id	sid	tid	token	lemma	pos
bam-7423	1	1	reprimo	reprimo	VERB
bam-7423	1	2	gene	gene	NOUN
bam-7423	1	3	in	in	ADP
bam-7423	1	4	gastric	gastric	ADJ
bam-7423	1	5	cancer	cancer	NOUN
bam-7423	1	6	eur	eur	PROPN
bam-7423	1	7	j	j	PROPN
bam-7423	1	8	transl	transl	PROPN
bam-7423	1	9	myol	myol	ADV
bam-7423	1	10	28	28	NUM
bam-7423	1	11	(	(	PUNCT
bam-7423	1	12	2	2	NUM
bam-7423	1	13	):	):	PUNCT
bam-7423	1	14	226	226	NUM
bam-7423	1	15	-	-	SYM
bam-7423	1	16	232	232	NUM
bam-7423	1	17	,	,	PUNCT
bam-7423	1	18	2018	2018	NUM
bam-7423	1	19	1	1	NUM
bam-7423	1	20	studying	study	VERB
bam-7423	1	21	the	the	DET
bam-7423	1	22	expression	expression	NOUN
bam-7423	1	23	rate	rate	NOUN
bam-7423	1	24	and	and	CCONJ
bam-7423	1	25	methylation	methylation	NOUN
bam-7423	1	26	of	of	ADP
bam-7423	1	27	reprimo	reprimo	ADJ
bam-7423	1	28	gene	gene	NOUN
bam-7423	1	29	in	in	ADP
bam-7423	1	30	the	the	DET
bam-7423	1	31	blood	blood	NOUN
bam-7423	1	32	of	of	ADP
bam-7423	1	33	patients	patient	NOUN
bam-7423	1	34	suffering	suffer	VERB
bam-7423	1	35	from	from	ADP
bam-7423	1	36	gastric	gastric	ADJ
bam-7423	1	37	cancer	cancer	NOUN
bam-7423	1	38	amin	amin	PROPN
bam-7423	1	39	abbasi	abbasi	PROPN
bam-7423	1	40	(	(	PUNCT
bam-7423	1	41	1	1	NUM
bam-7423	1	42	)	)	PUNCT
bam-7423	1	43	,	,	PUNCT
bam-7423	1	44	sahar	sahar	PROPN
bam-7423	1	45	heydari	heydari	NOUN
bam-7423	1	46	(	(	PUNCT
bam-7423	1	47	2	2	NUM
bam-7423	1	48	)	)	PUNCT
bam-7423	1	49	(	(	PUNCT
bam-7423	1	50	1	1	X
bam-7423	1	51	)	)	PUNCT
bam-7423	1	52	department	department	NOUN
bam-7423	1	53	of	of	ADP
bam-7423	1	54	biology	biology	NOUN
bam-7423	1	55	,	,	PUNCT
bam-7423	1	56	east	east	PROPN
bam-7423	1	57	tehran	tehran	PROPN
bam-7423	1	58	branch	branch	PROPN
bam-7423	1	59	,	,	PUNCT
bam-7423	1	60	islamic	islamic	PROPN
bam-7423	1	61	azad	azad	PROPN
bam-7423	1	62	university	university	PROPN
bam-7423	1	63	,	,	PUNCT
bam-7423	1	64	tehran	tehran	PROPN
bam-7423	1	65	,	,	PUNCT
bam-7423	1	66	iran	iran	PROPN
bam-7423	1	67	;	;	PUNCT
bam-7423	1	68	(	(	PUNCT
bam-7423	1	69	2	2	X
bam-7423	1	70	)	)	PUNCT
bam-7423	1	71	department	department	NOUN
bam-7423	1	72	of	of	ADP
bam-7423	1	73	genetic	genetic	ADJ
bam-7423	1	74	,	,	PUNCT
bam-7423	1	75	biology	biology	NOUN
bam-7423	1	76	research	research	NOUN
bam-7423	1	77	center	center	NOUN
bam-7423	1	78	,	,	PUNCT
bam-7423	1	79	zanjan	zanjan	NOUN
bam-7423	1	80	branch	branch	NOUN
bam-7423	1	81	,	,	PUNCT
bam-7423	1	82	islamic	islamic	PROPN
bam-7423	1	83	azad	azad	PROPN
bam-7423	1	84	university	university	PROPN
bam-7423	1	85	,	,	PUNCT
bam-7423	1	86	zanjan	zanjan	PROPN
bam-7423	1	87	,	,	PUNCT
bam-7423	1	88	iran	iran	PROPN
bam-7423	1	89	this	this	DET
bam-7423	1	90	article	article	NOUN
bam-7423	1	91	is	be	AUX
bam-7423	1	92	distributed	distribute	VERB
bam-7423	1	93	under	under	ADP
bam-7423	1	94	the	the	DET
bam-7423	1	95	terms	term	NOUN
bam-7423	1	96	of	of	ADP
bam-7423	1	97	the	the	DET
bam-7423	1	98	creative	creative	ADJ
bam-7423	1	99	commons	common	NOUN
bam-7423	1	100	attribution	attribution	NOUN
bam-7423	1	101	noncommercial	noncommercial	ADJ
bam-7423	1	102	license	license	NOUN
bam-7423	1	103	(	(	PUNCT
bam-7423	1	104	cc	cc	NOUN
bam-7423	1	105	by	by	ADP
bam-7423	1	106	-	-	PUNCT
bam-7423	1	107	nc	nc	PROPN
bam-7423	1	108	4.0	4.0	NUM
bam-7423	1	109	)	)	PUNCT
bam-7423	1	110	which	which	PRON
bam-7423	1	111	permits	permit	VERB
bam-7423	1	112	any	any	DET
bam-7423	1	113	noncommercial	noncommercial	ADJ
bam-7423	1	114	use	use	NOUN
bam-7423	1	115	,	,	PUNCT
bam-7423	1	116	distribution	distribution	NOUN
bam-7423	1	117	,	,	PUNCT
bam-7423	1	118	and	and	CCONJ
bam-7423	1	119	reproduction	reproduction	NOUN
bam-7423	1	120	in	in	ADP
bam-7423	1	121	any	any	DET
bam-7423	1	122	medium	medium	NOUN
bam-7423	1	123	,	,	PUNCT
bam-7423	1	124	provided	provide	VERB
bam-7423	1	125	the	the	DET
bam-7423	1	126	original	original	ADJ
bam-7423	1	127	author(s	author(s	NOUN
bam-7423	1	128	)	)	PUNCT
bam-7423	1	129	and	and	CCONJ
bam-7423	1	130	source	source	NOUN
bam-7423	1	131	are	be	AUX
bam-7423	1	132	credited	credit	VERB
bam-7423	1	133	.	.	PUNCT
bam-7423	2	1	abstract	abstract	ADV
bam-7423	2	2	as	as	SCONJ
bam-7423	2	3	gastric	gastric	ADJ
bam-7423	2	4	cancer	cancer	NOUN
bam-7423	2	5	has	have	VERB
bam-7423	2	6	no	no	DET
bam-7423	2	7	exclusive	exclusive	ADJ
bam-7423	2	8	signals	signal	NOUN
bam-7423	2	9	in	in	ADP
bam-7423	2	10	its	its	PRON
bam-7423	2	11	initial	initial	ADJ
bam-7423	2	12	phases	phase	NOUN
bam-7423	2	13	,	,	PUNCT
bam-7423	2	14	it	it	PRON
bam-7423	2	15	is	be	AUX
bam-7423	2	16	usually	usually	ADV
bam-7423	2	17	diagnosed	diagnose	VERB
bam-7423	2	18	in	in	ADP
bam-7423	2	19	advanced	advanced	ADJ
bam-7423	2	20	phases	phase	NOUN
bam-7423	2	21	.	.	PUNCT
bam-7423	3	1	although	although	SCONJ
bam-7423	3	2	many	many	ADJ
bam-7423	3	3	researches	research	NOUN
bam-7423	3	4	have	have	AUX
bam-7423	3	5	been	be	AUX
bam-7423	3	6	conducted	conduct	VERB
bam-7423	3	7	on	on	ADP
bam-7423	3	8	methylation	methylation	NOUN
bam-7423	3	9	and	and	CCONJ
bam-7423	3	10	diagnosis	diagnosis	NOUN
bam-7423	3	11	of	of	ADP
bam-7423	3	12	cancer	cancer	NOUN
bam-7423	3	13	’s	’s	PART
bam-7423	3	14	markers	marker	NOUN
bam-7423	3	15	,	,	PUNCT
bam-7423	3	16	the	the	DET
bam-7423	3	17	methylation	methylation	NOUN
bam-7423	3	18	and	and	CCONJ
bam-7423	3	19	expression	expression	NOUN
bam-7423	3	20	of	of	ADP
bam-7423	3	21	reprimo	reprimo	VERB
bam-7423	3	22	gene	gene	NOUN
bam-7423	3	23	and	and	CCONJ
bam-7423	3	24	its	its	PRON
bam-7423	3	25	correlation	correlation	NOUN
bam-7423	3	26	with	with	ADP
bam-7423	3	27	gastric	gastric	ADJ
bam-7423	3	28	cancer	cancer	NOUN
bam-7423	3	29	has	have	AUX
bam-7423	3	30	not	not	PART
bam-7423	3	31	been	be	AUX
bam-7423	3	32	thoroughly	thoroughly	ADV
bam-7423	3	33	studied	study	VERB
bam-7423	3	34	.	.	PUNCT
bam-7423	4	1	methylation	methylation	NOUN
bam-7423	4	2	of	of	ADP
bam-7423	4	3	reprimo	reprimo	ADJ
bam-7423	4	4	promoter	promoter	NOUN
bam-7423	4	5	is	be	AUX
bam-7423	4	6	a	a	DET
bam-7423	4	7	repetitive	repetitive	ADJ
bam-7423	4	8	procedure	procedure	NOUN
bam-7423	4	9	exclusive	exclusive	ADJ
bam-7423	4	10	to	to	ADP
bam-7423	4	11	cancer	cancer	NOUN
bam-7423	4	12	which	which	PRON
bam-7423	4	13	nullifies	nullify	VERB
bam-7423	4	14	its	its	PRON
bam-7423	4	15	expression	expression	NOUN
bam-7423	4	16	and	and	CCONJ
bam-7423	4	17	performance	performance	NOUN
bam-7423	4	18	.	.	PUNCT
bam-7423	5	1	the	the	DET
bam-7423	5	2	present	present	ADJ
bam-7423	5	3	research	research	NOUN
bam-7423	5	4	seeks	seek	VERB
bam-7423	5	5	to	to	PART
bam-7423	5	6	study	study	VERB
bam-7423	5	7	the	the	DET
bam-7423	5	8	expression	expression	NOUN
bam-7423	5	9	and	and	CCONJ
bam-7423	5	10	methylation	methylation	NOUN
bam-7423	5	11	of	of	ADP
bam-7423	5	12	reprimo	reprimo	VERB
bam-7423	5	13	among	among	ADP
bam-7423	5	14	people	people	NOUN
bam-7423	5	15	suffering	suffer	VERB
bam-7423	5	16	with	with	ADP
bam-7423	5	17	gastric	gastric	ADJ
bam-7423	5	18	cancer	cancer	NOUN
bam-7423	5	19	so	so	SCONJ
bam-7423	5	20	that	that	SCONJ
bam-7423	5	21	it	it	PRON
bam-7423	5	22	may	may	AUX
bam-7423	5	23	be	be	AUX
bam-7423	5	24	used	use	VERB
bam-7423	5	25	as	as	ADP
bam-7423	5	26	a	a	DET
bam-7423	5	27	biomarker	biomarker	NOUN
bam-7423	5	28	for	for	ADP
bam-7423	5	29	early	early	ADJ
bam-7423	5	30	diagnosis	diagnosis	NOUN
bam-7423	5	31	.	.	PUNCT
bam-7423	6	1	fifty	fifty	NUM
bam-7423	6	2	blood	blood	NOUN
bam-7423	6	3	samples	sample	NOUN
bam-7423	6	4	taken	take	VERB
bam-7423	6	5	from	from	ADP
bam-7423	6	6	healthy	healthy	ADJ
bam-7423	6	7	people	people	NOUN
bam-7423	6	8	(	(	PUNCT
bam-7423	6	9	normal	normal	ADJ
bam-7423	6	10	samples	sample	NOUN
bam-7423	6	11	)	)	PUNCT
bam-7423	6	12	and	and	CCONJ
bam-7423	6	13	50	50	NUM
bam-7423	6	14	blood	blood	NOUN
bam-7423	6	15	samples	sample	NOUN
bam-7423	6	16	obtained	obtain	VERB
bam-7423	6	17	from	from	ADP
bam-7423	6	18	gastric	gastric	ADJ
bam-7423	6	19	cancer	cancer	NOUN
bam-7423	6	20	patients	patient	NOUN
bam-7423	6	21	were	be	AUX
bam-7423	6	22	analyzed	analyze	VERB
bam-7423	6	23	using	use	VERB
bam-7423	6	24	real	real	ADJ
bam-7423	6	25	-	-	PUNCT
bam-7423	6	26	time	time	NOUN
bam-7423	6	27	pcr	pcr	NOUN
bam-7423	6	28	.	.	PUNCT
bam-7423	7	1	the	the	DET
bam-7423	7	2	methylation	methylation	NOUN
bam-7423	7	3	status	status	NOUN
bam-7423	7	4	of	of	ADP
bam-7423	7	5	the	the	DET
bam-7423	7	6	promoter	promoter	NOUN
bam-7423	7	7	of	of	ADP
bam-7423	7	8	reprimo	reprimo	PROPN
bam-7423	7	9	was	be	AUX
bam-7423	7	10	studied	study	VERB
bam-7423	7	11	using	use	VERB
bam-7423	7	12	methylation	methylation	NOUN
bam-7423	7	13	specific	specific	ADJ
bam-7423	7	14	pcr	pcr	NOUN
bam-7423	7	15	technique	technique	NOUN
bam-7423	7	16	in	in	ADP
bam-7423	7	17	normal	normal	ADJ
bam-7423	7	18	samples	sample	NOUN
bam-7423	7	19	and	and	CCONJ
bam-7423	7	20	in	in	ADP
bam-7423	7	21	gastric	gastric	ADJ
bam-7423	7	22	cancer	cancer	NOUN
bam-7423	7	23	iranian	iranian	ADJ
bam-7423	7	24	patients	patient	NOUN
bam-7423	7	25	.	.	PUNCT
bam-7423	8	1	we	we	PRON
bam-7423	8	2	observed	observe	VERB
bam-7423	8	3	reduction	reduction	NOUN
bam-7423	8	4	in	in	ADP
bam-7423	8	5	expression	expression	NOUN
bam-7423	8	6	rate	rate	NOUN
bam-7423	8	7	of	of	ADP
bam-7423	8	8	reprimo	reprimo	VERB
bam-7423	8	9	in	in	ADP
bam-7423	8	10	the	the	DET
bam-7423	8	11	blood	blood	NOUN
bam-7423	8	12	samples	sample	NOUN
bam-7423	8	13	of	of	ADP
bam-7423	8	14	patients	patient	NOUN
bam-7423	8	15	suffering	suffer	VERB
bam-7423	8	16	with	with	ADP
bam-7423	8	17	gastric	gastric	ADJ
bam-7423	8	18	cancer	cancer	NOUN
bam-7423	8	19	in	in	ADP
bam-7423	8	20	comparison	comparison	NOUN
bam-7423	8	21	to	to	ADP
bam-7423	8	22	normal	normal	ADJ
bam-7423	8	23	blood	blood	NOUN
bam-7423	8	24	samples	sample	NOUN
bam-7423	8	25	.	.	PUNCT
bam-7423	9	1	a	a	DET
bam-7423	9	2	significant	significant	ADJ
bam-7423	9	3	correlation	correlation	NOUN
bam-7423	9	4	was	be	AUX
bam-7423	9	5	also	also	ADV
bam-7423	9	6	observed	observe	VERB
bam-7423	9	7	between	between	ADP
bam-7423	9	8	the	the	DET
bam-7423	9	9	expression	expression	NOUN
bam-7423	9	10	rate	rate	NOUN
bam-7423	9	11	of	of	ADP
bam-7423	9	12	this	this	DET
bam-7423	9	13	gene	gene	NOUN
bam-7423	9	14	,	,	PUNCT
bam-7423	9	15	age	age	NOUN
bam-7423	9	16	and	and	CCONJ
bam-7423	9	17	methylation	methylation	NOUN
bam-7423	9	18	of	of	ADP
bam-7423	9	19	its	its	PRON
bam-7423	9	20	promoter	promoter	NOUN
bam-7423	9	21	among	among	ADP
bam-7423	9	22	patients	patient	NOUN
bam-7423	9	23	suffering	suffer	VERB
bam-7423	9	24	with	with	ADP
bam-7423	9	25	gastric	gastric	ADJ
bam-7423	9	26	cancer	cancer	NOUN
bam-7423	9	27	and	and	CCONJ
bam-7423	9	28	various	various	ADJ
bam-7423	9	29	analysis	analysis	NOUN
bam-7423	9	30	points	point	NOUN
bam-7423	9	31	to	to	ADP
bam-7423	9	32	a	a	DET
bam-7423	9	33	correlation	correlation	NOUN
bam-7423	9	34	between	between	ADP
bam-7423	9	35	reduced	reduce	VERB
bam-7423	9	36	expressions	expression	NOUN
bam-7423	9	37	of	of	ADP
bam-7423	9	38	reprimo	reprimo	VERB
bam-7423	9	39	gene	gene	NOUN
bam-7423	9	40	in	in	ADP
bam-7423	9	41	gastric	gastric	ADJ
bam-7423	9	42	cancer	cancer	NOUN
bam-7423	9	43	patients	patient	NOUN
bam-7423	9	44	.	.	PUNCT
bam-7423	10	1	in	in	ADP
bam-7423	10	2	conclusion	conclusion	NOUN
bam-7423	10	3	,	,	PUNCT
bam-7423	10	4	reduced	reduce	VERB
bam-7423	10	5	expression	expression	NOUN
bam-7423	10	6	of	of	ADP
bam-7423	10	7	reprimo	reprimo	VERB
bam-7423	10	8	gene	gene	NOUN
bam-7423	10	9	and	and	CCONJ
bam-7423	10	10	greater	great	ADJ
bam-7423	10	11	levels	level	NOUN
bam-7423	10	12	of	of	ADP
bam-7423	10	13	methylation	methylation	NOUN
bam-7423	10	14	of	of	ADP
bam-7423	10	15	its	its	PRON
bam-7423	10	16	promoter	promoter	NOUN
bam-7423	10	17	seems	seem	VERB
bam-7423	10	18	to	to	PART
bam-7423	10	19	be	be	AUX
bam-7423	10	20	promising	promise	VERB
bam-7423	10	21	biomarkers	biomarker	NOUN
bam-7423	10	22	for	for	ADP
bam-7423	10	23	early	early	ADJ
bam-7423	10	24	diagnosis	diagnosis	NOUN
bam-7423	10	25	of	of	ADP
bam-7423	10	26	gastric	gastric	ADJ
bam-7423	10	27	cancer	cancer	NOUN
bam-7423	10	28	.	.	PUNCT
bam-7423	11	1	key	key	ADJ
bam-7423	11	2	words	word	NOUN
bam-7423	11	3	:	:	PUNCT
bam-7423	11	4	gastric	gastric	ADJ
bam-7423	11	5	cancer	cancer	NOUN
bam-7423	11	6	,	,	PUNCT
bam-7423	11	7	methylation	methylation	NOUN
bam-7423	11	8	,	,	PUNCT
bam-7423	11	9	ms	ms	NOUN
bam-7423	11	10	-	-	PUNCT
bam-7423	11	11	pcr	pcr	NOUN
bam-7423	11	12	,	,	PUNCT
bam-7423	11	13	reprimo	reprimo	VERB
bam-7423	11	14	eur	eur	PROPN
bam-7423	11	15	j	j	PROPN
bam-7423	11	16	transl	transl	PROPN
bam-7423	11	17	myol	myol	ADV
bam-7423	11	18	28	28	NUM
bam-7423	11	19	(	(	PUNCT
bam-7423	11	20	2	2	NUM
bam-7423	11	21	):	):	PUNCT
bam-7423	11	22	226	226	NUM
bam-7423	11	23	-	-	SYM
bam-7423	11	24	232	232	NUM
bam-7423	11	25	,	,	PUNCT
bam-7423	11	26	2018	2018	NUM
bam-7423	11	27	gastric	gastric	ADJ
bam-7423	11	28	cancer	cancer	NOUN
bam-7423	11	29	is	be	AUX
bam-7423	11	30	the	the	DET
bam-7423	11	31	5th	5th	ADJ
bam-7423	11	32	most	most	ADV
bam-7423	11	33	common	common	ADJ
bam-7423	11	34	type	type	NOUN
bam-7423	11	35	of	of	ADP
bam-7423	11	36	cancer	cancer	NOUN
bam-7423	11	37	in	in	ADP
bam-7423	11	38	the	the	DET
bam-7423	11	39	world	world	NOUN
bam-7423	11	40	with	with	ADP
bam-7423	11	41	a	a	DET
bam-7423	11	42	mortality	mortality	NOUN
bam-7423	11	43	rate	rate	NOUN
bam-7423	11	44	of	of	ADP
bam-7423	11	45	723000	723000	NUM
bam-7423	11	46	cases	case	NOUN
bam-7423	11	47	reported	report	VERB
bam-7423	11	48	in	in	ADP
bam-7423	11	49	2012	2012	NUM
bam-7423	11	50	throughout	throughout	ADP
bam-7423	11	51	the	the	DET
bam-7423	11	52	world	world	NOUN
bam-7423	11	53	rendering	render	VERB
bam-7423	11	54	it	it	PRON
bam-7423	11	55	as	as	ADP
bam-7423	11	56	the	the	DET
bam-7423	11	57	third	third	ADJ
bam-7423	11	58	main	main	ADJ
bam-7423	11	59	cause	cause	NOUN
bam-7423	11	60	of	of	ADP
bam-7423	11	61	mortality	mortality	NOUN
bam-7423	11	62	as	as	ADP
bam-7423	11	63	a	a	DET
bam-7423	11	64	result	result	NOUN
bam-7423	11	65	of	of	ADP
bam-7423	11	66	cancer.1	cancer.1	NOUN
bam-7423	11	67	reprimo	reprimo	VERB
bam-7423	11	68	(	(	PUNCT
bam-7423	11	69	rprm	rprm	ADJ
bam-7423	11	70	)	)	PUNCT
bam-7423	11	71	gene	gene	NOUN
bam-7423	11	72	acts	act	VERB
bam-7423	11	73	as	as	ADP
bam-7423	11	74	a	a	DET
bam-7423	11	75	potential	potential	ADJ
bam-7423	11	76	suppressor	suppressor	NOUN
bam-7423	11	77	of	of	ADP
bam-7423	11	78	p53dependent	p53dependent	PROPN
bam-7423	11	79	tumor	tumor	NOUN
bam-7423	11	80	signaling	signal	VERB
bam-7423	11	81	pathway	pathway	NOUN
bam-7423	11	82	.	.	PUNCT
bam-7423	12	1	it	it	PRON
bam-7423	12	2	encodes	encode	VERB
bam-7423	12	3	a	a	DET
bam-7423	12	4	highly	highly	ADV
bam-7423	12	5	glycosilated	glycosilate	VERB
bam-7423	12	6	protein	protein	NOUN
bam-7423	12	7	mostly	mostly	ADV
bam-7423	12	8	found	find	VERB
bam-7423	12	9	in	in	ADP
bam-7423	12	10	cytoplasm.2,3	cytoplasm.2,3	PROPN
bam-7423	12	11	reprimo	reprimo	VERB
bam-7423	12	12	is	be	AUX
bam-7423	12	13	one	one	NUM
bam-7423	12	14	of	of	ADP
bam-7423	12	15	the	the	DET
bam-7423	12	16	genes	gene	NOUN
bam-7423	12	17	responsible	responsible	ADJ
bam-7423	12	18	for	for	ADP
bam-7423	12	19	regulation	regulation	NOUN
bam-7423	12	20	of	of	ADP
bam-7423	12	21	development	development	NOUN
bam-7423	12	22	and	and	CCONJ
bam-7423	12	23	growth	growth	NOUN
bam-7423	12	24	of	of	ADP
bam-7423	12	25	normal	normal	ADJ
bam-7423	12	26	cells.4	cells.4	ADJ
bam-7423	12	27	deactivation	deactivation	NOUN
bam-7423	12	28	of	of	ADP
bam-7423	12	29	reprimo	reprimo	ADJ
bam-7423	12	30	gene	gene	NOUN
bam-7423	12	31	usually	usually	ADV
bam-7423	12	32	takes	take	VERB
bam-7423	12	33	place	place	NOUN
bam-7423	12	34	in	in	ADP
bam-7423	12	35	initial	initial	ADJ
bam-7423	12	36	phases	phase	NOUN
bam-7423	12	37	of	of	ADP
bam-7423	12	38	various	various	ADJ
bam-7423	12	39	tumors	tumor	NOUN
bam-7423	12	40	mostly	mostly	ADV
bam-7423	12	41	as	as	ADP
bam-7423	12	42	a	a	DET
bam-7423	12	43	result	result	NOUN
bam-7423	12	44	of	of	ADP
bam-7423	12	45	dna	dna	PROPN
bam-7423	12	46	methylation.5	methylation.5	PROPN
bam-7423	12	47	it	it	PRON
bam-7423	12	48	has	have	AUX
bam-7423	12	49	been	be	AUX
bam-7423	12	50	greatly	greatly	ADV
bam-7423	12	51	observed	observe	VERB
bam-7423	12	52	that	that	SCONJ
bam-7423	12	53	in	in	ADP
bam-7423	12	54	two	two	NUM
bam-7423	12	55	cell	cell	NOUN
bam-7423	12	56	categories	category	NOUN
bam-7423	12	57	of	of	ADP
bam-7423	12	58	gastric	gastric	ADJ
bam-7423	12	59	cancer	cancer	NOUN
bam-7423	12	60	without	without	ADP
bam-7423	12	61	reprimo	reprimo	ADJ
bam-7423	12	62	methylation	methylation	NOUN
bam-7423	12	63	,	,	PUNCT
bam-7423	12	64	weak	weak	ADJ
bam-7423	12	65	expression	expression	NOUN
bam-7423	12	66	in	in	ADP
bam-7423	12	67	normal	normal	ADJ
bam-7423	12	68	conditions	condition	NOUN
bam-7423	12	69	and	and	CCONJ
bam-7423	12	70	high	high	ADJ
bam-7423	12	71	expression	expression	NOUN
bam-7423	12	72	in	in	ADP
bam-7423	12	73	cases	case	NOUN
bam-7423	12	74	of	of	ADP
bam-7423	12	75	dna	dna	PROPN
bam-7423	12	76	damage	damage	NOUN
bam-7423	12	77	were	be	AUX
bam-7423	12	78	observed.6	observed.6	PRON
bam-7423	12	79	expression	expression	NOUN
bam-7423	12	80	of	of	ADP
bam-7423	12	81	reprimo	reprimo	NOUN
bam-7423	12	82	is	be	AUX
bam-7423	12	83	usually	usually	ADV
bam-7423	12	84	stimulated	stimulate	VERB
bam-7423	12	85	in	in	ADP
bam-7423	12	86	response	response	NOUN
bam-7423	12	87	to	to	ADP
bam-7423	12	88	damages	damage	NOUN
bam-7423	12	89	caused	cause	VERB
bam-7423	12	90	to	to	ADP
bam-7423	12	91	dna	dna	PROPN
bam-7423	12	92	,	,	PUNCT
bam-7423	12	93	but	but	CCONJ
bam-7423	12	94	expression	expression	NOUN
bam-7423	12	95	of	of	ADP
bam-7423	12	96	reprimo	reprimo	VERB
bam-7423	12	97	wipes	wipe	NOUN
bam-7423	12	98	out	out	ADP
bam-7423	12	99	the	the	DET
bam-7423	12	100	expression	expression	NOUN
bam-7423	12	101	and	and	CCONJ
bam-7423	12	102	effects	effect	NOUN
bam-7423	12	103	of	of	ADP
bam-7423	12	104	this	this	DET
bam-7423	12	105	gene.6,7	gene.6,7	PROPN
bam-7423	12	106	as	as	ADP
bam-7423	12	107	a	a	DET
bam-7423	12	108	result	result	NOUN
bam-7423	12	109	,	,	PUNCT
bam-7423	12	110	this	this	DET
bam-7423	12	111	gene	gene	NOUN
bam-7423	12	112	acts	act	VERB
bam-7423	12	113	as	as	ADP
bam-7423	12	114	a	a	DET
bam-7423	12	115	suppressive	suppressive	ADJ
bam-7423	12	116	agent	agent	NOUN
bam-7423	12	117	for	for	ADP
bam-7423	12	118	tumor	tumor	NOUN
bam-7423	12	119	growth	growth	NOUN
bam-7423	12	120	in	in	ADP
bam-7423	12	121	gastric	gastric	ADJ
bam-7423	12	122	cancer	cancer	NOUN
bam-7423	12	123	.	.	PUNCT
bam-7423	13	1	clinical	clinical	ADJ
bam-7423	13	2	assessment	assessment	NOUN
bam-7423	13	3	of	of	ADP
bam-7423	13	4	methylation	methylation	NOUN
bam-7423	13	5	of	of	ADP
bam-7423	13	6	reprimo	reprimo	ADJ
bam-7423	13	7	promoter	promoter	NOUN
bam-7423	13	8	may	may	AUX
bam-7423	13	9	be	be	AUX
bam-7423	13	10	used	use	VERB
bam-7423	13	11	as	as	ADP
bam-7423	13	12	an	an	DET
bam-7423	13	13	indicator	indicator	NOUN
bam-7423	13	14	of	of	ADP
bam-7423	13	15	invasive	invasive	ADJ
bam-7423	13	16	tumors	tumor	NOUN
bam-7423	13	17	,	,	PUNCT
bam-7423	13	18	and	and	CCONJ
bam-7423	13	19	thus	thus	ADV
bam-7423	13	20	as	as	ADP
bam-7423	13	21	an	an	DET
bam-7423	13	22	indicator	indicator	NOUN
bam-7423	13	23	for	for	ADP
bam-7423	13	24	chemotherapy.8	chemotherapy.8	PROPN
bam-7423	13	25	although	although	SCONJ
bam-7423	13	26	it	it	PRON
bam-7423	13	27	is	be	AUX
bam-7423	13	28	of	of	ADP
bam-7423	13	29	significant	significant	ADJ
bam-7423	13	30	importance	importance	NOUN
bam-7423	13	31	for	for	ADP
bam-7423	13	32	better	well	ADJ
bam-7423	13	33	management	management	NOUN
bam-7423	13	34	of	of	ADP
bam-7423	13	35	gastric	gastric	ADJ
bam-7423	13	36	cancer	cancer	NOUN
bam-7423	13	37	,	,	PUNCT
bam-7423	13	38	the	the	DET
bam-7423	13	39	methylation	methylation	NOUN
bam-7423	13	40	and	and	CCONJ
bam-7423	13	41	expression	expression	NOUN
bam-7423	13	42	of	of	ADP
bam-7423	13	43	reprimo	reprimo	VERB
bam-7423	13	44	gene	gene	NOUN
bam-7423	13	45	and	and	CCONJ
bam-7423	13	46	its	its	PRON
bam-7423	13	47	correlation	correlation	NOUN
bam-7423	13	48	with	with	ADP
bam-7423	13	49	gastric	gastric	ADJ
bam-7423	13	50	cancer	cancer	NOUN
bam-7423	13	51	has	have	AUX
bam-7423	13	52	not	not	PART
bam-7423	13	53	been	be	AUX
bam-7423	13	54	thoroughly	thoroughly	ADV
bam-7423	13	55	analyzed	analyze	VERB
bam-7423	13	56	.	.	PUNCT
bam-7423	14	1	thus	thus	ADV
bam-7423	14	2	,	,	PUNCT
bam-7423	14	3	the	the	DET
bam-7423	14	4	present	present	ADJ
bam-7423	14	5	research	research	NOUN
bam-7423	14	6	seeks	seek	VERB
bam-7423	14	7	to	to	PART
bam-7423	14	8	study	study	VERB
bam-7423	14	9	the	the	DET
bam-7423	14	10	correlation	correlation	NOUN
bam-7423	14	11	between	between	ADP
bam-7423	14	12	methylation	methylation	NOUN
bam-7423	14	13	and	and	CCONJ
bam-7423	14	14	expression	expression	NOUN
bam-7423	14	15	rate	rate	NOUN
bam-7423	14	16	of	of	ADP
bam-7423	14	17	reprimo	reprimo	ADJ
bam-7423	14	18	gene	gene	NOUN
bam-7423	14	19	in	in	ADP
bam-7423	14	20	gastric	gastric	ADJ
bam-7423	14	21	cancer	cancer	NOUN
bam-7423	14	22	.	.	PUNCT
bam-7423	15	1	materials	material	NOUN
bam-7423	15	2	and	and	CCONJ
bam-7423	15	3	methods	method	NOUN
bam-7423	15	4	the	the	DET
bam-7423	15	5	present	present	ADJ
bam-7423	15	6	research	research	NOUN
bam-7423	15	7	studied	study	VERB
bam-7423	15	8	as	as	ADV
bam-7423	15	9	many	many	ADJ
bam-7423	15	10	as	as	ADP
bam-7423	15	11	100	100	NUM
bam-7423	15	12	venous	venous	ADJ
bam-7423	15	13	blood	blood	NOUN
bam-7423	15	14	samples	sample	NOUN
bam-7423	15	15	including	include	VERB
bam-7423	15	16	50	50	NUM
bam-7423	15	17	healthy	healthy	ADJ
bam-7423	15	18	blood	blood	NOUN
bam-7423	15	19	samples	sample	NOUN
bam-7423	15	20	(	(	PUNCT
bam-7423	15	21	normal	normal	ADJ
bam-7423	15	22	samples	sample	NOUN
bam-7423	15	23	)	)	PUNCT
bam-7423	15	24	and	and	CCONJ
bam-7423	15	25	50	50	NUM
bam-7423	15	26	blood	blood	NOUN
bam-7423	15	27	samples	sample	NOUN
bam-7423	15	28	obtained	obtain	VERB
bam-7423	15	29	from	from	ADP
bam-7423	15	30	gastric	gastric	ADJ
bam-7423	15	31	cancer	cancer	NOUN
bam-7423	15	32	patients	patient	NOUN
bam-7423	15	33	.	.	PUNCT
bam-7423	16	1	proper	proper	ADJ
bam-7423	16	2	samples	sample	NOUN
bam-7423	16	3	were	be	AUX
bam-7423	16	4	obtained	obtain	VERB
bam-7423	16	5	from	from	ADP
bam-7423	16	6	masoud	masoud	PROPN
bam-7423	16	7	medical	medical	PROPN
bam-7423	16	8	diagnostic	diagnostic	PROPN
bam-7423	16	9	laboratory	laboratory	NOUN
bam-7423	16	10	(	(	PUNCT
bam-7423	16	11	iran	iran	PROPN
bam-7423	16	12	)	)	PUNCT
bam-7423	16	13	collected	collect	VERB
bam-7423	16	14	from	from	ADP
bam-7423	16	15	2013	2013	NUM
bam-7423	16	16	to	to	ADP
bam-7423	16	17	2015	2015	NUM
bam-7423	16	18	in	in	ADP
bam-7423	16	19	test	test	NOUN
bam-7423	16	20	tubes	tube	NOUN
bam-7423	16	21	containing	contain	VERB
bam-7423	16	22	edta	edta	NOUN
bam-7423	16	23	.	.	PUNCT
bam-7423	17	1	the	the	DET
bam-7423	17	2	individuals	individual	NOUN
bam-7423	17	3	studied	study	VERB
bam-7423	17	4	aged	aged	ADJ
bam-7423	17	5	16	16	NUM
bam-7423	17	6	to	to	PART
bam-7423	17	7	86	86	NUM
bam-7423	17	8	years	year	NOUN
bam-7423	17	9	old	old	ADJ
bam-7423	17	10	.	.	PUNCT
bam-7423	18	1	non	non	PROPN
bam-7423	18	2	co	co	PROPN
bam-7423	18	3	mmerc	mmerc	PROPN
bam-7423	18	4	ial	ial	PROPN
bam-7423	18	5	us	us	PROPN
bam-7423	18	6	e	e	NOUN
bam-7423	18	7	o	o	NOUN
bam-7423	18	8	nly	nly	ADV
bam-7423	18	9	reprimo	reprimo	VERB
bam-7423	18	10	gene	gene	NOUN
bam-7423	18	11	in	in	ADP
bam-7423	18	12	gastric	gastric	ADJ
bam-7423	18	13	cancer	cancer	NOUN
bam-7423	18	14	eur	eur	PROPN
bam-7423	18	15	j	j	PROPN
bam-7423	18	16	transl	transl	PROPN
bam-7423	18	17	myol	myol	ADV
bam-7423	18	18	28	28	NUM
bam-7423	18	19	(	(	PUNCT
bam-7423	18	20	2	2	NUM
bam-7423	18	21	):	):	PUNCT
bam-7423	18	22	226	226	NUM
bam-7423	18	23	-	-	SYM
bam-7423	18	24	232	232	NUM
bam-7423	18	25	,	,	PUNCT
bam-7423	18	26	2018	2018	NUM
bam-7423	18	27	2	2	NUM
bam-7423	18	28	twentysix	twentysix	NOUN
bam-7423	18	29	samples	sample	NOUN
bam-7423	18	30	were	be	AUX
bam-7423	18	31	from	from	ADP
bam-7423	18	32	female	female	ADJ
bam-7423	18	33	and	and	CCONJ
bam-7423	18	34	the	the	DET
bam-7423	18	35	remaining	remain	VERB
bam-7423	18	36	sevetyfour	sevetyfour	NOUN
bam-7423	18	37	from	from	ADP
bam-7423	18	38	male	male	ADJ
bam-7423	18	39	subjects	subject	NOUN
bam-7423	18	40	.	.	PUNCT
bam-7423	19	1	40	40	NUM
bam-7423	19	2	samples	sample	NOUN
bam-7423	19	3	were	be	AUX
bam-7423	19	4	older	old	ADJ
bam-7423	19	5	than	than	ADP
bam-7423	19	6	55	55	NUM
bam-7423	19	7	years	year	NOUN
bam-7423	19	8	,	,	PUNCT
bam-7423	19	9	while	while	SCONJ
bam-7423	19	10	the	the	DET
bam-7423	19	11	remaining	remain	VERB
bam-7423	19	12	60	60	NUM
bam-7423	19	13	were	be	AUX
bam-7423	19	14	younger	young	ADJ
bam-7423	19	15	than	than	ADP
bam-7423	19	16	55	55	NUM
bam-7423	19	17	.	.	PUNCT
bam-7423	20	1	all	all	DET
bam-7423	20	2	participating	participate	VERB
bam-7423	20	3	patients	patient	NOUN
bam-7423	20	4	in	in	ADP
bam-7423	20	5	this	this	DET
bam-7423	20	6	study	study	NOUN
bam-7423	20	7	were	be	AUX
bam-7423	20	8	in	in	ADP
bam-7423	20	9	the	the	DET
bam-7423	20	10	early	early	ADJ
bam-7423	20	11	stages	stage	NOUN
bam-7423	20	12	of	of	ADP
bam-7423	20	13	gastric	gastric	ADJ
bam-7423	20	14	cancer	cancer	NOUN
bam-7423	20	15	.	.	PUNCT
bam-7423	21	1	they	they	PRON
bam-7423	21	2	had	have	AUX
bam-7423	21	3	been	be	AUX
bam-7423	21	4	referred	refer	VERB
bam-7423	21	5	to	to	ADP
bam-7423	21	6	the	the	DET
bam-7423	21	7	doctor	doctor	NOUN
bam-7423	21	8	with	with	ADP
bam-7423	21	9	stomach	stomach	NOUN
bam-7423	21	10	ache	ache	ADV
bam-7423	21	11	,	,	PUNCT
bam-7423	21	12	diarrhea	diarrhea	NOUN
bam-7423	21	13	and	and	CCONJ
bam-7423	21	14	vomiting	vomiting	NOUN
bam-7423	21	15	.	.	PUNCT
bam-7423	22	1	extracting	extract	VERB
bam-7423	22	2	rna	rna	NOUN
bam-7423	22	3	from	from	ADP
bam-7423	22	4	blood	blood	NOUN
bam-7423	22	5	and	and	CCONJ
bam-7423	22	6	cdna	cdna	PROPN
bam-7423	22	7	synthesis	synthesis	NOUN
bam-7423	22	8	rna	rna	NOUN
bam-7423	22	9	extraction	extraction	NOUN
bam-7423	22	10	kit	kit	NOUN
bam-7423	22	11	of	of	ADP
bam-7423	22	12	kiagen	kiagen	PROPN
bam-7423	22	13	com	com	PROPN
bam-7423	22	14	.	.	PUNCT
bam-7423	23	1	(	(	PUNCT
bam-7423	23	2	cat	cat	NOUN
bam-7423	23	3	.	.	PUNCT
bam-7423	24	1	no	no	INTJ
bam-7423	24	2	.	.	NOUN
bam-7423	24	3	762165	762165	NUM
bam-7423	24	4	)	)	PUNCT
bam-7423	24	5	was	be	AUX
bam-7423	24	6	used	use	VERB
bam-7423	24	7	to	to	PART
bam-7423	24	8	extract	extract	VERB
bam-7423	24	9	rna	rna	NOUN
bam-7423	24	10	in	in	ADP
bam-7423	24	11	accordance	accordance	NOUN
bam-7423	24	12	with	with	ADP
bam-7423	24	13	the	the	DET
bam-7423	24	14	standard	standard	ADJ
bam-7423	24	15	protocol	protocol	NOUN
bam-7423	24	16	which	which	PRON
bam-7423	24	17	accompanied	accompany	VERB
bam-7423	24	18	the	the	DET
bam-7423	24	19	kit	kit	NOUN
bam-7423	24	20	.	.	PUNCT
bam-7423	25	1	cdna	cdna	PROPN
bam-7423	25	2	synthesis	synthesis	NOUN
bam-7423	25	3	was	be	AUX
bam-7423	25	4	carried	carry	VERB
bam-7423	25	5	out	out	ADP
bam-7423	25	6	in	in	ADP
bam-7423	25	7	a	a	DET
bam-7423	25	8	microtube	microtube	NOUN
bam-7423	25	9	1μl	1μl	NOUN
bam-7423	25	10	of	of	ADP
bam-7423	25	11	dntp	dntp	NOUN
bam-7423	25	12	(	(	PUNCT
bam-7423	25	13	10	10	NUM
bam-7423	25	14	mm	mm	NOUN
bam-7423	25	15	)	)	PUNCT
bam-7423	25	16	,	,	PUNCT
bam-7423	25	17	1μl	1μl	NOUN
bam-7423	25	18	of	of	ADP
bam-7423	25	19	random	random	ADJ
bam-7423	25	20	hexamer	hexamer	NOUN
bam-7423	25	21	(	(	PUNCT
bam-7423	25	22	400	400	NUM
bam-7423	25	23	mm	mm	NOUN
bam-7423	25	24	)	)	PUNCT
bam-7423	25	25	,	,	PUNCT
bam-7423	25	26	1	1	NUM
bam-7423	25	27	μl	μl	ADP
bam-7423	25	28	of	of	ADP
bam-7423	25	29	oligo	oligo	ADJ
bam-7423	25	30	dt	dt	NOUN
bam-7423	25	31	,	,	PUNCT
bam-7423	25	32	2	2	NUM
bam-7423	25	33	μl	μl	ADP
bam-7423	25	34	of	of	ADP
bam-7423	25	35	mmulv	mmulv	PROPN
bam-7423	25	36	10x	10x	NOUN
bam-7423	25	37	buffer	buffer	NOUN
bam-7423	25	38	,	,	PUNCT
bam-7423	25	39	0.5	0.5	NUM
bam-7423	25	40	μl	μl	NUM
bam-7423	25	41	of	of	ADP
bam-7423	25	42	mmulv	mmulv	NOUN
bam-7423	25	43	(	(	PUNCT
bam-7423	25	44	200u	200u	PROPN
bam-7423	25	45	/	/	SYM
bam-7423	25	46	μl	μl	CCONJ
bam-7423	25	47	)	)	PUNCT
bam-7423	25	48	all	all	PRON
bam-7423	25	49	provided	provide	VERB
bam-7423	25	50	by	by	ADP
bam-7423	25	51	sinagen	sinagen	PROPN
bam-7423	25	52	co.	co.	PROPN
bam-7423	25	53	(	(	PUNCT
bam-7423	25	54	iran	iran	PROPN
bam-7423	25	55	)	)	PUNCT
bam-7423	25	56	and	and	CCONJ
bam-7423	25	57	the	the	DET
bam-7423	25	58	10μl	10μl	NOUN
bam-7423	25	59	of	of	ADP
bam-7423	25	60	rna	rna	NOUN
bam-7423	25	61	sample	sample	NOUN
bam-7423	25	62	and	and	CCONJ
bam-7423	25	63	4.5μl	4.5μl	NUM
bam-7423	25	64	of	of	ADP
bam-7423	25	65	nuclease	nuclease	NOUN
bam-7423	25	66	free	free	ADJ
bam-7423	25	67	water	water	NOUN
bam-7423	25	68	in	in	ADP
bam-7423	25	69	a	a	DET
bam-7423	25	70	total	total	ADJ
bam-7423	25	71	volume	volume	NOUN
bam-7423	25	72	of	of	ADP
bam-7423	25	73	20μl	20μl	ADV
bam-7423	25	74	was	be	AUX
bam-7423	25	75	conducted	conduct	VERB
bam-7423	25	76	.	.	PUNCT
bam-7423	26	1	the	the	DET
bam-7423	26	2	microtubes	microtube	NOUN
bam-7423	26	3	were	be	AUX
bam-7423	26	4	exposed	expose	VERB
bam-7423	26	5	to	to	ADP
bam-7423	26	6	a	a	DET
bam-7423	26	7	temperature	temperature	NOUN
bam-7423	26	8	of	of	ADP
bam-7423	26	9	65	65	NUM
bam-7423	26	10	℃	℃	PROPN
bam-7423	26	11	for	for	ADP
bam-7423	26	12	5	5	NUM
bam-7423	26	13	minutes	minute	NOUN
bam-7423	26	14	and	and	CCONJ
bam-7423	26	15	then	then	ADV
bam-7423	26	16	to	to	ADP
bam-7423	26	17	a	a	DET
bam-7423	26	18	temperature	temperature	NOUN
bam-7423	26	19	of	of	ADP
bam-7423	26	20	4	4	NUM
bam-7423	26	21	℃	℃	PROPN
bam-7423	26	22	for	for	ADP
bam-7423	26	23	1	1	NUM
bam-7423	26	24	minute	minute	NOUN
bam-7423	26	25	.	.	PUNCT
bam-7423	27	1	glyceraldehyde-3	glyceraldehyde-3	NUM
bam-7423	27	2	table	table	NOUN
bam-7423	27	3	1	1	NUM
bam-7423	27	4	.	.	PUNCT
bam-7423	28	1	primers	primer	NOUN
bam-7423	28	2	designed	design	VERB
bam-7423	28	3	for	for	ADP
bam-7423	28	4	real	real	ADJ
bam-7423	28	5	-	-	PUNCT
bam-7423	28	6	time	time	NOUN
bam-7423	28	7	pcr	pcr	ADJ
bam-7423	28	8	reaction	reaction	NOUN
bam-7423	28	9	of	of	ADP
bam-7423	28	10	reprimo	reprimo	VERB
bam-7423	28	11	and	and	CCONJ
bam-7423	28	12	gapdh	gapdh	NOUN
bam-7423	28	13	genes	gene	NOUN
bam-7423	28	14	primer	primer	NOUN
bam-7423	28	15	sequence	sequence	NOUN
bam-7423	28	16	tm	tm	ADP
bam-7423	28	17	℃	℃	PROPN
bam-7423	28	18	amplicon	amplicon	NOUN
bam-7423	28	19	size	size	NOUN
bam-7423	28	20	(	(	PUNCT
bam-7423	28	21	bp	bp	PROPN
bam-7423	28	22	)	)	PUNCT
bam-7423	28	23	reprimo	reprimo	VERB
bam-7423	28	24	(	(	PUNCT
bam-7423	28	25	f	f	X
bam-7423	28	26	)	)	PUNCT
bam-7423	28	27	ctgggacaaagacccagaat	ctgggacaaagacccagaat	PROPN
bam-7423	28	28	58.99	58.99	NUM
bam-7423	28	29	83	83	NUM
bam-7423	28	30	bp	bp	PROPN
bam-7423	28	31	reprimo	reprimo	VERB
bam-7423	29	1	(	(	PUNCT
bam-7423	29	2	r	r	NOUN
bam-7423	29	3	)	)	PUNCT
bam-7423	29	4	ggtgtcacggatgtcaagag	ggtgtcacggatgtcaagag	NOUN
bam-7423	29	5	59.10	59.10	NUM
bam-7423	29	6	83	83	NUM
bam-7423	29	7	bp	bp	PROPN
bam-7423	29	8	gapdh	gapdh	NOUN
bam-7423	29	9	(	(	PUNCT
bam-7423	29	10	f	f	X
bam-7423	29	11	)	)	PUNCT
bam-7423	29	12	atggagaaggctggggct	atggagaaggctggggct	VERB
bam-7423	29	13	62.05	62.05	NUM
bam-7423	29	14	124	124	NUM
bam-7423	29	15	bp	bp	PROPN
bam-7423	29	16	gapdh	gapdh	NOUN
bam-7423	29	17	(	(	PUNCT
bam-7423	29	18	r	r	NOUN
bam-7423	29	19	)	)	PUNCT
bam-7423	29	20	atcttgaggctgttgtcatacttctc	atcttgaggctgttgtcatacttctc	NOUN
bam-7423	29	21	61.62	61.62	NUM
bam-7423	29	22	124	124	NUM
bam-7423	29	23	bp	bp	PROPN
bam-7423	29	24	table	table	NOUN
bam-7423	29	25	2	2	NUM
bam-7423	29	26	.	.	PUNCT
bam-7423	29	27	primers	primer	NOUN
bam-7423	29	28	designed	design	VERB
bam-7423	29	29	for	for	ADP
bam-7423	29	30	methylated	methylate	VERB
bam-7423	29	31	and	and	CCONJ
bam-7423	29	32	non	non	ADJ
bam-7423	29	33	-	-	ADJ
bam-7423	29	34	methylated	methylate	VERB
bam-7423	29	35	regions	region	NOUN
bam-7423	29	36	in	in	ADP
bam-7423	29	37	ms	ms	ADJ
bam-7423	29	38	-	-	PUNCT
bam-7423	29	39	pcr	pcr	ADJ
bam-7423	29	40	reaction	reaction	NOUN
bam-7423	29	41	amplicon	amplicon	NOUN
bam-7423	29	42	size	size	NOUN
bam-7423	29	43	(	(	PUNCT
bam-7423	29	44	bp	bp	PROPN
bam-7423	29	45	)	)	PUNCT
bam-7423	29	46	tm	tm	PROPN
bam-7423	29	47	℃	℃	PROPN
bam-7423	29	48	sequence	sequence	NOUN
bam-7423	29	49	primer	primer	NOUN
bam-7423	29	50	158	158	NUM
bam-7423	29	51	bp	bp	PROPN
bam-7423	29	52	61.2	61.2	NUM
bam-7423	29	53	agtattattagggttggagcggacg	agtattattagggttggagcggacg	NOUN
bam-7423	29	54	reprimomet	reprimomet	VERB
bam-7423	29	55	(	(	PUNCT
bam-7423	29	56	f	f	X
bam-7423	29	57	)	)	PUNCT
bam-7423	29	58	158	158	NUM
bam-7423	29	59	bp	bp	PROPN
bam-7423	29	60	60.7	60.7	NUM
bam-7423	29	61	aaataccgaactaaacgctcactcg	aaataccgaactaaacgctcactcg	NOUN
bam-7423	29	62	reprimo	reprimo	NOUN
bam-7423	29	63	met	meet	VERB
bam-7423	29	64	(	(	PUNCT
bam-7423	29	65	r	r	NOUN
bam-7423	29	66	)	)	PUNCT
bam-7423	29	67	158	158	NUM
bam-7423	29	68	bp	bp	PROPN
bam-7423	29	69	54.3	54.3	NUM
bam-7423	29	70	tattattagggttggagtggatg	tattattagggttggagtggatg	NOUN
bam-7423	29	71	reprimo	reprimo	VERB
bam-7423	29	72	unmet	unmet	NOUN
bam-7423	29	73	(	(	PUNCT
bam-7423	29	74	f	f	X
bam-7423	29	75	)	)	PUNCT
bam-7423	29	76	158	158	NUM
bam-7423	29	77	bp	bp	PROPN
bam-7423	29	78	55.2	55.2	NUM
bam-7423	29	79	aaatactgaactaaatgctcacttg	aaatactgaactaaatgctcacttg	NOUN
bam-7423	29	80	reprimo	reprimo	VERB
bam-7423	29	81	unmet(r	unmet(r	NOUN
bam-7423	29	82	)	)	PUNCT
bam-7423	29	83	fig	fig	NOUN
bam-7423	29	84	1	1	NUM
bam-7423	29	85	.	.	PUNCT
bam-7423	30	1	the	the	DET
bam-7423	30	2	melting	melt	VERB
bam-7423	30	3	curve	curve	NOUN
bam-7423	30	4	of	of	ADP
bam-7423	30	5	reprimo	reprimo	VERB
bam-7423	30	6	in	in	ADP
bam-7423	30	7	normal	normal	ADJ
bam-7423	30	8	samples	sample	NOUN
bam-7423	30	9	and	and	CCONJ
bam-7423	30	10	gastric	gastric	ADJ
bam-7423	30	11	patients	patient	NOUN
bam-7423	30	12	fig	fig	VERB
bam-7423	30	13	2	2	NUM
bam-7423	30	14	.	.	PUNCT
bam-7423	31	1	the	the	DET
bam-7423	31	2	melting	melting	NOUN
bam-7423	31	3	curve	curve	NOUN
bam-7423	31	4	of	of	ADP
bam-7423	31	5	gapdh	gapdh	NOUN
bam-7423	31	6	gene	gene	NOUN
bam-7423	31	7	in	in	ADP
bam-7423	31	8	normal	normal	ADJ
bam-7423	31	9	samples	sample	NOUN
bam-7423	31	10	and	and	CCONJ
bam-7423	31	11	gastric	gastric	ADJ
bam-7423	31	12	patients	patient	NOUN
bam-7423	31	13	non	non	X
bam-7423	31	14	co	co	VERB
bam-7423	31	15	mmerc	mmerc	PROPN
bam-7423	31	16	ial	ial	PROPN
bam-7423	31	17	us	us	PROPN
bam-7423	31	18	e	e	NOUN
bam-7423	31	19	o	o	NOUN
bam-7423	31	20	nly	nly	ADV
bam-7423	31	21	reprimo	reprimo	VERB
bam-7423	31	22	gene	gene	NOUN
bam-7423	31	23	in	in	ADP
bam-7423	31	24	gastric	gastric	ADJ
bam-7423	31	25	cancer	cancer	NOUN
bam-7423	31	26	eur	eur	PROPN
bam-7423	31	27	j	j	PROPN
bam-7423	31	28	transl	transl	PROPN
bam-7423	31	29	myol	myol	ADV
bam-7423	31	30	28	28	NUM
bam-7423	31	31	(	(	PUNCT
bam-7423	31	32	2	2	NUM
bam-7423	31	33	):	):	PUNCT
bam-7423	31	34	226	226	NUM
bam-7423	31	35	-	-	SYM
bam-7423	31	36	232	232	NUM
bam-7423	31	37	,	,	PUNCT
bam-7423	31	38	2018	2018	NUM
bam-7423	31	39	3	3	NUM
bam-7423	31	40	phosphate	phosphate	NOUN
bam-7423	31	41	dehydrogenase	dehydrogenase	NOUN
bam-7423	31	42	(	(	PUNCT
bam-7423	31	43	gapdh	gapdh	NOUN
bam-7423	31	44	)	)	PUNCT
bam-7423	31	45	was	be	AUX
bam-7423	31	46	used	use	VERB
bam-7423	31	47	for	for	ADP
bam-7423	31	48	internal	internal	ADJ
bam-7423	31	49	control	control	NOUN
bam-7423	31	50	.	.	PUNCT
bam-7423	32	1	carrying	carry	VERB
bam-7423	32	2	out	out	ADP
bam-7423	32	3	real	real	ADJ
bam-7423	32	4	-	-	PUNCT
bam-7423	32	5	time	time	NOUN
bam-7423	32	6	pcr	pcr	NOUN
bam-7423	32	7	using	use	VERB
bam-7423	32	8	the	the	DET
bam-7423	32	9	sequences	sequence	NOUN
bam-7423	32	10	in	in	ADP
bam-7423	32	11	ncbi	ncbi	PROPN
bam-7423	32	12	gene	gene	PROPN
bam-7423	32	13	bank	bank	PROPN
bam-7423	32	14	,	,	PUNCT
bam-7423	32	15	the	the	DET
bam-7423	32	16	primers	primer	NOUN
bam-7423	32	17	required	require	VERB
bam-7423	32	18	for	for	ADP
bam-7423	32	19	reprimo	reprimo	VERB
bam-7423	32	20	genes	gene	NOUN
bam-7423	32	21	and	and	CCONJ
bam-7423	32	22	gapdh	gapdh	NOUN
bam-7423	32	23	were	be	AUX
bam-7423	32	24	designed	design	VERB
bam-7423	32	25	and	and	CCONJ
bam-7423	32	26	studied	study	VERB
bam-7423	32	27	using	use	VERB
bam-7423	32	28	gene	gene	NOUN
bam-7423	32	29	runner	runner	NOUN
bam-7423	32	30	software	software	NOUN
bam-7423	32	31	.	.	PUNCT
bam-7423	33	1	the	the	DET
bam-7423	33	2	designed	design	VERB
bam-7423	33	3	primer	primer	NOUN
bam-7423	33	4	had	have	VERB
bam-7423	33	5	a	a	DET
bam-7423	33	6	100	100	NUM
bam-7423	33	7	%	%	NOUN
bam-7423	33	8	match	match	NOUN
bam-7423	33	9	with	with	ADP
bam-7423	33	10	sequences	sequence	NOUN
bam-7423	33	11	and	and	CCONJ
bam-7423	33	12	it	it	PRON
bam-7423	33	13	was	be	AUX
bam-7423	33	14	used	use	VERB
bam-7423	33	15	in	in	ADP
bam-7423	33	16	iran	iran	PROPN
bam-7423	33	17	for	for	ADP
bam-7423	33	18	the	the	DET
bam-7423	33	19	first	first	ADJ
bam-7423	33	20	time	time	NOUN
bam-7423	33	21	(	(	PUNCT
bam-7423	33	22	table	table	NOUN
bam-7423	33	23	1	1	NUM
bam-7423	33	24	)	)	PUNCT
bam-7423	33	25	.	.	PUNCT
bam-7423	34	1	the	the	DET
bam-7423	34	2	mixture	mixture	NOUN
bam-7423	34	3	of	of	ADP
bam-7423	34	4	realtime	realtime	ADJ
bam-7423	34	5	pcr	pcr	NOUN
bam-7423	34	6	contained	contain	VERB
bam-7423	34	7	10μl	10μl	ADV
bam-7423	34	8	of	of	ADP
bam-7423	34	9	master	master	NOUN
bam-7423	34	10	mix	mix	NOUN
bam-7423	34	11	obtained	obtain	VERB
bam-7423	34	12	from	from	ADP
bam-7423	34	13	sinagen	sinagen	PROPN
bam-7423	34	14	co.	co.	PROPN
bam-7423	34	15	(	(	PUNCT
bam-7423	34	16	iran	iran	PROPN
bam-7423	34	17	)	)	PUNCT
bam-7423	34	18	,	,	PUNCT
bam-7423	34	19	0.5μl	0.5μl	PROPN
bam-7423	34	20	forward	forward	NOUN
bam-7423	34	21	primer	primer	NOUN
bam-7423	34	22	(	(	PUNCT
bam-7423	34	23	0.4	0.4	NUM
bam-7423	34	24	mm	mm	NOUN
bam-7423	34	25	)	)	PUNCT
bam-7423	34	26	,	,	PUNCT
bam-7423	34	27	0.5μl	0.5μl	NUM
bam-7423	34	28	of	of	ADP
bam-7423	34	29	reverse	reverse	ADJ
bam-7423	34	30	primer	primer	NOUN
bam-7423	34	31	(	(	PUNCT
bam-7423	34	32	0.4	0.4	NUM
bam-7423	34	33	mm	mm	NOUN
bam-7423	34	34	)	)	PUNCT
bam-7423	34	35	,	,	PUNCT
bam-7423	34	36	1μl	1μl	NOUN
bam-7423	34	37	of	of	ADP
bam-7423	34	38	cdna	cdna	PROPN
bam-7423	34	39	sample	sample	NOUN
bam-7423	34	40	,	,	PUNCT
bam-7423	34	41	and	and	CCONJ
bam-7423	34	42	8μl	8μl	NOUN
bam-7423	34	43	of	of	ADP
bam-7423	34	44	distilled	distil	VERB
bam-7423	34	45	water	water	NOUN
bam-7423	34	46	with	with	ADP
bam-7423	34	47	a	a	DET
bam-7423	34	48	total	total	ADJ
bam-7423	34	49	volume	volume	NOUN
bam-7423	34	50	of	of	ADP
bam-7423	34	51	20μl	20μl	ADV
bam-7423	34	52	.	.	PUNCT
bam-7423	35	1	the	the	DET
bam-7423	35	2	following	follow	VERB
bam-7423	35	3	thermal	thermal	ADJ
bam-7423	35	4	plan	plan	NOUN
bam-7423	35	5	was	be	AUX
bam-7423	35	6	designed	design	VERB
bam-7423	35	7	for	for	ADP
bam-7423	35	8	pcr	pcr	ADJ
bam-7423	35	9	reaction	reaction	NOUN
bam-7423	35	10	using	use	VERB
bam-7423	35	11	reprimo	reprimo	NOUN
bam-7423	35	12	primer	primer	NOUN
bam-7423	35	13	:	:	PUNCT
bam-7423	35	14	10	10	NUM
bam-7423	35	15	minutes	minute	NOUN
bam-7423	35	16	of	of	ADP
bam-7423	35	17	initial	initial	ADJ
bam-7423	35	18	denaturation	denaturation	NOUN
bam-7423	35	19	in	in	ADP
bam-7423	35	20	a	a	DET
bam-7423	35	21	temperature	temperature	NOUN
bam-7423	35	22	of	of	ADP
bam-7423	35	23	95	95	NUM
bam-7423	35	24	℃	℃	PROPN
bam-7423	35	25	for	for	ADP
bam-7423	35	26	1	1	NUM
bam-7423	35	27	cycle	cycle	NOUN
bam-7423	35	28	,	,	PUNCT
bam-7423	35	29	40	40	NUM
bam-7423	35	30	cycles	cycle	NOUN
bam-7423	35	31	of	of	ADP
bam-7423	35	32	exposure	exposure	NOUN
bam-7423	35	33	to	to	ADP
bam-7423	35	34	a	a	DET
bam-7423	35	35	temperature	temperature	NOUN
bam-7423	35	36	of	of	ADP
bam-7423	35	37	95	95	NUM
bam-7423	35	38	℃	℃	PROPN
bam-7423	35	39	each	each	PRON
bam-7423	35	40	lasting	last	VERB
bam-7423	35	41	15	15	NUM
bam-7423	35	42	seconds	second	NOUN
bam-7423	35	43	,	,	PUNCT
bam-7423	35	44	and	and	CCONJ
bam-7423	35	45	1	1	NUM
bam-7423	35	46	minute	minute	NOUN
bam-7423	35	47	of	of	ADP
bam-7423	35	48	exposure	exposure	NOUN
bam-7423	35	49	to	to	ADP
bam-7423	35	50	64.6	64.6	NUM
bam-7423	35	51	℃	℃	PROPN
bam-7423	35	52	of	of	ADP
bam-7423	35	53	annealing	anneal	VERB
bam-7423	35	54	.	.	PUNCT
bam-7423	36	1	the	the	DET
bam-7423	36	2	following	follow	VERB
bam-7423	36	3	thermal	thermal	ADJ
bam-7423	36	4	plan	plan	NOUN
bam-7423	36	5	was	be	AUX
bam-7423	36	6	defined	define	VERB
bam-7423	36	7	for	for	ADP
bam-7423	36	8	pcr	pcr	ADJ
bam-7423	36	9	reaction	reaction	NOUN
bam-7423	36	10	using	use	VERB
bam-7423	36	11	gapdh	gapdh	NOUN
bam-7423	36	12	primers	primer	NOUN
bam-7423	36	13	as	as	ADP
bam-7423	36	14	internal	internal	ADJ
bam-7423	36	15	controls	control	NOUN
bam-7423	36	16	:	:	PUNCT
bam-7423	36	17	10	10	NUM
bam-7423	36	18	minutes	minute	NOUN
bam-7423	36	19	of	of	ADP
bam-7423	36	20	initial	initial	ADJ
bam-7423	36	21	denaturation	denaturation	NOUN
bam-7423	36	22	in	in	ADP
bam-7423	36	23	a	a	DET
bam-7423	36	24	temperature	temperature	NOUN
bam-7423	36	25	of	of	ADP
bam-7423	36	26	95	95	NUM
bam-7423	36	27	℃	℃	PROPN
bam-7423	36	28	for	for	ADP
bam-7423	36	29	1	1	NUM
bam-7423	36	30	cycle	cycle	NOUN
bam-7423	36	31	,	,	PUNCT
bam-7423	36	32	45	45	NUM
bam-7423	36	33	cycles	cycle	NOUN
bam-7423	36	34	of	of	ADP
bam-7423	36	35	exposure	exposure	NOUN
bam-7423	36	36	to	to	ADP
bam-7423	36	37	a	a	DET
bam-7423	36	38	temperature	temperature	NOUN
bam-7423	36	39	of	of	ADP
bam-7423	36	40	95	95	NUM
bam-7423	36	41	℃	℃	PROPN
bam-7423	36	42	for	for	ADP
bam-7423	36	43	15	15	NUM
bam-7423	36	44	seconds	second	NOUN
bam-7423	36	45	,	,	PUNCT
bam-7423	36	46	30	30	NUM
bam-7423	36	47	seconds	second	NOUN
bam-7423	36	48	of	of	ADP
bam-7423	36	49	exposure	exposure	NOUN
bam-7423	36	50	to	to	ADP
bam-7423	36	51	an	an	DET
bam-7423	36	52	annealing	anneal	VERB
bam-7423	36	53	temperature	temperature	NOUN
bam-7423	36	54	of	of	ADP
bam-7423	36	55	59	59	NUM
bam-7423	36	56	℃	℃	PROPN
bam-7423	36	57	.	.	PUNCT
bam-7423	37	1	in	in	ADP
bam-7423	37	2	the	the	DET
bam-7423	37	3	end	end	NOUN
bam-7423	37	4	,	,	PUNCT
bam-7423	37	5	the	the	DET
bam-7423	37	6	analysis	analysis	NOUN
bam-7423	37	7	of	of	ADP
bam-7423	37	8	data	datum	NOUN
bam-7423	37	9	obtained	obtain	VERB
bam-7423	37	10	through	through	ADP
bam-7423	37	11	real	real	ADJ
bam-7423	37	12	-	-	PUNCT
bam-7423	37	13	time	time	NOUN
bam-7423	37	14	pcr	pcr	NOUN
bam-7423	37	15	was	be	AUX
bam-7423	37	16	carried	carry	VERB
bam-7423	37	17	out	out	ADP
bam-7423	37	18	based	base	VERB
bam-7423	37	19	upon	upon	SCONJ
bam-7423	37	20	the	the	DET
bam-7423	37	21	threshold	threshold	NOUN
bam-7423	37	22	cycle	cycle	NOUN
bam-7423	37	23	obtained	obtain	VERB
bam-7423	37	24	for	for	ADP
bam-7423	37	25	target	target	NOUN
bam-7423	37	26	and	and	CCONJ
bam-7423	37	27	reference	reference	NOUN
bam-7423	37	28	genes	gene	NOUN
bam-7423	37	29	.	.	PUNCT
bam-7423	38	1	the	the	DET
bam-7423	38	2	difference	difference	NOUN
bam-7423	38	3	between	between	ADP
bam-7423	38	4	the	the	DET
bam-7423	38	5	average	average	NOUN
bam-7423	38	6	of	of	ADP
bam-7423	38	7	reference	reference	NOUN
bam-7423	38	8	ct	ct	NUM
bam-7423	38	9	gene	gene	NOUN
bam-7423	38	10	and	and	CCONJ
bam-7423	38	11	target	target	NOUN
bam-7423	38	12	ct	ct	NUM
bam-7423	38	13	gene	gene	NOUN
bam-7423	38	14	was	be	AUX
bam-7423	38	15	calculated	calculate	VERB
bam-7423	38	16	as	as	ADP
bam-7423	38	17	an	an	DET
bam-7423	38	18	indicator	indicator	NOUN
bam-7423	38	19	of	of	ADP
bam-7423	38	20	∆ct	∆ct	NOUN
bam-7423	38	21	for	for	ADP
bam-7423	38	22	both	both	DET
bam-7423	38	23	test	test	NOUN
bam-7423	38	24	and	and	CCONJ
bam-7423	38	25	control	control	NOUN
bam-7423	38	26	groups	group	NOUN
bam-7423	38	27	.	.	PUNCT
bam-7423	39	1	to	to	PART
bam-7423	39	2	study	study	VERB
bam-7423	39	3	the	the	DET
bam-7423	39	4	specificity	specificity	NOUN
bam-7423	39	5	of	of	ADP
bam-7423	39	6	primers	primer	NOUN
bam-7423	39	7	and	and	CCONJ
bam-7423	39	8	cyber	cyber	ADJ
bam-7423	39	9	green	green	ADJ
bam-7423	39	10	fluorescence	fluorescence	NOUN
bam-7423	39	11	color	color	NOUN
bam-7423	39	12	and	and	CCONJ
bam-7423	39	13	assuring	assure	VERB
bam-7423	39	14	the	the	DET
bam-7423	39	15	proliferation	proliferation	NOUN
bam-7423	39	16	of	of	ADP
bam-7423	39	17	exclusive	exclusive	ADJ
bam-7423	39	18	parts	part	NOUN
bam-7423	39	19	and	and	CCONJ
bam-7423	39	20	making	make	VERB
bam-7423	39	21	sure	sure	ADJ
bam-7423	39	22	there	there	PRON
bam-7423	39	23	are	be	VERB
bam-7423	39	24	no	no	DET
bam-7423	39	25	non	non	ADJ
bam-7423	39	26	-	-	ADJ
bam-7423	39	27	specific	specific	ADJ
bam-7423	39	28	particles	particle	NOUN
bam-7423	39	29	and	and	CCONJ
bam-7423	39	30	dimer	dimer	NOUN
bam-7423	39	31	-	-	PUNCT
bam-7423	39	32	primer	primer	NOUN
bam-7423	39	33	in	in	ADP
bam-7423	39	34	pcr	pcr	ADJ
bam-7423	39	35	product	product	NOUN
bam-7423	39	36	,	,	PUNCT
bam-7423	39	37	the	the	DET
bam-7423	39	38	melting	melting	NOUN
bam-7423	39	39	curve	curve	NOUN
bam-7423	39	40	was	be	AUX
bam-7423	39	41	drawn	draw	VERB
bam-7423	39	42	for	for	ADP
bam-7423	39	43	reprimo	reprimo	VERB
bam-7423	39	44	and	and	CCONJ
bam-7423	39	45	gapdh	gapdh	NOUN
bam-7423	39	46	genes	gene	NOUN
bam-7423	39	47	separately	separately	ADV
bam-7423	39	48	using	use	VERB
bam-7423	39	49	step	step	NOUN
bam-7423	39	50	one	one	NUM
bam-7423	39	51	real	real	ADJ
bam-7423	39	52	-	-	PUNCT
bam-7423	39	53	time	time	NOUN
bam-7423	39	54	pcr	pcr	NOUN
bam-7423	39	55	applied	apply	VERB
bam-7423	39	56	biosystems	biosystem	NOUN
bam-7423	39	57	(	(	PUNCT
bam-7423	39	58	figures	figure	NOUN
bam-7423	39	59	1	1	NUM
bam-7423	39	60	and	and	CCONJ
bam-7423	39	61	2	2	NUM
bam-7423	39	62	)	)	PUNCT
bam-7423	39	63	.	.	PUNCT
bam-7423	40	1	the	the	DET
bam-7423	40	2	linear	linear	ADJ
bam-7423	40	3	charts	chart	NOUN
bam-7423	40	4	of	of	ADP
bam-7423	40	5	reprimo	reprimo	VERB
bam-7423	40	6	and	and	CCONJ
bam-7423	40	7	gapdh	gapdh	NOUN
bam-7423	40	8	genes	gene	NOUN
bam-7423	40	9	proliferation	proliferation	NOUN
bam-7423	40	10	curve	curve	NOUN
bam-7423	40	11	were	be	AUX
bam-7423	40	12	drawn	draw	VERB
bam-7423	40	13	by	by	ADP
bam-7423	40	14	assessing	assess	VERB
bam-7423	40	15	the	the	DET
bam-7423	40	16	changes	change	NOUN
bam-7423	40	17	in	in	ADP
bam-7423	40	18	the	the	DET
bam-7423	40	19	fluorescence	fluorescence	NOUN
bam-7423	40	20	level	level	NOUN
bam-7423	40	21	using	use	VERB
bam-7423	40	22	step	step	NOUN
bam-7423	40	23	one	one	NUM
bam-7423	40	24	real	real	ADJ
bam-7423	40	25	-	-	PUNCT
bam-7423	40	26	time	time	NOUN
bam-7423	40	27	pcr	pcr	NOUN
bam-7423	40	28	applied	apply	VERB
bam-7423	40	29	biosystems	biosystem	NOUN
bam-7423	40	30	(	(	PUNCT
bam-7423	40	31	figures	figure	NOUN
bam-7423	40	32	3	3	NUM
bam-7423	40	33	and	and	CCONJ
bam-7423	40	34	4	4	NUM
bam-7423	40	35	)	)	PUNCT
bam-7423	40	36	.	.	PUNCT
bam-7423	41	1	fig	fig	NOUN
bam-7423	41	2	3	3	NUM
bam-7423	41	3	.	.	PUNCT
bam-7423	42	1	linear	linear	ADJ
bam-7423	42	2	curve	curve	NOUN
bam-7423	42	3	of	of	ADP
bam-7423	42	4	reprimo	reprimo	VERB
bam-7423	42	5	gene	gene	NOUN
bam-7423	42	6	proliferation	proliferation	NOUN
bam-7423	42	7	in	in	ADP
bam-7423	42	8	normal	normal	ADJ
bam-7423	42	9	samples	sample	NOUN
bam-7423	42	10	and	and	CCONJ
bam-7423	42	11	gastric	gastric	ADJ
bam-7423	42	12	patients	patient	NOUN
bam-7423	42	13	fig	fig	VERB
bam-7423	42	14	4	4	NUM
bam-7423	42	15	.	.	PUNCT
bam-7423	43	1	the	the	DET
bam-7423	43	2	linear	linear	ADJ
bam-7423	43	3	curve	curve	NOUN
bam-7423	43	4	of	of	ADP
bam-7423	43	5	gapdh	gapdh	NOUN
bam-7423	43	6	gene	gene	NOUN
bam-7423	43	7	proliferation	proliferation	NOUN
bam-7423	43	8	in	in	ADP
bam-7423	43	9	healthy	healthy	ADJ
bam-7423	43	10	and	and	CCONJ
bam-7423	43	11	gastric	gastric	ADJ
bam-7423	43	12	patients	patient	NOUN
bam-7423	43	13	non	non	X
bam-7423	43	14	co	co	VERB
bam-7423	43	15	mmerc	mmerc	PROPN
bam-7423	43	16	ial	ial	PROPN
bam-7423	43	17	us	us	PROPN
bam-7423	43	18	e	e	NOUN
bam-7423	43	19	o	o	NOUN
bam-7423	43	20	nly	nly	ADV
bam-7423	43	21	reprimo	reprimo	VERB
bam-7423	43	22	gene	gene	NOUN
bam-7423	43	23	in	in	ADP
bam-7423	43	24	gastric	gastric	ADJ
bam-7423	43	25	cancer	cancer	NOUN
bam-7423	43	26	eur	eur	PROPN
bam-7423	43	27	j	j	PROPN
bam-7423	43	28	transl	transl	PROPN
bam-7423	43	29	myol	myol	ADV
bam-7423	43	30	28	28	NUM
bam-7423	43	31	(	(	PUNCT
bam-7423	43	32	2	2	NUM
bam-7423	43	33	):	):	PUNCT
bam-7423	43	34	226	226	NUM
bam-7423	43	35	-	-	SYM
bam-7423	43	36	232	232	NUM
bam-7423	43	37	,	,	PUNCT
bam-7423	43	38	2018	2018	NUM
bam-7423	43	39	4	4	NUM
bam-7423	43	40	dna	dna	NOUN
bam-7423	43	41	modification	modification	NOUN
bam-7423	43	42	purification	purification	NOUN
bam-7423	43	43	of	of	ADP
bam-7423	43	44	genome	genome	NOUN
bam-7423	43	45	dna	dna	NOUN
bam-7423	43	46	from	from	ADP
bam-7423	43	47	blood	blood	NOUN
bam-7423	43	48	was	be	AUX
bam-7423	43	49	carried	carry	VERB
bam-7423	43	50	out	out	ADP
bam-7423	43	51	using	use	VERB
bam-7423	43	52	dna	dna	PROPN
bam-7423	43	53	purification	purification	NOUN
bam-7423	43	54	gene	gene	NOUN
bam-7423	43	55	obtained	obtain	VERB
bam-7423	43	56	from	from	ADP
bam-7423	43	57	kiagen	kiagen	PROPN
bam-7423	43	58	co.	co.	PROPN
bam-7423	43	59	(	(	PUNCT
bam-7423	43	60	cat	cat	NOUN
bam-7423	43	61	.	.	PUNCT
bam-7423	44	1	no./id	no./id	NUM
bam-7423	44	2	:	:	PUNCT
bam-7423	44	3	69504	69504	NUM
bam-7423	44	4	)	)	PUNCT
bam-7423	44	5	based	base	VERB
bam-7423	44	6	upon	upon	SCONJ
bam-7423	44	7	the	the	DET
bam-7423	44	8	standard	standard	ADJ
bam-7423	44	9	protocol	protocol	NOUN
bam-7423	44	10	specified	specify	VERB
bam-7423	44	11	in	in	ADP
bam-7423	44	12	the	the	DET
bam-7423	44	13	kit	kit	NOUN
bam-7423	44	14	.	.	PUNCT
bam-7423	45	1	epijet	epijet	ADJ
bam-7423	45	2	bisulfite	bisulfite	NOUN
bam-7423	45	3	conversion	conversion	NOUN
bam-7423	45	4	kit	kit	NOUN
bam-7423	45	5	produced	produce	VERB
bam-7423	45	6	by	by	ADP
bam-7423	45	7	thermo	thermo	PROPN
bam-7423	45	8	scientific	scientific	PROPN
bam-7423	45	9	co.	co.	PROPN
bam-7423	45	10	(	(	PUNCT
bam-7423	45	11	usa	usa	PROPN
bam-7423	45	12	)	)	PUNCT
bam-7423	45	13	was	be	AUX
bam-7423	45	14	used	use	VERB
bam-7423	45	15	for	for	ADP
bam-7423	45	16	dna	dna	PROPN
bam-7423	45	17	methylation	methylation	NOUN
bam-7423	45	18	in	in	ADP
bam-7423	45	19	accordance	accordance	NOUN
bam-7423	45	20	with	with	ADP
bam-7423	45	21	the	the	DET
bam-7423	45	22	protocol	protocol	NOUN
bam-7423	45	23	specified	specify	VERB
bam-7423	45	24	in	in	ADP
bam-7423	45	25	the	the	DET
bam-7423	45	26	kit	kit	NOUN
bam-7423	45	27	.	.	PUNCT
bam-7423	46	1	ms	ms	ADJ
bam-7423	46	2	-	-	PUNCT
bam-7423	46	3	pcr	pcr	NOUN
bam-7423	46	4	to	to	PART
bam-7423	46	5	diagnose	diagnose	VERB
bam-7423	46	6	the	the	DET
bam-7423	46	7	methylated	methylate	VERB
bam-7423	46	8	and	and	CCONJ
bam-7423	46	9	non	non	ADJ
bam-7423	46	10	-	-	ADJ
bam-7423	46	11	methylated	methylate	VERB
bam-7423	46	12	areas	area	NOUN
bam-7423	46	13	in	in	ADP
bam-7423	46	14	designing	design	VERB
bam-7423	46	15	the	the	DET
bam-7423	46	16	primers	primer	NOUN
bam-7423	46	17	for	for	ADP
bam-7423	46	18	carrying	carry	VERB
bam-7423	46	19	out	out	ADP
bam-7423	46	20	ms	ms	PROPN
bam-7423	46	21	-	-	PUNCT
bam-7423	46	22	pcr	pcr	ADJ
bam-7423	46	23	(	(	PUNCT
bam-7423	46	24	methylation	methylation	NOUN
bam-7423	46	25	specific	specific	ADJ
bam-7423	46	26	pcr	pcr	NOUN
bam-7423	46	27	)	)	PUNCT
bam-7423	46	28	,	,	PUNCT
bam-7423	46	29	those	those	DET
bam-7423	46	30	primers	primer	NOUN
bam-7423	46	31	designed	design	VERB
bam-7423	46	32	for	for	ADP
bam-7423	46	33	the	the	DET
bam-7423	46	34	regions	region	NOUN
bam-7423	46	35	containing	contain	VERB
bam-7423	46	36	methylated	methylate	VERB
bam-7423	46	37	cytosines	cytosine	NOUN
bam-7423	46	38	begin	begin	VERB
bam-7423	46	39	with	with	ADP
bam-7423	46	40	letter	letter	NOUN
bam-7423	46	41	g	g	PROPN
bam-7423	46	42	,	,	PUNCT
bam-7423	46	43	while	while	SCONJ
bam-7423	46	44	those	those	PRON
bam-7423	46	45	designed	design	VERB
bam-7423	46	46	for	for	ADP
bam-7423	46	47	areas	area	NOUN
bam-7423	46	48	containing	contain	VERB
bam-7423	46	49	nonmethylated	nonmethylate	VERB
bam-7423	46	50	cytosines	cytosine	NOUN
bam-7423	46	51	begin	begin	VERB
bam-7423	46	52	with	with	ADP
bam-7423	46	53	letter	letter	NOUN
bam-7423	46	54	t.	t.	NOUN
bam-7423	46	55	two	two	NUM
bam-7423	46	56	pairs	pair	NOUN
bam-7423	46	57	of	of	ADP
bam-7423	46	58	primers	primer	NOUN
bam-7423	46	59	were	be	AUX
bam-7423	46	60	designed	design	VERB
bam-7423	46	61	for	for	ADP
bam-7423	46	62	this	this	DET
bam-7423	46	63	purpose	purpose	NOUN
bam-7423	46	64	:	:	PUNCT
bam-7423	46	65	1	1	NUM
bam-7423	46	66	pair	pair	NOUN
bam-7423	46	67	of	of	ADP
bam-7423	46	68	methylated	methylate	VERB
bam-7423	46	69	primer	primer	NOUN
bam-7423	46	70	and	and	CCONJ
bam-7423	46	71	1	1	NUM
bam-7423	46	72	pair	pair	NOUN
bam-7423	46	73	of	of	ADP
bam-7423	46	74	non	non	ADJ
bam-7423	46	75	-	-	ADJ
bam-7423	46	76	methylated	methylate	VERB
bam-7423	46	77	primer	primer	NOUN
bam-7423	46	78	(	(	PUNCT
bam-7423	46	79	table	table	NOUN
bam-7423	46	80	2	2	NUM
bam-7423	46	81	)	)	PUNCT
bam-7423	46	82	.	.	PUNCT
bam-7423	47	1	the	the	DET
bam-7423	47	2	complex	complex	NOUN
bam-7423	47	3	used	use	VERB
bam-7423	47	4	in	in	ADP
bam-7423	47	5	the	the	DET
bam-7423	47	6	reaction	reaction	NOUN
bam-7423	47	7	contained	contain	VERB
bam-7423	47	8	12.5μl	12.5μl	NUM
bam-7423	47	9	of	of	ADP
bam-7423	47	10	master	master	NOUN
bam-7423	47	11	mix	mix	NOUN
bam-7423	47	12	produced	produce	VERB
bam-7423	47	13	by	by	ADP
bam-7423	47	14	cleaver	cleaver	NOUN
bam-7423	47	15	scientific	scientific	NOUN
bam-7423	47	16	in	in	ADP
bam-7423	47	17	england	england	PROPN
bam-7423	47	18	(	(	PUNCT
bam-7423	47	19	cat	cat	NOUN
bam-7423	47	20	.	.	PUNCT
bam-7423	48	1	no	no	INTJ
bam-7423	48	2	.	.	PUNCT
bam-7423	49	1	csl	csl	PROPN
bam-7423	49	2	-	-	PUNCT
bam-7423	49	3	janda	janda	PROPN
bam-7423	49	4	)	)	PUNCT
bam-7423	49	5	,	,	PUNCT
bam-7423	49	6	1μl	1μl	NOUN
bam-7423	49	7	of	of	ADP
bam-7423	49	8	forward	forward	ADJ
bam-7423	49	9	primer	primer	NOUN
bam-7423	49	10	,	,	PUNCT
bam-7423	49	11	1μl	1μl	NOUN
bam-7423	49	12	of	of	ADP
bam-7423	49	13	reverse	reverse	ADJ
bam-7423	49	14	primer	primer	NOUN
bam-7423	49	15	,	,	PUNCT
bam-7423	49	16	2μl	2μl	NOUN
bam-7423	49	17	of	of	ADP
bam-7423	49	18	dna	dna	PROPN
bam-7423	49	19	sample	sample	NOUN
bam-7423	49	20	,	,	PUNCT
bam-7423	49	21	and	and	CCONJ
bam-7423	49	22	8.5μl	8.5μl	NUM
bam-7423	49	23	of	of	ADP
bam-7423	49	24	distilled	distil	VERB
bam-7423	49	25	water	water	NOUN
bam-7423	49	26	in	in	ADP
bam-7423	49	27	a	a	DET
bam-7423	49	28	total	total	ADJ
bam-7423	49	29	volume	volume	NOUN
bam-7423	49	30	of	of	ADP
bam-7423	49	31	25μl	25μl	NOUN
bam-7423	49	32	.	.	PUNCT
bam-7423	50	1	the	the	DET
bam-7423	50	2	following	follow	VERB
bam-7423	50	3	thermal	thermal	ADJ
bam-7423	50	4	plan	plan	NOUN
bam-7423	50	5	was	be	AUX
bam-7423	50	6	defined	define	VERB
bam-7423	50	7	for	for	ADP
bam-7423	50	8	ms	ms	NOUN
bam-7423	50	9	-	-	PUNCT
bam-7423	50	10	pcr	pcr	NOUN
bam-7423	50	11	in	in	ADP
bam-7423	50	12	order	order	NOUN
bam-7423	50	13	to	to	PART
bam-7423	50	14	diagnose	diagnose	VERB
bam-7423	50	15	the	the	DET
bam-7423	50	16	methylated	methylate	VERB
bam-7423	50	17	and	and	CCONJ
bam-7423	50	18	non	non	ADJ
bam-7423	50	19	-	-	ADJ
bam-7423	50	20	methylated	methylate	VERB
bam-7423	50	21	regions	region	NOUN
bam-7423	50	22	:	:	PUNCT
bam-7423	50	23	3	3	NUM
bam-7423	50	24	minutes	minute	NOUN
bam-7423	50	25	of	of	ADP
bam-7423	50	26	initial	initial	ADJ
bam-7423	50	27	denaturation	denaturation	NOUN
bam-7423	50	28	in	in	ADP
bam-7423	50	29	a	a	DET
bam-7423	50	30	temperature	temperature	NOUN
bam-7423	50	31	of	of	ADP
bam-7423	50	32	93	93	NUM
bam-7423	50	33	℃	℃	PROPN
bam-7423	50	34	,	,	PUNCT
bam-7423	50	35	30	30	NUM
bam-7423	50	36	cycles	cycle	NOUN
bam-7423	50	37	of	of	ADP
bam-7423	50	38	exposure	exposure	NOUN
bam-7423	50	39	to	to	ADP
bam-7423	50	40	a	a	DET
bam-7423	50	41	temperature	temperature	NOUN
bam-7423	50	42	of	of	ADP
bam-7423	50	43	93	93	NUM
bam-7423	50	44	℃	℃	PROPN
bam-7423	50	45	for	for	ADP
bam-7423	50	46	30	30	NUM
bam-7423	50	47	seconds	second	NOUN
bam-7423	50	48	,	,	PUNCT
bam-7423	50	49	and	and	CCONJ
bam-7423	50	50	exposure	exposure	NOUN
bam-7423	50	51	to	to	ADP
bam-7423	50	52	an	an	DET
bam-7423	50	53	annealing	anneal	VERB
bam-7423	50	54	temperature	temperature	NOUN
bam-7423	50	55	of	of	ADP
bam-7423	50	56	54.4	54.4	NUM
bam-7423	50	57	℃	℃	PROPN
bam-7423	50	58	for	for	ADP
bam-7423	50	59	primers	primer	NOUN
bam-7423	50	60	designed	design	VERB
bam-7423	50	61	for	for	ADP
bam-7423	50	62	non	non	ADJ
bam-7423	50	63	-	-	ADJ
bam-7423	50	64	methylated	methylate	VERB
bam-7423	50	65	regions	region	NOUN
bam-7423	50	66	and	and	CCONJ
bam-7423	50	67	64.6	64.6	NUM
bam-7423	50	68	℃	℃	PROPN
bam-7423	50	69	for	for	ADP
bam-7423	50	70	primers	primer	NOUN
bam-7423	50	71	designed	design	VERB
bam-7423	50	72	for	for	ADP
bam-7423	50	73	methylated	methylate	VERB
bam-7423	50	74	regions	region	NOUN
bam-7423	50	75	for	for	ADP
bam-7423	50	76	30	30	NUM
bam-7423	50	77	seconds	second	NOUN
bam-7423	50	78	,	,	PUNCT
bam-7423	50	79	30	30	NUM
bam-7423	50	80	seconds	second	NOUN
bam-7423	50	81	of	of	ADP
bam-7423	50	82	exposure	exposure	NOUN
bam-7423	50	83	to	to	ADP
bam-7423	50	84	a	a	DET
bam-7423	50	85	temperature	temperature	NOUN
bam-7423	50	86	fig	fig	NOUN
bam-7423	50	87	5	5	NUM
bam-7423	50	88	.	.	PUNCT
bam-7423	51	1	analysis	analysis	NOUN
bam-7423	51	2	of	of	ADP
bam-7423	51	3	reprimo	reprimo	ADJ
bam-7423	51	4	gene	gene	NOUN
bam-7423	51	5	expression	expression	NOUN
bam-7423	51	6	in	in	ADP
bam-7423	51	7	gastric	gastric	ADJ
bam-7423	51	8	patients	patient	NOUN
bam-7423	51	9	compared	compare	VERB
bam-7423	51	10	to	to	ADP
bam-7423	51	11	normal	normal	ADJ
bam-7423	51	12	samples	sample	NOUN
bam-7423	51	13	(	(	PUNCT
bam-7423	51	14	p	p	NOUN
bam-7423	51	15	-	-	PUNCT
bam-7423	51	16	value	value	NOUN
bam-7423	51	17	≤	≤	NOUN
bam-7423	51	18	0.0001	0.0001	NUM
bam-7423	51	19	)	)	PUNCT
bam-7423	51	20	.	.	PUNCT
bam-7423	52	1	1	1	NUM
bam-7423	52	2	-	-	SYM
bam-7423	52	3	35	35	NUM
bam-7423	52	4	groups	group	NOUN
bam-7423	52	5	:	:	PUNCT
bam-7423	52	6	average	average	ADJ
bam-7423	52	7	rate	rate	NOUN
bam-7423	52	8	of	of	ADP
bam-7423	52	9	reprimo	reprimo	ADJ
bam-7423	52	10	gene	gene	NOUN
bam-7423	52	11	expression	expression	NOUN
bam-7423	52	12	in	in	ADP
bam-7423	52	13	gastric	gastric	ADJ
bam-7423	52	14	cancer	cancer	NOUN
bam-7423	52	15	patients	patient	NOUN
bam-7423	52	16	.	.	PUNCT
bam-7423	53	1	normal	normal	ADJ
bam-7423	53	2	group	group	NOUN
bam-7423	53	3	:	:	PUNCT
bam-7423	53	4	average	average	ADJ
bam-7423	53	5	rate	rate	NOUN
bam-7423	53	6	of	of	ADP
bam-7423	53	7	reprimo	reprimo	ADJ
bam-7423	53	8	gene	gene	NOUN
bam-7423	53	9	expression	expression	NOUN
bam-7423	53	10	in	in	ADP
bam-7423	53	11	normal	normal	ADJ
bam-7423	53	12	samples	sample	NOUN
bam-7423	53	13	.	.	PUNCT
bam-7423	54	1	fig	fig	NOUN
bam-7423	54	2	6	6	NUM
bam-7423	54	3	.	.	PUNCT
bam-7423	55	1	analysis	analysis	NOUN
bam-7423	55	2	of	of	ADP
bam-7423	55	3	reprimo	reprimo	ADJ
bam-7423	55	4	gene	gene	NOUN
bam-7423	55	5	expression	expression	NOUN
bam-7423	55	6	rate	rate	NOUN
bam-7423	55	7	in	in	ADP
bam-7423	55	8	gastric	gastric	ADJ
bam-7423	55	9	patients	patient	NOUN
bam-7423	55	10	compared	compare	VERB
bam-7423	55	11	against	against	ADP
bam-7423	55	12	normal	normal	ADJ
bam-7423	55	13	cases	case	NOUN
bam-7423	55	14	(	(	PUNCT
bam-7423	55	15	p	p	NOUN
bam-7423	55	16	≤	≤	ADJ
bam-7423	55	17	0.04	0.04	NUM
bam-7423	55	18	)	)	PUNCT
bam-7423	55	19	fig	fig	NOUN
bam-7423	55	20	7	7	NUM
bam-7423	55	21	.	.	PUNCT
bam-7423	55	22	analysis	analysis	NOUN
bam-7423	55	23	of	of	ADP
bam-7423	55	24	expression	expression	NOUN
bam-7423	55	25	rate	rate	NOUN
bam-7423	55	26	of	of	ADP
bam-7423	55	27	reprimo	reprimo	ADJ
bam-7423	55	28	gene	gene	NOUN
bam-7423	55	29	among	among	ADP
bam-7423	55	30	cases	case	NOUN
bam-7423	55	31	older	old	ADJ
bam-7423	55	32	than	than	ADP
bam-7423	55	33	55	55	NUM
bam-7423	55	34	and	and	CCONJ
bam-7423	55	35	those	those	PRON
bam-7423	55	36	younger	young	ADJ
bam-7423	55	37	than	than	ADP
bam-7423	55	38	55	55	NUM
bam-7423	55	39	(	(	PUNCT
bam-7423	55	40	p	p	NOUN
bam-7423	55	41	≤0.0106	≤0.0106	NOUN
bam-7423	55	42	)	)	PUNCT
bam-7423	55	43	non	non	PROPN
bam-7423	55	44	co	co	X
bam-7423	55	45	mmerc	mmerc	PROPN
bam-7423	55	46	ial	ial	PROPN
bam-7423	55	47	us	us	PROPN
bam-7423	55	48	e	e	NOUN
bam-7423	55	49	o	o	NOUN
bam-7423	55	50	nly	nly	ADV
bam-7423	55	51	reprimo	reprimo	VERB
bam-7423	55	52	gene	gene	NOUN
bam-7423	55	53	in	in	ADP
bam-7423	55	54	gastric	gastric	ADJ
bam-7423	55	55	cancer	cancer	NOUN
bam-7423	55	56	eur	eur	PROPN
bam-7423	55	57	j	j	PROPN
bam-7423	55	58	transl	transl	PROPN
bam-7423	55	59	myol	myol	ADV
bam-7423	55	60	28	28	NUM
bam-7423	55	61	(	(	PUNCT
bam-7423	55	62	2	2	NUM
bam-7423	55	63	):	):	PUNCT
bam-7423	55	64	226	226	NUM
bam-7423	55	65	-	-	SYM
bam-7423	55	66	232	232	NUM
bam-7423	55	67	,	,	PUNCT
bam-7423	55	68	2018	2018	NUM
bam-7423	55	69	5	5	NUM
bam-7423	55	70	of	of	ADP
bam-7423	55	71	72	72	NUM
bam-7423	55	72	℃	℃	PROPN
bam-7423	55	73	for	for	ADP
bam-7423	55	74	elongation	elongation	NOUN
bam-7423	55	75	,	,	PUNCT
bam-7423	55	76	and	and	CCONJ
bam-7423	55	77	a	a	DET
bam-7423	55	78	1	1	NUM
bam-7423	55	79	final	final	ADJ
bam-7423	55	80	cycle	cycle	NOUN
bam-7423	55	81	of	of	ADP
bam-7423	55	82	exposure	exposure	NOUN
bam-7423	55	83	to	to	ADP
bam-7423	55	84	a	a	DET
bam-7423	55	85	temperature	temperature	NOUN
bam-7423	55	86	of	of	ADP
bam-7423	55	87	72	72	NUM
bam-7423	55	88	℃	℃	PROPN
bam-7423	55	89	for	for	ADP
bam-7423	55	90	5	5	NUM
bam-7423	55	91	minutes	minute	NOUN
bam-7423	55	92	.	.	PUNCT
bam-7423	56	1	finally	finally	ADV
bam-7423	56	2	,	,	PUNCT
bam-7423	56	3	1.5	1.5	NUM
bam-7423	56	4	%	%	NOUN
bam-7423	56	5	agarose	agarose	NOUN
bam-7423	56	6	gel	gel	NOUN
bam-7423	56	7	was	be	AUX
bam-7423	56	8	used	use	VERB
bam-7423	56	9	to	to	PART
bam-7423	56	10	study	study	VERB
bam-7423	56	11	the	the	DET
bam-7423	56	12	results	result	NOUN
bam-7423	56	13	of	of	ADP
bam-7423	56	14	ms	ms	ADJ
bam-7423	56	15	-	-	PUNCT
bam-7423	56	16	pcr	pcr	ADJ
bam-7423	56	17	reaction	reaction	NOUN
bam-7423	56	18	.	.	PUNCT
bam-7423	57	1	results	result	NOUN
bam-7423	57	2	and	and	CCONJ
bam-7423	57	3	discussion	discussion	VERB
bam-7423	57	4	the	the	DET
bam-7423	57	5	results	result	NOUN
bam-7423	57	6	of	of	ADP
bam-7423	57	7	the	the	DET
bam-7423	57	8	expression	expression	NOUN
bam-7423	57	9	rate	rate	NOUN
bam-7423	57	10	of	of	ADP
bam-7423	57	11	reprimo	reprimo	ADJ
bam-7423	57	12	gene	gene	NOUN
bam-7423	57	13	ct	ct	NUM
bam-7423	57	14	of	of	ADP
bam-7423	57	15	samples	sample	NOUN
bam-7423	57	16	was	be	AUX
bam-7423	57	17	calculated	calculate	VERB
bam-7423	57	18	by	by	ADP
bam-7423	57	19	the	the	DET
bam-7423	57	20	machine	machine	NOUN
bam-7423	57	21	following	follow	VERB
bam-7423	57	22	the	the	DET
bam-7423	57	23	proliferation	proliferation	NOUN
bam-7423	57	24	reaction	reaction	NOUN
bam-7423	57	25	and	and	CCONJ
bam-7423	57	26	it	it	PRON
bam-7423	57	27	was	be	AUX
bam-7423	57	28	converted	convert	VERB
bam-7423	57	29	to	to	AUX
bam-7423	57	30	rq	rq	VERB
bam-7423	57	31	(	(	PUNCT
bam-7423	57	32	quantification	quantification	NOUN
bam-7423	57	33	relative	relative	NOUN
bam-7423	57	34	)	)	PUNCT
bam-7423	57	35	of	of	ADP
bam-7423	57	36	expression	expression	NOUN
bam-7423	57	37	rate	rate	NOUN
bam-7423	57	38	.	.	PUNCT
bam-7423	58	1	graph	graph	NOUN
bam-7423	58	2	of	of	ADP
bam-7423	58	3	the	the	DET
bam-7423	58	4	results	result	NOUN
bam-7423	58	5	was	be	AUX
bam-7423	58	6	drawn	draw	VERB
bam-7423	58	7	by	by	ADP
bam-7423	58	8	graph	graph	NOUN
bam-7423	58	9	pad	pad	NOUN
bam-7423	58	10	prism	prism	NOUN
bam-7423	58	11	software	software	NOUN
bam-7423	58	12	(	(	PUNCT
bam-7423	58	13	fig	fig	NOUN
bam-7423	58	14	.	.	PUNCT
bam-7423	59	1	5	5	NUM
bam-7423	59	2	)	)	PUNCT
bam-7423	59	3	.	.	PUNCT
bam-7423	60	1	the	the	DET
bam-7423	60	2	majority	majority	NOUN
bam-7423	60	3	of	of	ADP
bam-7423	60	4	gastric	gastric	ADJ
bam-7423	60	5	patients	patient	NOUN
bam-7423	60	6	exhibited	exhibit	VERB
bam-7423	60	7	a	a	DET
bam-7423	60	8	reduced	reduce	VERB
bam-7423	60	9	reprimo	reprimo	ADJ
bam-7423	60	10	gene	gene	NOUN
bam-7423	60	11	expression	expression	NOUN
bam-7423	60	12	rate	rate	NOUN
bam-7423	60	13	compared	compare	VERB
bam-7423	60	14	to	to	ADP
bam-7423	60	15	normal	normal	ADJ
bam-7423	60	16	cases	case	NOUN
bam-7423	60	17	.	.	PUNCT
bam-7423	61	1	in	in	ADP
bam-7423	61	2	this	this	DET
bam-7423	61	3	case	case	NOUN
bam-7423	61	4	,	,	PUNCT
bam-7423	61	5	the	the	DET
bam-7423	61	6	average	average	NOUN
bam-7423	61	7	of	of	ADP
bam-7423	61	8	normal	normal	ADJ
bam-7423	61	9	samples	sample	NOUN
bam-7423	61	10	was	be	AUX
bam-7423	61	11	set	set	VERB
bam-7423	61	12	to	to	ADP
bam-7423	61	13	1	1	NUM
bam-7423	61	14	by	by	ADP
bam-7423	61	15	machine	machine	NOUN
bam-7423	61	16	analysis	analysis	NOUN
bam-7423	61	17	.	.	PUNCT
bam-7423	62	1	as	as	SCONJ
bam-7423	62	2	it	it	PRON
bam-7423	62	3	was	be	AUX
bam-7423	62	4	expected	expect	VERB
bam-7423	62	5	from	from	ADP
bam-7423	62	6	reprimo	reprimo	VERB
bam-7423	62	7	gene	gene	NOUN
bam-7423	62	8	as	as	ADP
bam-7423	62	9	a	a	DET
bam-7423	62	10	suppressive	suppressive	ADJ
bam-7423	62	11	tumor	tumor	NOUN
bam-7423	62	12	in	in	ADP
bam-7423	62	13	gastric	gastric	ADJ
bam-7423	62	14	cancer	cancer	NOUN
bam-7423	62	15	,	,	PUNCT
bam-7423	62	16	the	the	DET
bam-7423	62	17	expression	expression	NOUN
bam-7423	62	18	rate	rate	NOUN
bam-7423	62	19	of	of	ADP
bam-7423	62	20	this	this	DET
bam-7423	62	21	gene	gene	NOUN
bam-7423	62	22	in	in	ADP
bam-7423	62	23	normal	normal	ADJ
bam-7423	62	24	samples	sample	NOUN
bam-7423	62	25	was	be	AUX
bam-7423	62	26	much	much	ADV
bam-7423	62	27	more	more	ADJ
bam-7423	62	28	than	than	ADP
bam-7423	62	29	what	what	PRON
bam-7423	62	30	was	be	AUX
bam-7423	62	31	observed	observe	VERB
bam-7423	62	32	in	in	ADP
bam-7423	62	33	the	the	DET
bam-7423	62	34	majority	majority	NOUN
bam-7423	62	35	of	of	ADP
bam-7423	62	36	samples	sample	NOUN
bam-7423	62	37	suffering	suffer	VERB
bam-7423	62	38	with	with	ADP
bam-7423	62	39	gastric	gastric	ADJ
bam-7423	62	40	cancer	cancer	NOUN
bam-7423	62	41	.	.	PUNCT
bam-7423	63	1	this	this	DET
bam-7423	63	2	correlation	correlation	NOUN
bam-7423	63	3	is	be	AUX
bam-7423	63	4	significant	significant	ADJ
bam-7423	63	5	as	as	ADP
bam-7423	63	6	p	p	NOUN
bam-7423	63	7	-	-	PUNCT
bam-7423	63	8	value	value	NOUN
bam-7423	63	9	<	<	X
bam-7423	63	10	0.05	0.05	NUM
bam-7423	63	11	.	.	PUNCT
bam-7423	64	1	the	the	DET
bam-7423	64	2	average	average	NOUN
bam-7423	64	3	of	of	ADP
bam-7423	64	4	expression	expression	NOUN
bam-7423	64	5	of	of	ADP
bam-7423	64	6	gastric	gastric	ADJ
bam-7423	64	7	patients	patient	NOUN
bam-7423	64	8	is	be	AUX
bam-7423	64	9	much	much	ADV
bam-7423	64	10	less	less	ADJ
bam-7423	64	11	than	than	ADP
bam-7423	64	12	what	what	PRON
bam-7423	64	13	was	be	AUX
bam-7423	64	14	observed	observe	VERB
bam-7423	64	15	in	in	ADP
bam-7423	64	16	normal	normal	ADJ
bam-7423	64	17	samples	sample	NOUN
bam-7423	64	18	.	.	PUNCT
bam-7423	65	1	this	this	DET
bam-7423	65	2	comparison	comparison	NOUN
bam-7423	65	3	is	be	AUX
bam-7423	65	4	a	a	DET
bam-7423	65	5	significant	significant	ADJ
bam-7423	65	6	correlation	correlation	NOUN
bam-7423	65	7	considering	consider	VERB
bam-7423	65	8	the	the	DET
bam-7423	65	9	p	p	NOUN
bam-7423	65	10	-	-	PUNCT
bam-7423	65	11	value	value	NOUN
bam-7423	65	12	(	(	PUNCT
bam-7423	65	13	fig	fig	NOUN
bam-7423	65	14	.	.	PUNCT
bam-7423	65	15	10	10	NUM
bam-7423	65	16	)	)	PUNCT
bam-7423	65	17	.	.	PUNCT
bam-7423	66	1	an	an	DET
bam-7423	66	2	analysis	analysis	NOUN
bam-7423	66	3	fig	fig	NOUN
bam-7423	66	4	10	10	NUM
bam-7423	66	5	.	.	PUNCT
bam-7423	67	1	mean	mean	INTJ
bam-7423	67	2	rq	rq	NOUN
bam-7423	67	3	of	of	ADP
bam-7423	67	4	reprimo	reprimo	VERB
bam-7423	67	5	gene	gene	NOUN
bam-7423	67	6	based	base	VERB
bam-7423	67	7	upon	upon	SCONJ
bam-7423	67	8	methylation	methylation	NOUN
bam-7423	67	9	status	status	NOUN
bam-7423	67	10	fig	fig	NOUN
bam-7423	67	11	9	9	NUM
bam-7423	67	12	.	.	PUNCT
bam-7423	67	13	example	example	NOUN
bam-7423	67	14	of	of	ADP
bam-7423	67	15	ms	ms	ADJ
bam-7423	67	16	-	-	PUNCT
bam-7423	67	17	pcr	pcr	ADJ
bam-7423	67	18	results	result	NOUN
bam-7423	67	19	obtained	obtain	VERB
bam-7423	67	20	using	use	VERB
bam-7423	67	21	methylated	methylate	VERB
bam-7423	67	22	primers	primer	NOUN
bam-7423	67	23	.	.	PUNCT
bam-7423	68	1	the	the	DET
bam-7423	68	2	samples	sample	NOUN
bam-7423	68	3	with	with	ADP
bam-7423	68	4	a	a	DET
bam-7423	68	5	band	band	NOUN
bam-7423	68	6	size	size	NOUN
bam-7423	68	7	of	of	ADP
bam-7423	68	8	158	158	NUM
bam-7423	68	9	bp	bp	PROPN
bam-7423	68	10	have	have	VERB
bam-7423	68	11	methylation	methylation	NOUN
bam-7423	68	12	in	in	ADP
bam-7423	68	13	the	the	DET
bam-7423	68	14	region	region	NOUN
bam-7423	68	15	of	of	ADP
bam-7423	68	16	reprimo	reprimo	ADJ
bam-7423	68	17	gene	gene	NOUN
bam-7423	68	18	promoter	promoter	NOUN
bam-7423	68	19	fig	fig	NOUN
bam-7423	68	20	8	8	NUM
bam-7423	68	21	.	.	PUNCT
bam-7423	69	1	analysis	analysis	NOUN
bam-7423	69	2	of	of	ADP
bam-7423	69	3	expression	expression	NOUN
bam-7423	69	4	rate	rate	NOUN
bam-7423	69	5	of	of	ADP
bam-7423	69	6	reprimo	reprimo	ADJ
bam-7423	69	7	gene	gene	NOUN
bam-7423	69	8	among	among	ADP
bam-7423	69	9	sick	sick	ADJ
bam-7423	69	10	cases	case	NOUN
bam-7423	69	11	based	base	VERB
bam-7423	69	12	upon	upon	SCONJ
bam-7423	69	13	their	their	PRON
bam-7423	69	14	gender	gender	NOUN
bam-7423	69	15	(	(	PUNCT
bam-7423	69	16	p	p	NOUN
bam-7423	69	17	≤	≤	NOUN
bam-7423	69	18	0.960	0.960	NUM
bam-7423	69	19	)	)	PUNCT
bam-7423	69	20	)	)	PUNCT
bam-7423	70	1	non	non	PROPN
bam-7423	70	2	co	co	X
bam-7423	70	3	mmerc	mmerc	PROPN
bam-7423	70	4	ial	ial	PROPN
bam-7423	70	5	us	us	PROPN
bam-7423	70	6	e	e	NOUN
bam-7423	70	7	o	o	NOUN
bam-7423	70	8	nly	nly	ADV
bam-7423	70	9	reprimo	reprimo	VERB
bam-7423	70	10	gene	gene	NOUN
bam-7423	70	11	in	in	ADP
bam-7423	70	12	gastric	gastric	ADJ
bam-7423	70	13	cancer	cancer	NOUN
bam-7423	70	14	eur	eur	PROPN
bam-7423	70	15	j	j	PROPN
bam-7423	70	16	transl	transl	PROPN
bam-7423	70	17	myol	myol	ADV
bam-7423	70	18	28	28	NUM
bam-7423	70	19	(	(	PUNCT
bam-7423	70	20	2	2	NUM
bam-7423	70	21	):	):	PUNCT
bam-7423	70	22	226	226	NUM
bam-7423	70	23	-	-	SYM
bam-7423	70	24	232	232	NUM
bam-7423	70	25	,	,	PUNCT
bam-7423	70	26	2018	2018	NUM
bam-7423	70	27	6	6	NUM
bam-7423	70	28	of	of	ADP
bam-7423	70	29	results	result	NOUN
bam-7423	70	30	revealed	reveal	VERB
bam-7423	70	31	that	that	SCONJ
bam-7423	70	32	the	the	DET
bam-7423	70	33	expression	expression	NOUN
bam-7423	70	34	rate	rate	NOUN
bam-7423	70	35	of	of	ADP
bam-7423	70	36	reprimo	reprimo	ADJ
bam-7423	70	37	gene	gene	NOUN
bam-7423	70	38	among	among	ADP
bam-7423	70	39	sick	sick	ADJ
bam-7423	70	40	cases	case	NOUN
bam-7423	70	41	compared	compare	VERB
bam-7423	70	42	to	to	ADP
bam-7423	70	43	healthy	healthy	ADJ
bam-7423	70	44	people	people	NOUN
bam-7423	70	45	(	(	PUNCT
bam-7423	70	46	normal	normal	ADJ
bam-7423	70	47	samples	sample	NOUN
bam-7423	70	48	)	)	PUNCT
bam-7423	70	49	younger	young	ADJ
bam-7423	70	50	than	than	ADP
bam-7423	70	51	55	55	NUM
bam-7423	70	52	is	be	AUX
bam-7423	70	53	1.206	1.206	NUM
bam-7423	70	54	while	while	SCONJ
bam-7423	70	55	this	this	DET
bam-7423	70	56	value	value	NOUN
bam-7423	70	57	among	among	ADP
bam-7423	70	58	those	those	PRON
bam-7423	70	59	older	old	ADJ
bam-7423	70	60	than	than	ADP
bam-7423	70	61	55	55	NUM
bam-7423	70	62	was	be	AUX
bam-7423	70	63	0.673	0.673	NUM
bam-7423	70	64	.	.	PUNCT
bam-7423	71	1	this	this	DET
bam-7423	71	2	classification	classification	NOUN
bam-7423	71	3	is	be	AUX
bam-7423	71	4	solely	solely	ADV
bam-7423	71	5	based	base	VERB
bam-7423	71	6	upon	upon	SCONJ
bam-7423	71	7	people	people	NOUN
bam-7423	71	8	’s	’s	PART
bam-7423	71	9	age	age	NOUN
bam-7423	71	10	group	group	NOUN
bam-7423	71	11	.	.	PUNCT
bam-7423	72	1	as	as	SCONJ
bam-7423	72	2	it	it	PRON
bam-7423	72	3	is	be	AUX
bam-7423	72	4	evident	evident	ADJ
bam-7423	72	5	in	in	ADP
bam-7423	72	6	chart	chart	NOUN
bam-7423	72	7	3	3	NUM
bam-7423	72	8	,	,	PUNCT
bam-7423	72	9	the	the	DET
bam-7423	72	10	mean	mean	ADJ
bam-7423	72	11	expression	expression	NOUN
bam-7423	72	12	rate	rate	NOUN
bam-7423	72	13	of	of	ADP
bam-7423	72	14	patients	patient	NOUN
bam-7423	72	15	younger	young	ADJ
bam-7423	72	16	than	than	ADP
bam-7423	72	17	55	55	NUM
bam-7423	72	18	is	be	AUX
bam-7423	72	19	statistically	statistically	ADV
bam-7423	72	20	significant	significant	ADJ
bam-7423	72	21	(	(	PUNCT
bam-7423	72	22	fig	fig	NOUN
bam-7423	72	23	.	.	PUNCT
bam-7423	72	24	7	7	NUM
bam-7423	72	25	)	)	PUNCT
bam-7423	72	26	.	.	PUNCT
bam-7423	73	1	the	the	DET
bam-7423	73	2	expression	expression	NOUN
bam-7423	73	3	rate	rate	NOUN
bam-7423	73	4	of	of	ADP
bam-7423	73	5	reprimo	reprimo	ADJ
bam-7423	73	6	gene	gene	NOUN
bam-7423	73	7	among	among	ADP
bam-7423	73	8	male	male	ADJ
bam-7423	73	9	patients	patient	NOUN
bam-7423	73	10	was	be	AUX
bam-7423	73	11	nearly	nearly	ADV
bam-7423	73	12	equal	equal	ADJ
bam-7423	73	13	to	to	ADP
bam-7423	73	14	what	what	PRON
bam-7423	73	15	was	be	AUX
bam-7423	73	16	observed	observe	VERB
bam-7423	73	17	among	among	ADP
bam-7423	73	18	female	female	ADJ
bam-7423	73	19	patients	patient	NOUN
bam-7423	73	20	and	and	CCONJ
bam-7423	73	21	the	the	DET
bam-7423	73	22	mean	mean	NOUN
bam-7423	73	23	rq	rq	VERB
bam-7423	73	24	level	level	NOUN
bam-7423	73	25	of	of	ADP
bam-7423	73	26	men	man	NOUN
bam-7423	73	27	and	and	CCONJ
bam-7423	73	28	women	woman	NOUN
bam-7423	73	29	was	be	AUX
bam-7423	73	30	0.785	0.785	NUM
bam-7423	73	31	and	and	CCONJ
bam-7423	73	32	0.774	0.774	NUM
bam-7423	73	33	respectively	respectively	ADV
bam-7423	73	34	(	(	PUNCT
bam-7423	73	35	fig	fig	NOUN
bam-7423	73	36	8)	8)	NUM
bam-7423	73	37	.	.	PUNCT
bam-7423	73	38	considering	consider	VERB
bam-7423	73	39	chart	chart	NOUN
bam-7423	73	40	4	4	NUM
bam-7423	73	41	,	,	PUNCT
bam-7423	73	42	we	we	PRON
bam-7423	73	43	may	may	AUX
bam-7423	73	44	conclude	conclude	VERB
bam-7423	73	45	that	that	SCONJ
bam-7423	73	46	gender	gender	NOUN
bam-7423	73	47	has	have	VERB
bam-7423	73	48	no	no	DET
bam-7423	73	49	influence	influence	NOUN
bam-7423	73	50	on	on	ADP
bam-7423	73	51	the	the	DET
bam-7423	73	52	expression	expression	NOUN
bam-7423	73	53	rate	rate	NOUN
bam-7423	73	54	of	of	ADP
bam-7423	73	55	reprimo	reprimo	NOUN
bam-7423	73	56	and	and	CCONJ
bam-7423	73	57	pathogenicity	pathogenicity	NOUN
bam-7423	73	58	of	of	ADP
bam-7423	73	59	gastric	gastric	ADJ
bam-7423	73	60	cancer	cancer	NOUN
bam-7423	73	61	.	.	PUNCT
bam-7423	74	1	the	the	DET
bam-7423	74	2	results	result	NOUN
bam-7423	74	3	of	of	ADP
bam-7423	74	4	ms	ms	ADJ
bam-7423	74	5	-	-	PUNCT
bam-7423	74	6	pcr	pcr	NOUN
bam-7423	74	7	using	use	VERB
bam-7423	74	8	methylated	methylate	VERB
bam-7423	74	9	primers	primer	NOUN
bam-7423	74	10	having	having	AUX
bam-7423	74	11	carried	carry	VERB
bam-7423	74	12	out	out	ADP
bam-7423	74	13	ms	ms	PROPN
bam-7423	74	14	-	-	PUNCT
bam-7423	74	15	pcr	pcr	NOUN
bam-7423	74	16	using	use	VERB
bam-7423	74	17	methylated	methylate	VERB
bam-7423	74	18	primers	primer	NOUN
bam-7423	74	19	on	on	ADP
bam-7423	74	20	100	100	NUM
bam-7423	74	21	intended	intend	VERB
bam-7423	74	22	samples	sample	NOUN
bam-7423	74	23	in	in	ADP
bam-7423	74	24	order	order	NOUN
bam-7423	74	25	to	to	PART
bam-7423	74	26	study	study	VERB
bam-7423	74	27	the	the	DET
bam-7423	74	28	methylation	methylation	NOUN
bam-7423	74	29	status	status	NOUN
bam-7423	74	30	of	of	ADP
bam-7423	74	31	reprimo	reprimo	VERB
bam-7423	74	32	gene	gene	NOUN
bam-7423	74	33	promoter	promoter	NOUN
bam-7423	74	34	,	,	PUNCT
bam-7423	74	35	it	it	PRON
bam-7423	74	36	turned	turn	VERB
bam-7423	74	37	out	out	ADP
bam-7423	74	38	that	that	SCONJ
bam-7423	74	39	23	23	NUM
bam-7423	74	40	samples	sample	NOUN
bam-7423	74	41	out	out	ADP
bam-7423	74	42	of	of	ADP
bam-7423	74	43	the	the	DET
bam-7423	74	44	total	total	ADJ
bam-7423	74	45	50	50	NUM
bam-7423	74	46	dna	dna	NOUN
bam-7423	74	47	samples	sample	NOUN
bam-7423	74	48	of	of	ADP
bam-7423	74	49	patients	patient	NOUN
bam-7423	74	50	were	be	AUX
bam-7423	74	51	methylated	methylate	VERB
bam-7423	74	52	,	,	PUNCT
bam-7423	74	53	but	but	CCONJ
bam-7423	74	54	this	this	DET
bam-7423	74	55	number	number	NOUN
bam-7423	74	56	in	in	ADP
bam-7423	74	57	normal	normal	ADJ
bam-7423	74	58	cases	case	NOUN
bam-7423	74	59	was	be	AUX
bam-7423	74	60	only	only	ADV
bam-7423	74	61	7	7	NUM
bam-7423	74	62	.	.	PUNCT
bam-7423	75	1	as	as	ADP
bam-7423	75	2	a	a	DET
bam-7423	75	3	result	result	NOUN
bam-7423	75	4	,	,	PUNCT
bam-7423	75	5	45.7	45.7	NUM
bam-7423	75	6	%	%	NOUN
bam-7423	75	7	of	of	ADP
bam-7423	75	8	samples	sample	NOUN
bam-7423	75	9	for	for	ADP
bam-7423	75	10	reprimo	reprimo	VERB
bam-7423	75	11	gene	gene	NOUN
bam-7423	75	12	promoter	promoter	NOUN
bam-7423	75	13	are	be	AUX
bam-7423	75	14	methylated	methylate	VERB
bam-7423	75	15	(	(	PUNCT
bam-7423	75	16	fig	fig	NOUN
bam-7423	75	17	.	.	PUNCT
bam-7423	76	1	9	9	NUM
bam-7423	76	2	)	)	PUNCT
bam-7423	76	3	.	.	PUNCT
bam-7423	77	1	the	the	DET
bam-7423	77	2	expression	expression	NOUN
bam-7423	77	3	rate	rate	NOUN
bam-7423	77	4	of	of	ADP
bam-7423	77	5	reprimo	reprimo	ADJ
bam-7423	77	6	gene	gene	NOUN
bam-7423	77	7	in	in	ADP
bam-7423	77	8	non	non	ADJ
bam-7423	77	9	-	-	ADJ
bam-7423	77	10	methylated	methylate	VERB
bam-7423	77	11	samples	sample	NOUN
bam-7423	77	12	turned	turn	VERB
bam-7423	77	13	out	out	ADP
bam-7423	77	14	to	to	PART
bam-7423	77	15	be	be	AUX
bam-7423	77	16	99.6	99.6	NUM
bam-7423	77	17	%	%	NOUN
bam-7423	77	18	while	while	SCONJ
bam-7423	77	19	this	this	DET
bam-7423	77	20	value	value	NOUN
bam-7423	77	21	in	in	ADP
bam-7423	77	22	methylated	methylate	VERB
bam-7423	77	23	samples	sample	NOUN
bam-7423	77	24	was	be	AUX
bam-7423	77	25	54	54	NUM
bam-7423	77	26	%	%	NOUN
bam-7423	77	27	.	.	PUNCT
bam-7423	78	1	the	the	DET
bam-7423	78	2	mean	mean	ADJ
bam-7423	78	3	expression	expression	NOUN
bam-7423	78	4	rate	rate	NOUN
bam-7423	78	5	of	of	ADP
bam-7423	78	6	reprimo	reprimo	ADJ
bam-7423	78	7	gene	gene	NOUN
bam-7423	78	8	in	in	ADP
bam-7423	78	9	non	non	ADJ
bam-7423	78	10	-	-	ADJ
bam-7423	78	11	methylated	methylate	VERB
bam-7423	78	12	samples	sample	NOUN
bam-7423	78	13	is	be	AUX
bam-7423	78	14	more	more	ADJ
bam-7423	78	15	than	than	ADP
bam-7423	78	16	what	what	PRON
bam-7423	78	17	was	be	AUX
bam-7423	78	18	observed	observe	VERB
bam-7423	78	19	in	in	ADP
bam-7423	78	20	methylated	methylate	VERB
bam-7423	78	21	samples	sample	NOUN
bam-7423	78	22	.	.	PUNCT
bam-7423	79	1	although	although	SCONJ
bam-7423	79	2	recognition	recognition	NOUN
bam-7423	79	3	of	of	ADP
bam-7423	79	4	factors	factor	NOUN
bam-7423	79	5	such	such	ADJ
bam-7423	79	6	as	as	ADP
bam-7423	79	7	helicobacter	helicobacter	NOUN
bam-7423	79	8	pylori	pylori	NOUN
bam-7423	79	9	and	and	CCONJ
bam-7423	79	10	various	various	ADJ
bam-7423	79	11	environmental	environmental	ADJ
bam-7423	79	12	factors	factor	NOUN
bam-7423	79	13	has	have	AUX
bam-7423	79	14	helped	help	VERB
bam-7423	79	15	reduce	reduce	VERB
bam-7423	79	16	the	the	DET
bam-7423	79	17	prevalence	prevalence	NOUN
bam-7423	79	18	of	of	ADP
bam-7423	79	19	gastric	gastric	ADJ
bam-7423	79	20	cancer	cancer	NOUN
bam-7423	79	21	,	,	PUNCT
bam-7423	79	22	it	it	PRON
bam-7423	79	23	is	be	AUX
bam-7423	79	24	still	still	ADV
bam-7423	79	25	one	one	NUM
bam-7423	79	26	of	of	ADP
bam-7423	79	27	the	the	DET
bam-7423	79	28	most	most	ADV
bam-7423	79	29	common	common	ADJ
bam-7423	79	30	types	type	NOUN
bam-7423	79	31	of	of	ADP
bam-7423	79	32	cancers	cancer	NOUN
bam-7423	79	33	in	in	ADP
bam-7423	79	34	the	the	DET
bam-7423	79	35	world	world	NOUN
bam-7423	79	36	and	and	CCONJ
bam-7423	79	37	constitutes	constitute	VERB
bam-7423	79	38	a	a	DET
bam-7423	79	39	major	major	ADJ
bam-7423	79	40	clinical	clinical	ADJ
bam-7423	79	41	challenge.9	challenge.9	NOUN
bam-7423	79	42	gastric	gastric	ADJ
bam-7423	79	43	cancer	cancer	NOUN
bam-7423	79	44	is	be	AUX
bam-7423	79	45	one	one	NUM
bam-7423	79	46	of	of	ADP
bam-7423	79	47	the	the	DET
bam-7423	79	48	most	most	ADV
bam-7423	79	49	important	important	ADJ
bam-7423	79	50	causes	cause	NOUN
bam-7423	79	51	of	of	ADP
bam-7423	79	52	mortality	mortality	NOUN
bam-7423	79	53	in	in	ADP
bam-7423	79	54	developing	develop	VERB
bam-7423	79	55	countries.10	countries.10	NOUN
bam-7423	79	56	as	as	ADP
bam-7423	79	57	a	a	DET
bam-7423	79	58	result	result	NOUN
bam-7423	79	59	of	of	ADP
bam-7423	79	60	ineffectiveness	ineffectiveness	NOUN
bam-7423	79	61	of	of	ADP
bam-7423	79	62	most	most	ADJ
bam-7423	79	63	common	common	ADJ
bam-7423	79	64	treatments	treatment	NOUN
bam-7423	79	65	,	,	PUNCT
bam-7423	79	66	the	the	DET
bam-7423	79	67	majority	majority	NOUN
bam-7423	79	68	of	of	ADP
bam-7423	79	69	patients	patient	NOUN
bam-7423	79	70	have	have	VERB
bam-7423	79	71	a	a	DET
bam-7423	79	72	low	low	ADJ
bam-7423	79	73	survival	survival	NOUN
bam-7423	79	74	rate	rate	NOUN
bam-7423	79	75	even	even	ADV
bam-7423	79	76	after	after	ADP
bam-7423	79	77	treatment	treatment	NOUN
bam-7423	79	78	and	and	CCONJ
bam-7423	79	79	pass	pass	VERB
bam-7423	79	80	away	away	ADV
bam-7423	79	81	.	.	PUNCT
bam-7423	80	1	various	various	ADJ
bam-7423	80	2	studies	study	NOUN
bam-7423	80	3	have	have	AUX
bam-7423	80	4	pointed	point	VERB
bam-7423	80	5	to	to	ADP
bam-7423	80	6	the	the	DET
bam-7423	80	7	fact	fact	NOUN
bam-7423	80	8	that	that	SCONJ
bam-7423	80	9	various	various	ADJ
bam-7423	80	10	factors	factor	NOUN
bam-7423	80	11	such	such	ADJ
bam-7423	80	12	as	as	ADP
bam-7423	80	13	helicobacter	helicobacter	NOUN
bam-7423	80	14	pylori	pylori	NOUN
bam-7423	80	15	infection	infection	NOUN
bam-7423	80	16	and	and	CCONJ
bam-7423	80	17	its	its	PRON
bam-7423	80	18	resulting	result	VERB
bam-7423	80	19	side	side	NOUN
bam-7423	80	20	effects	effect	NOUN
bam-7423	80	21	and	and	CCONJ
bam-7423	80	22	other	other	ADJ
bam-7423	80	23	factors	factor	NOUN
bam-7423	80	24	such	such	ADJ
bam-7423	80	25	as	as	ADP
bam-7423	80	26	genetics	genetic	NOUN
bam-7423	80	27	and	and	CCONJ
bam-7423	80	28	its	its	PRON
bam-7423	80	29	resulting	result	VERB
bam-7423	80	30	polymorphism	polymorphism	NOUN
bam-7423	80	31	may	may	AUX
bam-7423	80	32	have	have	AUX
bam-7423	80	33	a	a	DET
bam-7423	80	34	major	major	ADJ
bam-7423	80	35	influence	influence	NOUN
bam-7423	80	36	on	on	ADP
bam-7423	80	37	sensitivity	sensitivity	NOUN
bam-7423	80	38	and	and	CCONJ
bam-7423	80	39	development	development	NOUN
bam-7423	80	40	of	of	ADP
bam-7423	80	41	gastric	gastric	ADJ
bam-7423	80	42	cancer.11	cancer.11	VERB
bam-7423	80	43	the	the	DET
bam-7423	80	44	multi	multi	ADJ
bam-7423	80	45	-	-	ADJ
bam-7423	80	46	factor	factor	NOUN
bam-7423	80	47	nature	nature	NOUN
bam-7423	80	48	of	of	ADP
bam-7423	80	49	gastric	gastric	ADJ
bam-7423	80	50	cancer	cancer	NOUN
bam-7423	80	51	makes	make	VERB
bam-7423	80	52	it	it	PRON
bam-7423	80	53	impossible	impossible	ADJ
bam-7423	80	54	to	to	PART
bam-7423	80	55	come	come	VERB
bam-7423	80	56	up	up	ADP
bam-7423	80	57	with	with	ADP
bam-7423	80	58	an	an	DET
bam-7423	80	59	accurate	accurate	ADJ
bam-7423	80	60	prohibition	prohibition	NOUN
bam-7423	80	61	strategy	strategy	NOUN
bam-7423	80	62	and	and	CCONJ
bam-7423	80	63	to	to	PART
bam-7423	80	64	diagnose	diagnose	VERB
bam-7423	80	65	it	it	PRON
bam-7423	80	66	quickly	quickly	ADV
bam-7423	80	67	.	.	PUNCT
bam-7423	81	1	as	as	SCONJ
bam-7423	81	2	the	the	DET
bam-7423	81	3	majority	majority	NOUN
bam-7423	81	4	of	of	ADP
bam-7423	81	5	gastric	gastric	ADJ
bam-7423	81	6	cancer	cancer	NOUN
bam-7423	81	7	cases	case	NOUN
bam-7423	81	8	have	have	VERB
bam-7423	81	9	no	no	DET
bam-7423	81	10	symptoms	symptom	NOUN
bam-7423	81	11	until	until	SCONJ
bam-7423	81	12	they	they	PRON
bam-7423	81	13	reach	reach	VERB
bam-7423	81	14	the	the	DET
bam-7423	81	15	advanced	advanced	ADJ
bam-7423	81	16	level	level	NOUN
bam-7423	81	17	,	,	PUNCT
bam-7423	81	18	early	early	ADJ
bam-7423	81	19	diagnosis	diagnosis	NOUN
bam-7423	81	20	of	of	ADP
bam-7423	81	21	gastric	gastric	ADJ
bam-7423	81	22	cancer	cancer	NOUN
bam-7423	81	23	is	be	AUX
bam-7423	81	24	very	very	ADV
bam-7423	81	25	difficult.12	difficult.12	NOUN
bam-7423	81	26	the	the	DET
bam-7423	81	27	first	first	ADJ
bam-7423	81	28	documented	document	VERB
bam-7423	81	29	epigenetic	epigenetic	ADJ
bam-7423	81	30	change	change	NOUN
bam-7423	81	31	in	in	ADP
bam-7423	81	32	gastric	gastric	ADJ
bam-7423	81	33	cancer	cancer	NOUN
bam-7423	81	34	is	be	AUX
bam-7423	81	35	hyper	hyper	ADJ
bam-7423	81	36	-	-	NOUN
bam-7423	81	37	methylation	methylation	NOUN
bam-7423	81	38	of	of	ADP
bam-7423	81	39	the	the	DET
bam-7423	81	40	promoter	promoter	NOUN
bam-7423	81	41	of	of	ADP
bam-7423	81	42	genes	gene	NOUN
bam-7423	81	43	that	that	PRON
bam-7423	81	44	restore	restore	VERB
bam-7423	81	45	inconsistent	inconsistent	ADJ
bam-7423	81	46	nucleotide	nucleotide	ADJ
bam-7423	81	47	mutations	mutation	NOUN
bam-7423	81	48	of	of	ADP
bam-7423	81	49	dna.13	dna.13	VERB
bam-7423	81	50	several	several	ADJ
bam-7423	81	51	genes	gene	NOUN
bam-7423	81	52	have	have	AUX
bam-7423	81	53	been	be	AUX
bam-7423	81	54	described	describe	VERB
bam-7423	81	55	as	as	SCONJ
bam-7423	81	56	tumor	tumor	NOUN
bam-7423	81	57	repressors	repressor	NOUN
bam-7423	81	58	deactivated	deactivate	VERB
bam-7423	81	59	as	as	ADP
bam-7423	81	60	a	a	DET
bam-7423	81	61	result	result	NOUN
bam-7423	81	62	of	of	ADP
bam-7423	81	63	hyper	hyper	NOUN
bam-7423	81	64	-	-	NOUN
bam-7423	81	65	methylation	methylation	NOUN
bam-7423	81	66	in	in	ADP
bam-7423	81	67	gastric	gastric	ADJ
bam-7423	81	68	cancer	cancer	NOUN
bam-7423	81	69	.	.	PUNCT
bam-7423	82	1	although	although	SCONJ
bam-7423	82	2	recent	recent	ADJ
bam-7423	82	3	reports	report	NOUN
bam-7423	82	4	point	point	VERB
bam-7423	82	5	to	to	ADP
bam-7423	82	6	the	the	DET
bam-7423	82	7	discovery	discovery	NOUN
bam-7423	82	8	of	of	ADP
bam-7423	82	9	methylation	methylation	NOUN
bam-7423	82	10	of	of	ADP
bam-7423	82	11	particular	particular	ADJ
bam-7423	82	12	genes	gene	NOUN
bam-7423	82	13	,	,	PUNCT
bam-7423	82	14	no	no	DET
bam-7423	82	15	comprehensive	comprehensive	ADJ
bam-7423	82	16	characteristic	characteristic	NOUN
bam-7423	82	17	of	of	ADP
bam-7423	82	18	dna	dna	PROPN
bam-7423	82	19	methylation	methylation	NOUN
bam-7423	82	20	in	in	ADP
bam-7423	82	21	gastric	gastric	ADJ
bam-7423	82	22	cancer	cancer	NOUN
bam-7423	82	23	has	have	AUX
bam-7423	82	24	been	be	AUX
bam-7423	82	25	reported	report	VERB
bam-7423	82	26	to	to	ADP
bam-7423	82	27	this	this	DET
bam-7423	82	28	date	date	NOUN
bam-7423	82	29	.	.	PUNCT
bam-7423	83	1	bernal	bernal	PROPN
bam-7423	83	2	et	et	PROPN
bam-7423	83	3	al	al	PROPN
bam-7423	83	4	started	start	VERB
bam-7423	83	5	a	a	DET
bam-7423	83	6	research	research	NOUN
bam-7423	83	7	to	to	PART
bam-7423	83	8	find	find	VERB
bam-7423	83	9	a	a	DET
bam-7423	83	10	gene	gene	NOUN
bam-7423	83	11	with	with	ADP
bam-7423	83	12	inappropriate	inappropriate	ADJ
bam-7423	83	13	hypermethylation	hypermethylation	NOUN
bam-7423	83	14	which	which	PRON
bam-7423	83	15	is	be	AUX
bam-7423	83	16	useful	useful	ADJ
bam-7423	83	17	for	for	ADP
bam-7423	83	18	early	early	ADJ
bam-7423	83	19	diagnosis.15	diagnosis.15	NOUN
bam-7423	83	20	by	by	ADP
bam-7423	83	21	searching	search	VERB
bam-7423	83	22	cpg	cpg	NOUN
bam-7423	83	23	islands	island	NOUN
bam-7423	83	24	in	in	ADP
bam-7423	83	25	the	the	DET
bam-7423	83	26	promoter	promoter	NOUN
bam-7423	83	27	24	24	NUM
bam-7423	83	28	region	region	NOUN
bam-7423	83	29	of	of	ADP
bam-7423	83	30	candidated	candidated	ADJ
bam-7423	83	31	gene	gene	NOUN
bam-7423	83	32	among	among	ADP
bam-7423	83	33	32	32	NUM
bam-7423	83	34	cases	case	NOUN
bam-7423	83	35	suffering	suffer	VERB
bam-7423	83	36	with	with	ADP
bam-7423	83	37	gastric	gastric	ADJ
bam-7423	83	38	cancer	cancer	NOUN
bam-7423	83	39	,	,	PUNCT
bam-7423	83	40	they	they	PRON
bam-7423	83	41	arrived	arrive	VERB
bam-7423	83	42	at	at	ADP
bam-7423	83	43	the	the	DET
bam-7423	83	44	conclusion	conclusion	NOUN
bam-7423	83	45	that	that	SCONJ
bam-7423	83	46	inappropriate	inappropriate	ADJ
bam-7423	83	47	methylation	methylation	NOUN
bam-7423	83	48	of	of	ADP
bam-7423	83	49	reprimo	reprimo	NOUN
bam-7423	83	50	can	can	AUX
bam-7423	83	51	act	act	VERB
bam-7423	83	52	as	as	ADP
bam-7423	83	53	a	a	DET
bam-7423	83	54	potential	potential	ADJ
bam-7423	83	55	biomarker	biomarker	NOUN
bam-7423	83	56	for	for	ADP
bam-7423	83	57	early	early	ADJ
bam-7423	83	58	diagnosis	diagnosis	NOUN
bam-7423	83	59	of	of	ADP
bam-7423	83	60	gastric	gastric	ADJ
bam-7423	83	61	cancer	cancer	NOUN
bam-7423	83	62	.	.	PUNCT
bam-7423	84	1	reprimo	reprimo	VERB
bam-7423	84	2	is	be	AUX
bam-7423	84	3	the	the	DET
bam-7423	84	4	new	new	ADJ
bam-7423	84	5	candidate	candidate	NOUN
bam-7423	84	6	mediating	mediate	VERB
bam-7423	84	7	termination	termination	NOUN
bam-7423	84	8	of	of	ADP
bam-7423	84	9	cell	cell	NOUN
bam-7423	84	10	cycle	cycle	NOUN
bam-7423	84	11	in	in	ADP
bam-7423	84	12	g2	g2	PROPN
bam-7423	84	13	phase	phase	NOUN
bam-7423	84	14	with	with	ADP
bam-7423	84	15	the	the	DET
bam-7423	84	16	aid	aid	NOUN
bam-7423	84	17	of	of	ADP
bam-7423	84	18	p53	p53	NOUN
bam-7423	84	19	.	.	PUNCT
bam-7423	85	1	takao	takao	PROPN
bam-7423	85	2	takahashi	takahashi	PROPN
bam-7423	85	3	et	et	PROPN
bam-7423	85	4	al	al	PROPN
bam-7423	85	5	.	.	PROPN
bam-7423	85	6	have	have	AUX
bam-7423	85	7	pointed	point	VERB
bam-7423	85	8	to	to	ADP
bam-7423	85	9	the	the	DET
bam-7423	85	10	fact	fact	NOUN
bam-7423	85	11	that	that	PRON
bam-7423	85	12	reprimo	reprimo	VERB
bam-7423	85	13	gene	gene	NOUN
bam-7423	85	14	is	be	AUX
bam-7423	85	15	not	not	PART
bam-7423	85	16	expressed	express	VERB
bam-7423	85	17	by	by	ADP
bam-7423	85	18	its	its	PRON
bam-7423	85	19	promoter	promoter	NOUN
bam-7423	85	20	’s	’s	PART
bam-7423	85	21	methylation	methylation	NOUN
bam-7423	85	22	in	in	ADP
bam-7423	85	23	pancreatic	pancreatic	ADJ
bam-7423	85	24	and	and	CCONJ
bam-7423	85	25	lung	lung	NOUN
bam-7423	85	26	cancer	cancer	NOUN
bam-7423	85	27	.	.	PUNCT
bam-7423	86	1	they	they	PRON
bam-7423	86	2	proved	prove	VERB
bam-7423	86	3	that	that	SCONJ
bam-7423	86	4	hyper	hyper	NOUN
bam-7423	86	5	-	-	NOUN
bam-7423	86	6	methylation	methylation	NOUN
bam-7423	86	7	is	be	AUX
bam-7423	86	8	responsible	responsible	ADJ
bam-7423	86	9	for	for	ADP
bam-7423	86	10	transcription	transcription	NOUN
bam-7423	86	11	of	of	AUX
bam-7423	86	12	reprimo	reprimo	VERB
bam-7423	86	13	through	through	ADP
bam-7423	86	14	hyper	hyper	NOUN
bam-7423	86	15	-	-	NOUN
bam-7423	86	16	methylation	methylation	NOUN
bam-7423	86	17	(	(	PUNCT
bam-7423	86	18	92	92	NUM
bam-7423	86	19	%	%	NOUN
bam-7423	86	20	match	match	NOUN
bam-7423	86	21	)	)	PUNCT
bam-7423	86	22	.	.	PUNCT
bam-7423	87	1	methylation	methylation	NOUN
bam-7423	87	2	of	of	ADP
bam-7423	87	3	reprimo	reprimo	ADJ
bam-7423	87	4	promoter	promoter	NOUN
bam-7423	87	5	has	have	AUX
bam-7423	87	6	been	be	AUX
bam-7423	87	7	reported	report	VERB
bam-7423	87	8	in	in	ADP
bam-7423	87	9	79	79	NUM
bam-7423	87	10	%	%	NOUN
bam-7423	87	11	of	of	ADP
bam-7423	87	12	gastric	gastric	ADJ
bam-7423	87	13	cancer	cancer	NOUN
bam-7423	87	14	,	,	PUNCT
bam-7423	87	15	62	62	NUM
bam-7423	87	16	%	%	NOUN
bam-7423	87	17	of	of	ADP
bam-7423	87	18	gallbladder	gallbladder	NOUN
bam-7423	87	19	cancer	cancer	NOUN
bam-7423	87	20	,	,	PUNCT
bam-7423	87	21	57	57	NUM
bam-7423	87	22	%	%	NOUN
bam-7423	87	23	of	of	ADP
bam-7423	87	24	lymphoma	lymphoma	NOUN
bam-7423	87	25	,	,	PUNCT
bam-7423	87	26	56	56	NUM
bam-7423	87	27	%	%	NOUN
bam-7423	87	28	of	of	ADP
bam-7423	87	29	clone	clone	NOUN
bam-7423	87	30	cancers	cancer	NOUN
bam-7423	87	31	,	,	PUNCT
bam-7423	87	32	40	40	NUM
bam-7423	87	33	%	%	NOUN
bam-7423	87	34	of	of	ADP
bam-7423	87	35	esophageal	esophageal	ADJ
bam-7423	87	36	cancer	cancer	NOUN
bam-7423	87	37	,	,	PUNCT
bam-7423	87	38	37	37	NUM
bam-7423	87	39	%	%	NOUN
bam-7423	87	40	of	of	ADP
bam-7423	87	41	breast	breast	NOUN
bam-7423	87	42	cancer	cancer	NOUN
bam-7423	87	43	,	,	PUNCT
bam-7423	87	44	and	and	CCONJ
bam-7423	87	45	31	31	NUM
bam-7423	87	46	%	%	NOUN
bam-7423	87	47	of	of	ADP
bam-7423	87	48	leukemia	leukemia	NOUN
bam-7423	87	49	cases.16	cases.16	PROPN
bam-7423	87	50	by	by	ADP
bam-7423	87	51	studying	study	VERB
bam-7423	87	52	39	39	NUM
bam-7423	87	53	patients	patient	NOUN
bam-7423	87	54	with	with	ADP
bam-7423	87	55	an	an	DET
bam-7423	87	56	average	average	ADJ
bam-7423	87	57	age	age	NOUN
bam-7423	87	58	of	of	ADP
bam-7423	87	59	older	old	ADJ
bam-7423	87	60	than	than	ADP
bam-7423	87	61	64	64	NUM
bam-7423	87	62	and	and	CCONJ
bam-7423	87	63	a	a	DET
bam-7423	87	64	men	man	NOUN
bam-7423	87	65	to	to	ADP
bam-7423	87	66	woman	woman	NOUN
bam-7423	87	67	ration	ration	NOUN
bam-7423	87	68	of	of	ADP
bam-7423	87	69	1.3	1.3	NUM
bam-7423	87	70	to	to	PART
bam-7423	87	71	1	1	NUM
bam-7423	87	72	and	and	CCONJ
bam-7423	87	73	comparing	compare	VERB
bam-7423	87	74	them	they	PRON
bam-7423	87	75	against	against	ADP
bam-7423	87	76	normal	normal	ADJ
bam-7423	87	77	control	control	NOUN
bam-7423	87	78	samples	sample	NOUN
bam-7423	87	79	,	,	PUNCT
bam-7423	87	80	alejandro	alejandro	PROPN
bam-7423	87	81	et	et	PROPN
bam-7423	87	82	al	al	PROPN
bam-7423	87	83	arrived	arrive	VERB
bam-7423	87	84	at	at	ADP
bam-7423	87	85	the	the	DET
bam-7423	87	86	conclusion	conclusion	NOUN
bam-7423	87	87	that	that	PRON
bam-7423	87	88	reprimo	reprimo	VERB
bam-7423	87	89	is	be	AUX
bam-7423	87	90	superior	superior	ADJ
bam-7423	87	91	in	in	ADP
bam-7423	87	92	diagnosing	diagnose	VERB
bam-7423	87	93	non	non	ADJ
bam-7423	87	94	-	-	ADJ
bam-7423	87	95	invasive	invasive	ADJ
bam-7423	87	96	genes	gene	NOUN
bam-7423	87	97	than	than	ADP
bam-7423	87	98	cea	cea	PROPN
bam-7423	87	99	and	and	CCONJ
bam-7423	87	100	ca	ca	PROPN
bam-7423	87	101	19_9	19_9	NUM
bam-7423	87	102	.	.	PUNCT
bam-7423	88	1	sensitivity	sensitivity	NOUN
bam-7423	88	2	,	,	PUNCT
bam-7423	88	3	specificity	specificity	NOUN
bam-7423	88	4	,	,	PUNCT
bam-7423	88	5	positive	positive	ADJ
bam-7423	88	6	predictive	predictive	ADJ
bam-7423	88	7	value	value	NOUN
bam-7423	88	8	,	,	PUNCT
bam-7423	88	9	negative	negative	ADJ
bam-7423	88	10	predictive	predictive	ADJ
bam-7423	88	11	value	value	NOUN
bam-7423	88	12	,	,	PUNCT
bam-7423	88	13	and	and	CCONJ
bam-7423	88	14	the	the	DET
bam-7423	88	15	rate	rate	NOUN
bam-7423	88	16	of	of	ADP
bam-7423	88	17	positive	positive	ADJ
bam-7423	88	18	possibilities	possibility	NOUN
bam-7423	88	19	may	may	AUX
bam-7423	88	20	be	be	AUX
bam-7423	88	21	a	a	DET
bam-7423	88	22	great	great	ADJ
bam-7423	88	23	progress	progress	NOUN
bam-7423	88	24	in	in	ADP
bam-7423	88	25	assessing	assess	VERB
bam-7423	88	26	the	the	DET
bam-7423	88	27	diagnostic	diagnostic	ADJ
bam-7423	88	28	effect	effect	NOUN
bam-7423	88	29	of	of	AUX
bam-7423	88	30	reprimo	reprimo	VERB
bam-7423	88	31	for	for	ADP
bam-7423	88	32	noninvasive	noninvasive	ADJ
bam-7423	88	33	diagnosis	diagnosis	NOUN
bam-7423	88	34	of	of	ADP
bam-7423	88	35	gastric	gastric	ADJ
bam-7423	88	36	cancer.17	cancer.17	PROPN
bam-7423	88	37	considering	consider	VERB
bam-7423	88	38	the	the	DET
bam-7423	88	39	important	important	ADJ
bam-7423	88	40	effect	effect	NOUN
bam-7423	88	41	of	of	ADP
bam-7423	88	42	reprimo	reprimo	VERB
bam-7423	88	43	gene	gene	NOUN
bam-7423	88	44	in	in	ADP
bam-7423	88	45	preventing	prevent	VERB
bam-7423	88	46	gastric	gastric	ADJ
bam-7423	88	47	cancer	cancer	NOUN
bam-7423	88	48	and	and	CCONJ
bam-7423	88	49	as	as	ADP
bam-7423	88	50	a	a	DET
bam-7423	88	51	repressor	repressor	NOUN
bam-7423	88	52	in	in	ADP
bam-7423	88	53	early	early	ADJ
bam-7423	88	54	diagnosis	diagnosis	NOUN
bam-7423	88	55	of	of	ADP
bam-7423	88	56	gastric	gastric	ADJ
bam-7423	88	57	cancer	cancer	NOUN
bam-7423	88	58	among	among	ADP
bam-7423	88	59	those	those	PRON
bam-7423	88	60	suffering	suffer	VERB
bam-7423	88	61	with	with	ADP
bam-7423	88	62	it	it	PRON
bam-7423	88	63	,	,	PUNCT
bam-7423	88	64	we	we	PRON
bam-7423	88	65	decided	decide	VERB
bam-7423	88	66	to	to	PART
bam-7423	88	67	study	study	VERB
bam-7423	88	68	the	the	DET
bam-7423	88	69	expression	expression	NOUN
bam-7423	88	70	rate	rate	NOUN
bam-7423	88	71	of	of	ADP
bam-7423	88	72	this	this	DET
bam-7423	88	73	gene	gene	NOUN
bam-7423	88	74	in	in	ADP
bam-7423	88	75	the	the	DET
bam-7423	88	76	blood	blood	NOUN
bam-7423	88	77	sample	sample	NOUN
bam-7423	88	78	of	of	ADP
bam-7423	88	79	those	those	PRON
bam-7423	88	80	suffering	suffer	VERB
bam-7423	88	81	with	with	ADP
bam-7423	88	82	gastric	gastric	ADJ
bam-7423	88	83	cancer	cancer	NOUN
bam-7423	88	84	in	in	ADP
bam-7423	88	85	iran	iran	PROPN
bam-7423	88	86	.	.	PUNCT
bam-7423	89	1	this	this	DET
bam-7423	89	2	project	project	NOUN
bam-7423	89	3	is	be	AUX
bam-7423	89	4	the	the	DET
bam-7423	89	5	first	first	ADJ
bam-7423	89	6	comprehensive	comprehensive	ADJ
bam-7423	89	7	research	research	NOUN
bam-7423	89	8	studying	study	VERB
bam-7423	89	9	the	the	DET
bam-7423	89	10	expression	expression	NOUN
bam-7423	89	11	rate	rate	NOUN
bam-7423	89	12	of	of	ADP
bam-7423	89	13	gene	gene	NOUN
bam-7423	89	14	in	in	ADP
bam-7423	89	15	the	the	DET
bam-7423	89	16	blood	blood	NOUN
bam-7423	89	17	samples	sample	NOUN
bam-7423	89	18	obtained	obtain	VERB
bam-7423	89	19	from	from	ADP
bam-7423	89	20	those	those	PRON
bam-7423	89	21	suffering	suffer	VERB
bam-7423	89	22	with	with	ADP
bam-7423	89	23	gastric	gastric	ADJ
bam-7423	89	24	cancer	cancer	NOUN
bam-7423	89	25	in	in	ADP
bam-7423	89	26	iran	iran	PROPN
bam-7423	89	27	.	.	PUNCT
bam-7423	90	1	using	use	VERB
bam-7423	90	2	real	real	ADJ
bam-7423	90	3	time	time	NOUN
bam-7423	90	4	pcr	pcr	NOUN
bam-7423	90	5	based	base	VERB
bam-7423	90	6	upon	upon	SCONJ
bam-7423	90	7	cyber	cyber	NOUN
bam-7423	90	8	-	-	PUNCT
bam-7423	90	9	green	green	NOUN
bam-7423	90	10	of	of	ADP
bam-7423	90	11	rprm	rprm	ADJ
bam-7423	90	12	gene	gene	NOUN
bam-7423	90	13	expression	expression	NOUN
bam-7423	90	14	and	and	CCONJ
bam-7423	90	15	utilizing	utilize	VERB
bam-7423	90	16	ms	ms	ADJ
bam-7423	90	17	-	-	PUNCT
bam-7423	90	18	pcr	pcr	ADJ
bam-7423	90	19	technique	technique	NOUN
bam-7423	90	20	,	,	PUNCT
bam-7423	90	21	the	the	DET
bam-7423	90	22	methylation	methylation	NOUN
bam-7423	90	23	status	status	NOUN
bam-7423	90	24	of	of	ADP
bam-7423	90	25	reprimo	reprimo	ADJ
bam-7423	90	26	gene	gene	NOUN
bam-7423	90	27	promoter	promoter	NOUN
bam-7423	90	28	was	be	AUX
bam-7423	90	29	studied	study	VERB
bam-7423	90	30	.	.	PUNCT
bam-7423	91	1	as	as	SCONJ
bam-7423	91	2	the	the	DET
bam-7423	91	3	results	result	NOUN
bam-7423	91	4	of	of	ADP
bam-7423	91	5	this	this	DET
bam-7423	91	6	research	research	NOUN
bam-7423	91	7	showed	show	VERB
bam-7423	91	8	,	,	PUNCT
bam-7423	91	9	the	the	DET
bam-7423	91	10	expression	expression	NOUN
bam-7423	91	11	rate	rate	NOUN
bam-7423	91	12	of	of	ADP
bam-7423	91	13	rprm	rprm	ADJ
bam-7423	91	14	gene	gene	NOUN
bam-7423	91	15	in	in	ADP
bam-7423	91	16	the	the	DET
bam-7423	91	17	blood	blood	NOUN
bam-7423	91	18	samples	sample	NOUN
bam-7423	91	19	obtained	obtain	VERB
bam-7423	91	20	from	from	ADP
bam-7423	91	21	patients	patient	NOUN
bam-7423	91	22	is	be	AUX
bam-7423	91	23	much	much	ADV
bam-7423	91	24	less	less	ADJ
bam-7423	91	25	than	than	ADP
bam-7423	91	26	what	what	PRON
bam-7423	91	27	is	be	AUX
bam-7423	91	28	observed	observe	VERB
bam-7423	91	29	in	in	ADP
bam-7423	91	30	normal	normal	ADJ
bam-7423	91	31	blood	blood	NOUN
bam-7423	91	32	samples	sample	NOUN
bam-7423	91	33	.	.	PUNCT
bam-7423	92	1	considering	consider	VERB
bam-7423	92	2	that	that	SCONJ
bam-7423	92	3	all	all	DET
bam-7423	92	4	patients	patient	NOUN
bam-7423	92	5	with	with	ADP
bam-7423	92	6	gastric	gastric	ADJ
bam-7423	92	7	cancer	cancer	NOUN
bam-7423	92	8	who	who	PRON
bam-7423	92	9	participated	participate	VERB
bam-7423	92	10	in	in	ADP
bam-7423	92	11	this	this	DET
bam-7423	92	12	study	study	NOUN
bam-7423	92	13	were	be	AUX
bam-7423	92	14	in	in	ADP
bam-7423	92	15	the	the	DET
bam-7423	92	16	early	early	ADJ
bam-7423	92	17	stages	stage	NOUN
bam-7423	92	18	of	of	ADP
bam-7423	92	19	cancer	cancer	NOUN
bam-7423	92	20	,	,	PUNCT
bam-7423	92	21	based	base	VERB
bam-7423	92	22	on	on	ADP
bam-7423	92	23	our	our	PRON
bam-7423	92	24	results	result	NOUN
bam-7423	92	25	,	,	PUNCT
bam-7423	92	26	the	the	DET
bam-7423	92	27	study	study	NOUN
bam-7423	92	28	of	of	ADP
bam-7423	92	29	reprimo	reprimo	ADJ
bam-7423	92	30	gene	gene	NOUN
bam-7423	92	31	hypermethylation	hypermethylation	NOUN
bam-7423	92	32	can	can	AUX
bam-7423	92	33	be	be	AUX
bam-7423	92	34	useful	useful	ADJ
bam-7423	92	35	in	in	ADP
bam-7423	92	36	early	early	ADJ
bam-7423	92	37	diagnosis	diagnosis	NOUN
bam-7423	92	38	of	of	ADP
bam-7423	92	39	gastric	gastric	ADJ
bam-7423	92	40	cancer	cancer	NOUN
bam-7423	92	41	.	.	PUNCT
bam-7423	93	1	our	our	PRON
bam-7423	93	2	results	result	NOUN
bam-7423	93	3	are	be	AUX
bam-7423	93	4	in	in	ADP
bam-7423	93	5	line	line	NOUN
bam-7423	93	6	with	with	ADP
bam-7423	93	7	those	those	PRON
bam-7423	93	8	reported	report	VERB
bam-7423	93	9	by	by	ADP
bam-7423	93	10	kathleen	kathleen	PROPN
bam-7423	93	11	saavedra	saavedra	PROPN
bam-7423	93	12	et	et	PROPN
bam-7423	93	13	al	al	PROPN
bam-7423	93	14	.	.	PUNCT
bam-7423	94	1	pointing	point	VERB
bam-7423	94	2	that	that	PRON
bam-7423	94	3	reprimo	reprimo	VERB
bam-7423	94	4	gene	gene	NOUN
bam-7423	94	5	is	be	AUX
bam-7423	94	6	a	a	DET
bam-7423	94	7	tumor	tumor	NOUN
bam-7423	94	8	repressor	repressor	NOUN
bam-7423	94	9	and	and	CCONJ
bam-7423	94	10	its	its	PRON
bam-7423	94	11	methylation	methylation	NOUN
bam-7423	94	12	in	in	ADP
bam-7423	94	13	the	the	DET
bam-7423	94	14	blood	blood	NOUN
bam-7423	94	15	samples	sample	NOUN
bam-7423	94	16	obtained	obtain	VERB
bam-7423	94	17	from	from	ADP
bam-7423	94	18	those	those	PRON
bam-7423	94	19	suffering	suffer	VERB
bam-7423	94	20	with	with	ADP
bam-7423	94	21	gastric	gastric	ADJ
bam-7423	94	22	cancer	cancer	NOUN
bam-7423	94	23	is	be	AUX
bam-7423	94	24	much	much	ADV
bam-7423	94	25	higer	hig	ADJ
bam-7423	94	26	than	than	ADP
bam-7423	94	27	what	what	PRON
bam-7423	94	28	we	we	PRON
bam-7423	94	29	see	see	VERB
bam-7423	94	30	in	in	ADP
bam-7423	94	31	healthy	healthy	ADJ
bam-7423	94	32	individuals	individual	NOUN
bam-7423	94	33	(	(	PUNCT
bam-7423	94	34	45.7	45.7	NUM
bam-7423	94	35	%	%	NOUN
bam-7423	94	36	of	of	ADP
bam-7423	94	37	patients	patient	NOUN
bam-7423	94	38	constituting	constitute	VERB
bam-7423	94	39	a	a	DET
bam-7423	94	40	significant	significant	ADJ
bam-7423	94	41	correlation	correlation	NOUN
bam-7423	94	42	)	)	PUNCT
bam-7423	94	43	.	.	PUNCT
bam-7423	95	1	it	it	PRON
bam-7423	95	2	can	can	AUX
bam-7423	95	3	also	also	ADV
bam-7423	95	4	act	act	VERB
bam-7423	95	5	as	as	ADP
bam-7423	95	6	a	a	DET
bam-7423	95	7	biomarker	biomarker	NOUN
bam-7423	95	8	for	for	ADP
bam-7423	95	9	early	early	ADJ
bam-7423	95	10	diagnosis	diagnosis	NOUN
bam-7423	95	11	of	of	ADP
bam-7423	95	12	gastric	gastric	ADJ
bam-7423	95	13	cancer	cancer	NOUN
bam-7423	95	14	.	.	PUNCT
bam-7423	96	1	there	there	PRON
bam-7423	96	2	is	be	VERB
bam-7423	96	3	also	also	ADV
bam-7423	96	4	a	a	DET
bam-7423	96	5	significant	significant	ADJ
bam-7423	96	6	correlation	correlation	NOUN
bam-7423	96	7	between	between	ADP
bam-7423	96	8	expression	expression	NOUN
bam-7423	96	9	rate	rate	NOUN
bam-7423	96	10	of	of	ADP
bam-7423	96	11	reprimo	reprimo	VERB
bam-7423	96	12	and	and	CCONJ
bam-7423	96	13	the	the	DET
bam-7423	96	14	age	age	NOUN
bam-7423	96	15	of	of	ADP
bam-7423	96	16	people	people	NOUN
bam-7423	96	17	suffering	suffer	VERB
bam-7423	96	18	with	with	ADP
bam-7423	96	19	cancer	cancer	NOUN
bam-7423	96	20	and	and	CCONJ
bam-7423	96	21	the	the	DET
bam-7423	96	22	methylation	methylation	NOUN
bam-7423	96	23	status	status	NOUN
bam-7423	96	24	of	of	ADP
bam-7423	96	25	its	its	PRON
bam-7423	96	26	promoter	promoter	NOUN
bam-7423	96	27	.	.	PUNCT
bam-7423	97	1	on	on	ADP
bam-7423	97	2	the	the	DET
bam-7423	97	3	hoter	hoter	NOUN
bam-7423	97	4	hand	hand	NOUN
bam-7423	97	5	,	,	PUNCT
bam-7423	97	6	the	the	DET
bam-7423	97	7	correlation	correlation	NOUN
bam-7423	97	8	between	between	ADP
bam-7423	97	9	the	the	DET
bam-7423	97	10	expression	expression	NOUN
bam-7423	97	11	rate	rate	NOUN
bam-7423	97	12	of	of	ADP
bam-7423	97	13	reprimo	reprimo	ADJ
bam-7423	97	14	gene	gene	NOUN
bam-7423	97	15	and	and	CCONJ
bam-7423	97	16	the	the	DET
bam-7423	97	17	gender	gender	NOUN
bam-7423	97	18	of	of	ADP
bam-7423	97	19	those	those	PRON
bam-7423	97	20	suffering	suffer	VERB
bam-7423	97	21	with	with	ADP
bam-7423	97	22	cancer	cancer	NOUN
bam-7423	97	23	was	be	AUX
bam-7423	97	24	far	far	ADV
bam-7423	97	25	from	from	ADP
bam-7423	97	26	being	be	AUX
bam-7423	97	27	significant	significant	ADJ
bam-7423	97	28	.	.	PUNCT
bam-7423	98	1	non	non	PROPN
bam-7423	98	2	co	co	PROPN
bam-7423	98	3	mmerc	mmerc	PROPN
bam-7423	98	4	ial	ial	PROPN
bam-7423	98	5	us	us	PROPN
bam-7423	98	6	e	e	NOUN
bam-7423	98	7	o	o	NOUN
bam-7423	98	8	nly	nly	ADV
bam-7423	98	9	reprimo	reprimo	VERB
bam-7423	98	10	gene	gene	NOUN
bam-7423	98	11	in	in	ADP
bam-7423	98	12	gastric	gastric	ADJ
bam-7423	98	13	cancer	cancer	NOUN
bam-7423	98	14	eur	eur	PROPN
bam-7423	98	15	j	j	PROPN
bam-7423	98	16	transl	transl	PROPN
bam-7423	98	17	myol	myol	ADV
bam-7423	98	18	28	28	NUM
bam-7423	98	19	(	(	PUNCT
bam-7423	98	20	2	2	NUM
bam-7423	98	21	):	):	PUNCT
bam-7423	98	22	226	226	NUM
bam-7423	98	23	-	-	SYM
bam-7423	98	24	232	232	NUM
bam-7423	98	25	,	,	PUNCT
bam-7423	98	26	2018	2018	NUM
bam-7423	98	27	7	7	NUM
bam-7423	98	28	list	list	NOUN
bam-7423	98	29	of	of	ADP
bam-7423	98	30	acronyms	acronym	NOUN
bam-7423	98	31	mmulv	mmulv	PROPN
bam-7423	98	32	moloney	moloney	PROPN
bam-7423	98	33	murine	murine	PROPN
bam-7423	98	34	leukemia	leukemia	PROPN
bam-7423	98	35	virus	virus	NOUN
bam-7423	98	36	ms	ms	ADJ
bam-7423	98	37	-	-	PUNCT
bam-7423	98	38	pcr	pcr	PROPN
bam-7423	98	39	methylation	methylation	NOUN
bam-7423	98	40	specific	specific	ADJ
bam-7423	98	41	-	-	PUNCT
bam-7423	98	42	pcr	pcr	ADJ
bam-7423	98	43	rprm	rprm	NOUN
bam-7423	98	44	reprimo	reprimo	NOUN
bam-7423	98	45	,	,	PUNCT
bam-7423	98	46	tp53	tp53	PROPN
bam-7423	98	47	dependent	dependent	ADJ
bam-7423	98	48	g2	g2	PROPN
bam-7423	98	49	arrest	arrest	NOUN
bam-7423	98	50	mediator	mediator	NOUN
bam-7423	98	51	homolog	homolog	NOUN
bam-7423	98	52	rq	rq	VERB
bam-7423	98	53	quantification	quantification	NOUN
bam-7423	98	54	relative	relative	ADJ
bam-7423	98	55	author	author	NOUN
bam-7423	98	56	’s	’s	PART
bam-7423	98	57	contributions	contribution	NOUN
bam-7423	98	58	each	each	DET
bam-7423	98	59	author	author	NOUN
bam-7423	98	60	contributed	contribute	VERB
bam-7423	98	61	in	in	ADP
bam-7423	98	62	equal	equal	ADJ
bam-7423	98	63	part	part	NOUN
bam-7423	98	64	to	to	ADP
bam-7423	98	65	the	the	DET
bam-7423	98	66	manuscript	manuscript	NOUN
bam-7423	98	67	.	.	PUNCT
bam-7423	99	1	acknowledgments	acknowledgment	NOUN
bam-7423	99	2	the	the	DET
bam-7423	99	3	authors	author	NOUN
bam-7423	99	4	thank	thank	VERB
bam-7423	99	5	professors	professor	NOUN
bam-7423	99	6	(	(	PUNCT
bam-7423	99	7	east	east	PROPN
bam-7423	99	8	tehran	tehran	PROPN
bam-7423	99	9	branch	branch	PROPN
bam-7423	99	10	,	,	PUNCT
bam-7423	99	11	islamic	islamic	PROPN
bam-7423	99	12	azad	azad	PROPN
bam-7423	99	13	university	university	PROPN
bam-7423	99	14	)	)	PUNCT
bam-7423	99	15	for	for	ADP
bam-7423	99	16	their	their	PRON
bam-7423	99	17	skilled	skilled	ADJ
bam-7423	99	18	technical	technical	ADJ
bam-7423	99	19	assistance	assistance	NOUN
bam-7423	99	20	.	.	PUNCT
bam-7423	100	1	funding	funding	NOUN
bam-7423	100	2	:	:	PUNCT
bam-7423	100	3	none	none	NOUN
bam-7423	100	4	conflict	conflict	NOUN
bam-7423	100	5	of	of	ADP
bam-7423	100	6	interest	interest	NOUN
bam-7423	100	7	the	the	DET
bam-7423	100	8	authors	author	NOUN
bam-7423	100	9	declare	declare	VERB
bam-7423	100	10	no	no	DET
bam-7423	100	11	conflicts	conflict	NOUN
bam-7423	100	12	of	of	ADP
bam-7423	100	13	interests	interest	NOUN
bam-7423	100	14	.	.	PUNCT
bam-7423	101	1	ethical	ethical	ADJ
bam-7423	101	2	publication	publication	NOUN
bam-7423	101	3	statement	statement	NOUN
bam-7423	101	4	we	we	PRON
bam-7423	101	5	confirm	confirm	VERB
bam-7423	101	6	that	that	SCONJ
bam-7423	101	7	we	we	PRON
bam-7423	101	8	have	have	AUX
bam-7423	101	9	read	read	VERB
bam-7423	101	10	the	the	DET
bam-7423	101	11	journal	journal	NOUN
bam-7423	101	12	’s	’s	PART
bam-7423	101	13	position	position	NOUN
bam-7423	101	14	on	on	ADP
bam-7423	101	15	issues	issue	NOUN
bam-7423	101	16	involved	involve	VERB
bam-7423	101	17	in	in	ADP
bam-7423	101	18	ethical	ethical	ADJ
bam-7423	101	19	publication	publication	NOUN
bam-7423	101	20	and	and	CCONJ
bam-7423	101	21	affirm	affirm	NOUN
bam-7423	101	22	that	that	SCONJ
bam-7423	101	23	this	this	DET
bam-7423	101	24	report	report	NOUN
bam-7423	101	25	is	be	AUX
bam-7423	101	26	consistent	consistent	ADJ
bam-7423	101	27	with	with	ADP
bam-7423	101	28	those	those	DET
bam-7423	101	29	guidelines	guideline	NOUN
bam-7423	101	30	.	.	PUNCT
bam-7423	102	1	corresponding	correspond	VERB
bam-7423	102	2	author	author	PROPN
bam-7423	102	3	amin	amin	PROPN
bam-7423	102	4	abbasi	abbasi	PROPN
bam-7423	102	5	,	,	PUNCT
bam-7423	102	6	department	department	NOUN
bam-7423	102	7	of	of	ADP
bam-7423	102	8	biology	biology	NOUN
bam-7423	102	9	,	,	PUNCT
bam-7423	102	10	east	east	PROPN
bam-7423	102	11	tehran	tehran	PROPN
bam-7423	102	12	branch	branch	PROPN
bam-7423	102	13	,	,	PUNCT
bam-7423	102	14	islamic	islamic	PROPN
bam-7423	102	15	azad	azad	PROPN
bam-7423	102	16	university	university	PROPN
bam-7423	102	17	,	,	PUNCT
bam-7423	102	18	tehran	tehran	PROPN
bam-7423	102	19	,	,	PUNCT
bam-7423	102	20	iran	iran	PROPN
bam-7423	102	21	.	.	PUNCT
bam-7423	103	1	phone	phone	NOUN
bam-7423	103	2	:	:	PUNCT
bam-7423	103	3	+989032721145	+989032721145	X
bam-7423	103	4	and	and	CCONJ
bam-7423	103	5	+33666942434	+33666942434	NUM
bam-7423	103	6	email	email	NOUN
bam-7423	103	7	:	:	PUNCT
bam-7423	103	8	aminabbasi1989@yahoo.com	aminabbasi1989@yahoo.com	X
bam-7423	104	1	e	e	NOUN
bam-7423	105	1	-	-	NOUN
bam-7423	105	2	mail	mail	NOUN
bam-7423	105	3	of	of	ADP
bam-7423	105	4	co	co	NOUN
bam-7423	105	5	-	-	NOUN
bam-7423	105	6	author	author	NOUN
bam-7423	105	7	sahar	sahar	PROPN
bam-7423	105	8	heydari	heydari	PROPN
bam-7423	105	9	:	:	PUNCT
bam-7423	105	10	s.heydari1989@gmail.com	s.heydari1989@gmail.com	X
bam-7423	105	11	references	reference	NOUN
bam-7423	105	12	1	1	NUM
bam-7423	105	13	.	.	PUNCT
bam-7423	105	14	sandoval	sandoval	NOUN
bam-7423	105	15	-	-	PUNCT
bam-7423	105	16	bórquez	bórquez	PROPN
bam-7423	105	17	a	a	NOUN
bam-7423	105	18	,	,	PUNCT
bam-7423	105	19	saavedra	saavedra	PROPN
bam-7423	105	20	k	k	PROPN
bam-7423	105	21	,	,	PUNCT
bam-7423	105	22	carrasco	carrasco	PROPN
bam-7423	105	23	-	-	PUNCT
bam-7423	105	24	avino	avino	PROPN
bam-7423	105	25	g	g	PROPN
bam-7423	105	26	,	,	PUNCT
bam-7423	105	27	garcia	garcia	PROPN
bam-7423	105	28	-	-	PUNCT
bam-7423	105	29	bloj	bloj	PROPN
bam-7423	105	30	b	b	PROPN
bam-7423	105	31	,	,	PUNCT
bam-7423	105	32	fry	fry	PROPN
bam-7423	105	33	j	j	PROPN
bam-7423	105	34	,	,	PUNCT
bam-7423	105	35	wichmann	wichmann	PROPN
bam-7423	105	36	i	i	PRON
bam-7423	105	37	,	,	PUNCT
bam-7423	105	38	corvalán	corvalán	VERB
bam-7423	105	39	ah	ah	INTJ
bam-7423	105	40	.	.	PUNCT
bam-7423	106	1	noncoding	noncode	VERB
bam-7423	106	2	genomics	genomic	NOUN
bam-7423	106	3	in	in	ADP
bam-7423	106	4	gastric	gastric	ADJ
bam-7423	106	5	cancer	cancer	NOUN
bam-7423	106	6	and	and	CCONJ
bam-7423	106	7	the	the	DET
bam-7423	106	8	gastric	gastric	ADJ
bam-7423	106	9	precancerous	precancerous	ADJ
bam-7423	106	10	cascade	cascade	NOUN
bam-7423	106	11	:	:	PUNCT
bam-7423	106	12	pathogenesis	pathogenesis	NOUN
bam-7423	106	13	and	and	CCONJ
bam-7423	106	14	biomarkers	biomarker	NOUN
bam-7423	106	15	.	.	PUNCT
bam-7423	107	1	dis	dis	PROPN
bam-7423	107	2	markers	marker	VERB
bam-7423	107	3	2015	2015	NUM
bam-7423	107	4	;	;	PUNCT
bam-7423	107	5	2015	2015	NUM
bam-7423	107	6	:	:	PUNCT
bam-7423	107	7	503762	503762	NUM
bam-7423	107	8	.	.	PUNCT
bam-7423	108	1	2	2	X
bam-7423	108	2	.	.	X
bam-7423	108	3	ikeda	ikeda	PROPN
bam-7423	108	4	f	f	PROPN
bam-7423	108	5	,	,	PUNCT
bam-7423	108	6	doi	doi	X
bam-7423	108	7	y	y	PROPN
bam-7423	108	8	,	,	PUNCT
bam-7423	108	9	yonemoto	yonemoto	NOUN
bam-7423	108	10	k	k	PROPN
bam-7423	108	11	,	,	PUNCT
bam-7423	108	12	et	et	PROPN
bam-7423	108	13	al	al	PROPN
bam-7423	108	14	.	.	PUNCT
bam-7423	108	15	hyperglycemia	hyperglycemia	NOUN
bam-7423	108	16	increases	increase	VERB
bam-7423	108	17	risk	risk	NOUN
bam-7423	108	18	of	of	ADP
bam-7423	108	19	gastric	gastric	ADJ
bam-7423	108	20	cancer	cancer	NOUN
bam-7423	108	21	posed	pose	VERB
bam-7423	108	22	by	by	ADP
bam-7423	108	23	helicobacter	helicobacter	NOUN
bam-7423	108	24	pylori	pylori	ADJ
bam-7423	108	25	infection	infection	NOUN
bam-7423	108	26	:	:	PUNCT
bam-7423	108	27	a	a	DET
bam-7423	108	28	population	population	NOUN
bam-7423	108	29	-	-	PUNCT
bam-7423	108	30	based	base	VERB
bam-7423	108	31	cohort	cohort	NOUN
bam-7423	108	32	study	study	NOUN
bam-7423	108	33	.	.	PUNCT
bam-7423	109	1	gastroenterology	gastroenterology	NOUN
bam-7423	109	2	2009;136:1234	2009;136:1234	NUM
bam-7423	109	3	-	-	SYM
bam-7423	109	4	41	41	NUM
bam-7423	109	5	.	.	PUNCT
bam-7423	110	1	3	3	X
bam-7423	110	2	.	.	X
bam-7423	110	3	baylin	baylin	PROPN
bam-7423	110	4	sb	sb	PROPN
bam-7423	110	5	,	,	PUNCT
bam-7423	110	6	esteller	esteller	PROPN
bam-7423	110	7	m	m	PROPN
bam-7423	110	8	,	,	PUNCT
bam-7423	110	9	rountree	rountree	PROPN
bam-7423	110	10	mr	mr	PROPN
bam-7423	110	11	,	,	PUNCT
bam-7423	110	12	et	et	PROPN
bam-7423	110	13	al	al	PROPN
bam-7423	110	14	.	.	PROPN
bam-7423	111	1	aberrant	aberrant	ADJ
bam-7423	111	2	patterns	pattern	NOUN
bam-7423	111	3	of	of	ADP
bam-7423	111	4	dna	dna	PROPN
bam-7423	111	5	methylation	methylation	NOUN
bam-7423	111	6	,	,	PUNCT
bam-7423	111	7	chromatin	chromatin	NOUN
bam-7423	111	8	formation	formation	NOUN
bam-7423	111	9	and	and	CCONJ
bam-7423	111	10	gene	gene	NOUN
bam-7423	111	11	expression	expression	NOUN
bam-7423	111	12	in	in	ADP
bam-7423	111	13	cancer	cancer	NOUN
bam-7423	111	14	.	.	PUNCT
bam-7423	112	1	hum	hum	PROPN
bam-7423	112	2	mol	mol	ADP
bam-7423	112	3	genet	genet	PROPN
bam-7423	112	4	2001;10:687	2001;10:687	PROPN
bam-7423	112	5	-	-	SYM
bam-7423	112	6	92	92	NUM
bam-7423	112	7	.	.	PUNCT
bam-7423	113	1	4	4	X
bam-7423	113	2	.	.	X
bam-7423	113	3	corvalan	corvalan	VERB
bam-7423	113	4	ah	ah	INTJ
bam-7423	113	5	,	,	PUNCT
bam-7423	113	6	garrido	garrido	PROPN
bam-7423	113	7	m	m	PROPN
bam-7423	113	8	,	,	PUNCT
bam-7423	113	9	maturana	maturana	PROPN
bam-7423	113	10	mj	mj	PROPN
bam-7423	113	11	,	,	PUNCT
bam-7423	113	12	et	et	PROPN
bam-7423	113	13	al	al	PROPN
bam-7423	113	14	.	.	PROPN
bam-7423	113	15	su1987	su1987	PROPN
bam-7423	113	16	methylated	methylate	VERB
bam-7423	113	17	reprimo	reprimo	VERB
bam-7423	113	18	in	in	ADP
bam-7423	113	19	cell	cell	NOUN
bam-7423	113	20	-	-	PUNCT
bam-7423	113	21	free	free	ADJ
bam-7423	113	22	dna	dna	NOUN
bam-7423	113	23	(	(	PUNCT
bam-7423	113	24	rprm	rprm	ADJ
bam-7423	113	25	)	)	PUNCT
bam-7423	113	26	in	in	ADP
bam-7423	113	27	comparison	comparison	NOUN
bam-7423	113	28	with	with	ADP
bam-7423	113	29	cea	cea	PROPN
bam-7423	113	30	and	and	CCONJ
bam-7423	113	31	ca	ca	PROPN
bam-7423	113	32	19	19	NUM
bam-7423	113	33	-	-	SYM
bam-7423	113	34	9	9	NUM
bam-7423	113	35	as	as	ADP
bam-7423	113	36	a	a	DET
bam-7423	113	37	tumor	tumor	NOUN
bam-7423	113	38	marker	marker	NOUN
bam-7423	113	39	in	in	ADP
bam-7423	113	40	gastric	gastric	ADJ
bam-7423	113	41	cancer	cancer	NOUN
bam-7423	113	42	.	.	PUNCT
bam-7423	114	1	gastroenterology	gastroenterology	NOUN
bam-7423	114	2	2015;148	2015;148	PROPN
bam-7423	114	3	:	:	PUNCT
bam-7423	114	4	s-568	s-568	NOUN
bam-7423	114	5	.	.	PROPN
bam-7423	115	1	5	5	NUM
bam-7423	115	2	.	.	X
bam-7423	115	3	costello	costello	PROPN
bam-7423	115	4	jf	jf	PROPN
bam-7423	115	5	,	,	PUNCT
bam-7423	115	6	frühwald	frühwald	PROPN
bam-7423	115	7	mc	mc	PROPN
bam-7423	115	8	,	,	PUNCT
bam-7423	115	9	smiraglia	smiraglia	PROPN
bam-7423	115	10	dj	dj	PROPN
bam-7423	115	11	,	,	PUNCT
bam-7423	115	12	et	et	PROPN
bam-7423	115	13	al	al	PROPN
bam-7423	115	14	.	.	PROPN
bam-7423	115	15	aberrant	aberrant	PROPN
bam-7423	115	16	cpg	cpg	PROPN
bam-7423	115	17	-	-	PUNCT
bam-7423	115	18	island	island	NOUN
bam-7423	115	19	methylation	methylation	NOUN
bam-7423	115	20	has	have	VERB
bam-7423	115	21	non	non	ADJ
bam-7423	115	22	-	-	ADJ
bam-7423	115	23	random	random	ADJ
bam-7423	115	24	and	and	CCONJ
bam-7423	115	25	tumour	tumour	NOUN
bam-7423	115	26	-	-	PUNCT
bam-7423	115	27	type	type	NOUN
bam-7423	115	28	-	-	PUNCT
bam-7423	115	29	specific	specific	ADJ
bam-7423	115	30	patterns	pattern	NOUN
bam-7423	115	31	.	.	PUNCT
bam-7423	116	1	nat	nat	PROPN
bam-7423	116	2	genet	genet	PROPN
bam-7423	116	3	2000;24:132	2000;24:132	PROPN
bam-7423	116	4	.	.	PROPN
bam-7423	116	5	6	6	NUM
bam-7423	116	6	.	.	X
bam-7423	117	1	elimova	elimova	PROPN
bam-7423	117	2	e	e	NOUN
bam-7423	117	3	,	,	PUNCT
bam-7423	117	4	wadhwa	wadhwa	PROPN
bam-7423	117	5	r	r	PROPN
bam-7423	117	6	,	,	PUNCT
bam-7423	117	7	shiozaki	shiozaki	PROPN
bam-7423	117	8	h	h	PROPN
bam-7423	117	9	,	,	PUNCT
bam-7423	117	10	et	et	PROPN
bam-7423	117	11	al	al	PROPN
bam-7423	117	12	.	.	PUNCT
bam-7423	118	1	molecular	molecular	ADJ
bam-7423	118	2	biomarkers	biomarker	NOUN
bam-7423	118	3	in	in	ADP
bam-7423	118	4	gastric	gastric	ADJ
bam-7423	118	5	cancer	cancer	NOUN
bam-7423	118	6	.	.	PUNCT
bam-7423	119	1	j	j	PROPN
bam-7423	119	2	natl	natl	PROPN
bam-7423	119	3	compr	compr	PROPN
bam-7423	119	4	canc	canc	PROPN
bam-7423	119	5	netw	netw	PROPN
bam-7423	119	6	2015;13	2015;13	NUM
bam-7423	119	7	:	:	PUNCT
bam-7423	119	8	e19	e19	NOUN
bam-7423	119	9	-	-	PUNCT
bam-7423	119	10	29	29	NUM
bam-7423	119	11	.	.	PUNCT
bam-7423	120	1	7	7	X
bam-7423	120	2	.	.	X
bam-7423	120	3	ohki	ohki	PROPN
bam-7423	120	4	r	r	PROPN
bam-7423	120	5	,	,	PUNCT
bam-7423	120	6	nemoto	nemoto	PROPN
bam-7423	120	7	j	j	PROPN
bam-7423	120	8	,	,	PUNCT
bam-7423	120	9	murasawa	murasawa	PROPN
bam-7423	120	10	h	h	PROPN
bam-7423	120	11	,	,	PUNCT
bam-7423	121	1	et	et	PROPN
bam-7423	121	2	al	al	PROPN
bam-7423	121	3	.	.	PROPN
bam-7423	121	4	reprimo	reprimo	PROPN
bam-7423	121	5	,	,	PUNCT
bam-7423	121	6	a	a	DET
bam-7423	121	7	new	new	ADJ
bam-7423	121	8	candidate	candidate	NOUN
bam-7423	121	9	mediator	mediator	NOUN
bam-7423	121	10	of	of	ADP
bam-7423	121	11	the	the	DET
bam-7423	121	12	p53	p53	NOUN
bam-7423	121	13	-	-	PUNCT
bam-7423	121	14	mediated	mediate	VERB
bam-7423	121	15	cell	cell	NOUN
bam-7423	121	16	cycle	cycle	NOUN
bam-7423	121	17	arrest	arrest	NOUN
bam-7423	121	18	at	at	ADP
bam-7423	121	19	the	the	DET
bam-7423	121	20	g2	g2	PROPN
bam-7423	121	21	phase	phase	NOUN
bam-7423	121	22	.	.	PUNCT
bam-7423	122	1	j	j	PROPN
bam-7423	122	2	biol	biol	PROPN
bam-7423	122	3	chem	chem	NOUN
bam-7423	122	4	2000;275:22627	2000;275:22627	NUM
bam-7423	122	5	-	-	SYM
bam-7423	122	6	30	30	NUM
bam-7423	122	7	.	.	NOUN
bam-7423	122	8	8	8	NUM
bam-7423	122	9	.	.	PUNCT
bam-7423	123	1	ooki	ooki	PROPN
bam-7423	123	2	a	a	PRON
bam-7423	123	3	,	,	PUNCT
bam-7423	123	4	yamashita	yamashita	PROPN
bam-7423	123	5	k	k	PROPN
bam-7423	123	6	,	,	PUNCT
bam-7423	123	7	yamaguchi	yamaguchi	PROPN
bam-7423	123	8	k	k	PROPN
bam-7423	123	9	,	,	PUNCT
bam-7423	123	10	et	et	PROPN
bam-7423	123	11	al	al	PROPN
bam-7423	123	12	.	.	PROPN
bam-7423	123	13	dna	dna	PROPN
bam-7423	123	14	damage	damage	NOUN
bam-7423	123	15	-	-	PUNCT
bam-7423	123	16	inducible	inducible	ADJ
bam-7423	123	17	gene	gene	NOUN
bam-7423	123	18	,	,	PUNCT
bam-7423	123	19	reprimo	reprimo	VERB
bam-7423	123	20	functions	function	NOUN
bam-7423	123	21	as	as	ADP
bam-7423	123	22	a	a	DET
bam-7423	123	23	tumor	tumor	NOUN
bam-7423	123	24	-	-	PUNCT
bam-7423	123	25	suppressor	suppressor	NOUN
bam-7423	123	26	and	and	CCONJ
bam-7423	123	27	is	be	AUX
bam-7423	123	28	suppressed	suppress	VERB
bam-7423	123	29	by	by	ADP
bam-7423	123	30	promoter	promoter	NOUN
bam-7423	123	31	methylation	methylation	NOUN
bam-7423	123	32	in	in	ADP
bam-7423	123	33	gastric	gastric	ADJ
bam-7423	123	34	cancer	cancer	NOUN
bam-7423	123	35	.	.	PUNCT
bam-7423	124	1	mol	mol	ADP
bam-7423	124	2	cancer	cancer	NOUN
bam-7423	124	3	res	re	NOUN
bam-7423	124	4	2013	2013	NUM
bam-7423	124	5	aug	aug	NOUN
bam-7423	124	6	27	27	NUM
bam-7423	124	7	:	:	PUNCT
bam-7423	124	8	molcanres-0091	molcanres-0091	ADJ
bam-7423	124	9	.	.	PUNCT
bam-7423	125	1	9	9	X
bam-7423	125	2	.	.	X
bam-7423	125	3	saavedra	saavedra	PROPN
bam-7423	125	4	k	k	PROPN
bam-7423	125	5	,	,	PUNCT
bam-7423	125	6	valbuena	valbuena	PROPN
bam-7423	125	7	j	j	PROPN
bam-7423	125	8	,	,	PUNCT
bam-7423	125	9	olivares	olivares	PROPN
bam-7423	125	10	w	w	PROPN
bam-7423	125	11	,	,	PUNCT
bam-7423	125	12	et	et	PROPN
bam-7423	125	13	al	al	PROPN
bam-7423	125	14	.	.	PUNCT
bam-7423	125	15	loss	loss	NOUN
bam-7423	125	16	of	of	ADP
bam-7423	125	17	expression	expression	NOUN
bam-7423	125	18	of	of	ADP
bam-7423	125	19	reprimo	reprimo	PROPN
bam-7423	125	20	,	,	PUNCT
bam-7423	125	21	a	a	DET
bam-7423	125	22	p53	p53	NOUN
bam-7423	125	23	-	-	PUNCT
bam-7423	125	24	induced	induce	VERB
bam-7423	125	25	cell	cell	NOUN
bam-7423	125	26	cycle	cycle	NOUN
bam-7423	125	27	arrest	arrest	NOUN
bam-7423	125	28	gene	gene	NOUN
bam-7423	125	29	,	,	PUNCT
bam-7423	125	30	correlates	correlate	VERB
bam-7423	125	31	with	with	ADP
bam-7423	125	32	invasive	invasive	ADJ
bam-7423	125	33	stage	stage	NOUN
bam-7423	125	34	of	of	ADP
bam-7423	125	35	tumor	tumor	NOUN
bam-7423	125	36	progression	progression	NOUN
bam-7423	125	37	and	and	CCONJ
bam-7423	125	38	p73	p73	NOUN
bam-7423	125	39	expression	expression	NOUN
bam-7423	125	40	in	in	ADP
bam-7423	125	41	gastric	gastric	ADJ
bam-7423	125	42	cancer	cancer	NOUN
bam-7423	125	43	.	.	PUNCT
bam-7423	126	1	plos	plos	PROPN
bam-7423	126	2	one	one	NUM
bam-7423	126	3	2015;10	2015;10	NUM
bam-7423	126	4	:	:	PUNCT
bam-7423	126	5	e0125834	e0125834	NOUN
bam-7423	126	6	.	.	PROPN
bam-7423	126	7	10	10	NUM
bam-7423	126	8	.	.	PUNCT
bam-7423	127	1	kelley	kelley	PROPN
bam-7423	127	2	jr	jr	PROPN
bam-7423	127	3	,	,	PUNCT
bam-7423	127	4	duggan	duggan	PROPN
bam-7423	127	5	jm	jm	PROPN
bam-7423	127	6	.	.	PROPN
bam-7423	127	7	gastric	gastric	ADJ
bam-7423	127	8	cancer	cancer	NOUN
bam-7423	127	9	epidemiology	epidemiology	NOUN
bam-7423	127	10	and	and	CCONJ
bam-7423	127	11	risk	risk	NOUN
bam-7423	127	12	factors	factor	NOUN
bam-7423	127	13	.	.	PUNCT
bam-7423	128	1	j	j	PROPN
bam-7423	128	2	clin	clin	PROPN
bam-7423	128	3	epidemiol	epidemiol	PROPN
bam-7423	128	4	2003;56:1	2003;56:1	PROPN
bam-7423	128	5	-	-	PUNCT
bam-7423	128	6	9	9	NUM
bam-7423	128	7	.	.	NOUN
bam-7423	128	8	11	11	NUM
bam-7423	128	9	.	.	PUNCT
bam-7423	129	1	zhen	zhen	PROPN
bam-7423	129	2	zhen	zhen	PROPN
bam-7423	129	3	z	z	PROPN
bam-7423	129	4	,	,	PUNCT
bam-7423	129	5	si	si	PROPN
bam-7423	129	6	c	c	PROPN
bam-7423	129	7	,	,	PUNCT
bam-7423	129	8	yan	yan	PROPN
bam-7423	129	9	y	y	PROPN
bam-7423	129	10	,	,	PUNCT
bam-7423	129	11	et	et	PROPN
bam-7423	129	12	al	al	PROPN
bam-7423	129	13	.	.	PUNCT
bam-7423	130	1	autophagy	autophagy	PROPN
bam-7423	130	2	protects	protect	VERB
bam-7423	130	3	human	human	ADJ
bam-7423	130	4	gastric	gastric	ADJ
bam-7423	130	5	cancer	cancer	NOUN
bam-7423	130	6	cells	cell	NOUN
bam-7423	130	7	from	from	ADP
bam-7423	130	8	apoptosis	apoptosis	NOUN
bam-7423	130	9	induced	induce	VERB
bam-7423	130	10	by	by	ADP
bam-7423	130	11	the	the	DET
bam-7423	130	12	microtubule	microtubule	NOUN
bam-7423	130	13	-	-	PUNCT
bam-7423	130	14	targeting	target	VERB
bam-7423	130	15	agent	agent	NOUN
bam-7423	130	16	taxol	taxol	NOUN
bam-7423	130	17	.	.	PUNCT
bam-7423	131	1	http://europepmc.org/abstract/cba/646081	http://europepmc.org/abstract/cba/646081	PROPN
bam-7423	131	2	.	.	PUNCT
bam-7423	132	1	12	12	NUM
bam-7423	132	2	.	.	PUNCT
bam-7423	133	1	nomura	nomura	PROPN
bam-7423	133	2	s	s	PROPN
bam-7423	133	3	,	,	PUNCT
bam-7423	133	4	kaminishi	kaminishi	PROPN
bam-7423	133	5	m.	m.	NOUN
bam-7423	133	6	surgical	surgical	ADJ
bam-7423	133	7	treatment	treatment	NOUN
bam-7423	133	8	of	of	ADP
bam-7423	133	9	early	early	ADJ
bam-7423	133	10	gastric	gastric	ADJ
bam-7423	133	11	cancer	cancer	NOUN
bam-7423	133	12	,	,	PUNCT
bam-7423	133	13	digestive	digestive	ADJ
bam-7423	133	14	surgery	surgery	NOUN
bam-7423	133	15	2007;24:96	2007;24:96	NUM
bam-7423	133	16	-	-	SYM
bam-7423	133	17	100	100	NUM
bam-7423	133	18	.	.	PUNCT
bam-7423	133	19	13	13	NUM
bam-7423	133	20	.	.	PUNCT
bam-7423	134	1	shijian	shijian	PROPN
bam-7423	134	2	f	f	PROPN
bam-7423	134	3	,	,	PUNCT
bam-7423	134	4	li	li	PROPN
bam-7423	134	5	d	d	PROPN
bam-7423	134	6	,	,	PUNCT
bam-7423	134	7	wenbing	wenbe	VERB
bam-7423	134	8	z	z	PROPN
bam-7423	134	9	,	,	PUNCT
bam-7423	134	10	et	et	PROPN
bam-7423	134	11	al	al	PROPN
bam-7423	134	12	.	.	PROPN
bam-7423	134	13	histology	histology	NOUN
bam-7423	134	14	of	of	ADP
bam-7423	134	15	stomach	stomach	NOUN
bam-7423	134	16	and	and	CCONJ
bam-7423	134	17	liver	liver	NOUN
bam-7423	134	18	in	in	ADP
bam-7423	134	19	silurus	silurus	PROPN
bam-7423	134	20	meridionalis	meridionalis	PROPN
bam-7423	134	21	and	and	CCONJ
bam-7423	134	22	their	their	PRON
bam-7423	134	23	change	change	NOUN
bam-7423	134	24	during	during	ADP
bam-7423	134	25	starvation	starvation	NOUN
bam-7423	134	26	.	.	PUNCT
bam-7423	135	1	xinan	xinan	PROPN
bam-7423	135	2	shifan	shifan	PROPN
bam-7423	135	3	daxue	daxue	PROPN
bam-7423	135	4	xuebao	xuebao	PROPN
bam-7423	136	1	1999;24:336	1999;24:336	PROPN
bam-7423	136	2	-	-	PUNCT
bam-7423	136	3	42	42	NUM
bam-7423	136	4	.	.	PUNCT
bam-7423	137	1	14	14	NUM
bam-7423	137	2	.	.	PUNCT
bam-7423	138	1	sullivan	sullivan	PROPN
bam-7423	138	2	kd	kd	PROPN
bam-7423	138	3	,	,	PUNCT
bam-7423	138	4	gallant	gallant	NOUN
bam-7423	138	5	-	-	PUNCT
bam-7423	138	6	behm	behm	NOUN
bam-7423	138	7	cl	cl	NOUN
bam-7423	138	8	,	,	PUNCT
bam-7423	138	9	henry	henry	PROPN
bam-7423	138	10	re	re	PROPN
bam-7423	138	11	,	,	PUNCT
bam-7423	138	12	et	et	PROPN
bam-7423	138	13	al	al	PROPN
bam-7423	138	14	.	.	PUNCT
bam-7423	139	1	the	the	DET
bam-7423	139	2	p53	p53	NOUN
bam-7423	139	3	circuit	circuit	PROPN
bam-7423	139	4	board	board	PROPN
bam-7423	139	5	.	.	PUNCT
bam-7423	140	1	biochim	biochim	PROPN
bam-7423	140	2	biophysica	biophysica	PROPN
bam-7423	140	3	acta	acta	PROPN
bam-7423	140	4	(	(	PUNCT
bam-7423	140	5	bba)reviews	bba)reviews	PROPN
bam-7423	140	6	on	on	ADP
bam-7423	140	7	cancer	cancer	NOUN
bam-7423	140	8	2012;1825:229	2012;1825:229	PROPN
bam-7423	140	9	-	-	SYM
bam-7423	140	10	44	44	NUM
bam-7423	140	11	.	.	PUNCT
bam-7423	140	12	15	15	NUM
bam-7423	140	13	.	.	PUNCT
bam-7423	141	1	bernal	bernal	PROPN
bam-7423	141	2	c	c	PROPN
bam-7423	141	3	,	,	PUNCT
bam-7423	141	4	aguayo	aguayo	PROPN
bam-7423	141	5	f	f	PROPN
bam-7423	141	6	,	,	PUNCT
bam-7423	141	7	villarroel	villarroel	PROPN
bam-7423	141	8	c	c	NOUN
bam-7423	141	9	,	,	PUNCT
bam-7423	141	10	et	et	PROPN
bam-7423	141	11	al	al	PROPN
bam-7423	141	12	.	.	PROPN
bam-7423	141	13	reprimo	reprimo	VERB
bam-7423	141	14	as	as	ADP
bam-7423	141	15	a	a	DET
bam-7423	141	16	potential	potential	ADJ
bam-7423	141	17	biomarker	biomarker	NOUN
bam-7423	141	18	for	for	ADP
bam-7423	141	19	early	early	ADJ
bam-7423	141	20	detection	detection	NOUN
bam-7423	141	21	in	in	ADP
bam-7423	141	22	gastric	gastric	ADJ
bam-7423	141	23	cancer	cancer	NOUN
bam-7423	141	24	.	.	PUNCT
bam-7423	142	1	clin	clin	PROPN
bam-7423	142	2	cancer	cancer	NOUN
bam-7423	142	3	res	re	VERB
bam-7423	142	4	2008;14:6264	2008;14:6264	NUM
bam-7423	142	5	-	-	SYM
bam-7423	142	6	9	9	NUM
bam-7423	142	7	.	.	NOUN
bam-7423	142	8	16	16	NUM
bam-7423	142	9	.	.	PUNCT
bam-7423	143	1	takahashi	takahashi	PROPN
bam-7423	143	2	t	t	PROPN
bam-7423	143	3	,	,	PUNCT
bam-7423	143	4	suzuki	suzuki	PROPN
bam-7423	143	5	m	m	PROPN
bam-7423	143	6	,	,	PUNCT
bam-7423	143	7	shigematsu	shigematsu	ADJ
bam-7423	143	8	h	h	NOUN
bam-7423	143	9	,	,	PUNCT
bam-7423	143	10	et	et	PROPN
bam-7423	143	11	al	al	PROPN
bam-7423	143	12	.	.	PROPN
bam-7423	143	13	aberrant	aberrant	ADJ
bam-7423	143	14	methylation	methylation	NOUN
bam-7423	143	15	of	of	ADP
bam-7423	143	16	reprimo	reprimo	VERB
bam-7423	143	17	in	in	ADP
bam-7423	143	18	human	human	ADJ
bam-7423	143	19	malignancies	malignancy	NOUN
bam-7423	143	20	.	.	PUNCT
bam-7423	144	1	int	int	PROPN
bam-7423	144	2	j	j	PROPN
bam-7423	144	3	cancer	cancer	NOUN
bam-7423	144	4	2005;115:503	2005;115:503	NUM
bam-7423	144	5	-	-	SYM
bam-7423	144	6	10	10	NUM
bam-7423	144	7	.	.	PUNCT
bam-7423	144	8	17	17	NUM
bam-7423	144	9	.	.	PUNCT
bam-7423	145	1	anderson	anderson	PROPN
bam-7423	145	2	wf	wf	PROPN
bam-7423	145	3	,	,	PUNCT
bam-7423	145	4	camargo	camargo	PROPN
bam-7423	145	5	mc	mc	PROPN
bam-7423	145	6	,	,	PUNCT
bam-7423	145	7	fraumeni	fraumeni	PROPN
bam-7423	145	8	jf	jf	PROPN
bam-7423	145	9	,	,	PUNCT
bam-7423	145	10	et	et	PROPN
bam-7423	145	11	al	al	PROPN
bam-7423	145	12	.	.	PUNCT
bam-7423	145	13	age	age	NOUN
bam-7423	145	14	-	-	PUNCT
bam-7423	145	15	specific	specific	ADJ
bam-7423	145	16	trends	trend	NOUN
bam-7423	145	17	in	in	ADP
bam-7423	145	18	incidence	incidence	NOUN
bam-7423	145	19	of	of	ADP
bam-7423	145	20	noncardia	noncardia	ADJ
bam-7423	145	21	gastric	gastric	ADJ
bam-7423	145	22	cancer	cancer	NOUN
bam-7423	145	23	in	in	ADP
bam-7423	145	24	us	us	PROPN
bam-7423	145	25	adults	adult	NOUN
bam-7423	145	26	.	.	PUNCT
bam-7423	146	1	jama	jama	PROPN
bam-7423	146	2	.	.	PUNCT
bam-7423	147	1	2010;303:1723	2010;303:1723	NUM
bam-7423	147	2	-	-	SYM
bam-7423	147	3	8	8	NUM
bam-7423	147	4	.	.	PUNCT
bam-7423	147	5	submission	submission	NOUN
bam-7423	147	6	:	:	PUNCT
bam-7423	148	1	19/03/18	19/03/18	NUM
bam-7423	148	2	revisions	revision	NOUN
bam-7423	148	3	received	receive	VERB
bam-7423	148	4	:	:	PUNCT
bam-7423	148	5	31/05/18	31/05/18	NUM
bam-7423	148	6	acceptance	acceptance	NOUN
bam-7423	148	7	:	:	PUNCT
bam-7423	148	8	31/05/18	31/05/18	NUM
bam-7423	148	9	non	non	X
bam-7423	148	10	co	co	PROPN
bam-7423	148	11	mmerc	mmerc	PROPN
bam-7423	148	12	ial	ial	PROPN
bam-7423	148	13	us	us	PROPN
bam-7423	148	14	e	e	NOUN
bam-7423	148	15	o	o	PROPN
bam-7423	148	16	nly	nly	ADV
bam-7423	148	17	mailto:aminabbasi1989@yahoo.com	mailto:aminabbasi1989@yahoo.com	X
bam-7423	148	18	mailto:s.heydari1989@gmail.com	mailto:s.heydari1989@gmail.com	NUM