCT
bam-6406	59	21	,	,	PUNCT
bam-6406	59	22	p	p	NOUN
bam-6406	59	23	-	-	PUNCT
bam-6406	59	24	rela	rela	NOUN
bam-6406	59	25	(	(	PUNCT
bam-6406	59	26	cell	cell	NOUN
bam-6406	59	27	signalling	signal	VERB
bam-6406	59	28	3033	3033	NUM
bam-6406	59	29	)	)	PUNCT
bam-6406	59	30	,	,	PUNCT
bam-6406	59	31	tot	tot	NOUN
bam-6406	59	32	-	-	PUNCT
bam-6406	59	33	rela	rela	NOUN
bam-6406	59	34	(	(	PUNCT
bam-6406	59	35	cell	cell	NOUN
bam-6406	59	36	signalling	signal	VERB
bam-6406	59	37	4764	4764	NUM
bam-6406	59	38	)	)	PUNCT
bam-6406	59	39	,	,	PUNCT
bam-6406	59	40	4	4	NUM
bam-6406	59	41	-	-	PUNCT
bam-6406	59	42	hne	hne	X
bam-6406	59	43	(	(	PUNCT
bam-6406	59	44	abcam	abcam	PROPN
bam-6406	59	45	46545	46545	NUM
bam-6406	59	46	)	)	PUNCT
bam-6406	59	47	antioxidant	antioxidant	ADJ
bam-6406	59	48	enzymes	enzyme	NOUN
bam-6406	59	49	activities	activity	NOUN
bam-6406	59	50	muscles	muscle	NOUN
bam-6406	59	51	were	be	AUX
bam-6406	59	52	homogenized	homogenize	VERB
bam-6406	59	53	in	in	ADP
bam-6406	59	54	100	100	NUM
bam-6406	59	55	mm	mm	INTJ
bam-6406	59	56	na	na	NOUN
bam-6406	59	57	-	-	ADJ
bam-6406	59	58	phosphate	phosphate	ADJ
bam-6406	59	59	buffer	buffer	NOUN
bam-6406	59	60	ph	ph	X
bam-6406	59	61	7.0	7.0	NUM
bam-6406	59	62	or	or	CCONJ
bam-6406	59	63	ph	ph	VERB
bam-6406	59	64	6.5	6.5	NUM
bam-6406	59	65	depending	depend	VERB
bam-6406	59	66	on	on	ADP
bam-6406	59	67	the	the	DET
bam-6406	59	68	assay	assay	NOUN
bam-6406	59	69	,	,	PUNCT
bam-6406	59	70	with	with	ADP
bam-6406	59	71	protease	protease	NOUN
bam-6406	59	72	inhibitors	inhibitor	NOUN
bam-6406	59	73	cocktail	cocktail	NOUN
bam-6406	59	74	(	(	PUNCT
bam-6406	59	75	sigma	sigma	PROPN
bam-6406	59	76	)	)	PUNCT
bam-6406	59	77	and	and	CCONJ
bam-6406	59	78	centrifuged	centrifuge	VERB
bam-6406	59	79	at	at	ADP
bam-6406	59	80	100,000	100,000	NUM
bam-6406	59	81	x	x	SYM
bam-6406	59	82	g	g	NOUN
bam-6406	59	83	for	for	ADP
bam-6406	59	84	15	15	NUM
bam-6406	59	85	minutes	minute	NOUN
bam-6406	59	86	at	at	ADP
bam-6406	59	87	4	4	NUM
bam-6406	59	88	°	°	ADP
bam-6406	59	89	c.	c.	NOUN
bam-6406	59	90	cytosol	cytosol	PROPN
bam-6406	59	91	proteins	protein	NOUN
bam-6406	59	92	were	be	AUX
bam-6406	59	93	measured	measure	VERB
bam-6406	59	94	on	on	ADP
bam-6406	59	95	the	the	DET
bam-6406	59	96	resulting	result	VERB
bam-6406	59	97	supernatant	supernatant	NOUN
bam-6406	59	98	according	accord	VERB
bam-6406	59	99	to	to	ADP
bam-6406	59	100	the	the	DET
bam-6406	59	101	bradford	bradford	NOUN
bam-6406	59	102	’s	’s	PART
bam-6406	59	103	method	method	NOUN
bam-6406	59	104	.	.	PUNCT
bam-6406	60	1	glutathione	glutathione	NOUN
bam-6406	60	2	s	s	NOUN
bam-6406	60	3	-	-	PUNCT
bam-6406	60	4	transferase	transferase	NOUN
bam-6406	60	5	activity	activity	NOUN
bam-6406	60	6	was	be	AUX
bam-6406	60	7	determined	determine	VERB
bam-6406	60	8	by	by	ADP
bam-6406	60	9	using	use	VERB
bam-6406	60	10	1	1	NUM
bam-6406	60	11	-	-	PUNCT
bam-6406	60	12	cloro-2	cloro-2	VERB
bam-6406	60	13	-	-	PUNCT
bam-6406	60	14	4dinitrobenzene	4dinitrobenzene	NUM
bam-6406	60	15	(	(	PUNCT
bam-6406	60	16	cdnb	cdnb	NOUN
bam-6406	60	17	)	)	PUNCT
bam-6406	60	18	as	as	ADP
bam-6406	60	19	substrate	substrate	NOUN
bam-6406	60	20	.	.	PUNCT
bam-6406	61	1	the	the	DET
bam-6406	61	2	assay	assay	NOUN
bam-6406	61	3	was	be	AUX
bam-6406	61	4	performed	perform	VERB
bam-6406	61	5	at	at	ADP
bam-6406	61	6	340	340	NUM
bam-6406	61	7	410	410	NUM
bam-6406	61	8	nm	nm	NOUN
bam-6406	61	9	(	(	PUNCT
bam-6406	61	10	ε	ε	PROPN
bam-6406	61	11	=	=	SYM
bam-6406	61	12	9.6	9.6	NUM
bam-6406	61	13	mm	mm	INTJ
bam-6406	61	14	-1	-1	NOUN
bam-6406	61	15	cm	cm	NOUN
bam-6406	61	16	-1	-1	PUNCT
bam-6406	61	17	)	)	PUNCT
bam-6406	61	18	in	in	ADP
bam-6406	61	19	a	a	DET
bam-6406	61	20	final	final	ADJ
bam-6406	61	21	volume	volume	NOUN
bam-6406	61	22	of	of	ADP
bam-6406	61	23	1	1	NUM
bam-6406	61	24	ml	ml	NOUN
bam-6406	61	25	containing	contain	VERB
bam-6406	61	26	100	100	NUM
bam-6406	61	27	mm	mm	INTJ
bam-6406	61	28	na	na	NOUN
bam-6406	61	29	-	-	ADJ
bam-6406	61	30	phosphate	phosphate	ADJ
bam-6406	61	31	buffer	buffer	NOUN
bam-6406	61	32	ph	ph	VERB
bam-6406	61	33	6.5	6.5	NUM
bam-6406	61	34	,	,	PUNCT
bam-6406	61	35	1	1	NUM
bam-6406	61	36	mm	mm	NOUN
bam-6406	61	37	cdnb	cdnb	NOUN
bam-6406	61	38	,	,	PUNCT
bam-6406	61	39	1	1	NUM
bam-6406	61	40	mm	mm	NOUN
bam-6406	61	41	reduced	reduce	VERB
bam-6406	61	42	glutathione	glutathione	NOUN
bam-6406	61	43	,	,	PUNCT
bam-6406	61	44	and	and	CCONJ
bam-6406	61	45	50	50	NUM
bam-6406	61	46	µg	µg	NOUN
bam-6406	61	47	of	of	ADP
bam-6406	61	48	protein	protein	NOUN
bam-6406	61	49	lysate	lysate	NOUN
bam-6406	61	50	.	.	PUNCT
bam-6406	62	1	glutathione	glutathione	NOUN
bam-6406	62	2	reductase	reductase	NOUN
bam-6406	62	3	activity	activity	NOUN
bam-6406	62	4	was	be	AUX
bam-6406	62	5	measured	measure	VERB
bam-6406	62	6	by	by	ADP
bam-6406	62	7	the	the	DET
bam-6406	62	8	rate	rate	NOUN
bam-6406	62	9	of	of	ADP
bam-6406	62	10	decrease	decrease	NOUN
bam-6406	62	11	in	in	ADP
bam-6406	62	12	absorbance	absorbance	NOUN
bam-6406	62	13	induced	induce	VERB
bam-6406	62	14	by	by	ADP
bam-6406	62	15	nadph	nadph	ADJ
bam-6406	62	16	oxidation	oxidation	NOUN
bam-6406	62	17	,	,	PUNCT
bam-6406	62	18	at	at	ADP
bam-6406	62	19	340	340	NUM
bam-6406	62	20	nm	nm	NOUN
bam-6406	62	21	(	(	PUNCT
bam-6406	62	22	ε	ε	PROPN
bam-6406	62	23	=	=	SYM
bam-6406	62	24	6.22	6.22	NUM
bam-6406	62	25	mm	mm	INTJ
bam-6406	62	26	-1	-1	NOUN
bam-6406	62	27	cm	cm	NOUN
bam-6406	62	28	-1	-1	PUNCT
bam-6406	62	29	)	)	PUNCT
bam-6406	62	30	.	.	PUNCT
bam-6406	63	1	the	the	DET
bam-6406	63	2	assay	assay	NOUN
bam-6406	63	3	mixture	mixture	NOUN
bam-6406	63	4	contained	contain	VERB
bam-6406	63	5	,	,	PUNCT
bam-6406	63	6	in	in	ADP
bam-6406	63	7	a	a	DET
bam-6406	63	8	final	final	ADJ
bam-6406	63	9	volume	volume	NOUN
bam-6406	63	10	of	of	ADP
bam-6406	63	11	1	1	NUM
bam-6406	63	12	ml	ml	NOUN
bam-6406	63	13	,	,	PUNCT
bam-6406	63	14	100	100	NUM
bam-6406	63	15	mm	mm	INTJ
bam-6406	63	16	na	na	ADJ
bam-6406	63	17	-	-	ADJ
bam-6406	63	18	phosphate	phosphate	ADJ
bam-6406	63	19	buffer	buffer	NOUN
bam-6406	63	20	ph	ph	VERB
bam-6406	63	21	7.0	7.0	NUM
bam-6406	63	22	,	,	PUNCT
bam-6406	63	23	1	1	NUM
bam-6406	63	24	mm	mm	NOUN
bam-6406	63	25	glutathione	glutathione	NOUN
bam-6406	63	26	disulfide	disulfide	NOUN
bam-6406	63	27	,	,	PUNCT
bam-6406	63	28	60	60	NUM
bam-6406	63	29	µm	µm	ADP
bam-6406	63	30	nadph	nadph	ADJ
bam-6406	63	31	and	and	CCONJ
bam-6406	63	32	100	100	NUM
bam-6406	63	33	mg	mg	NOUN
bam-6406	63	34	of	of	ADP
bam-6406	63	35	protein	protein	NOUN
bam-6406	63	36	lysate	lysate	NOUN
bam-6406	63	37	.	.	PUNCT
bam-6406	64	1	protein	protein	NOUN
bam-6406	64	2	carbonyl	carbonyl	NOUN
bam-6406	64	3	assay	assay	VERB
bam-6406	64	4	the	the	DET
bam-6406	64	5	assay	assay	NOUN
bam-6406	64	6	was	be	AUX
bam-6406	64	7	performed	perform	VERB
bam-6406	64	8	as	as	SCONJ
bam-6406	64	9	described	describe	VERB
bam-6406	64	10	in	in	ADP
bam-6406	64	11	.	.	PUNCT
bam-6406	65	1	18	18	NUM
bam-6406	65	2	the	the	DET
bam-6406	65	3	amount	amount	NOUN
bam-6406	65	4	of	of	ADP
bam-6406	65	5	protein	protein	NOUN
bam-6406	65	6	-	-	PUNCT
bam-6406	65	7	hydrozone	hydrozone	NOUN
bam-6406	65	8	produced	produce	VERB
bam-6406	65	9	is	be	AUX
bam-6406	65	10	quantified	quantify	VERB
bam-6406	65	11	spectrophotometrically	spectrophotometrically	ADV
bam-6406	65	12	.	.	PUNCT
bam-6406	66	1	carbonyl	carbonyl	NOUN
bam-6406	66	2	content	content	NOUN
bam-6406	66	3	was	be	AUX
bam-6406	66	4	normalized	normalize	VERB
bam-6406	66	5	to	to	ADP
bam-6406	66	6	protein	protein	NOUN
bam-6406	66	7	concentration	concentration	NOUN
bam-6406	66	8	statistics	statistic	NOUN
bam-6406	66	9	statistical	statistical	ADJ
bam-6406	66	10	significance	significance	NOUN
bam-6406	66	11	was	be	AUX
bam-6406	66	12	determined	determine	VERB
bam-6406	66	13	using	use	VERB
bam-6406	66	14	two	two	NUM
bam-6406	66	15	-	-	PUNCT
bam-6406	66	16	tailed	tail	VERB
bam-6406	66	17	student	student	NOUN
bam-6406	66	18	t	t	NOUN
bam-6406	66	19	-	-	PUNCT
bam-6406	66	20	test	test	NOUN
bam-6406	66	21	with	with	ADP
bam-6406	66	22	a	a	DET
bam-6406	66	23	significance	significance	NOUN
bam-6406	66	24	level	level	NOUN
bam-6406	66	25	<	<	X
bam-6406	66	26	0.05	0.05	NUM
bam-6406	66	27	results	result	NOUN
bam-6406	66	28	oxidative	oxidative	ADJ
bam-6406	66	29	stress	stress	NOUN
bam-6406	66	30	is	be	AUX
bam-6406	66	31	induced	induce	VERB
bam-6406	66	32	in	in	ADP
bam-6406	66	33	skeletal	skeletal	ADJ
bam-6406	66	34	muscle	muscle	NOUN
bam-6406	66	35	following	follow	VERB
bam-6406	66	36	denervation	denervation	NOUN
bam-6406	66	37	in	in	ADP
bam-6406	66	38	order	order	NOUN
bam-6406	66	39	to	to	PART
bam-6406	66	40	characterize	characterize	VERB
bam-6406	66	41	the	the	DET
bam-6406	66	42	molecular	molecular	ADJ
bam-6406	66	43	pathways	pathway	NOUN
bam-6406	66	44	triggered	trigger	VERB
bam-6406	66	45	by	by	ADP
bam-6406	66	46	denervation	denervation	NOUN
bam-6406	66	47	in	in	ADP
bam-6406	66	48	skeletal	skeletal	ADJ
bam-6406	66	49	muscle	muscle	NOUN
bam-6406	66	50	,	,	PUNCT
bam-6406	66	51	we	we	PRON
bam-6406	66	52	severed	sever	VERB
bam-6406	66	53	the	the	DET
bam-6406	66	54	sciatic	sciatic	ADJ
bam-6406	66	55	nerve	nerve	NOUN
bam-6406	66	56	of	of	ADP
bam-6406	66	57	one	one	NUM
bam-6406	66	58	limb	limb	NOUN
bam-6406	66	59	of	of	ADP
bam-6406	66	60	adult	adult	NOUN
bam-6406	66	61	mice	mouse	NOUN
bam-6406	66	62	and	and	CCONJ
bam-6406	66	63	analyzed	analyze	VERB
bam-6406	66	64	the	the	DET
bam-6406	66	65	skeletal	skeletal	ADJ
bam-6406	66	66	muscle	muscle	NOUN
bam-6406	66	67	response	response	NOUN
bam-6406	66	68	over	over	ADP
bam-6406	66	69	time	time	NOUN
bam-6406	66	70	.	.	PUNCT
bam-6406	67	1	to	to	PART
bam-6406	67	2	reduce	reduce	VERB
bam-6406	67	3	the	the	DET
bam-6406	67	4	number	number	NOUN
bam-6406	67	5	of	of	ADP
bam-6406	67	6	mice	mouse	NOUN
bam-6406	67	7	,	,	PUNCT
bam-6406	67	8	we	we	PRON
bam-6406	67	9	first	first	ADV
bam-6406	67	10	tested	test	VERB
bam-6406	67	11	if	if	SCONJ
bam-6406	67	12	contralateral	contralateral	ADJ
bam-6406	67	13	innervated	innervated	ADJ
bam-6406	67	14	muscles	muscle	NOUN
bam-6406	67	15	could	could	AUX
bam-6406	67	16	be	be	AUX
bam-6406	67	17	used	use	VERB
bam-6406	67	18	as	as	ADP
bam-6406	67	19	control	control	NOUN
bam-6406	67	20	.	.	PUNCT
bam-6406	68	1	oxidative	oxidative	ADJ
bam-6406	68	2	stress	stress	NOUN
bam-6406	68	3	was	be	AUX
bam-6406	68	4	evaluated	evaluate	VERB
bam-6406	68	5	by	by	ADP
bam-6406	68	6	measuring	measure	VERB
bam-6406	68	7	the	the	DET
bam-6406	68	8	ros	ros	PROPN
bam-6406	68	9	levels	level	NOUN
bam-6406	68	10	by	by	ADP
bam-6406	68	11	dihydrohetidium	dihydrohetidium	PROPN
bam-6406	68	12	(	(	PUNCT
bam-6406	68	13	dhe	dhe	NOUN
bam-6406	68	14	)	)	PUNCT
bam-6406	68	15	staining	stain	VERB
bam-6406	68	16	and	and	CCONJ
bam-6406	68	17	the	the	DET
bam-6406	68	18	expression	expression	NOUN
bam-6406	68	19	levels	level	NOUN
bam-6406	68	20	of	of	ADP
bam-6406	68	21	cytochrome	cytochrome	ADJ
bam-6406	68	22	b-245	b-245	ADV
bam-6406	68	23	,	,	PUNCT
bam-6406	68	24	beta	beta	ADJ
bam-6406	68	25	polypeptide	polypeptide	ADJ
bam-6406	68	26	(	(	PUNCT
bam-6406	68	27	cybb	cybb	PROPN
bam-6406	68	28	)	)	PUNCT
bam-6406	68	29	in	in	ADP
bam-6406	68	30	the	the	DET
bam-6406	68	31	contralateral	contralateral	ADJ
bam-6406	68	32	ta	ta	ADP
bam-6406	68	33	muscles	muscle	NOUN
bam-6406	68	34	,	,	PUNCT
bam-6406	68	35	compared	compare	VERB
bam-6406	68	36	with	with	ADP
bam-6406	68	37	control	control	NOUN
bam-6406	68	38	mice	mouse	NOUN
bam-6406	68	39	,	,	PUNCT
bam-6406	68	40	not	not	PART
bam-6406	68	41	subjected	subject	VERB
bam-6406	68	42	to	to	ADP
bam-6406	68	43	denervation	denervation	NOUN
bam-6406	68	44	.	.	PUNCT
bam-6406	69	1	no	no	DET
bam-6406	69	2	significant	significant	ADJ
bam-6406	69	3	differences	difference	NOUN
bam-6406	69	4	were	be	AUX
bam-6406	69	5	observed	observe	VERB
bam-6406	69	6	between	between	ADP
bam-6406	69	7	the	the	DET
bam-6406	69	8	two	two	NUM
bam-6406	69	9	groups	group	NOUN
bam-6406	69	10	(	(	PUNCT
bam-6406	69	11	fig	fig	NOUN
bam-6406	69	12	.	.	NOUN
bam-6406	69	13	1	1	NUM
bam-6406	69	14	)	)	PUNCT
bam-6406	69	15	,	,	PUNCT
bam-6406	69	16	allowing	allow	VERB
bam-6406	69	17	contralateral	contralateral	ADJ
bam-6406	69	18	muscles	muscle	NOUN
bam-6406	69	19	to	to	PART
bam-6406	69	20	be	be	AUX
bam-6406	69	21	used	use	VERB
bam-6406	69	22	as	as	ADP
bam-6406	69	23	control	control	NOUN
bam-6406	69	24	muscles	muscle	NOUN
bam-6406	69	25	,	,	PUNCT
bam-6406	69	26	thus	thus	ADV
bam-6406	69	27	reducing	reduce	VERB
bam-6406	69	28	the	the	DET
bam-6406	69	29	number	number	NOUN
bam-6406	69	30	of	of	ADP
bam-6406	69	31	experimental	experimental	ADJ
bam-6406	69	32	animals	animal	NOUN
bam-6406	69	33	to	to	PART
bam-6406	69	34	assess	assess	VERB
bam-6406	69	35	if	if	SCONJ
bam-6406	69	36	denervation	denervation	NOUN
bam-6406	69	37	induces	induce	VERB
bam-6406	69	38	os	os	ADV
bam-6406	69	39	in	in	ADP
bam-6406	69	40	skeletal	skeletal	ADJ
bam-6406	69	41	muscle	muscle	NOUN
bam-6406	69	42	,	,	PUNCT
bam-6406	69	43	ros	ros	PROPN
bam-6406	69	44	were	be	AUX
bam-6406	69	45	labeled	label	VERB
bam-6406	69	46	by	by	ADP
bam-6406	69	47	dhe	dhe	PROPN
bam-6406	69	48	in	in	ADP
bam-6406	69	49	contralateral	contralateral	ADJ
bam-6406	69	50	and	and	CCONJ
bam-6406	69	51	in	in	ADP
bam-6406	69	52	denervated	denervate	VERB
bam-6406	69	53	muscles	muscle	NOUN
bam-6406	69	54	.	.	PUNCT
bam-6406	70	1	denervated	denervate	VERB
bam-6406	70	2	muscles	muscle	NOUN
bam-6406	70	3	showed	show	VERB
bam-6406	70	4	a	a	DET
bam-6406	70	5	time	time	NOUN
bam-6406	70	6	-	-	PUNCT
bam-6406	70	7	dependent	dependent	ADJ
bam-6406	70	8	increase	increase	NOUN
bam-6406	70	9	in	in	ADP
bam-6406	70	10	ros	ros	PROPN
bam-6406	70	11	levels	level	NOUN
bam-6406	70	12	,	,	PUNCT
bam-6406	70	13	compared	compare	VERB
bam-6406	70	14	to	to	ADP
bam-6406	70	15	contralateral	contralateral	ADJ
bam-6406	70	16	muscles	muscle	NOUN
bam-6406	70	17	(	(	PUNCT
bam-6406	70	18	fig	fig	NOUN
bam-6406	70	19	.	.	PUNCT
bam-6406	70	20	2a	2a	NUM
bam-6406	70	21	)	)	PUNCT
bam-6406	70	22	.	.	PUNCT
bam-6406	71	1	this	this	DET
bam-6406	71	2	result	result	NOUN
bam-6406	71	3	was	be	AUX
bam-6406	71	4	confirmed	confirm	VERB
bam-6406	71	5	by	by	ADP
bam-6406	71	6	the	the	DET
bam-6406	71	7	kinetic	kinetic	NOUN
bam-6406	71	8	of	of	ADP
bam-6406	71	9	induction	induction	NOUN
bam-6406	71	10	of	of	ADP
bam-6406	71	11	cybb	cybb	NOUN
bam-6406	71	12	expression	expression	NOUN
bam-6406	71	13	,	,	PUNCT
bam-6406	71	14	at	at	ADP
bam-6406	71	15	both	both	CCONJ
bam-6406	71	16	the	the	DET
bam-6406	71	17	mrna	mrna	NOUN
bam-6406	71	18	and	and	CCONJ
bam-6406	71	19	protein	protein	NOUN
bam-6406	71	20	levels	level	NOUN
bam-6406	71	21	,	,	PUNCT
bam-6406	71	22	(	(	PUNCT
bam-6406	71	23	fig	fig	NOUN
bam-6406	71	24	.	.	PUNCT
bam-6406	71	25	2b	2b	NUM
bam-6406	71	26	and	and	CCONJ
bam-6406	71	27	c	c	NOUN
bam-6406	71	28	)	)	PUNCT
bam-6406	71	29	.	.	PUNCT
bam-6406	72	1	os	os	PROPN
bam-6406	72	2	activates	activate	VERB
bam-6406	72	3	nfκb	nfκb	NOUN
bam-6406	72	4	which	which	PRON
bam-6406	72	5	,	,	PUNCT
bam-6406	72	6	in	in	ADP
bam-6406	72	7	turn	turn	NOUN
bam-6406	72	8	,	,	PUNCT
bam-6406	72	9	regulates	regulate	VERB
bam-6406	72	10	the	the	DET
bam-6406	72	11	expression	expression	NOUN
bam-6406	72	12	of	of	ADP
bam-6406	72	13	cybb	cybb	NOUN
bam-6406	72	14	.	.	PUNCT
bam-6406	73	1	to	to	PART
bam-6406	73	2	evaluate	evaluate	VERB
bam-6406	73	3	if	if	SCONJ
bam-6406	73	4	denervation	denervation	NOUN
bam-6406	73	5	induces	induce	VERB
bam-6406	73	6	nfκb	nfκb	ADJ
bam-6406	73	7	activation	activation	NOUN
bam-6406	73	8	,	,	PUNCT
bam-6406	73	9	the	the	DET
bam-6406	73	10	levels	level	NOUN
bam-6406	73	11	of	of	ADP
bam-6406	73	12	the	the	DET
bam-6406	73	13	phosphorylated	phosphorylate	VERB
bam-6406	73	14	,	,	PUNCT
bam-6406	73	15	active	active	ADJ
bam-6406	73	16	form	form	NOUN
bam-6406	73	17	of	of	ADP
bam-6406	73	18	the	the	DET
bam-6406	73	19	rela	rela	ADJ
bam-6406	73	20	subunit	subunit	NOUN
bam-6406	73	21	(	(	PUNCT
bam-6406	73	22	prela	prela	PROPN
bam-6406	73	23	)	)	PUNCT
bam-6406	73	24	of	of	ADP
bam-6406	73	25	nfκb	nfκb	NOUN
bam-6406	73	26	were	be	AUX
bam-6406	73	27	monitored	monitor	VERB
bam-6406	73	28	in	in	ADP
bam-6406	73	29	ta	ta	ADP
bam-6406	73	30	muscles	muscle	NOUN
bam-6406	73	31	,	,	PUNCT
bam-6406	73	32	over	over	ADP
bam-6406	73	33	fig	fig	NOUN
bam-6406	73	34	1	1	NUM
bam-6406	73	35	.	.	PUNCT
bam-6406	73	36	oxidative	oxidative	ADJ
bam-6406	73	37	stress	stress	NOUN
bam-6406	73	38	is	be	AUX
bam-6406	73	39	not	not	PART
bam-6406	73	40	induced	induce	VERB
bam-6406	73	41	in	in	ADP
bam-6406	73	42	non	non	ADJ
bam-6406	73	43	-	-	ADJ
bam-6406	73	44	denervated	denervated	ADJ
bam-6406	73	45	,	,	PUNCT
bam-6406	73	46	contralateral	contralateral	ADJ
bam-6406	73	47	muscles	muscle	NOUN
bam-6406	73	48	.	.	PUNCT
bam-6406	74	1	(	(	PUNCT
bam-6406	74	2	a	a	X
bam-6406	74	3	)	)	PUNCT
bam-6406	74	4	dhe	dhe	NOUN
bam-6406	74	5	staining	stain	VERB
bam-6406	74	6	in	in	ADP
bam-6406	74	7	ta	ta	ADP
bam-6406	74	8	of	of	ADP
bam-6406	74	9	mice	mouse	NOUN
bam-6406	74	10	not	not	PART
bam-6406	74	11	subjected	subject	VERB
bam-6406	74	12	to	to	ADP
bam-6406	74	13	denervation	denervation	NOUN
bam-6406	74	14	(	(	PUNCT
bam-6406	74	15	control	control	NOUN
bam-6406	74	16	)	)	PUNCT
bam-6406	74	17	or	or	CCONJ
bam-6406	74	18	contralateral	contralateral	ADJ
bam-6406	74	19	muscles	muscle	NOUN
bam-6406	74	20	of	of	ADP
bam-6406	74	21	denervated	denervate	VERB
bam-6406	74	22	mice	mouse	NOUN
bam-6406	74	23	(	(	PUNCT
bam-6406	74	24	contra	contra	PROPN
bam-6406	74	25	)	)	PUNCT
bam-6406	74	26	,	,	PUNCT
bam-6406	74	27	3	3	NUM
bam-6406	74	28	and	and	CCONJ
bam-6406	74	29	7	7	NUM
bam-6406	74	30	days	day	NOUN
bam-6406	74	31	following	follow	VERB
bam-6406	74	32	denervation	denervation	NOUN
bam-6406	74	33	.	.	PUNCT
bam-6406	75	1	scale	scale	NOUN
bam-6406	75	2	bar	bar	NOUN
bam-6406	75	3	=	=	PUNCT
bam-6406	75	4	50	50	NUM
bam-6406	75	5	μm	μm	NOUN
bam-6406	75	6	.	.	PUNCT
bam-6406	76	1	(	(	PUNCT
bam-6406	76	2	b	b	X
bam-6406	76	3	)	)	PUNCT
bam-6406	76	4	real	real	ADJ
bam-6406	76	5	-	-	PUNCT
bam-6406	76	6	time	time	NOUN
bam-6406	76	7	pcr	pcr	NOUN
bam-6406	76	8	of	of	ADP
bam-6406	76	9	cybb	cybb	PROPN
bam-6406	76	10	in	in	ADP
bam-6406	76	11	control	control	NOUN
bam-6406	76	12	and	and	CCONJ
bam-6406	76	13	contralateral	contralateral	ADJ
bam-6406	76	14	muscles	muscle	NOUN
bam-6406	76	15	,	,	PUNCT
bam-6406	76	16	3	3	NUM
bam-6406	76	17	and	and	CCONJ
bam-6406	76	18	7	7	NUM
bam-6406	76	19	days	day	NOUN
bam-6406	76	20	following	follow	VERB
bam-6406	76	21	denervation	denervation	NOUN
bam-6406	76	22	.	.	PUNCT
bam-6406	77	1	values	value	NOUN
bam-6406	77	2	represent	represent	VERB
bam-6406	77	3	mean	mean	PROPN
bam-6406	77	4	±	±	NUM
bam-6406	77	5	sem	sem	NOUN
bam-6406	77	6	.	.	PUNCT
bam-6406	78	1	n	n	PROPN
bam-6406	78	2	=	=	SYM
bam-6406	78	3	3	3	X
bam-6406	78	4	.	.	NOUN
bam-6406	78	5	muscle	muscle	NOUN
bam-6406	78	6	denervation	denervation	NOUN
bam-6406	78	7	atrophy	atrophy	NOUN
bam-6406	78	8	is	be	AUX
bam-6406	78	9	not	not	PART
bam-6406	78	10	related	relate	VERB
bam-6406	78	11	to	to	PART
bam-6406	78	12	oxidative	oxidative	VERB
bam-6406	78	13	stress	stress	NOUN
bam-6406	78	14	eur	eur	PROPN
bam-6406	78	15	j	j	PROPN
bam-6406	78	16	transl	transl	PROPN
bam-6406	78	17	myol	myol	NOUN
bam-6406	78	18	2017	2017	NUM
bam-6406	78	19	;	;	PUNCT
bam-6406	78	20	27	27	NUM
bam-6406	78	21	(	(	PUNCT
bam-6406	78	22	1	1	NUM
bam-6406	78	23	):	):	PUNCT
bam-6406	78	24	43	43	NUM
bam-6406	78	25	-	-	SYM
bam-6406	78	26	50	50	NUM
bam-6406	78	27	46	46	NUM
bam-6406	78	28	time	time	NOUN
bam-6406	78	29	.	.	PUNCT
bam-6406	79	1	nfκb	nfκb	ADJ
bam-6406	79	2	activation	activation	NOUN
bam-6406	79	3	was	be	AUX
bam-6406	79	4	detected	detect	VERB
bam-6406	79	5	as	as	ADV
bam-6406	79	6	early	early	ADV
bam-6406	79	7	as	as	ADP
bam-6406	79	8	three	three	NUM
bam-6406	79	9	days	day	NOUN
bam-6406	79	10	following	follow	VERB
bam-6406	79	11	denervation	denervation	NOUN
bam-6406	79	12	,	,	PUNCT
bam-6406	79	13	and	and	CCONJ
bam-6406	79	14	it	it	PRON
bam-6406	79	15	further	far	ADV
bam-6406	79	16	increased	increase	VERB
bam-6406	79	17	seven	seven	NUM
bam-6406	79	18	days	day	NOUN
bam-6406	79	19	after	after	ADP
bam-6406	79	20	denervation	denervation	NOUN
bam-6406	79	21	(	(	PUNCT
bam-6406	79	22	fig	fig	NOUN
bam-6406	79	23	.	.	PUNCT
bam-6406	80	1	2d	2d	NOUN
bam-6406	80	2	)	)	PUNCT
bam-6406	80	3	.	.	PUNCT
bam-6406	81	1	since	since	SCONJ
bam-6406	81	2	nfκb	nfκb	PROPN
bam-6406	81	3	cross	cross	NOUN
bam-6406	81	4	-	-	NOUN
bam-6406	81	5	talks	talk	NOUN
bam-6406	81	6	with	with	ADP
bam-6406	81	7	the	the	DET
bam-6406	81	8	nfe2l2	nfe2l2	PROPN
bam-6406	81	9	,	,	PUNCT
bam-6406	81	10	we	we	PRON
bam-6406	81	11	monitored	monitor	VERB
bam-6406	81	12	nfe2l2	nfe2l2	PROPN
bam-6406	81	13	activation	activation	NOUN
bam-6406	81	14	in	in	ADP
bam-6406	81	15	skeletal	skeletal	ADJ
bam-6406	81	16	muscle	muscle	NOUN
bam-6406	81	17	upon	upon	SCONJ
bam-6406	81	18	denervation	denervation	NOUN
bam-6406	81	19	.	.	PUNCT
bam-6406	82	1	real	real	ADJ
bam-6406	82	2	-	-	PUNCT
bam-6406	82	3	time	time	NOUN
bam-6406	82	4	pcr	pcr	PROPN
bam-6406	82	5	analyses	analysis	NOUN
bam-6406	82	6	showed	show	VERB
bam-6406	82	7	increased	increase	VERB
bam-6406	82	8	levels	level	NOUN
bam-6406	82	9	of	of	ADP
bam-6406	82	10	nfe2l2	nfe2l2	PROPN
bam-6406	82	11	expression	expression	NOUN
bam-6406	82	12	at	at	ADP
bam-6406	82	13	three	three	NUM
bam-6406	82	14	and	and	CCONJ
bam-6406	82	15	seven	seven	NUM
bam-6406	82	16	days	day	NOUN
bam-6406	82	17	following	follow	VERB
bam-6406	82	18	denervation	denervation	NOUN
bam-6406	82	19	(	(	PUNCT
bam-6406	82	20	fig	fig	NOUN
bam-6406	82	21	.	.	PUNCT
bam-6406	83	1	2e	2e	NUM
bam-6406	83	2	)	)	PUNCT
bam-6406	83	3	.	.	PUNCT
bam-6406	84	1	importantly	importantly	ADV
bam-6406	84	2	,	,	PUNCT
bam-6406	84	3	nfe2l2	nfe2l2	PROPN
bam-6406	84	4	mainly	mainly	ADV
bam-6406	84	5	fig	fig	NOUN
bam-6406	84	6	2	2	NUM
bam-6406	84	7	.	.	PUNCT
bam-6406	84	8	oxidative	oxidative	ADJ
bam-6406	84	9	stress	stress	NOUN
bam-6406	84	10	is	be	AUX
bam-6406	84	11	induced	induce	VERB
bam-6406	84	12	in	in	ADP
bam-6406	84	13	skeletal	skeletal	ADJ
bam-6406	84	14	muscle	muscle	NOUN
bam-6406	84	15	following	follow	VERB
bam-6406	84	16	denervation	denervation	NOUN
bam-6406	84	17	.	.	PUNCT
bam-6406	85	1	(	(	PUNCT
bam-6406	85	2	a	a	X
bam-6406	85	3	)	)	PUNCT
bam-6406	85	4	dhe	dhe	NOUN
bam-6406	85	5	staining	stain	VERB
bam-6406	85	6	and	and	CCONJ
bam-6406	85	7	quantification	quantification	NOUN
bam-6406	85	8	in	in	ADP
bam-6406	85	9	innervated	innervated	ADJ
bam-6406	85	10	(	(	PUNCT
bam-6406	85	11	contra	contra	PROPN
bam-6406	85	12	)	)	PUNCT
bam-6406	85	13	or	or	CCONJ
bam-6406	85	14	denervated	denervate	VERB
bam-6406	85	15	ta	ta	ADP
bam-6406	85	16	muscles	muscle	NOUN
bam-6406	85	17	,	,	PUNCT
bam-6406	85	18	3	3	NUM
bam-6406	85	19	and	and	CCONJ
bam-6406	85	20	7	7	NUM
bam-6406	85	21	days	day	NOUN
bam-6406	85	22	following	follow	VERB
bam-6406	85	23	denervation	denervation	NOUN
bam-6406	85	24	.	.	PUNCT
bam-6406	86	1	scale	scale	NOUN
bam-6406	86	2	bar	bar	NOUN
bam-6406	86	3	=	=	PUNCT
bam-6406	86	4	50	50	NUM
bam-6406	86	5	μm	μm	NOUN
bam-6406	86	6	.	.	PUNCT
bam-6406	87	1	values	value	NOUN
bam-6406	87	2	represent	represent	VERB
bam-6406	87	3	mean	mean	PROPN
bam-6406	87	4	±	±	NUM
bam-6406	87	5	sem	sem	NOUN
bam-6406	87	6	.	.	PUNCT
bam-6406	88	1	n	n	NOUN
bam-6406	88	2	=	=	NOUN
bam-6406	88	3	4	4	X
bam-6406	88	4	.	.	PUNCT
bam-6406	89	1	*	*	PUNCT
bam-6406	89	2	*	*	PUNCT
bam-6406	89	3	*	*	PUNCT
bam-6406	89	4	p<0.0001	p<0.0001	NOUN
bam-6406	89	5	.	.	PUNCT
bam-6406	90	1	(	(	PUNCT
bam-6406	90	2	b	b	X
bam-6406	90	3	)	)	PUNCT
bam-6406	90	4	real	real	ADJ
bam-6406	90	5	-	-	PUNCT
bam-6406	90	6	time	time	NOUN
bam-6406	90	7	pcr	pcr	NOUN
bam-6406	90	8	for	for	ADP
bam-6406	90	9	cybb	cybb	NOUN
bam-6406	90	10	at	at	ADP
bam-6406	90	11	different	different	ADJ
bam-6406	90	12	time	time	NOUN
bam-6406	90	13	points	point	NOUN
bam-6406	90	14	following	follow	VERB
bam-6406	90	15	denervation	denervation	NOUN
bam-6406	90	16	,	,	PUNCT
bam-6406	90	17	relative	relative	ADJ
bam-6406	90	18	to	to	ADP
bam-6406	90	19	innervated	innervated	ADJ
bam-6406	90	20	contralateral	contralateral	ADJ
bam-6406	90	21	muscles	muscle	NOUN
bam-6406	90	22	.	.	PUNCT
bam-6406	91	1	values	value	NOUN
bam-6406	91	2	represent	represent	VERB
bam-6406	91	3	mean	mean	PROPN
bam-6406	91	4	±	±	NUM
bam-6406	91	5	sem	sem	NOUN
bam-6406	91	6	.	.	PUNCT
bam-6406	92	1	n	n	NOUN
bam-6406	92	2	=	=	SYM
bam-6406	92	3	4	4	NUM
bam-6406	92	4	-	-	SYM
bam-6406	92	5	6	6	NUM
bam-6406	92	6	.	.	PUNCT
bam-6406	93	1	*	*	PUNCT
bam-6406	93	2	p<0.05	p<0.05	NOUN
bam-6406	93	3	;	;	PUNCT
bam-6406	93	4	*	*	PUNCT
bam-6406	93	5	*	*	PUNCT
bam-6406	93	6	p<0.001	p<0.001	X
bam-6406	93	7	vs	vs	ADP
bam-6406	93	8	contralateral	contralateral	ADJ
bam-6406	93	9	muscles	muscle	NOUN
bam-6406	93	10	.	.	PUNCT
bam-6406	94	1	(	(	PUNCT
bam-6406	94	2	c	c	X
bam-6406	94	3	)	)	PUNCT
bam-6406	94	4	western	western	ADJ
bam-6406	94	5	blotting	blotting	ADJ
bam-6406	94	6	analyses	analysis	NOUN
bam-6406	94	7	and	and	CCONJ
bam-6406	94	8	densitometry	densitometry	NOUN
bam-6406	94	9	of	of	ADP
bam-6406	94	10	cybb	cybb	PROPN
bam-6406	94	11	at	at	ADP
bam-6406	94	12	indicated	indicate	VERB
bam-6406	94	13	time	time	NOUN
bam-6406	94	14	points	point	NOUN
bam-6406	94	15	following	follow	VERB
bam-6406	94	16	denervation	denervation	NOUN
bam-6406	94	17	.	.	PUNCT
bam-6406	95	1	gapdh	gapdh	NOUN
bam-6406	95	2	was	be	AUX
bam-6406	95	3	used	use	VERB
bam-6406	95	4	as	as	ADP
bam-6406	95	5	loading	loading	NOUN
bam-6406	95	6	control	control	NOUN
bam-6406	95	7	.	.	PUNCT
bam-6406	96	1	n	n	NOUN
bam-6406	97	1	=	=	SYM
bam-6406	97	2	2	2	NUM
bam-6406	97	3	-	-	SYM
bam-6406	97	4	4	4	NUM
bam-6406	97	5	;	;	PUNCT
bam-6406	97	6	*	*	PUNCT
bam-6406	97	7	p<0.05	p<0.05	NOUN
bam-6406	97	8	.	.	PUNCT
bam-6406	98	1	(	(	PUNCT
bam-6406	98	2	d	d	X
bam-6406	98	3	)	)	PUNCT
bam-6406	98	4	western	western	ADJ
bam-6406	98	5	blot	blot	NOUN
bam-6406	98	6	analyses	analysis	NOUN
bam-6406	98	7	and	and	CCONJ
bam-6406	98	8	densitometry	densitometry	NOUN
bam-6406	98	9	of	of	ADP
bam-6406	98	10	pand	pand	PROPN
bam-6406	98	11	total	total	PROPN
bam-6406	98	12	rela	rela	PROPN
bam-6406	98	13	subunit	subunit	NOUN
bam-6406	98	14	of	of	ADP
bam-6406	98	15	nfκb	nfκb	NOUN
bam-6406	98	16	in	in	ADP
bam-6406	98	17	ta	ta	ADP
bam-6406	98	18	muscles	muscle	NOUN
bam-6406	98	19	at	at	ADP
bam-6406	98	20	the	the	DET
bam-6406	98	21	indicated	indicate	VERB
bam-6406	98	22	time	time	NOUN
bam-6406	98	23	points	point	NOUN
bam-6406	98	24	following	follow	VERB
bam-6406	98	25	denervation	denervation	NOUN
bam-6406	98	26	.	.	PUNCT
bam-6406	99	1	gapdh	gapdh	NOUN
bam-6406	99	2	was	be	AUX
bam-6406	99	3	used	use	VERB
bam-6406	99	4	as	as	ADP
bam-6406	99	5	loading	loading	NOUN
bam-6406	99	6	control	control	NOUN
bam-6406	99	7	.	.	PUNCT
bam-6406	100	1	n	n	NOUN
bam-6406	101	1	=	=	SYM
bam-6406	101	2	2	2	NUM
bam-6406	101	3	-	-	SYM
bam-6406	101	4	4	4	NUM
bam-6406	101	5	;	;	PUNCT
bam-6406	101	6	*	*	PUNCT
bam-6406	101	7	p<0.05	p<0.05	NOUN
bam-6406	101	8	.	.	PUNCT
bam-6406	102	1	(	(	PUNCT
bam-6406	102	2	e	e	NOUN
bam-6406	102	3	)	)	PUNCT
bam-6406	102	4	real	real	ADJ
bam-6406	102	5	-	-	PUNCT
bam-6406	102	6	time	time	NOUN
bam-6406	102	7	pcr	pcr	NOUN
bam-6406	102	8	for	for	ADP
bam-6406	102	9	nfe2l2	nfe2l2	PROPN
bam-6406	102	10	in	in	ADP
bam-6406	102	11	ta	ta	ADP
bam-6406	102	12	muscles	muscle	NOUN
bam-6406	102	13	at	at	ADP
bam-6406	102	14	indicated	indicate	VERB
bam-6406	102	15	time	time	NOUN
bam-6406	102	16	points	point	NOUN
bam-6406	102	17	following	follow	VERB
bam-6406	102	18	denervation	denervation	NOUN
bam-6406	102	19	,	,	PUNCT
bam-6406	102	20	respect	respect	NOUN
bam-6406	102	21	to	to	ADP
bam-6406	102	22	contralateral	contralateral	ADJ
bam-6406	102	23	muscles	muscle	NOUN
bam-6406	102	24	.	.	PUNCT
bam-6406	103	1	values	value	NOUN
bam-6406	103	2	represent	represent	VERB
bam-6406	103	3	mean	mean	PROPN
bam-6406	103	4	±	±	NUM
bam-6406	103	5	sem	sem	NOUN
bam-6406	103	6	.	.	PUNCT
bam-6406	104	1	n	n	NOUN
bam-6406	104	2	=	=	SYM
bam-6406	104	3	4	4	NUM
bam-6406	104	4	-	-	SYM
bam-6406	104	5	6	6	NUM
bam-6406	104	6	.	.	PUNCT
bam-6406	105	1	*	*	PUNCT
bam-6406	105	2	p<0.05	p<0.05	NOUN
bam-6406	105	3	;	;	PUNCT
bam-6406	105	4	*	*	PUNCT
bam-6406	105	5	*	*	PUNCT
bam-6406	105	6	p<0.001	p<0.001	X
bam-6406	105	7	vs	vs	ADP
bam-6406	105	8	contra	contra	PROPN
bam-6406	105	9	muscles	muscle	NOUN
bam-6406	105	10	.	.	PUNCT
bam-6406	106	1	(	(	PUNCT
bam-6406	106	2	f	f	X
bam-6406	106	3	)	)	PUNCT
bam-6406	106	4	immunofluorescence	immunofluorescence	NOUN
bam-6406	106	5	staining	staining	NOUN
bam-6406	106	6	and	and	CCONJ
bam-6406	106	7	quantification	quantification	NOUN
bam-6406	106	8	of	of	ADP
bam-6406	106	9	intracellular	intracellular	ADJ
bam-6406	106	10	localization	localization	NOUN
bam-6406	106	11	of	of	ADP
bam-6406	106	12	nfe2l2	nfe2l2	PROPN
bam-6406	106	13	in	in	ADP
bam-6406	106	14	skeletal	skeletal	ADJ
bam-6406	106	15	muscle	muscle	NOUN
bam-6406	106	16	following	follow	VERB
bam-6406	106	17	denervation	denervation	NOUN
bam-6406	106	18	.	.	PUNCT
bam-6406	107	1	scale	scale	NOUN
bam-6406	107	2	bar	bar	NOUN
bam-6406	107	3	=	=	SYM
bam-6406	107	4	20	20	NUM
bam-6406	107	5	m	m	NOUN
bam-6406	107	6	.	.	PUNCT
bam-6406	108	1	values	value	NOUN
bam-6406	108	2	represent	represent	VERB
bam-6406	108	3	mean	mean	PROPN
bam-6406	108	4	±	±	NUM
bam-6406	108	5	sem	sem	NOUN
bam-6406	108	6	.	.	PUNCT
bam-6406	109	1	n	n	NOUN
bam-6406	109	2	=	=	SYM
bam-6406	109	3	2	2	NUM
bam-6406	109	4	each	each	DET
bam-6406	109	5	time	time	NOUN
bam-6406	109	6	point	point	NOUN
bam-6406	109	7	.	.	PUNCT
bam-6406	110	1	*	*	PUNCT
bam-6406	110	2	p<0.05	p<0.05	NOUN
bam-6406	110	3	.	.	PUNCT
bam-6406	111	1	(	(	PUNCT
bam-6406	111	2	g	g	NOUN
bam-6406	111	3	)	)	PUNCT
bam-6406	111	4	real	real	ADJ
bam-6406	111	5	-	-	PUNCT
bam-6406	111	6	time	time	NOUN
bam-6406	111	7	pcr	pcr	NOUN
bam-6406	111	8	of	of	ADP
bam-6406	111	9	gclc	gclc	NOUN
bam-6406	111	10	and	and	CCONJ
bam-6406	111	11	gclm	gclm	NOUN
bam-6406	111	12	at	at	ADP
bam-6406	111	13	indicated	indicate	VERB
bam-6406	111	14	time	time	NOUN
bam-6406	111	15	points	point	NOUN
bam-6406	111	16	following	follow	VERB
bam-6406	111	17	denervation	denervation	NOUN
bam-6406	111	18	.	.	PUNCT
bam-6406	112	1	values	value	NOUN
bam-6406	112	2	represent	represent	VERB
bam-6406	112	3	mean	mean	PROPN
bam-6406	112	4	±	±	NUM
bam-6406	112	5	sem	sem	NOUN
bam-6406	112	6	.	.	PUNCT
bam-6406	113	1	n	n	NOUN
bam-6406	113	2	=	=	SYM
bam-6406	113	3	4	4	NUM
bam-6406	113	4	-	-	SYM
bam-6406	113	5	6	6	NUM
bam-6406	113	6	.	.	PUNCT
bam-6406	114	1	*	*	PUNCT
bam-6406	114	2	p<0.05	p<0.05	NOUN
bam-6406	114	3	;	;	PUNCT
bam-6406	114	4	*	*	PUNCT
bam-6406	114	5	*	*	PUNCT
bam-6406	114	6	p<0.001	p<0.001	X
bam-6406	114	7	vs	vs	ADP
bam-6406	114	8	contra	contra	PROPN
bam-6406	114	9	muscles	muscle	NOUN
bam-6406	114	10	.	.	PUNCT
bam-6406	115	1	(	(	PUNCT
bam-6406	115	2	h	h	NOUN
bam-6406	115	3	)	)	PUNCT
bam-6406	115	4	enzymatic	enzymatic	ADJ
bam-6406	115	5	activities	activity	NOUN
bam-6406	115	6	of	of	ADP
bam-6406	115	7	gsr	gsr	NOUN
bam-6406	115	8	and	and	CCONJ
bam-6406	115	9	gstp1	gstp1	NOUN
bam-6406	115	10	at	at	ADP
bam-6406	115	11	indicated	indicate	VERB
bam-6406	115	12	time	time	NOUN
bam-6406	115	13	points	point	NOUN
bam-6406	115	14	following	follow	VERB
bam-6406	115	15	denervation	denervation	NOUN
bam-6406	115	16	,	,	PUNCT
bam-6406	115	17	relative	relative	ADJ
bam-6406	115	18	to	to	ADP
bam-6406	115	19	contralateral	contralateral	ADJ
bam-6406	115	20	muscles	muscle	NOUN
bam-6406	115	21	.	.	PUNCT
bam-6406	116	1	n	n	NOUN
bam-6406	116	2	=	=	SYM
bam-6406	116	3	4	4	X
bam-6406	116	4	.	.	PUNCT
bam-6406	116	5	values	value	NOUN
bam-6406	116	6	represent	represent	VERB
bam-6406	116	7	mean	mean	PROPN
bam-6406	116	8	±	±	NUM
bam-6406	116	9	sem	sem	PROPN
bam-6406	116	10	*	*	PROPN
bam-6406	116	11	p<0.05	p<0.05	PROPN
bam-6406	116	12	vs	vs	ADP
bam-6406	116	13	contra	contra	PROPN
bam-6406	116	14	muscles	muscle	NOUN
bam-6406	116	15	.	.	PUNCT
bam-6406	117	1	(	(	PUNCT
bam-6406	117	2	i	i	NOUN
bam-6406	117	3	)	)	PUNCT
bam-6406	117	4	real	real	ADJ
bam-6406	117	5	-	-	PUNCT
bam-6406	117	6	time	time	NOUN
bam-6406	117	7	pcr	pcr	NOUN
bam-6406	117	8	of	of	ADP
bam-6406	117	9	indicated	indicate	VERB
bam-6406	117	10	genesat	genesat	NOUN
bam-6406	117	11	indicated	indicate	VERB
bam-6406	117	12	time	time	NOUN
bam-6406	117	13	points	point	NOUN
bam-6406	117	14	following	follow	VERB
bam-6406	117	15	denervation	denervation	NOUN
bam-6406	117	16	,	,	PUNCT
bam-6406	117	17	relative	relative	ADJ
bam-6406	117	18	to	to	ADP
bam-6406	117	19	contralateral	contralateral	ADJ
bam-6406	117	20	muscles	muscle	NOUN
bam-6406	117	21	.	.	PUNCT
bam-6406	118	1	values	value	NOUN
bam-6406	118	2	represent	represent	VERB
bam-6406	118	3	mean	mean	PROPN
bam-6406	118	4	±	±	NUM
bam-6406	118	5	sem	sem	NOUN
bam-6406	118	6	.	.	PUNCT
bam-6406	119	1	n	n	NOUN
bam-6406	119	2	=	=	SYM
bam-6406	119	3	4	4	NUM
bam-6406	119	4	-	-	SYM
bam-6406	119	5	6	6	NUM
bam-6406	119	6	.	.	PUNCT
bam-6406	120	1	*	*	PUNCT
bam-6406	120	2	p<0.05	p<0.05	NOUN
bam-6406	120	3	;	;	PUNCT
bam-6406	120	4	*	*	PUNCT
bam-6406	120	5	*	*	PUNCT
bam-6406	120	6	p<0.001	p<0.001	X
bam-6406	120	7	vs	vs	ADP
bam-6406	120	8	contra	contra	PROPN
bam-6406	120	9	muscles	muscle	NOUN
bam-6406	120	10	.	.	PUNCT
bam-6406	121	1	muscle	muscle	NOUN
bam-6406	121	2	denervation	denervation	NOUN
bam-6406	121	3	atrophy	atrophy	NOUN
bam-6406	121	4	is	be	AUX
bam-6406	121	5	not	not	PART
bam-6406	121	6	related	relate	VERB
bam-6406	121	7	to	to	PART
bam-6406	121	8	oxidative	oxidative	VERB
bam-6406	121	9	stress	stress	NOUN
bam-6406	121	10	eur	eur	PROPN
bam-6406	121	11	j	j	PROPN
bam-6406	121	12	transl	transl	PROPN
bam-6406	121	13	myol	myol	NOUN
bam-6406	121	14	2017	2017	NUM
bam-6406	121	15	;	;	PUNCT
bam-6406	121	16	27	27	NUM
bam-6406	121	17	(	(	PUNCT
bam-6406	121	18	1	1	NUM
bam-6406	121	19	):	):	PUNCT
bam-6406	121	20	43	43	NUM
bam-6406	121	21	-	-	SYM
bam-6406	121	22	50	50	NUM
bam-6406	121	23	47	47	NUM
bam-6406	121	24	translocated	translocate	VERB
bam-6406	121	25	into	into	ADP
bam-6406	121	26	the	the	DET
bam-6406	121	27	nuclei	nucleus	NOUN
bam-6406	121	28	at	at	ADP
bam-6406	121	29	three	three	NUM
bam-6406	121	30	and	and	CCONJ
bam-6406	121	31	,	,	PUNCT
bam-6406	121	32	even	even	ADV
bam-6406	121	33	more	more	ADJ
bam-6406	121	34	,	,	PUNCT
bam-6406	121	35	at	at	ADP
bam-6406	121	36	seven	seven	NUM
bam-6406	121	37	days	day	NOUN
bam-6406	121	38	following	follow	VERB
bam-6406	121	39	denervation	denervation	NOUN
bam-6406	121	40	,	,	PUNCT
bam-6406	121	41	compared	compare	VERB
bam-6406	121	42	to	to	ADP
bam-6406	121	43	contralateral	contralateral	ADJ
bam-6406	121	44	muscles	muscle	NOUN
bam-6406	121	45	(	(	PUNCT
bam-6406	121	46	fig	fig	NOUN
bam-6406	121	47	.	.	PUNCT
bam-6406	122	1	2f	2f	NUM
bam-6406	122	2	)	)	PUNCT
bam-6406	122	3	.	.	PUNCT
bam-6406	123	1	to	to	PART
bam-6406	123	2	confirm	confirm	VERB
bam-6406	123	3	the	the	DET
bam-6406	123	4	kinetics	kinetic	NOUN
bam-6406	123	5	of	of	ADP
bam-6406	123	6	nfe2l2	nfe2l2	PROPN
bam-6406	123	7	activation	activation	NOUN
bam-6406	123	8	,	,	PUNCT
bam-6406	123	9	we	we	PRON
bam-6406	123	10	evaluated	evaluate	VERB
bam-6406	123	11	the	the	DET
bam-6406	123	12	expression	expression	NOUN
bam-6406	123	13	of	of	ADP
bam-6406	123	14	glutamate	glutamate	NOUN
bam-6406	123	15	-	-	PUNCT
bam-6406	123	16	cysteine	cysteine	NOUN
bam-6406	123	17	ligase	ligase	NOUN
bam-6406	123	18	catalytic	catalytic	ADJ
bam-6406	123	19	(	(	PUNCT
bam-6406	123	20	gclc	gclc	PROPN
bam-6406	123	21	)	)	PUNCT
bam-6406	123	22	and	and	CCONJ
bam-6406	123	23	modifier	modifier	NOUN
bam-6406	123	24	(	(	PUNCT
bam-6406	123	25	gclm	gclm	NOUN
bam-6406	123	26	)	)	PUNCT
bam-6406	123	27	subunits	subunit	NOUN
bam-6406	123	28	,	,	PUNCT
bam-6406	123	29	two	two	NUM
bam-6406	123	30	known	know	VERB
bam-6406	123	31	nfe2l2	nfe2l2	PROPN
bam-6406	123	32	target	target	NOUN
bam-6406	123	33	genes	gene	NOUN
bam-6406	123	34	14	14	NUM
bam-6406	123	35	(	(	PUNCT
bam-6406	123	36	fig	fig	NOUN
bam-6406	123	37	.	.	PUNCT
bam-6406	124	1	2	2	NUM
bam-6406	124	2	g	g	NOUN
bam-6406	124	3	)	)	PUNCT
bam-6406	124	4	.	.	PUNCT
bam-6406	125	1	the	the	DET
bam-6406	125	2	expression	expression	NOUN
bam-6406	125	3	of	of	ADP
bam-6406	125	4	both	both	DET
bam-6406	125	5	genes	gene	NOUN
bam-6406	125	6	increased	increase	VERB
bam-6406	125	7	over	over	ADP
bam-6406	125	8	time	time	NOUN
bam-6406	125	9	following	follow	VERB
bam-6406	125	10	denervation	denervation	NOUN
bam-6406	125	11	,	,	PUNCT
bam-6406	125	12	confirming	confirm	VERB
bam-6406	125	13	that	that	SCONJ
bam-6406	125	14	nfe2l2	nfe2l2	PROPN
bam-6406	125	15	is	be	AUX
bam-6406	125	16	more	more	ADV
bam-6406	125	17	active	active	ADJ
bam-6406	125	18	at	at	ADP
bam-6406	125	19	seven	seven	NUM
bam-6406	125	20	than	than	ADP
bam-6406	125	21	at	at	ADP
bam-6406	125	22	three	three	NUM
bam-6406	125	23	days	day	NOUN
bam-6406	125	24	following	follow	VERB
bam-6406	125	25	denervation	denervation	NOUN
bam-6406	125	26	.	.	PUNCT
bam-6406	126	1	glutathione	glutathione	NOUN
bam-6406	126	2	plays	play	VERB
bam-6406	126	3	a	a	DET
bam-6406	126	4	key	key	ADJ
bam-6406	126	5	role	role	NOUN
bam-6406	126	6	in	in	ADP
bam-6406	126	7	cellular	cellular	ADJ
bam-6406	126	8	detoxification	detoxification	NOUN
bam-6406	126	9	processes	process	NOUN
bam-6406	126	10	19	19	NUM
bam-6406	126	11	through	through	ADP
bam-6406	126	12	glutathione	glutathione	NOUN
bam-6406	126	13	reductase	reductase	NOUN
bam-6406	126	14	(	(	PUNCT
bam-6406	126	15	gsr	gsr	NOUN
bam-6406	126	16	)	)	PUNCT
bam-6406	126	17	and	and	CCONJ
bam-6406	126	18	glutathione	glutathione	NOUN
bam-6406	126	19	s	s	NOUN
bam-6406	126	20	-	-	NOUN
bam-6406	126	21	transferase	transferase	NOUN
bam-6406	126	22	pi	pi	NOUN
bam-6406	126	23	1	1	NUM
bam-6406	126	24	(	(	PUNCT
bam-6406	126	25	gstp1	gstp1	NOUN
bam-6406	126	26	)	)	PUNCT
bam-6406	126	27	enzymes	enzyme	NOUN
bam-6406	126	28	.	.	PUNCT
bam-6406	127	1	gsr	gsr	ADJ
bam-6406	127	2	activity	activity	NOUN
bam-6406	127	3	was	be	AUX
bam-6406	127	4	significantly	significantly	ADV
bam-6406	127	5	increased	increase	VERB
bam-6406	127	6	at	at	ADP
bam-6406	127	7	seven	seven	NUM
bam-6406	127	8	days	day	NOUN
bam-6406	127	9	,	,	PUNCT
bam-6406	127	10	but	but	CCONJ
bam-6406	127	11	it	it	PRON
bam-6406	127	12	decreased	decrease	VERB
bam-6406	127	13	at	at	ADP
bam-6406	127	14	ten	ten	NUM
bam-6406	127	15	and	and	CCONJ
bam-6406	127	16	fourteen	fourteen	NUM
bam-6406	127	17	days	day	NOUN
bam-6406	127	18	after	after	ADP
bam-6406	127	19	denervation	denervation	NOUN
bam-6406	127	20	;	;	PUNCT
bam-6406	127	21	conversely	conversely	ADV
bam-6406	127	22	,	,	PUNCT
bam-6406	127	23	gstp1	gstp1	NOUN
bam-6406	127	24	achieved	achieve	VERB
bam-6406	127	25	its	its	PRON
bam-6406	127	26	maximal	maximal	ADJ
bam-6406	127	27	activity	activity	NOUN
bam-6406	127	28	ten	ten	NUM
bam-6406	127	29	days	day	NOUN
bam-6406	127	30	following	follow	VERB
bam-6406	127	31	denervation	denervation	NOUN
bam-6406	127	32	(	(	PUNCT
bam-6406	127	33	fig	fig	NOUN
bam-6406	127	34	.	.	PUNCT
bam-6406	128	1	2h	2h	NUM
bam-6406	128	2	)	)	PUNCT
bam-6406	128	3	.	.	PUNCT
bam-6406	129	1	to	to	PART
bam-6406	129	2	determine	determine	VERB
bam-6406	129	3	the	the	DET
bam-6406	129	4	molecular	molecular	ADJ
bam-6406	129	5	response	response	NOUN
bam-6406	129	6	of	of	ADP
bam-6406	129	7	skeletal	skeletal	ADJ
bam-6406	129	8	muscle	muscle	NOUN
bam-6406	129	9	to	to	PART
bam-6406	129	10	os	os	VERB
bam-6406	129	11	,	,	PUNCT
bam-6406	129	12	we	we	PRON
bam-6406	129	13	monitored	monitor	VERB
bam-6406	129	14	the	the	DET
bam-6406	129	15	expression	expression	NOUN
bam-6406	129	16	of	of	ADP
bam-6406	129	17	several	several	ADJ
bam-6406	129	18	genes	gene	NOUN
bam-6406	129	19	involved	involve	VERB
bam-6406	129	20	in	in	ADP
bam-6406	129	21	ros	ros	PROPN
bam-6406	129	22	buffering	buffering	NOUN
bam-6406	129	23	,	,	PUNCT
bam-6406	129	24	over	over	ADP
bam-6406	129	25	time	time	NOUN
bam-6406	129	26	.	.	PUNCT
bam-6406	130	1	a	a	DET
bam-6406	130	2	significant	significant	ADJ
bam-6406	130	3	induction	induction	NOUN
bam-6406	130	4	of	of	ADP
bam-6406	130	5	hmox1	hmox1	NOUN
bam-6406	130	6	expression	expression	NOUN
bam-6406	130	7	was	be	AUX
bam-6406	130	8	detected	detect	VERB
bam-6406	130	9	as	as	ADV
bam-6406	130	10	soon	soon	ADV
bam-6406	130	11	as	as	ADP
bam-6406	130	12	eight	eight	NUM
bam-6406	130	13	hours	hour	NOUN
bam-6406	130	14	following	follow	VERB
bam-6406	130	15	denervation	denervation	NOUN
bam-6406	130	16	reached	reach	VERB
bam-6406	130	17	the	the	DET
bam-6406	130	18	maximal	maximal	ADJ
bam-6406	130	19	expression	expression	NOUN
bam-6406	130	20	at	at	ADP
bam-6406	130	21	one	one	NUM
bam-6406	130	22	day	day	NOUN
bam-6406	130	23	and	and	CCONJ
bam-6406	130	24	decreased	decrease	VERB
bam-6406	130	25	after	after	ADP
bam-6406	130	26	three	three	NUM
bam-6406	130	27	days	day	NOUN
bam-6406	130	28	.	.	PUNCT
bam-6406	131	1	expression	expression	NOUN
bam-6406	131	2	of	of	ADP
bam-6406	131	3	nqo1	nqo1	PROPN
bam-6406	131	4	gene	gene	NOUN
bam-6406	131	5	increased	increase	VERB
bam-6406	131	6	in	in	ADP
bam-6406	131	7	a	a	DET
bam-6406	131	8	time	time	NOUN
bam-6406	131	9	-	-	PUNCT
bam-6406	131	10	dependent	dependent	ADJ
bam-6406	131	11	manner	manner	NOUN
bam-6406	131	12	,	,	PUNCT
bam-6406	131	13	beginning	begin	VERB
bam-6406	131	14	at	at	ADP
bam-6406	131	15	day	day	NOUN
bam-6406	131	16	three	three	NUM
bam-6406	131	17	.	.	PUNCT
bam-6406	132	1	the	the	DET
bam-6406	132	2	expression	expression	NOUN
bam-6406	132	3	of	of	ADP
bam-6406	132	4	other	other	ADJ
bam-6406	132	5	genes	gene	NOUN
bam-6406	132	6	–	–	PUNCT
bam-6406	132	7	i.e.	i.e.	X
bam-6406	132	8	catalase	catalase	NOUN
bam-6406	132	9	(	(	PUNCT
bam-6406	132	10	cat	cat	NOUN
bam-6406	132	11	)	)	PUNCT
bam-6406	132	12	and	and	CCONJ
bam-6406	132	13	thioredoxin	thioredoxin	PROPN
bam-6406	132	14	1(txn	1(txn	NUM
bam-6406	132	15	1	1	NUM
bam-6406	132	16	)	)	PUNCT
bam-6406	132	17	–	–	PUNCT
bam-6406	132	18	showed	show	VERB
bam-6406	132	19	a	a	DET
bam-6406	132	20	significant	significant	ADJ
bam-6406	132	21	induction	induction	NOUN
bam-6406	132	22	one	one	NUM
bam-6406	132	23	day	day	NOUN
bam-6406	132	24	following	follow	VERB
bam-6406	132	25	denervation	denervation	NOUN
bam-6406	132	26	,	,	PUNCT
bam-6406	132	27	reached	reach	VERB
bam-6406	132	28	a	a	DET
bam-6406	132	29	peak	peak	NOUN
bam-6406	132	30	after	after	ADP
bam-6406	132	31	three	three	NUM
bam-6406	132	32	days	day	NOUN
bam-6406	132	33	and	and	CCONJ
bam-6406	132	34	decreased	decrease	VERB
bam-6406	132	35	seven	seven	NUM
bam-6406	132	36	days	day	NOUN
bam-6406	132	37	after	after	ADP
bam-6406	132	38	denervation	denervation	NOUN
bam-6406	132	39	(	(	PUNCT
bam-6406	132	40	fig	fig	NOUN
bam-6406	132	41	.	.	PUNCT
bam-6406	133	1	2h	2h	NUM
bam-6406	133	2	)	)	PUNCT
bam-6406	133	3	.	.	PUNCT
bam-6406	134	1	the	the	DET
bam-6406	134	2	effects	effect	NOUN
bam-6406	134	3	of	of	ADP
bam-6406	134	4	ros	ros	PROPN
bam-6406	134	5	are	be	AUX
bam-6406	134	6	dose	dose	NOUN
bam-6406	134	7	-	-	PUNCT
bam-6406	134	8	dependent	dependent	ADJ
bam-6406	134	9	since	since	SCONJ
bam-6406	134	10	they	they	PRON
bam-6406	134	11	can	can	AUX
bam-6406	134	12	act	act	VERB
bam-6406	134	13	as	as	ADP
bam-6406	134	14	physiological	physiological	ADJ
bam-6406	134	15	signaling	signal	VERB
bam-6406	134	16	molecules	molecule	NOUN
bam-6406	134	17	at	at	ADP
bam-6406	134	18	low	low	ADJ
bam-6406	134	19	levels	level	NOUN
bam-6406	134	20	but	but	CCONJ
bam-6406	134	21	they	they	PRON
bam-6406	134	22	can	can	AUX
bam-6406	134	23	be	be	AUX
bam-6406	134	24	harmful	harmful	ADJ
bam-6406	134	25	above	above	ADP
bam-6406	134	26	a	a	DET
bam-6406	134	27	threshold	threshold	NOUN
bam-6406	134	28	.	.	PUNCT
bam-6406	135	1	20	20	NUM
bam-6406	135	2	to	to	PART
bam-6406	135	3	verify	verify	VERB
bam-6406	135	4	if	if	SCONJ
bam-6406	135	5	the	the	DET
bam-6406	135	6	induction	induction	NOUN
bam-6406	135	7	of	of	ADP
bam-6406	135	8	os	os	NOUN
bam-6406	135	9	upon	upon	SCONJ
bam-6406	135	10	denervation	denervation	NOUN
bam-6406	135	11	leads	lead	VERB
bam-6406	135	12	to	to	ADP
bam-6406	135	13	muscle	muscle	NOUN
bam-6406	135	14	damage	damage	NOUN
bam-6406	135	15	,	,	PUNCT
bam-6406	135	16	protein	protein	NOUN
bam-6406	135	17	carbonyl	carbonyl	NOUN
bam-6406	135	18	level	level	NOUN
bam-6406	135	19	and	and	CCONJ
bam-6406	135	20	lipid	lipid	NOUN
bam-6406	135	21	peroxidation	peroxidation	NOUN
bam-6406	135	22	,	,	PUNCT
bam-6406	135	23	sensitive	sensitive	ADJ
bam-6406	135	24	biomarkers	biomarker	NOUN
bam-6406	135	25	of	of	ADP
bam-6406	135	26	ros	ros	PROPN
bam-6406	135	27	-	-	PUNCT
bam-6406	135	28	mediated	mediate	VERB
bam-6406	135	29	damage	damage	NOUN
bam-6406	135	30	,	,	PUNCT
bam-6406	135	31	were	be	AUX
bam-6406	135	32	quantified	quantify	VERB
bam-6406	135	33	in	in	ADP
bam-6406	135	34	skeletal	skeletal	ADJ
bam-6406	135	35	muscle	muscle	NOUN
bam-6406	135	36	tissue	tissue	NOUN
bam-6406	135	37	,	,	PUNCT
bam-6406	135	38	seven	seven	NUM
bam-6406	135	39	days	day	NOUN
bam-6406	135	40	following	follow	VERB
bam-6406	135	41	denervation	denervation	NOUN
bam-6406	135	42	.	.	PUNCT
bam-6406	136	1	interestingly	interestingly	ADV
bam-6406	136	2	,	,	PUNCT
bam-6406	136	3	denervation	denervation	NOUN
bam-6406	136	4	induced	induce	VERB
bam-6406	136	5	neither	neither	CCONJ
bam-6406	136	6	a	a	DET
bam-6406	136	7	significant	significant	ADJ
bam-6406	136	8	increase	increase	NOUN
bam-6406	136	9	in	in	ADP
bam-6406	136	10	carbonyl	carbonyl	NOUN
bam-6406	136	11	groups	group	NOUN
bam-6406	136	12	nor	nor	CCONJ
bam-6406	136	13	an	an	DET
bam-6406	136	14	induction	induction	NOUN
bam-6406	136	15	in	in	ADP
bam-6406	136	16	lipid	lipid	ADJ
bam-6406	136	17	peroxidation	peroxidation	NOUN
bam-6406	136	18	(	(	PUNCT
bam-6406	136	19	fig	fig	NOUN
bam-6406	136	20	.	.	PUNCT
bam-6406	137	1	3	3	NUM
bam-6406	137	2	)	)	PUNCT
bam-6406	137	3	,	,	PUNCT
bam-6406	137	4	as	as	SCONJ
bam-6406	137	5	detected	detect	VERB
bam-6406	137	6	by	by	ADP
bam-6406	137	7	4	4	NUM
bam-6406	137	8	-	-	PUNCT
bam-6406	137	9	hydroxynonenal	hydroxynonenal	NOUN
bam-6406	137	10	(	(	PUNCT
bam-6406	137	11	4	4	NUM
bam-6406	137	12	-	-	PUNCT
bam-6406	137	13	hne	hne	NOUN
bam-6406	137	14	)	)	PUNCT
bam-6406	137	15	levels	level	NOUN
bam-6406	137	16	,	,	PUNCT
bam-6406	137	17	suggesting	suggest	VERB
bam-6406	137	18	that	that	SCONJ
bam-6406	137	19	skeletal	skeletal	ADJ
bam-6406	137	20	muscle	muscle	NOUN
bam-6406	137	21	is	be	AUX
bam-6406	137	22	not	not	PART
bam-6406	137	23	damaged	damage	VERB
bam-6406	137	24	by	by	ADP
bam-6406	137	25	os	os	NOUN
bam-6406	137	26	after	after	ADP
bam-6406	137	27	severing	sever	VERB
bam-6406	137	28	nerve	nerve	NOUN
bam-6406	137	29	.	.	PUNCT
bam-6406	138	1	oxidative	oxidative	ADJ
bam-6406	138	2	stress	stress	NOUN
bam-6406	138	3	does	do	AUX
bam-6406	138	4	not	not	PART
bam-6406	138	5	induce	induce	VERB
bam-6406	138	6	muscle	muscle	NOUN
bam-6406	138	7	atrophy	atrophy	NOUN
bam-6406	138	8	following	follow	VERB
bam-6406	138	9	denervation	denervation	NOUN
bam-6406	138	10	denervation	denervation	NOUN
bam-6406	138	11	induces	induce	VERB
bam-6406	138	12	skeletal	skeletal	ADJ
bam-6406	138	13	muscle	muscle	NOUN
bam-6406	138	14	atrophy	atrophy	NOUN
bam-6406	138	15	and	and	CCONJ
bam-6406	138	16	os	os	NOUN
bam-6406	138	17	.	.	PUNCT
bam-6406	139	1	to	to	PART
bam-6406	139	2	investigate	investigate	VERB
bam-6406	139	3	the	the	DET
bam-6406	139	4	contribution	contribution	NOUN
bam-6406	139	5	of	of	ADP
bam-6406	139	6	os	os	NOUN
bam-6406	139	7	to	to	ADP
bam-6406	139	8	neurogenic	neurogenic	ADJ
bam-6406	139	9	muscle	muscle	NOUN
bam-6406	139	10	atrophy	atrophy	NOUN
bam-6406	139	11	,	,	PUNCT
bam-6406	139	12	mice	mouse	NOUN
bam-6406	139	13	were	be	AUX
bam-6406	139	14	treated	treat	VERB
bam-6406	139	15	with	with	ADP
bam-6406	139	16	trolox	trolox	PROPN
bam-6406	139	17	,	,	PUNCT
bam-6406	139	18	a	a	DET
bam-6406	139	19	cellpermeable	cellpermeable	ADJ
bam-6406	139	20	derivate	derivate	NOUN
bam-6406	139	21	of	of	ADP
bam-6406	139	22	vitamin	vitamin	NOUN
bam-6406	139	23	e	e	NOUN
bam-6406	139	24	with	with	ADP
bam-6406	139	25	antioxidant	antioxidant	ADJ
bam-6406	139	26	properties	property	NOUN
bam-6406	139	27	,	,	PUNCT
bam-6406	139	28	21,22	21,22	NOUN
bam-6406	139	29	or	or	CCONJ
bam-6406	139	30	vehicle	vehicle	NOUN
bam-6406	139	31	as	as	ADP
bam-6406	139	32	a	a	DET
bam-6406	139	33	control	control	NOUN
bam-6406	139	34	,	,	PUNCT
bam-6406	139	35	starting	start	VERB
bam-6406	139	36	from	from	ADP
bam-6406	139	37	the	the	DET
bam-6406	139	38	day	day	NOUN
bam-6406	139	39	of	of	ADP
bam-6406	139	40	denervation	denervation	NOUN
bam-6406	139	41	.	.	PUNCT
bam-6406	140	1	we	we	PRON
bam-6406	140	2	first	first	ADV
bam-6406	140	3	verified	verify	VERB
bam-6406	140	4	that	that	SCONJ
bam-6406	140	5	trolox	trolox	PROPN
bam-6406	140	6	treatment	treatment	NOUN
bam-6406	140	7	effectively	effectively	ADV
bam-6406	140	8	reduced	reduce	VERB
bam-6406	140	9	os	os	NOUN
bam-6406	140	10	in	in	ADP
bam-6406	140	11	skeletal	skeletal	ADJ
bam-6406	140	12	muscle	muscle	NOUN
bam-6406	140	13	following	follow	VERB
bam-6406	140	14	denervation	denervation	NOUN
bam-6406	140	15	,	,	PUNCT
bam-6406	140	16	by	by	ADP
bam-6406	140	17	evaluating	evaluate	VERB
bam-6406	140	18	cybb	cybb	NOUN
bam-6406	140	19	levels	level	NOUN
bam-6406	140	20	by	by	ADP
bam-6406	140	21	western	western	ADJ
bam-6406	140	22	blot	blot	NOUN
bam-6406	140	23	analyses	analysis	NOUN
bam-6406	140	24	(	(	PUNCT
bam-6406	140	25	fig	fig	NOUN
bam-6406	140	26	.	.	PUNCT
bam-6406	141	1	4a	4a	NUM
bam-6406	141	2	)	)	PUNCT
bam-6406	141	3	.	.	PUNCT
bam-6406	142	1	muscle	muscle	NOUN
bam-6406	142	2	mass	mass	NOUN
bam-6406	142	3	evaluation	evaluation	NOUN
bam-6406	142	4	and	and	CCONJ
bam-6406	142	5	histological	histological	ADJ
bam-6406	142	6	analyses	analysis	NOUN
bam-6406	142	7	showed	show	VERB
bam-6406	142	8	that	that	SCONJ
bam-6406	142	9	trolox	trolox	PROPN
bam-6406	142	10	exerted	exert	VERB
bam-6406	142	11	no	no	DET
bam-6406	142	12	protective	protective	ADJ
bam-6406	142	13	effects	effect	NOUN
bam-6406	142	14	on	on	ADP
bam-6406	142	15	muscle	muscle	NOUN
bam-6406	142	16	atrophy	atrophy	NOUN
bam-6406	142	17	,	,	PUNCT
bam-6406	142	18	two	two	NUM
bam-6406	142	19	and	and	CCONJ
bam-6406	142	20	four	four	NUM
bam-6406	142	21	weeks	week	NOUN
bam-6406	142	22	following	follow	VERB
bam-6406	142	23	denervation	denervation	NOUN
bam-6406	142	24	(	(	PUNCT
bam-6406	142	25	fig	fig	NOUN
bam-6406	142	26	.	.	PUNCT
bam-6406	143	1	4b	4b	PROPN
bam-6406	143	2	&	&	CCONJ
bam-6406	143	3	4c	4c	NOUN
bam-6406	143	4	)	)	PUNCT
bam-6406	143	5	.	.	PUNCT
bam-6406	144	1	similar	similar	ADJ
bam-6406	144	2	results	result	NOUN
bam-6406	144	3	were	be	AUX
bam-6406	144	4	obtain	obtain	VERB
bam-6406	144	5	by	by	ADP
bam-6406	144	6	treating	treat	VERB
bam-6406	144	7	mice	mouse	NOUN
bam-6406	144	8	with	with	ADP
bam-6406	144	9	another	another	DET
bam-6406	144	10	anti	anti	ADJ
bam-6406	144	11	-	-	ADJ
bam-6406	144	12	oxidant	oxidant	ADJ
bam-6406	144	13	drug	drug	NOUN
bam-6406	144	14	,	,	PUNCT
bam-6406	144	15	resveratrol	resveratrol	NOUN
bam-6406	144	16	,	,	PUNCT
bam-6406	144	17	23	23	NUM
bam-6406	144	18	for	for	ADP
bam-6406	144	19	four	four	NUM
bam-6406	144	20	weeks	week	NOUN
bam-6406	144	21	following	follow	VERB
bam-6406	144	22	denervation	denervation	NOUN
bam-6406	144	23	(	(	PUNCT
bam-6406	144	24	data	datum	NOUN
bam-6406	144	25	not	not	PART
bam-6406	144	26	shown	show	VERB
bam-6406	144	27	)	)	PUNCT
bam-6406	144	28	.	.	PUNCT
bam-6406	145	1	these	these	DET
bam-6406	145	2	results	result	NOUN
bam-6406	145	3	indicate	indicate	VERB
bam-6406	145	4	that	that	SCONJ
bam-6406	145	5	denervation	denervation	NOUN
bam-6406	145	6	activates	activate	VERB
bam-6406	145	7	os	os	NOUN
bam-6406	145	8	,	,	PUNCT
bam-6406	145	9	which	which	PRON
bam-6406	145	10	is	be	AUX
bam-6406	145	11	however	however	ADV
bam-6406	145	12	not	not	PART
bam-6406	145	13	responsible	responsible	ADJ
bam-6406	145	14	for	for	ADP
bam-6406	145	15	neurogenic	neurogenic	ADJ
bam-6406	145	16	muscle	muscle	NOUN
bam-6406	145	17	atrophy	atrophy	NOUN
bam-6406	145	18	.	.	PUNCT
bam-6406	146	1	discussion	discussion	NOUN
bam-6406	146	2	in	in	ADP
bam-6406	146	3	this	this	DET
bam-6406	146	4	study	study	NOUN
bam-6406	146	5	,	,	PUNCT
bam-6406	146	6	we	we	PRON
bam-6406	146	7	examined	examine	VERB
bam-6406	146	8	the	the	DET
bam-6406	146	9	kinetics	kinetic	NOUN
bam-6406	146	10	of	of	ADP
bam-6406	146	11	activation	activation	NOUN
bam-6406	146	12	of	of	ADP
bam-6406	146	13	the	the	DET
bam-6406	146	14	os	os	NOUN
bam-6406	146	15	response	response	NOUN
bam-6406	146	16	following	follow	VERB
bam-6406	146	17	denervation	denervation	NOUN
bam-6406	146	18	in	in	ADP
bam-6406	146	19	skeletal	skeletal	ADJ
bam-6406	146	20	muscle	muscle	NOUN
bam-6406	146	21	,	,	PUNCT
bam-6406	146	22	and	and	CCONJ
bam-6406	146	23	determined	determine	VERB
bam-6406	146	24	if	if	SCONJ
bam-6406	146	25	ros	ros	PROPN
bam-6406	146	26	activation	activation	NOUN
bam-6406	146	27	plays	play	VERB
bam-6406	146	28	a	a	DET
bam-6406	146	29	causal	causal	ADJ
bam-6406	146	30	role	role	NOUN
bam-6406	146	31	in	in	ADP
bam-6406	146	32	the	the	DET
bam-6406	146	33	causing	cause	VERB
bam-6406	146	34	muscle	muscle	NOUN
bam-6406	146	35	atrophy	atrophy	NOUN
bam-6406	146	36	.	.	PUNCT
bam-6406	147	1	we	we	PRON
bam-6406	147	2	showed	show	VERB
bam-6406	147	3	that	that	SCONJ
bam-6406	147	4	os	os	NOUN
bam-6406	147	5	is	be	AUX
bam-6406	147	6	induced	induce	VERB
bam-6406	147	7	in	in	ADP
bam-6406	147	8	skeletal	skeletal	ADJ
bam-6406	147	9	muscle	muscle	NOUN
bam-6406	147	10	as	as	ADV
bam-6406	147	11	early	early	ADV
bam-6406	147	12	as	as	ADP
bam-6406	147	13	three	three	NUM
bam-6406	147	14	days	day	NOUN
bam-6406	147	15	following	follow	VERB
bam-6406	147	16	denervation	denervation	NOUN
bam-6406	147	17	,	,	PUNCT
bam-6406	147	18	prior	prior	ADV
bam-6406	147	19	to	to	ADP
bam-6406	147	20	the	the	DET
bam-6406	147	21	appearance	appearance	NOUN
bam-6406	147	22	of	of	ADP
bam-6406	147	23	muscle	muscle	NOUN
bam-6406	147	24	atrophy	atrophy	NOUN
bam-6406	147	25	.	.	PUNCT
bam-6406	148	1	consistently	consistently	ADV
bam-6406	148	2	,	,	PUNCT
bam-6406	148	3	the	the	DET
bam-6406	148	4	induction	induction	NOUN
bam-6406	148	5	of	of	ADP
bam-6406	148	6	antioxidant	antioxidant	ADJ
bam-6406	148	7	response	response	NOUN
bam-6406	148	8	genes	gene	NOUN
bam-6406	148	9	began	begin	VERB
bam-6406	148	10	at	at	ADP
bam-6406	148	11	day	day	NOUN
bam-6406	148	12	three	three	NUM
bam-6406	148	13	and	and	CCONJ
bam-6406	148	14	increased	increase	VERB
bam-6406	148	15	over	over	ADP
bam-6406	148	16	time	time	NOUN
bam-6406	148	17	following	follow	VERB
bam-6406	148	18	denervation	denervation	NOUN
bam-6406	148	19	,	,	PUNCT
bam-6406	148	20	as	as	SCONJ
bam-6406	148	21	confirmed	confirm	VERB
bam-6406	148	22	by	by	ADP
bam-6406	148	23	nuclear	nuclear	ADJ
bam-6406	148	24	translocation	translocation	NOUN
bam-6406	148	25	of	of	ADP
bam-6406	148	26	nfe2l2	nfe2l2	PROPN
bam-6406	148	27	and	and	CCONJ
bam-6406	148	28	by	by	ADP
bam-6406	148	29	the	the	DET
bam-6406	148	30	kinetics	kinetic	NOUN
bam-6406	148	31	of	of	ADP
bam-6406	148	32	expression	expression	NOUN
bam-6406	148	33	of	of	ADP
bam-6406	148	34	gclc	gclc	NOUN
bam-6406	148	35	and	and	CCONJ
bam-6406	148	36	gclm	gclm	NOUN
bam-6406	148	37	genes	gene	NOUN
bam-6406	148	38	,	,	PUNCT
bam-6406	148	39	two	two	NUM
bam-6406	148	40	nfe2l2	nfe2l2	PROPN
bam-6406	148	41	targets	target	NOUN
bam-6406	148	42	.	.	PUNCT
bam-6406	149	1	it	it	PRON
bam-6406	149	2	has	have	AUX
bam-6406	149	3	been	be	AUX
bam-6406	149	4	reported	report	VERB
bam-6406	149	5	that	that	SCONJ
bam-6406	149	6	muscle	muscle	NOUN
bam-6406	149	7	inactivity	inactivity	NOUN
bam-6406	149	8	or	or	CCONJ
bam-6406	149	9	denervation	denervation	NOUN
bam-6406	149	10	increases	increase	VERB
bam-6406	149	11	the	the	DET
bam-6406	149	12	levels	level	NOUN
bam-6406	149	13	of	of	ADP
bam-6406	149	14	ros	ros	PROPN
bam-6406	149	15	as	as	ADP
bam-6406	149	16	a	a	DET
bam-6406	149	17	consequence	consequence	NOUN
bam-6406	149	18	of	of	ADP
bam-6406	149	19	both	both	DET
bam-6406	149	20	reduced	reduce	VERB
bam-6406	149	21	antioxidant	antioxidant	ADJ
bam-6406	149	22	capacity	capacity	NOUN
bam-6406	149	23	and	and	CCONJ
bam-6406	149	24	induced	induced	ADJ
bam-6406	149	25	production	production	NOUN
bam-6406	149	26	of	of	ADP
bam-6406	149	27	ros	ros	PROPN
bam-6406	149	28	.	.	PROPN
bam-6406	150	1	24	24	NUM
bam-6406	150	2	-	-	SYM
bam-6406	150	3	26	26	NUM
bam-6406	150	4	furthermore	furthermore	ADV
bam-6406	150	5	,	,	PUNCT
bam-6406	150	6	exercise	exercise	NOUN
bam-6406	150	7	and	and	CCONJ
bam-6406	150	8	functional	functional	ADJ
bam-6406	150	9	electrical	electrical	ADJ
bam-6406	150	10	stimulation	stimulation	NOUN
bam-6406	150	11	(	(	PUNCT
bam-6406	150	12	fes	fes	NOUN
bam-6406	150	13	)	)	PUNCT
bam-6406	150	14	greatly	greatly	ADV
bam-6406	150	15	improve	improve	VERB
bam-6406	150	16	muscle	muscle	NOUN
bam-6406	150	17	mass	mass	NOUN
bam-6406	150	18	and	and	CCONJ
bam-6406	150	19	functionality	functionality	NOUN
bam-6406	150	20	in	in	ADP
bam-6406	150	21	denervated	denervated	ADJ
bam-6406	150	22	patients	patient	NOUN
bam-6406	150	23	;	;	PUNCT
bam-6406	150	24	27,28	27,28	VERB
bam-6406	150	25	although	although	SCONJ
bam-6406	150	26	,	,	PUNCT
bam-6406	150	27	a	a	DET
bam-6406	150	28	direct	direct	ADJ
bam-6406	150	29	correlation	correlation	NOUN
bam-6406	150	30	between	between	ADP
bam-6406	150	31	treatment	treatment	NOUN
bam-6406	150	32	and	and	CCONJ
bam-6406	150	33	improved	improve	VERB
bam-6406	150	34	antioxidant	antioxidant	ADJ
bam-6406	150	35	defense	defense	NOUN
bam-6406	150	36	has	have	AUX
bam-6406	150	37	established	establish	VERB
bam-6406	150	38	only	only	ADV
bam-6406	150	39	for	for	ADP
bam-6406	150	40	physical	physical	ADJ
bam-6406	150	41	activity	activity	NOUN
bam-6406	150	42	,	,	PUNCT
bam-6406	150	43	while	while	SCONJ
bam-6406	150	44	fes	fes	NOUN
bam-6406	150	45	stimulus	stimulus	NOUN
bam-6406	150	46	is	be	AUX
bam-6406	150	47	insufficient	insufficient	ADJ
bam-6406	150	48	to	to	PART
bam-6406	150	49	change	change	VERB
bam-6406	150	50	oxidative	oxidative	ADJ
bam-6406	150	51	status	status	NOUN
bam-6406	150	52	on	on	ADP
bam-6406	150	53	denervated	denervate	VERB
bam-6406	150	54	muscles	muscle	NOUN
bam-6406	150	55	.	.	PUNCT
bam-6406	151	1	29,30	29,30	NUM
bam-6406	151	2	here	here	ADV
bam-6406	151	3	we	we	PRON
bam-6406	151	4	showed	show	VERB
bam-6406	151	5	that	that	SCONJ
bam-6406	151	6	the	the	DET
bam-6406	151	7	expression	expression	NOUN
bam-6406	151	8	of	of	ADP
bam-6406	151	9	antioxidant	antioxidant	ADJ
bam-6406	151	10	genes	gene	NOUN
bam-6406	151	11	increased	increase	VERB
bam-6406	151	12	quickly	quickly	ADV
bam-6406	151	13	following	follow	VERB
bam-6406	151	14	denervation	denervation	NOUN
bam-6406	151	15	,	,	PUNCT
bam-6406	151	16	suggesting	suggest	VERB
bam-6406	151	17	that	that	SCONJ
bam-6406	151	18	os	os	NOUN
bam-6406	151	19	is	be	AUX
bam-6406	151	20	due	due	ADJ
bam-6406	151	21	to	to	ADP
bam-6406	151	22	ros	ros	PROPN
bam-6406	151	23	generation	generation	NOUN
bam-6406	151	24	rather	rather	ADV
bam-6406	151	25	than	than	ADP
bam-6406	151	26	to	to	ADP
bam-6406	151	27	a	a	DET
bam-6406	151	28	reduced	reduce	VERB
bam-6406	151	29	antioxidant	antioxidant	ADJ
bam-6406	151	30	response	response	NOUN
bam-6406	151	31	.	.	PUNCT
bam-6406	152	1	moreover	moreover	ADV
bam-6406	152	2	,	,	PUNCT
bam-6406	152	3	distinct	distinct	ADJ
bam-6406	152	4	antioxidant	antioxidant	ADJ
bam-6406	152	5	genes	gene	NOUN
bam-6406	152	6	are	be	AUX
bam-6406	152	7	induced	induce	VERB
bam-6406	152	8	at	at	ADP
bam-6406	152	9	different	different	ADJ
bam-6406	152	10	time	time	NOUN
bam-6406	152	11	points	point	NOUN
bam-6406	152	12	and	and	CCONJ
bam-6406	152	13	with	with	ADP
bam-6406	152	14	different	different	ADJ
bam-6406	152	15	kinetics	kinetic	NOUN
bam-6406	152	16	,	,	PUNCT
bam-6406	152	17	probably	probably	ADV
bam-6406	152	18	due	due	ADP
bam-6406	152	19	to	to	ADP
bam-6406	152	20	the	the	DET
bam-6406	152	21	different	different	ADJ
bam-6406	152	22	substrate	substrate	NOUN
bam-6406	152	23	specificity	specificity	NOUN
bam-6406	152	24	of	of	ADP
bam-6406	152	25	the	the	DET
bam-6406	152	26	encoded	encode	VERB
bam-6406	152	27	enzymes	enzyme	NOUN
bam-6406	152	28	.	.	PUNCT
bam-6406	153	1	31	31	NUM
bam-6406	154	1	the	the	DET
bam-6406	154	2	principal	principal	ADJ
bam-6406	154	3	source	source	NOUN
bam-6406	154	4	of	of	ADP
bam-6406	154	5	ros	ros	PROPN
bam-6406	154	6	in	in	ADP
bam-6406	154	7	eukaryotic	eukaryotic	ADJ
bam-6406	154	8	cells	cell	NOUN
bam-6406	154	9	are	be	AUX
bam-6406	154	10	mitochondria	mitochondria	NOUN
bam-6406	154	11	.	.	PUNCT
bam-6406	155	1	denervation	denervation	NOUN
bam-6406	155	2	induces	induce	VERB
bam-6406	155	3	a	a	DET
bam-6406	155	4	rapid	rapid	ADJ
bam-6406	155	5	decrease	decrease	NOUN
bam-6406	155	6	in	in	ADP
bam-6406	155	7	muscle	muscle	NOUN
bam-6406	155	8	mitochondrial	mitochondrial	ADJ
bam-6406	155	9	content	content	NOUN
bam-6406	155	10	32	32	NUM
bam-6406	155	11	and	and	CCONJ
bam-6406	155	12	an	an	DET
bam-6406	155	13	unbalance	unbalance	NOUN
bam-6406	155	14	in	in	ADP
bam-6406	155	15	mitochondrial	mitochondrial	ADJ
bam-6406	155	16	ros	ros	PROPN
bam-6406	155	17	production	production	NOUN
bam-6406	155	18	.	.	PUNCT
bam-6406	156	1	33	33	NUM
bam-6406	156	2	moreover	moreover	ADV
bam-6406	156	3	,	,	PUNCT
bam-6406	156	4	numerous	numerous	ADJ
bam-6406	156	5	enzymes	enzyme	NOUN
bam-6406	156	6	can	can	AUX
bam-6406	156	7	also	also	ADV
bam-6406	156	8	generate	generate	VERB
bam-6406	156	9	ros	ros	PROPN
bam-6406	156	10	,	,	PUNCT
bam-6406	156	11	including	include	VERB
bam-6406	156	12	nadph	nadph	ADJ
bam-6406	156	13	oxidases	oxidase	NOUN
bam-6406	156	14	,	,	PUNCT
bam-6406	156	15	cyclooxygenases	cyclooxygenase	NOUN
bam-6406	156	16	,	,	PUNCT
bam-6406	156	17	lipoxygenases	lipoxygenase	NOUN
bam-6406	156	18	and	and	CCONJ
bam-6406	156	19	no	no	DET
bam-6406	156	20	synthases	synthase	NOUN
bam-6406	156	21	.	.	PUNCT
bam-6406	157	1	34	34	NUM
bam-6406	157	2	we	we	PRON
bam-6406	157	3	found	find	VERB
bam-6406	157	4	an	an	DET
bam-6406	157	5	increase	increase	NOUN
bam-6406	157	6	in	in	ADP
bam-6406	157	7	the	the	DET
bam-6406	157	8	expression	expression	NOUN
bam-6406	157	9	of	of	ADP
bam-6406	157	10	fig	fig	NOUN
bam-6406	157	11	3	3	NUM
bam-6406	157	12	.	.	PUNCT
bam-6406	157	13	oxidative	oxidative	ADJ
bam-6406	157	14	stress	stress	NOUN
bam-6406	157	15	does	do	AUX
bam-6406	157	16	not	not	PART
bam-6406	157	17	induce	induce	VERB
bam-6406	157	18	cellular	cellular	ADJ
bam-6406	157	19	damage	damage	NOUN
bam-6406	157	20	in	in	ADP
bam-6406	157	21	skeletal	skeletal	ADJ
bam-6406	157	22	muscle	muscle	NOUN
bam-6406	157	23	following	follow	VERB
bam-6406	157	24	denervation	denervation	NOUN
bam-6406	157	25	.	.	PUNCT
bam-6406	158	1	(	(	PUNCT
bam-6406	158	2	a	a	X
bam-6406	158	3	)	)	PUNCT
bam-6406	158	4	protein	protein	NOUN
bam-6406	158	5	carbonyl	carbonyl	NOUN
bam-6406	158	6	content	content	NOUN
bam-6406	158	7	relative	relative	ADJ
bam-6406	158	8	to	to	ADP
bam-6406	158	9	contralateral	contralateral	ADJ
bam-6406	158	10	muscles	muscle	NOUN
bam-6406	158	11	,	,	PUNCT
bam-6406	158	12	seven	seven	NUM
bam-6406	158	13	days	day	NOUN
bam-6406	158	14	following	follow	VERB
bam-6406	158	15	denervation	denervation	NOUN
bam-6406	158	16	.	.	PUNCT
bam-6406	159	1	n	n	NOUN
bam-6406	159	2	=	=	SYM
bam-6406	159	3	3	3	X
bam-6406	159	4	.	.	PUNCT
bam-6406	159	5	(	(	PUNCT
bam-6406	159	6	b	b	X
bam-6406	159	7	)	)	PUNCT
bam-6406	159	8	western	western	ADJ
bam-6406	159	9	blotting	blotting	ADJ
bam-6406	159	10	analyses	analysis	NOUN
bam-6406	159	11	for	for	ADP
bam-6406	159	12	4	4	NUM
bam-6406	159	13	-	-	PUNCT
bam-6406	159	14	hne	hne	NOUN
bam-6406	159	15	in	in	ADP
bam-6406	159	16	contralateral	contralateral	ADJ
bam-6406	159	17	and	and	CCONJ
bam-6406	159	18	denervated	denervated	ADJ
bam-6406	159	19	muscles	muscle	NOUN
bam-6406	159	20	,	,	PUNCT
bam-6406	159	21	7	7	NUM
bam-6406	159	22	days	day	NOUN
bam-6406	159	23	following	follow	VERB
bam-6406	159	24	denervation	denervation	NOUN
bam-6406	159	25	.	.	PUNCT
bam-6406	160	1	gapdh	gapdh	NOUN
bam-6406	160	2	was	be	AUX
bam-6406	160	3	used	use	VERB
bam-6406	160	4	as	as	ADP
bam-6406	160	5	loading	loading	NOUN
bam-6406	160	6	control	control	NOUN
bam-6406	160	7	.	.	PUNCT
bam-6406	161	1	muscle	muscle	NOUN
bam-6406	161	2	denervation	denervation	NOUN
bam-6406	161	3	atrophy	atrophy	NOUN
bam-6406	161	4	is	be	AUX
bam-6406	161	5	not	not	PART
bam-6406	161	6	related	relate	VERB
bam-6406	161	7	to	to	PART
bam-6406	161	8	oxidative	oxidative	VERB
bam-6406	161	9	stress	stress	NOUN
bam-6406	161	10	eur	eur	PROPN
bam-6406	161	11	j	j	PROPN
bam-6406	161	12	transl	transl	PROPN
bam-6406	161	13	myol	myol	NOUN
bam-6406	161	14	2017	2017	NUM
bam-6406	161	15	;	;	PUNCT
bam-6406	161	16	27	27	NUM
bam-6406	161	17	(	(	PUNCT
bam-6406	161	18	1	1	NUM
bam-6406	161	19	):	):	PUNCT
bam-6406	161	20	43	43	NUM
bam-6406	161	21	-	-	SYM
bam-6406	161	22	50	50	NUM
bam-6406	161	23	48	48	NUM
bam-6406	161	24	cybb	cybb	NOUN
bam-6406	161	25	,	,	PUNCT
bam-6406	161	26	a	a	DET
bam-6406	161	27	subunit	subunit	NOUN
bam-6406	161	28	of	of	ADP
bam-6406	161	29	nadph	nadph	ADJ
bam-6406	161	30	oxidase	oxidase	NOUN
bam-6406	161	31	,	,	PUNCT
bam-6406	161	32	starting	start	VERB
bam-6406	161	33	at	at	ADP
bam-6406	161	34	three	three	NUM
bam-6406	161	35	days	day	NOUN
bam-6406	161	36	after	after	ADP
bam-6406	161	37	denervation	denervation	NOUN
bam-6406	161	38	,	,	PUNCT
bam-6406	161	39	accompanied	accompany	VERB
bam-6406	161	40	by	by	ADP
bam-6406	161	41	a	a	DET
bam-6406	161	42	timedependent	timedependent	NOUN
bam-6406	161	43	increase	increase	NOUN
bam-6406	161	44	in	in	ADP
bam-6406	161	45	nfκb	nfκb	ADJ
bam-6406	161	46	activation	activation	NOUN
bam-6406	161	47	.	.	PUNCT
bam-6406	162	1	these	these	DET
bam-6406	162	2	findings	finding	NOUN
bam-6406	162	3	suggest	suggest	VERB
bam-6406	162	4	that	that	SCONJ
bam-6406	162	5	nfκb	nfκb	NOUN
bam-6406	162	6	might	might	AUX
bam-6406	162	7	be	be	AUX
bam-6406	162	8	responsible	responsible	ADJ
bam-6406	162	9	,	,	PUNCT
bam-6406	162	10	at	at	ADP
bam-6406	162	11	least	least	ADJ
bam-6406	162	12	in	in	ADP
bam-6406	162	13	part	part	NOUN
bam-6406	162	14	,	,	PUNCT
bam-6406	162	15	for	for	ADP
bam-6406	162	16	ros	ros	PROPN
bam-6406	162	17	generation	generation	NOUN
bam-6406	162	18	in	in	ADP
bam-6406	162	19	denervated	denervate	VERB
bam-6406	162	20	muscles	muscle	NOUN
bam-6406	162	21	.	.	PUNCT
bam-6406	163	1	while	while	SCONJ
bam-6406	163	2	there	there	PRON
bam-6406	163	3	was	be	VERB
bam-6406	163	4	a	a	DET
bam-6406	163	5	clear	clear	ADJ
bam-6406	163	6	activation	activation	NOUN
bam-6406	163	7	of	of	ADP
bam-6406	163	8	the	the	DET
bam-6406	163	9	response	response	NOUN
bam-6406	163	10	to	to	ADP
bam-6406	163	11	os	os	VERB
bam-6406	163	12	,	,	PUNCT
bam-6406	163	13	no	no	DET
bam-6406	163	14	osdependent	osdependent	ADJ
bam-6406	163	15	damage	damage	NOUN
bam-6406	163	16	was	be	AUX
bam-6406	163	17	detected	detect	VERB
bam-6406	163	18	upon	upon	SCONJ
bam-6406	163	19	denervation	denervation	NOUN
bam-6406	163	20	,	,	PUNCT
bam-6406	163	21	such	such	ADJ
bam-6406	163	22	as	as	ADP
bam-6406	163	23	high	high	ADJ
bam-6406	163	24	levels	level	NOUN
bam-6406	163	25	of	of	ADP
bam-6406	163	26	carbonyl	carbonyl	NOUN
bam-6406	163	27	groups	group	NOUN
bam-6406	163	28	and	and	CCONJ
bam-6406	163	29	lipid	lipid	NOUN
bam-6406	163	30	peroxidation	peroxidation	NOUN
bam-6406	163	31	.	.	PUNCT
bam-6406	164	1	therefore	therefore	ADV
bam-6406	164	2	,	,	PUNCT
bam-6406	164	3	it	it	PRON
bam-6406	164	4	seems	seem	VERB
bam-6406	164	5	likely	likely	ADJ
bam-6406	164	6	that	that	SCONJ
bam-6406	164	7	denervation	denervation	NOUN
bam-6406	164	8	triggers	trigger	VERB
bam-6406	164	9	os	os	ADV
bam-6406	164	10	above	above	ADP
bam-6406	164	11	the	the	DET
bam-6406	164	12	“	"	PUNCT
bam-6406	164	13	harmful	harmful	ADJ
bam-6406	164	14	threshold	threshold	NOUN
bam-6406	164	15	”	"	PUNCT
bam-6406	164	16	in	in	ADP
bam-6406	164	17	skeletal	skeletal	ADJ
bam-6406	164	18	muscle	muscle	NOUN
bam-6406	164	19	.	.	PUNCT
bam-6406	165	1	20	20	NUM
bam-6406	165	2	to	to	PART
bam-6406	165	3	test	test	VERB
bam-6406	165	4	if	if	SCONJ
bam-6406	165	5	os	os	NOUN
bam-6406	165	6	play	play	VERB
bam-6406	165	7	a	a	DET
bam-6406	165	8	direct	direct	ADJ
bam-6406	165	9	role	role	NOUN
bam-6406	165	10	in	in	ADP
bam-6406	165	11	the	the	DET
bam-6406	165	12	induction	induction	NOUN
bam-6406	165	13	of	of	ADP
bam-6406	165	14	muscle	muscle	NOUN
bam-6406	165	15	atrophy	atrophy	NOUN
bam-6406	165	16	,	,	PUNCT
bam-6406	165	17	we	we	PRON
bam-6406	165	18	treated	treat	VERB
bam-6406	165	19	mice	mouse	NOUN
bam-6406	165	20	with	with	ADP
bam-6406	165	21	antioxidant	antioxidant	ADJ
bam-6406	165	22	drugs	drug	NOUN
bam-6406	165	23	,	,	PUNCT
bam-6406	165	24	trolox	trolox	NOUN
bam-6406	165	25	or	or	CCONJ
bam-6406	165	26	resveratrol	resveratrol	NOUN
bam-6406	165	27	,	,	PUNCT
bam-6406	165	28	daily	daily	ADV
bam-6406	165	29	,	,	PUNCT
bam-6406	165	30	for	for	ADP
bam-6406	165	31	four	four	NUM
bam-6406	165	32	weeks	week	NOUN
bam-6406	165	33	after	after	ADP
bam-6406	165	34	denervation	denervation	NOUN
bam-6406	165	35	.	.	PUNCT
bam-6406	166	1	although	although	SCONJ
bam-6406	166	2	both	both	DET
bam-6406	166	3	treatments	treatment	NOUN
bam-6406	166	4	reduced	reduce	VERB
bam-6406	166	5	os	os	NOUN
bam-6406	166	6	levels	level	NOUN
bam-6406	166	7	in	in	ADP
bam-6406	166	8	skeletal	skeletal	ADJ
bam-6406	166	9	muscle	muscle	NOUN
bam-6406	166	10	,	,	PUNCT
bam-6406	166	11	the	the	DET
bam-6406	166	12	reduction	reduction	NOUN
bam-6406	166	13	of	of	ADP
bam-6406	166	14	muscle	muscle	NOUN
bam-6406	166	15	mass	mass	NOUN
bam-6406	166	16	was	be	AUX
bam-6406	166	17	not	not	PART
bam-6406	166	18	affected	affect	VERB
bam-6406	166	19	by	by	ADP
bam-6406	166	20	the	the	DET
bam-6406	166	21	drugs	drug	NOUN
bam-6406	166	22	,	,	PUNCT
bam-6406	166	23	indicating	indicate	VERB
bam-6406	166	24	that	that	SCONJ
bam-6406	166	25	neurogenic	neurogenic	ADJ
bam-6406	166	26	muscle	muscle	NOUN
bam-6406	166	27	atrophy	atrophy	NOUN
bam-6406	166	28	does	do	AUX
bam-6406	166	29	not	not	PART
bam-6406	166	30	depend	depend	VERB
bam-6406	166	31	on	on	ADP
bam-6406	166	32	os	os	PROPN
bam-6406	166	33	.	.	PUNCT
bam-6406	166	34	similar	similar	ADJ
bam-6406	166	35	conclusions	conclusion	NOUN
bam-6406	166	36	were	be	AUX
bam-6406	166	37	drawn	draw	VERB
bam-6406	166	38	from	from	ADP
bam-6406	166	39	several	several	ADJ
bam-6406	166	40	studies	study	NOUN
bam-6406	166	41	performed	perform	VERB
bam-6406	166	42	on	on	ADP
bam-6406	166	43	murine	murine	ADJ
bam-6406	166	44	models	model	NOUN
bam-6406	166	45	of	of	ADP
bam-6406	166	46	disuse	disuse	NOUN
bam-6406	166	47	muscle	muscle	NOUN
bam-6406	166	48	atrophy	atrophy	NOUN
bam-6406	166	49	,	,	PUNCT
bam-6406	166	50	where	where	SCONJ
bam-6406	166	51	trolox	trolox	PROPN
bam-6406	166	52	treatment	treatment	NOUN
bam-6406	166	53	failed	fail	VERB
bam-6406	166	54	to	to	PART
bam-6406	166	55	protect	protect	VERB
bam-6406	166	56	against	against	ADP
bam-6406	166	57	muscle	muscle	NOUN
bam-6406	166	58	mass	mass	NOUN
bam-6406	166	59	loss	loss	NOUN
bam-6406	166	60	.	.	PUNCT
bam-6406	167	1	35	35	NUM
bam-6406	167	2	-	-	SYM
bam-6406	167	3	37	37	NUM
bam-6406	167	4	in	in	ADP
bam-6406	167	5	conclusion	conclusion	NOUN
bam-6406	167	6	,	,	PUNCT
bam-6406	167	7	our	our	PRON
bam-6406	167	8	study	study	NOUN
bam-6406	167	9	clarifies	clarify	VERB
bam-6406	167	10	the	the	DET
bam-6406	167	11	kinetics	kinetic	NOUN
bam-6406	167	12	of	of	ADP
bam-6406	167	13	activation	activation	NOUN
bam-6406	167	14	of	of	ADP
bam-6406	167	15	os	os	ADJ
bam-6406	167	16	response	response	NOUN
bam-6406	167	17	in	in	ADP
bam-6406	167	18	denervated	denervate	VERB
bam-6406	167	19	skeletal	skeletal	ADJ
bam-6406	167	20	muscle	muscle	NOUN
bam-6406	167	21	.	.	PUNCT
bam-6406	168	1	despite	despite	SCONJ
bam-6406	168	2	the	the	DET
bam-6406	168	3	increase	increase	NOUN
bam-6406	168	4	,	,	PUNCT
bam-6406	168	5	os	os	NOUN
bam-6406	168	6	does	do	AUX
bam-6406	168	7	not	not	PART
bam-6406	168	8	lead	lead	VERB
bam-6406	168	9	to	to	ADP
bam-6406	168	10	skeletal	skeletal	ADJ
bam-6406	168	11	muscle	muscle	NOUN
bam-6406	168	12	damage	damage	NOUN
bam-6406	168	13	and	and	CCONJ
bam-6406	168	14	does	do	AUX
bam-6406	168	15	not	not	PART
bam-6406	168	16	cause	cause	VERB
bam-6406	168	17	muscle	muscle	NOUN
bam-6406	168	18	atrophy	atrophy	NOUN
bam-6406	168	19	in	in	ADP
bam-6406	168	20	response	response	NOUN
bam-6406	168	21	to	to	ADP
bam-6406	168	22	denervation	denervation	NOUN
bam-6406	168	23	.	.	PUNCT
bam-6406	169	1	delineation	delineation	NOUN
bam-6406	169	2	of	of	ADP
bam-6406	169	3	the	the	DET
bam-6406	169	4	kinetics	kinetic	NOUN
bam-6406	169	5	of	of	ADP
bam-6406	169	6	activation	activation	NOUN
bam-6406	169	7	of	of	ADP
bam-6406	169	8	the	the	DET
bam-6406	169	9	molecular	molecular	ADJ
bam-6406	169	10	pathways	pathway	NOUN
bam-6406	169	11	triggered	trigger	VERB
bam-6406	169	12	by	by	ADP
bam-6406	169	13	the	the	DET
bam-6406	169	14	loss	loss	NOUN
bam-6406	169	15	of	of	ADP
bam-6406	169	16	motor	motor	NOUN
bam-6406	169	17	neurons	neuron	NOUN
bam-6406	169	18	and	and	CCONJ
bam-6406	169	19	their	their	PRON
bam-6406	169	20	relative	relative	ADJ
bam-6406	169	21	importance	importance	NOUN
bam-6406	169	22	in	in	ADP
bam-6406	169	23	the	the	DET
bam-6406	169	24	activation	activation	NOUN
bam-6406	169	25	of	of	ADP
bam-6406	169	26	the	the	DET
bam-6406	169	27	catabolic	catabolic	ADJ
bam-6406	169	28	pathways	pathway	NOUN
bam-6406	169	29	,	,	PUNCT
bam-6406	169	30	responsible	responsible	ADJ
bam-6406	169	31	of	of	ADP
bam-6406	169	32	skeletal	skeletal	ADJ
bam-6406	169	33	muscle	muscle	NOUN
bam-6406	169	34	atrophy	atrophy	NOUN
bam-6406	169	35	,	,	PUNCT
bam-6406	169	36	is	be	AUX
bam-6406	169	37	a	a	DET
bam-6406	169	38	prerequisite	prerequisite	NOUN
bam-6406	169	39	for	for	ADP
bam-6406	169	40	developing	develop	VERB
bam-6406	169	41	more	more	ADV
bam-6406	169	42	appropriate	appropriate	ADJ
bam-6406	169	43	drugs	drug	NOUN
bam-6406	169	44	to	to	PART
bam-6406	169	45	treat	treat	VERB
bam-6406	169	46	neurogenic	neurogenic	ADJ
bam-6406	169	47	muscle	muscle	NOUN
bam-6406	169	48	atrophy	atrophy	NOUN
bam-6406	169	49	.	.	PUNCT
bam-6406	170	1	author	author	NOUN
bam-6406	170	2	’s	’s	PART
bam-6406	170	3	contributions	contribution	NOUN
bam-6406	170	4	conception	conception	NOUN
bam-6406	170	5	of	of	ADP
bam-6406	170	6	the	the	DET
bam-6406	170	7	work	work	NOUN
bam-6406	170	8	:	:	PUNCT
bam-6406	170	9	vm	vm	NOUN
bam-6406	170	10	,	,	PUNCT
bam-6406	170	11	ib	ib	PROPN
bam-6406	170	12	.	.	PROPN
bam-6406	170	13	acquisition	acquisition	PROPN
bam-6406	170	14	,	,	PUNCT
bam-6406	170	15	analysis	analysis	NOUN
bam-6406	170	16	,	,	PUNCT
bam-6406	170	17	and	and	CCONJ
bam-6406	170	18	interpretation	interpretation	NOUN
bam-6406	170	19	of	of	ADP
bam-6406	170	20	data	data	PROPN
bam-6406	170	21	:	:	PUNCT
bam-6406	170	22	ep	ep	PROPN
bam-6406	170	23	,	,	PUNCT
bam-6406	170	24	eg	eg	PROPN
bam-6406	170	25	,	,	PUNCT
bam-6406	170	26	gm	gm	PROPN
bam-6406	170	27	,	,	PUNCT
bam-6406	170	28	sg	sg	PROPN
bam-6406	170	29	,	,	PUNCT
bam-6406	170	30	ar	ar	PROPN
bam-6406	170	31	,	,	PUNCT
bam-6406	170	32	rm	rm	PROPN
bam-6406	170	33	,	,	PUNCT
bam-6406	170	34	sa	sa	PROPN
bam-6406	170	35	,	,	PUNCT
bam-6406	170	36	ib	ib	PROPN
bam-6406	170	37	and	and	CCONJ
bam-6406	170	38	vm	vm	PROPN
bam-6406	170	39	.	.	PROPN
bam-6406	170	40	drafting	draft	VERB
bam-6406	170	41	the	the	DET
bam-6406	170	42	manuscript	manuscript	NOUN
bam-6406	170	43	and	and	CCONJ
bam-6406	170	44	critically	critically	ADV
bam-6406	170	45	revising	revise	VERB
bam-6406	170	46	it	it	PRON
bam-6406	170	47	for	for	ADP
bam-6406	170	48	important	important	ADJ
bam-6406	170	49	intellectual	intellectual	ADJ
bam-6406	170	50	content	content	NOUN
bam-6406	170	51	:	:	PUNCT
bam-6406	170	52	ep	ep	PROPN
bam-6406	170	53	,	,	PUNCT
bam-6406	170	54	eg	eg	NOUN
bam-6406	170	55	,	,	PUNCT
bam-6406	170	56	vm	vm	PROPN
bam-6406	170	57	,	,	PUNCT
bam-6406	170	58	sa	sa	PROPN
bam-6406	170	59	,	,	PUNCT
bam-6406	170	60	rm	rm	PROPN
bam-6406	170	61	,	,	PUNCT
bam-6406	170	62	am	be	AUX
bam-6406	170	63	,	,	PUNCT
bam-6406	170	64	sf	sf	PROPN
bam-6406	170	65	and	and	CCONJ
bam-6406	170	66	ib	ib	INTJ
bam-6406	170	67	.	.	PUNCT
bam-6406	171	1	all	all	DET
bam-6406	171	2	authors	author	NOUN
bam-6406	171	3	approved	approve	VERB
bam-6406	171	4	the	the	DET
bam-6406	171	5	final	final	ADJ
bam-6406	171	6	version	version	NOUN
bam-6406	171	7	of	of	ADP
bam-6406	171	8	the	the	DET
bam-6406	171	9	manuscript	manuscript	NOUN
bam-6406	171	10	and	and	CCONJ
bam-6406	171	11	agree	agree	VERB
bam-6406	171	12	to	to	PART
bam-6406	171	13	be	be	AUX
bam-6406	171	14	accountable	accountable	ADJ
bam-6406	171	15	for	for	ADP
bam-6406	171	16	all	all	DET
bam-6406	171	17	aspects	aspect	NOUN
bam-6406	171	18	of	of	ADP
bam-6406	171	19	the	the	DET
bam-6406	171	20	work	work	NOUN
bam-6406	171	21	in	in	ADP
bam-6406	171	22	ensuring	ensure	VERB
bam-6406	171	23	that	that	SCONJ
bam-6406	171	24	questions	question	NOUN
bam-6406	171	25	related	relate	VERB
bam-6406	171	26	to	to	ADP
bam-6406	171	27	the	the	DET
bam-6406	171	28	accuracy	accuracy	NOUN
bam-6406	171	29	or	or	CCONJ
bam-6406	171	30	integrity	integrity	NOUN
bam-6406	171	31	of	of	ADP
bam-6406	171	32	any	any	DET
bam-6406	171	33	part	part	NOUN
bam-6406	171	34	of	of	ADP
bam-6406	171	35	the	the	DET
bam-6406	171	36	work	work	NOUN
bam-6406	171	37	are	be	AUX
bam-6406	171	38	appropriately	appropriately	ADV
bam-6406	171	39	investigated	investigate	VERB
bam-6406	171	40	and	and	CCONJ
bam-6406	171	41	resolved	resolve	VERB
bam-6406	171	42	.	.	PUNCT
bam-6406	172	1	fig	fig	NOUN
bam-6406	172	2	4	4	NUM
bam-6406	172	3	.	.	PUNCT
bam-6406	173	1	trolox	trolox	PROPN
bam-6406	173	2	does	do	AUX
bam-6406	173	3	not	not	PART
bam-6406	173	4	prevent	prevent	VERB
bam-6406	173	5	neurogenic	neurogenic	ADJ
bam-6406	173	6	muscle	muscle	NOUN
bam-6406	173	7	atrophy	atrophy	NOUN
bam-6406	173	8	.	.	PUNCT
bam-6406	174	1	(	(	PUNCT
bam-6406	174	2	a	a	X
bam-6406	174	3	)	)	PUNCT
bam-6406	174	4	western	western	ADJ
bam-6406	174	5	blotting	blot	VERB
bam-6406	174	6	analyses	analysis	NOUN
bam-6406	174	7	and	and	CCONJ
bam-6406	174	8	(	(	PUNCT
bam-6406	174	9	b	b	NOUN
bam-6406	174	10	)	)	PUNCT
bam-6406	174	11	densitometry	densitometry	NOUN
bam-6406	174	12	of	of	ADP
bam-6406	174	13	cybb	cybb	PROPN
bam-6406	174	14	of	of	ADP
bam-6406	174	15	vehicle	vehicle	NOUN
bam-6406	174	16	(	(	PUNCT
bam-6406	174	17	-	-	PUNCT
bam-6406	174	18	)	)	PUNCT
bam-6406	174	19	or	or	CCONJ
bam-6406	174	20	trolox	trolox	X
bam-6406	174	21	(	(	PUNCT
bam-6406	174	22	trx	trx	NOUN
bam-6406	174	23	)	)	PUNCT
bam-6406	174	24	treated	treat	VERB
bam-6406	174	25	mice	mouse	NOUN
bam-6406	174	26	,	,	PUNCT
bam-6406	174	27	7	7	NUM
bam-6406	174	28	days	day	NOUN
bam-6406	174	29	following	follow	VERB
bam-6406	174	30	denervation	denervation	NOUN
bam-6406	174	31	.	.	PUNCT
bam-6406	175	1	gapdh	gapdh	NOUN
bam-6406	175	2	was	be	AUX
bam-6406	175	3	used	use	VERB
bam-6406	175	4	as	as	ADP
bam-6406	175	5	loading	loading	NOUN
bam-6406	175	6	control	control	NOUN
bam-6406	175	7	.	.	PUNCT
bam-6406	176	1	values	value	NOUN
bam-6406	176	2	represent	represent	VERB
bam-6406	176	3	mean	mean	PROPN
bam-6406	176	4	±	±	NUM
bam-6406	176	5	sem	sem	NOUN
bam-6406	176	6	.	.	PUNCT
bam-6406	177	1	n	n	NOUN
bam-6406	178	1	=	=	SYM
bam-6406	178	2	2	2	NUM
bam-6406	178	3	-	-	SYM
bam-6406	178	4	4	4	NUM
bam-6406	178	5	;	;	PUNCT
bam-6406	178	6	*	*	PUNCT
bam-6406	178	7	p<0.05	p<0.05	NOUN
bam-6406	178	8	.	.	PUNCT
bam-6406	179	1	(	(	PUNCT
bam-6406	179	2	c	c	X
bam-6406	179	3	)	)	PUNCT
bam-6406	179	4	ta	ta	ADP
bam-6406	179	5	weight	weight	NOUN
bam-6406	179	6	of	of	ADP
bam-6406	179	7	vehicle	vehicle	NOUN
bam-6406	179	8	or	or	CCONJ
bam-6406	179	9	trolox	trolox	NOUN
bam-6406	179	10	treated	treat	VERB
bam-6406	179	11	contralateral	contralateral	ADJ
bam-6406	179	12	and	and	CCONJ
bam-6406	179	13	denervated	denervated	ADJ
bam-6406	179	14	muscles	muscle	NOUN
bam-6406	179	15	,	,	PUNCT
bam-6406	179	16	14	14	NUM
bam-6406	179	17	and	and	CCONJ
bam-6406	179	18	28	28	NUM
bam-6406	179	19	days	day	NOUN
bam-6406	179	20	following	follow	VERB
bam-6406	179	21	denervation	denervation	NOUN
bam-6406	179	22	,	,	PUNCT
bam-6406	179	23	relative	relative	ADJ
bam-6406	179	24	to	to	ADP
bam-6406	179	25	contralateral	contralateral	ADJ
bam-6406	179	26	muscles	muscle	NOUN
bam-6406	179	27	of	of	ADP
bam-6406	179	28	vehicle	vehicle	NOUN
bam-6406	179	29	-	-	PUNCT
bam-6406	179	30	treated	treat	VERB
bam-6406	179	31	mice	mouse	NOUN
bam-6406	179	32	.	.	PUNCT
bam-6406	180	1	values	value	NOUN
bam-6406	180	2	represent	represent	VERB
bam-6406	180	3	mean	mean	PROPN
bam-6406	180	4	±	±	NUM
bam-6406	180	5	sem	sem	NOUN
bam-6406	180	6	.	.	PUNCT
bam-6406	181	1	n	n	PROPN
bam-6406	181	2	=	=	SYM
bam-6406	181	3	3	3	X
bam-6406	181	4	.	.	X
bam-6406	182	1	*	*	PUNCT
bam-6406	182	2	*	*	PUNCT
bam-6406	182	3	p<0.01	p<0.01	PROPN
bam-6406	182	4	.	.	PUNCT
bam-6406	183	1	(	(	PUNCT
bam-6406	183	2	d	d	X
bam-6406	183	3	)	)	PUNCT
bam-6406	183	4	representative	representative	ADJ
bam-6406	183	5	histology	histology	NOUN
bam-6406	183	6	of	of	ADP
bam-6406	183	7	vehicle	vehicle	NOUN
bam-6406	183	8	or	or	CCONJ
bam-6406	183	9	trolox	trolox	NOUN
bam-6406	183	10	treated	treat	VERB
bam-6406	183	11	contralateral	contralateral	ADJ
bam-6406	183	12	and	and	CCONJ
bam-6406	183	13	denervated	denervated	ADJ
bam-6406	183	14	muscles	muscle	NOUN
bam-6406	183	15	,	,	PUNCT
bam-6406	183	16	14	14	NUM
bam-6406	183	17	and	and	CCONJ
bam-6406	183	18	28	28	NUM
bam-6406	183	19	days	day	NOUN
bam-6406	183	20	following	follow	VERB
bam-6406	183	21	denervation	denervation	NOUN
bam-6406	183	22	.	.	PUNCT
bam-6406	184	1	scale	scale	NOUN
bam-6406	184	2	bar	bar	NOUN
bam-6406	184	3	=	=	SYM
bam-6406	184	4	50μm	50μm	NOUN
bam-6406	184	5	.	.	PUNCT
bam-6406	185	1	muscle	muscle	NOUN
bam-6406	185	2	denervation	denervation	NOUN
bam-6406	185	3	atrophy	atrophy	NOUN
bam-6406	185	4	is	be	AUX
bam-6406	185	5	not	not	PART
bam-6406	185	6	related	relate	VERB
bam-6406	185	7	to	to	PART
bam-6406	185	8	oxidative	oxidative	VERB
bam-6406	185	9	stress	stress	NOUN
bam-6406	185	10	eur	eur	PROPN
bam-6406	185	11	j	j	PROPN
bam-6406	185	12	transl	transl	PROPN
bam-6406	185	13	myol	myol	NOUN
bam-6406	185	14	2017	2017	NUM
bam-6406	185	15	;	;	PUNCT
bam-6406	185	16	27	27	NUM
bam-6406	185	17	(	(	PUNCT
bam-6406	185	18	1	1	NUM
bam-6406	185	19	):	):	PUNCT
bam-6406	185	20	43	43	NUM
bam-6406	185	21	-	-	SYM
bam-6406	185	22	50	50	NUM
bam-6406	185	23	49	49	NUM
bam-6406	185	24	all	all	DET
bam-6406	185	25	persons	person	NOUN
bam-6406	185	26	designated	designate	VERB
bam-6406	185	27	as	as	SCONJ
bam-6406	185	28	authors	author	NOUN
bam-6406	185	29	qualify	qualify	VERB
bam-6406	185	30	for	for	ADP
bam-6406	185	31	authorship	authorship	NOUN
bam-6406	185	32	,	,	PUNCT
bam-6406	185	33	and	and	CCONJ
bam-6406	185	34	all	all	DET
bam-6406	185	35	those	those	PRON
bam-6406	185	36	who	who	PRON
bam-6406	185	37	qualify	qualify	VERB
bam-6406	185	38	for	for	ADP
bam-6406	185	39	authorship	authorship	NOUN
bam-6406	185	40	are	be	AUX
bam-6406	185	41	listed	list	VERB
bam-6406	185	42	.	.	PUNCT
bam-6406	186	1	acknowledgments	acknowledgment	NOUN
bam-6406	186	2	this	this	DET
bam-6406	186	3	work	work	NOUN
bam-6406	186	4	was	be	AUX
bam-6406	186	5	supported	support	VERB
bam-6406	186	6	by	by	ADP
bam-6406	186	7	firb	firb	PROPN
bam-6406	186	8	2012	2012	NUM
bam-6406	186	9	grant	grant	NOUN
bam-6406	186	10	(	(	PUNCT
bam-6406	186	11	rbfr12	rbfr12	NOUN
bam-6406	186	12	bumh	bumh	NOUN
bam-6406	186	13	)	)	PUNCT
bam-6406	186	14	and	and	CCONJ
bam-6406	186	15	prin	prin	PROPN
bam-6406	186	16	2012	2012	NUM
bam-6406	186	17	grant	grant	NOUN
bam-6406	186	18	(	(	PUNCT
bam-6406	186	19	2012n8yjc3	2012n8yjc3	NUM
bam-6406	186	20	)	)	PUNCT
bam-6406	186	21	from	from	ADP
bam-6406	186	22	miur	miur	NOUN
bam-6406	186	23	.	.	PUNCT
bam-6406	187	1	we	we	PRON
bam-6406	187	2	thank	thank	VERB
bam-6406	187	3	carla	carla	PROPN
bam-6406	187	4	ramina	ramina	PROPN
bam-6406	187	5	for	for	ADP
bam-6406	187	6	technical	technical	ADJ
bam-6406	187	7	assistance	assistance	NOUN
bam-6406	187	8	with	with	ADP
bam-6406	187	9	the	the	DET
bam-6406	187	10	experimental	experimental	ADJ
bam-6406	187	11	analyses	analysis	NOUN
bam-6406	187	12	.	.	PUNCT
bam-6406	188	1	conflict	conflict	NOUN
bam-6406	188	2	of	of	ADP
bam-6406	188	3	interest	interest	NOUN
bam-6406	188	4	the	the	DET
bam-6406	188	5	authors	author	NOUN
bam-6406	188	6	submit	submit	VERB
bam-6406	188	7	no	no	DET
bam-6406	188	8	conflict	conflict	NOUN
bam-6406	188	9	of	of	ADP
bam-6406	188	10	interest	interest	NOUN
bam-6406	188	11	regarding	regard	VERB
bam-6406	188	12	the	the	DET
bam-6406	188	13	publication	publication	NOUN
bam-6406	188	14	of	of	ADP
bam-6406	188	15	this	this	DET
bam-6406	188	16	article	article	NOUN
bam-6406	188	17	.	.	PUNCT
bam-6406	189	1	corresponding	correspond	VERB
bam-6406	189	2	author	author	PROPN
bam-6406	189	3	sergio	sergio	PROPN
bam-6406	189	4	adamo	adamo	PROPN
bam-6406	189	5	via	via	ADP
bam-6406	189	6	antonio	antonio	PROPN
bam-6406	189	7	scarpa	scarpa	PROPN
bam-6406	189	8	16	16	NUM
bam-6406	189	9	,	,	PUNCT
bam-6406	189	10	00161	00161	NUM
bam-6406	189	11	roma	roma	PROPN
bam-6406	189	12	t	t	PROPN
bam-6406	189	13	(	(	PUNCT
bam-6406	189	14	+39	+39	PROPN
bam-6406	189	15	)	)	PUNCT
bam-6406	189	16	06	06	NUM
bam-6406	189	17	4976	4976	NUM
bam-6406	189	18	6756	6756	NUM
bam-6406	189	19	(	(	PUNCT
bam-6406	189	20	26756	26756	NUM
bam-6406	189	21	)	)	PUNCT
bam-6406	189	22	/	/	SYM
bam-6406	189	23	3492682502	3492682502	NUM
bam-6406	189	24	f	f	X
bam-6406	189	25	(	(	PUNCT
bam-6406	189	26	+39	+39	PROPN
bam-6406	189	27	)	)	PUNCT
bam-6406	189	28	06	06	NUM
bam-6406	189	29	4462854	4462854	NUM
bam-6406	189	30	email	email	NOUN
bam-6406	189	31	:	:	PUNCT
bam-6406	189	32	sergio.adamo@uniroma1.it	sergio.adamo@uniroma1.it	NOUN
bam-6406	189	33	e	e	NOUN
bam-6406	189	34	-	-	NOUN
bam-6406	189	35	mails	mail	NOUN
bam-6406	189	36	of	of	ADP
bam-6406	189	37	coauthors	coauthor	NOUN
bam-6406	189	38	eva	eva	PROPN
bam-6406	189	39	pigna	pigna	PROPN
bam-6406	189	40	:	:	PUNCT
bam-6406	189	41	eva.pigna@uniroma1.it	eva.pigna@uniroma1.it	PROPN
bam-6406	189	42	emanuela	emanuela	PROPN
bam-6406	189	43	greco	greco	PROPN
bam-6406	189	44	:	:	PUNCT
bam-6406	189	45	emanuela.greco1505@gmail.com	emanuela.greco1505@gmail.com	PROPN
bam-6406	189	46	giulio	giulio	PROPN
bam-6406	189	47	morozzi	morozzi	NOUN
bam-6406	189	48	:	:	PUNCT
bam-6406	189	49	morozzigiulio@gmail.com	morozzigiulio@gmail.com	X
bam-6406	190	1	silvia	silvia	PROPN
bam-6406	190	2	grottelli	grottelli	PROPN
bam-6406	190	3	:	:	PUNCT
bam-6406	190	4	silvia.grottelli@unipg.it	silvia.grottelli@unipg.it	PROPN
bam-6406	190	5	alessio	alessio	PROPN
bam-6406	190	6	rotini	rotini	PROPN
bam-6406	190	7	:	:	PUNCT
bam-6406	190	8	alessio.rotini@gmail.com	alessio.rotini@gmail.com	X
bam-6406	190	9	alba	alba	PROPN
bam-6406	190	10	minelli	minelli	PROPN
bam-6406	190	11	:	:	PUNCT
bam-6406	190	12	alba.minelli@unipg.it	alba.minelli@unipg.it	PROPN
bam-6406	190	13	stefania	stefania	PROPN
bam-6406	190	14	fulle	fulle	ADV
bam-6406	190	15	:	:	PUNCT
bam-6406	190	16	sfulle@unich.it	sfulle@unich.it	PROPN
bam-6406	190	17	rosa	rosa	PROPN
bam-6406	190	18	mancinelli	mancinelli	PROPN
bam-6406	190	19	:	:	PUNCT
bam-6406	190	20	r.mancinelli@unich.it	r.mancinelli@unich.it	NUM
bam-6406	191	1	ilaria	ilaria	PROPN
bam-6406	191	2	bellezza	bellezza	PROPN
bam-6406	191	3	:	:	PUNCT
bam-6406	191	4	ilaria.bellezza@unipg.it	ilaria.bellezza@unipg.it	PROPN
bam-6406	191	5	viviana	viviana	PROPN
bam-6406	191	6	moresi	moresi	PROPN
bam-6406	191	7	:	:	PUNCT
bam-6406	191	8	viviana.moresi@uniroma1.it	viviana.moresi@uniroma1.it	NOUN
bam-6406	191	9	references	reference	NOUN
bam-6406	191	10	1	1	NUM
bam-6406	191	11	.	.	PUNCT
bam-6406	191	12	glass	glass	NOUN
bam-6406	191	13	dj	dj	NOUN
bam-6406	191	14	.	.	PUNCT
bam-6406	192	1	molecular	molecular	ADJ
bam-6406	192	2	mechanisms	mechanism	NOUN
bam-6406	192	3	modulating	modulate	VERB
bam-6406	192	4	muscle	muscle	NOUN
bam-6406	192	5	mass	mass	PROPN
bam-6406	192	6	.	.	PUNCT
bam-6406	193	1	trends	trend	NOUN
bam-6406	193	2	mol	mol	ADP
bam-6406	193	3	med	med	ADJ
bam-6406	193	4	2003;9:344	2003;9:344	PROPN
bam-6406	193	5	-	-	SYM
bam-6406	193	6	350	350	NUM
bam-6406	193	7	.	.	NOUN
bam-6406	194	1	2	2	NUM
bam-6406	194	2	.	.	X
bam-6406	195	1	fulle	fulle	PROPN
bam-6406	195	2	s	s	NOUN
bam-6406	195	3	,	,	PUNCT
bam-6406	195	4	di	di	X
bam-6406	195	5	ds	ds	NOUN
bam-6406	195	6	,	,	PUNCT
bam-6406	195	7	puglielli	puglielli	ADJ
bam-6406	195	8	c	c	NOUN
bam-6406	195	9	,	,	PUNCT
bam-6406	195	10	age	age	NOUN
bam-6406	195	11	-	-	PUNCT
bam-6406	195	12	dependent	dependent	ADJ
bam-6406	195	13	imbalance	imbalance	NOUN
bam-6406	195	14	of	of	ADP
bam-6406	195	15	the	the	DET
bam-6406	195	16	antioxidative	antioxidative	ADJ
bam-6406	195	17	system	system	NOUN
bam-6406	195	18	in	in	ADP
bam-6406	195	19	human	human	ADJ
bam-6406	195	20	satellite	satellite	NOUN
bam-6406	195	21	cells	cell	NOUN
bam-6406	195	22	.	.	PUNCT
bam-6406	196	1	exp	exp	NOUN
bam-6406	196	2	gerontol	gerontol	NOUN
bam-6406	196	3	2005	2005	NUM
bam-6406	196	4	;	;	PUNCT
bam-6406	196	5	189	189	NUM
bam-6406	196	6	-	-	SYM
bam-6406	196	7	197	197	NUM
bam-6406	196	8	.	.	PUNCT
bam-6406	197	1	3	3	X
bam-6406	197	2	.	.	X
bam-6406	197	3	powers	power	NOUN
bam-6406	197	4	sk	sk	VERB
bam-6406	197	5	,	,	PUNCT
bam-6406	197	6	kavazis	kavazis	NOUN
bam-6406	197	7	an	an	PRON
bam-6406	197	8	,	,	PUNCT
bam-6406	197	9	deruisseau	deruisseau	PROPN
bam-6406	197	10	kc	kc	PROPN
bam-6406	197	11	.	.	PUNCT
bam-6406	197	12	mechanisms	mechanism	NOUN
bam-6406	197	13	of	of	ADP
bam-6406	197	14	disuse	disuse	NOUN
bam-6406	197	15	muscle	muscle	NOUN
bam-6406	197	16	atrophy	atrophy	NOUN
bam-6406	197	17	:	:	PUNCT
bam-6406	197	18	role	role	NOUN
bam-6406	197	19	of	of	ADP
bam-6406	197	20	oxidative	oxidative	ADJ
bam-6406	197	21	stress	stress	NOUN
bam-6406	197	22	.	.	PUNCT
bam-6406	198	1	am	be	AUX
bam-6406	198	2	j	j	PROPN
bam-6406	198	3	physiol	physiol	PROPN
bam-6406	198	4	regul	regul	PROPN
bam-6406	198	5	integr	integr	PROPN
bam-6406	198	6	comp	comp	PROPN
bam-6406	198	7	physiol	physiol	PROPN
bam-6406	198	8	2005	2005	NUM
bam-6406	198	9	;	;	PUNCT
bam-6406	198	10	r337	r337	PROPN
bam-6406	198	11	-	-	PUNCT
bam-6406	198	12	r344	r344	PROPN
bam-6406	198	13	.	.	PUNCT
bam-6406	199	1	4	4	NUM
bam-6406	199	2	.	.	X
bam-6406	199	3	fl	fl	PROPN
bam-6406	199	4	muller	muller	PROPN
bam-6406	199	5	,	,	PUNCT
bam-6406	199	6	w	w	PROPN
bam-6406	199	7	song	song	NOUN
bam-6406	199	8	,	,	PUNCT
bam-6406	199	9	yc	yc	PROPN
bam-6406	199	10	jang	jang	PROPN
bam-6406	199	11	,	,	PUNCT
bam-6406	199	12	et	et	PROPN
bam-6406	199	13	al	al	PROPN
bam-6406	199	14	.	.	PROPN
bam-6406	199	15	denervationinduced	denervationinduce	VERB
bam-6406	199	16	skeletal	skeletal	ADJ
bam-6406	199	17	muscle	muscle	NOUN
bam-6406	199	18	atrophy	atrophy	NOUN
bam-6406	199	19	is	be	AUX
bam-6406	199	20	associated	associate	VERB
bam-6406	199	21	with	with	ADP
bam-6406	199	22	increased	increase	VERB
bam-6406	199	23	mitochondrial	mitochondrial	ADJ
bam-6406	199	24	ros	ros	PROPN
bam-6406	199	25	production	production	NOUN
bam-6406	199	26	.	.	PUNCT
bam-6406	200	1	am	be	AUX
bam-6406	200	2	j	j	PROPN
bam-6406	200	3	physiol	physiol	PROPN
bam-6406	200	4	regul	regul	PROPN
bam-6406	200	5	integr	integr	PROPN
bam-6406	200	6	comp	comp	PROPN
bam-6406	200	7	physiol	physiol	PROPN
bam-6406	200	8	2007;293	2007;293	NUM
bam-6406	200	9	:	:	PUNCT
bam-6406	200	10	r1159	r1159	PROPN
bam-6406	200	11	-	-	PUNCT
bam-6406	200	12	r1168	r1168	PROPN
bam-6406	200	13	.	.	PROPN
bam-6406	200	14	5	5	NUM
bam-6406	200	15	.	.	X
bam-6406	201	1	moylan	moylan	PROPN
bam-6406	201	2	js	js	PROPN
bam-6406	201	3	,	,	PUNCT
bam-6406	201	4	reid	reid	PROPN
bam-6406	201	5	mb	mb	PROPN
bam-6406	201	6	.	.	PROPN
bam-6406	201	7	oxidative	oxidative	ADJ
bam-6406	201	8	stress	stress	NOUN
bam-6406	201	9	,	,	PUNCT
bam-6406	201	10	chronic	chronic	ADJ
bam-6406	201	11	disease	disease	NOUN
bam-6406	201	12	,	,	PUNCT
bam-6406	201	13	and	and	CCONJ
bam-6406	201	14	muscle	muscle	NOUN
bam-6406	201	15	wasting	waste	VERB
bam-6406	201	16	.	.	PUNCT
bam-6406	202	1	muscle	muscle	NOUN
bam-6406	202	2	nerve	nerve	NOUN
bam-6406	202	3	2007	2007	NUM
bam-6406	202	4	;	;	PUNCT
bam-6406	202	5	411	411	NUM
bam-6406	202	6	-	-	SYM
bam-6406	202	7	429	429	NUM
bam-6406	202	8	.	.	NOUN
bam-6406	203	1	6	6	NUM
bam-6406	203	2	.	.	X
bam-6406	204	1	powers	power	NOUN
bam-6406	204	2	sk	sk	VERB
bam-6406	204	3	,	,	PUNCT
bam-6406	204	4	duarte	duarte	PROPN
bam-6406	204	5	j	j	PROPN
bam-6406	204	6	,	,	PUNCT
bam-6406	204	7	kavazis	kavazis	PROPN
bam-6406	204	8	an	an	PROPN
bam-6406	204	9	,	,	PUNCT
bam-6406	204	10	talbert	talbert	PROPN
bam-6406	204	11	ee	ee	PROPN
bam-6406	204	12	.	.	PROPN
bam-6406	204	13	reactive	reactive	ADJ
bam-6406	204	14	oxygen	oxygen	NOUN
bam-6406	204	15	species	specie	NOUN
bam-6406	204	16	are	be	AUX
bam-6406	204	17	signalling	signal	VERB
bam-6406	204	18	molecules	molecule	NOUN
bam-6406	204	19	for	for	ADP
bam-6406	204	20	skeletal	skeletal	ADJ
bam-6406	204	21	muscle	muscle	NOUN
bam-6406	204	22	adaptation	adaptation	NOUN
bam-6406	204	23	.	.	PUNCT
bam-6406	205	1	exp	exp	NOUN
bam-6406	205	2	physiol	physiol	PROPN
bam-6406	205	3	2010	2010	NUM
bam-6406	205	4	;	;	PUNCT
bam-6406	205	5	1	1	NUM
bam-6406	205	6	-	-	SYM
bam-6406	205	7	9	9	NUM
bam-6406	205	8	.	.	NOUN
bam-6406	205	9	7	7	NUM
bam-6406	205	10	.	.	X
bam-6406	205	11	sandri	sandri	PROPN
bam-6406	205	12	,	,	PUNCT
bam-6406	205	13	m.	m.	NOUN
bam-6406	205	14	autophagy	autophagy	NOUN
bam-6406	205	15	in	in	ADP
bam-6406	205	16	skeletal	skeletal	ADJ
bam-6406	205	17	muscle	muscle	NOUN
bam-6406	205	18	.	.	PUNCT
bam-6406	206	1	febs	febs	PROPN
bam-6406	206	2	lett	lett	PROPN
bam-6406	206	3	.	.	PUNCT
bam-6406	207	1	2010	2010	NUM
bam-6406	207	2	;	;	PUNCT
bam-6406	207	3	1411	1411	NUM
bam-6406	207	4	-	-	SYM
bam-6406	207	5	1416	1416	NUM
bam-6406	207	6	.	.	PUNCT
bam-6406	208	1	8	8	NUM
bam-6406	208	2	.	.	PUNCT
bam-6406	209	1	nakashima	nakashima	PROPN
bam-6406	209	2	,	,	PUNCT
bam-6406	209	3	k.	k.	PROPN
bam-6406	209	4	&	&	CCONJ
bam-6406	209	5	yakabe	yakabe	PROPN
bam-6406	209	6	,	,	PUNCT
bam-6406	209	7	y.	y.	PROPN
bam-6406	209	8	ampk	ampk	PROPN
bam-6406	209	9	activation	activation	NOUN
bam-6406	209	10	stimulates	stimulate	VERB
bam-6406	209	11	myofibrillar	myofibrillar	ADJ
bam-6406	209	12	protein	protein	NOUN
bam-6406	209	13	degradation	degradation	NOUN
bam-6406	209	14	and	and	CCONJ
bam-6406	209	15	expression	expression	NOUN
bam-6406	209	16	of	of	ADP
bam-6406	209	17	atrophy	atrophy	NOUN
bam-6406	209	18	-	-	PUNCT
bam-6406	209	19	related	relate	VERB
bam-6406	209	20	ubiquitin	ubiquitin	ADJ
bam-6406	209	21	ligases	ligase	NOUN
bam-6406	209	22	by	by	ADP
bam-6406	209	23	increasing	increase	VERB
bam-6406	209	24	foxo	foxo	ADJ
bam-6406	209	25	transcription	transcription	NOUN
bam-6406	209	26	factors	factor	NOUN
bam-6406	209	27	in	in	ADP
bam-6406	209	28	c2c12	c2c12	PROPN
bam-6406	209	29	myotubes	myotube	NOUN
bam-6406	209	30	.	.	PUNCT
bam-6406	210	1	biosci	biosci	PROPN
bam-6406	210	2	.	.	PUNCT
bam-6406	211	1	biotechnol	biotechnol	PROPN
bam-6406	211	2	.	.	PUNCT
bam-6406	212	1	biochem	biochem	PROPN
bam-6406	212	2	2007	2007	NUM
bam-6406	212	3	;	;	PUNCT
bam-6406	212	4	1650	1650	NUM
bam-6406	212	5	-	-	SYM
bam-6406	212	6	1656	1656	NUM
bam-6406	212	7	.	.	PUNCT
bam-6406	213	1	9	9	NUM
bam-6406	213	2	.	.	X
bam-6406	213	3	romanello	romanello	PROPN
bam-6406	213	4	v	v	NOUN
bam-6406	213	5	,	,	PUNCT
bam-6406	213	6	guadagnin	guadagnin	ADJ
bam-6406	213	7	e	e	NOUN
bam-6406	213	8	,	,	PUNCT
bam-6406	213	9	gomes	gomes	PROPN
bam-6406	213	10	l	l	PROPN
bam-6406	213	11	,	,	PUNCT
bam-6406	213	12	et	et	PROPN
bam-6406	213	13	al	al	PROPN
bam-6406	213	14	.	.	PUNCT
bam-6406	214	1	mitochondrial	mitochondrial	ADJ
bam-6406	214	2	fission	fission	NOUN
bam-6406	214	3	and	and	CCONJ
bam-6406	214	4	remodelling	remodelling	NOUN
bam-6406	214	5	contributes	contribute	VERB
bam-6406	214	6	to	to	ADP
bam-6406	214	7	muscle	muscle	NOUN
bam-6406	214	8	atrophy	atrophy	NOUN
bam-6406	214	9	.	.	PUNCT
bam-6406	215	1	embo	embo	PROPN
bam-6406	215	2	j	j	PROPN
bam-6406	215	3	2010	2010	NUM
bam-6406	215	4	;	;	PUNCT
bam-6406	215	5	1774	1774	NUM
bam-6406	215	6	-	-	SYM
bam-6406	215	7	1785	1785	NUM
bam-6406	215	8	.	.	PUNCT
bam-6406	216	1	10	10	NUM
bam-6406	216	2	.	.	PUNCT
bam-6406	216	3	beccafico	beccafico	PROPN
bam-6406	216	4	s	s	PART
bam-6406	216	5	,	,	PUNCT
bam-6406	216	6	puglielli	puglielli	ADV
bam-6406	216	7	c	c	NOUN
bam-6406	216	8	,	,	PUNCT
bam-6406	216	9	pietrangelo	pietrangelo	PROPN
bam-6406	216	10	t	t	PROPN
bam-6406	216	11	,	,	PUNCT
bam-6406	216	12	et	et	PROPN
bam-6406	216	13	al	al	PROPN
bam-6406	216	14	.	.	PROPN
bam-6406	217	1	agedependent	agedependent	PROPN
bam-6406	217	2	effects	effect	NOUN
bam-6406	217	3	on	on	ADP
bam-6406	217	4	functional	functional	ADJ
bam-6406	217	5	aspects	aspect	NOUN
bam-6406	217	6	in	in	ADP
bam-6406	217	7	human	human	ADJ
bam-6406	217	8	satellite	satellite	NOUN
bam-6406	217	9	cells	cell	NOUN
bam-6406	217	10	.	.	PUNCT
bam-6406	218	1	ann	ann	PROPN
bam-6406	218	2	n	n	PROPN
bam-6406	218	3	y	y	PROPN
bam-6406	218	4	acad	acad	PROPN
bam-6406	218	5	sci	sci	PROPN
bam-6406	218	6	2007	2007	NUM
bam-6406	218	7	;	;	PUNCT
bam-6406	218	8	345	345	NUM
bam-6406	218	9	-	-	SYM
bam-6406	218	10	352	352	NUM
bam-6406	218	11	.	.	NOUN
bam-6406	218	12	11	11	NUM
bam-6406	218	13	.	.	PUNCT
bam-6406	219	1	bellezza	bellezza	PROPN
bam-6406	219	2	i	i	PROPN
bam-6406	219	3	,	,	PUNCT
bam-6406	219	4	mierla	mierla	PROPN
bam-6406	219	5	al	al	PROPN
bam-6406	219	6	,	,	PUNCT
bam-6406	219	7	minelli	minelli	PROPN
bam-6406	219	8	a.	a.	PROPN
bam-6406	219	9	nrf2	nrf2	PROPN
bam-6406	219	10	and	and	CCONJ
bam-6406	219	11	nfkappab	nfkappab	NOUN
bam-6406	219	12	and	and	CCONJ
bam-6406	219	13	their	their	PRON
bam-6406	219	14	concerted	concerted	ADJ
bam-6406	219	15	modulation	modulation	NOUN
bam-6406	219	16	in	in	ADP
bam-6406	219	17	cancer	cancer	NOUN
bam-6406	219	18	pathogenesis	pathogenesis	NOUN
bam-6406	219	19	and	and	CCONJ
bam-6406	219	20	progression	progression	NOUN
bam-6406	219	21	.	.	PUNCT
bam-6406	220	1	cancers	cancer	NOUN
bam-6406	220	2	(	(	PUNCT
bam-6406	220	3	basel	basel	PROPN
bam-6406	220	4	)	)	PUNCT
bam-6406	220	5	2010;483	2010;483	NUM
bam-6406	220	6	-	-	SYM
bam-6406	220	7	497	497	NUM
bam-6406	220	8	.	.	PUNCT
bam-6406	220	9	12	12	NUM
bam-6406	220	10	.	.	PUNCT
bam-6406	221	1	minelli	minelli	PROPN
bam-6406	221	2	a	a	PROPN
bam-6406	221	3	,	,	PUNCT
bam-6406	221	4	conte	conte	PROPN
bam-6406	221	5	c	c	NOUN
bam-6406	221	6	,	,	PUNCT
bam-6406	221	7	grottelli	grottelli	PROPN
bam-6406	221	8	s	s	PROPN
bam-6406	221	9	,	,	PUNCT
bam-6406	221	10	bellezza	bellezza	PROPN
bam-6406	221	11	i	i	PROPN
bam-6406	221	12	,	,	PUNCT
bam-6406	221	13	et	et	PROPN
bam-6406	221	14	al	al	PROPN
bam-6406	221	15	.	.	PUNCT
bam-6406	222	1	cyclo(his	cyclo(his	PROPN
bam-6406	222	2	-	-	PUNCT
bam-6406	222	3	pro	pro	NOUN
bam-6406	222	4	)	)	PUNCT
bam-6406	222	5	promotes	promote	VERB
bam-6406	222	6	cytoprotection	cytoprotection	NOUN
bam-6406	222	7	by	by	ADP
bam-6406	222	8	activating	activate	VERB
bam-6406	222	9	nrf2	nrf2	NOUN
bam-6406	222	10	-	-	PUNCT
bam-6406	222	11	mediated	mediate	VERB
bam-6406	222	12	up	up	NOUN
bam-6406	222	13	-	-	PUNCT
bam-6406	222	14	regulation	regulation	NOUN
bam-6406	222	15	of	of	ADP
bam-6406	222	16	antioxidant	antioxidant	ADJ
bam-6406	222	17	defence	defence	NOUN
bam-6406	222	18	.	.	PUNCT
bam-6406	223	1	j	j	PROPN
bam-6406	223	2	cell	cell	PROPN
bam-6406	223	3	mol	mol	ADP
bam-6406	223	4	med	med	PROPN
bam-6406	223	5	2009	2009	NUM
bam-6406	223	6	;	;	PUNCT
bam-6406	223	7	11491161	11491161	NUM
bam-6406	223	8	.	.	PUNCT
bam-6406	224	1	13	13	NUM
bam-6406	224	2	.	.	PUNCT
bam-6406	225	1	minelli	minelli	PROPN
bam-6406	225	2	a	a	PRON
bam-6406	225	3	,	,	PUNCT
bam-6406	225	4	bellezza	bellezza	PROPN
bam-6406	225	5	i	i	PROPN
bam-6406	225	6	,	,	PUNCT
bam-6406	225	7	tucci	tucci	PROPN
bam-6406	225	8	a.	a.	PROPN
bam-6406	225	9	differential	differential	PROPN
bam-6406	225	10	involvement	involvement	NOUN
bam-6406	225	11	of	of	ADP
bam-6406	225	12	reactive	reactive	ADJ
bam-6406	225	13	oxygen	oxygen	NOUN
bam-6406	225	14	species	specie	NOUN
bam-6406	225	15	and	and	CCONJ
bam-6406	225	16	nucleoside	nucleoside	ADJ
bam-6406	225	17	transporters	transporter	NOUN
bam-6406	225	18	in	in	ADP
bam-6406	225	19	cytotoxicity	cytotoxicity	NOUN
bam-6406	225	20	induced	induce	VERB
bam-6406	225	21	by	by	ADP
bam-6406	225	22	two	two	NUM
bam-6406	225	23	adenosine	adenosine	ADJ
bam-6406	225	24	analogues	analogue	NOUN
bam-6406	225	25	in	in	ADP
bam-6406	225	26	human	human	ADJ
bam-6406	225	27	prostate	prostate	NOUN
bam-6406	225	28	cancer	cancer	NOUN
bam-6406	225	29	cells	cell	NOUN
bam-6406	225	30	.	.	PUNCT
bam-6406	226	1	prostate	prostate	NOUN
bam-6406	226	2	2009	2009	NUM
bam-6406	226	3	;	;	PUNCT
bam-6406	226	4	538	538	NUM
bam-6406	226	5	-	-	SYM
bam-6406	226	6	547	547	NUM
bam-6406	226	7	.	.	PUNCT
bam-6406	226	8	14	14	NUM
bam-6406	226	9	.	.	PUNCT
bam-6406	227	1	niture	niture	PROPN
bam-6406	227	2	sk	sk	PROPN
bam-6406	227	3	,	,	PUNCT
bam-6406	227	4	khatri	khatri	PROPN
bam-6406	227	5	r	r	PROPN
bam-6406	227	6	,	,	PUNCT
bam-6406	227	7	jaiswal	jaiswal	PROPN
bam-6406	227	8	ak	ak	PROPN
bam-6406	227	9	.	.	PROPN
bam-6406	227	10	regulation	regulation	NOUN
bam-6406	227	11	of	of	ADP
bam-6406	227	12	nrf2	nrf2	NOUN
bam-6406	227	13	-	-	PUNCT
bam-6406	227	14	an	an	DET
bam-6406	227	15	update	update	NOUN
bam-6406	227	16	.	.	PUNCT
bam-6406	228	1	free	free	ADJ
bam-6406	228	2	radic	radic	ADJ
bam-6406	228	3	biol	biol	PROPN
bam-6406	228	4	med	me	VERB
bam-6406	228	5	2014	2014	NUM
bam-6406	228	6	;	;	PUNCT
bam-6406	228	7	36	36	NUM
bam-6406	228	8	-	-	SYM
bam-6406	228	9	44	44	NUM
bam-6406	228	10	.	.	PUNCT
bam-6406	229	1	15	15	NUM
bam-6406	229	2	.	.	PUNCT
bam-6406	230	1	abdelsalam	abdelsalam	PROPN
bam-6406	230	2	rm	rm	PROPN
bam-6406	230	3	,	,	PUNCT
bam-6406	230	4	safar	safar	PROPN
bam-6406	230	5	mm	mm	PROPN
bam-6406	230	6	.	.	PUNCT
bam-6406	230	7	neuroprotective	neuroprotective	ADJ
bam-6406	230	8	effects	effect	NOUN
bam-6406	230	9	of	of	ADP
bam-6406	230	10	vildagliptin	vildagliptin	NOUN
bam-6406	230	11	in	in	ADP
bam-6406	230	12	rat	rat	NOUN
bam-6406	230	13	rotenone	rotenone	NOUN
bam-6406	230	14	parkinson	parkinson	NOUN
bam-6406	230	15	's	's	PART
bam-6406	230	16	disease	disease	NOUN
bam-6406	230	17	model	model	NOUN
bam-6406	230	18	:	:	PUNCT
bam-6406	230	19	role	role	NOUN
bam-6406	230	20	of	of	ADP
bam-6406	230	21	rage	rage	NOUN
bam-6406	230	22	-	-	PUNCT
bam-6406	230	23	nfkappab	nfkappab	NOUN
bam-6406	230	24	and	and	CCONJ
bam-6406	230	25	nrf2	nrf2	NOUN
bam-6406	230	26	-	-	PUNCT
bam-6406	230	27	antioxidant	antioxidant	NOUN
bam-6406	230	28	signaling	signal	VERB
bam-6406	230	29	pathways	pathway	NOUN
bam-6406	230	30	.	.	PUNCT
bam-6406	231	1	j	j	PROPN
bam-6406	231	2	neurochem	neurochem	PROPN
bam-6406	231	3	2015	2015	NUM
bam-6406	231	4	;	;	PUNCT
bam-6406	231	5	700	700	NUM
bam-6406	231	6	-	-	SYM
bam-6406	231	7	707	707	NUM
bam-6406	231	8	.	.	PUNCT
bam-6406	232	1	16	16	NUM
bam-6406	232	2	.	.	PUNCT
bam-6406	233	1	huang	huang	PROPN
bam-6406	233	2	cs	cs	PROPN
bam-6406	233	3	,	,	PUNCT
bam-6406	233	4	lin	lin	PROPN
bam-6406	233	5	ah	ah	INTJ
bam-6406	233	6	,	,	PUNCT
bam-6406	233	7	yang	yang	PROPN
bam-6406	233	8	tc	tc	PROPN
bam-6406	233	9	,	,	PUNCT
bam-6406	233	10	liu	liu	PROPN
bam-6406	233	11	kl	kl	PROPN
bam-6406	233	12	,	,	PUNCT
bam-6406	234	1	chen	chen	PROPN
bam-6406	234	2	hw	hw	PROPN
bam-6406	234	3	et	et	PROPN
bam-6406	234	4	al	al	PROPN
bam-6406	234	5	.	.	PROPN
bam-6406	234	6	shikonin	shikonin	PROPN
bam-6406	234	7	inhibits	inhibits	AUX
bam-6406	234	8	oxidized	oxidize	VERB
bam-6406	234	9	ldl	ldl	NOUN
bam-6406	234	10	-	-	PUNCT
bam-6406	234	11	induced	induce	VERB
bam-6406	234	12	monocyte	monocyte	NOUN
bam-6406	234	13	adhesion	adhesion	NOUN
bam-6406	234	14	by	by	ADP
bam-6406	234	15	suppressing	suppress	VERB
bam-6406	234	16	nfkappab	nfkappab	NOUN
bam-6406	234	17	activation	activation	NOUN
bam-6406	234	18	via	via	ADP
bam-6406	234	19	up	up	ADP
bam-6406	234	20	-	-	PUNCT
bam-6406	234	21	regulation	regulation	NOUN
bam-6406	234	22	of	of	ADP
bam-6406	234	23	pi3k	pi3k	PROPN
bam-6406	234	24	/	/	SYM
bam-6406	234	25	akt	akt	PROPN
bam-6406	234	26	/	/	SYM
bam-6406	234	27	nrf2dependent	nrf2dependent	PROPN
bam-6406	234	28	antioxidation	antioxidation	NOUN
bam-6406	234	29	in	in	ADP
bam-6406	234	30	ea.hy926	ea.hy926	NOUN
bam-6406	234	31	endothelial	endothelial	ADJ
bam-6406	234	32	cells	cell	NOUN
bam-6406	234	33	.	.	PUNCT
bam-6406	235	1	biochem	biochem	PROPN
bam-6406	235	2	pharmacol	pharmacol	PROPN
bam-6406	235	3	2015	2015	NUM
bam-6406	235	4	;	;	PUNCT
bam-6406	235	5	352	352	NUM
bam-6406	235	6	-	-	SYM
bam-6406	235	7	361	361	NUM
bam-6406	235	8	.	.	PUNCT
bam-6406	235	9	17	17	NUM
bam-6406	235	10	.	.	PUNCT
bam-6406	236	1	o'leary	o'leary	PROPN
bam-6406	236	2	mf	mf	PROPN
bam-6406	236	3	,	,	PUNCT
bam-6406	236	4	hood	hood	NOUN
bam-6406	236	5	da	da	NOUN
bam-6406	236	6	.	.	PUNCT
bam-6406	237	1	denervation	denervation	NOUN
bam-6406	237	2	-	-	PUNCT
bam-6406	237	3	induced	induce	VERB
bam-6406	237	4	oxidative	oxidative	ADJ
bam-6406	237	5	stress	stress	NOUN
bam-6406	237	6	and	and	CCONJ
bam-6406	237	7	autophagy	autophagy	NOUN
bam-6406	237	8	signaling	signal	VERB
bam-6406	237	9	in	in	ADP
bam-6406	237	10	muscle	muscle	NOUN
bam-6406	237	11	.	.	PUNCT
bam-6406	238	1	autophagy	autophagy	NOUN
bam-6406	238	2	2009	2009	NUM
bam-6406	238	3	;	;	PUNCT
bam-6406	238	4	230	230	NUM
bam-6406	238	5	-	-	SYM
bam-6406	238	6	231	231	NUM
bam-6406	238	7	.	.	PUNCT
bam-6406	238	8	18	18	NUM
bam-6406	238	9	.	.	PUNCT
bam-6406	239	1	zusterzeel	zusterzeel	PROPN
bam-6406	239	2	pl	pl	PROPN
bam-6406	239	3	,	,	PUNCT
bam-6406	239	4	mulder	mulder	PROPN
bam-6406	239	5	tp	tp	PROPN
bam-6406	239	6	,	,	PUNCT
bam-6406	239	7	peters	peters	PROPN
bam-6406	239	8	wh	wh	PROPN
bam-6406	239	9	,	,	PUNCT
bam-6406	239	10	et	et	PROPN
bam-6406	239	11	al	al	PROPN
bam-6406	239	12	.	.	PUNCT
bam-6406	239	13	plasma	plasma	NOUN
bam-6406	239	14	protein	protein	NOUN
bam-6406	239	15	carbonyls	carbonyl	VERB
bam-6406	239	16	in	in	ADP
bam-6406	239	17	nonpregnant	nonpregnant	NOUN
bam-6406	239	18	,	,	PUNCT
bam-6406	239	19	healthy	healthy	ADJ
bam-6406	239	20	pregnant	pregnant	ADJ
bam-6406	239	21	and	and	CCONJ
bam-6406	239	22	preeclamptic	preeclamptic	ADJ
bam-6406	239	23	women	woman	NOUN
bam-6406	239	24	.	.	PUNCT
bam-6406	240	1	free	free	ADJ
bam-6406	240	2	radic	radic	NOUN
bam-6406	240	3	.	.	PUNCT
bam-6406	241	1	res	re	NOUN
bam-6406	241	2	.	.	PROPN
bam-6406	241	3	2000	2000	NUM
bam-6406	241	4	;	;	PUNCT
bam-6406	241	5	471	471	NUM
bam-6406	241	6	-	-	SYM
bam-6406	241	7	476	476	NUM
bam-6406	241	8	.	.	PUNCT
bam-6406	242	1	19	19	NUM
bam-6406	242	2	.	.	PUNCT
bam-6406	243	1	limon	limon	PROPN
bam-6406	243	2	-	-	PUNCT
bam-6406	243	3	pacheco	pacheco	PROPN
bam-6406	243	4	j	j	PROPN
bam-6406	243	5	,	,	PUNCT
bam-6406	243	6	gonsebatt	gonsebatt	VERB
bam-6406	243	7	me	i	PRON
bam-6406	243	8	.	.	PUNCT
bam-6406	244	1	the	the	DET
bam-6406	244	2	role	role	NOUN
bam-6406	244	3	of	of	ADP
bam-6406	244	4	antioxidants	antioxidant	NOUN
bam-6406	244	5	and	and	CCONJ
bam-6406	244	6	antioxidant	antioxidant	NOUN
bam-6406	244	7	-	-	PUNCT
bam-6406	244	8	related	relate	VERB
bam-6406	244	9	enzymes	enzyme	NOUN
bam-6406	244	10	in	in	ADP
bam-6406	244	11	protective	protective	ADJ
bam-6406	244	12	responses	response	NOUN
bam-6406	244	13	to	to	ADP
bam-6406	244	14	environmentally	environmentally	ADV
bam-6406	244	15	induced	induced	ADJ
bam-6406	244	16	oxidative	oxidative	ADJ
bam-6406	244	17	stress	stress	NOUN
bam-6406	244	18	.	.	PUNCT
bam-6406	245	1	mutat	mutat	ADJ
bam-6406	245	2	res	re	NOUN
bam-6406	245	3	2009	2009	NUM
bam-6406	245	4	;	;	PUNCT
bam-6406	245	5	137	137	NUM
bam-6406	245	6	-	-	SYM
bam-6406	245	7	147	147	NUM
bam-6406	245	8	.	.	PUNCT
bam-6406	245	9	20	20	NUM
bam-6406	245	10	.	.	PUNCT
bam-6406	246	1	musaro	musaro	VERB
bam-6406	246	2	a	a	DET
bam-6406	246	3	,	,	PUNCT
bam-6406	246	4	fulle	fulle	ADJ
bam-6406	246	5	s	s	NOUN
bam-6406	246	6	,	,	PUNCT
bam-6406	246	7	fano	fano	PROPN
bam-6406	246	8	g.	g.	PROPN
bam-6406	246	9	oxidative	oxidative	ADJ
bam-6406	246	10	stress	stress	NOUN
bam-6406	246	11	and	and	CCONJ
bam-6406	246	12	muscle	muscle	NOUN
bam-6406	246	13	homeostasis	homeostasis	NOUN
bam-6406	246	14	.	.	PUNCT
bam-6406	247	1	curr	curr	PROPN
bam-6406	247	2	opin	opin	PROPN
bam-6406	247	3	clin	clin	PROPN
bam-6406	247	4	nutr	nutr	PROPN
bam-6406	247	5	metab	metab	PROPN
bam-6406	247	6	care	care	NOUN
bam-6406	247	7	2010	2010	NUM
bam-6406	247	8	;	;	PUNCT
bam-6406	247	9	236	236	NUM
bam-6406	247	10	-	-	SYM
bam-6406	247	11	242	242	NUM
bam-6406	247	12	.	.	PUNCT
bam-6406	248	1	21	21	NUM
bam-6406	248	2	.	.	PUNCT
bam-6406	249	1	salgo	salgo	PROPN
bam-6406	249	2	mg	mg	PROPN
bam-6406	249	3	,	,	PUNCT
bam-6406	249	4	pryor	pryor	PROPN
bam-6406	249	5	wa	wa	PROPN
bam-6406	249	6	.	.	PROPN
bam-6406	249	7	trolox	trolox	PROPN
bam-6406	249	8	inhibits	inhibit	VERB
bam-6406	249	9	peroxynitrite	peroxynitrite	VERB
bam-6406	249	10	-	-	PUNCT
bam-6406	249	11	mediated	mediate	VERB
bam-6406	249	12	oxidative	oxidative	ADJ
bam-6406	249	13	stress	stress	NOUN
bam-6406	249	14	and	and	CCONJ
bam-6406	249	15	apoptosis	apoptosis	NOUN
bam-6406	249	16	in	in	ADP
bam-6406	249	17	rat	rat	NOUN
bam-6406	249	18	thymocytes	thymocyte	NOUN
bam-6406	249	19	.	.	PUNCT
bam-6406	250	1	arch	arch	ADJ
bam-6406	250	2	biochem	biochem	PROPN
bam-6406	250	3	biophys	biophy	NOUN
bam-6406	250	4	1996	1996	NUM
bam-6406	250	5	;	;	PUNCT
bam-6406	250	6	482	482	NUM
bam-6406	250	7	-	-	SYM
bam-6406	250	8	488	488	NUM
bam-6406	250	9	.	.	PUNCT
bam-6406	251	1	22	22	NUM
bam-6406	251	2	.	.	PUNCT
bam-6406	252	1	wu	wu	PROPN
bam-6406	252	2	tw	tw	PROPN
bam-6406	252	3	,	,	PUNCT
bam-6406	252	4	hashimoto	hashimoto	NOUN
bam-6406	252	5	n	n	CCONJ
bam-6406	252	6	,	,	PUNCT
bam-6406	252	7	wu	wu	PROPN
bam-6406	252	8	j	j	PROPN
bam-6406	252	9	,	,	PUNCT
bam-6406	252	10	carey	carey	PROPN
bam-6406	252	11	d	d	PROPN
bam-6406	252	12	,	,	PUNCT
bam-6406	252	13	et	et	PROPN
bam-6406	252	14	al	al	PROPN
bam-6406	252	15	.	.	PUNCT
bam-6406	253	1	the	the	DET
bam-6406	253	2	cytoprotective	cytoprotective	ADJ
bam-6406	253	3	effect	effect	NOUN
bam-6406	253	4	of	of	ADP
bam-6406	253	5	trolox	trolox	PROPN
bam-6406	253	6	demonstrated	demonstrate	VERB
bam-6406	253	7	with	with	ADP
bam-6406	253	8	three	three	NUM
bam-6406	253	9	types	type	NOUN
bam-6406	253	10	of	of	ADP
bam-6406	253	11	human	human	ADJ
bam-6406	253	12	cells	cell	NOUN
bam-6406	253	13	.	.	PUNCT
bam-6406	254	1	biochem	biochem	PROPN
bam-6406	254	2	cell	cell	NOUN
bam-6406	254	3	biol	biol	PROPN
bam-6406	254	4	1990	1990	NUM
bam-6406	254	5	;	;	PUNCT
bam-6406	254	6	1189	1189	NUM
bam-6406	254	7	-	-	SYM
bam-6406	254	8	1194	1194	NUM
bam-6406	254	9	.	.	PUNCT
bam-6406	255	1	mailto:sergio.adamo@uniroma1.it	mailto:sergio.adamo@uniroma1.it	NOUN
bam-6406	256	1	mailto:eva.pigna@uniroma1.it	mailto:eva.pigna@uniroma1.it	PROPN
bam-6406	256	2	mailto:emanuela.greco1505@gmail.com	mailto:emanuela.greco1505@gmail.com	X
bam-6406	256	3	mailto:morozzigiulio@gmail.com	mailto:morozzigiulio@gmail.com	PROPN
bam-6406	257	1	mailto:silvia.grottelli@unipg.it	mailto:silvia.grottelli@unipg.it	PROPN
bam-6406	257	2	mailto:alessio.rotini@gmail.com	mailto:alessio.rotini@gmail.com	X
bam-6406	258	1	mailto:alba.minelli@unipg.it	mailto:alba.minelli@unipg.it	PROPN
bam-6406	258	2	mailto:sfulle@unich.it	mailto:sfulle@unich.it	PROPN
bam-6406	258	3	mailto:r.mancinelli@unich.it	mailto:r.mancinelli@unich.it	VERB
bam-6406	259	1	mailto:ilaria.bellezza@unipg.it	mailto:ilaria.bellezza@unipg.it	PROPN
bam-6406	259	2	mailto:viviana.moresi@uniroma1.it	mailto:viviana.moresi@uniroma1.it	PROPN
bam-6406	259	3	muscle	muscle	NOUN
bam-6406	259	4	denervation	denervation	NOUN
bam-6406	259	5	atrophy	atrophy	NOUN
bam-6406	259	6	is	be	AUX
bam-6406	259	7	not	not	PART
bam-6406	259	8	related	relate	VERB
bam-6406	259	9	to	to	PART
bam-6406	259	10	oxidative	oxidative	VERB
bam-6406	259	11	stress	stress	NOUN
bam-6406	259	12	eur	eur	PROPN
bam-6406	259	13	j	j	PROPN
bam-6406	259	14	transl	transl	PROPN
bam-6406	259	15	myol	myol	NOUN
bam-6406	259	16	2017	2017	NUM
bam-6406	259	17	;	;	PUNCT
bam-6406	259	18	27	27	NUM
bam-6406	259	19	(	(	PUNCT
bam-6406	259	20	1	1	NUM
bam-6406	259	21	):	):	PUNCT
bam-6406	259	22	43	43	NUM
bam-6406	259	23	-	-	SYM
bam-6406	259	24	50	50	NUM
bam-6406	259	25	50	50	NUM
bam-6406	259	26	23	23	NUM
bam-6406	259	27	.	.	PUNCT
bam-6406	260	1	lancon	lancon	PROPN
bam-6406	260	2	a	a	PRON
bam-6406	260	3	,	,	PUNCT
bam-6406	260	4	frazzi	frazzi	ADJ
bam-6406	260	5	r	r	NOUN
bam-6406	260	6	,	,	PUNCT
bam-6406	260	7	latruffe	latruffe	PROPN
bam-6406	260	8	n.	n.	ADJ
bam-6406	260	9	anti	anti	ADJ
bam-6406	260	10	-	-	ADJ
bam-6406	260	11	oxidant	oxidant	ADJ
bam-6406	260	12	,	,	PUNCT
bam-6406	260	13	anti	anti	ADJ
bam-6406	260	14	-	-	ADJ
bam-6406	260	15	inflammatory	inflammatory	ADJ
bam-6406	260	16	and	and	CCONJ
bam-6406	260	17	anti	anti	ADJ
bam-6406	260	18	-	-	ADJ
bam-6406	260	19	angiogenic	angiogenic	ADJ
bam-6406	260	20	properties	property	NOUN
bam-6406	260	21	of	of	ADP
bam-6406	260	22	resveratrol	resveratrol	NOUN
bam-6406	260	23	in	in	ADP
bam-6406	260	24	ocular	ocular	ADJ
bam-6406	260	25	diseases	disease	NOUN
bam-6406	260	26	.	.	PUNCT
bam-6406	261	1	molecules	molecule	NOUN
bam-6406	261	2	2016;21:304	2016;21:304	NUM
bam-6406	261	3	.	.	PUNCT
bam-6406	261	4	24	24	NUM
bam-6406	261	5	.	.	PUNCT
bam-6406	262	1	powers	power	NOUN
bam-6406	262	2	sk	sk	VERB
bam-6406	262	3	,	,	PUNCT
bam-6406	262	4	smuder	smuder	PROPN
bam-6406	262	5	aj	aj	PROPN
bam-6406	262	6	,	,	PUNCT
bam-6406	262	7	judge	judge	PROPN
bam-6406	262	8	ar	ar	PROPN
bam-6406	262	9	.	.	PROPN
bam-6406	262	10	oxidative	oxidative	ADJ
bam-6406	262	11	stress	stress	NOUN
bam-6406	262	12	and	and	CCONJ
bam-6406	262	13	disuse	disuse	NOUN
bam-6406	262	14	muscle	muscle	NOUN
bam-6406	262	15	atrophy	atrophy	NOUN
bam-6406	262	16	:	:	PUNCT
bam-6406	262	17	cause	cause	VERB
bam-6406	262	18	or	or	CCONJ
bam-6406	262	19	consequence	consequence	VERB
bam-6406	262	20	?	?	PUNCT
bam-6406	263	1	curr	curr	PROPN
bam-6406	263	2	opin	opin	PROPN
bam-6406	263	3	clin	clin	PROPN
bam-6406	263	4	nutr	nutr	PROPN
bam-6406	263	5	metab	metab	PROPN
bam-6406	263	6	care	care	PROPN
bam-6406	263	7	2012	2012	NUM
bam-6406	263	8	;	;	PUNCT
bam-6406	263	9	240	240	NUM
bam-6406	263	10	-	-	SYM
bam-6406	263	11	245	245	NUM
bam-6406	263	12	.	.	PUNCT
bam-6406	263	13	25	25	NUM
bam-6406	263	14	.	.	PUNCT
bam-6406	264	1	carraro	carraro	PROPN
bam-6406	264	2	u	u	PROPN
bam-6406	264	3	,	,	PUNCT
bam-6406	264	4	coletti	coletti	PROPN
bam-6406	264	5	d	d	PROPN
bam-6406	264	6	,	,	PUNCT
bam-6406	264	7	kern	kern	PROPN
bam-6406	264	8	h.	h.	PROPN
bam-6406	265	1	the	the	DET
bam-6406	265	2	ejtm	ejtm	NOUN
bam-6406	265	3	special	special	ADJ
bam-6406	265	4	"	"	PUNCT
bam-6406	265	5	the	the	DET
bam-6406	265	6	long	long	ADJ
bam-6406	265	7	-	-	PUNCT
bam-6406	265	8	term	term	NOUN
bam-6406	265	9	denervated	denervated	ADJ
bam-6406	265	10	muscle	muscle	NOUN
bam-6406	265	11	"	"	PUNCT
bam-6406	265	12	.	.	PUNCT
bam-6406	266	1	eur	eur	PROPN
bam-6406	266	2	j	j	PROPN
bam-6406	266	3	transl	transl	PROPN
bam-6406	266	4	myol	myol	NOUN
bam-6406	266	5	2014;24:73	2014;24:73	NUM
bam-6406	266	6	.	.	PUNCT
bam-6406	266	7	26	26	NUM
bam-6406	266	8	.	.	PUNCT
bam-6406	267	1	abruzzo	abruzzo	NOUN
bam-6406	267	2	pm	pm	PROPN
bam-6406	267	3	,	,	PUNCT
bam-6406	267	4	di	di	X
bam-6406	267	5	tullio	tullio	NOUN
bam-6406	267	6	s	s	PROPN
bam-6406	267	7	,	,	PUNCT
bam-6406	267	8	marchionni	marchionni	PROPN
bam-6406	267	9	c	c	NOUN
bam-6406	267	10	,	,	PUNCT
bam-6406	267	11	et	et	PROPN
bam-6406	267	12	al	al	PROPN
bam-6406	267	13	.	.	PROPN
bam-6406	267	14	oxidative	oxidative	ADJ
bam-6406	267	15	stress	stress	NOUN
bam-6406	267	16	in	in	ADP
bam-6406	267	17	the	the	DET
bam-6406	267	18	denervated	denervated	ADJ
bam-6406	267	19	muscle	muscle	NOUN
bam-6406	267	20	.	.	PUNCT
bam-6406	268	1	free	free	ADJ
bam-6406	268	2	radic	radic	ADJ
bam-6406	268	3	res	re	NOUN
bam-6406	268	4	2010;44:563	2010;44:563	PROPN
bam-6406	268	5	-	-	SYM
bam-6406	268	6	76	76	NUM
bam-6406	268	7	.	.	PUNCT
bam-6406	269	1	27	27	NUM
bam-6406	269	2	.	.	PUNCT
bam-6406	270	1	carraro	carraro	PROPN
bam-6406	270	2	u	u	PROPN
bam-6406	270	3	,	,	PUNCT
bam-6406	270	4	kern	kern	PROPN
bam-6406	270	5	h	h	PROPN
bam-6406	270	6	,	,	PUNCT
bam-6406	270	7	gava	gava	PROPN
bam-6406	270	8	p	p	X
bam-6406	270	9	et	et	PROPN
bam-6406	270	10	al	al	PROPN
bam-6406	270	11	.	.	PROPN
bam-6406	270	12	biology	biology	NOUN
bam-6406	270	13	of	of	ADP
bam-6406	270	14	muscle	muscle	NOUN
bam-6406	270	15	atrophy	atrophy	NOUN
bam-6406	270	16	and	and	CCONJ
bam-6406	270	17	of	of	ADP
bam-6406	270	18	its	its	PRON
bam-6406	270	19	recovery	recovery	NOUN
bam-6406	270	20	by	by	ADP
bam-6406	270	21	fes	fes	NOUN
bam-6406	270	22	in	in	ADP
bam-6406	270	23	aging	aging	NOUN
bam-6406	270	24	and	and	CCONJ
bam-6406	270	25	mobiliting	mobilite	VERB
bam-6406	270	26	impairments	impairment	NOUN
bam-6406	270	27	:	:	PUNCT
bam-6406	270	28	roots	root	NOUN
bam-6406	270	29	and	and	CCONJ
bam-6406	270	30	byproducts	byproduct	NOUN
bam-6406	270	31	.	.	PUNCT
bam-6406	271	1	eur	eur	PROPN
bam-6406	271	2	j	j	PROPN
bam-6406	271	3	transl	transl	VERB
bam-6406	271	4	myol	myol	NOUN
bam-6406	271	5	2015;25:221	2015;25:221	NOUN
bam-6406	271	6	-	-	SYM
bam-6406	271	7	30	30	NUM
bam-6406	271	8	.	.	PUNCT
bam-6406	272	1	28	28	NUM
bam-6406	272	2	.	.	PUNCT
bam-6406	273	1	kern	kern	PROPN
bam-6406	273	2	h	h	PROPN
bam-6406	273	3	,	,	PUNCT
bam-6406	273	4	carraro	carraro	PROPN
bam-6406	273	5	u.	u.	PROPN
bam-6406	273	6	home	home	NOUN
bam-6406	273	7	-	-	PUNCT
bam-6406	273	8	based	base	VERB
bam-6406	273	9	functional	functional	ADJ
bam-6406	273	10	electrical	electrical	ADJ
bam-6406	273	11	stimulation	stimulation	NOUN
bam-6406	273	12	for	for	ADP
bam-6406	273	13	long	long	ADJ
bam-6406	273	14	-	-	PUNCT
bam-6406	273	15	term	term	NOUN
bam-6406	273	16	denervated	denervate	VERB
bam-6406	273	17	human	human	ADJ
bam-6406	273	18	muscle	muscle	NOUN
bam-6406	273	19	:	:	PUNCT
bam-6406	273	20	history	history	NOUN
bam-6406	273	21	,	,	PUNCT
bam-6406	273	22	basics	basic	NOUN
bam-6406	273	23	,	,	PUNCT
bam-6406	273	24	results	result	NOUN
bam-6406	273	25	and	and	CCONJ
bam-6406	273	26	perspectives	perspective	NOUN
bam-6406	273	27	of	of	ADP
bam-6406	273	28	the	the	DET
bam-6406	273	29	vienna	vienna	PROPN
bam-6406	273	30	rehabilitation	rehabilitation	NOUN
bam-6406	273	31	strategy	strategy	NOUN
bam-6406	273	32	.	.	PUNCT
bam-6406	274	1	eur	eur	PROPN
bam-6406	274	2	j	j	PROPN
bam-6406	274	3	transl	transl	PROPN
bam-6406	274	4	myol	myol	NOUN
bam-6406	274	5	2014;24:3296	2014;24:3296	NUM
bam-6406	274	6	29	29	NUM
bam-6406	274	7	.	.	PUNCT
bam-6406	275	1	ordonez	ordonez	PROPN
bam-6406	275	2	fj	fj	PROPN
bam-6406	275	3	,	,	PUNCT
bam-6406	275	4	roseti	roseti	PROPN
bam-6406	275	5	ma	ma	PROPN
bam-6406	275	6	,	,	PUNCT
bam-6406	275	7	camacho	camacho	PROPN
bam-6406	275	8	a	a	PRON
bam-6406	275	9	et	et	PROPN
bam-6406	275	10	al	al	PROPN
bam-6406	275	11	.	.	PUNCT
bam-6406	276	1	armcrancking	armcrancke	VERB
bam-6406	276	2	exercise	exercise	NOUN
bam-6406	276	3	reduced	reduce	VERB
bam-6406	276	4	oxidative	oxidative	ADJ
bam-6406	276	5	damage	damage	NOUN
bam-6406	276	6	in	in	ADP
bam-6406	276	7	adults	adult	NOUN
bam-6406	276	8	with	with	ADP
bam-6406	276	9	chronic	chronic	ADJ
bam-6406	276	10	spinal	spinal	NOUN
bam-6406	276	11	cord	cord	NOUN
bam-6406	276	12	injury	injury	NOUN
bam-6406	276	13	.	.	PUNCT
bam-6406	277	1	arch	arch	ADJ
bam-6406	277	2	phys	phy	NOUN
bam-6406	277	3	med	me	VERB
bam-6406	277	4	rehabil	rehabil	ADJ
bam-6406	277	5	2013;94	2013;94	NUM
bam-6406	277	6	:	:	PUNCT
bam-6406	277	7	2336	2336	NUM
bam-6406	277	8	-	-	SYM
bam-6406	277	9	41	41	NUM
bam-6406	277	10	30	30	NUM
bam-6406	277	11	.	.	PUNCT
bam-6406	278	1	van	van	PROPN
bam-6406	278	2	duijnhoven	duijnhoven	VERB
bam-6406	278	3	n	n	PROPN
bam-6406	278	4	,	,	PUNCT
bam-6406	278	5	hesse	hesse	PROPN
bam-6406	278	6	e	e	PROPN
bam-6406	278	7	,	,	PUNCT
bam-6406	278	8	janssen	janssen	PROPN
bam-6406	278	9	t	t	PROPN
bam-6406	278	10	et	et	PROPN
bam-6406	278	11	al	al	PROPN
bam-6406	278	12	.	.	PROPN
bam-6406	278	13	impact	impact	NOUN
bam-6406	278	14	of	of	ADP
bam-6406	278	15	exercise	exercise	NOUN
bam-6406	278	16	training	training	NOUN
bam-6406	278	17	on	on	ADP
bam-6406	278	18	oxidative	oxidative	ADJ
bam-6406	278	19	stress	stress	NOUN
bam-6406	278	20	in	in	ADP
bam-6406	278	21	individuals	individual	NOUN
bam-6406	278	22	with	with	ADP
bam-6406	278	23	a	a	DET
bam-6406	278	24	spinal	spinal	ADJ
bam-6406	278	25	cord	cord	NOUN
bam-6406	278	26	injury	injury	NOUN
bam-6406	278	27	.	.	PUNCT
bam-6406	279	1	eur	eur	PROPN
bam-6406	279	2	j	j	PROPN
bam-6406	279	3	appl	appl	PROPN
bam-6406	279	4	physiol	physiol	PROPN
bam-6406	279	5	2010;109:1059	2010;109:1059	PROPN
bam-6406	279	6	-	-	SYM
bam-6406	279	7	66	66	NUM
bam-6406	279	8	31	31	NUM
bam-6406	279	9	.	.	PUNCT
bam-6406	280	1	morgan	morgan	PROPN
bam-6406	280	2	mj	mj	PROPN
bam-6406	280	3	,	,	PUNCT
bam-6406	280	4	liu	liu	PROPN
bam-6406	280	5	zg	zg	PROPN
bam-6406	280	6	.	.	PROPN
bam-6406	280	7	crosstalk	crosstalk	PROPN
bam-6406	280	8	of	of	ADP
bam-6406	280	9	reactive	reactive	ADJ
bam-6406	280	10	oxygen	oxygen	NOUN
bam-6406	280	11	species	specie	NOUN
bam-6406	280	12	and	and	CCONJ
bam-6406	280	13	nf	nf	ADJ
bam-6406	280	14	-	-	PUNCT
bam-6406	280	15	kappab	kappab	NOUN
bam-6406	280	16	signaling	signal	VERB
bam-6406	280	17	.	.	PUNCT
bam-6406	281	1	cell	cell	NOUN
bam-6406	281	2	res	re	NOUN
bam-6406	281	3	2011	2011	NUM
bam-6406	281	4	;	;	PUNCT
bam-6406	281	5	103	103	NUM
bam-6406	281	6	-	-	SYM
bam-6406	281	7	115	115	NUM
bam-6406	281	8	.	.	PUNCT
bam-6406	282	1	32	32	NUM
bam-6406	282	2	.	.	PUNCT
bam-6406	283	1	tryon	tryon	PROPN
bam-6406	283	2	ld	ld	PROPN
bam-6406	283	3	,	,	PUNCT
bam-6406	283	4	crilly	crilly	ADV
bam-6406	283	5	mj	mj	PROPN
bam-6406	283	6	,	,	PUNCT
bam-6406	283	7	hood	hood	NOUN
bam-6406	283	8	da	da	PROPN
bam-6406	283	9	.	.	PUNCT
bam-6406	283	10	effect	effect	NOUN
bam-6406	283	11	of	of	ADP
bam-6406	283	12	denervation	denervation	NOUN
bam-6406	283	13	on	on	ADP
bam-6406	283	14	the	the	DET
bam-6406	283	15	regulation	regulation	NOUN
bam-6406	283	16	of	of	ADP
bam-6406	283	17	mitochondrial	mitochondrial	ADJ
bam-6406	283	18	transcription	transcription	NOUN
bam-6406	283	19	factor	factor	NOUN
bam-6406	283	20	a	a	DET
bam-6406	283	21	expression	expression	NOUN
bam-6406	283	22	in	in	ADP
bam-6406	283	23	skeletal	skeletal	ADJ
bam-6406	283	24	muscle	muscle	NOUN
bam-6406	283	25	.	.	PUNCT
bam-6406	284	1	am	be	AUX
bam-6406	284	2	j	j	PROPN
bam-6406	284	3	physiol	physiol	PROPN
bam-6406	284	4	cell	cell	PROPN
bam-6406	284	5	physiol	physiol	PROPN
bam-6406	284	6	15	15	NUM
bam-6406	284	7	-	-	SYM
bam-6406	284	8	8	8	NUM
bam-6406	284	9	-	-	NUM
bam-6406	284	10	2015	2015	NUM
bam-6406	284	11	;	;	PUNCT
bam-6406	284	12	c228	c228	PROPN
bam-6406	284	13	-	-	SYM
bam-6406	284	14	c238	c238	PROPN
bam-6406	284	15	.	.	PROPN
bam-6406	284	16	33	33	NUM
bam-6406	284	17	.	.	PUNCT
bam-6406	285	1	adhihetty	adhihetty	PROPN
bam-6406	285	2	pj	pj	PROPN
bam-6406	285	3	,	,	PUNCT
bam-6406	285	4	o'leary	o'leary	PROPN
bam-6406	285	5	mf	mf	PROPN
bam-6406	285	6	,	,	PUNCT
bam-6406	285	7	chabi	chabi	NOUN
bam-6406	285	8	b	b	PROPN
bam-6406	285	9	,	,	PUNCT
bam-6406	285	10	et	et	PROPN
bam-6406	285	11	al	al	PROPN
bam-6406	285	12	.	.	PROPN
bam-6406	286	1	effect	effect	NOUN
bam-6406	286	2	of	of	ADP
bam-6406	286	3	denervation	denervation	NOUN
bam-6406	286	4	on	on	ADP
bam-6406	286	5	mitochondrially	mitochondrially	ADV
bam-6406	286	6	mediated	mediate	VERB
bam-6406	286	7	apoptosis	apoptosis	NOUN
bam-6406	286	8	in	in	ADP
bam-6406	286	9	skeletal	skeletal	ADJ
bam-6406	286	10	muscle	muscle	NOUN
bam-6406	286	11	.	.	PUNCT
bam-6406	287	1	j.	j.	PROPN
bam-6406	287	2	appl	appl	PROPN
bam-6406	287	3	.	.	PROPN
bam-6406	287	4	physiol	physiol	PROPN
bam-6406	287	5	(	(	PUNCT
bam-6406	287	6	1985	1985	NUM
bam-6406	287	7	.	.	PUNCT
bam-6406	287	8	)	)	PUNCT
bam-6406	287	9	2007	2007	NUM
bam-6406	287	10	;	;	PUNCT
bam-6406	287	11	1143	1143	NUM
bam-6406	287	12	-	-	SYM
bam-6406	287	13	1151	1151	NUM
bam-6406	287	14	.	.	PUNCT
bam-6406	288	1	34	34	NUM
bam-6406	288	2	.	.	PUNCT
bam-6406	289	1	reid	reid	PROPN
bam-6406	289	2	mb	mb	PROPN
bam-6406	289	3	.	.	PROPN
bam-6406	289	4	invited	invite	VERB
bam-6406	289	5	review	review	NOUN
bam-6406	289	6	:	:	PUNCT
bam-6406	289	7	redox	redox	ADJ
bam-6406	289	8	modulation	modulation	NOUN
bam-6406	289	9	of	of	ADP
bam-6406	289	10	skeletal	skeletal	ADJ
bam-6406	289	11	muscle	muscle	NOUN
bam-6406	289	12	contraction	contraction	NOUN
bam-6406	289	13	:	:	PUNCT
bam-6406	289	14	what	what	PRON
bam-6406	289	15	we	we	PRON
bam-6406	289	16	know	know	VERB
bam-6406	289	17	and	and	CCONJ
bam-6406	289	18	what	what	PRON
bam-6406	289	19	we	we	PRON
bam-6406	289	20	do	do	VERB
bam-6406	289	21	n't	not	PART
bam-6406	289	22	.	.	PUNCT
bam-6406	290	1	j	j	PROPN
bam-6406	290	2	appl	appl	PROPN
bam-6406	290	3	physiol	physiol	PROPN
bam-6406	290	4	(	(	PUNCT
bam-6406	290	5	1985	1985	NUM
bam-6406	290	6	)	)	PUNCT
bam-6406	290	7	2001	2001	NUM
bam-6406	290	8	;	;	PUNCT
bam-6406	290	9	724731	724731	NUM
bam-6406	290	10	.	.	PUNCT
bam-6406	291	1	35	35	NUM
bam-6406	291	2	.	.	PUNCT
bam-6406	292	1	brocca	brocca	PROPN
bam-6406	292	2	l	l	PROPN
bam-6406	292	3	,	,	PUNCT
bam-6406	292	4	pellegrino	pellegrino	PROPN
bam-6406	292	5	ma	ma	PROPN
bam-6406	292	6	,	,	PUNCT
bam-6406	292	7	desaphy	desaphy	PROPN
bam-6406	292	8	jf	jf	PROPN
bam-6406	292	9	,	,	PUNCT
bam-6406	292	10	et	et	PROPN
bam-6406	292	11	al	al	PROPN
bam-6406	292	12	.	.	PROPN
bam-6406	292	13	is	be	AUX
bam-6406	292	14	oxidative	oxidative	ADJ
bam-6406	292	15	stress	stress	NOUN
bam-6406	292	16	a	a	DET
bam-6406	292	17	cause	cause	NOUN
bam-6406	292	18	or	or	CCONJ
bam-6406	292	19	consequence	consequence	NOUN
bam-6406	292	20	of	of	ADP
bam-6406	292	21	disuse	disuse	NOUN
bam-6406	292	22	muscle	muscle	NOUN
bam-6406	292	23	atrophy	atrophy	NOUN
bam-6406	292	24	in	in	ADP
bam-6406	292	25	mice	mouse	NOUN
bam-6406	292	26	?	?	PUNCT
bam-6406	293	1	a	a	DET
bam-6406	293	2	proteomic	proteomic	ADJ
bam-6406	293	3	approach	approach	NOUN
bam-6406	293	4	in	in	ADP
bam-6406	293	5	hindlimb	hindlimb	NOUN
bam-6406	293	6	-	-	PUNCT
bam-6406	293	7	unloaded	unload	VERB
bam-6406	293	8	mice	mouse	NOUN
bam-6406	293	9	.	.	PUNCT
bam-6406	294	1	exp	exp	NOUN
bam-6406	294	2	physiol	physiol	PROPN
bam-6406	294	3	2010;331350	2010;331350	NUM
bam-6406	294	4	.	.	PUNCT
bam-6406	295	1	36	36	NUM
bam-6406	295	2	.	.	PUNCT
bam-6406	295	3	cannavino	cannavino	PROPN
bam-6406	295	4	j	j	PROPN
bam-6406	295	5	,	,	PUNCT
bam-6406	295	6	brocca	brocca	ADJ
bam-6406	295	7	l	l	PROPN
bam-6406	295	8	,	,	PUNCT
bam-6406	295	9	sandri	sandri	PROPN
bam-6406	295	10	m	m	PROPN
bam-6406	295	11	,	,	PUNCT
bam-6406	295	12	bottinelli	bottinelli	PROPN
bam-6406	295	13	r	r	PROPN
bam-6406	295	14	,	,	PUNCT
bam-6406	295	15	et	et	PROPN
bam-6406	295	16	al	al	PROPN
bam-6406	295	17	.	.	PUNCT
bam-6406	296	1	pgc1	pgc1	PROPN
bam-6406	296	2	-	-	PUNCT
bam-6406	296	3	alpha	alpha	NOUN
bam-6406	296	4	over	over	ADP
bam-6406	296	5	-	-	PUNCT
bam-6406	296	6	expression	expression	NOUN
bam-6406	296	7	prevents	prevent	VERB
bam-6406	296	8	metabolic	metabolic	NOUN
bam-6406	296	9	alterations	alteration	NOUN
bam-6406	296	10	and	and	CCONJ
bam-6406	296	11	soleus	soleus	ADJ
bam-6406	296	12	muscle	muscle	NOUN
bam-6406	296	13	atrophy	atrophy	NOUN
bam-6406	296	14	in	in	ADP
bam-6406	296	15	hindlimb	hindlimb	NOUN
bam-6406	296	16	unloaded	unload	VERB
bam-6406	296	17	mice	mouse	NOUN
bam-6406	296	18	.	.	PUNCT
bam-6406	297	1	j	j	PROPN
bam-6406	297	2	physiol	physiol	PROPN
bam-6406	297	3	2014	2014	NUM
bam-6406	297	4	;	;	PUNCT
bam-6406	297	5	45754589	45754589	NUM
bam-6406	297	6	.	.	PUNCT
bam-6406	298	1	37	37	NUM
bam-6406	298	2	.	.	PUNCT
bam-6406	299	1	desaphy	desaphy	PROPN
bam-6406	299	2	jf	jf	PROPN
bam-6406	299	3	,	,	PUNCT
bam-6406	299	4	pierno	pierno	VERB
bam-6406	299	5	s	s	PART
bam-6406	299	6	,	,	PUNCT
bam-6406	299	7	liantonio	liantonio	ADJ
bam-6406	299	8	a	a	X
bam-6406	299	9	,	,	PUNCT
bam-6406	299	10	et	et	PROPN
bam-6406	299	11	al	al	PROPN
bam-6406	299	12	.	.	PROPN
bam-6406	300	1	antioxidant	antioxidant	ADJ
bam-6406	300	2	treatment	treatment	NOUN
bam-6406	300	3	of	of	ADP
bam-6406	300	4	hindlimb	hindlimb	NOUN
bam-6406	300	5	-	-	PUNCT
bam-6406	300	6	unloaded	unload	VERB
bam-6406	300	7	mouse	mouse	NOUN
bam-6406	300	8	counteracts	counteract	NOUN
bam-6406	300	9	fiber	fiber	NOUN
bam-6406	300	10	type	type	NOUN
bam-6406	300	11	transition	transition	NOUN
bam-6406	300	12	but	but	CCONJ
bam-6406	300	13	not	not	PART
bam-6406	300	14	atrophy	atrophy	NOUN
bam-6406	300	15	of	of	ADP
bam-6406	300	16	disused	disused	ADJ
bam-6406	300	17	muscles	muscle	NOUN
bam-6406	300	18	.	.	PUNCT
bam-6406	301	1	pharmacol	pharmacol	NOUN
bam-6406	301	2	res	re	NOUN
bam-6406	301	3	2010	2010	NUM
bam-6406	301	4	;	;	PUNCT
bam-6406	301	5	553	553	NUM
bam-6406	301	6	-	-	SYM
bam-6406	301	7	563	563	NUM
bam-6406	301	8	.	.	PUNCT