id	sid	tid	token	lemma	pos
bam-7186	1	1	polymorphisms	polymorphism	NOUN
bam-7186	1	2	of	of	ADP
bam-7186	1	3	elite	elite	ADJ
bam-7186	1	4	athletes	athlete	NOUN
bam-7186	1	5	phenotype	phenotype	VERB
bam-7186	1	6	eur	eur	PROPN
bam-7186	1	7	j	j	PROPN
bam-7186	1	8	transl	transl	PROPN
bam-7186	1	9	myol	myol	ADV
bam-7186	1	10	28	28	NUM
bam-7186	1	11	(	(	PUNCT
bam-7186	1	12	1	1	NUM
bam-7186	1	13	):	):	PUNCT
bam-7186	1	14	87	87	NUM
bam-7186	1	15	-	-	SYM
bam-7186	1	16	92	92	NUM
bam-7186	1	17	,	,	PUNCT
bam-7186	1	18	2018	2018	NUM
bam-7186	1	19	87	87	NUM
bam-7186	1	20	an	an	DET
bam-7186	1	21	innovative	innovative	ADJ
bam-7186	1	22	way	way	NOUN
bam-7186	1	23	to	to	PART
bam-7186	1	24	highlight	highlight	VERB
bam-7186	1	25	the	the	DET
bam-7186	1	26	power	power	NOUN
bam-7186	1	27	of	of	ADP
bam-7186	1	28	each	each	DET
bam-7186	1	29	polymorphism	polymorphism	NOUN
bam-7186	1	30	on	on	ADP
bam-7186	1	31	elite	elite	ADJ
bam-7186	1	32	athletes	athlete	NOUN
bam-7186	1	33	phenotype	phenotype	NOUN
bam-7186	1	34	expression	expression	NOUN
bam-7186	1	35	valentina	valentina	PROPN
bam-7186	1	36	contrò	contrò	PROPN
bam-7186	1	37	(	(	PUNCT
bam-7186	1	38	1	1	NUM
bam-7186	1	39	)	)	PUNCT
bam-7186	1	40	,	,	PUNCT
bam-7186	1	41	gabriella	gabriella	PROPN
bam-7186	1	42	schiera	schiera	NOUN
bam-7186	1	43	(	(	PUNCT
bam-7186	1	44	2	2	NUM
bam-7186	1	45	)	)	PUNCT
bam-7186	1	46	,	,	PUNCT
bam-7186	1	47	antonino	antonino	PROPN
bam-7186	1	48	abbruzzo	abbruzzo	X
bam-7186	1	49	(	(	PUNCT
bam-7186	1	50	1	1	NUM
bam-7186	1	51	)	)	PUNCT
bam-7186	1	52	,	,	PUNCT
bam-7186	1	53	antonino	antonino	PROPN
bam-7186	1	54	bianco	bianco	PROPN
bam-7186	1	55	(	(	PUNCT
bam-7186	1	56	3	3	NUM
bam-7186	1	57	)	)	PUNCT
bam-7186	1	58	,	,	PUNCT
bam-7186	1	59	alessandra	alessandra	PROPN
bam-7186	1	60	amato	amato	PROPN
bam-7186	1	61	(	(	PUNCT
bam-7186	1	62	3	3	NUM
bam-7186	1	63	)	)	PUNCT
bam-7186	1	64	,	,	PUNCT
bam-7186	1	65	alessia	alessia	PROPN
bam-7186	1	66	sacco	sacco	PROPN
bam-7186	1	67	(	(	PUNCT
bam-7186	1	68	3	3	NUM
bam-7186	1	69	)	)	PUNCT
bam-7186	1	70	,	,	PUNCT
bam-7186	1	71	alessandra	alessandra	PROPN
bam-7186	1	72	macchiarella	macchiarella	PROPN
bam-7186	1	73	(	(	PUNCT
bam-7186	1	74	3	3	NUM
bam-7186	1	75	)	)	PUNCT
bam-7186	1	76	,	,	PUNCT
bam-7186	1	77	antonio	antonio	PROPN
bam-7186	1	78	palma	palma	PROPN
bam-7186	1	79	(	(	PUNCT
bam-7186	1	80	3	3	NUM
bam-7186	1	81	)	)	PUNCT
bam-7186	1	82	,	,	PUNCT
bam-7186	1	83	patrizia	patrizia	PROPN
bam-7186	1	84	proia	proia	NOUN
bam-7186	1	85	(	(	PUNCT
bam-7186	1	86	3	3	NUM
bam-7186	1	87	)	)	PUNCT
bam-7186	1	88	(	(	PUNCT
bam-7186	1	89	1	1	X
bam-7186	1	90	)	)	PUNCT
bam-7186	1	91	department	department	NOUN
bam-7186	1	92	of	of	ADP
bam-7186	1	93	statistics	statistic	NOUN
bam-7186	1	94	,	,	PUNCT
bam-7186	1	95	seas	sea	NOUN
bam-7186	1	96	,	,	PUNCT
bam-7186	1	97	university	university	NOUN
bam-7186	1	98	of	of	ADP
bam-7186	1	99	palermo	palermo	NOUN
bam-7186	1	100	;	;	PUNCT
bam-7186	1	101	(	(	PUNCT
bam-7186	1	102	2	2	X
bam-7186	1	103	)	)	PUNCT
bam-7186	1	104	department	department	NOUN
bam-7186	1	105	of	of	ADP
bam-7186	1	106	biological	biological	ADJ
bam-7186	1	107	chemical	chemical	NOUN
bam-7186	1	108	and	and	CCONJ
bam-7186	1	109	pharmaceutical	pharmaceutical	NOUN
bam-7186	1	110	sciences	science	NOUN
bam-7186	1	111	and	and	CCONJ
bam-7186	1	112	technologies	technology	NOUN
bam-7186	1	113	(	(	PUNCT
bam-7186	1	114	stebicef	stebicef	NOUN
bam-7186	1	115	)	)	PUNCT
bam-7186	1	116	,	,	PUNCT
bam-7186	1	117	university	university	NOUN
bam-7186	1	118	of	of	ADP
bam-7186	1	119	palermo	palermo	NOUN
bam-7186	1	120	;	;	PUNCT
bam-7186	1	121	(	(	PUNCT
bam-7186	1	122	3	3	X
bam-7186	1	123	)	)	PUNCT
bam-7186	1	124	department	department	NOUN
bam-7186	1	125	of	of	ADP
bam-7186	1	126	psychological	psychological	ADJ
bam-7186	1	127	,	,	PUNCT
bam-7186	1	128	pedagogical	pedagogical	ADJ
bam-7186	1	129	and	and	CCONJ
bam-7186	1	130	educational	educational	ADJ
bam-7186	1	131	sciences	science	NOUN
bam-7186	1	132	,	,	PUNCT
bam-7186	1	133	sport	sport	NOUN
bam-7186	1	134	and	and	CCONJ
bam-7186	1	135	exercise	exercise	NOUN
bam-7186	1	136	sciences	sciences	PROPN
bam-7186	1	137	research	research	NOUN
bam-7186	1	138	unit	unit	NOUN
bam-7186	1	139	,	,	PUNCT
bam-7186	1	140	university	university	PROPN
bam-7186	1	141	of	of	ADP
bam-7186	1	142	palermo	palermo	PROPN
bam-7186	1	143	,	,	PUNCT
bam-7186	1	144	italy	italy	PROPN
bam-7186	1	145	.	.	PUNCT
bam-7186	2	1	this	this	DET
bam-7186	2	2	article	article	NOUN
bam-7186	2	3	is	be	AUX
bam-7186	2	4	distributed	distribute	VERB
bam-7186	2	5	under	under	ADP
bam-7186	2	6	the	the	DET
bam-7186	2	7	terms	term	NOUN
bam-7186	2	8	of	of	ADP
bam-7186	2	9	the	the	DET
bam-7186	2	10	creative	creative	ADJ
bam-7186	2	11	commons	common	NOUN
bam-7186	2	12	attribution	attribution	NOUN
bam-7186	2	13	noncommercial	noncommercial	ADJ
bam-7186	2	14	license	license	NOUN
bam-7186	2	15	(	(	PUNCT
bam-7186	2	16	cc	cc	NOUN
bam-7186	2	17	by	by	ADP
bam-7186	2	18	-	-	PUNCT
bam-7186	2	19	nc	nc	PROPN
bam-7186	2	20	4.0	4.0	NUM
bam-7186	2	21	)	)	PUNCT
bam-7186	2	22	which	which	PRON
bam-7186	2	23	permits	permit	VERB
bam-7186	2	24	any	any	DET
bam-7186	2	25	noncommercial	noncommercial	ADJ
bam-7186	2	26	use	use	NOUN
bam-7186	2	27	,	,	PUNCT
bam-7186	2	28	distribution	distribution	NOUN
bam-7186	2	29	,	,	PUNCT
bam-7186	2	30	and	and	CCONJ
bam-7186	2	31	reproduction	reproduction	NOUN
bam-7186	2	32	in	in	ADP
bam-7186	2	33	any	any	DET
bam-7186	2	34	medium	medium	NOUN
bam-7186	2	35	,	,	PUNCT
bam-7186	2	36	provided	provide	VERB
bam-7186	2	37	the	the	DET
bam-7186	2	38	original	original	ADJ
bam-7186	2	39	author(s	author(s	NOUN
bam-7186	2	40	)	)	PUNCT
bam-7186	2	41	and	and	CCONJ
bam-7186	2	42	source	source	NOUN
bam-7186	2	43	are	be	AUX
bam-7186	2	44	credited	credit	VERB
bam-7186	2	45	.	.	PUNCT
bam-7186	3	1	abstract	abstract	ADJ
bam-7186	3	2	the	the	DET
bam-7186	3	3	purpose	purpose	NOUN
bam-7186	3	4	of	of	ADP
bam-7186	3	5	this	this	DET
bam-7186	3	6	study	study	NOUN
bam-7186	3	7	was	be	AUX
bam-7186	3	8	to	to	PART
bam-7186	3	9	determine	determine	VERB
bam-7186	3	10	the	the	DET
bam-7186	3	11	probability	probability	NOUN
bam-7186	3	12	of	of	ADP
bam-7186	3	13	soccer	soccer	NOUN
bam-7186	3	14	players	player	NOUN
bam-7186	3	15	having	have	VERB
bam-7186	3	16	the	the	DET
bam-7186	3	17	best	good	ADJ
bam-7186	3	18	genetic	genetic	ADJ
bam-7186	3	19	background	background	NOUN
bam-7186	3	20	that	that	PRON
bam-7186	3	21	could	could	AUX
bam-7186	3	22	increase	increase	VERB
bam-7186	3	23	performance	performance	NOUN
bam-7186	3	24	,	,	PUNCT
bam-7186	3	25	evaluating	evaluate	VERB
bam-7186	3	26	the	the	DET
bam-7186	3	27	polymorphism	polymorphism	NOUN
bam-7186	3	28	that	that	PRON
bam-7186	3	29	are	be	AUX
bam-7186	3	30	considered	consider	VERB
bam-7186	3	31	performance	performance	NOUN
bam-7186	3	32	enhancing	enhance	VERB
bam-7186	3	33	polymorphism	polymorphism	NOUN
bam-7186	3	34	(	(	PUNCT
bam-7186	3	35	peps	pep	NOUN
bam-7186	3	36	)	)	PUNCT
bam-7186	3	37	distributed	distribute	VERB
bam-7186	3	38	on	on	ADP
bam-7186	3	39	five	five	NUM
bam-7186	3	40	genes	gene	NOUN
bam-7186	3	41	:	:	PUNCT
bam-7186	3	42	pparα	pparα	NOUN
bam-7186	3	43	,	,	PUNCT
bam-7186	3	44	ppargc1a	ppargc1a	NOUN
bam-7186	3	45	,	,	PUNCT
bam-7186	3	46	nrf2	nrf2	NOUN
bam-7186	3	47	,	,	PUNCT
bam-7186	3	48	ace	ace	NOUN
bam-7186	3	49	e	e	PROPN
bam-7186	3	50	ckmm	ckmm	NOUN
bam-7186	3	51	.	.	PUNCT
bam-7186	4	1	particularly	particularly	ADV
bam-7186	4	2	,	,	PUNCT
bam-7186	4	3	we	we	PRON
bam-7186	4	4	investigated	investigate	VERB
bam-7186	4	5	how	how	SCONJ
bam-7186	4	6	each	each	DET
bam-7186	4	7	polymorphism	polymorphism	NOUN
bam-7186	4	8	works	work	VERB
bam-7186	4	9	directly	directly	ADV
bam-7186	4	10	or	or	CCONJ
bam-7186	4	11	through	through	ADP
bam-7186	4	12	another	another	DET
bam-7186	4	13	polymorphism	polymorphism	NOUN
bam-7186	4	14	to	to	PART
bam-7186	4	15	distinguish	distinguish	VERB
bam-7186	4	16	elite	elite	ADJ
bam-7186	4	17	athletes	athlete	NOUN
bam-7186	4	18	from	from	ADP
bam-7186	4	19	non	non	ADJ
bam-7186	4	20	-	-	ADJ
bam-7186	4	21	athletic	athletic	ADJ
bam-7186	4	22	population	population	NOUN
bam-7186	4	23	.	.	PUNCT
bam-7186	5	1	sixty	sixty	NUM
bam-7186	5	2	professional	professional	ADJ
bam-7186	5	3	soccer	soccer	NOUN
bam-7186	5	4	players	player	NOUN
bam-7186	5	5	(	(	PUNCT
bam-7186	5	6	age	age	NOUN
bam-7186	5	7	22.5	22.5	NUM
bam-7186	5	8	±	±	NUM
bam-7186	5	9	2.2	2.2	NUM
bam-7186	5	10	)	)	PUNCT
bam-7186	5	11	and	and	CCONJ
bam-7186	5	12	sixty	sixty	NUM
bam-7186	5	13	healthy	healthy	ADJ
bam-7186	5	14	volunteers	volunteer	NOUN
bam-7186	5	15	(	(	PUNCT
bam-7186	5	16	age	age	NOUN
bam-7186	5	17	21.2±	21.2±	NOUN
bam-7186	5	18	2.3	2.3	NUM
bam-7186	5	19	)	)	PUNCT
bam-7186	5	20	were	be	AUX
bam-7186	5	21	enrolled	enrol	VERB
bam-7186	5	22	.	.	PUNCT
bam-7186	6	1	samples	sample	NOUN
bam-7186	6	2	of	of	ADP
bam-7186	6	3	venous	venous	ADJ
bam-7186	6	4	blood	blood	NOUN
bam-7186	6	5	was	be	AUX
bam-7186	6	6	used	use	VERB
bam-7186	6	7	to	to	PART
bam-7186	6	8	prepare	prepare	VERB
bam-7186	6	9	genomic	genomic	ADJ
bam-7186	6	10	dna	dna	NOUN
bam-7186	6	11	.	.	PUNCT
bam-7186	7	1	the	the	DET
bam-7186	7	2	polymorphic	polymorphic	ADJ
bam-7186	7	3	sites	site	NOUN
bam-7186	7	4	were	be	AUX
bam-7186	7	5	scanned	scan	VERB
bam-7186	7	6	using	use	VERB
bam-7186	7	7	pcr	pcr	ADJ
bam-7186	7	8	-	-	PUNCT
bam-7186	7	9	rflp	rflp	NOUN
bam-7186	7	10	protocols	protocol	NOUN
bam-7186	7	11	with	with	ADP
bam-7186	7	12	different	different	ADJ
bam-7186	7	13	enzyme	enzyme	NOUN
bam-7186	7	14	.	.	PUNCT
bam-7186	8	1	we	we	PRON
bam-7186	8	2	used	use	VERB
bam-7186	8	3	a	a	DET
bam-7186	8	4	multivariate	multivariate	NOUN
bam-7186	8	5	logistic	logistic	ADJ
bam-7186	8	6	regression	regression	NOUN
bam-7186	8	7	analysis	analysis	NOUN
bam-7186	8	8	to	to	PART
bam-7186	8	9	demonstrate	demonstrate	VERB
bam-7186	8	10	an	an	DET
bam-7186	8	11	association	association	NOUN
bam-7186	8	12	between	between	ADP
bam-7186	8	13	the	the	DET
bam-7186	8	14	five	five	NUM
bam-7186	8	15	peps	pep	NOUN
bam-7186	8	16	and	and	CCONJ
bam-7186	8	17	elite	elite	ADJ
bam-7186	8	18	phenotype	phenotype	NOUN
bam-7186	8	19	.	.	PUNCT
bam-7186	9	1	we	we	PRON
bam-7186	9	2	found	find	VERB
bam-7186	9	3	statistical	statistical	ADJ
bam-7186	9	4	significance	significance	NOUN
bam-7186	9	5	in	in	ADP
bam-7186	9	6	nrf2	nrf2	PROPN
bam-7186	9	7	(	(	PUNCT
bam-7186	9	8	ag	ag	PROPN
bam-7186	9	9	/	/	SYM
bam-7186	9	10	gg	gg	NOUN
bam-7186	9	11	genotype	genotype	NOUN
bam-7186	9	12	)	)	PUNCT
bam-7186	9	13	polymorphism	polymorphism	NOUN
bam-7186	9	14	/	/	SYM
bam-7186	9	15	soccer	soccer	NOUN
bam-7186	9	16	players	player	NOUN
bam-7186	9	17	association	association	NOUN
bam-7186	9	18	(	(	PUNCT
bam-7186	9	19	p	p	X
bam-7186	9	20	<	<	X
bam-7186	9	21	0.05	0.05	NUM
bam-7186	9	22	)	)	PUNCT
bam-7186	9	23	as	as	ADV
bam-7186	9	24	well	well	ADV
bam-7186	9	25	as	as	ADP
bam-7186	9	26	a	a	DET
bam-7186	9	27	stronger	strong	ADJ
bam-7186	9	28	association	association	NOUN
bam-7186	9	29	in	in	ADP
bam-7186	9	30	ace	ace	NOUN
bam-7186	9	31	polymorphism	polymorphism	NOUN
bam-7186	9	32	(	(	PUNCT
bam-7186	9	33	p	p	NOUN
bam-7186	9	34	=	=	NOUN
bam-7186	9	35	0.02	0.02	NUM
bam-7186	9	36	)	)	PUNCT
bam-7186	9	37	.	.	PUNCT
bam-7186	10	1	particularly	particularly	ADV
bam-7186	10	2	,	,	PUNCT
bam-7186	10	3	we	we	PRON
bam-7186	10	4	noticed	notice	VERB
bam-7186	10	5	that	that	SCONJ
bam-7186	10	6	the	the	DET
bam-7186	10	7	ace	ace	NOUN
bam-7186	10	8	i	i	PROPN
bam-7186	10	9	d	d	NOUN
bam-7186	10	10	genotype	genotype	NOUN
bam-7186	10	11	and	and	CCONJ
bam-7186	10	12	even	even	ADV
bam-7186	10	13	more	more	ADV
bam-7186	10	14	the	the	DET
bam-7186	10	15	ii	ii	PROPN
bam-7186	10	16	genotype	genotype	NOUN
bam-7186	10	17	are	be	AUX
bam-7186	10	18	associated	associate	VERB
bam-7186	10	19	with	with	ADP
bam-7186	10	20	soccer	soccer	NOUN
bam-7186	10	21	player	player	NOUN
bam-7186	10	22	phenotype	phenotype	NOUN
bam-7186	10	23	.	.	PUNCT
bam-7186	11	1	although	although	SCONJ
bam-7186	11	2	the	the	DET
bam-7186	11	3	other	other	ADJ
bam-7186	11	4	peps	pep	NOUN
bam-7186	11	5	had	have	VERB
bam-7186	11	6	no	no	DET
bam-7186	11	7	statistical	statistical	ADJ
bam-7186	11	8	significance	significance	NOUN
bam-7186	11	9	,	,	PUNCT
bam-7186	11	10	we	we	PRON
bam-7186	11	11	proved	prove	VERB
bam-7186	11	12	that	that	SCONJ
bam-7186	11	13	some	some	PRON
bam-7186	11	14	of	of	ADP
bam-7186	11	15	these	these	PRON
bam-7186	11	16	may	may	AUX
bam-7186	11	17	work	work	VERB
bam-7186	11	18	indirectly	indirectly	ADV
bam-7186	11	19	,	,	PUNCT
bam-7186	11	20	amplifying	amplify	VERB
bam-7186	11	21	the	the	DET
bam-7186	11	22	effect	effect	NOUN
bam-7186	11	23	of	of	ADP
bam-7186	11	24	another	another	DET
bam-7186	11	25	polymorphism	polymorphism	NOUN
bam-7186	11	26	;	;	PUNCT
bam-7186	11	27	for	for	ADP
bam-7186	11	28	example	example	NOUN
bam-7186	11	29	,	,	PUNCT
bam-7186	11	30	seems	seem	VERB
bam-7186	11	31	that	that	SCONJ
bam-7186	11	32	pparα	pparα	NOUN
bam-7186	11	33	could	could	AUX
bam-7186	11	34	acts	act	VERB
bam-7186	11	35	on	on	ADP
bam-7186	11	36	nrf2	nrf2	PROPN
bam-7186	11	37	(	(	PUNCT
bam-7186	11	38	gg	gg	NOUN
bam-7186	11	39	)	)	PUNCT
bam-7186	11	40	enhancing	enhance	VERB
bam-7186	11	41	the	the	DET
bam-7186	11	42	effect	effect	NOUN
bam-7186	11	43	of	of	ADP
bam-7186	11	44	the	the	DET
bam-7186	11	45	latter	latter	ADJ
bam-7186	11	46	,	,	PUNCT
bam-7186	11	47	notwithstanding	notwithstanding	SCONJ
bam-7186	11	48	it	it	PRON
bam-7186	11	49	had	have	AUX
bam-7186	11	50	not	not	PART
bam-7186	11	51	shown	show	VERB
bam-7186	11	52	a	a	DET
bam-7186	11	53	statistical	statistical	ADJ
bam-7186	11	54	significance	significance	NOUN
bam-7186	11	55	.	.	PUNCT
bam-7186	12	1	in	in	ADP
bam-7186	12	2	conclusion	conclusion	NOUN
bam-7186	12	3	,	,	PUNCT
bam-7186	12	4	to	to	PART
bam-7186	12	5	establish	establish	VERB
bam-7186	12	6	if	if	SCONJ
bam-7186	12	7	a	a	DET
bam-7186	12	8	polymorphism	polymorphism	NOUN
bam-7186	12	9	can	can	AUX
bam-7186	12	10	influence	influence	VERB
bam-7186	12	11	the	the	DET
bam-7186	12	12	performance	performance	NOUN
bam-7186	12	13	,	,	PUNCT
bam-7186	12	14	it	it	PRON
bam-7186	12	15	is	be	AUX
bam-7186	12	16	necessary	necessary	ADJ
bam-7186	12	17	to	to	PART
bam-7186	12	18	understand	understand	VERB
bam-7186	12	19	how	how	SCONJ
bam-7186	12	20	they	they	PRON
bam-7186	12	21	act	act	VERB
bam-7186	12	22	and	and	CCONJ
bam-7186	12	23	interact	interact	VERB
bam-7186	12	24	,	,	PUNCT
bam-7186	12	25	directly	directly	ADV
bam-7186	12	26	and	and	CCONJ
bam-7186	12	27	indirectly	indirectly	ADV
bam-7186	12	28	,	,	PUNCT
bam-7186	12	29	on	on	ADP
bam-7186	12	30	each	each	DET
bam-7186	12	31	other	other	ADJ
bam-7186	12	32	.	.	PUNCT
bam-7186	13	1	key	key	ADJ
bam-7186	13	2	words	word	NOUN
bam-7186	13	3	:	:	PUNCT
bam-7186	13	4	polymerase	polymerase	NOUN
bam-7186	13	5	chain	chain	NOUN
bam-7186	13	6	reaction	reaction	NOUN
bam-7186	13	7	-	-	PUNCT
bam-7186	13	8	restriction	restriction	NOUN
bam-7186	13	9	fragment	fragment	NOUN
bam-7186	13	10	length	length	NOUN
bam-7186	13	11	polymorphism	polymorphism	NOUN
bam-7186	13	12	,	,	PUNCT
bam-7186	13	13	performance	performance	NOUN
bam-7186	13	14	-	-	PUNCT
bam-7186	13	15	enhancing	enhance	VERB
bam-7186	13	16	polymorphisms	polymorphism	NOUN
bam-7186	13	17	,	,	PUNCT
bam-7186	13	18	performance	performance	NOUN
bam-7186	13	19	eur	eur	PROPN
bam-7186	13	20	j	j	PROPN
bam-7186	13	21	transl	transl	PROPN
bam-7186	13	22	myol	myol	ADV
bam-7186	13	23	28	28	NUM
bam-7186	13	24	(	(	PUNCT
bam-7186	13	25	1	1	NUM
bam-7186	13	26	):	):	PUNCT
bam-7186	13	27	87	87	NUM
bam-7186	13	28	-	-	SYM
bam-7186	13	29	92	92	NUM
bam-7186	13	30	,	,	PUNCT
bam-7186	13	31	2018	2018	NUM
bam-7186	13	32	the	the	DET
bam-7186	13	33	abilities	ability	NOUN
bam-7186	13	34	of	of	ADP
bam-7186	13	35	athletes	athlete	NOUN
bam-7186	13	36	to	to	PART
bam-7186	13	37	stand	stand	VERB
bam-7186	13	38	out	out	ADP
bam-7186	13	39	in	in	ADP
bam-7186	13	40	particular	particular	ADJ
bam-7186	13	41	physical	physical	ADJ
bam-7186	13	42	qualities	quality	NOUN
bam-7186	13	43	are	be	AUX
bam-7186	13	44	determined	determine	VERB
bam-7186	13	45	,	,	PUNCT
bam-7186	13	46	among	among	ADP
bam-7186	13	47	other	other	ADJ
bam-7186	13	48	things	thing	NOUN
bam-7186	13	49	,	,	PUNCT
bam-7186	13	50	by	by	ADP
bam-7186	13	51	adaptation	adaptation	NOUN
bam-7186	13	52	to	to	PART
bam-7186	13	53	stress	stress	NOUN
bam-7186	13	54	of	of	ADP
bam-7186	13	55	circulatory	circulatory	ADJ
bam-7186	13	56	,	,	PUNCT
bam-7186	13	57	respiratory	respiratory	ADJ
bam-7186	13	58	,	,	PUNCT
bam-7186	13	59	muscular	muscular	ADJ
bam-7186	13	60	and	and	CCONJ
bam-7186	13	61	other	other	ADJ
bam-7186	13	62	biological	biological	ADJ
bam-7186	13	63	systems	system	NOUN
bam-7186	13	64	.	.	PUNCT
bam-7186	14	1	the	the	DET
bam-7186	14	2	effectiveness	effectiveness	NOUN
bam-7186	14	3	of	of	ADP
bam-7186	14	4	these	these	DET
bam-7186	14	5	mechanisms	mechanism	NOUN
bam-7186	14	6	can	can	AUX
bam-7186	14	7	certainly	certainly	ADV
bam-7186	14	8	be	be	AUX
bam-7186	14	9	improved	improve	VERB
bam-7186	14	10	with	with	ADP
bam-7186	14	11	training	training	NOUN
bam-7186	14	12	.	.	PUNCT
bam-7186	15	1	biologically	biologically	ADV
bam-7186	15	2	,	,	PUNCT
bam-7186	15	3	it	it	PRON
bam-7186	15	4	joins	join	VERB
bam-7186	15	5	changes	change	NOUN
bam-7186	15	6	in	in	ADP
bam-7186	15	7	tissues	tissue	NOUN
bam-7186	15	8	and	and	CCONJ
bam-7186	15	9	cells	cell	NOUN
bam-7186	15	10	,	,	PUNCT
bam-7186	15	11	in	in	ADP
bam-7186	15	12	turn	turn	NOUN
bam-7186	15	13	depending	depend	VERB
bam-7186	15	14	on	on	ADP
bam-7186	15	15	local	local	ADJ
bam-7186	15	16	variations	variation	NOUN
bam-7186	15	17	of	of	ADP
bam-7186	15	18	gene	gene	NOUN
bam-7186	15	19	expression	expression	NOUN
bam-7186	15	20	.	.	PUNCT
bam-7186	16	1	the	the	DET
bam-7186	16	2	presence	presence	NOUN
bam-7186	16	3	of	of	ADP
bam-7186	16	4	specific	specific	ADJ
bam-7186	16	5	gene	gene	NOUN
bam-7186	16	6	variants	variant	NOUN
bam-7186	16	7	decides	decide	VERB
bam-7186	16	8	the	the	DET
bam-7186	16	9	prowess	prowess	NOUN
bam-7186	16	10	of	of	ADP
bam-7186	16	11	some	some	DET
bam-7186	16	12	physical	physical	ADJ
bam-7186	16	13	traits	trait	NOUN
bam-7186	16	14	,	,	PUNCT
bam-7186	16	15	such	such	ADJ
bam-7186	16	16	as	as	ADP
bam-7186	16	17	speed	speed	NOUN
bam-7186	16	18	,	,	PUNCT
bam-7186	16	19	muscle	muscle	NOUN
bam-7186	16	20	strength	strength	NOUN
bam-7186	16	21	,	,	PUNCT
bam-7186	16	22	greater	great	ADJ
bam-7186	16	23	possibility	possibility	NOUN
bam-7186	16	24	of	of	ADP
bam-7186	16	25	injury	injury	NOUN
bam-7186	16	26	and	and	CCONJ
bam-7186	16	27	even	even	ADV
bam-7186	16	28	emotional	emotional	ADJ
bam-7186	16	29	control.1,2	control.1,2	ADJ
bam-7186	16	30	invaluable	invaluable	ADJ
bam-7186	16	31	contributions	contribution	NOUN
bam-7186	16	32	were	be	AUX
bam-7186	16	33	provided	provide	VERB
bam-7186	16	34	by	by	ADP
bam-7186	16	35	both	both	CCONJ
bam-7186	16	36	the	the	DET
bam-7186	16	37	human	human	ADJ
bam-7186	16	38	genome	genome	NOUN
bam-7186	16	39	project,3	project,3	NOUN
bam-7186	16	40	that	that	PRON
bam-7186	16	41	sequenced	sequence	VERB
bam-7186	16	42	20.000	20.000	NUM
bam-7186	16	43	to	to	ADP
bam-7186	16	44	25.000	25.000	NUM
bam-7186	16	45	genes	gene	NOUN
bam-7186	16	46	,	,	PUNCT
bam-7186	16	47	and	and	CCONJ
bam-7186	16	48	subsequently	subsequently	ADV
bam-7186	16	49	by	by	ADP
bam-7186	16	50	the	the	DET
bam-7186	16	51	international	international	ADJ
bam-7186	16	52	hapmap	hapmap	PROPN
bam-7186	16	53	project	project	NOUN
bam-7186	16	54	,	,	PUNCT
bam-7186	16	55	that	that	PRON
bam-7186	16	56	identified	identify	VERB
bam-7186	16	57	variations	variation	NOUN
bam-7186	16	58	in	in	ADP
bam-7186	16	59	the	the	DET
bam-7186	16	60	human	human	ADJ
bam-7186	16	61	genome	genome	NOUN
bam-7186	16	62	and	and	CCONJ
bam-7186	16	63	genes	gene	NOUN
bam-7186	16	64	related	relate	VERB
bam-7186	16	65	to	to	ADP
bam-7186	16	66	common	common	ADJ
bam-7186	16	67	diseases	disease	NOUN
bam-7186	16	68	such	such	ADJ
bam-7186	16	69	as	as	ADP
bam-7186	16	70	asthma	asthma	NOUN
bam-7186	16	71	,	,	PUNCT
bam-7186	16	72	cancer	cancer	NOUN
bam-7186	16	73	,	,	PUNCT
bam-7186	16	74	diabetes	diabetes	NOUN
bam-7186	16	75	and	and	CCONJ
bam-7186	16	76	cardiovascular	cardiovascular	ADJ
bam-7186	16	77	diseases.4	diseases.4	PROPN
bam-7186	16	78	brey	brey	PROPN
bam-7186	16	79	et	et	PROPN
bam-7186	16	80	al.5	al.5	PROPN
bam-7186	16	81	have	have	AUX
bam-7186	16	82	instead	instead	ADV
bam-7186	16	83	developed	develop	VERB
bam-7186	16	84	a	a	DET
bam-7186	16	85	genetic	genetic	ADJ
bam-7186	16	86	polymorphisms	polymorphism	NOUN
bam-7186	16	87	map	map	NOUN
bam-7186	16	88	that	that	PRON
bam-7186	16	89	may	may	AUX
bam-7186	16	90	be	be	AUX
bam-7186	16	91	associated	associate	VERB
bam-7186	16	92	with	with	ADP
bam-7186	16	93	predispositions	predisposition	NOUN
bam-7186	16	94	of	of	ADP
bam-7186	16	95	better	well	ADJ
bam-7186	16	96	fitness	fitness	NOUN
bam-7186	16	97	and	and	CCONJ
bam-7186	16	98	sports	sport	NOUN
bam-7186	16	99	results	result	NOUN
bam-7186	16	100	.	.	PUNCT
bam-7186	17	1	239	239	NUM
bam-7186	17	2	fitness	fitness	NOUN
bam-7186	17	3	genes	gene	NOUN
bam-7186	17	4	were	be	AUX
bam-7186	17	5	identified	identify	VERB
bam-7186	17	6	:	:	PUNCT
bam-7186	17	7	7	7	NUM
bam-7186	17	8	in	in	ADP
bam-7186	17	9	chromosomes	chromosome	NOUN
bam-7186	17	10	x	x	SYM
bam-7186	17	11	,	,	PUNCT
bam-7186	17	12	18	18	NUM
bam-7186	17	13	in	in	ADP
bam-7186	17	14	mitochondrial	mitochondrial	ADJ
bam-7186	17	15	dna	dna	NOUN
bam-7186	17	16	and	and	CCONJ
bam-7186	17	17	214	214	NUM
bam-7186	17	18	in	in	ADP
bam-7186	17	19	autosomes	autosome	NOUN
bam-7186	17	20	.	.	PUNCT
bam-7186	18	1	since	since	SCONJ
bam-7186	18	2	several	several	ADJ
bam-7186	18	3	years	year	NOUN
bam-7186	18	4	,	,	PUNCT
bam-7186	18	5	researchers	researcher	NOUN
bam-7186	18	6	are	be	AUX
bam-7186	18	7	focusing	focus	VERB
bam-7186	18	8	their	their	PRON
bam-7186	18	9	interest	interest	NOUN
bam-7186	18	10	on	on	ADP
bam-7186	18	11	research	research	NOUN
bam-7186	18	12	of	of	ADP
bam-7186	18	13	the	the	DET
bam-7186	18	14	“	"	PUNCT
bam-7186	18	15	right	right	ADJ
bam-7186	18	16	”	"	PUNCT
bam-7186	18	17	genetic	genetic	ADJ
bam-7186	18	18	profile	profile	NOUN
bam-7186	18	19	that	that	PRON
bam-7186	18	20	can	can	AUX
bam-7186	18	21	contribute	contribute	VERB
bam-7186	18	22	to	to	ADP
bam-7186	18	23	athletic	athletic	ADJ
bam-7186	18	24	performance	performance	NOUN
bam-7186	18	25	and	and	CCONJ
bam-7186	18	26	to	to	PART
bam-7186	18	27	determine	determine	VERB
bam-7186	18	28	the	the	DET
bam-7186	18	29	mechanisms	mechanism	NOUN
bam-7186	18	30	that	that	PRON
bam-7186	18	31	can	can	AUX
bam-7186	18	32	guide	guide	VERB
bam-7186	18	33	a	a	DET
bam-7186	18	34	person	person	NOUN
bam-7186	18	35	to	to	ADP
bam-7186	18	36	a	a	DET
bam-7186	18	37	specific	specific	ADJ
bam-7186	18	38	athletic	athletic	ADJ
bam-7186	18	39	field.6	field.6	NUM
bam-7186	18	40	-	-	SYM
bam-7186	18	41	8	8	NUM
bam-7186	18	42	contributions	contribution	NOUN
bam-7186	18	43	of	of	ADP
bam-7186	18	44	genotype	genotype	NOUN
bam-7186	18	45	and	and	CCONJ
bam-7186	18	46	phenotype	phenotype	NOUN
bam-7186	18	47	to	to	PART
bam-7186	18	48	achieve	achieve	VERB
bam-7186	18	49	elite	elite	ADJ
bam-7186	18	50	performance	performance	NOUN
bam-7186	18	51	is	be	AUX
bam-7186	18	52	still	still	ADV
bam-7186	18	53	not	not	PART
bam-7186	18	54	known	know	VERB
bam-7186	18	55	.	.	PUNCT
bam-7186	19	1	adaptations	adaptation	NOUN
bam-7186	19	2	to	to	ADP
bam-7186	19	3	a	a	DET
bam-7186	19	4	resistance	resistance	NOUN
bam-7186	19	5	effort	effort	NOUN
bam-7186	19	6	are	be	AUX
bam-7186	19	7	strongly	strongly	ADV
bam-7186	19	8	supported	support	VERB
bam-7186	19	9	by	by	ADP
bam-7186	19	10	the	the	DET
bam-7186	19	11	non	non	PROPN
bam-7186	19	12	co	co	PROPN
bam-7186	19	13	mmerc	mmerc	PROPN
bam-7186	19	14	ial	ial	PROPN
bam-7186	20	1	us	us	PROPN
bam-7186	20	2	e	e	NOUN
bam-7186	20	3	o	o	NOUN
bam-7186	20	4	nly	nly	ADV
bam-7186	20	5	polymorphisms	polymorphism	NOUN
bam-7186	20	6	of	of	ADP
bam-7186	20	7	elite	elite	ADJ
bam-7186	20	8	athletes	athlete	NOUN
bam-7186	20	9	phenotype	phenotype	VERB
bam-7186	20	10	eur	eur	PROPN
bam-7186	20	11	j	j	PROPN
bam-7186	20	12	transl	transl	PROPN
bam-7186	20	13	myol	myol	ADV
bam-7186	20	14	28	28	NUM
bam-7186	20	15	(	(	PUNCT
bam-7186	20	16	1	1	NUM
bam-7186	20	17	):	):	PUNCT
bam-7186	20	18	87	87	NUM
bam-7186	20	19	-	-	SYM
bam-7186	20	20	92	92	NUM
bam-7186	20	21	,	,	PUNCT
bam-7186	20	22	2018	2018	NUM
bam-7186	20	23	88	88	NUM
bam-7186	20	24	mitochondrial	mitochondrial	ADJ
bam-7186	20	25	functions	function	NOUN
bam-7186	20	26	:	:	PUNCT
bam-7186	20	27	it	it	PRON
bam-7186	20	28	is	be	AUX
bam-7186	20	29	determined	determine	VERB
bam-7186	20	30	by	by	ADP
bam-7186	20	31	genes	gene	NOUN
bam-7186	20	32	of	of	ADP
bam-7186	20	33	nuclear	nuclear	ADJ
bam-7186	20	34	and	and	CCONJ
bam-7186	20	35	mitochondrial	mitochondrial	ADJ
bam-7186	20	36	dna	dna	NOUN
bam-7186	20	37	that	that	PRON
bam-7186	20	38	encode	encode	ADJ
bam-7186	20	39	enzymes	enzyme	NOUN
bam-7186	20	40	of	of	ADP
bam-7186	20	41	energy	energy	NOUN
bam-7186	20	42	metabolism	metabolism	NOUN
bam-7186	20	43	and	and	CCONJ
bam-7186	20	44	are	be	AUX
bam-7186	20	45	associated	associate	VERB
bam-7186	20	46	with	with	ADP
bam-7186	20	47	aerobic	aerobic	ADJ
bam-7186	20	48	physical	physical	ADJ
bam-7186	20	49	fitness	fitness	NOUN
bam-7186	20	50	and	and	CCONJ
bam-7186	20	51	insulin	insulin	NOUN
bam-7186	20	52	sensitivity	sensitivity	NOUN
bam-7186	20	53	,	,	PUNCT
bam-7186	20	54	a	a	DET
bam-7186	20	55	factor	factor	NOUN
bam-7186	20	56	that	that	PRON
bam-7186	20	57	could	could	AUX
bam-7186	20	58	play	play	VERB
bam-7186	20	59	a	a	DET
bam-7186	20	60	key	key	ADJ
bam-7186	20	61	role	role	NOUN
bam-7186	20	62	in	in	ADP
bam-7186	20	63	the	the	DET
bam-7186	20	64	pathophysiology	pathophysiology	NOUN
bam-7186	20	65	of	of	ADP
bam-7186	20	66	type	type	NOUN
bam-7186	20	67	2	2	NUM
bam-7186	20	68	diabetes	diabetes	NOUN
bam-7186	20	69	.	.	PUNCT
bam-7186	21	1	for	for	ADP
bam-7186	21	2	example	example	NOUN
bam-7186	21	3	,	,	PUNCT
bam-7186	21	4	the	the	DET
bam-7186	21	5	genes	gene	NOUN
bam-7186	21	6	coding	code	VERB
bam-7186	21	7	for	for	ADP
bam-7186	21	8	the	the	DET
bam-7186	21	9	peroxisome	peroxisome	PROPN
bam-7186	21	10	proliferator	proliferator	NOUN
bam-7186	21	11	-	-	PUNCT
bam-7186	21	12	activated	activate	VERB
bam-7186	21	13	receptor	receptor	NOUN
bam-7186	21	14	(	(	PUNCT
bam-7186	21	15	ppar	ppar	NOUN
bam-7186	21	16	)	)	PUNCT
bam-7186	21	17	delta	delta	NOUN
bam-7186	21	18	and	and	CCONJ
bam-7186	21	19	gamma	gamma	PROPN
bam-7186	21	20	coactivator	coactivator	PROPN
bam-7186	21	21	1	1	NUM
bam-7186	21	22	alpha	alpha	NOUN
bam-7186	21	23	,	,	PUNCT
bam-7186	21	24	which	which	PRON
bam-7186	21	25	will	will	AUX
bam-7186	21	26	be	be	AUX
bam-7186	21	27	discussed	discuss	VERB
bam-7186	21	28	in	in	ADP
bam-7186	21	29	details	detail	NOUN
bam-7186	21	30	below	below	ADV
bam-7186	21	31	,	,	PUNCT
bam-7186	21	32	are	be	AUX
bam-7186	21	33	very	very	ADV
bam-7186	21	34	important	important	ADJ
bam-7186	21	35	for	for	ADP
bam-7186	21	36	proper	proper	ADJ
bam-7186	21	37	functions	function	NOUN
bam-7186	21	38	of	of	ADP
bam-7186	21	39	mitochondria	mitochondria	NOUN
bam-7186	21	40	.	.	PUNCT
bam-7186	22	1	ppar	ppar	PROPN
bam-7186	22	2	δ	δ	PROPN
bam-7186	22	3	,	,	PUNCT
bam-7186	22	4	in	in	ADP
bam-7186	22	5	particular	particular	ADJ
bam-7186	22	6	,	,	PUNCT
bam-7186	22	7	regulates	regulate	VERB
bam-7186	22	8	the	the	DET
bam-7186	22	9	expression	expression	NOUN
bam-7186	22	10	of	of	ADP
bam-7186	22	11	genes	gene	NOUN
bam-7186	22	12	involved	involve	VERB
bam-7186	22	13	in	in	ADP
bam-7186	22	14	lipid	lipid	NOUN
bam-7186	22	15	and	and	CCONJ
bam-7186	22	16	carbohydrate	carbohydrate	VERB
bam-7186	22	17	metabolism	metabolism	NOUN
bam-7186	22	18	and	and	CCONJ
bam-7186	22	19	one	one	NUM
bam-7186	22	20	of	of	ADP
bam-7186	22	21	its	its	PRON
bam-7186	22	22	functional	functional	ADJ
bam-7186	22	23	polymorphism	polymorphism	NOUN
bam-7186	22	24	has	have	AUX
bam-7186	22	25	been	be	AUX
bam-7186	22	26	associated	associate	VERB
bam-7186	22	27	with	with	ADP
bam-7186	22	28	a	a	DET
bam-7186	22	29	predisposition	predisposition	NOUN
bam-7186	22	30	for	for	ADP
bam-7186	22	31	an	an	DET
bam-7186	22	32	endurace	endurace	NOUN
bam-7186	22	33	performance.9	performance.9	NOUN
bam-7186	22	34	nuclear	nuclear	ADJ
bam-7186	22	35	respiratory	respiratory	ADJ
bam-7186	22	36	factors	factor	NOUN
bam-7186	22	37	nrf1	nrf1	ADJ
bam-7186	22	38	and	and	CCONJ
bam-7186	22	39	nrf2	nrf2	PROPN
bam-7186	22	40	coordinate	coordinate	VERB
bam-7186	22	41	the	the	DET
bam-7186	22	42	expression	expression	NOUN
bam-7186	22	43	of	of	ADP
bam-7186	22	44	nuclear	nuclear	ADJ
bam-7186	22	45	and	and	CCONJ
bam-7186	22	46	mitochondrial	mitochondrial	ADJ
bam-7186	22	47	genes	gene	NOUN
bam-7186	22	48	relevant	relevant	ADJ
bam-7186	22	49	to	to	ADP
bam-7186	22	50	mitochondrial	mitochondrial	ADJ
bam-7186	22	51	biogenesis	biogenesis	NOUN
bam-7186	22	52	and	and	CCONJ
bam-7186	22	53	cellular	cellular	ADJ
bam-7186	22	54	respiration	respiration	NOUN
bam-7186	22	55	.	.	PUNCT
bam-7186	23	1	the	the	DET
bam-7186	23	2	polymorphism	polymorphism	NOUN
bam-7186	23	3	carriers	carrier	NOUN
bam-7186	23	4	in	in	ADP
bam-7186	23	5	the	the	DET
bam-7186	23	6	opening	opening	NOUN
bam-7186	23	7	translation	translation	NOUN
bam-7186	23	8	sequence	sequence	NOUN
bam-7186	23	9	atg	atg	PROPN
bam-7186	23	10	of	of	ADP
bam-7186	23	11	the	the	DET
bam-7186	23	12	gene	gene	NOUN
bam-7186	23	13	nrf2	nrf2	NOUN
bam-7186	23	14	prove	prove	VERB
bam-7186	23	15	to	to	PART
bam-7186	23	16	have	have	VERB
bam-7186	23	17	a	a	DET
bam-7186	23	18	greater	great	ADJ
bam-7186	23	19	run	run	NOUN
bam-7186	23	20	economy	economy	NOUN
bam-7186	23	21	than	than	ADP
bam-7186	23	22	non	non	NOUN
bam-7186	23	23	-	-	NOUN
bam-7186	23	24	carriers	carrier	NOUN
bam-7186	23	25	,	,	PUNCT
bam-7186	23	26	which	which	PRON
bam-7186	23	27	could	could	AUX
bam-7186	23	28	potentially	potentially	ADV
bam-7186	23	29	explain	explain	VERB
bam-7186	23	30	inter	inter	ADJ
bam-7186	23	31	-	-	ADJ
bam-7186	23	32	individual	individual	ADJ
bam-7186	23	33	differences	difference	NOUN
bam-7186	23	34	in	in	ADP
bam-7186	23	35	endurance	endurance	NOUN
bam-7186	23	36	capacity.10	capacity.10	NOUN
bam-7186	23	37	ppargc1	ppargc1	PROPN
bam-7186	23	38	is	be	AUX
bam-7186	23	39	an	an	DET
bam-7186	23	40	important	important	ADJ
bam-7186	23	41	cofactor	cofactor	NOUN
bam-7186	23	42	that	that	PRON
bam-7186	23	43	regulates	regulate	VERB
bam-7186	23	44	gene	gene	NOUN
bam-7186	23	45	expression	expression	NOUN
bam-7186	23	46	related	relate	VERB
bam-7186	23	47	to	to	ADP
bam-7186	23	48	oxidative	oxidative	ADJ
bam-7186	23	49	phosphorylation	phosphorylation	NOUN
bam-7186	23	50	and	and	CCONJ
bam-7186	23	51	atp	atp	NOUN
bam-7186	23	52	production	production	NOUN
bam-7186	23	53	in	in	ADP
bam-7186	23	54	target	target	NOUN
bam-7186	23	55	tissues	tissue	NOUN
bam-7186	23	56	through	through	ADP
bam-7186	23	57	coactivation	coactivation	NOUN
bam-7186	23	58	of	of	ADP
bam-7186	23	59	nuclear	nuclear	ADJ
bam-7186	23	60	receptors	receptor	NOUN
bam-7186	23	61	.	.	PUNCT
bam-7186	24	1	studies	study	NOUN
bam-7186	24	2	in	in	ADP
bam-7186	24	3	mice	mouse	NOUN
bam-7186	24	4	show	show	VERB
bam-7186	24	5	that	that	SCONJ
bam-7186	24	6	it	it	PRON
bam-7186	24	7	increases	increase	VERB
bam-7186	24	8	performance	performance	NOUN
bam-7186	24	9	during	during	ADP
bam-7186	24	10	a	a	DET
bam-7186	24	11	test	test	NOUN
bam-7186	24	12	carried	carry	VERB
bam-7186	24	13	out	out	ADP
bam-7186	24	14	at	at	ADP
bam-7186	24	15	vo2	vo2	PROPN
bam-7186	24	16	peak	peak	NOUN
bam-7186	24	17	,	,	PUNCT
bam-7186	24	18	showing	show	VERB
bam-7186	24	19	an	an	DET
bam-7186	24	20	increase	increase	NOUN
bam-7186	24	21	of	of	ADP
bam-7186	24	22	oxidative	oxidative	ADJ
bam-7186	24	23	peak	peak	NOUN
bam-7186	24	24	capacity	capacity	NOUN
bam-7186	24	25	or	or	CCONJ
bam-7186	24	26	greater	great	ADJ
bam-7186	24	27	oxygen	oxygen	NOUN
bam-7186	24	28	consumption	consumption	NOUN
bam-7186	24	29	throughout	throughout	ADP
bam-7186	24	30	the	the	DET
bam-7186	24	31	body.11	body.11	VERB
bam-7186	24	32	studies	study	NOUN
bam-7186	24	33	have	have	AUX
bam-7186	24	34	shown	show	VERB
bam-7186	24	35	that	that	SCONJ
bam-7186	24	36	ppargc1a	ppargc1a	NOUN
bam-7186	24	37	(	(	PUNCT
bam-7186	24	38	gly482ser	gly482ser	NOUN
bam-7186	24	39	)	)	PUNCT
bam-7186	24	40	polymorphism	polymorphism	NOUN
bam-7186	24	41	is	be	AUX
bam-7186	24	42	associated	associate	VERB
bam-7186	24	43	with	with	ADP
bam-7186	24	44	state	state	NOUN
bam-7186	24	45	athletic	athletic	ADJ
bam-7186	24	46	strength	strength	NOUN
bam-7186	24	47	/	/	SYM
bam-7186	24	48	power	power	NOUN
bam-7186	24	49	,	,	PUNCT
bam-7186	24	50	and	and	CCONJ
bam-7186	24	51	in	in	ADP
bam-7186	24	52	particular	particular	ADJ
bam-7186	24	53	,	,	PUNCT
bam-7186	24	54	the	the	DET
bam-7186	24	55	ppargc1a	ppargc1a	NOUN
bam-7186	24	56	ser	ser	NOUN
bam-7186	24	57	/	/	SYM
bam-7186	24	58	ser	ser	NOUN
bam-7186	24	59	genotype	genotype	NOUN
bam-7186	24	60	seems	seem	VERB
bam-7186	24	61	more	more	ADV
bam-7186	24	62	favorable	favorable	ADJ
bam-7186	24	63	to	to	ADP
bam-7186	24	64	athletes	athlete	NOUN
bam-7186	24	65	more	more	ADV
bam-7186	24	66	powerful	powerful	ADJ
bam-7186	24	67	than	than	ADP
bam-7186	24	68	controls	control	NOUN
bam-7186	24	69	.	.	PUNCT
bam-7186	25	1	in	in	ADP
bam-7186	25	2	these	these	DET
bam-7186	25	3	athletes	athlete	NOUN
bam-7186	25	4	there	there	PRON
bam-7186	25	5	was	be	VERB
bam-7186	25	6	an	an	DET
bam-7186	25	7	increase	increase	NOUN
bam-7186	25	8	in	in	ADP
bam-7186	25	9	the	the	DET
bam-7186	25	10	contribution	contribution	NOUN
bam-7186	25	11	of	of	ADP
bam-7186	25	12	the	the	DET
bam-7186	25	13	anaerobic	anaerobic	NOUN
bam-7186	25	14	system	system	NOUN
bam-7186	25	15	to	to	ADP
bam-7186	25	16	the	the	DET
bam-7186	25	17	production	production	NOUN
bam-7186	25	18	of	of	ADP
bam-7186	25	19	energy	energy	NOUN
bam-7186	25	20	needed	need	VERB
bam-7186	25	21	for	for	ADP
bam-7186	25	22	exercise	exercise	NOUN
bam-7186	25	23	.	.	PUNCT
bam-7186	26	1	athletes	athlete	NOUN
bam-7186	26	2	undergoing	undergo	VERB
bam-7186	26	3	a	a	DET
bam-7186	26	4	heavyweight	heavyweight	ADJ
bam-7186	26	5	training	training	NOUN
bam-7186	26	6	program	program	NOUN
bam-7186	26	7	that	that	PRON
bam-7186	26	8	had	have	VERB
bam-7186	26	9	this	this	DET
bam-7186	26	10	genotype	genotype	NOUN
bam-7186	26	11	showed	show	VERB
bam-7186	26	12	an	an	DET
bam-7186	26	13	advantage	advantage	NOUN
bam-7186	26	14	in	in	ADP
bam-7186	26	15	developing	develop	VERB
bam-7186	26	16	resistance.12	resistance.12	NOUN
bam-7186	26	17	the	the	DET
bam-7186	26	18	mitochondrial	mitochondrial	ADJ
bam-7186	26	19	synthesis	synthesis	NOUN
bam-7186	26	20	is	be	AUX
bam-7186	26	21	stimulated	stimulate	VERB
bam-7186	26	22	by	by	ADP
bam-7186	26	23	the	the	DET
bam-7186	26	24	pathway	pathway	NOUN
bam-7186	26	25	ppargc1a	ppargc1a	PROPN
bam-7186	26	26	(	(	PUNCT
bam-7186	26	27	peroxisome	peroxisome	VERB
bam-7186	26	28	proliferatoractivated	proliferatoractivate	VERB
bam-7186	26	29	receptor	receptor	NOUN
bam-7186	26	30	coactivator	coactivator	NOUN
bam-7186	26	31	1	1	NUM
bam-7186	26	32	gamma	gamma	NOUN
bam-7186	26	33	alpha)-nrf	alpha)-nrf	PROPN
bam-7186	26	34	(	(	PUNCT
bam-7186	26	35	nuclear	nuclear	ADJ
bam-7186	26	36	respiratory	respiratory	ADJ
bam-7186	26	37	factor)-tfam	factor)-tfam	PROPN
bam-7186	26	38	(	(	PUNCT
bam-7186	26	39	mitochondrial	mitochondrial	ADJ
bam-7186	26	40	transciption	transciption	NOUN
bam-7186	26	41	factor	factor	NOUN
bam-7186	26	42	a	a	NOUN
bam-7186	26	43	)	)	PUNCT
bam-7186	26	44	.	.	PUNCT
bam-7186	27	1	in	in	ADP
bam-7186	27	2	summary	summary	NOUN
bam-7186	27	3	,	,	PUNCT
bam-7186	27	4	the	the	DET
bam-7186	27	5	receptor	receptor	NOUN
bam-7186	27	6	peroxisome	peroxisome	VERB
bam-7186	27	7	proliferator	proliferator	NOUN
bam-7186	27	8	-	-	PUNCT
bam-7186	27	9	activated	activate	VERB
bam-7186	27	10	receptor	receptor	NOUN
bam-7186	27	11	-	-	PUNCT
bam-7186	27	12	δ	δ	NOUN
bam-7186	27	13	(	(	PUNCT
bam-7186	27	14	ppar	ppar	NOUN
bam-7186	27	15	-	-	PUNCT
bam-7186	27	16	δ	δ	NOUN
bam-7186	27	17	)	)	PUNCT
bam-7186	27	18	leads	lead	VERB
bam-7186	27	19	the	the	DET
bam-7186	27	20	promotion	promotion	NOUN
bam-7186	27	21	of	of	ADP
bam-7186	27	22	ppargc1a	ppargc1a	PROPN
bam-7186	27	23	,	,	PUNCT
bam-7186	27	24	which	which	PRON
bam-7186	27	25	is	be	AUX
bam-7186	27	26	the	the	DET
bam-7186	27	27	first	first	ADJ
bam-7186	27	28	stimulator	stimulator	NOUN
bam-7186	27	29	of	of	ADP
bam-7186	27	30	mitochondrial	mitochondrial	ADJ
bam-7186	27	31	biogenesis	biogenesis	NOUN
bam-7186	27	32	.	.	PUNCT
bam-7186	28	1	factors	factor	NOUN
bam-7186	28	2	nrf1	nrf1	ADV
bam-7186	28	3	and	and	CCONJ
bam-7186	28	4	nrf2	nrf2	PROPN
bam-7186	28	5	are	be	AUX
bam-7186	28	6	intermediate	intermediate	ADJ
bam-7186	28	7	transcription	transcription	NOUN
bam-7186	28	8	factors	factor	NOUN
bam-7186	28	9	that	that	PRON
bam-7186	28	10	stimulate	stimulate	VERB
bam-7186	28	11	the	the	DET
bam-7186	28	12	synthesis	synthesis	NOUN
bam-7186	28	13	of	of	ADP
bam-7186	28	14	tfam	tfam	NOUN
bam-7186	28	15	,	,	PUNCT
bam-7186	28	16	and	and	CCONJ
bam-7186	28	17	the	the	DET
bam-7186	28	18	latter	latter	ADJ
bam-7186	28	19	is	be	AUX
bam-7186	28	20	the	the	DET
bam-7186	28	21	final	final	ADJ
bam-7186	28	22	effector	effector	NOUN
bam-7186	28	23	that	that	PRON
bam-7186	28	24	activates	activate	VERB
bam-7186	28	25	replication	replication	NOUN
bam-7186	28	26	of	of	ADP
bam-7186	28	27	mitochondrial	mitochondrial	ADJ
bam-7186	28	28	dna	dna	NOUN
bam-7186	28	29	molecules.13	molecules.13	NUM
bam-7186	28	30	.	.	PUNCT
bam-7186	29	1	among	among	ADP
bam-7186	29	2	the	the	DET
bam-7186	29	3	factors	factor	NOUN
bam-7186	29	4	that	that	PRON
bam-7186	29	5	may	may	AUX
bam-7186	29	6	affect	affect	VERB
bam-7186	29	7	this	this	DET
bam-7186	29	8	pathway	pathway	NOUN
bam-7186	29	9	,	,	PUNCT
bam-7186	29	10	some	some	DET
bam-7186	29	11	genetic	genetic	ADJ
bam-7186	29	12	variations	variation	NOUN
bam-7186	29	13	should	should	AUX
bam-7186	29	14	be	be	AUX
bam-7186	29	15	included	include	VERB
bam-7186	29	16	,	,	PUNCT
bam-7186	29	17	which	which	PRON
bam-7186	29	18	can	can	AUX
bam-7186	29	19	have	have	VERB
bam-7186	29	20	effects	effect	NOUN
bam-7186	29	21	individually	individually	ADV
bam-7186	29	22	or	or	CCONJ
bam-7186	29	23	in	in	ADP
bam-7186	29	24	combination	combination	NOUN
bam-7186	29	25	with	with	ADP
bam-7186	29	26	physical	physical	ADJ
bam-7186	29	27	activity	activity	NOUN
bam-7186	29	28	.	.	PUNCT
bam-7186	30	1	for	for	ADP
bam-7186	30	2	example	example	NOUN
bam-7186	30	3	,	,	PUNCT
bam-7186	30	4	the	the	DET
bam-7186	30	5	functional	functional	ADJ
bam-7186	30	6	polymorphism	polymorphism	NOUN
bam-7186	30	7	c294	c294	PROPN
bam-7186	30	8	t	t	PROPN
bam-7186	30	9	(	(	PUNCT
bam-7186	30	10	rs2016520	rs2016520	PROPN
bam-7186	30	11	)	)	PUNCT
bam-7186	30	12	of	of	ADP
bam-7186	30	13	the	the	DET
bam-7186	30	14	gene	gene	NOUN
bam-7186	30	15	encoding	encode	VERB
bam-7186	30	16	ppar	ppar	NOUN
bam-7186	30	17	-	-	PUNCT
bam-7186	30	18	δ	δ	PROPN
bam-7186	30	19	and	and	CCONJ
bam-7186	30	20	gly482ser	gly482ser	NOUN
bam-7186	30	21	polymorphism	polymorphism	NOUN
bam-7186	30	22	(	(	PUNCT
bam-7186	30	23	rs8192678	rs8192678	PROPN
bam-7186	30	24	)	)	PUNCT
bam-7186	30	25	of	of	ADP
bam-7186	30	26	the	the	DET
bam-7186	30	27	gene	gene	NOUN
bam-7186	30	28	encoding	encode	VERB
bam-7186	30	29	ppargc1a	ppargc1a	NOUN
bam-7186	30	30	could	could	AUX
bam-7186	30	31	play	play	VERB
bam-7186	30	32	a	a	DET
bam-7186	30	33	key	key	ADJ
bam-7186	30	34	role	role	NOUN
bam-7186	30	35	in	in	ADP
bam-7186	30	36	the	the	DET
bam-7186	30	37	activity	activity	NOUN
bam-7186	30	38	of	of	ADP
bam-7186	30	39	protein	protein	NOUN
bam-7186	30	40	and/or	and/or	CCONJ
bam-7186	30	41	mrna	mrna	PROPN
bam-7186	30	42	.	.	PUNCT
bam-7186	31	1	the	the	DET
bam-7186	31	2	c	c	PROPN
bam-7186	31	3	allele	allele	NOUN
bam-7186	31	4	of	of	ADP
bam-7186	31	5	the	the	DET
bam-7186	31	6	c294	c294	PROPN
bam-7186	31	7	t	t	NOUN
bam-7186	31	8	polymorphism	polymorphism	NOUN
bam-7186	31	9	of	of	ADP
bam-7186	31	10	ppar	ppar	NOUN
bam-7186	31	11	-	-	PUNCT
bam-7186	31	12	δ	δ	NOUN
bam-7186	31	13	(	(	PUNCT
bam-7186	31	14	site	site	NOUN
bam-7186	31	15	in	in	ADP
bam-7186	31	16	exon	exon	NOUN
bam-7186	31	17	4	4	NUM
bam-7186	31	18	)	)	PUNCT
bam-7186	31	19	is	be	AUX
bam-7186	31	20	associated	associate	VERB
bam-7186	31	21	with	with	ADP
bam-7186	31	22	a	a	DET
bam-7186	31	23	highest	high	ADJ
bam-7186	31	24	transcriptional	transcriptional	ADJ
bam-7186	31	25	activity	activity	NOUN
bam-7186	31	26	of	of	ADP
bam-7186	31	27	the	the	DET
bam-7186	31	28	ppar	ppar	NOUN
bam-7186	31	29	-	-	PUNCT
bam-7186	31	30	δ	δ	NOUN
bam-7186	31	31	promoter	promoter	NOUN
bam-7186	31	32	,	,	PUNCT
bam-7186	31	33	inducing	induce	VERB
bam-7186	31	34	a	a	DET
bam-7186	31	35	binding	bind	VERB
bam-7186	31	36	site	site	NOUN
bam-7186	31	37	for	for	ADP
bam-7186	31	38	the	the	DET
bam-7186	31	39	transcription	transcription	NOUN
bam-7186	31	40	factor	factor	NOUN
bam-7186	31	41	sp-1.14	sp-1.14	PROPN
bam-7186	31	42	the	the	DET
bam-7186	31	43	minor	minor	ADJ
bam-7186	31	44	allele	allele	NOUN
bam-7186	31	45	of	of	ADP
bam-7186	31	46	ppargc1a	ppargc1a	NOUN
bam-7186	31	47	ser482	ser482	PROPN
bam-7186	31	48	is	be	AUX
bam-7186	31	49	associated	associate	VERB
bam-7186	31	50	with	with	ADP
bam-7186	31	51	a	a	DET
bam-7186	31	52	more	more	ADV
bam-7186	31	53	modest	modest	ADJ
bam-7186	31	54	capacity	capacity	NOUN
bam-7186	31	55	of	of	ADP
bam-7186	31	56	endurance	endurance	NOUN
bam-7186	31	57	during	during	ADP
bam-7186	31	58	physical	physical	ADJ
bam-7186	31	59	activity.15	activity.15	NOUN
bam-7186	31	60	the	the	DET
bam-7186	31	61	g	g	PROPN
bam-7186	31	62	allele	allele	NOUN
bam-7186	31	63	of	of	ADP
bam-7186	31	64	the	the	DET
bam-7186	31	65	variant	variant	NOUN
bam-7186	31	66	a	a	PRON
bam-7186	31	67	/	/	SYM
bam-7186	31	68	g	g	NOUN
bam-7186	31	69	intron	intron	ADJ
bam-7186	31	70	3	3	NUM
bam-7186	31	71	of	of	ADP
bam-7186	31	72	the	the	DET
bam-7186	31	73	subunits	subunit	NOUN
bam-7186	31	74	β1	β1	PROPN
bam-7186	31	75	of	of	ADP
bam-7186	31	76	the	the	DET
bam-7186	31	77	nrf2	nrf2	PROPN
bam-7186	31	78	gene	gene	NOUN
bam-7186	31	79	(	(	PUNCT
bam-7186	31	80	rs7181866	rs7181866	PROPN
bam-7186	31	81	)	)	PUNCT
bam-7186	31	82	is	be	AUX
bam-7186	31	83	associated	associate	VERB
bam-7186	31	84	with	with	ADP
bam-7186	31	85	endurance	endurance	NOUN
bam-7186	31	86	and	and	CCONJ
bam-7186	31	87	maximum	maximum	ADJ
bam-7186	31	88	oxygen	oxygen	NOUN
bam-7186	31	89	consumption	consumption	NOUN
bam-7186	31	90	in	in	ADP
bam-7186	31	91	response	response	NOUN
bam-7186	31	92	to	to	ADP
bam-7186	31	93	resistance	resistance	NOUN
bam-7186	31	94	training.16	training.16	PROPN
bam-7186	31	95	common	common	ADJ
bam-7186	31	96	genetic	genetic	ADJ
bam-7186	31	97	variation	variation	NOUN
bam-7186	31	98	that	that	PRON
bam-7186	31	99	separates	separate	VERB
bam-7186	31	100	endurance	endurance	NOUN
bam-7186	31	101	athletes	athlete	NOUN
bam-7186	31	102	by	by	ADP
bam-7186	31	103	sprinter	sprinter	NOUN
bam-7186	31	104	,	,	PUNCT
bam-7186	31	105	is	be	AUX
bam-7186	31	106	probably	probably	ADV
bam-7186	31	107	due	due	ADJ
bam-7186	31	108	to	to	ADP
bam-7186	31	109	natural	natural	ADJ
bam-7186	31	110	selection	selection	NOUN
bam-7186	31	111	.	.	PUNCT
bam-7186	32	1	for	for	ADP
bam-7186	32	2	example	example	NOUN
bam-7186	32	3	,	,	PUNCT
bam-7186	32	4	the	the	DET
bam-7186	32	5	actin	actin	NOUN
bam-7186	32	6	-	-	PUNCT
bam-7186	32	7	binding	bind	VERB
bam-7186	32	8	protein	protein	NOUN
bam-7186	32	9	alpha	alpha	NOUN
bam-7186	32	10	-	-	PUNCT
bam-7186	32	11	actinin-3	actinin-3	PROPN
bam-7186	32	12	(	(	PUNCT
bam-7186	32	13	actn3	actn3	NOUN
bam-7186	32	14	)	)	PUNCT
bam-7186	32	15	is	be	AUX
bam-7186	32	16	highly	highly	ADV
bam-7186	32	17	present	present	ADJ
bam-7186	32	18	in	in	ADP
bam-7186	32	19	the	the	DET
bam-7186	32	20	mechanical	mechanical	ADJ
bam-7186	32	21	contraction	contraction	NOUN
bam-7186	32	22	of	of	ADP
bam-7186	32	23	the	the	DET
bam-7186	32	24	fast	fast	ADJ
bam-7186	32	25	muscle	muscle	NOUN
bam-7186	32	26	fibers	fiber	NOUN
bam-7186	32	27	;	;	PUNCT
bam-7186	32	28	in	in	ADP
bam-7186	32	29	sarcomere	sarcomere	NOUN
bam-7186	32	30	it	it	PRON
bam-7186	32	31	is	be	AUX
bam-7186	32	32	the	the	DET
bam-7186	32	33	largest	large	ADJ
bam-7186	32	34	component	component	NOUN
bam-7186	32	35	of	of	ADP
bam-7186	32	36	the	the	DET
bam-7186	32	37	z	z	NOUN
bam-7186	32	38	line	line	NOUN
bam-7186	32	39	and	and	CCONJ
bam-7186	32	40	plays	play	VERB
bam-7186	32	41	a	a	DET
bam-7186	32	42	fundamental	fundamental	ADJ
bam-7186	32	43	organizing	organizing	NOUN
bam-7186	32	44	and	and	CCONJ
bam-7186	32	45	regulating	regulate	VERB
bam-7186	32	46	function	function	NOUN
bam-7186	32	47	for	for	ADP
bam-7186	32	48	the	the	DET
bam-7186	32	49	muscle	muscle	NOUN
bam-7186	32	50	contraction	contraction	NOUN
bam-7186	32	51	.	.	PUNCT
bam-7186	33	1	actn3	actn3	NOUN
bam-7186	33	2	is	be	AUX
bam-7186	33	3	nearly	nearly	ADV
bam-7186	33	4	always	always	ADV
bam-7186	33	5	expressed	express	VERB
bam-7186	33	6	among	among	ADP
bam-7186	33	7	professional	professional	ADJ
bam-7186	33	8	athletes	athlete	NOUN
bam-7186	33	9	of	of	ADP
bam-7186	33	10	power,17	power,17	NOUN
bam-7186	33	11	while	while	SCONJ
bam-7186	33	12	the	the	DET
bam-7186	33	13	polymorphism	polymorphism	NOUN
bam-7186	33	14	r577x	r577x	PROPN
bam-7186	33	15	(	(	PUNCT
bam-7186	33	16	results	result	NOUN
bam-7186	33	17	in	in	ADP
bam-7186	33	18	premature	premature	ADJ
bam-7186	33	19	stop	stop	NOUN
bam-7186	33	20	codon	codon	NOUN
bam-7186	33	21	)	)	PUNCT
bam-7186	33	22	,	,	PUNCT
bam-7186	33	23	which	which	PRON
bam-7186	33	24	is	be	AUX
bam-7186	33	25	associated	associate	VERB
bam-7186	33	26	with	with	ADP
bam-7186	33	27	an	an	DET
bam-7186	33	28	absolute	absolute	ADJ
bam-7186	33	29	deficiency	deficiency	NOUN
bam-7186	33	30	of	of	ADP
bam-7186	33	31	actn3	actn3	NOUN
bam-7186	33	32	,	,	PUNCT
bam-7186	33	33	it	it	PRON
bam-7186	33	34	is	be	AUX
bam-7186	33	35	prevalent	prevalent	ADJ
bam-7186	33	36	to	to	ADP
bam-7186	33	37	a	a	DET
bam-7186	33	38	greater	great	ADJ
bam-7186	33	39	extent	extent	NOUN
bam-7186	33	40	among	among	ADP
bam-7186	33	41	professional	professional	ADJ
bam-7186	33	42	table	table	NOUN
bam-7186	33	43	1	1	NUM
bam-7186	33	44	information	information	NOUN
bam-7186	33	45	on	on	ADP
bam-7186	33	46	genotyping	genotype	VERB
bam-7186	33	47	methods	method	NOUN
bam-7186	33	48	for	for	ADP
bam-7186	33	49	each	each	DET
bam-7186	33	50	polymorphism	polymorphism	NOUN
bam-7186	33	51	gene	gene	NOUN
bam-7186	33	52	primers	primer	NOUN
bam-7186	34	1	temperature	temperature	NOUN
bam-7186	34	2	annealing	anneal	VERB
bam-7186	34	3	restriction	restriction	NOUN
bam-7186	34	4	enzyme	enzyme	NOUN
bam-7186	34	5	ppara	ppara	NOUN
bam-7186	34	6	intron	intron	ADJ
bam-7186	34	7	7g	7g	NOUN
bam-7186	34	8	/	/	SYM
bam-7186	34	9	c	c	PROPN
bam-7186	34	10	f	f	PROPN
bam-7186	34	11	5’-3	5’-3	PROPN
bam-7186	34	12	’	'	PUNCT
bam-7186	34	13	:	:	PUNCT
bam-7186	34	14	acaatcactccttaaatatggtgg	acaatcactccttaaatatggtgg	VERB
bam-7186	34	15	59	59	NUM
bam-7186	34	16	°	°	PROPN
bam-7186	34	17	c	c	NOUN
bam-7186	34	18	taq	taq	NOUN
bam-7186	34	19	i	i	NOUN
bam-7186	34	20	r	r	NOUN
bam-7186	34	21	5’-3	5’-3	PROPN
bam-7186	34	22	’	'	PUNCT
bam-7186	34	23	:	:	PUNCT
bam-7186	34	24	aagtagggacagacaggaccagta	aagtagggacagacaggaccagta	PROPN
bam-7186	34	25	ppargc1gly482ser	ppargc1gly482ser	NOUN
bam-7186	34	26	f	f	PROPN
bam-7186	34	27	5’-3	5’-3	PROPN
bam-7186	34	28	’	'	PUNCT
bam-7186	34	29	:	:	PUNCT
bam-7186	34	30	taaagatgtctcctctgatt	taaagatgtctcctctgatt	X
bam-7186	34	31	50	50	NUM
bam-7186	34	32	°	°	NOUN
bam-7186	34	33	c	c	ADP
bam-7186	34	34	hpa	hpa	NOUN
bam-7186	34	35	ii	ii	NOUN
bam-7186	34	36	r	r	NOUN
bam-7186	34	37	5’-3	5’-3	PROPN
bam-7186	34	38	’	'	PUNCT
bam-7186	34	39	:	:	PUNCT
bam-7186	34	40	ggagacacattgaacaatgaataggattg	ggagacacattgaacaatgaataggattg	PROPN
bam-7186	34	41	ace	ace	PROPN
bam-7186	34	42	f	f	PROPN
bam-7186	34	43	5’-3	5’-3	PROPN
bam-7186	34	44	’	'	PUNCT
bam-7186	34	45	:	:	PUNCT
bam-7186	34	46	gccctgcaggtgtctgcagcatgt	gccctgcaggtgtctgcagcatgt	VERB
bam-7186	34	47	66	66	NUM
bam-7186	34	48	°	°	ADP
bam-7186	34	49	c	c	NOUN
bam-7186	34	50	--r	--r	PROPN
bam-7186	34	51	5’-3	5’-3	PROPN
bam-7186	34	52	’	'	PUNCT
bam-7186	34	53	:	:	PUNCT
bam-7186	34	54	ggatggctctccccgccttgtctc	ggatggctctccccgccttgtctc	PROPN
bam-7186	34	55	ckmm	ckmm	PROPN
bam-7186	34	56	f	f	PROPN
bam-7186	34	57	5’-3	5’-3	PROPN
bam-7186	34	58	’	'	PUNCT
bam-7186	34	59	:	:	PUNCT
bam-7186	34	60	gggatgctcagactcacaga	gggatgctcagactcacaga	NOUN
bam-7186	34	61	50	50	NUM
bam-7186	34	62	°	°	ADP
bam-7186	34	63	c	c	NOUN
bam-7186	34	64	nco	nco	NOUN
bam-7186	34	65	i	i	NOUN
bam-7186	34	66	r	r	NOUN
bam-7186	34	67	5’-3	5’-3	PROPN
bam-7186	34	68	’	'	PUNCT
bam-7186	34	69	:	:	PUNCT
bam-7186	34	70	aacttgaatttagcccaacg	aacttgaatttagcccaacg	PROPN
bam-7186	34	71	nrf2	nrf2	PROPN
bam-7186	34	72	ag	ag	PROPN
bam-7186	34	73	/	/	SYM
bam-7186	34	74	gg	gg	PROPN
bam-7186	34	75	f	f	PROPN
bam-7186	34	76	5’-3	5’-3	PROPN
bam-7186	34	77	’	'	PUNCT
bam-7186	34	78	:	:	PUNCT
bam-7186	34	79	agtttagtgtctcccagtgt	agtttagtgtctcccagtgt	PROPN
bam-7186	34	80	50	50	NUM
bam-7186	34	81	°	°	PROPN
bam-7186	34	82	c	c	PROPN
bam-7186	34	83	rsa	rsa	NOUN
bam-7186	34	84	i	i	NOUN
bam-7186	34	85	r	r	NOUN
bam-7186	34	86	5’-3	5’-3	PROPN
bam-7186	34	87	’	'	PUNCT
bam-7186	34	88	:	:	PUNCT
bam-7186	34	89	cttagttttcttgtatccgt	cttagttttcttgtatccgt	PROPN
bam-7186	34	90	non	non	PROPN
bam-7186	34	91	co	co	PROPN
bam-7186	34	92	mmerc	mmerc	PROPN
bam-7186	34	93	ial	ial	PROPN
bam-7186	34	94	us	us	PROPN
bam-7186	35	1	e	e	NOUN
bam-7186	35	2	o	o	NOUN
bam-7186	35	3	nly	nly	ADV
bam-7186	35	4	polymorphisms	polymorphism	NOUN
bam-7186	35	5	of	of	ADP
bam-7186	35	6	elite	elite	ADJ
bam-7186	35	7	athletes	athlete	NOUN
bam-7186	35	8	phenotype	phenotype	VERB
bam-7186	35	9	eur	eur	PROPN
bam-7186	35	10	j	j	PROPN
bam-7186	35	11	transl	transl	PROPN
bam-7186	35	12	myol	myol	ADV
bam-7186	35	13	28	28	NUM
bam-7186	35	14	(	(	PUNCT
bam-7186	35	15	1	1	NUM
bam-7186	35	16	):	):	PUNCT
bam-7186	35	17	87	87	NUM
bam-7186	35	18	-	-	SYM
bam-7186	35	19	92	92	NUM
bam-7186	35	20	,	,	PUNCT
bam-7186	35	21	2018	2018	NUM
bam-7186	35	22	89	89	NUM
bam-7186	35	23	endurance	endurance	NOUN
bam-7186	35	24	athletes.18	athletes.18	PROPN
bam-7186	35	25	in	in	ADP
bam-7186	35	26	a	a	DET
bam-7186	35	27	recent	recent	ADJ
bam-7186	35	28	work	work	NOUN
bam-7186	35	29	on	on	ADP
bam-7186	35	30	soccer	soccer	NOUN
bam-7186	35	31	players	player	NOUN
bam-7186	35	32	it	it	PRON
bam-7186	35	33	was	be	AUX
bam-7186	35	34	showed	show	VERB
bam-7186	35	35	a	a	DET
bam-7186	35	36	prevalence	prevalence	NOUN
bam-7186	35	37	of	of	ADP
bam-7186	35	38	actn3rr	actn3rr	PROPN
bam-7186	35	39	genotype	genotype	NOUN
bam-7186	35	40	,	,	PUNCT
bam-7186	35	41	that	that	PRON
bam-7186	35	42	was	be	AUX
bam-7186	35	43	linked	link	VERB
bam-7186	35	44	with	with	ADP
bam-7186	35	45	a	a	DET
bam-7186	35	46	high	high	ADJ
bam-7186	35	47	production	production	NOUN
bam-7186	35	48	of	of	ADP
bam-7186	35	49	actn3	actn3	NOUN
bam-7186	35	50	and	and	CCONJ
bam-7186	35	51	for	for	ADP
bam-7186	35	52	the	the	DET
bam-7186	35	53	first	first	ADJ
bam-7186	35	54	time	time	NOUN
bam-7186	35	55	it	it	PRON
bam-7186	35	56	was	be	AUX
bam-7186	35	57	correleted	correlete	VERB
bam-7186	35	58	with	with	ADP
bam-7186	35	59	the	the	DET
bam-7186	35	60	training	training	NOUN
bam-7186	35	61	load	load	NOUN
bam-7186	35	62	and	and	CCONJ
bam-7186	35	63	overall	overall	ADJ
bam-7186	35	64	the	the	DET
bam-7186	35	65	mtdna	mtdna	NOUN
bam-7186	35	66	copy	copy	NOUN
bam-7186	35	67	number	number	NOUN
bam-7186	35	68	increase	increase	NOUN
bam-7186	35	69	was	be	AUX
bam-7186	35	70	assess	assess	NOUN
bam-7186	35	71	as	as	SCONJ
bam-7186	35	72	a	a	DET
bam-7186	35	73	bioenergetics	bioenergetic	NOUN
bam-7186	35	74	biomarker.19	biomarker.19	NOUN
bam-7186	35	75	some	some	DET
bam-7186	35	76	authors	author	NOUN
bam-7186	35	77	observed	observe	VERB
bam-7186	35	78	a	a	DET
bam-7186	35	79	significantly	significantly	ADV
bam-7186	35	80	lowest	low	ADJ
bam-7186	35	81	frequency	frequency	NOUN
bam-7186	35	82	of	of	ADP
bam-7186	35	83	the	the	DET
bam-7186	35	84	x	x	ADJ
bam-7186	35	85	/	/	SYM
bam-7186	35	86	x	x	ADJ
bam-7186	35	87	genotype	genotype	NOUN
bam-7186	35	88	in	in	ADP
bam-7186	35	89	power	power	NOUN
bam-7186	35	90	athletes	athlete	NOUN
bam-7186	35	91	compared	compare	VERB
bam-7186	35	92	with	with	ADP
bam-7186	35	93	the	the	DET
bam-7186	35	94	control	control	NOUN
bam-7186	35	95	group.20	group.20	PROPN
bam-7186	35	96	the	the	DET
bam-7186	35	97	gene	gene	NOUN
bam-7186	35	98	creatine	creatine	PROPN
bam-7186	35	99	kinase	kinase	PROPN
bam-7186	35	100	-	-	PUNCT
bam-7186	35	101	mm	mm	PROPN
bam-7186	35	102	(	(	PUNCT
bam-7186	35	103	ck	ck	NOUN
bam-7186	35	104	-	-	PUNCT
bam-7186	35	105	mm	mm	NOUN
bam-7186	35	106	)	)	PUNCT
bam-7186	35	107	encoding	encode	VERB
bam-7186	35	108	the	the	DET
bam-7186	35	109	cytosolic	cytosolic	ADJ
bam-7186	35	110	muscle	muscle	NOUN
bam-7186	35	111	isoform	isoform	NOUN
bam-7186	35	112	of	of	ADP
bam-7186	35	113	ck	ck	PROPN
bam-7186	35	114	,	,	PUNCT
bam-7186	35	115	responsible	responsible	ADJ
bam-7186	35	116	for	for	ADP
bam-7186	35	117	the	the	DET
bam-7186	35	118	rapid	rapid	ADJ
bam-7186	35	119	atp	atp	NOUN
bam-7186	35	120	regeneration	regeneration	NOUN
bam-7186	35	121	during	during	ADP
bam-7186	35	122	intense	intense	ADJ
bam-7186	35	123	muscle	muscle	NOUN
bam-7186	35	124	contraction.21	contraction.21	NOUN
bam-7186	35	125	reduced	reduce	VERB
bam-7186	35	126	expression	expression	NOUN
bam-7186	35	127	of	of	ADP
bam-7186	35	128	this	this	DET
bam-7186	35	129	enzyme	enzyme	NOUN
bam-7186	35	130	may	may	AUX
bam-7186	35	131	be	be	AUX
bam-7186	35	132	responsible	responsible	ADJ
bam-7186	35	133	for	for	ADP
bam-7186	35	134	muscle	muscle	NOUN
bam-7186	35	135	fatigue	fatigue	NOUN
bam-7186	35	136	most	most	ADV
bam-7186	35	137	likely	likely	ADJ
bam-7186	35	138	due	due	ADJ
bam-7186	35	139	to	to	ADP
bam-7186	35	140	increased	increase	VERB
bam-7186	35	141	intracellular	intracellular	ADJ
bam-7186	35	142	concentration	concentration	NOUN
bam-7186	35	143	of	of	ADP
bam-7186	35	144	inorganic	inorganic	ADJ
bam-7186	35	145	phosphate	phosphate	NOUN
bam-7186	35	146	.	.	PUNCT
bam-7186	36	1	moreover	moreover	ADV
bam-7186	36	2	,	,	PUNCT
bam-7186	36	3	studies	study	NOUN
bam-7186	36	4	of	of	ADP
bam-7186	36	5	changes	change	NOUN
bam-7186	36	6	in	in	ADP
bam-7186	36	7	ck	ck	ADJ
bam-7186	36	8	-	-	PUNCT
bam-7186	36	9	mm	mm	NOUN
bam-7186	36	10	gene	gene	NOUN
bam-7186	36	11	sequence	sequence	NOUN
bam-7186	36	12	showed	show	VERB
bam-7186	36	13	a	a	DET
bam-7186	36	14	significant	significant	ADJ
bam-7186	36	15	association	association	NOUN
bam-7186	36	16	between	between	ADP
bam-7186	36	17	some	some	PRON
bam-7186	36	18	of	of	ADP
bam-7186	36	19	its	its	PRON
bam-7186	36	20	polymorphisms	polymorphism	NOUN
bam-7186	36	21	and	and	CCONJ
bam-7186	36	22	increased	increase	VERB
bam-7186	36	23	cardiorespiratory	cardiorespiratory	ADJ
bam-7186	36	24	endurance	endurance	NOUN
bam-7186	36	25	,	,	PUNCT
bam-7186	36	26	peak	peak	NOUN
bam-7186	36	27	performance	performance	NOUN
bam-7186	36	28	and	and	CCONJ
bam-7186	36	29	lower	low	ADJ
bam-7186	36	30	decline	decline	NOUN
bam-7186	36	31	in	in	ADP
bam-7186	36	32	force	force	NOUN
bam-7186	36	33	generation	generation	NOUN
bam-7186	36	34	;	;	PUNCT
bam-7186	36	35	particularly	particularly	ADV
bam-7186	36	36	,	,	PUNCT
bam-7186	36	37	gg	gg	NOUN
bam-7186	36	38	genotype	genotype	NOUN
bam-7186	36	39	and	and	CCONJ
bam-7186	36	40	g	g	NOUN
bam-7186	36	41	allele	allele	NOUN
bam-7186	36	42	are	be	AUX
bam-7186	36	43	represented	represent	VERB
bam-7186	36	44	in	in	ADP
bam-7186	36	45	power	power	NOUN
bam-7186	36	46	-	-	PUNCT
bam-7186	36	47	oriented	orient	VERB
bam-7186	36	48	athletes.22	athletes.22	NOUN
bam-7186	36	49	several	several	ADJ
bam-7186	36	50	beneficial	beneficial	ADJ
bam-7186	36	51	effects	effect	NOUN
bam-7186	36	52	on	on	ADP
bam-7186	36	53	athletic	athletic	ADJ
bam-7186	36	54	performance	performance	NOUN
bam-7186	36	55	in	in	ADP
bam-7186	36	56	endurance	endurance	NOUN
bam-7186	36	57	and	and	CCONJ
bam-7186	36	58	sprint	sprint	NOUN
bam-7186	36	59	,	,	PUNCT
bam-7186	36	60	were	be	AUX
bam-7186	36	61	also	also	ADV
bam-7186	36	62	observed	observe	VERB
bam-7186	36	63	in	in	ADP
bam-7186	36	64	different	different	ADJ
bam-7186	36	65	genotypes	genotype	NOUN
bam-7186	36	66	of	of	ADP
bam-7186	36	67	a	a	DET
bam-7186	36	68	single	single	ADJ
bam-7186	36	69	locus	locus	NOUN
bam-7186	36	70	of	of	ADP
bam-7186	36	71	angiotensin	angiotensin	NOUN
bam-7186	36	72	converting	convert	VERB
bam-7186	36	73	enzyme	enzyme	NOUN
bam-7186	36	74	(	(	PUNCT
bam-7186	36	75	ace	ace	NOUN
bam-7186	36	76	)	)	PUNCT
bam-7186	36	77	.	.	PUNCT
bam-7186	37	1	the	the	DET
bam-7186	37	2	ace	ace	NOUN
bam-7186	37	3	gene	gene	NOUN
bam-7186	37	4	,	,	PUNCT
bam-7186	37	5	despite	despite	SCONJ
bam-7186	37	6	some	some	DET
bam-7186	37	7	controversy	controversy	NOUN
bam-7186	37	8	,	,	PUNCT
bam-7186	37	9	seems	seem	VERB
bam-7186	37	10	to	to	PART
bam-7186	37	11	present	present	VERB
bam-7186	37	12	variations	variation	NOUN
bam-7186	37	13	that	that	PRON
bam-7186	37	14	can	can	AUX
bam-7186	37	15	be	be	AUX
bam-7186	37	16	associated	associate	VERB
bam-7186	37	17	with	with	ADP
bam-7186	37	18	many	many	ADJ
bam-7186	37	19	inherited	inherit	VERB
bam-7186	37	20	traits	trait	NOUN
bam-7186	37	21	,	,	PUNCT
bam-7186	37	22	including	include	VERB
bam-7186	37	23	physical	physical	ADJ
bam-7186	37	24	,	,	PUNCT
bam-7186	37	25	psychological	psychological	ADJ
bam-7186	37	26	and	and	CCONJ
bam-7186	37	27	performance	performance	NOUN
bam-7186	37	28	parameters,23	parameters,23	NOUN
bam-7186	37	29	it	it	PRON
bam-7186	37	30	has	have	VERB
bam-7186	37	31	two	two	NUM
bam-7186	37	32	alleles	allele	NOUN
bam-7186	37	33	,	,	PUNCT
bam-7186	37	34	called	call	VERB
bam-7186	37	35	"	"	PUNCT
bam-7186	37	36	i	i	PROPN
bam-7186	37	37	"	"	PUNCT
bam-7186	37	38	and	and	CCONJ
bam-7186	37	39	"	"	PUNCT
bam-7186	37	40	d	d	NOUN
bam-7186	37	41	"	"	PUNCT
bam-7186	37	42	.	.	PUNCT
bam-7186	38	1	the	the	DET
bam-7186	38	2	latter	latter	ADJ
bam-7186	38	3	is	be	AUX
bam-7186	38	4	associated	associate	VERB
bam-7186	38	5	with	with	ADP
bam-7186	38	6	power	power	NOUN
bam-7186	38	7	-	-	PUNCT
bam-7186	38	8	oriented	orient	VERB
bam-7186	38	9	athletes	athlete	NOUN
bam-7186	38	10	and	and	CCONJ
bam-7186	38	11	anaerobic	anaerobic	NOUN
bam-7186	38	12	sports	sport	NOUN
bam-7186	38	13	:	:	PUNCT
bam-7186	38	14	the	the	DET
bam-7186	38	15	mechanism	mechanism	NOUN
bam-7186	38	16	that	that	PRON
bam-7186	38	17	underlies	underlie	VERB
bam-7186	38	18	it	it	PRON
bam-7186	38	19	is	be	AUX
bam-7186	38	20	probably	probably	ADV
bam-7186	38	21	governed	govern	VERB
bam-7186	38	22	by	by	ADP
bam-7186	38	23	the	the	DET
bam-7186	38	24	differences	difference	NOUN
bam-7186	38	25	in	in	ADP
bam-7186	38	26	strength	strength	NOUN
bam-7186	38	27	gain	gain	NOUN
bam-7186	38	28	at	at	ADP
bam-7186	38	29	skeletal	skeletal	ADJ
bam-7186	38	30	muscle	muscle	NOUN
bam-7186	38	31	level	level	NOUN
bam-7186	38	32	,	,	PUNCT
bam-7186	38	33	because	because	SCONJ
bam-7186	38	34	d	d	PRON
bam-7186	38	35	allele	allele	NOUN
bam-7186	38	36	was	be	AUX
bam-7186	38	37	associated	associate	VERB
bam-7186	38	38	with	with	ADP
bam-7186	38	39	greater	great	ADJ
bam-7186	38	40	increases	increase	NOUN
bam-7186	38	41	in	in	ADP
bam-7186	38	42	quadriceps	quadricep	NOUN
bam-7186	38	43	strength	strength	NOUN
bam-7186	38	44	after	after	ADP
bam-7186	38	45	training	training	NOUN
bam-7186	38	46	,	,	PUNCT
bam-7186	38	47	especially	especially	ADV
bam-7186	38	48	dd	dd	VERB
bam-7186	38	49	genotypes	genotype	NOUN
bam-7186	38	50	presented	present	VERB
bam-7186	38	51	better	well	ADJ
bam-7186	38	52	performance	performance	NOUN
bam-7186	38	53	for	for	ADP
bam-7186	38	54	example	example	NOUN
bam-7186	38	55	during	during	ADP
bam-7186	38	56	jump	jump	NOUN
bam-7186	38	57	and	and	CCONJ
bam-7186	38	58	sprint	sprint	NOUN
bam-7186	38	59	tests	test	NOUN
bam-7186	38	60	.	.	PUNCT
bam-7186	39	1	in	in	ADP
bam-7186	39	2	contrast	contrast	NOUN
bam-7186	39	3	,	,	PUNCT
bam-7186	39	4	i	i	PRON
bam-7186	39	5	allele	allele	NOUN
bam-7186	39	6	could	could	AUX
bam-7186	39	7	influence	influence	VERB
bam-7186	39	8	resistance	resistance	NOUN
bam-7186	39	9	performance	performance	NOUN
bam-7186	39	10	improvements	improvement	NOUN
bam-7186	39	11	through	through	ADP
bam-7186	39	12	a	a	DET
bam-7186	39	13	better	well	ADJ
bam-7186	39	14	use	use	NOUN
bam-7186	39	15	of	of	ADP
bam-7186	39	16	substrate	substrate	NOUN
bam-7186	39	17	and	and	CCONJ
bam-7186	39	18	muscle	muscle	NOUN
bam-7186	39	19	efficiency	efficiency	NOUN
bam-7186	39	20	,	,	PUNCT
bam-7186	39	21	with	with	ADP
bam-7186	39	22	a	a	DET
bam-7186	39	23	consequent	consequent	ADJ
bam-7186	39	24	saving	saving	NOUN
bam-7186	39	25	of	of	ADP
bam-7186	39	26	energy	energy	NOUN
bam-7186	39	27	supplies	supply	NOUN
bam-7186	39	28	.	.	PUNCT
bam-7186	40	1	on	on	ADP
bam-7186	40	2	the	the	DET
bam-7186	40	3	other	other	ADJ
bam-7186	40	4	hand	hand	NOUN
bam-7186	40	5	,	,	PUNCT
bam-7186	40	6	dd	dd	VERB
bam-7186	40	7	genotypes	genotype	NOUN
bam-7186	40	8	may	may	AUX
bam-7186	40	9	benefit	benefit	VERB
bam-7186	40	10	athletes	athlete	NOUN
bam-7186	40	11	in	in	ADP
bam-7186	40	12	activities	activity	NOUN
bam-7186	40	13	that	that	PRON
bam-7186	40	14	require	require	VERB
bam-7186	40	15	strength	strength	NOUN
bam-7186	40	16	and	and	CCONJ
bam-7186	40	17	speed	speed	NOUN
bam-7186	40	18	,	,	PUNCT
bam-7186	40	19	while	while	SCONJ
bam-7186	40	20	ii	ii	NOUN
bam-7186	40	21	ace	ace	NOUN
bam-7186	40	22	genotype	genotype	NOUN
bam-7186	40	23	in	in	ADP
bam-7186	40	24	endurance	endurance	NOUN
bam-7186	40	25	activities.24	activities.24	NOUN
bam-7186	40	26	materials	material	NOUN
bam-7186	40	27	and	and	CCONJ
bam-7186	40	28	methods	method	NOUN
bam-7186	40	29	sixty	sixty	NUM
bam-7186	40	30	sub	sub	ADJ
bam-7186	40	31	-	-	ADJ
bam-7186	40	32	elite	elite	ADJ
bam-7186	40	33	male	male	ADJ
bam-7186	40	34	italian	italian	ADJ
bam-7186	40	35	soccer	soccer	NOUN
bam-7186	40	36	players	player	NOUN
bam-7186	40	37	(	(	PUNCT
bam-7186	40	38	age	age	NOUN
bam-7186	40	39	22.5	22.5	NUM
bam-7186	40	40	±	±	NUM
bam-7186	40	41	2.2	2.2	NUM
bam-7186	40	42	)	)	PUNCT
bam-7186	40	43	and	and	CCONJ
bam-7186	40	44	sixty	sixty	NUM
bam-7186	40	45	sedentary	sedentary	ADJ
bam-7186	40	46	male	male	ADJ
bam-7186	40	47	volunteers	volunteer	NOUN
bam-7186	40	48	(	(	PUNCT
bam-7186	40	49	age	age	NOUN
bam-7186	40	50	21.2	21.2	NUM
bam-7186	40	51	±	±	NUM
bam-7186	40	52	2.3	2.3	NUM
bam-7186	40	53	)	)	PUNCT
bam-7186	40	54	were	be	AUX
bam-7186	40	55	enrolled	enrol	VERB
bam-7186	40	56	in	in	ADP
bam-7186	40	57	this	this	DET
bam-7186	40	58	study	study	NOUN
bam-7186	40	59	.	.	PUNCT
bam-7186	41	1	athletes	athlete	NOUN
bam-7186	41	2	and	and	CCONJ
bam-7186	41	3	controls	control	NOUN
bam-7186	41	4	were	be	AUX
bam-7186	41	5	all	all	ADV
bam-7186	41	6	caucasian	caucasian	ADJ
bam-7186	41	7	,	,	PUNCT
bam-7186	41	8	in	in	ADP
bam-7186	41	9	order	order	NOUN
bam-7186	41	10	to	to	PART
bam-7186	41	11	ensure	ensure	VERB
bam-7186	41	12	the	the	DET
bam-7186	41	13	absence	absence	NOUN
bam-7186	41	14	of	of	ADP
bam-7186	41	15	a	a	DET
bam-7186	41	16	probable	probable	ADJ
bam-7186	41	17	genetic	genetic	ADJ
bam-7186	41	18	ethnicity	ethnicity	NOUN
bam-7186	41	19	inclination	inclination	NOUN
bam-7186	41	20	and	and	CCONJ
bam-7186	41	21	to	to	PART
bam-7186	41	22	overcome	overcome	VERB
bam-7186	41	23	any	any	DET
bam-7186	41	24	problems	problem	NOUN
bam-7186	41	25	of	of	ADP
bam-7186	41	26	population	population	NOUN
bam-7186	41	27	stratification	stratification	NOUN
bam-7186	41	28	.	.	PUNCT
bam-7186	42	1	all	all	DET
bam-7186	42	2	participants	participant	NOUN
bam-7186	42	3	gave	give	VERB
bam-7186	42	4	their	their	PRON
bam-7186	42	5	informed	informed	ADJ
bam-7186	42	6	consent	consent	NOUN
bam-7186	42	7	for	for	ADP
bam-7186	42	8	genotyping	genotyping	NOUN
bam-7186	42	9	,	,	PUNCT
bam-7186	42	10	understood	understand	VERB
bam-7186	42	11	that	that	SCONJ
bam-7186	42	12	the	the	DET
bam-7186	42	13	results	result	NOUN
bam-7186	42	14	would	would	AUX
bam-7186	42	15	be	be	AUX
bam-7186	42	16	anonymous	anonymous	ADJ
bam-7186	42	17	and	and	CCONJ
bam-7186	42	18	confidential	confidential	ADJ
bam-7186	42	19	.	.	PUNCT
bam-7186	43	1	by	by	ADP
bam-7186	43	2	standard	standard	ADJ
bam-7186	43	3	clinical	clinical	ADJ
bam-7186	43	4	procedures	procedure	NOUN
bam-7186	43	5	venous	venous	ADJ
bam-7186	43	6	blood	blood	NOUN
bam-7186	43	7	samples	sample	NOUN
bam-7186	43	8	were	be	AUX
bam-7186	43	9	obtained	obtain	VERB
bam-7186	43	10	,	,	PUNCT
bam-7186	43	11	between	between	ADP
bam-7186	43	12	8:00	8:00	NUM
bam-7186	43	13	and	and	CCONJ
bam-7186	43	14	10:00	10:00	NUM
bam-7186	43	15	in	in	ADP
bam-7186	43	16	the	the	DET
bam-7186	43	17	morning	morning	NOUN
bam-7186	43	18	,	,	PUNCT
bam-7186	43	19	at	at	ADP
bam-7186	43	20	rest	rest	NOUN
bam-7186	43	21	.	.	PUNCT
bam-7186	44	1	the	the	DET
bam-7186	44	2	samples	sample	NOUN
bam-7186	44	3	were	be	AUX
bam-7186	44	4	treated	treat	VERB
bam-7186	44	5	with	with	ADP
bam-7186	44	6	anticoagulant	anticoagulant	NOUN
bam-7186	44	7	(	(	PUNCT
bam-7186	44	8	heparin	heparin	NOUN
bam-7186	44	9	)	)	PUNCT
bam-7186	44	10	and	and	CCONJ
bam-7186	44	11	used	use	VERB
bam-7186	44	12	for	for	ADP
bam-7186	44	13	genomic	genomic	ADJ
bam-7186	44	14	dna	dna	NOUN
bam-7186	44	15	extraction	extraction	NOUN
bam-7186	44	16	(	(	PUNCT
bam-7186	44	17	purelink	purelink	VERB
bam-7186	44	18	genomic	genomic	PROPN
bam-7186	44	19	dna	dna	NOUN
bam-7186	44	20	,	,	PUNCT
bam-7186	44	21	thermofisher	thermofisher	ADJ
bam-7186	44	22	scientific	scientific	NOUN
bam-7186	44	23	)	)	PUNCT
bam-7186	44	24	.	.	PUNCT
bam-7186	45	1	the	the	DET
bam-7186	45	2	polymorphic	polymorphic	ADJ
bam-7186	45	3	sites	site	NOUN
bam-7186	45	4	were	be	AUX
bam-7186	45	5	analyzed	analyze	VERB
bam-7186	45	6	by	by	ADP
bam-7186	45	7	pcr	pcr	ADJ
bam-7186	45	8	-	-	PUNCT
bam-7186	45	9	rflp	rflp	NOUN
bam-7186	45	10	protocols	protocol	NOUN
bam-7186	45	11	with	with	ADP
bam-7186	45	12	different	different	ADJ
bam-7186	45	13	enzymes	enzyme	NOUN
bam-7186	45	14	(	(	PUNCT
bam-7186	45	15	tab	tab	NOUN
bam-7186	45	16	1	1	NUM
bam-7186	45	17	)	)	PUNCT
bam-7186	45	18	.	.	PUNCT
bam-7186	46	1	results	result	NOUN
bam-7186	46	2	using	use	VERB
bam-7186	46	3	a	a	DET
bam-7186	46	4	multivariate	multivariate	NOUN
bam-7186	46	5	logistic	logistic	ADJ
bam-7186	46	6	regression	regression	NOUN
bam-7186	46	7	analysis	analysis	NOUN
bam-7186	46	8	,	,	PUNCT
bam-7186	46	9	we	we	PRON
bam-7186	46	10	tried	try	VERB
bam-7186	46	11	to	to	PART
bam-7186	46	12	figure	figure	VERB
bam-7186	46	13	out	out	ADP
bam-7186	46	14	if	if	SCONJ
bam-7186	46	15	it	it	PRON
bam-7186	46	16	is	be	AUX
bam-7186	46	17	possible	possible	ADJ
bam-7186	46	18	to	to	PART
bam-7186	46	19	speculate	speculate	VERB
bam-7186	46	20	the	the	DET
bam-7186	46	21	impact	impact	NOUN
bam-7186	46	22	of	of	ADP
bam-7186	46	23	each	each	DET
bam-7186	46	24	polymorphism	polymorphism	NOUN
bam-7186	46	25	on	on	ADP
bam-7186	46	26	the	the	DET
bam-7186	46	27	expression	expression	NOUN
bam-7186	46	28	of	of	ADP
bam-7186	46	29	elite	elite	ADJ
bam-7186	46	30	soccer	soccer	NOUN
bam-7186	46	31	fig	fig	NOUN
bam-7186	46	32	2	2	NUM
bam-7186	46	33	.	.	PUNCT
bam-7186	47	1	receiver	receiver	ADJ
bam-7186	47	2	operating	operate	VERB
bam-7186	47	3	characteristic	characteristic	ADJ
bam-7186	47	4	curve	curve	NOUN
bam-7186	47	5	(	(	PUNCT
bam-7186	47	6	roc	roc	PROPN
bam-7186	47	7	)	)	PUNCT
bam-7186	47	8	summarizing	summarize	VERB
bam-7186	47	9	the	the	DET
bam-7186	47	10	ability	ability	NOUN
bam-7186	47	11	of	of	ADP
bam-7186	47	12	elite	elite	ADJ
bam-7186	47	13	genotype	genotype	NOUN
bam-7186	47	14	score	score	NOUN
bam-7186	47	15	to	to	PART
bam-7186	47	16	classify	classify	VERB
bam-7186	47	17	potential	potential	ADJ
bam-7186	47	18	elite	elite	ADJ
bam-7186	47	19	athletes	athlete	NOUN
bam-7186	47	20	from	from	ADP
bam-7186	47	21	non	non	ADJ
bam-7186	47	22	-	-	ADJ
bam-7186	47	23	athletes	athletes	ADJ
bam-7186	47	24	(	(	PUNCT
bam-7186	47	25	controls	control	NOUN
bam-7186	47	26	)	)	PUNCT
bam-7186	47	27	.	.	PUNCT
bam-7186	48	1	auc	auc	PROPN
bam-7186	48	2	indicates	indicate	VERB
bam-7186	48	3	the	the	DET
bam-7186	48	4	area	area	NOUN
bam-7186	48	5	under	under	ADP
bam-7186	48	6	the	the	DET
bam-7186	48	7	curve	curve	NOUN
bam-7186	48	8	(	(	PUNCT
bam-7186	48	9	95	95	NUM
bam-7186	48	10	%	%	NOUN
bam-7186	48	11	confidence	confidence	NOUN
bam-7186	48	12	intervals	interval	NOUN
bam-7186	48	13	)	)	PUNCT
bam-7186	48	14	.	.	PUNCT
bam-7186	49	1	non	non	PROPN
bam-7186	49	2	co	co	PROPN
bam-7186	49	3	mmerc	mmerc	PROPN
bam-7186	49	4	ial	ial	PROPN
bam-7186	49	5	us	us	PROPN
bam-7186	50	1	e	e	NOUN
bam-7186	50	2	o	o	NOUN
bam-7186	50	3	nly	nly	ADV
bam-7186	50	4	polymorphisms	polymorphism	NOUN
bam-7186	50	5	of	of	ADP
bam-7186	50	6	elite	elite	ADJ
bam-7186	50	7	athletes	athlete	NOUN
bam-7186	50	8	phenotype	phenotype	VERB
bam-7186	50	9	eur	eur	PROPN
bam-7186	50	10	j	j	PROPN
bam-7186	50	11	transl	transl	PROPN
bam-7186	50	12	myol	myol	ADV
bam-7186	50	13	28	28	NUM
bam-7186	50	14	(	(	PUNCT
bam-7186	50	15	1	1	NUM
bam-7186	50	16	):	):	PUNCT
bam-7186	50	17	87	87	NUM
bam-7186	50	18	-	-	SYM
bam-7186	50	19	92	92	NUM
bam-7186	50	20	,	,	PUNCT
bam-7186	50	21	2018	2018	NUM
bam-7186	50	22	90	90	NUM
bam-7186	50	23	player	player	NOUN
bam-7186	50	24	phenotype	phenotype	NOUN
bam-7186	50	25	.	.	PUNCT
bam-7186	51	1	particularly	particularly	ADV
bam-7186	51	2	,	,	PUNCT
bam-7186	51	3	we	we	PRON
bam-7186	51	4	investigated	investigate	VERB
bam-7186	51	5	how	how	SCONJ
bam-7186	51	6	each	each	DET
bam-7186	51	7	polymorphism	polymorphism	NOUN
bam-7186	51	8	works	work	VERB
bam-7186	51	9	directly	directly	ADV
bam-7186	51	10	or	or	CCONJ
bam-7186	51	11	through	through	ADP
bam-7186	51	12	other	other	ADJ
bam-7186	51	13	polymorphism	polymorphism	NOUN
bam-7186	51	14	to	to	PART
bam-7186	51	15	discern	discern	ADJ
bam-7186	51	16	elite	elite	ADJ
bam-7186	51	17	athletes	athlete	NOUN
bam-7186	51	18	from	from	ADP
bam-7186	51	19	non	non	ADJ
bam-7186	51	20	-	-	ADJ
bam-7186	51	21	athletic	athletic	ADJ
bam-7186	51	22	population	population	NOUN
bam-7186	51	23	.	.	PUNCT
bam-7186	52	1	we	we	PRON
bam-7186	52	2	found	find	VERB
bam-7186	52	3	statistical	statistical	ADJ
bam-7186	52	4	significance	significance	NOUN
bam-7186	52	5	in	in	ADP
bam-7186	52	6	nrf2	nrf2	PROPN
bam-7186	52	7	(	(	PUNCT
bam-7186	52	8	ag	ag	PROPN
bam-7186	52	9	/	/	SYM
bam-7186	52	10	gg	gg	NOUN
bam-7186	52	11	genotype	genotype	NOUN
bam-7186	52	12	)	)	PUNCT
bam-7186	52	13	polymorphism	polymorphism	NOUN
bam-7186	52	14	/	/	SYM
bam-7186	52	15	soccer	soccer	NOUN
bam-7186	52	16	player	player	NOUN
bam-7186	52	17	association	association	NOUN
bam-7186	52	18	(	(	PUNCT
bam-7186	52	19	p=0.03	p=0.03	ADJ
bam-7186	52	20	)	)	PUNCT
bam-7186	52	21	as	as	ADV
bam-7186	52	22	well	well	ADV
bam-7186	52	23	as	as	ADP
bam-7186	52	24	in	in	ADP
bam-7186	52	25	ace	ace	PROPN
bam-7186	52	26	ii	ii	PROPN
bam-7186	52	27	genotype	genotype	NOUN
bam-7186	52	28	(	(	PUNCT
bam-7186	52	29	p=0.02	p=0.02	NOUN
bam-7186	52	30	)	)	PUNCT
bam-7186	52	31	.	.	PUNCT
bam-7186	53	1	particularly	particularly	ADV
bam-7186	53	2	,	,	PUNCT
bam-7186	53	3	it	it	PRON
bam-7186	53	4	merges	merge	VERB
bam-7186	53	5	a	a	DET
bam-7186	53	6	probability	probability	NOUN
bam-7186	53	7	three	three	NUM
bam-7186	53	8	times	time	NOUN
bam-7186	53	9	higher	high	ADJ
bam-7186	53	10	to	to	PART
bam-7186	53	11	become	become	VERB
bam-7186	53	12	soccer	soccer	NOUN
bam-7186	53	13	players	player	NOUN
bam-7186	53	14	if	if	SCONJ
bam-7186	53	15	you	you	PRON
bam-7186	53	16	have	have	VERB
bam-7186	53	17	these	these	DET
bam-7186	53	18	two	two	NUM
bam-7186	53	19	polymorphisms	polymorphism	NOUN
bam-7186	53	20	(	(	PUNCT
bam-7186	53	21	nrf2	nrf2	PROPN
bam-7186	53	22	ag	ag	PROPN
bam-7186	53	23	/	/	SYM
bam-7186	53	24	gg	gg	PROPN
bam-7186	53	25	and	and	CCONJ
bam-7186	53	26	ace	ace	PROPN
bam-7186	53	27	ii	ii	PROPN
bam-7186	53	28	)	)	PUNCT
bam-7186	53	29	.	.	PUNCT
bam-7186	54	1	furthermore	furthermore	ADV
bam-7186	54	2	,	,	PUNCT
bam-7186	54	3	despite	despite	SCONJ
bam-7186	54	4	ppar	ppar	NOUN
bam-7186	54	5	has	have	VERB
bam-7186	54	6	not	not	PART
bam-7186	54	7	a	a	DET
bam-7186	54	8	statistical	statistical	ADJ
bam-7186	54	9	significance	significance	NOUN
bam-7186	54	10	,	,	PUNCT
bam-7186	54	11	have	have	VERB
bam-7186	54	12	a	a	DET
bam-7186	54	13	positive	positive	ADJ
bam-7186	54	14	estimate	estimate	NOUN
bam-7186	54	15	value	value	NOUN
bam-7186	54	16	(	(	PUNCT
bam-7186	54	17	0,5	0,5	NUM
bam-7186	54	18	)	)	PUNCT
bam-7186	54	19	compare	compare	VERB
bam-7186	54	20	to	to	ADP
bam-7186	54	21	the	the	DET
bam-7186	54	22	others	other	NOUN
bam-7186	54	23	that	that	PRON
bam-7186	54	24	suggest	suggest	VERB
bam-7186	54	25	a	a	DET
bam-7186	54	26	possible	possible	ADJ
bam-7186	54	27	involving	involve	VERB
bam-7186	54	28	in	in	ADP
bam-7186	54	29	the	the	DET
bam-7186	54	30	induction	induction	NOUN
bam-7186	54	31	of	of	ADP
bam-7186	54	32	the	the	DET
bam-7186	54	33	expression	expression	NOUN
bam-7186	54	34	of	of	ADP
bam-7186	54	35	elite	elite	ADJ
bam-7186	54	36	phenotype	phenotype	NOUN
bam-7186	54	37	(	(	PUNCT
bam-7186	54	38	tab	tab	NOUN
bam-7186	54	39	.	.	NOUN
bam-7186	54	40	2	2	NUM
bam-7186	54	41	)	)	PUNCT
bam-7186	54	42	.	.	PUNCT
bam-7186	55	1	although	although	SCONJ
bam-7186	55	2	the	the	DET
bam-7186	55	3	others	other	NOUN
bam-7186	55	4	peps	pep	NOUN
bam-7186	55	5	(	(	PUNCT
bam-7186	55	6	ppar	ppar	NOUN
bam-7186	55	7	,	,	PUNCT
bam-7186	55	8	ppargc1	ppargc1	NOUN
bam-7186	55	9	,	,	PUNCT
bam-7186	55	10	ckmm	ckmm	PROPN
bam-7186	55	11	)	)	PUNCT
bam-7186	55	12	had	have	VERB
bam-7186	55	13	no	no	DET
bam-7186	55	14	statistical	statistical	ADJ
bam-7186	55	15	significance	significance	NOUN
bam-7186	55	16	and	and	CCONJ
bam-7186	55	17	they	they	PRON
bam-7186	55	18	did	do	AUX
bam-7186	55	19	n’t	not	PART
bam-7186	55	20	show	show	VERB
bam-7186	55	21	any	any	DET
bam-7186	55	22	correlation	correlation	NOUN
bam-7186	55	23	with	with	ADP
bam-7186	55	24	the	the	DET
bam-7186	55	25	others	other	NOUN
bam-7186	55	26	,	,	PUNCT
bam-7186	55	27	it	it	PRON
bam-7186	55	28	means	mean	VERB
bam-7186	55	29	they	they	PRON
bam-7186	55	30	probably	probably	ADV
bam-7186	55	31	work	work	VERB
bam-7186	55	32	independently	independently	ADV
bam-7186	55	33	.	.	PUNCT
bam-7186	56	1	figure	figure	VERB
bam-7186	56	2	1	1	NUM
bam-7186	56	3	summarized	summarize	VERB
bam-7186	56	4	all	all	DET
bam-7186	56	5	five	five	NUM
bam-7186	56	6	polymorphisms	polymorphism	NOUN
bam-7186	56	7	belong	belong	VERB
bam-7186	56	8	to	to	ADP
bam-7186	56	9	the	the	DET
bam-7186	56	10	performanceenhancing	performanceenhance	VERB
bam-7186	56	11	polymorphism	polymorphism	NOUN
bam-7186	56	12	family	family	NOUN
bam-7186	56	13	and	and	CCONJ
bam-7186	56	14	how	how	SCONJ
bam-7186	56	15	it	it	PRON
bam-7186	56	16	’s	’	VERB
bam-7186	56	17	probably	probably	ADV
bam-7186	56	18	works	work	VERB
bam-7186	56	19	.	.	PUNCT
bam-7186	57	1	previously	previously	ADV
bam-7186	57	2	,	,	PUNCT
bam-7186	57	3	we	we	PRON
bam-7186	57	4	demonstrated	demonstrate	VERB
bam-7186	57	5	that	that	SCONJ
bam-7186	57	6	pparhad	pparhad	VERB
bam-7186	57	7	a	a	DET
bam-7186	57	8	significant	significant	ADJ
bam-7186	57	9	trend	trend	NOUN
bam-7186	57	10	of	of	ADP
bam-7186	57	11	association	association	NOUN
bam-7186	57	12	between	between	ADP
bam-7186	57	13	gg	gg	PROPN
bam-7186	57	14	polymorphism	polymorphism	NOUN
bam-7186	57	15	,	,	PUNCT
bam-7186	57	16	especially	especially	ADV
bam-7186	57	17	g	g	ADP
bam-7186	57	18	allele	allele	NOUN
bam-7186	57	19	,	,	PUNCT
bam-7186	57	20	and	and	CCONJ
bam-7186	57	21	elite	elite	ADJ
bam-7186	57	22	soccer	soccer	NOUN
bam-7186	57	23	player.25	player.25	NOUN
bam-7186	57	24	through	through	ADP
bam-7186	57	25	this	this	DET
bam-7186	57	26	new	new	ADJ
bam-7186	57	27	approach	approach	NOUN
bam-7186	57	28	,	,	PUNCT
bam-7186	57	29	we	we	PRON
bam-7186	57	30	realized	realize	VERB
bam-7186	57	31	that	that	SCONJ
bam-7186	57	32	the	the	DET
bam-7186	57	33	polymorphism	polymorphism	NOUN
bam-7186	57	34	investigation	investigation	NOUN
bam-7186	57	35	could	could	AUX
bam-7186	57	36	be	be	AUX
bam-7186	57	37	a	a	DET
bam-7186	57	38	marker	marker	NOUN
bam-7186	57	39	of	of	ADP
bam-7186	57	40	the	the	DET
bam-7186	57	41	elite	elite	ADJ
bam-7186	57	42	phenotype	phenotype	NOUN
bam-7186	57	43	only	only	ADV
bam-7186	57	44	if	if	SCONJ
bam-7186	57	45	it	it	PRON
bam-7186	57	46	’s	’s	AUX
bam-7186	57	47	associated	associate	VERB
bam-7186	57	48	each	each	DET
bam-7186	57	49	other	other	ADJ
bam-7186	57	50	.	.	PUNCT
bam-7186	58	1	as	as	ADP
bam-7186	58	2	a	a	DET
bam-7186	58	3	matter	matter	NOUN
bam-7186	58	4	of	of	ADP
bam-7186	58	5	fact	fact	NOUN
bam-7186	58	6	ppardemonstrated	ppardemonstrate	VERB
bam-7186	58	7	a	a	DET
bam-7186	58	8	significant	significant	ADJ
bam-7186	58	9	statistical	statistical	ADJ
bam-7186	58	10	association	association	NOUN
bam-7186	58	11	with	with	ADP
bam-7186	58	12	soccer	soccer	NOUN
bam-7186	58	13	player	player	NOUN
bam-7186	58	14	group	group	NOUN
bam-7186	58	15	(	(	PUNCT
bam-7186	58	16	p=0.03	p=0.03	ADJ
bam-7186	58	17	)	)	PUNCT
bam-7186	58	18	only	only	ADV
bam-7186	58	19	when	when	SCONJ
bam-7186	58	20	is	be	AUX
bam-7186	58	21	investigated	investigate	VERB
bam-7186	58	22	with	with	ADP
bam-7186	58	23	nrf2	nrf2	NOUN
bam-7186	58	24	genotype	genotype	NOUN
bam-7186	58	25	.	.	PUNCT
bam-7186	59	1	definitely	definitely	ADV
bam-7186	59	2	ppar	ppar	NOUN
bam-7186	59	3	could	could	AUX
bam-7186	59	4	acts	act	VERB
bam-7186	59	5	on	on	ADP
bam-7186	59	6	nrf2	nrf2	PROPN
bam-7186	59	7	(	(	PUNCT
bam-7186	59	8	gg	gg	NOUN
bam-7186	59	9	)	)	PUNCT
bam-7186	59	10	enhancing	enhance	VERB
bam-7186	59	11	the	the	DET
bam-7186	59	12	effects	effect	NOUN
bam-7186	59	13	of	of	ADP
bam-7186	59	14	the	the	DET
bam-7186	59	15	latter	latter	ADJ
bam-7186	59	16	nonetheless	nonetheless	ADV
bam-7186	59	17	it	it	PRON
bam-7186	59	18	had	have	AUX
bam-7186	59	19	not	not	PART
bam-7186	59	20	shown	show	VERB
bam-7186	59	21	a	a	DET
bam-7186	59	22	statistical	statistical	ADJ
bam-7186	59	23	significance	significance	NOUN
bam-7186	59	24	(	(	PUNCT
bam-7186	59	25	fig	fig	NOUN
bam-7186	59	26	1	1	NUM
bam-7186	59	27	)	)	PUNCT
bam-7186	59	28	.	.	PUNCT
bam-7186	60	1	the	the	DET
bam-7186	60	2	genotype	genotype	NOUN
bam-7186	60	3	distribution	distribution	NOUN
bam-7186	60	4	was	be	AUX
bam-7186	60	5	in	in	ADP
bam-7186	60	6	hardy	hardy	ADJ
bam-7186	60	7	-	-	PUNCT
bam-7186	60	8	weinberg	weinberg	NOUN
bam-7186	60	9	equilibrium	equilibrium	NOUN
bam-7186	60	10	for	for	ADP
bam-7186	60	11	the	the	DET
bam-7186	60	12	whole	whole	ADJ
bam-7186	60	13	group	group	NOUN
bam-7186	60	14	(	(	PUNCT
bam-7186	60	15	soccer	soccer	NOUN
bam-7186	60	16	players	player	NOUN
bam-7186	60	17	and	and	CCONJ
bam-7186	60	18	control	control	NOUN
bam-7186	60	19	group	group	NOUN
bam-7186	60	20	)	)	PUNCT
bam-7186	60	21	.	.	PUNCT
bam-7186	61	1	the	the	DET
bam-7186	61	2	area	area	NOUN
bam-7186	61	3	under	under	ADP
bam-7186	61	4	the	the	DET
bam-7186	61	5	roc	roc	PROPN
bam-7186	61	6	curve	curve	NOUN
bam-7186	61	7	is	be	AUX
bam-7186	61	8	.80	.80	NUM
bam-7186	61	9	(	(	PUNCT
bam-7186	61	10	auc	auc	NOUN
bam-7186	61	11	)	)	PUNCT
bam-7186	61	12	that	that	PRON
bam-7186	61	13	be	be	AUX
bam-7186	61	14	considered	consider	VERB
bam-7186	61	15	to	to	PART
bam-7186	61	16	be	be	AUX
bam-7186	61	17	"	"	PUNCT
bam-7186	61	18	good	good	ADJ
bam-7186	61	19	"	"	PUNCT
bam-7186	61	20	at	at	ADP
bam-7186	61	21	separating	separate	VERB
bam-7186	61	22	elite	elite	ADJ
bam-7186	61	23	soccer	soccer	NOUN
bam-7186	61	24	players	player	NOUN
bam-7186	61	25	from	from	ADP
bam-7186	61	26	control	control	PROPN
bam-7186	61	27	group	group	NOUN
bam-7186	61	28	.	.	PUNCT
bam-7186	62	1	the	the	DET
bam-7186	62	2	roc	roc	PROPN
bam-7186	62	3	analysis	analysis	NOUN
bam-7186	62	4	highlights	highlight	NOUN
bam-7186	62	5	a	a	DET
bam-7186	62	6	significant	significant	ADJ
bam-7186	62	7	discriminating	discriminate	VERB
bam-7186	62	8	accuracy	accuracy	NOUN
bam-7186	62	9	of	of	ADP
bam-7186	62	10	the	the	DET
bam-7186	62	11	model	model	NOUN
bam-7186	62	12	in	in	ADP
bam-7186	62	13	identifying	identify	VERB
bam-7186	62	14	an	an	DET
bam-7186	62	15	elite	elite	ADJ
bam-7186	62	16	soccer	soccer	NOUN
bam-7186	62	17	players	player	NOUN
bam-7186	62	18	(	(	PUNCT
bam-7186	62	19	area	area	NOUN
bam-7186	62	20	under	under	ADP
bam-7186	62	21	the	the	DET
bam-7186	62	22	curve	curve	NOUN
bam-7186	62	23	[	[	X
bam-7186	62	24	auc]=0.80	auc]=0.80	X
bam-7186	62	25	;	;	PUNCT
bam-7186	62	26	95	95	NUM
bam-7186	62	27	%	%	NOUN
bam-7186	62	28	confidence	confidence	NOUN
bam-7186	62	29	interval	interval	NOUN
bam-7186	63	1	[	[	X
bam-7186	63	2	ci	ci	X
bam-7186	63	3	]	]	X
bam-7186	63	4	:	:	PUNCT
bam-7186	63	5	0.71	0.71	NUM
bam-7186	63	6	-	-	SYM
bam-7186	63	7	0.88	0.88	NUM
bam-7186	63	8	)	)	PUNCT
bam-7186	63	9	(	(	PUNCT
bam-7186	63	10	fig	fig	NOUN
bam-7186	63	11	2	2	NUM
bam-7186	63	12	)	)	PUNCT
bam-7186	63	13	.	.	PUNCT
bam-7186	64	1	definitely	definitely	ADV
bam-7186	64	2	,	,	PUNCT
bam-7186	64	3	the	the	DET
bam-7186	64	4	results	result	NOUN
bam-7186	64	5	of	of	ADP
bam-7186	64	6	the	the	DET
bam-7186	64	7	statistical	statistical	ADJ
bam-7186	64	8	analysis	analysis	NOUN
bam-7186	64	9	for	for	ADP
bam-7186	64	10	the	the	DET
bam-7186	64	11	comparison	comparison	NOUN
bam-7186	64	12	of	of	ADP
bam-7186	64	13	elite	elite	ADJ
bam-7186	64	14	athletes	athlete	NOUN
bam-7186	64	15	vs	vs	ADP
bam-7186	64	16	controls	control	NOUN
bam-7186	64	17	indicated	indicate	VERB
bam-7186	64	18	that	that	SCONJ
bam-7186	64	19	particularly	particularly	ADV
bam-7186	64	20	3	3	NUM
bam-7186	64	21	polymorphisms	polymorphism	NOUN
bam-7186	64	22	of	of	ADP
bam-7186	64	23	those	those	PRON
bam-7186	64	24	analysed	analyse	VERB
bam-7186	64	25	were	be	AUX
bam-7186	64	26	significantly	significantly	ADV
bam-7186	64	27	associated	associate	VERB
bam-7186	64	28	with	with	ADP
bam-7186	64	29	elite	elite	ADJ
bam-7186	64	30	phenotype	phenotype	NOUN
bam-7186	64	31	:	:	PUNCT
bam-7186	64	32	2	2	NUM
bam-7186	64	33	directly	directly	ADV
bam-7186	64	34	(	(	PUNCT
bam-7186	64	35	nrf2	nrf2	PROPN
bam-7186	64	36	ag	ag	PROPN
bam-7186	64	37	/	/	SYM
bam-7186	64	38	gg	gg	PROPN
bam-7186	64	39	and	and	CCONJ
bam-7186	64	40	ace	ace	PROPN
bam-7186	64	41	ii	ii	PROPN
bam-7186	64	42	)	)	PUNCT
bam-7186	64	43	and	and	CCONJ
bam-7186	64	44	1	1	NUM
bam-7186	64	45	indirectly	indirectly	ADV
bam-7186	64	46	(	(	PUNCT
bam-7186	64	47	pparthrough	pparthrough	NUM
bam-7186	64	48	nrf2	nrf2	NOUN
bam-7186	64	49	)	)	PUNCT
bam-7186	64	50	.	.	PUNCT
bam-7186	65	1	discussion	discussion	NOUN
bam-7186	65	2	since	since	SCONJ
bam-7186	65	3	many	many	ADJ
bam-7186	65	4	years	year	NOUN
bam-7186	65	5	disputes	dispute	NOUN
bam-7186	65	6	have	have	AUX
bam-7186	65	7	emerged	emerge	VERB
bam-7186	65	8	about	about	ADP
bam-7186	65	9	the	the	DET
bam-7186	65	10	interpretation	interpretation	NOUN
bam-7186	65	11	of	of	ADP
bam-7186	65	12	association	association	NOUN
bam-7186	65	13	studies	study	NOUN
bam-7186	65	14	involving	involve	VERB
bam-7186	65	15	ace	ace	NOUN
bam-7186	65	16	gene	gene	NOUN
bam-7186	65	17	(	(	PUNCT
bam-7186	65	18	i	i	NOUN
bam-7186	65	19	/	/	SYM
bam-7186	65	20	d	d	NOUN
bam-7186	65	21	)	)	PUNCT
bam-7186	65	22	.	.	PUNCT
bam-7186	66	1	some	some	DET
bam-7186	66	2	studies	study	NOUN
bam-7186	66	3	,	,	PUNCT
bam-7186	66	4	indeed	indeed	ADV
bam-7186	66	5	,	,	PUNCT
bam-7186	66	6	related	relate	VERB
bam-7186	66	7	the	the	DET
bam-7186	66	8	i	i	PROPN
bam-7186	66	9	allele	allele	NOUN
bam-7186	66	10	with	with	ADP
bam-7186	66	11	power	power	NOUN
bam-7186	66	12	performance	performance	NOUN
bam-7186	66	13	instead	instead	ADV
bam-7186	66	14	of	of	ADP
bam-7186	66	15	endurance	endurance	NOUN
bam-7186	66	16	performance	performance	NOUN
bam-7186	66	17	26,27.the	26,27.the	DET
bam-7186	66	18	novelty	novelty	NOUN
bam-7186	66	19	of	of	ADP
bam-7186	66	20	this	this	DET
bam-7186	66	21	study	study	NOUN
bam-7186	66	22	lies	lie	VERB
bam-7186	66	23	in	in	ADP
bam-7186	66	24	the	the	DET
bam-7186	66	25	fact	fact	NOUN
bam-7186	66	26	that	that	SCONJ
bam-7186	66	27	even	even	ADV
bam-7186	66	28	in	in	ADP
bam-7186	66	29	a	a	DET
bam-7186	66	30	team	team	NOUN
bam-7186	66	31	sport	sport	NOUN
bam-7186	66	32	like	like	ADP
bam-7186	66	33	football	football	NOUN
bam-7186	66	34	,	,	PUNCT
bam-7186	66	35	it	it	PRON
bam-7186	66	36	is	be	AUX
bam-7186	66	37	possible	possible	ADJ
bam-7186	66	38	to	to	PART
bam-7186	66	39	find	find	VERB
bam-7186	66	40	this	this	DET
bam-7186	66	41	type	type	NOUN
bam-7186	66	42	of	of	ADP
bam-7186	66	43	association	association	NOUN
bam-7186	66	44	.	.	PUNCT
bam-7186	67	1	particularly	particularly	ADV
bam-7186	67	2	,	,	PUNCT
bam-7186	67	3	we	we	PRON
bam-7186	67	4	applied	apply	VERB
bam-7186	67	5	a	a	DET
bam-7186	67	6	multivariate	multivariate	NOUN
bam-7186	67	7	linear	linear	ADJ
bam-7186	67	8	regression	regression	NOUN
bam-7186	67	9	to	to	PART
bam-7186	67	10	better	well	ADV
bam-7186	67	11	analyzed	analyze	VERB
bam-7186	67	12	which	which	PRON
bam-7186	67	13	is	be	AUX
bam-7186	67	14	the	the	DET
bam-7186	67	15	impact	impact	NOUN
bam-7186	67	16	of	of	ADP
bam-7186	67	17	each	each	DET
bam-7186	67	18	polimorphism	polimorphism	NOUN
bam-7186	67	19	alone	alone	ADJ
bam-7186	67	20	or	or	CCONJ
bam-7186	67	21	together	together	ADV
bam-7186	67	22	to	to	PART
bam-7186	67	23	induce	induce	VERB
bam-7186	67	24	elite	elite	ADJ
bam-7186	67	25	phenotype	phenotype	NOUN
bam-7186	67	26	expression	expression	NOUN
bam-7186	67	27	.	.	PUNCT
bam-7186	68	1	taken	take	VERB
bam-7186	68	2	together	together	ADV
bam-7186	68	3	the	the	DET
bam-7186	68	4	results	result	NOUN
bam-7186	68	5	obtained	obtain	VERB
bam-7186	68	6	in	in	ADP
bam-7186	68	7	our	our	PRON
bam-7186	68	8	previous	previous	ADJ
bam-7186	68	9	study25	study25	NOUN
bam-7186	68	10	and	and	CCONJ
bam-7186	68	11	in	in	ADP
bam-7186	68	12	this	this	DET
bam-7186	68	13	one	one	NOUN
bam-7186	68	14	,	,	PUNCT
bam-7186	68	15	it	it	PRON
bam-7186	68	16	is	be	AUX
bam-7186	68	17	clear	clear	ADJ
bam-7186	68	18	that	that	SCONJ
bam-7186	68	19	the	the	DET
bam-7186	68	20	new	new	ADJ
bam-7186	68	21	approach	approach	NOUN
bam-7186	68	22	shows	show	VERB
bam-7186	68	23	power	power	NOUN
bam-7186	68	24	of	of	ADP
bam-7186	68	25	each	each	DET
bam-7186	68	26	polymorphism	polymorphism	NOUN
bam-7186	68	27	as	as	ADP
bam-7186	68	28	performance	performance	NOUN
bam-7186	68	29	-	-	PUNCT
bam-7186	68	30	enhancing	enhance	VERB
bam-7186	68	31	factor	factor	NOUN
bam-7186	68	32	.	.	PUNCT
bam-7186	69	1	in	in	ADP
bam-7186	69	2	the	the	DET
bam-7186	69	3	attempt	attempt	NOUN
bam-7186	69	4	to	to	PART
bam-7186	69	5	implement	implement	VERB
bam-7186	69	6	experimental	experimental	ADJ
bam-7186	69	7	designs	design	NOUN
bam-7186	69	8	reducing	reduce	VERB
bam-7186	69	9	selection	selection	NOUN
bam-7186	69	10	errors	error	NOUN
bam-7186	69	11	and	and	CCONJ
bam-7186	69	12	the	the	DET
bam-7186	69	13	study	study	NOUN
bam-7186	69	14	of	of	ADP
bam-7186	69	15	athletes	athlete	NOUN
bam-7186	69	16	from	from	ADP
bam-7186	69	17	different	different	ADJ
bam-7186	69	18	sports	sport	NOUN
bam-7186	69	19	,	,	PUNCT
bam-7186	69	20	comparing	compare	VERB
bam-7186	69	21	them	they	PRON
bam-7186	69	22	with	with	ADP
bam-7186	69	23	a	a	DET
bam-7186	69	24	control	control	NOUN
bam-7186	69	25	group	group	NOUN
bam-7186	69	26	adequately	adequately	ADV
bam-7186	69	27	table	table	NOUN
bam-7186	69	28	2	2	NUM
bam-7186	69	29	.	.	PUNCT
bam-7186	69	30	estimates	estimate	NOUN
bam-7186	69	31	and	and	CCONJ
bam-7186	69	32	standard	standard	ADJ
bam-7186	69	33	errors	error	NOUN
bam-7186	69	34	for	for	ADP
bam-7186	69	35	the	the	DET
bam-7186	69	36	model	model	NOUN
bam-7186	69	37	and	and	CCONJ
bam-7186	69	38	the	the	DET
bam-7186	69	39	significance	significance	NOUN
bam-7186	69	40	of	of	ADP
bam-7186	69	41	each	each	DET
bam-7186	69	42	coefficient	coefficient	NOUN
bam-7186	69	43	in	in	ADP
bam-7186	69	44	the	the	DET
bam-7186	69	45	presence	presence	NOUN
bam-7186	69	46	of	of	ADP
bam-7186	69	47	the	the	DET
bam-7186	69	48	others	other	NOUN
bam-7186	69	49	variable	variable	ADJ
bam-7186	69	50	estimates	estimate	VERB
bam-7186	69	51	std	std	NOUN
bam-7186	69	52	error	error	NOUN
bam-7186	69	53	z	z	NOUN
bam-7186	69	54	value	value	NOUN
bam-7186	69	55	p	p	NOUN
bam-7186	69	56	-	-	PUNCT
bam-7186	69	57	value	value	NOUN
bam-7186	69	58	intercept	intercept	NOUN
bam-7186	69	59	-2,4614	-2,4614	PROPN
bam-7186	69	60	1,5752	1,5752	NUM
bam-7186	69	61	-1,56	-1,56	PROPN
bam-7186	69	62	0,1182	0,1182	PROPN
bam-7186	69	63	ppara	ppara	PROPN
bam-7186	69	64	gc	gc	PROPN
bam-7186	69	65	-0,1094	-0,1094	PROPN
bam-7186	69	66	0,7996	0,7996	PROPN
bam-7186	69	67	-0,14	-0,14	ADP
bam-7186	69	68	0,8912	0,8912	PROPN
bam-7186	69	69	ppara	ppara	NOUN
bam-7186	69	70	gg	gg	PROPN
bam-7186	69	71	0,5458	0,5458	PROPN
bam-7186	69	72	0,7942	0,7942	NOUN
bam-7186	69	73	0,69	0,69	PUNCT
bam-7186	70	1	0,4919	0,4919	PROPN
bam-7186	70	2	ppargc1	ppargc1	NOUN
bam-7186	70	3	sg	sg	PROPN
bam-7186	70	4	-0,3521	-0,3521	PROPN
bam-7186	70	5	0,5198	0,5198	PROPN
bam-7186	70	6	-0,68	-0,68	PUNCT
bam-7186	70	7	0,4981	0,4981	NUM
bam-7186	70	8	ppargc1	ppargc1	PROPN
bam-7186	70	9	ss	ss	PROPN
bam-7186	71	1	-0,6604	-0,6604	PROPN
bam-7186	71	2	0,8459	0,8459	NOUN
bam-7186	72	1	-0,78	-0,78	PROPN
bam-7186	72	2	0,4350	0,4350	PROPN
bam-7186	72	3	ace	ace	VERB
bam-7186	73	1	i	i	PROPN
bam-7186	73	2	d	d	PROPN
bam-7186	73	3	0,6882	0,6882	PROPN
bam-7186	73	4	0,5347	0,5347	PROPN
bam-7186	73	5	1,29	1,29	NUM
bam-7186	73	6	0,1981	0,1981	PROPN
bam-7186	73	7	ace	ace	PROPN
bam-7186	73	8	ii	ii	NOUN
bam-7186	73	9	3,3034	3,3034	NUM
bam-7186	73	10	1,5015	1,5015	PROPN
bam-7186	73	11	2,20	2,20	NUM
bam-7186	73	12	0,0278	0,0278	PROPN
bam-7186	73	13	*	*	PUNCT
bam-7186	73	14	ckmm	ckmm	PROPN
bam-7186	73	15	ag	ag	PROPN
bam-7186	73	16	-0,8885	-0,8885	PROPN
bam-7186	73	17	0,5113	0,5113	NUM
bam-7186	73	18	-1,74	-1,74	PROPN
bam-7186	73	19	0,0822	0,0822	NOUN
bam-7186	73	20	.	.	PUNCT
bam-7186	74	1	ckmm	ckmm	PROPN
bam-7186	74	2	gg	gg	PROPN
bam-7186	74	3	-0,8795	-0,8795	PROPN
bam-7186	74	4	0,7630	0,7630	PROPN
bam-7186	74	5	-1,15	-1,15	PROPN
bam-7186	74	6	0,2490	0,2490	NUM
bam-7186	74	7	nrf2	nrf2	PROPN
bam-7186	74	8	ag	ag	PROPN
bam-7186	74	9	/	/	SYM
bam-7186	74	10	ag	ag	PROPN
bam-7186	74	11	3,1164	3,1164	PROPN
bam-7186	74	12	1,4368	1,4368	NUM
bam-7186	74	13	2,17	2,17	NUM
bam-7186	74	14	0,0301	0,0301	NOUN
bam-7186	74	15	*	*	PUNCT
bam-7186	74	16	nrf2	nrf2	PROPN
bam-7186	74	17	ag	ag	PROPN
bam-7186	74	18	/	/	SYM
bam-7186	74	19	gg	gg	PROPN
bam-7186	74	20	3,8156	3,8156	PROPN
bam-7186	74	21	1,7672	1,7672	PROPN
bam-7186	74	22	2,16	2,16	NUM
bam-7186	74	23	0,0308	0,0308	NUM
bam-7186	74	24	*	*	PUNCT
bam-7186	74	25	non	non	ADJ
bam-7186	74	26	co	co	X
bam-7186	74	27	mmerc	mmerc	PROPN
bam-7186	74	28	ial	ial	PROPN
bam-7186	74	29	us	us	PROPN
bam-7186	74	30	e	e	NOUN
bam-7186	74	31	o	o	NOUN
bam-7186	74	32	nly	nly	ADV
bam-7186	74	33	polymorphisms	polymorphism	NOUN
bam-7186	74	34	of	of	ADP
bam-7186	74	35	elite	elite	ADJ
bam-7186	74	36	athletes	athlete	NOUN
bam-7186	74	37	phenotype	phenotype	VERB
bam-7186	74	38	eur	eur	PROPN
bam-7186	74	39	j	j	PROPN
bam-7186	74	40	transl	transl	PROPN
bam-7186	74	41	myol	myol	ADV
bam-7186	74	42	28	28	NUM
bam-7186	74	43	(	(	PUNCT
bam-7186	74	44	1	1	NUM
bam-7186	74	45	):	):	PUNCT
bam-7186	74	46	87	87	NUM
bam-7186	74	47	-	-	SYM
bam-7186	74	48	92	92	NUM
bam-7186	74	49	,	,	PUNCT
bam-7186	74	50	2018	2018	NUM
bam-7186	74	51	91	91	NUM
bam-7186	74	52	large	large	ADJ
bam-7186	74	53	,	,	PUNCT
bam-7186	74	54	helps	help	VERB
bam-7186	74	55	to	to	PART
bam-7186	74	56	make	make	VERB
bam-7186	74	57	results	result	NOUN
bam-7186	74	58	achievable	achievable	ADJ
bam-7186	74	59	and	and	CCONJ
bam-7186	74	60	reproducible	reproducible	ADJ
bam-7186	74	61	.	.	PUNCT
bam-7186	75	1	in	in	ADP
bam-7186	75	2	details	detail	NOUN
bam-7186	75	3	,	,	PUNCT
bam-7186	75	4	during	during	ADP
bam-7186	75	5	a	a	DET
bam-7186	75	6	game	game	NOUN
bam-7186	75	7	of	of	ADP
bam-7186	75	8	90	90	NUM
bam-7186	75	9	minutes	minute	NOUN
bam-7186	75	10	,	,	PUNCT
bam-7186	75	11	medium	medium	ADJ
bam-7186	75	12	-	-	PUNCT
bam-7186	75	13	high	high	ADJ
bam-7186	75	14	level	level	NOUN
bam-7186	75	15	players	player	NOUN
bam-7186	75	16	run	run	VERB
bam-7186	75	17	for	for	ADP
bam-7186	75	18	about	about	ADV
bam-7186	75	19	8	8	NUM
bam-7186	75	20	-	-	SYM
bam-7186	75	21	10	10	NUM
bam-7186	75	22	km	km	NOUN
bam-7186	75	23	at	at	ADP
bam-7186	75	24	an	an	DET
bam-7186	75	25	intensity	intensity	NOUN
bam-7186	75	26	close	close	ADV
bam-7186	75	27	to	to	ADP
bam-7186	75	28	the	the	DET
bam-7186	75	29	anaerobic	anaerobic	NOUN
bam-7186	75	30	threshold	threshold	NOUN
bam-7186	75	31	(	(	PUNCT
bam-7186	75	32	80	80	NUM
bam-7186	75	33	-	-	SYM
bam-7186	75	34	90	90	NUM
bam-7186	75	35	%	%	NOUN
bam-7186	75	36	of	of	ADP
bam-7186	75	37	maximum	maximum	ADJ
bam-7186	75	38	heart	heart	NOUN
bam-7186	75	39	rate	rate	NOUN
bam-7186	75	40	)	)	PUNCT
bam-7186	75	41	.	.	PUNCT
bam-7186	76	1	however	however	ADV
bam-7186	76	2	,	,	PUNCT
bam-7186	76	3	within	within	ADP
bam-7186	76	4	this	this	DET
bam-7186	76	5	endurance	endurance	NOUN
bam-7186	76	6	context	context	NOUN
bam-7186	76	7	are	be	AUX
bam-7186	76	8	required	require	VERB
bam-7186	76	9	numerous	numerous	ADJ
bam-7186	76	10	flashes	flash	NOUN
bam-7186	76	11	of	of	ADP
bam-7186	76	12	explosive	explosive	ADJ
bam-7186	76	13	strenght	strenght	ADJ
bam-7186	76	14	,	,	PUNCT
bam-7186	76	15	as	as	SCONJ
bam-7186	76	16	kicks	kick	NOUN
bam-7186	76	17	,	,	PUNCT
bam-7186	76	18	jumps	jump	VERB
bam-7186	76	19	,	,	PUNCT
bam-7186	76	20	sprints	sprint	NOUN
bam-7186	76	21	,	,	PUNCT
bam-7186	76	22	changes	change	NOUN
bam-7186	76	23	of	of	ADP
bam-7186	76	24	speed	speed	NOUN
bam-7186	76	25	and	and	CCONJ
bam-7186	76	26	direction	direction	NOUN
bam-7186	76	27	and	and	CCONJ
bam-7186	76	28	tackle	tackle	VERB
bam-7186	76	29	,	,	PUNCT
bam-7186	76	30	in	in	ADP
bam-7186	76	31	addition	addition	NOUN
bam-7186	76	32	to	to	ADP
bam-7186	76	33	maintaining	maintain	VERB
bam-7186	76	34	balance	balance	NOUN
bam-7186	76	35	under	under	ADP
bam-7186	76	36	defensive	defensive	ADJ
bam-7186	76	37	pressure	pressure	NOUN
bam-7186	76	38	to	to	PART
bam-7186	76	39	control	control	VERB
bam-7186	76	40	the	the	DET
bam-7186	76	41	ball	ball	NOUN
bam-7186	76	42	.	.	PUNCT
bam-7186	77	1	since	since	SCONJ
bam-7186	77	2	the	the	DET
bam-7186	77	3	main	main	ADJ
bam-7186	77	4	component	component	NOUN
bam-7186	77	5	is	be	AUX
bam-7186	77	6	,	,	PUNCT
bam-7186	77	7	however	however	ADV
bam-7186	77	8	,	,	PUNCT
bam-7186	77	9	resistance	resistance	NOUN
bam-7186	77	10	,	,	PUNCT
bam-7186	77	11	this	this	PRON
bam-7186	77	12	could	could	AUX
bam-7186	77	13	explain	explain	VERB
bam-7186	77	14	a	a	DET
bam-7186	77	15	genotypic	genotypic	NOUN
bam-7186	77	16	profile	profile	NOUN
bam-7186	77	17	typical	typical	ADJ
bam-7186	77	18	of	of	ADP
bam-7186	77	19	endurance	endurance	NOUN
bam-7186	77	20	athletes	athlete	NOUN
bam-7186	77	21	associated	associate	VERB
bam-7186	77	22	with	with	ADP
bam-7186	77	23	football	football	NOUN
bam-7186	77	24	players	player	NOUN
bam-7186	77	25	.	.	PUNCT
bam-7186	78	1	on	on	ADP
bam-7186	78	2	the	the	DET
bam-7186	78	3	other	other	ADJ
bam-7186	78	4	hand	hand	NOUN
bam-7186	78	5	,	,	PUNCT
bam-7186	78	6	it	it	PRON
bam-7186	78	7	should	should	AUX
bam-7186	78	8	be	be	AUX
bam-7186	78	9	stressed	stress	VERB
bam-7186	78	10	that	that	SCONJ
bam-7186	78	11	athletic	athletic	ADJ
bam-7186	78	12	performances	performance	NOUN
bam-7186	78	13	are	be	AUX
bam-7186	78	14	multifactorial	multifactorial	ADJ
bam-7186	78	15	events	event	NOUN
bam-7186	78	16	:	:	PUNCT
bam-7186	78	17	factors	factor	NOUN
bam-7186	78	18	such	such	ADJ
bam-7186	78	19	as	as	ADP
bam-7186	78	20	environment	environment	NOUN
bam-7186	78	21	,	,	PUNCT
bam-7186	78	22	gene	gene	NOUN
bam-7186	78	23	-	-	PUNCT
bam-7186	78	24	gene	gene	NOUN
bam-7186	78	25	and	and	CCONJ
bam-7186	78	26	geneenvironment	geneenvironment	NOUN
bam-7186	78	27	interactions	interaction	NOUN
bam-7186	78	28	play	play	VERB
bam-7186	78	29	valuable	valuable	ADJ
bam-7186	78	30	roles	role	NOUN
bam-7186	78	31	in	in	ADP
bam-7186	78	32	the	the	DET
bam-7186	78	33	complex	complex	ADJ
bam-7186	78	34	traits	trait	NOUN
bam-7186	78	35	of	of	ADP
bam-7186	78	36	champions	champion	NOUN
bam-7186	78	37	,	,	PUNCT
bam-7186	78	38	that	that	PRON
bam-7186	78	39	can	can	AUX
bam-7186	78	40	not	not	PART
bam-7186	78	41	be	be	AUX
bam-7186	78	42	reduced	reduce	VERB
bam-7186	78	43	to	to	ADP
bam-7186	78	44	a	a	DET
bam-7186	78	45	set	set	NOUN
bam-7186	78	46	of	of	ADP
bam-7186	78	47	genetic	genetic	ADJ
bam-7186	78	48	polymorphisms.28	polymorphisms.28	NOUN
bam-7186	78	49	this	this	DET
bam-7186	78	50	innovative	innovative	ADJ
bam-7186	78	51	method	method	NOUN
bam-7186	78	52	begins	begin	VERB
bam-7186	78	53	to	to	PART
bam-7186	78	54	be	be	AUX
bam-7186	78	55	used	use	VERB
bam-7186	78	56	in	in	ADP
bam-7186	78	57	many	many	ADJ
bam-7186	78	58	other	other	ADJ
bam-7186	78	59	fields	field	NOUN
bam-7186	78	60	,	,	PUNCT
bam-7186	78	61	such	such	ADJ
bam-7186	78	62	as	as	ADP
bam-7186	78	63	the	the	DET
bam-7186	78	64	prevention	prevention	NOUN
bam-7186	78	65	of	of	ADP
bam-7186	78	66	injuries	injury	NOUN
bam-7186	78	67	and	and	CCONJ
bam-7186	78	68	the	the	DET
bam-7186	78	69	investigation	investigation	NOUN
bam-7186	78	70	of	of	ADP
bam-7186	78	71	muscular	muscular	ADJ
bam-7186	78	72	morphological	morphological	ADJ
bam-7186	78	73	changes	change	NOUN
bam-7186	78	74	,	,	PUNCT
bam-7186	78	75	such	such	ADJ
bam-7186	78	76	as	as	ADP
bam-7186	78	77	atrophy	atrophy	NOUN
bam-7186	78	78	or	or	CCONJ
bam-7186	78	79	myasthenic	myasthenic	ADJ
bam-7186	78	80	syndrome.29,30,31	syndrome.29,30,31	NOUN
bam-7186	78	81	list	list	NOUN
bam-7186	78	82	of	of	ADP
bam-7186	78	83	acronyms	acronym	NOUN
bam-7186	78	84	ace	ace	VERB
bam-7186	78	85	angiotensin	angiotensin	NOUN
bam-7186	78	86	converting	convert	VERB
bam-7186	78	87	enzyme	enzyme	NOUN
bam-7186	78	88	actn3	actn3	NOUN
bam-7186	78	89	-actin	-actin	NOUN
bam-7186	78	90	-	-	PUNCT
bam-7186	78	91	binding	bind	VERB
bam-7186	78	92	protein	protein	NOUN
bam-7186	78	93	alpha	alpha	NOUN
bam-7186	78	94	-	-	PUNCT
bam-7186	78	95	actinin-3	actinin-3	NUM
bam-7186	78	96	ck	ck	PROPN
bam-7186	78	97	-	-	PUNCT
bam-7186	78	98	mm	mm	PROPN
bam-7186	78	99	creatine	creatine	NOUN
bam-7186	78	100	kinase	kinase	PROPN
bam-7186	78	101	-	-	PUNCT
bam-7186	78	102	mm	mm	PROPN
bam-7186	78	103	nrf	nrf	ADJ
bam-7186	78	104	nuclear	nuclear	ADJ
bam-7186	78	105	respiratory	respiratory	ADJ
bam-7186	78	106	factor	factor	NOUN
bam-7186	78	107	pcr	pcr	NOUN
bam-7186	78	108	-	-	PUNCT
bam-7186	78	109	rflp	rflp	NOUN
bam-7186	78	110	polymerase	polymerase	NOUN
bam-7186	78	111	chain	chain	NOUN
bam-7186	78	112	reaction	reaction	NOUN
bam-7186	78	113	-	-	PUNCT
bam-7186	78	114	restriction	restriction	NOUN
bam-7186	78	115	fragment	fragment	NOUN
bam-7186	78	116	length	length	NOUN
bam-7186	78	117	polymorphism	polymorphism	NOUN
bam-7186	78	118	peps	pep	NOUN
bam-7186	78	119	performance	performance	NOUN
bam-7186	78	120	-	-	PUNCT
bam-7186	78	121	enhancing	enhance	VERB
bam-7186	78	122	polymorphisms	polymorphism	NOUN
bam-7186	78	123	ppar	ppar	NOUN
bam-7186	78	124	peroxisome	peroxisome	VERB
bam-7186	78	125	proliferator	proliferator	NOUN
bam-7186	78	126	-	-	PUNCT
bam-7186	78	127	activated	activate	VERB
bam-7186	78	128	receptor	receptor	NOUN
bam-7186	78	129	tfam	tfam	NOUN
bam-7186	78	130	mitochondrial	mitochondrial	ADJ
bam-7186	78	131	transciption	transciption	NOUN
bam-7186	78	132	factor	factor	NOUN
bam-7186	78	133	a	a	DET
bam-7186	78	134	vo2	vo2	NOUN
bam-7186	78	135	oxygen	oxygen	NOUN
bam-7186	78	136	uptake	uptake	ADJ
bam-7186	78	137	author	author	NOUN
bam-7186	78	138	’s	’s	PART
bam-7186	78	139	contributions	contribution	NOUN
bam-7186	78	140	each	each	DET
bam-7186	78	141	author	author	NOUN
bam-7186	78	142	contributed	contribute	VERB
bam-7186	78	143	in	in	ADP
bam-7186	78	144	equal	equal	ADJ
bam-7186	78	145	part	part	NOUN
bam-7186	78	146	to	to	ADP
bam-7186	78	147	the	the	DET
bam-7186	78	148	manuscript	manuscript	NOUN
bam-7186	78	149	.	.	PUNCT
bam-7186	79	1	acknowledgments	acknowledgment	NOUN
bam-7186	79	2	and	and	CCONJ
bam-7186	79	3	funding	fund	VERB
bam-7186	79	4	this	this	DET
bam-7186	79	5	research	research	NOUN
bam-7186	79	6	received	receive	VERB
bam-7186	79	7	no	no	DET
bam-7186	79	8	specific	specific	ADJ
bam-7186	79	9	grant	grant	NOUN
bam-7186	79	10	from	from	ADP
bam-7186	79	11	any	any	DET
bam-7186	79	12	funding	funding	NOUN
bam-7186	79	13	agency	agency	NOUN
bam-7186	79	14	in	in	ADP
bam-7186	79	15	the	the	DET
bam-7186	79	16	public	public	ADJ
bam-7186	79	17	,	,	PUNCT
bam-7186	79	18	commercial	commercial	ADJ
bam-7186	79	19	or	or	CCONJ
bam-7186	79	20	not	not	PART
bam-7186	79	21	-	-	PUNCT
bam-7186	79	22	for	for	ADP
bam-7186	79	23	-	-	PUNCT
bam-7186	79	24	profit	profit	NOUN
bam-7186	79	25	sectors	sector	NOUN
bam-7186	79	26	.	.	PUNCT
bam-7186	80	1	conflict	conflict	NOUN
bam-7186	80	2	of	of	ADP
bam-7186	80	3	interest	interest	NOUN
bam-7186	80	4	the	the	DET
bam-7186	80	5	authors	author	NOUN
bam-7186	80	6	declare	declare	VERB
bam-7186	80	7	no	no	DET
bam-7186	80	8	conflicts	conflict	NOUN
bam-7186	80	9	of	of	ADP
bam-7186	80	10	interests	interest	NOUN
bam-7186	80	11	derived	derive	VERB
bam-7186	80	12	from	from	ADP
bam-7186	80	13	the	the	DET
bam-7186	80	14	outcomes	outcome	NOUN
bam-7186	80	15	of	of	ADP
bam-7186	80	16	this	this	DET
bam-7186	80	17	stud	stud	NOUN
bam-7186	80	18	.	.	PUNCT
bam-7186	81	1	ethical	ethical	ADJ
bam-7186	81	2	publication	publication	NOUN
bam-7186	81	3	statement	statement	NOUN
bam-7186	81	4	institutional	institutional	PROPN
bam-7186	81	5	review	review	NOUN
bam-7186	81	6	board	board	NOUN
bam-7186	81	7	that	that	PRON
bam-7186	81	8	approved	approve	VERB
bam-7186	81	9	the	the	DET
bam-7186	81	10	protocol	protocol	NOUN
bam-7186	81	11	for	for	ADP
bam-7186	81	12	the	the	DET
bam-7186	81	13	study	study	NOUN
bam-7186	81	14	:	:	PUNCT
bam-7186	81	15	sport	sport	NOUN
bam-7186	81	16	and	and	CCONJ
bam-7186	81	17	exercise	exercise	NOUN
bam-7186	81	18	sciences	sciences	PROPN
bam-7186	81	19	research	research	NOUN
bam-7186	81	20	unit	unit	NOUN
bam-7186	81	21	,	,	PUNCT
bam-7186	81	22	university	university	PROPN
bam-7186	81	23	of	of	ADP
bam-7186	81	24	palermo	palermo	PROPN
bam-7186	81	25	,	,	PUNCT
bam-7186	81	26	italy	italy	PROPN
bam-7186	81	27	.	.	PUNCT
bam-7186	82	1	we	we	PRON
bam-7186	82	2	confirm	confirm	VERB
bam-7186	82	3	that	that	SCONJ
bam-7186	82	4	we	we	PRON
bam-7186	82	5	have	have	AUX
bam-7186	82	6	read	read	VERB
bam-7186	82	7	the	the	DET
bam-7186	82	8	journal	journal	NOUN
bam-7186	82	9	’s	’s	PART
bam-7186	82	10	position	position	NOUN
bam-7186	82	11	on	on	ADP
bam-7186	82	12	issues	issue	NOUN
bam-7186	82	13	involved	involve	VERB
bam-7186	82	14	in	in	ADP
bam-7186	82	15	ethical	ethical	ADJ
bam-7186	82	16	publication	publication	NOUN
bam-7186	82	17	and	and	CCONJ
bam-7186	82	18	affirm	affirm	NOUN
bam-7186	82	19	that	that	SCONJ
bam-7186	82	20	this	this	DET
bam-7186	82	21	report	report	NOUN
bam-7186	82	22	is	be	AUX
bam-7186	82	23	consistent	consistent	ADJ
bam-7186	82	24	with	with	ADP
bam-7186	82	25	those	those	DET
bam-7186	82	26	guidelines	guideline	NOUN
bam-7186	82	27	.	.	PUNCT
bam-7186	83	1	corresponding	correspond	VERB
bam-7186	83	2	author	author	NOUN
bam-7186	83	3	patrizia	patrizia	PROPN
bam-7186	83	4	proia	proia	PROPN
bam-7186	83	5	,	,	PUNCT
bam-7186	83	6	via	via	ADP
bam-7186	83	7	pascoli	pascoli	NOUN
bam-7186	83	8	,	,	PUNCT
bam-7186	83	9	6	6	NUM
bam-7186	83	10	,	,	PUNCT
bam-7186	83	11	90144	90144	NUM
bam-7186	83	12	palermo	palermo	NOUN
bam-7186	83	13	(	(	PUNCT
bam-7186	83	14	italy	italy	PROPN
bam-7186	83	15	)	)	PUNCT
bam-7186	83	16	.	.	PUNCT
bam-7186	84	1	tel	tel	ADP
bam-7186	84	2	:	:	PUNCT
bam-7186	84	3	+39	+39	PROPN
bam-7186	84	4	091	091	NUM
bam-7186	84	5	23899919	23899919	NUM
bam-7186	84	6	e	e	NOUN
bam-7186	84	7	-	-	NOUN
bam-7186	84	8	mail	mail	NOUN
bam-7186	84	9	:	:	PUNCT
bam-7186	84	10	patrizia.proia@unipa.it	patrizia.proia@unipa.it	NOUN
bam-7186	84	11	e	e	NOUN
bam-7186	84	12	-	-	NOUN
bam-7186	84	13	mails	mail	NOUN
bam-7186	84	14	of	of	ADP
bam-7186	84	15	co	co	NOUN
bam-7186	84	16	-	-	NOUN
bam-7186	84	17	author	author	NOUN
bam-7186	84	18	valentina	valentina	PROPN
bam-7186	84	19	contrò	contrò	PROPN
bam-7186	84	20	:	:	PUNCT
bam-7186	84	21	valecontro@gmail.com	valecontro@gmail.com	X
bam-7186	85	1	gabriella	gabriella	PROPN
bam-7186	85	2	schiera	schiera	NOUN
bam-7186	85	3	:	:	PUNCT
bam-7186	85	4	gabriella.schiera@unipa.it	gabriella.schiera@unipa.it	PROPN
bam-7186	85	5	antonino	antonino	PROPN
bam-7186	85	6	abbruzzo	abbruzzo	VERB
bam-7186	85	7	:	:	PUNCT
bam-7186	85	8	aabbruzzo@gmail.com	aabbruzzo@gmail.com	X
bam-7186	85	9	antonino	antonino	PROPN
bam-7186	85	10	bianco	bianco	PROPN
bam-7186	85	11	:	:	PUNCT
bam-7186	85	12	antonino.bianco@unipa.it	antonino.bianco@unipa.it	AUX
bam-7186	85	13	alessandra	alessandra	PROPN
bam-7186	85	14	amato	amato	PROPN
bam-7186	85	15	:	:	PUNCT
bam-7186	85	16	amale94@hotmail.it	amale94@hotmail.it	PROPN
bam-7186	85	17	alessia	alessia	PROPN
bam-7186	85	18	sacco	sacco	PROPN
bam-7186	85	19	:	:	PUNCT
bam-7186	85	20	alessiasacco1989@gmail.com	alessiasacco1989@gmail.com	PROPN
bam-7186	85	21	alessandra	alessandra	PROPN
bam-7186	85	22	macchiarella	macchiarella	PROPN
bam-7186	85	23	:	:	PUNCT
bam-7186	85	24	alemacchi89@gmail.com	alemacchi89@gmail.com	X
bam-7186	86	1	antonio	antonio	PROPN
bam-7186	86	2	palma	palma	PROPN
bam-7186	86	3	:	:	PUNCT
bam-7186	86	4	antonio.palma@unipa.it	antonio.palma@unipa.it	NOUN
bam-7186	86	5	references	reference	VERB
bam-7186	86	6	lippi	lippi	PROPN
bam-7186	86	7	g	g	PROPN
bam-7186	86	8	,	,	PUNCT
bam-7186	86	9	longo	longo	PROPN
bam-7186	86	10	ug	ug	ADP
bam-7186	86	11	,	,	PUNCT
bam-7186	86	12	maffulli	maffulli	ADV
bam-7186	86	13	n.	n.	PROPN
bam-7186	86	14	genetics	genetics	PROPN
bam-7186	86	15	and	and	CCONJ
bam-7186	86	16	sports	sport	NOUN
bam-7186	86	17	.	.	PUNCT
bam-7186	87	1	british	british	PROPN
bam-7186	87	2	medical	medical	ADJ
bam-7186	87	3	bulletin	bulletin	PROPN
bam-7186	87	4	2009;93:27–47	2009;93:27–47	NUM
bam-7186	87	5	.	.	PUNCT
bam-7186	88	1	jung	jung	PROPN
bam-7186	88	2	h	h	PROPN
bam-7186	88	3	,	,	PUNCT
bam-7186	88	4	lee	lee	PROPN
bam-7186	88	5	n	n	PRON
bam-7186	88	6	,	,	PUNCT
bam-7186	88	7	park	park	NOUN
bam-7186	88	8	s.	s.	PROPN
bam-7186	88	9	interaction	interaction	NOUN
bam-7186	88	10	of	of	ADP
bam-7186	88	11	actn3	actn3	NOUN
bam-7186	88	12	gene	gene	NOUN
bam-7186	88	13	polymorphism	polymorphism	NOUN
bam-7186	88	14	and	and	CCONJ
bam-7186	88	15	muscle	muscle	NOUN
bam-7186	88	16	imbalance	imbalance	NOUN
bam-7186	88	17	effects	effect	NOUN
bam-7186	88	18	on	on	ADP
bam-7186	88	19	kinematic	kinematic	ADJ
bam-7186	88	20	efficiency	efficiency	NOUN
bam-7186	88	21	in	in	ADP
bam-7186	88	22	combat	combat	NOUN
bam-7186	88	23	sports	sport	NOUN
bam-7186	88	24	athletes	athlete	NOUN
bam-7186	88	25	.	.	PUNCT
bam-7186	89	1	j	j	PROPN
bam-7186	89	2	exerc	exerc	PROPN
bam-7186	89	3	nutrition	nutrition	PROPN
bam-7186	89	4	biochem	biochem	PROPN
bam-7186	89	5	2016;20:1	2016;20:1	PROPN
bam-7186	89	6	-	-	SYM
bam-7186	89	7	7	7	NUM
bam-7186	89	8	.	.	PUNCT
bam-7186	90	1	collins	collins	PROPN
bam-7186	90	2	fs	fs	PROPN
bam-7186	90	3	,	,	PUNCT
bam-7186	90	4	morgan	morgan	PROPN
bam-7186	90	5	m	m	PROPN
bam-7186	90	6	,	,	PUNCT
bam-7186	90	7	patrinos	patrinos	VERB
bam-7186	90	8	a.	a.	NOUN
bam-7186	90	9	the	the	DET
bam-7186	90	10	human	human	ADJ
bam-7186	90	11	genome	genome	NOUN
bam-7186	90	12	project	project	NOUN
bam-7186	90	13	:	:	PUNCT
bam-7186	90	14	lessons	lesson	NOUN
bam-7186	90	15	from	from	ADP
bam-7186	90	16	large	large	ADJ
bam-7186	90	17	-	-	PUNCT
bam-7186	90	18	scale	scale	NOUN
bam-7186	90	19	biology	biology	NOUN
bam-7186	90	20	.	.	PUNCT
bam-7186	91	1	science	science	NOUN
bam-7186	91	2	2003;11:286	2003;11:286	PROPN
bam-7186	91	3	.	.	PUNCT
bam-7186	92	1	thorisson	thorisson	PROPN
bam-7186	92	2	ga	ga	PROPN
bam-7186	92	3	,	,	PUNCT
bam-7186	92	4	smith	smith	PROPN
bam-7186	92	5	av	av	PROPN
bam-7186	92	6	,	,	PUNCT
bam-7186	92	7	krishnan	krishnan	PROPN
bam-7186	92	8	l	l	PROPN
bam-7186	92	9	,	,	PUNCT
bam-7186	92	10	stein	stein	PROPN
bam-7186	92	11	ld	ld	PROPN
bam-7186	92	12	.	.	PUNCT
bam-7186	93	1	the	the	DET
bam-7186	93	2	international	international	ADJ
bam-7186	93	3	hapmap	hapmap	PROPN
bam-7186	93	4	project	project	NOUN
bam-7186	93	5	web	web	NOUN
bam-7186	93	6	site	site	NOUN
bam-7186	93	7	.	.	PUNCT
bam-7186	94	1	genome	genome	NOUN
bam-7186	94	2	research	research	NOUN
bam-7186	94	3	2005;15:1591	2005;15:1591	NUM
bam-7186	94	4	-	-	SYM
bam-7186	94	5	3	3	NUM
bam-7186	94	6	.	.	PUNCT
bam-7186	95	1	brey	brey	PROPN
bam-7186	95	2	cw	cw	PROPN
bam-7186	95	3	,	,	PUNCT
bam-7186	95	4	nelder	nelder	PROPN
bam-7186	95	5	mp	mp	PROPN
bam-7186	95	6	,	,	PUNCT
bam-7186	95	7	hailemariam	hailemariam	PROPN
bam-7186	95	8	t	t	PROPN
bam-7186	95	9	,	,	PUNCT
bam-7186	95	10	et	et	PROPN
bam-7186	95	11	al	al	PROPN
bam-7186	95	12	.	.	PUNCT
bam-7186	96	1	krüppel	krüppel	NOUN
bam-7186	96	2	-	-	PUNCT
bam-7186	96	3	like	like	ADJ
bam-7186	96	4	family	family	NOUN
bam-7186	96	5	of	of	ADP
bam-7186	96	6	transcription	transcription	NOUN
bam-7186	96	7	factors	factor	NOUN
bam-7186	96	8	:	:	PUNCT
bam-7186	96	9	an	an	DET
bam-7186	96	10	emerging	emerge	VERB
bam-7186	96	11	new	new	ADJ
bam-7186	96	12	frontier	frontier	NOUN
bam-7186	96	13	in	in	ADP
bam-7186	96	14	fat	fat	ADJ
bam-7186	96	15	biology	biology	NOUN
bam-7186	96	16	.	.	PUNCT
bam-7186	97	1	int	int	NOUN
bam-7186	97	2	j	j	PROPN
bam-7186	97	3	biol	biol	PROPN
bam-7186	97	4	sci	sci	PROPN
bam-7186	97	5	2009;5:622	2009;5:622	PROPN
bam-7186	97	6	-	-	SYM
bam-7186	97	7	36	36	NUM
bam-7186	97	8	.	.	PUNCT
bam-7186	98	1	grealy	grealy	PROPN
bam-7186	98	2	r	r	PROPN
bam-7186	98	3	,	,	PUNCT
bam-7186	98	4	herruer	herruer	PROPN
bam-7186	98	5	j	j	PROPN
bam-7186	98	6	,	,	PUNCT
bam-7186	98	7	smith	smith	PROPN
bam-7186	98	8	cl	cl	PROPN
bam-7186	98	9	,	,	PUNCT
bam-7186	98	10	et	et	PROPN
bam-7186	98	11	al	al	PROPN
bam-7186	98	12	.	.	PUNCT
bam-7186	98	13	evaluation	evaluation	NOUN
bam-7186	98	14	of	of	ADP
bam-7186	98	15	a	a	DET
bam-7186	98	16	7gene	7gene	NUM
bam-7186	98	17	genetic	genetic	ADJ
bam-7186	98	18	profile	profile	NOUN
bam-7186	98	19	for	for	ADP
bam-7186	98	20	athletic	athletic	ADJ
bam-7186	98	21	endurance	endurance	NOUN
bam-7186	98	22	phenotype	phenotype	NOUN
bam-7186	98	23	in	in	ADP
bam-7186	98	24	ironman	ironman	NOUN
bam-7186	98	25	championship	championship	NOUN
bam-7186	98	26	triathletes	triathlete	NOUN
bam-7186	98	27	.	.	PUNCT
bam-7186	99	1	plos	plos	PROPN
bam-7186	99	2	one	one	NUM
bam-7186	99	3	2015;30;10(12	2015;30;10(12	NUM
bam-7186	99	4	)	)	PUNCT
bam-7186	99	5	.	.	PUNCT
bam-7186	100	1	santiago	santiago	PROPN
bam-7186	100	2	c	c	X
bam-7186	100	3	,	,	PUNCT
bam-7186	100	4	ruiz	ruiz	PROPN
bam-7186	100	5	jr	jr	PROPN
bam-7186	100	6	,	,	PUNCT
bam-7186	100	7	muniesa	muniesa	PROPN
bam-7186	100	8	ca	ca	PROPN
bam-7186	100	9	,	,	PUNCT
bam-7186	100	10	et	et	PROPN
bam-7186	100	11	al	al	PROPN
bam-7186	100	12	.	.	PROPN
bam-7186	100	13	does	do	AUX
bam-7186	100	14	the	the	DET
bam-7186	100	15	polygenic	polygenic	ADJ
bam-7186	100	16	profile	profile	NOUN
bam-7186	100	17	determine	determine	VERB
bam-7186	100	18	the	the	DET
bam-7186	100	19	potential	potential	NOUN
bam-7186	100	20	for	for	ADP
bam-7186	100	21	becoming	become	VERB
bam-7186	100	22	a	a	DET
bam-7186	100	23	world	world	NOUN
bam-7186	100	24	-	-	PUNCT
bam-7186	100	25	class	class	NOUN
bam-7186	100	26	athlete	athlete	NOUN
bam-7186	100	27	?	?	PUNCT
bam-7186	101	1	insights	insight	NOUN
bam-7186	101	2	from	from	ADP
bam-7186	101	3	the	the	DET
bam-7186	101	4	sport	sport	NOUN
bam-7186	101	5	of	of	ADP
bam-7186	101	6	rowing	rowing	NOUN
bam-7186	101	7	.	.	PUNCT
bam-7186	102	1	scand	scand	PROPN
bam-7186	102	2	j	j	PROPN
bam-7186	102	3	med	med	PROPN
bam-7186	102	4	sci	sci	PROPN
bam-7186	102	5	sports	sports	PROPN
bam-7186	102	6	2010;20	2010;20	NUM
bam-7186	102	7	:	:	PUNCT
bam-7186	102	8	e188	e188	PROPN
bam-7186	102	9	-	-	SYM
bam-7186	102	10	94	94	NUM
bam-7186	102	11	.	.	PUNCT
bam-7186	103	1	ruiz	ruiz	PROPN
bam-7186	103	2	jr	jr	PROPN
bam-7186	103	3	,	,	PUNCT
bam-7186	103	4	gómez	gómez	NOUN
bam-7186	103	5	-	-	PUNCT
bam-7186	103	6	gallego	gallego	NOUN
bam-7186	103	7	f	f	NOUN
bam-7186	103	8	,	,	PUNCT
bam-7186	103	9	santiago	santiago	PROPN
bam-7186	103	10	c	c	X
bam-7186	103	11	,	,	PUNCT
bam-7186	103	12	et	et	PROPN
bam-7186	103	13	al	al	PROPN
bam-7186	103	14	.	.	PROPN
bam-7186	103	15	is	be	AUX
bam-7186	103	16	there	there	PRON
bam-7186	103	17	an	an	DET
bam-7186	103	18	optimum	optimum	ADJ
bam-7186	103	19	endurance	endurance	NOUN
bam-7186	103	20	polygenic	polygenic	ADJ
bam-7186	103	21	profile	profile	NOUN
bam-7186	103	22	?	?	PUNCT
bam-7186	104	1	j	j	PROPN
bam-7186	104	2	physiol	physiol	PROPN
bam-7186	104	3	2009;587(pt	2009;587(pt	PROPN
bam-7186	104	4	7):1527	7):1527	PROPN
bam-7186	104	5	-	-	SYM
bam-7186	104	6	34	34	NUM
bam-7186	104	7	.	.	PUNCT
bam-7186	104	8	ahmetov	ahmetov	PROPN
bam-7186	104	9	ii	ii	PROPN
bam-7186	104	10	,	,	PUNCT
bam-7186	104	11	astranenkova	astranenkova	PROPN
bam-7186	104	12	iv	iv	NUM
bam-7186	104	13	,	,	PUNCT
bam-7186	104	14	rogozkin	rogozkin	PROPN
bam-7186	104	15	va	va	PROPN
bam-7186	104	16	.	.	PUNCT
bam-7186	104	17	association	association	PROPN
bam-7186	104	18	of	of	ADP
bam-7186	104	19	ppard	ppard	ADJ
bam-7186	104	20	gene	gene	NOUN
bam-7186	104	21	polymorphism	polymorphism	NOUN
bam-7186	104	22	with	with	ADP
bam-7186	104	23	human	human	ADJ
bam-7186	104	24	physical	physical	ADJ
bam-7186	104	25	performance	performance	NOUN
bam-7186	104	26	.	.	PUNCT
bam-7186	105	1	mol	mol	ADP
bam-7186	105	2	biol	biol	PROPN
bam-7186	105	3	(	(	PUNCT
bam-7186	105	4	mosk	mosk	PROPN
bam-7186	105	5	)	)	PUNCT
bam-7186	105	6	2007;41,852–7	2007;41,852–7	NOUN
bam-7186	105	7	.	.	PUNCT
bam-7186	106	1	he	he	PRON
bam-7186	107	1	z	z	PROPN
bam-7186	107	2	,	,	PUNCT
bam-7186	107	3	hu	hu	PROPN
bam-7186	107	4	y	y	PROPN
bam-7186	107	5	,	,	PUNCT
bam-7186	108	1	feng	feng	PROPN
bam-7186	108	2	l	l	PROPN
bam-7186	108	3	lu	lu	PROPN
bam-7186	108	4	y	y	PROPN
bam-7186	108	5	,	,	PUNCT
bam-7186	108	6	et	et	PROPN
bam-7186	108	7	al	al	PROPN
bam-7186	108	8	.	.	PROPN
bam-7186	108	9	nrf2	nrf2	PROPN
bam-7186	108	10	genotype	genotype	NOUN
bam-7186	108	11	improves	improve	VERB
bam-7186	108	12	endurance	endurance	NOUN
bam-7186	108	13	capacity	capacity	NOUN
bam-7186	108	14	in	in	ADP
bam-7186	108	15	response	response	NOUN
bam-7186	108	16	to	to	ADP
bam-7186	108	17	training	training	NOUN
bam-7186	108	18	.	.	PUNCT
bam-7186	109	1	int	int	NOUN
bam-7186	109	2	j	j	PROPN
bam-7186	109	3	sports	sport	NOUN
bam-7186	109	4	med	med	PROPN
bam-7186	109	5	2007;28:717–21	2007;28:717–21	PROPN
bam-7186	109	6	.	.	PUNCT
bam-7186	110	1	calvo	calvo	PROPN
bam-7186	110	2	ja	ja	PROPN
bam-7186	110	3	,	,	PUNCT
bam-7186	110	4	daniels	daniels	PROPN
bam-7186	110	5	tg	tg	PROPN
bam-7186	110	6	,	,	PUNCT
bam-7186	110	7	wang	wang	PROPN
bam-7186	110	8	x	x	PROPN
bam-7186	110	9	,	,	PUNCT
bam-7186	110	10	et	et	PROPN
bam-7186	110	11	al	al	PROPN
bam-7186	110	12	.	.	PROPN
bam-7186	110	13	muscle	muscle	NOUN
bam-7186	110	14	-	-	PUNCT
bam-7186	110	15	specific	specific	ADJ
bam-7186	110	16	expression	expression	NOUN
bam-7186	110	17	of	of	ADP
bam-7186	110	18	ppar	ppar	NOUN
bam-7186	110	19	gamma	gamma	NOUN
bam-7186	110	20	coactivator-1alpha	coactivator-1alpha	PROPN
bam-7186	110	21	improves	improve	VERB
bam-7186	110	22	exercise	exercise	NOUN
bam-7186	110	23	performance	performance	NOUN
bam-7186	110	24	and	and	CCONJ
bam-7186	110	25	increases	increase	NOUN
bam-7186	110	26	peak	peak	VERB
bam-7186	110	27	oxygen	oxygen	NOUN
bam-7186	110	28	uptake	uptake	NOUN
bam-7186	110	29	.	.	PUNCT
bam-7186	111	1	j	j	PROPN
bam-7186	111	2	appl	appl	PROPN
bam-7186	111	3	physiol	physiol	PROPN
bam-7186	111	4	2008;104,1304–12	2008;104,1304–12	NUM
bam-7186	111	5	.	.	PUNCT
bam-7186	112	1	gineviciene	gineviciene	PROPN
bam-7186	112	2	v	v	PROPN
bam-7186	112	3	,	,	PUNCT
bam-7186	112	4	jakaitiene	jakaitiene	PROPN
bam-7186	112	5	a	a	PRON
bam-7186	112	6	,	,	PUNCT
bam-7186	112	7	aksenov	aksenov	ADJ
bam-7186	112	8	mo	mo	PROPN
bam-7186	112	9	,	,	PUNCT
bam-7186	112	10	et	et	PROPN
bam-7186	112	11	al	al	PROPN
bam-7186	112	12	.	.	PROPN
bam-7186	113	1	association	association	NOUN
bam-7186	113	2	analysis	analysis	NOUN
bam-7186	113	3	of	of	ADP
bam-7186	113	4	ace	ace	NOUN
bam-7186	113	5	,	,	PUNCT
bam-7186	113	6	actn3	actn3	NOUN
bam-7186	113	7	and	and	CCONJ
bam-7186	113	8	ppargc1a	ppargc1a	NOUN
bam-7186	113	9	gene	gene	NOUN
bam-7186	113	10	polymorphisms	polymorphism	NOUN
bam-7186	113	11	in	in	ADP
bam-7186	113	12	two	two	NUM
bam-7186	113	13	cohorts	cohort	NOUN
bam-7186	113	14	of	of	ADP
bam-7186	113	15	european	european	ADJ
bam-7186	113	16	strength	strength	NOUN
bam-7186	113	17	and	and	CCONJ
bam-7186	113	18	power	power	NOUN
bam-7186	113	19	athletes	athlete	NOUN
bam-7186	113	20	.	.	PUNCT
bam-7186	114	1	biol	biol	PROPN
bam-7186	114	2	sport	sport	PROPN
bam-7186	114	3	2016;33:199–206	2016;33:199–206	PROPN
bam-7186	114	4	.	.	PUNCT
bam-7186	115	1	kanki	kanki	PROPN
bam-7186	115	2	t	t	PROPN
bam-7186	115	3	,	,	PUNCT
bam-7186	115	4	ohgaki	ohgaki	PROPN
bam-7186	115	5	k	k	PROPN
bam-7186	115	6	,	,	PUNCT
bam-7186	115	7	gaspari	gaspari	PROPN
bam-7186	115	8	m	m	PROPN
bam-7186	115	9	,	,	PUNCT
bam-7186	115	10	et	et	PROPN
bam-7186	115	11	al	al	PROPN
bam-7186	115	12	.	.	PUNCT
bam-7186	115	13	architectural	architectural	ADJ
bam-7186	115	14	role	role	NOUN
bam-7186	115	15	of	of	ADP
bam-7186	115	16	mitochondrial	mitochondrial	ADJ
bam-7186	115	17	transcription	transcription	NOUN
bam-7186	115	18	factor	factor	NOUN
bam-7186	115	19	a	a	NOUN
bam-7186	115	20	in	in	ADP
bam-7186	115	21	maintenance	maintenance	NOUN
bam-7186	115	22	of	of	ADP
bam-7186	115	23	human	human	ADJ
bam-7186	115	24	mitochondrial	mitochondrial	ADJ
bam-7186	115	25	dna	dna	NOUN
bam-7186	115	26	.	.	PUNCT
bam-7186	116	1	mol	mol	ADP
bam-7186	116	2	cell	cell	NOUN
bam-7186	116	3	biol	biol	NOUN
bam-7186	116	4	2004;24:9823–34	2004;24:9823–34	NUM
bam-7186	116	5	.	.	PUNCT
bam-7186	117	1	skogsberg	skogsberg	PROPN
bam-7186	117	2	j	j	PROPN
bam-7186	117	3	,	,	PUNCT
bam-7186	117	4	kannisto	kannisto	PROPN
bam-7186	117	5	k	k	PROPN
bam-7186	117	6	,	,	PUNCT
bam-7186	117	7	cassel	cassel	PROPN
bam-7186	117	8	tn	tn	PROPN
bam-7186	117	9	,	,	PUNCT
bam-7186	117	10	et	et	PROPN
bam-7186	117	11	al	al	PROPN
bam-7186	117	12	.	.	PROPN
bam-7186	117	13	evidence	evidence	NOUN
bam-7186	117	14	that	that	PRON
bam-7186	117	15	peroxisome	peroxisome	VERB
bam-7186	117	16	proliferator	proliferator	NOUN
bam-7186	117	17	-	-	PUNCT
bam-7186	117	18	activated	activate	VERB
bam-7186	117	19	receptor	receptor	NOUN
bam-7186	117	20	delta	delta	NOUN
bam-7186	117	21	influences	influence	VERB
bam-7186	117	22	cholesterol	cholesterol	NOUN
bam-7186	117	23	metabolism	metabolism	NOUN
bam-7186	117	24	in	in	ADP
bam-7186	117	25	men	man	NOUN
bam-7186	117	26	.	.	PUNCT
bam-7186	118	1	arterioscler	arterioscler	PROPN
bam-7186	118	2	thromb	thromb	PROPN
bam-7186	118	3	vasc	vasc	PROPN
bam-7186	118	4	biol	biol	PROPN
bam-7186	118	5	2003;23:637–43	2003;23:637–43	PROPN
bam-7186	118	6	.	.	PUNCT
bam-7186	119	1	non	non	PROPN
bam-7186	119	2	co	co	PROPN
bam-7186	119	3	mmerc	mmerc	PROPN
bam-7186	119	4	ial	ial	PROPN
bam-7186	119	5	us	us	PROPN
bam-7186	120	1	e	e	NOUN
bam-7186	120	2	o	o	NOUN
bam-7186	120	3	nly	nly	ADV
bam-7186	120	4	mailto:patrizia.proia@unipa.it	mailto:patrizia.proia@unipa.it	ADJ
bam-7186	120	5	mailto:valecontro@gmail.com	mailto:valecontro@gmail.com	X
bam-7186	120	6	mailto:gabriella.schiera@unipa.it	mailto:gabriella.schiera@unipa.it	NOUN
bam-7186	120	7	mailto:aabbruzzo@gmail.com	mailto:aabbruzzo@gmail.com	X
bam-7186	120	8	mailto:antonino.bianco@unipa.it	mailto:antonino.bianco@unipa.it	PROPN
bam-7186	120	9	mailto:amale94@hotmail.it	mailto:amale94@hotmail.it	PUNCT
bam-7186	120	10	mailto:alessiasacco1989@gmail.com	mailto:alessiasacco1989@gmail.com	PROPN
bam-7186	120	11	mailto:alemacchi89@gmail.com	mailto:alemacchi89@gmail.com	PROPN
bam-7186	121	1	mailto:antonio.palma@unipa.it	mailto:antonio.palma@unipa.it	PROPN
bam-7186	121	2	polymorphisms	polymorphism	NOUN
bam-7186	121	3	of	of	ADP
bam-7186	121	4	elite	elite	ADJ
bam-7186	121	5	athletes	athlete	NOUN
bam-7186	121	6	phenotype	phenotype	VERB
bam-7186	121	7	eur	eur	PROPN
bam-7186	121	8	j	j	PROPN
bam-7186	121	9	transl	transl	PROPN
bam-7186	121	10	myol	myol	ADV
bam-7186	121	11	28	28	NUM
bam-7186	121	12	(	(	PUNCT
bam-7186	121	13	1	1	NUM
bam-7186	121	14	):	):	PUNCT
bam-7186	121	15	87	87	NUM
bam-7186	121	16	-	-	SYM
bam-7186	121	17	92	92	NUM
bam-7186	121	18	,	,	PUNCT
bam-7186	121	19	2018	2018	NUM
bam-7186	121	20	92	92	NUM
bam-7186	121	21	lucia	lucia	PROPN
bam-7186	121	22	a	a	PRON
bam-7186	121	23	,	,	PUNCT
bam-7186	121	24	gomez	gomez	NOUN
bam-7186	121	25	-	-	PUNCT
bam-7186	121	26	gallego	gallego	NOUN
bam-7186	121	27	f	f	PROPN
bam-7186	121	28	,	,	PUNCT
bam-7186	121	29	barroso	barroso	PROPN
bam-7186	121	30	i	i	PROPN
bam-7186	121	31	,	,	PUNCT
bam-7186	121	32	et	et	PROPN
bam-7186	121	33	al	al	PROPN
bam-7186	121	34	.	.	PUNCT
bam-7186	121	35	ppargc1a	ppargc1a	PROPN
bam-7186	121	36	genotype	genotype	NOUN
bam-7186	121	37	(	(	PUNCT
bam-7186	121	38	gly482ser	gly482ser	NOUN
bam-7186	121	39	)	)	PUNCT
bam-7186	121	40	predicts	predict	VERB
bam-7186	121	41	exceptional	exceptional	ADJ
bam-7186	121	42	endurance	endurance	NOUN
bam-7186	121	43	capacity	capacity	NOUN
bam-7186	121	44	in	in	ADP
bam-7186	121	45	european	european	ADJ
bam-7186	121	46	men	man	NOUN
bam-7186	121	47	.	.	PUNCT
bam-7186	122	1	j	j	PROPN
bam-7186	122	2	appl	appl	PROPN
bam-7186	122	3	physiol	physiol	PROPN
bam-7186	122	4	2005;99:344	2005;99:344	PROPN
bam-7186	122	5	–	–	PUNCT
bam-7186	122	6	8	8	NUM
bam-7186	122	7	.	.	PUNCT
bam-7186	123	1	he	he	PRON
bam-7186	124	1	z	z	PROPN
bam-7186	124	2	,	,	PUNCT
bam-7186	124	3	hu	hu	PROPN
bam-7186	124	4	y	y	PROPN
bam-7186	124	5	,	,	PUNCT
bam-7186	124	6	feng	feng	PROPN
bam-7186	124	7	l	l	PROPN
bam-7186	124	8	,	,	PUNCT
bam-7186	124	9	et	et	PROPN
bam-7186	124	10	al	al	PROPN
bam-7186	124	11	.	.	PROPN
bam-7186	124	12	nrf-1	nrf-1	NUM
bam-7186	124	13	genotypes	genotype	NOUN
bam-7186	124	14	and	and	CCONJ
bam-7186	124	15	endurance	endurance	NOUN
bam-7186	124	16	exercise	exercise	NOUN
bam-7186	124	17	capacity	capacity	NOUN
bam-7186	124	18	in	in	ADP
bam-7186	124	19	young	young	ADJ
bam-7186	124	20	chinese	chinese	ADJ
bam-7186	124	21	men	man	NOUN
bam-7186	124	22	.	.	PUNCT
bam-7186	125	1	br	br	PROPN
bam-7186	125	2	j	j	PROPN
bam-7186	125	3	sports	sport	NOUN
bam-7186	125	4	med	med	PROPN
bam-7186	125	5	.	.	PUNCT
bam-7186	126	1	2008;4:361–6	2008;4:361–6	NUM
bam-7186	126	2	.	.	PUNCT
bam-7186	127	1	yang	yang	PROPN
bam-7186	127	2	r	r	PROPN
bam-7186	127	3	,	,	PUNCT
bam-7186	127	4	shen	shen	NOUN
bam-7186	127	5	x	x	PROPN
bam-7186	127	6	,	,	PUNCT
bam-7186	127	7	wang	wang	PROPN
bam-7186	127	8	y	y	PROPN
bam-7186	127	9	,	,	PUNCT
bam-7186	127	10	et	et	PROPN
bam-7186	127	11	al	al	PROPN
bam-7186	127	12	.	.	PUNCT
bam-7186	127	13	actn3	actn3	PROPN
bam-7186	128	1	r577x	r577x	PROPN
bam-7186	128	2	gene	gene	NOUN
bam-7186	128	3	variant	variant	NOUN
bam-7186	128	4	is	be	AUX
bam-7186	128	5	associated	associate	VERB
bam-7186	128	6	with	with	ADP
bam-7186	128	7	muscle	muscle	NOUN
bam-7186	128	8	-	-	PUNCT
bam-7186	128	9	related	relate	VERB
bam-7186	128	10	phenotypes	phenotype	NOUN
bam-7186	128	11	in	in	ADP
bam-7186	128	12	elite	elite	ADJ
bam-7186	128	13	chinese	chinese	ADJ
bam-7186	128	14	sprint	sprint	NOUN
bam-7186	128	15	/	/	SYM
bam-7186	128	16	power	power	NOUN
bam-7186	128	17	athletes	athlete	NOUN
bam-7186	128	18	.	.	PUNCT
bam-7186	129	1	j	j	PROPN
bam-7186	129	2	strength	strength	PROPN
bam-7186	129	3	cond	cond	NOUN
bam-7186	129	4	res	re	NOUN
bam-7186	129	5	2017;31:1107	2017;31:1107	PROPN
bam-7186	129	6	-	-	SYM
bam-7186	129	7	15	15	NUM
bam-7186	129	8	yang	yang	PROPN
bam-7186	129	9	n	n	PROPN
bam-7186	129	10	,	,	PUNCT
bam-7186	129	11	macarthur	macarthur	PROPN
bam-7186	129	12	dg	dg	PROPN
bam-7186	129	13	,	,	PUNCT
bam-7186	129	14	gulbin	gulbin	PROPN
bam-7186	129	15	jp	jp	PROPN
bam-7186	129	16	,	,	PUNCT
bam-7186	129	17	et	et	PROPN
bam-7186	129	18	al	al	PROPN
bam-7186	129	19	.	.	PUNCT
bam-7186	130	1	actn3	actn3	PROPN
bam-7186	130	2	genotype	genotype	NOUN
bam-7186	130	3	is	be	AUX
bam-7186	130	4	associated	associate	VERB
bam-7186	130	5	with	with	ADP
bam-7186	130	6	human	human	ADJ
bam-7186	130	7	elite	elite	ADJ
bam-7186	130	8	athletic	athletic	ADJ
bam-7186	130	9	performance	performance	NOUN
bam-7186	130	10	.	.	PUNCT
bam-7186	131	1	am	be	AUX
bam-7186	131	2	j	j	PROPN
bam-7186	131	3	hum	hum	PROPN
bam-7186	131	4	genet	genet	PROPN
bam-7186	131	5	2003;73:627–31	2003;73:627–31	PROPN
bam-7186	131	6	.	.	PROPN
bam-7186	131	7	galeandro	galeandro	PROPN
bam-7186	131	8	v	v	ADP
bam-7186	131	9	,	,	PUNCT
bam-7186	131	10	notarnicola	notarnicola	NOUN
bam-7186	131	11	a	a	X
bam-7186	131	12	,	,	PUNCT
bam-7186	131	13	bianco	bianco	PROPN
bam-7186	131	14	a	a	X
bam-7186	131	15	et	et	PROPN
bam-7186	131	16	al	al	PROPN
bam-7186	131	17	.	.	PUNCT
bam-7186	131	18	actn3	actn3	PROPN
bam-7186	131	19	/	/	SYM
bam-7186	131	20	ace	ace	NOUN
bam-7186	131	21	genotypes	genotype	NOUN
bam-7186	131	22	and	and	CCONJ
bam-7186	131	23	mitochondrial	mitochondrial	ADJ
bam-7186	131	24	genome	genome	NOUN
bam-7186	131	25	in	in	ADP
bam-7186	131	26	professional	professional	ADJ
bam-7186	131	27	soccer	soccer	NOUN
bam-7186	131	28	players’performance	players’performance	NOUN
bam-7186	131	29	.	.	PUNCT
bam-7186	132	1	j	j	PROPN
bam-7186	132	2	biol	biol	PROPN
bam-7186	132	3	regul	regul	PROPN
bam-7186	132	4	homeost	homeost	ADJ
bam-7186	132	5	agents	agent	NOUN
bam-7186	132	6	2017;31:207	2017;31:207	NOUN
bam-7186	132	7	-	-	SYM
bam-7186	132	8	13	13	NUM
bam-7186	132	9	.	.	PUNCT
bam-7186	133	1	macarthur	macarthur	PROPN
bam-7186	133	2	dg	dg	PROPN
bam-7186	133	3	,	,	PUNCT
bam-7186	133	4	north	north	PROPN
bam-7186	133	5	kn	kn	PROPN
bam-7186	133	6	.	.	PUNCT
bam-7186	134	1	a	a	DET
bam-7186	134	2	gene	gene	NOUN
bam-7186	134	3	for	for	ADP
bam-7186	134	4	speed	speed	NOUN
bam-7186	134	5	?	?	PUNCT
bam-7186	135	1	the	the	DET
bam-7186	135	2	evolution	evolution	NOUN
bam-7186	135	3	and	and	CCONJ
bam-7186	135	4	function	function	NOUN
bam-7186	135	5	of	of	ADP
bam-7186	135	6	alpha	alpha	NOUN
bam-7186	135	7	-	-	PUNCT
bam-7186	135	8	actinin-3	actinin-3	PROPN
bam-7186	135	9	.	.	PUNCT
bam-7186	135	10	bioessays	bioessay	NOUN
bam-7186	135	11	2004	2004	NUM
bam-7186	135	12	;	;	PUNCT
bam-7186	135	13	26:786	26:786	NUM
bam-7186	135	14	-	-	SYM
bam-7186	135	15	95	95	NUM
bam-7186	135	16	.	.	PUNCT
bam-7186	136	1	zhou	zhou	PROPN
bam-7186	136	2	dq	dq	PROPN
bam-7186	136	3	,	,	PUNCT
bam-7186	136	4	hu	hu	PROPN
bam-7186	136	5	y	y	PROPN
bam-7186	136	6	,	,	PUNCT
bam-7186	136	7	liu	liu	PROPN
bam-7186	136	8	g	g	PROPN
bam-7186	136	9	,	,	PUNCT
bam-7186	136	10	et	et	PROPN
bam-7186	136	11	al	al	PROPN
bam-7186	136	12	.	.	PROPN
bam-7186	136	13	muscle	muscle	NOUN
bam-7186	136	14	-	-	PUNCT
bam-7186	136	15	specific	specific	ADJ
bam-7186	136	16	creatine	creatine	NOUN
bam-7186	136	17	kinase	kinase	PROPN
bam-7186	136	18	gene	gene	NOUN
bam-7186	136	19	polymorphism	polymorphism	NOUN
bam-7186	136	20	and	and	CCONJ
bam-7186	136	21	running	run	VERB
bam-7186	136	22	economy	economy	NOUN
bam-7186	136	23	responses	response	NOUN
bam-7186	136	24	to	to	ADP
bam-7186	136	25	an	an	DET
bam-7186	136	26	18	18	NUM
bam-7186	136	27	-	-	PUNCT
bam-7186	136	28	week	week	NOUN
bam-7186	136	29	5000	5000	NUM
bam-7186	136	30	-	-	PUNCT
bam-7186	136	31	m	m	NOUN
bam-7186	136	32	training	training	NOUN
bam-7186	136	33	programme	programme	NOUN
bam-7186	136	34	.	.	PUNCT
bam-7186	137	1	br	br	PROPN
bam-7186	137	2	j	j	PROPN
bam-7186	137	3	sports	sport	NOUN
bam-7186	137	4	med	med	ADJ
bam-7186	137	5	2006;40:988	2006;40:988	PROPN
bam-7186	137	6	-	-	SYM
bam-7186	137	7	91	91	NUM
bam-7186	137	8	.	.	PUNCT
bam-7186	138	1	he	he	PRON
bam-7186	138	2	ep	ep	PROPN
bam-7186	138	3	,	,	PUNCT
bam-7186	138	4	li	li	PROPN
bam-7186	138	5	yh	yh	PROPN
bam-7186	138	6	,	,	PUNCT
bam-7186	138	7	qian	qian	PROPN
bam-7186	138	8	jd	jd	PROPN
bam-7186	138	9	,	,	PUNCT
bam-7186	138	10	yan	yan	PROPN
bam-7186	138	11	hw	hw	PROPN
bam-7186	138	12	.	.	PUNCT
bam-7186	139	1	association	association	PROPN
bam-7186	139	2	of	of	ADP
bam-7186	139	3	ckmm	ckmm	PROPN
bam-7186	139	4	gene	gene	VERB
bam-7186	139	5	a	a	DET
bam-7186	139	6	/	/	SYM
bam-7186	139	7	g	g	NOUN
bam-7186	139	8	polymorphism	polymorphism	NOUN
bam-7186	139	9	and	and	CCONJ
bam-7186	139	10	athletic	athletic	ADJ
bam-7186	139	11	performance	performance	NOUN
bam-7186	139	12	of	of	ADP
bam-7186	139	13	uyghur	uyghur	ADJ
bam-7186	139	14	nationality	nationality	NOUN
bam-7186	139	15	.	.	PUNCT
bam-7186	140	1	chinese	chinese	ADJ
bam-7186	140	2	journal	journal	PROPN
bam-7186	140	3	of	of	ADP
bam-7186	140	4	applied	apply	VERB
bam-7186	140	5	physiology	physiology	NOUN
bam-7186	140	6	2016;32:82	2016;32:82	NUM
bam-7186	140	7	-	-	SYM
bam-7186	140	8	6	6	NUM
bam-7186	140	9	.	.	PUNCT
bam-7186	141	1	moran	moran	PROPN
bam-7186	141	2	cn	cn	PROPN
bam-7186	141	3	,	,	PUNCT
bam-7186	141	4	vassilopoulos	vassilopoulos	PROPN
bam-7186	141	5	c	c	PROPN
bam-7186	141	6	,	,	PUNCT
bam-7186	141	7	tsiokanos	tsiokanos	PROPN
bam-7186	141	8	,	,	PUNCT
bam-7186	141	9	et	et	PROPN
bam-7186	141	10	al	al	PROPN
bam-7186	141	11	.	.	PUNCT
bam-7186	142	1	the	the	DET
bam-7186	142	2	associations	association	NOUN
bam-7186	142	3	of	of	ADP
bam-7186	142	4	ace	ace	ADJ
bam-7186	142	5	polymorphisms	polymorphism	NOUN
bam-7186	142	6	with	with	ADP
bam-7186	142	7	physical	physical	ADJ
bam-7186	142	8	,	,	PUNCT
bam-7186	142	9	physiological	physiological	ADJ
bam-7186	142	10	and	and	CCONJ
bam-7186	142	11	skill	skill	NOUN
bam-7186	142	12	parameters	parameter	NOUN
bam-7186	142	13	in	in	ADP
bam-7186	142	14	adolescents	adolescent	NOUN
bam-7186	142	15	.	.	PUNCT
bam-7186	143	1	eur	eur	PROPN
bam-7186	143	2	j	j	PROPN
bam-7186	143	3	hum	hum	PROPN
bam-7186	143	4	genet	genet	PROPN
bam-7186	143	5	2006;14:332–9	2006;14:332–9	PROPN
bam-7186	143	6	.	.	PUNCT
bam-7186	144	1	dionísio	dionísio	PROPN
bam-7186	144	2	tj	tj	PROPN
bam-7186	144	3	,	,	PUNCT
bam-7186	144	4	thiengo	thiengo	NOUN
bam-7186	144	5	cr	cr	PROPN
bam-7186	144	6	,	,	PUNCT
bam-7186	144	7	brozoski	brozoski	NOUN
bam-7186	144	8	dt	dt	PROPN
bam-7186	144	9	,	,	PUNCT
bam-7186	144	10	et	et	PROPN
bam-7186	144	11	al	al	PROPN
bam-7186	144	12	.	.	PUNCT
bam-7186	145	1	the	the	DET
bam-7186	145	2	influence	influence	NOUN
bam-7186	145	3	of	of	ADP
bam-7186	145	4	genetic	genetic	ADJ
bam-7186	145	5	polymorphisms	polymorphism	NOUN
bam-7186	145	6	on	on	ADP
bam-7186	145	7	performance	performance	NOUN
bam-7186	145	8	and	and	CCONJ
bam-7186	145	9	cardiac	cardiac	ADJ
bam-7186	145	10	and	and	CCONJ
bam-7186	145	11	hemodynamic	hemodynamic	ADJ
bam-7186	145	12	parameters	parameter	NOUN
bam-7186	145	13	among	among	ADP
bam-7186	145	14	brazilian	brazilian	ADJ
bam-7186	145	15	soccer	soccer	NOUN
bam-7186	145	16	players	player	NOUN
bam-7186	145	17	.	.	PUNCT
bam-7186	146	1	appl	appl	PROPN
bam-7186	146	2	physiol	physiol	PROPN
bam-7186	146	3	nutr	nutr	PROPN
bam-7186	146	4	metab	metab	PROPN
bam-7186	146	5	2017;42:596604	2017;42:596604	NUM
bam-7186	146	6	.	.	PUNCT
bam-7186	147	1	proia	proia	PROPN
bam-7186	147	2	p	p	NOUN
bam-7186	147	3	,	,	PUNCT
bam-7186	147	4	bianco	bianco	PROPN
bam-7186	147	5	a	a	PRON
bam-7186	147	6	,	,	PUNCT
bam-7186	147	7	schiera	schiera	NOUN
bam-7186	147	8	g	g	NOUN
bam-7186	147	9	,	,	PUNCT
bam-7186	147	10	et	et	PROPN
bam-7186	147	11	al	al	PROPN
bam-7186	147	12	.	.	PUNCT
bam-7186	148	1	pparα	pparα	PROPN
bam-7186	148	2	gene	gene	NOUN
bam-7186	148	3	variants	variant	NOUN
bam-7186	148	4	as	as	ADP
bam-7186	148	5	predicted	predict	VERB
bam-7186	148	6	performance	performance	NOUN
bam-7186	148	7	-	-	PUNCT
bam-7186	148	8	enhancing	enhance	VERB
bam-7186	148	9	polymorphisms	polymorphism	NOUN
bam-7186	148	10	in	in	ADP
bam-7186	148	11	professional	professional	ADJ
bam-7186	148	12	italian	italian	ADJ
bam-7186	148	13	soccer	soccer	NOUN
bam-7186	148	14	players	player	NOUN
bam-7186	148	15	.	.	PUNCT
bam-7186	149	1	open	open	ADJ
bam-7186	149	2	access	access	NOUN
bam-7186	149	3	j	j	PROPN
bam-7186	149	4	sports	sport	NOUN
bam-7186	149	5	med	med	ADJ
bam-7186	149	6	2014;5:273	2014;5:273	NUM
bam-7186	149	7	-	-	SYM
bam-7186	149	8	8	8	NUM
bam-7186	149	9	.	.	PUNCT
bam-7186	150	1	tobina	tobina	PROPN
bam-7186	150	2	t	t	PROPN
bam-7186	150	3	,	,	PUNCT
bam-7186	150	4	michishita	michishita	PROPN
bam-7186	150	5	r	r	NOUN
bam-7186	150	6	,	,	PUNCT
bam-7186	150	7	yamasawa	yamasawa	PROPN
bam-7186	150	8	f	f	PROPN
bam-7186	150	9	,	,	PUNCT
bam-7186	151	1	et	et	PROPN
bam-7186	151	2	al	al	PROPN
bam-7186	151	3	.	.	PROPN
bam-7186	151	4	association	association	PROPN
bam-7186	151	5	between	between	ADP
bam-7186	151	6	the	the	DET
bam-7186	151	7	angiotensin	angiotensin	NOUN
bam-7186	151	8	i	i	PRON
bam-7186	151	9	-	-	PUNCT
bam-7186	151	10	converting	convert	VERB
bam-7186	151	11	enzyme	enzyme	NOUN
bam-7186	151	12	gene	gene	NOUN
bam-7186	151	13	insertion	insertion	NOUN
bam-7186	151	14	/	/	SYM
bam-7186	151	15	deletion	deletion	NOUN
bam-7186	151	16	polymorphism	polymorphism	NOUN
bam-7186	151	17	and	and	CCONJ
bam-7186	151	18	endurance	endurance	NOUN
bam-7186	151	19	running	run	VERB
bam-7186	151	20	speed	speed	NOUN
bam-7186	151	21	in	in	ADP
bam-7186	151	22	japanese	japanese	ADJ
bam-7186	151	23	runners	runner	NOUN
bam-7186	151	24	.	.	PUNCT
bam-7186	152	1	journal	journal	NOUN
bam-7186	152	2	of	of	ADP
bam-7186	152	3	physiological	physiological	ADJ
bam-7186	152	4	sciences	science	NOUN
bam-7186	152	5	2010;60;5:325	2010;60;5:325	PROPN
bam-7186	152	6	-	-	SYM
bam-7186	152	7	30	30	NUM
bam-7186	152	8	.	.	PUNCT
bam-7186	152	9	offer	offer	VERB
bam-7186	152	10	a	a	PRON
bam-7186	152	11	,	,	PUNCT
bam-7186	152	12	ruthie	ruthie	PROPN
bam-7186	152	13	a	a	PROPN
bam-7186	152	14	,	,	PUNCT
bam-7186	152	15	chen	chen	PROPN
bam-7186	152	16	y	y	PROPN
bam-7186	152	17	,	,	PUNCT
bam-7186	152	18	et	et	PROPN
bam-7186	152	19	al	al	PROPN
bam-7186	152	20	.	.	PUNCT
bam-7186	153	1	the	the	DET
bam-7186	153	2	ace	ace	PROPN
bam-7186	153	3	deletion	deletion	NOUN
bam-7186	153	4	allele	allele	NOUN
bam-7186	153	5	is	be	AUX
bam-7186	153	6	associated	associate	VERB
bam-7186	153	7	with	with	ADP
bam-7186	153	8	israeli	israeli	ADJ
bam-7186	153	9	elite	elite	ADJ
bam-7186	153	10	endurance	endurance	NOUN
bam-7186	153	11	athletes	athlete	NOUN
bam-7186	153	12	.	.	PUNCT
bam-7186	154	1	exp	exp	NOUN
bam-7186	154	2	physiol	physiol	PROPN
bam-7186	154	3	2007	2007	NUM
bam-7186	154	4	;	;	PUNCT
bam-7186	154	5	92;5	92;5	NUM
bam-7186	154	6	;	;	PUNCT
bam-7186	154	7	881–886	881–886	NUM
bam-7186	154	8	.	.	PUNCT
bam-7186	155	1	buxens	buxen	NOUN
bam-7186	155	2	a	a	PRON
bam-7186	155	3	,	,	PUNCT
bam-7186	155	4	ruiz	ruiz	PROPN
bam-7186	155	5	jr	jr	PROPN
bam-7186	155	6	,	,	PUNCT
bam-7186	155	7	arteta	arteta	PROPN
bam-7186	156	1	d	d	PROPN
bam-7186	156	2	,	,	PUNCT
bam-7186	156	3	et	et	PROPN
bam-7186	156	4	al	al	PROPN
bam-7186	156	5	.	.	PUNCT
bam-7186	157	1	can	can	AUX
bam-7186	157	2	we	we	PRON
bam-7186	157	3	predict	predict	VERB
bam-7186	157	4	toplevel	toplevel	NOUN
bam-7186	157	5	sports	sport	NOUN
bam-7186	157	6	performance	performance	NOUN
bam-7186	157	7	in	in	ADP
bam-7186	157	8	power	power	NOUN
bam-7186	157	9	vs	vs	ADP
bam-7186	157	10	endurance	endurance	NOUN
bam-7186	157	11	events	event	NOUN
bam-7186	157	12	?	?	PUNCT
bam-7186	158	1	a	a	DET
bam-7186	158	2	genetic	genetic	ADJ
bam-7186	158	3	approach	approach	NOUN
bam-7186	158	4	.	.	PUNCT
bam-7186	159	1	scandinavian	scandinavian	ADJ
bam-7186	159	2	journal	journal	PROPN
bam-7186	159	3	of	of	ADP
bam-7186	159	4	medicine	medicine	PROPN
bam-7186	159	5	&	&	CCONJ
bam-7186	159	6	science	science	PROPN
bam-7186	159	7	in	in	ADP
bam-7186	159	8	sports	sport	NOUN
bam-7186	159	9	2011;21;4:570	2011;21;4:570	NOUN
bam-7186	159	10	-	-	SYM
bam-7186	159	11	9	9	NUM
bam-7186	159	12	.	.	PUNCT
bam-7186	159	13	bevilacqua	bevilacqua	PROPN
bam-7186	159	14	ja	ja	PROPN
bam-7186	159	15	,	,	PUNCT
bam-7186	159	16	lara	lara	PROPN
bam-7186	159	17	m	m	PROPN
bam-7186	159	18	,	,	PUNCT
bam-7186	159	19	díaz	díaz	PROPN
bam-7186	159	20	j	j	PROPN
bam-7186	159	21	,	,	PUNCT
bam-7186	159	22	campero	campero	PROPN
bam-7186	159	23	m	m	PROPN
bam-7186	159	24	,	,	PUNCT
bam-7186	159	25	vázquez	vázquez	PROPN
bam-7186	159	26	j	j	PROPN
bam-7186	159	27	,	,	PUNCT
bam-7186	159	28	maselli	maselli	PROPN
bam-7186	159	29	ra	ra	PROPN
bam-7186	159	30	.	.	PUNCT
bam-7186	160	1	congenital	congenital	ADJ
bam-7186	160	2	myasthenic	myasthenic	ADJ
bam-7186	160	3	syndrome	syndrome	NOUN
bam-7186	160	4	due	due	ADP
bam-7186	160	5	to	to	ADP
bam-7186	160	6	dok7	dok7	NOUN
bam-7186	160	7	mutations	mutation	NOUN
bam-7186	160	8	in	in	ADP
bam-7186	160	9	a	a	DET
bam-7186	160	10	family	family	NOUN
bam-7186	160	11	from	from	ADP
bam-7186	160	12	chile	chile	PROPN
bam-7186	160	13	.	.	PUNCT
bam-7186	161	1	eur	eur	PROPN
bam-7186	161	2	j	j	PROPN
bam-7186	161	3	transl	transl	PROPN
bam-7186	161	4	myol	myol	NOUN
bam-7186	161	5	.	.	PUNCT
bam-7186	162	1	2017	2017	NUM
bam-7186	162	2	sep	sep	NOUN
bam-7186	162	3	20;27(3):6832	20;27(3):6832	NUM
bam-7186	162	4	.	.	PUNCT
bam-7186	163	1	doi	doi	NOUN
bam-7186	163	2	:	:	PUNCT
bam-7186	163	3	10.4081	10.4081	NUM
bam-7186	163	4	/	/	SYM
bam-7186	163	5	ejtm.2017.6832	ejtm.2017.6832	NOUN
bam-7186	163	6	.	.	PUNCT
bam-7186	164	1	ecollection	ecollection	NOUN
bam-7186	164	2	2017	2017	NUM
bam-7186	164	3	jun	jun	PROPN
bam-7186	164	4	27	27	NUM
bam-7186	164	5	.	.	PUNCT
bam-7186	165	1	seene	seene	PROPN
bam-7186	165	2	t	t	PROPN
bam-7186	165	3	,	,	PUNCT
bam-7186	165	4	umnova	umnova	PROPN
bam-7186	165	5	m	m	PROPN
bam-7186	165	6	,	,	PUNCT
bam-7186	165	7	kaasik	kaasik	ADJ
bam-7186	165	8	p.	p.	NOUN
bam-7186	165	9	morphological	morphological	ADJ
bam-7186	165	10	peculiarities	peculiarity	NOUN
bam-7186	165	11	of	of	ADP
bam-7186	165	12	neuromuscular	neuromuscular	ADJ
bam-7186	165	13	junctions	junction	NOUN
bam-7186	165	14	among	among	ADP
bam-7186	165	15	different	different	ADJ
bam-7186	165	16	fiber	fiber	NOUN
bam-7186	165	17	types	type	NOUN
bam-7186	165	18	:	:	PUNCT
bam-7186	165	19	effect	effect	NOUN
bam-7186	165	20	of	of	ADP
bam-7186	165	21	exercise	exercise	NOUN
bam-7186	165	22	.	.	PUNCT
bam-7186	166	1	eur	eur	PROPN
bam-7186	166	2	j	j	PROPN
bam-7186	166	3	transl	transl	PROPN
bam-7186	166	4	myol	myol	NOUN
bam-7186	166	5	.	.	PUNCT
bam-7186	167	1	2017	2017	NUM
bam-7186	167	2	jun	jun	PROPN
bam-7186	167	3	27;27(3):6708	27;27(3):6708	NUM
bam-7186	167	4	.	.	PUNCT
bam-7186	168	1	doi	doi	NOUN
bam-7186	168	2	:	:	PUNCT
bam-7186	168	3	10.4081	10.4081	NUM
bam-7186	168	4	/	/	SYM
bam-7186	168	5	ejtm.2017.6708	ejtm.2017.6708	NUM
bam-7186	168	6	.	.	PUNCT
bam-7186	169	1	ecollection	ecollection	NOUN
bam-7186	169	2	2017	2017	NUM
bam-7186	169	3	jun	jun	PROPN
bam-7186	169	4	27	27	NUM
bam-7186	169	5	.	.	PUNCT
bam-7186	170	1	hockerman	hockerman	PROPN
bam-7186	170	2	gh	gh	PROPN
bam-7186	170	3	,	,	PUNCT
bam-7186	170	4	dethrow	dethrow	PROPN
bam-7186	170	5	nm	nm	PROPN
bam-7186	170	6	,	,	PUNCT
bam-7186	170	7	hameed	hameed	PROPN
bam-7186	170	8	s	s	PROPN
bam-7186	170	9	,	,	PUNCT
bam-7186	170	10	et	et	PROPN
bam-7186	170	11	al	al	PROPN
bam-7186	170	12	.	.	PUNCT
bam-7186	171	1	the	the	DET
bam-7186	171	2	ubr2	ubr2	NOUN
bam-7186	171	3	gene	gene	NOUN
bam-7186	171	4	is	be	AUX
bam-7186	171	5	expressed	express	VERB
bam-7186	171	6	in	in	ADP
bam-7186	171	7	skeletal	skeletal	ADJ
bam-7186	171	8	muscle	muscle	NOUN
bam-7186	171	9	atrophying	atrophy	VERB
bam-7186	171	10	as	as	ADP
bam-7186	171	11	a	a	DET
bam-7186	171	12	result	result	NOUN
bam-7186	171	13	of	of	ADP
bam-7186	171	14	hind	hind	ADJ
bam-7186	171	15	limb	limb	NOUN
bam-7186	171	16	suspension	suspension	NOUN
bam-7186	171	17	,	,	PUNCT
bam-7186	171	18	but	but	CCONJ
bam-7186	171	19	not	not	PART
bam-7186	171	20	merg1a	merg1a	ADJ
bam-7186	171	21	expression	expression	NOUN
bam-7186	171	22	alone	alone	ADV
bam-7186	171	23	.	.	PUNCT
bam-7186	172	1	eur	eur	PROPN
bam-7186	172	2	j	j	PROPN
bam-7186	172	3	transl	transl	PROPN
bam-7186	172	4	myol	myol	NOUN
bam-7186	172	5	.	.	PUNCT
bam-7186	173	1	2014;24(3):3319	2014;24(3):3319	PROPN
bam-7186	173	2	.	.	PUNCT
bam-7186	173	3	doi	doi	NOUN
bam-7186	173	4	:	:	PUNCT
bam-7186	173	5	10.4081	10.4081	NUM
bam-7186	173	6	/	/	SYM
bam-7186	173	7	ejtm.2014.3319	ejtm.2014.3319	PROPN
bam-7186	173	8	.	.	PUNCT
bam-7186	174	1	ecollection	ecollection	NOUN
bam-7186	174	2	2014	2014	NUM
bam-7186	174	3	sep	sep	PROPN
bam-7186	174	4	23	23	NUM
bam-7186	174	5	.	.	PUNCT
bam-7186	174	6	received	receive	VERB
bam-7186	174	7	for	for	ADP
bam-7186	174	8	publication	publication	NOUN
bam-7186	174	9	:	:	PUNCT
bam-7186	174	10	november	november	PROPN
bam-7186	174	11	10	10	NUM
bam-7186	174	12	,	,	PUNCT
bam-7186	174	13	2017	2017	NUM
bam-7186	174	14	revision	revision	NOUN
bam-7186	174	15	received	receive	VERB
bam-7186	174	16	:	:	PUNCT
bam-7186	174	17	november	november	PROPN
bam-7186	174	18	10	10	NUM
bam-7186	174	19	,	,	PUNCT
bam-7186	174	20	2017	2017	NUM
bam-7186	174	21	accepted	accept	VERB
bam-7186	174	22	for	for	ADP
bam-7186	174	23	publication	publication	NOUN
bam-7186	174	24	:	:	PUNCT
bam-7186	174	25	november	november	PROPN
bam-7186	174	26	10	10	NUM
bam-7186	174	27	,	,	PUNCT
bam-7186	174	28	2017	2017	NUM
bam-7186	174	29	non	non	X
bam-7186	174	30	co	co	X
bam-7186	174	31	mmerc	mmerc	PROPN
bam-7186	174	32	ial	ial	PROPN
bam-7186	174	33	us	us	PROPN
bam-7186	175	1	e	e	NOUN
bam-7186	175	2	o	o	NOUN
bam-7186	175	3	nly	nly	ADV