id	sid	tid	token	lemma	pos
bam-8970	1	1	tyms	tyms	PROPN
bam-8970	1	2	gene	gene	NOUN
bam-8970	1	3	polymorphism	polymorphism	NOUN
bam-8970	1	4	and	and	CCONJ
bam-8970	1	5	toxicity	toxicity	NOUN
bam-8970	1	6	response	response	NOUN
bam-8970	1	7	eur	eur	PROPN
bam-8970	1	8	j	j	PROPN
bam-8970	1	9	transl	transl	PROPN
bam-8970	1	10	myol	myol	NOUN
bam-8970	1	11	2020	2020	NUM
bam-8970	1	12	;	;	PUNCT
bam-8970	1	13	30	30	NUM
bam-8970	1	14	(	(	PUNCT
bam-8970	1	15	3	3	NUM
bam-8970	1	16	):	):	PUNCT
bam-8970	1	17	8970	8970	NUM
bam-8970	1	18	.	.	PUNCT
bam-8970	2	1	doi	doi	NOUN
bam-8970	2	2	:	:	PUNCT
bam-8970	2	3	10.4081	10.4081	NUM
bam-8970	2	4	/	/	SYM
bam-8970	2	5	ejtm.2020.8970	ejtm.2020.8970	PROPN
bam-8970	2	6	1	1	NUM
bam-8970	2	7	correlation	correlation	NOUN
bam-8970	2	8	between	between	ADP
bam-8970	2	9	polymorphism	polymorphism	NOUN
bam-8970	2	10	of	of	ADP
bam-8970	2	11	tyms	tyms	PROPN
bam-8970	2	12	gene	gene	NOUN
bam-8970	2	13	and	and	CCONJ
bam-8970	2	14	toxicity	toxicity	NOUN
bam-8970	2	15	response	response	NOUN
bam-8970	2	16	to	to	ADP
bam-8970	2	17	treatment	treatment	NOUN
bam-8970	2	18	with	with	ADP
bam-8970	2	19	5	5	NUM
bam-8970	2	20	-	-	PUNCT
bam-8970	2	21	fluoruracil	fluoruracil	ADJ
bam-8970	2	22	and	and	CCONJ
bam-8970	2	23	capecitabine	capecitabine	NOUN
bam-8970	2	24	stefano	stefano	PROPN
bam-8970	2	25	vitello	vitello	PROPN
bam-8970	2	26	(	(	PUNCT
bam-8970	2	27	1	1	NUM
bam-8970	2	28	)	)	PUNCT
bam-8970	2	29	,	,	PUNCT
bam-8970	2	30	italia	italia	PROPN
bam-8970	2	31	di	di	PROPN
bam-8970	2	32	liegro	liegro	PROPN
bam-8970	2	33	(	(	PUNCT
bam-8970	2	34	2	2	NUM
bam-8970	2	35	)	)	PUNCT
bam-8970	2	36	,	,	PUNCT
bam-8970	2	37	maria	maria	PROPN
bam-8970	2	38	rita	rita	PROPN
bam-8970	2	39	ricciardi	ricciardi	PROPN
bam-8970	2	40	(	(	PUNCT
bam-8970	2	41	1	1	NUM
bam-8970	2	42	)	)	PUNCT
bam-8970	2	43	,	,	PUNCT
bam-8970	2	44	chiara	chiara	PROPN
bam-8970	2	45	verga	verga	NOUN
bam-8970	2	46	(	(	PUNCT
bam-8970	2	47	1	1	NUM
bam-8970	2	48	)	)	PUNCT
bam-8970	2	49	,	,	PUNCT
bam-8970	2	50	alessandra	alessandra	PROPN
bam-8970	2	51	amato	amato	PROPN
bam-8970	2	52	(	(	PUNCT
bam-8970	2	53	3	3	NUM
bam-8970	2	54	)	)	PUNCT
bam-8970	2	55	,	,	PUNCT
bam-8970	2	56	gabriella	gabriella	PROPN
bam-8970	2	57	schiera	schiera	NOUN
bam-8970	2	58	(	(	PUNCT
bam-8970	2	59	4	4	NUM
bam-8970	2	60	)	)	PUNCT
bam-8970	2	61	,	,	PUNCT
bam-8970	2	62	carlo	carlo	PROPN
bam-8970	2	63	di	di	PROPN
bam-8970	2	64	liegro	liegro	PROPN
bam-8970	2	65	(	(	PUNCT
bam-8970	2	66	4	4	NUM
bam-8970	2	67	)	)	PUNCT
bam-8970	2	68	,	,	PUNCT
bam-8970	2	69	giuseppe	giuseppe	PROPN
bam-8970	2	70	messina	messina	PROPN
bam-8970	2	71	(	(	PUNCT
bam-8970	2	72	3	3	NUM
bam-8970	2	73	)	)	PUNCT
bam-8970	2	74	,	,	PUNCT
bam-8970	2	75	patrizia	patrizia	PROPN
bam-8970	2	76	proia	proia	NOUN
bam-8970	2	77	(	(	PUNCT
bam-8970	2	78	3	3	NUM
bam-8970	2	79	)	)	PUNCT
bam-8970	2	80	(	(	PUNCT
bam-8970	2	81	1	1	X
bam-8970	2	82	)	)	PUNCT
bam-8970	2	83	regional	regional	ADJ
bam-8970	2	84	hospital	hospital	NOUN
bam-8970	2	85	s.	s.	PROPN
bam-8970	2	86	elia	elia	PROPN
bam-8970	2	87	,	,	PUNCT
bam-8970	2	88	caltanissetta	caltanissetta	PROPN
bam-8970	2	89	,	,	PUNCT
bam-8970	2	90	italy	italy	PROPN
bam-8970	2	91	;	;	PUNCT
bam-8970	2	92	(	(	PUNCT
bam-8970	2	93	2	2	X
bam-8970	2	94	)	)	PUNCT
bam-8970	2	95	department	department	NOUN
bam-8970	2	96	of	of	ADP
bam-8970	2	97	experimental	experimental	ADJ
bam-8970	2	98	biomedicine	biomedicine	NOUN
bam-8970	2	99	and	and	CCONJ
bam-8970	2	100	clinical	clinical	ADJ
bam-8970	2	101	neurosciences	neuroscience	NOUN
bam-8970	2	102	(	(	PUNCT
bam-8970	2	103	bionec	bionec	NOUN
bam-8970	2	104	)	)	PUNCT
bam-8970	2	105	,	,	PUNCT
bam-8970	2	106	university	university	NOUN
bam-8970	2	107	of	of	ADP
bam-8970	2	108	palermo	palermo	PROPN
bam-8970	2	109	,	,	PUNCT
bam-8970	2	110	palermo	palermo	PROPN
bam-8970	2	111	,	,	PUNCT
bam-8970	2	112	italy	italy	PROPN
bam-8970	2	113	;	;	PUNCT
bam-8970	2	114	(	(	PUNCT
bam-8970	2	115	3	3	X
bam-8970	2	116	)	)	PUNCT
bam-8970	2	117	department	department	NOUN
bam-8970	2	118	of	of	ADP
bam-8970	2	119	psychological	psychological	ADJ
bam-8970	2	120	,	,	PUNCT
bam-8970	2	121	pedagogical	pedagogical	ADJ
bam-8970	2	122	and	and	CCONJ
bam-8970	2	123	educational	educational	ADJ
bam-8970	2	124	sciences	science	NOUN
bam-8970	2	125	,	,	PUNCT
bam-8970	2	126	sport	sport	NOUN
bam-8970	2	127	and	and	CCONJ
bam-8970	2	128	exercise	exercise	NOUN
bam-8970	2	129	sciences	sciences	PROPN
bam-8970	2	130	research	research	NOUN
bam-8970	2	131	unit	unit	NOUN
bam-8970	2	132	,	,	PUNCT
bam-8970	2	133	university	university	PROPN
bam-8970	2	134	of	of	ADP
bam-8970	2	135	palermo	palermo	PROPN
bam-8970	2	136	,	,	PUNCT
bam-8970	2	137	palermo	palermo	PROPN
bam-8970	2	138	,	,	PUNCT
bam-8970	2	139	italy	italy	PROPN
bam-8970	2	140	;	;	PUNCT
bam-8970	2	141	(	(	PUNCT
bam-8970	2	142	4	4	X
bam-8970	2	143	)	)	PUNCT
bam-8970	2	144	department	department	NOUN
bam-8970	2	145	of	of	ADP
bam-8970	2	146	biological	biological	ADJ
bam-8970	2	147	chemical	chemical	NOUN
bam-8970	2	148	and	and	CCONJ
bam-8970	2	149	pharmaceutical	pharmaceutical	NOUN
bam-8970	2	150	sciences	science	NOUN
bam-8970	2	151	and	and	CCONJ
bam-8970	2	152	technologies	technology	NOUN
bam-8970	2	153	(	(	PUNCT
bam-8970	2	154	stebicef	stebicef	NOUN
bam-8970	2	155	)	)	PUNCT
bam-8970	2	156	,	,	PUNCT
bam-8970	2	157	university	university	NOUN
bam-8970	2	158	of	of	ADP
bam-8970	2	159	palermo	palermo	PROPN
bam-8970	2	160	,	,	PUNCT
bam-8970	2	161	palermo	palermo	PROPN
bam-8970	2	162	,	,	PUNCT
bam-8970	2	163	italy	italy	PROPN
bam-8970	2	164	this	this	DET
bam-8970	2	165	article	article	NOUN
bam-8970	2	166	is	be	AUX
bam-8970	2	167	distributed	distribute	VERB
bam-8970	2	168	under	under	ADP
bam-8970	2	169	the	the	DET
bam-8970	2	170	terms	term	NOUN
bam-8970	2	171	of	of	ADP
bam-8970	2	172	the	the	DET
bam-8970	2	173	creative	creative	ADJ
bam-8970	2	174	commons	common	NOUN
bam-8970	2	175	attribution	attribution	NOUN
bam-8970	2	176	noncommercial	noncommercial	ADJ
bam-8970	2	177	license	license	NOUN
bam-8970	2	178	(	(	PUNCT
bam-8970	2	179	cc	cc	NOUN
bam-8970	2	180	by	by	ADP
bam-8970	2	181	-	-	PUNCT
bam-8970	2	182	nc	nc	PROPN
bam-8970	2	183	4.0	4.0	NUM
bam-8970	2	184	)	)	PUNCT
bam-8970	2	185	which	which	PRON
bam-8970	2	186	permits	permit	VERB
bam-8970	2	187	any	any	DET
bam-8970	2	188	noncommercial	noncommercial	ADJ
bam-8970	2	189	use	use	NOUN
bam-8970	2	190	,	,	PUNCT
bam-8970	2	191	distribution	distribution	NOUN
bam-8970	2	192	,	,	PUNCT
bam-8970	2	193	and	and	CCONJ
bam-8970	2	194	reproduction	reproduction	NOUN
bam-8970	2	195	in	in	ADP
bam-8970	2	196	any	any	DET
bam-8970	2	197	medium	medium	NOUN
bam-8970	2	198	,	,	PUNCT
bam-8970	2	199	provided	provide	VERB
bam-8970	2	200	the	the	DET
bam-8970	2	201	original	original	ADJ
bam-8970	2	202	author(s	author(s	NOUN
bam-8970	2	203	)	)	PUNCT
bam-8970	2	204	and	and	CCONJ
bam-8970	2	205	source	source	NOUN
bam-8970	2	206	are	be	AUX
bam-8970	2	207	credited	credit	VERB
bam-8970	2	208	.	.	PUNCT
bam-8970	3	1	abstract	abstract	ADJ
bam-8970	3	2	tumorigenesis	tumorigenesis	NOUN
bam-8970	3	3	is	be	AUX
bam-8970	3	4	a	a	DET
bam-8970	3	5	multiphasic	multiphasic	NOUN
bam-8970	3	6	process	process	NOUN
bam-8970	3	7	in	in	ADP
bam-8970	3	8	which	which	PRON
bam-8970	3	9	genetic	genetic	ADJ
bam-8970	3	10	alterations	alteration	NOUN
bam-8970	3	11	guide	guide	VERB
bam-8970	3	12	the	the	DET
bam-8970	3	13	progressive	progressive	ADJ
bam-8970	3	14	transformation	transformation	NOUN
bam-8970	3	15	in	in	ADP
bam-8970	3	16	cancer	cancer	NOUN
bam-8970	3	17	cells1	cells1	ADJ
bam-8970	3	18	.	.	PUNCT
bam-8970	4	1	in	in	ADP
bam-8970	4	2	order	order	NOUN
bam-8970	4	3	to	to	PART
bam-8970	4	4	evaluate	evaluate	VERB
bam-8970	4	5	the	the	DET
bam-8970	4	6	possible	possible	ADJ
bam-8970	4	7	correlation	correlation	NOUN
bam-8970	4	8	between	between	ADP
bam-8970	4	9	some	some	DET
bam-8970	4	10	gene	gene	NOUN
bam-8970	4	11	variants	variant	NOUN
bam-8970	4	12	and	and	CCONJ
bam-8970	4	13	the	the	DET
bam-8970	4	14	risk	risk	NOUN
bam-8970	4	15	of	of	ADP
bam-8970	4	16	the	the	DET
bam-8970	4	17	toxicity	toxicity	NOUN
bam-8970	4	18	development	development	NOUN
bam-8970	4	19	onset	onset	NOUN
bam-8970	4	20	,	,	PUNCT
bam-8970	4	21	two	two	NUM
bam-8970	4	22	of	of	ADP
bam-8970	4	23	the	the	DET
bam-8970	4	24	polymorphisms	polymorphism	NOUN
bam-8970	4	25	of	of	ADP
bam-8970	4	26	the	the	DET
bam-8970	4	27	thymidylate	thymidylate	NOUN
bam-8970	4	28	synthase	synthase	NOUN
bam-8970	4	29	(	(	PUNCT
bam-8970	4	30	tyms	tyms	PROPN
bam-8970	4	31	)	)	PUNCT
bam-8970	4	32	,	,	PUNCT
bam-8970	4	33	rs34743033	rs34743033	VERB
bam-8970	4	34	(	(	PUNCT
bam-8970	4	35	2r/3r	2r/3r	NUM
bam-8970	4	36	)	)	PUNCT
bam-8970	4	37	and	and	CCONJ
bam-8970	4	38	rs16430	rs16430	NOUN
bam-8970	4	39	(	(	PUNCT
bam-8970	4	40	del	del	PROPN
bam-8970	4	41	/	/	SYM
bam-8970	4	42	ins	in	NOUN
bam-8970	4	43	)	)	PUNCT
bam-8970	4	44	were	be	AUX
bam-8970	4	45	investigated	investigate	VERB
bam-8970	4	46	.	.	PUNCT
bam-8970	5	1	we	we	PRON
bam-8970	5	2	enrolled	enrol	VERB
bam-8970	5	3	in	in	ADP
bam-8970	5	4	our	our	PRON
bam-8970	5	5	study	study	NOUN
bam-8970	5	6	47	47	NUM
bam-8970	5	7	patients	patient	NOUN
bam-8970	5	8	from	from	ADP
bam-8970	5	9	the	the	DET
bam-8970	5	10	hospital	hospital	NOUN
bam-8970	5	11	of	of	ADP
bam-8970	5	12	sicily	sicily	ADV
bam-8970	5	13	.	.	PUNCT
bam-8970	6	1	our	our	PRON
bam-8970	6	2	preliminary	preliminary	ADJ
bam-8970	6	3	findings	finding	NOUN
bam-8970	6	4	suggest	suggest	VERB
bam-8970	6	5	that	that	SCONJ
bam-8970	6	6	there	there	PRON
bam-8970	6	7	could	could	AUX
bam-8970	6	8	be	be	AUX
bam-8970	6	9	a	a	DET
bam-8970	6	10	linkage	linkage	NOUN
bam-8970	6	11	between	between	ADP
bam-8970	6	12	the	the	DET
bam-8970	6	13	genotypes	genotype	NOUN
bam-8970	6	14	discussed	discuss	VERB
bam-8970	6	15	and	and	CCONJ
bam-8970	6	16	the	the	DET
bam-8970	6	17	development	development	NOUN
bam-8970	6	18	of	of	ADP
bam-8970	6	19	the	the	DET
bam-8970	6	20	toxicity	toxicity	NOUN
bam-8970	6	21	following	follow	VERB
bam-8970	6	22	the	the	DET
bam-8970	6	23	chemotherapy	chemotherapy	NOUN
bam-8970	6	24	treatment	treatment	NOUN
bam-8970	6	25	.	.	PUNCT
bam-8970	7	1	these	these	DET
bam-8970	7	2	results	result	NOUN
bam-8970	7	3	need	need	VERB
bam-8970	7	4	to	to	PART
bam-8970	7	5	be	be	AUX
bam-8970	7	6	confirmed	confirm	VERB
bam-8970	7	7	by	by	ADP
bam-8970	7	8	further	further	ADJ
bam-8970	7	9	studies	study	NOUN
bam-8970	7	10	,	,	PUNCT
bam-8970	7	11	however	however	ADV
bam-8970	7	12	this	this	DET
bam-8970	7	13	short	short	ADJ
bam-8970	7	14	paper	paper	NOUN
bam-8970	7	15	offers	offer	VERB
bam-8970	7	16	some	some	DET
bam-8970	7	17	initial	initial	ADJ
bam-8970	7	18	insight	insight	NOUN
bam-8970	7	19	into	into	ADP
bam-8970	7	20	the	the	DET
bam-8970	7	21	relationships	relationship	NOUN
bam-8970	7	22	between	between	ADP
bam-8970	7	23	genetic	genetic	ADJ
bam-8970	7	24	background	background	NOUN
bam-8970	7	25	and	and	CCONJ
bam-8970	7	26	the	the	DET
bam-8970	7	27	better	well	ADJ
bam-8970	7	28	outcome	outcome	NOUN
bam-8970	7	29	for	for	ADP
bam-8970	7	30	patients	patient	NOUN
bam-8970	7	31	.	.	PUNCT
bam-8970	8	1	key	key	ADJ
bam-8970	8	2	words	word	NOUN
bam-8970	8	3	:	:	PUNCT
bam-8970	8	4	cancer	cancer	NOUN
bam-8970	8	5	,	,	PUNCT
bam-8970	8	6	genetics	genetic	NOUN
bam-8970	8	7	,	,	PUNCT
bam-8970	8	8	thymidylate	thymidylate	NOUN
bam-8970	8	9	synthase	synthase	NOUN
bam-8970	8	10	,	,	PUNCT
bam-8970	8	11	polymorphisms	polymorphism	NOUN
bam-8970	8	12	,	,	PUNCT
bam-8970	8	13	toxicity	toxicity	NOUN
bam-8970	8	14	.	.	PUNCT
bam-8970	9	1	eur	eur	PROPN
bam-8970	9	2	j	j	PROPN
bam-8970	9	3	transl	transl	PROPN
bam-8970	9	4	myol	myol	NOUN
bam-8970	9	5	2020	2020	NUM
bam-8970	9	6	;	;	PUNCT
bam-8970	9	7	30	30	NUM
bam-8970	9	8	(	(	PUNCT
bam-8970	9	9	3	3	NUM
bam-8970	9	10	):	):	PUNCT
bam-8970	9	11	8970	8970	NUM
bam-8970	9	12	.	.	PUNCT
bam-8970	10	1	doi	doi	NOUN
bam-8970	10	2	:	:	PUNCT
bam-8970	10	3	10.4081	10.4081	NUM
bam-8970	10	4	/	/	SYM
bam-8970	10	5	ejtm.2020.8970	ejtm.2020.8970	PROPN
bam-8970	10	6	cancer	cancer	NOUN
bam-8970	10	7	is	be	AUX
bam-8970	10	8	a	a	DET
bam-8970	10	9	pathology	pathology	NOUN
bam-8970	10	10	characterized	characterize	VERB
bam-8970	10	11	by	by	ADP
bam-8970	10	12	dynamic	dynamic	ADJ
bam-8970	10	13	alterations	alteration	NOUN
bam-8970	10	14	in	in	ADP
bam-8970	10	15	the	the	DET
bam-8970	10	16	genome.1	genome.1	PROPN
bam-8970	10	17	tumorigenesis	tumorigenesis	NOUN
bam-8970	10	18	is	be	AUX
bam-8970	10	19	a	a	DET
bam-8970	10	20	multiphasic	multiphasic	NOUN
bam-8970	10	21	process	process	NOUN
bam-8970	10	22	in	in	ADP
bam-8970	10	23	which	which	PRON
bam-8970	10	24	the	the	DET
bam-8970	10	25	succession	succession	NOUN
bam-8970	10	26	of	of	ADP
bam-8970	10	27	genetic	genetic	ADJ
bam-8970	10	28	alterations	alteration	NOUN
bam-8970	10	29	,	,	PUNCT
bam-8970	10	30	capable	capable	ADJ
bam-8970	10	31	of	of	ADP
bam-8970	10	32	conferring	confer	VERB
bam-8970	10	33	a	a	DET
bam-8970	10	34	growth	growth	NOUN
bam-8970	10	35	advantage	advantage	NOUN
bam-8970	10	36	,	,	PUNCT
bam-8970	10	37	guide	guide	VERB
bam-8970	10	38	the	the	DET
bam-8970	10	39	progressive	progressive	ADJ
bam-8970	10	40	transformation	transformation	NOUN
bam-8970	10	41	of	of	ADP
bam-8970	10	42	a	a	DET
bam-8970	10	43	normal	normal	ADJ
bam-8970	10	44	cell	cell	NOUN
bam-8970	10	45	into	into	ADP
bam-8970	10	46	a	a	DET
bam-8970	10	47	tumor	tumor	NOUN
bam-8970	11	1	cell.2	cell.2	NOUN
bam-8970	11	2	the	the	DET
bam-8970	11	3	unregulated	unregulated	ADJ
bam-8970	11	4	growth	growth	NOUN
bam-8970	11	5	of	of	ADP
bam-8970	11	6	cancer	cancer	NOUN
bam-8970	11	7	cells	cell	NOUN
bam-8970	11	8	derives	derive	VERB
bam-8970	11	9	from	from	ADP
bam-8970	11	10	the	the	DET
bam-8970	11	11	sequential	sequential	ADJ
bam-8970	11	12	acquisition	acquisition	NOUN
bam-8970	11	13	of	of	ADP
bam-8970	11	14	somatic	somatic	ADJ
bam-8970	11	15	mutations	mutation	NOUN
bam-8970	11	16	and/or	and/or	CCONJ
bam-8970	11	17	alterations	alteration	NOUN
bam-8970	11	18	in	in	ADP
bam-8970	11	19	the	the	DET
bam-8970	11	20	expression	expression	NOUN
bam-8970	11	21	of	of	ADP
bam-8970	11	22	genes	gene	NOUN
bam-8970	11	23	that	that	PRON
bam-8970	11	24	control	control	VERB
bam-8970	11	25	growth	growth	NOUN
bam-8970	11	26	,	,	PUNCT
bam-8970	11	27	differentiation	differentiation	NOUN
bam-8970	11	28	and	and	CCONJ
bam-8970	11	29	apoptosis	apoptosis	NOUN
bam-8970	11	30	;	;	PUNCT
bam-8970	11	31	or	or	CCONJ
bam-8970	11	32	that	that	PRON
bam-8970	11	33	guarantee	guarantee	VERB
bam-8970	11	34	the	the	DET
bam-8970	11	35	integrity	integrity	NOUN
bam-8970	11	36	of	of	ADP
bam-8970	11	37	the	the	DET
bam-8970	11	38	genome	genome	NOUN
bam-8970	11	39	,	,	PUNCT
bam-8970	11	40	i.e.	i.e.	X
bam-8970	11	41	those	those	DET
bam-8970	11	42	mechanisms	mechanism	NOUN
bam-8970	11	43	that	that	PRON
bam-8970	11	44	normally	normally	ADV
bam-8970	11	45	regulate	regulate	VERB
bam-8970	11	46	cell	cell	NOUN
bam-8970	11	47	proliferation	proliferation	NOUN
bam-8970	11	48	and	and	CCONJ
bam-8970	11	49	homeostasis.3	homeostasis.3	NOUN
bam-8970	11	50	in	in	ADP
bam-8970	11	51	recent	recent	ADJ
bam-8970	11	52	times	time	NOUN
bam-8970	11	53	,	,	PUNCT
bam-8970	11	54	numerous	numerous	ADJ
bam-8970	11	55	studies	study	NOUN
bam-8970	11	56	have	have	AUX
bam-8970	11	57	attempted	attempt	VERB
bam-8970	11	58	to	to	PART
bam-8970	11	59	identify	identify	VERB
bam-8970	11	60	predisposition	predisposition	NOUN
bam-8970	11	61	factors	factor	NOUN
bam-8970	11	62	of	of	ADP
bam-8970	11	63	cancer	cancer	NOUN
bam-8970	11	64	.	.	PUNCT
bam-8970	12	1	genes	gene	NOUN
bam-8970	12	2	have	have	AUX
bam-8970	12	3	been	be	AUX
bam-8970	12	4	identified	identify	VERB
bam-8970	12	5	whose	whose	DET
bam-8970	12	6	reduced	reduce	VERB
bam-8970	12	7	expression	expression	NOUN
bam-8970	12	8	can	can	AUX
bam-8970	12	9	act	act	VERB
bam-8970	12	10	as	as	ADP
bam-8970	12	11	biomarkers	biomarker	NOUN
bam-8970	12	12	for	for	ADP
bam-8970	12	13	the	the	DET
bam-8970	12	14	early	early	ADJ
bam-8970	12	15	diagnosis	diagnosis	NOUN
bam-8970	12	16	of	of	ADP
bam-8970	12	17	tumors	tumor	NOUN
bam-8970	12	18	,	,	PUNCT
bam-8970	12	19	such	such	ADJ
bam-8970	12	20	as	as	ADP
bam-8970	12	21	reprimo	reprimo	VERB
bam-8970	12	22	gene	gene	NOUN
bam-8970	12	23	for	for	ADP
bam-8970	12	24	gastric	gastric	ADJ
bam-8970	12	25	cancer,4	cancer,4	NOUN
bam-8970	12	26	or	or	CCONJ
bam-8970	12	27	reduced	reduce	VERB
bam-8970	12	28	cancer	cancer	NOUN
bam-8970	12	29	incidence	incidence	NOUN
bam-8970	12	30	such	such	ADJ
bam-8970	12	31	as	as	ADP
bam-8970	12	32	biallelic	biallelic	ADJ
bam-8970	12	33	expression	expression	NOUN
bam-8970	12	34	of	of	ADP
bam-8970	12	35	exits	exit	NOUN
bam-8970	12	36	genes	gene	NOUN
bam-8970	12	37	in	in	ADP
bam-8970	12	38	females	female	NOUN
bam-8970	12	39	explains	explain	VERB
bam-8970	12	40	a	a	DET
bam-8970	12	41	portion	portion	NOUN
bam-8970	12	42	of	of	ADP
bam-8970	12	43	the	the	DET
bam-8970	12	44	reduced	reduced	ADJ
bam-8970	12	45	cancer	cancer	NOUN
bam-8970	12	46	incidence	incidence	NOUN
bam-8970	12	47	compared	compare	VERB
bam-8970	12	48	to	to	ADP
bam-8970	12	49	males	male	NOUN
bam-8970	12	50	across	across	ADP
bam-8970	12	51	a	a	DET
bam-8970	12	52	variety	variety	NOUN
bam-8970	12	53	of	of	ADP
bam-8970	12	54	tumor	tumor	NOUN
bam-8970	12	55	types.5	types.5	NOUN
bam-8970	12	56	the	the	DET
bam-8970	12	57	probability	probability	NOUN
bam-8970	12	58	that	that	SCONJ
bam-8970	12	59	an	an	DET
bam-8970	12	60	individual	individual	NOUN
bam-8970	12	61	affected	affect	VERB
bam-8970	12	62	by	by	ADP
bam-8970	12	63	these	these	DET
bam-8970	12	64	mutations	mutation	NOUN
bam-8970	12	65	will	will	AUX
bam-8970	12	66	develop	develop	VERB
bam-8970	12	67	a	a	DET
bam-8970	12	68	tumor	tumor	NOUN
bam-8970	12	69	is	be	AUX
bam-8970	12	70	variable	variable	ADJ
bam-8970	12	71	and	and	CCONJ
bam-8970	12	72	depends	depend	VERB
bam-8970	12	73	on	on	ADP
bam-8970	12	74	various	various	ADJ
bam-8970	12	75	factors	factor	NOUN
bam-8970	12	76	.	.	PUNCT
bam-8970	13	1	these	these	PRON
bam-8970	13	2	include	include	VERB
bam-8970	13	3	the	the	DET
bam-8970	13	4	type	type	NOUN
bam-8970	13	5	of	of	ADP
bam-8970	13	6	mutated	mutate	VERB
bam-8970	13	7	allele	allele	NOUN
bam-8970	13	8	,	,	PUNCT
bam-8970	13	9	as	as	ADV
bam-8970	13	10	well	well	ADV
bam-8970	13	11	as	as	ADP
bam-8970	13	12	the	the	DET
bam-8970	13	13	age	age	NOUN
bam-8970	13	14	and	and	CCONJ
bam-8970	13	15	the	the	DET
bam-8970	13	16	action	action	NOUN
bam-8970	13	17	of	of	ADP
bam-8970	13	18	other	other	ADJ
bam-8970	13	19	genes	gene	NOUN
bam-8970	13	20	called	call	VERB
bam-8970	13	21	modifiers	modifier	NOUN
bam-8970	13	22	.	.	PUNCT
bam-8970	14	1	the	the	DET
bam-8970	14	2	influence	influence	NOUN
bam-8970	14	3	of	of	ADP
bam-8970	14	4	other	other	ADJ
bam-8970	14	5	factors	factor	NOUN
bam-8970	14	6	such	such	ADJ
bam-8970	14	7	as	as	ADP
bam-8970	14	8	diet	diet	NOUN
bam-8970	14	9	,	,	PUNCT
bam-8970	14	10	lifestyle	lifestyle	NOUN
bam-8970	14	11	and	and	CCONJ
bam-8970	14	12	environmental	environmental	ADJ
bam-8970	14	13	factors	factor	NOUN
bam-8970	14	14	remains	remain	VERB
bam-8970	14	15	unclear	unclear	ADJ
bam-8970	14	16	.	.	PUNCT
bam-8970	15	1	the	the	DET
bam-8970	15	2	data	datum	NOUN
bam-8970	15	3	obtained	obtain	VERB
bam-8970	15	4	to	to	ADP
bam-8970	15	5	date	date	NOUN
bam-8970	15	6	,	,	PUNCT
bam-8970	15	7	suggests	suggest	VERB
bam-8970	15	8	that	that	SCONJ
bam-8970	15	9	for	for	ADP
bam-8970	15	10	any	any	DET
bam-8970	15	11	type	type	NOUN
bam-8970	15	12	of	of	ADP
bam-8970	15	13	tumor	tumor	NOUN
bam-8970	15	14	,	,	PUNCT
bam-8970	15	15	only	only	ADV
bam-8970	15	16	one	one	NUM
bam-8970	15	17	or	or	CCONJ
bam-8970	15	18	a	a	DET
bam-8970	15	19	few	few	ADJ
bam-8970	15	20	loci	locus	NOUN
bam-8970	15	21	can	can	AUX
bam-8970	15	22	explain	explain	VERB
bam-8970	15	23	the	the	DET
bam-8970	15	24	genetic	genetic	ADJ
bam-8970	15	25	risk	risk	NOUN
bam-8970	15	26	,	,	PUNCT
bam-8970	15	27	regardless	regardless	ADV
bam-8970	15	28	of	of	ADP
bam-8970	15	29	the	the	DET
bam-8970	15	30	type	type	NOUN
bam-8970	15	31	of	of	ADP
bam-8970	15	32	the	the	DET
bam-8970	15	33	genetic	genetic	ADJ
bam-8970	15	34	variant	variant	NOUN
bam-8970	15	35	(	(	PUNCT
bam-8970	15	36	i.e.	i.e.	X
bam-8970	15	37	,	,	PUNCT
bam-8970	15	38	single	single	ADJ
bam-8970	15	39	nucleotide	nucleotide	NOUN
bam-8970	15	40	polymorphisms	polymorphism	NOUN
bam-8970	15	41	,	,	PUNCT
bam-8970	15	42	snps	snps	NOUN
bam-8970	15	43	or	or	CCONJ
bam-8970	15	44	copynumber	copynumber	NOUN
bam-8970	15	45	variations	variation	NOUN
bam-8970	15	46	,	,	PUNCT
bam-8970	15	47	cnvs	cnvs	NOUN
bam-8970	15	48	)	)	PUNCT
bam-8970	15	49	,	,	PUNCT
bam-8970	15	50	or	or	CCONJ
bam-8970	15	51	frequency	frequency	NOUN
bam-8970	15	52	(	(	PUNCT
bam-8970	15	53	wether	wether	PROPN
bam-8970	15	54	it	it	PRON
bam-8970	15	55	is	be	AUX
bam-8970	15	56	common	common	ADJ
bam-8970	15	57	,	,	PUNCT
bam-8970	15	58	rare	rare	ADJ
bam-8970	15	59	or	or	CCONJ
bam-8970	15	60	very	very	ADV
bam-8970	15	61	rare	rare	ADJ
bam-8970	15	62	)	)	PUNCT
bam-8970	15	63	.	.	PUNCT
bam-8970	16	1	the	the	DET
bam-8970	16	2	risk	risk	NOUN
bam-8970	16	3	of	of	ADP
bam-8970	16	4	developing	develop	VERB
bam-8970	16	5	a	a	DET
bam-8970	16	6	tumor	tumor	NOUN
bam-8970	16	7	would	would	AUX
bam-8970	16	8	instead	instead	ADV
bam-8970	16	9	be	be	AUX
bam-8970	16	10	associated	associate	VERB
bam-8970	16	11	with	with	ADP
bam-8970	16	12	a	a	DET
bam-8970	16	13	polygenic	polygenic	ADJ
bam-8970	16	14	inheritance	inheritance	NOUN
bam-8970	16	15	in	in	ADP
bam-8970	16	16	which	which	PRON
bam-8970	16	17	hundreds	hundred	NOUN
bam-8970	16	18	or	or	CCONJ
bam-8970	16	19	thousands	thousand	NOUN
bam-8970	16	20	of	of	ADP
bam-8970	16	21	genetic	genetic	ADJ
bam-8970	16	22	variants	variant	NOUN
bam-8970	16	23	would	would	AUX
bam-8970	16	24	be	be	AUX
bam-8970	16	25	involved	involve	VERB
bam-8970	16	26	.	.	PUNCT
bam-8970	17	1	a	a	DET
bam-8970	17	2	theoretical	theoretical	ADJ
bam-8970	17	3	model	model	NOUN
bam-8970	17	4	is	be	AUX
bam-8970	17	5	thus	thus	ADV
bam-8970	17	6	governed	govern	VERB
bam-8970	17	7	by	by	ADP
bam-8970	17	8	a	a	DET
bam-8970	17	9	complex	complex	ADJ
bam-8970	17	10	architecture	architecture	NOUN
bam-8970	17	11	and	and	CCONJ
bam-8970	17	12	a	a	DET
bam-8970	17	13	multiplicity	multiplicity	NOUN
bam-8970	17	14	of	of	ADP
bam-8970	17	15	genetic	genetic	ADJ
bam-8970	17	16	loci	loci	NOUN
bam-8970	17	17	in	in	ADP
bam-8970	17	18	which	which	PRON
bam-8970	17	19	mutations	mutation	NOUN
bam-8970	17	20	in	in	ADP
bam-8970	17	21	the	the	DET
bam-8970	17	22	individual	individual	ADJ
bam-8970	17	23	genes	gene	NOUN
bam-8970	17	24	and	and	CCONJ
bam-8970	17	25	genetic	genetic	ADJ
bam-8970	17	26	variants	variant	NOUN
bam-8970	17	27	present	present	ADJ
bam-8970	17	28	in	in	ADP
bam-8970	17	29	different	different	ADJ
bam-8970	17	30	loci	locus	NOUN
bam-8970	17	31	would	would	AUX
bam-8970	17	32	generate	generate	VERB
bam-8970	17	33	tumorigenic	tumorigenic	ADJ
bam-8970	17	34	conditions	condition	NOUN
bam-8970	17	35	in	in	ADP
bam-8970	17	36	otherwise	otherwise	ADV
bam-8970	17	37	normal	normal	ADJ
bam-8970	17	38	tissue	tissue	NOUN
bam-8970	17	39	.	.	PUNCT
bam-8970	18	1	this	this	DET
bam-8970	18	2	predisposing	predispose	VERB
bam-8970	18	3	risk	risk	NOUN
bam-8970	18	4	would	would	AUX
bam-8970	18	5	then	then	ADV
bam-8970	18	6	be	be	AUX
bam-8970	18	7	modulated	modulate	VERB
bam-8970	18	8	differently	differently	ADV
bam-8970	18	9	in	in	ADP
bam-8970	18	10	each	each	DET
bam-8970	18	11	individual	individual	NOUN
bam-8970	18	12	from	from	ADP
bam-8970	18	13	environmental	environmental	ADJ
bam-8970	18	14	factors	factor	NOUN
bam-8970	18	15	leading	lead	VERB
bam-8970	18	16	to	to	ADP
bam-8970	18	17	tumor	tumor	NOUN
bam-8970	18	18	development.6	development.6	NOUN
bam-8970	18	19	timidylate	timidylate	NOUN
bam-8970	18	20	synthetase	synthetase	NOUN
bam-8970	18	21	(	(	PUNCT
bam-8970	18	22	tyms	tyms	PROPN
bam-8970	18	23	)	)	PUNCT
bam-8970	18	24	is	be	AUX
bam-8970	18	25	an	an	DET
bam-8970	18	26	enzyme	enzyme	NOUN
bam-8970	18	27	that	that	PRON
bam-8970	18	28	is	be	AUX
bam-8970	18	29	essential	essential	ADJ
bam-8970	18	30	for	for	ADP
bam-8970	18	31	dna	dna	NOUN
bam-8970	18	32	replication	replication	NOUN
bam-8970	18	33	and	and	CCONJ
bam-8970	18	34	repair	repair	NOUN
bam-8970	18	35	and	and	CCONJ
bam-8970	18	36	is	be	AUX
bam-8970	18	37	also	also	ADV
bam-8970	18	38	an	an	DET
bam-8970	18	39	important	important	ADJ
bam-8970	18	40	target	target	NOUN
bam-8970	18	41	for	for	ADP
bam-8970	18	42	a	a	DET
bam-8970	18	43	variety	variety	NOUN
bam-8970	18	44	of	of	ADP
bam-8970	18	45	chemotherapy	chemotherapy	NOUN
bam-8970	18	46	drugs	drug	NOUN
bam-8970	18	47	,	,	PUNCT
bam-8970	18	48	playing	play	VERB
bam-8970	18	49	an	an	DET
bam-8970	18	50	important	important	ADJ
bam-8970	18	51	role	role	NOUN
bam-8970	18	52	not	not	PART
bam-8970	18	53	only	only	ADV
bam-8970	18	54	in	in	ADP
bam-8970	18	55	cancer	cancer	NOUN
bam-8970	18	56	therapy	therapy	NOUN
bam-8970	18	57	but	but	CCONJ
bam-8970	18	58	also	also	ADV
bam-8970	18	59	possibly	possibly	ADV
bam-8970	18	60	in	in	ADP
bam-8970	18	61	cancer	cancer	NOUN
bam-8970	18	62	prevention.7	prevention.7	ADJ
bam-8970	18	63	polymorphisms	polymorphism	NOUN
bam-8970	18	64	in	in	ADP
bam-8970	18	65	the	the	DET
bam-8970	18	66	tyms	tyms	PROPN
bam-8970	18	67	gene	gene	NOUN
bam-8970	18	68	(	(	PUNCT
bam-8970	18	69	rs16430	rs16430	NOUN
bam-8970	18	70	)	)	PUNCT
bam-8970	18	71	can	can	AUX
bam-8970	18	72	therefore	therefore	ADV
bam-8970	18	73	lead	lead	VERB
bam-8970	18	74	to	to	PART
bam-8970	18	75	altered	alter	VERB
bam-8970	18	76	tyms	tyms	PROPN
bam-8970	18	77	gene	gene	NOUN
bam-8970	18	78	polymorphism	polymorphism	NOUN
bam-8970	18	79	and	and	CCONJ
bam-8970	18	80	toxicity	toxicity	NOUN
bam-8970	18	81	response	response	NOUN
bam-8970	18	82	eur	eur	PROPN
bam-8970	18	83	j	j	PROPN
bam-8970	18	84	transl	transl	PROPN
bam-8970	18	85	myol	myol	NOUN
bam-8970	18	86	2020	2020	NUM
bam-8970	18	87	;	;	PUNCT
bam-8970	18	88	30	30	NUM
bam-8970	18	89	(	(	PUNCT
bam-8970	18	90	3	3	NUM
bam-8970	18	91	):	):	PUNCT
bam-8970	18	92	8970	8970	NUM
bam-8970	18	93	.	.	PUNCT
bam-8970	19	1	doi	doi	NOUN
bam-8970	19	2	:	:	PUNCT
bam-8970	19	3	10.4081	10.4081	NUM
bam-8970	19	4	/	/	SYM
bam-8970	19	5	ejtm.2020.8970	ejtm.2020.8970	NUM
bam-8970	19	6	2	2	NUM
bam-8970	19	7	enzymatic	enzymatic	ADJ
bam-8970	19	8	function	function	NOUN
bam-8970	19	9	,	,	PUNCT
bam-8970	19	10	which	which	PRON
bam-8970	19	11	can	can	AUX
bam-8970	19	12	influence	influence	VERB
bam-8970	19	13	susceptibility	susceptibility	NOUN
bam-8970	19	14	to	to	PART
bam-8970	19	15	cancer.7	cancer.7	VERB
bam-8970	19	16	among	among	ADP
bam-8970	19	17	these	these	PRON
bam-8970	19	18	,	,	PUNCT
bam-8970	19	19	a	a	DET
bam-8970	19	20	deletion	deletion	NOUN
bam-8970	19	21	/	/	SYM
bam-8970	19	22	insertion	insertion	NOUN
bam-8970	19	23	of	of	ADP
bam-8970	19	24	6	6	NUM
bam-8970	19	25	base	base	NOUN
bam-8970	19	26	pairs	pair	NOUN
bam-8970	19	27	has	have	AUX
bam-8970	19	28	been	be	AUX
bam-8970	19	29	observed	observe	VERB
bam-8970	19	30	at	at	ADP
bam-8970	19	31	the	the	DET
bam-8970	19	32	untranslated	untranslated	ADJ
bam-8970	19	33	end	end	NOUN
bam-8970	19	34	(	(	PUNCT
bam-8970	19	35	3’-utr	3’-utr	NUM
bam-8970	19	36	)	)	PUNCT
bam-8970	19	37	.	.	PUNCT
bam-8970	20	1	therefore	therefore	ADV
bam-8970	20	2	,	,	PUNCT
bam-8970	20	3	there	there	PRON
bam-8970	20	4	exists	exist	VERB
bam-8970	20	5	different	different	ADJ
bam-8970	20	6	genotypes	genotype	NOUN
bam-8970	20	7	related	relate	VERB
bam-8970	20	8	to	to	ADP
bam-8970	20	9	insertion	insertion	NOUN
bam-8970	20	10	and	and	CCONJ
bam-8970	20	11	deletion	deletion	NOUN
bam-8970	20	12	:	:	PUNCT
bam-8970	20	13	(	(	PUNCT
bam-8970	20	14	a	a	X
bam-8970	20	15	)	)	PUNCT
bam-8970	20	16	a	a	DET
bam-8970	20	17	homozygosity	homozygosity	NOUN
bam-8970	20	18	for	for	ADP
bam-8970	20	19	deletion	deletion	NOUN
bam-8970	20	20	(	(	PUNCT
bam-8970	20	21	del	del	PROPN
bam-8970	20	22	/	/	SYM
bam-8970	20	23	del	del	PROPN
bam-8970	20	24	6	6	NUM
bam-8970	20	25	bp	bp	NOUN
bam-8970	20	26	)	)	PUNCT
bam-8970	20	27	,	,	PUNCT
bam-8970	20	28	(	(	PUNCT
bam-8970	20	29	b	b	X
bam-8970	20	30	)	)	PUNCT
bam-8970	20	31	a	a	DET
bam-8970	20	32	homozygosity	homozygosity	NOUN
bam-8970	20	33	for	for	ADP
bam-8970	20	34	insertion	insertion	NOUN
bam-8970	20	35	(	(	PUNCT
bam-8970	20	36	ins	ins	PROPN
bam-8970	20	37	/	/	SYM
bam-8970	20	38	ins	ins	PROPN
bam-8970	20	39	6bp	6bp	NOUN
bam-8970	20	40	)	)	PUNCT
bam-8970	20	41	or	or	CCONJ
bam-8970	20	42	(	(	PUNCT
bam-8970	20	43	c	c	X
bam-8970	20	44	)	)	PUNCT
bam-8970	20	45	a	a	DET
bam-8970	20	46	condition	condition	NOUN
bam-8970	20	47	of	of	ADP
bam-8970	20	48	heterozygosity	heterozygosity	NOUN
bam-8970	20	49	(	(	PUNCT
bam-8970	20	50	del	del	PROPN
bam-8970	20	51	/	/	SYM
bam-8970	20	52	ins	ins	PROPN
bam-8970	20	53	6	6	NUM
bam-8970	20	54	bp	bp	NOUN
bam-8970	20	55	)	)	PUNCT
bam-8970	20	56	.	.	PUNCT
bam-8970	21	1	the	the	DET
bam-8970	21	2	correlation	correlation	NOUN
bam-8970	21	3	between	between	ADP
bam-8970	21	4	rs16430	rs16430	NOUN
bam-8970	21	5	and	and	CCONJ
bam-8970	21	6	the	the	DET
bam-8970	21	7	susceptibility	susceptibility	NOUN
bam-8970	21	8	of	of	ADP
bam-8970	21	9	many	many	ADJ
bam-8970	21	10	tumors	tumor	NOUN
bam-8970	21	11	including	include	VERB
bam-8970	21	12	gastric	gastric	ADJ
bam-8970	21	13	cancer	cancer	NOUN
bam-8970	21	14	,	,	PUNCT
bam-8970	21	15	colorectal	colorectal	ADJ
bam-8970	21	16	cancer	cancer	NOUN
bam-8970	21	17	and	and	CCONJ
bam-8970	21	18	breast	breast	NOUN
bam-8970	21	19	cancer	cancer	NOUN
bam-8970	21	20	has	have	AUX
bam-8970	21	21	also	also	ADV
bam-8970	21	22	been	be	AUX
bam-8970	21	23	highlighted	highlight	VERB
bam-8970	21	24	in	in	ADP
bam-8970	21	25	the	the	DET
bam-8970	21	26	literature	literature	NOUN
bam-8970	21	27	,	,	PUNCT
bam-8970	21	28	exemplifying	exemplify	VERB
bam-8970	21	29	the	the	DET
bam-8970	21	30	importance	importance	NOUN
bam-8970	21	31	of	of	ADP
bam-8970	21	32	this	this	DET
bam-8970	21	33	polymorphism	polymorphism	NOUN
bam-8970	21	34	in	in	ADP
bam-8970	21	35	a	a	DET
bam-8970	21	36	discussion	discussion	NOUN
bam-8970	21	37	of	of	ADP
bam-8970	21	38	potential	potential	ADJ
bam-8970	21	39	cancer	cancer	NOUN
bam-8970	21	40	treatments	treatment	NOUN
bam-8970	21	41	.	.	PUNCT
bam-8970	22	1	the	the	DET
bam-8970	22	2	risk	risk	NOUN
bam-8970	22	3	of	of	ADP
bam-8970	22	4	breast	breast	NOUN
bam-8970	22	5	cancer	cancer	NOUN
bam-8970	22	6	has	have	AUX
bam-8970	22	7	been	be	AUX
bam-8970	22	8	associated	associate	VERB
bam-8970	22	9	with	with	ADP
bam-8970	22	10	the	the	DET
bam-8970	22	11	homozygous	homozygous	ADJ
bam-8970	22	12	deletion	deletion	NOUN
bam-8970	22	13	genotype	genotype	NOUN
bam-8970	22	14	,	,	PUNCT
bam-8970	22	15	and	and	CCONJ
bam-8970	22	16	has	have	AUX
bam-8970	22	17	been	be	AUX
bam-8970	22	18	more	more	ADV
bam-8970	22	19	evident	evident	ADJ
bam-8970	22	20	in	in	ADP
bam-8970	22	21	older	old	ADJ
bam-8970	22	22	,	,	PUNCT
bam-8970	22	23	postmenopausal	postmenopausal	ADJ
bam-8970	22	24	women	woman	NOUN
bam-8970	22	25	,	,	PUNCT
bam-8970	22	26	and	and	CCONJ
bam-8970	22	27	in	in	ADP
bam-8970	22	28	those	those	PRON
bam-8970	22	29	in	in	ADP
bam-8970	22	30	whom	whom	PRON
bam-8970	22	31	menarche	menarche	NOUN
bam-8970	22	32	occurred	occur	VERB
bam-8970	22	33	at	at	ADP
bam-8970	22	34	an	an	DET
bam-8970	22	35	older	old	ADJ
bam-8970	22	36	age	age	NOUN
bam-8970	22	37	.	.	PUNCT
bam-8970	23	1	the	the	DET
bam-8970	23	2	homozygous	homozygous	ADJ
bam-8970	23	3	insertion	insertion	NOUN
bam-8970	23	4	genotype	genotype	NOUN
bam-8970	23	5	,	,	PUNCT
bam-8970	23	6	on	on	ADP
bam-8970	23	7	the	the	DET
bam-8970	23	8	other	other	ADJ
bam-8970	23	9	hand	hand	NOUN
bam-8970	23	10	,	,	PUNCT
bam-8970	23	11	has	have	AUX
bam-8970	23	12	been	be	AUX
bam-8970	23	13	associated	associate	VERB
bam-8970	23	14	with	with	ADP
bam-8970	23	15	a	a	DET
bam-8970	23	16	significantly	significantly	ADV
bam-8970	23	17	decreased	decrease	VERB
bam-8970	23	18	risk	risk	NOUN
bam-8970	23	19	of	of	ADP
bam-8970	23	20	breast	breast	NOUN
bam-8970	23	21	cancer	cancer	NOUN
bam-8970	23	22	;	;	PUNCT
bam-8970	23	23	suggestive	suggestive	ADJ
bam-8970	23	24	of	of	ADP
bam-8970	23	25	a	a	DET
bam-8970	23	26	protective	protective	ADJ
bam-8970	23	27	effect	effect	NOUN
bam-8970	23	28	given	give	VERB
bam-8970	23	29	by	by	ADP
bam-8970	23	30	the	the	DET
bam-8970	23	31	levels	level	NOUN
bam-8970	23	32	of	of	ADP
bam-8970	23	33	sex	sex	NOUN
bam-8970	23	34	hormones	hormone	NOUN
bam-8970	23	35	during	during	ADP
bam-8970	23	36	the	the	DET
bam-8970	23	37	life	life	NOUN
bam-8970	23	38	of	of	ADP
bam-8970	23	39	the	the	DET
bam-8970	23	40	subjects	subject	NOUN
bam-8970	23	41	.	.	PUNCT
bam-8970	24	1	the	the	DET
bam-8970	24	2	same	same	ADJ
bam-8970	24	3	data	datum	NOUN
bam-8970	24	4	was	be	AUX
bam-8970	24	5	subsequently	subsequently	ADV
bam-8970	24	6	confirmed	confirm	VERB
bam-8970	24	7	in	in	ADP
bam-8970	24	8	2015	2015	NUM
bam-8970	24	9	by	by	ADP
bam-8970	24	10	guan	guan	PROPN
bam-8970	24	11	and	and	CCONJ
bam-8970	24	12	collaborators	collaborator	NOUN
bam-8970	24	13	in	in	ADP
bam-8970	24	14	a	a	DET
bam-8970	24	15	case	case	NOUN
bam-8970	24	16	-	-	PUNCT
bam-8970	24	17	control	control	NOUN
bam-8970	24	18	study	study	NOUN
bam-8970	24	19	carried	carry	VERB
bam-8970	24	20	out	out	ADP
bam-8970	24	21	on	on	ADP
bam-8970	24	22	non	non	ADJ
bam-8970	24	23	-	-	ADJ
bam-8970	24	24	hispanic	hispanic	ADJ
bam-8970	24	25	white	white	ADJ
bam-8970	24	26	women	woman	NOUN
bam-8970	24	27	aged	age	VERB
bam-8970	24	28	less	less	ADJ
bam-8970	24	29	than	than	ADP
bam-8970	24	30	or	or	CCONJ
bam-8970	24	31	equal	equal	ADJ
bam-8970	24	32	to	to	ADP
bam-8970	24	33	55	55	NUM
bam-8970	24	34	years.8	years.8	PROPN
bam-8970	24	35	the	the	DET
bam-8970	24	36	rs16430	rs16430	PROPN
bam-8970	24	37	polymorphism	polymorphism	NOUN
bam-8970	24	38	of	of	ADP
bam-8970	24	39	tyms	tyms	PROPN
bam-8970	24	40	also	also	ADV
bam-8970	24	41	appears	appear	VERB
bam-8970	24	42	to	to	PART
bam-8970	24	43	influence	influence	VERB
bam-8970	24	44	the	the	DET
bam-8970	24	45	susceptibility	susceptibility	NOUN
bam-8970	24	46	of	of	ADP
bam-8970	24	47	colorectal	colorectal	ADJ
bam-8970	24	48	cancer	cancer	NOUN
bam-8970	24	49	,	,	PUNCT
bam-8970	24	50	as	as	SCONJ
bam-8970	24	51	confirmed	confirm	VERB
bam-8970	24	52	by	by	ADP
bam-8970	24	53	vilmos	vilmo	NOUN
bam-8970	24	54	and	and	CCONJ
bam-8970	24	55	colleagues.9	colleagues.9	VERB
bam-8970	24	56	in	in	ADP
bam-8970	24	57	particular	particular	ADJ
bam-8970	24	58	,	,	PUNCT
bam-8970	24	59	the	the	DET
bam-8970	24	60	ins	ins	PROPN
bam-8970	24	61	6	6	NUM
bam-8970	24	62	/	/	SYM
bam-8970	24	63	del	del	PROPN
bam-8970	24	64	6	6	NUM
bam-8970	24	65	heterozygotes	heterozygote	NOUN
bam-8970	24	66	are	be	AUX
bam-8970	24	67	less	less	ADV
bam-8970	24	68	susceptible	susceptible	ADJ
bam-8970	24	69	to	to	ADP
bam-8970	24	70	the	the	DET
bam-8970	24	71	onset	onset	NOUN
bam-8970	24	72	of	of	ADP
bam-8970	24	73	this	this	DET
bam-8970	24	74	type	type	NOUN
bam-8970	24	75	of	of	ADP
bam-8970	24	76	tumor	tumor	NOUN
bam-8970	24	77	.	.	PUNCT
bam-8970	25	1	another	another	DET
bam-8970	25	2	variant	variant	NOUN
bam-8970	25	3	is	be	AUX
bam-8970	25	4	28	28	NUM
bam-8970	25	5	bp	bp	PROPN
bam-8970	25	6	variable	variable	ADJ
bam-8970	25	7	number	number	NOUN
bam-8970	25	8	tandem	tandem	PROPN
bam-8970	25	9	(	(	PUNCT
bam-8970	25	10	vntr	vntr	NOUN
bam-8970	25	11	)	)	PUNCT
bam-8970	25	12	polymorphism	polymorphism	NOUN
bam-8970	25	13	is	be	AUX
bam-8970	25	14	found	find	VERB
bam-8970	25	15	in	in	ADP
bam-8970	25	16	5	5	NUM
bam-8970	25	17	’	'	PUNCT
bam-8970	25	18	untraslated	untraslated	ADJ
bam-8970	25	19	region	region	NOUN
bam-8970	25	20	(	(	PUNCT
bam-8970	25	21	5’utr	5’utr	NOUN
bam-8970	25	22	)	)	PUNCT
bam-8970	25	23	of	of	ADP
bam-8970	25	24	tyms,10	tyms,10	NOUN
bam-8970	25	25	occuring	occur	VERB
bam-8970	25	26	with	with	ADP
bam-8970	25	27	variable	variable	ADJ
bam-8970	25	28	number	number	NOUN
bam-8970	25	29	generated	generate	VERB
bam-8970	25	30	two	two	NUM
bam-8970	25	31	different	different	ADJ
bam-8970	25	32	alleles:11	alleles:11	PROPN
bam-8970	25	33	two	two	NUM
bam-8970	25	34	tandem	tandem	NOUN
bam-8970	25	35	repeats	repeat	NOUN
bam-8970	25	36	(	(	PUNCT
bam-8970	25	37	2r	2r	NUM
bam-8970	25	38	)	)	PUNCT
bam-8970	25	39	or	or	CCONJ
bam-8970	25	40	three	three	NUM
bam-8970	25	41	tandem	tandem	NOUN
bam-8970	25	42	repeats	repeat	NOUN
bam-8970	25	43	(	(	PUNCT
bam-8970	25	44	3r	3r	NUM
bam-8970	25	45	)	)	PUNCT
bam-8970	25	46	.	.	PUNCT
bam-8970	26	1	while	while	SCONJ
bam-8970	26	2	3r	3r	NOUN
bam-8970	26	3	represents	represent	VERB
bam-8970	26	4	the	the	DET
bam-8970	26	5	wild	wild	ADJ
bam-8970	26	6	-	-	PUNCT
bam-8970	26	7	type	type	NOUN
bam-8970	26	8	form	form	NOUN
bam-8970	26	9	,	,	PUNCT
bam-8970	26	10	2r	2r	NUM
bam-8970	26	11	represent	represent	VERB
bam-8970	26	12	the	the	DET
bam-8970	26	13	mutant	mutant	ADJ
bam-8970	26	14	form	form	NOUN
bam-8970	26	15	and	and	CCONJ
bam-8970	26	16	the	the	DET
bam-8970	26	17	three	three	NUM
bam-8970	26	18	possible	possible	ADJ
bam-8970	26	19	genotype	genotype	NOUN
bam-8970	26	20	are	be	AUX
bam-8970	26	21	:	:	PUNCT
bam-8970	26	22	2r/2r	2r/2r	NUM
bam-8970	26	23	,	,	PUNCT
bam-8970	26	24	2r/3r	2r/3r	NUM
bam-8970	26	25	and	and	CCONJ
bam-8970	26	26	3r/3r.12	3r/3r.12	NUM
bam-8970	26	27	5	5	NUM
bam-8970	26	28	-	-	PUNCT
bam-8970	26	29	fluoruracil	fluoruracil	NOUN
bam-8970	26	30	is	be	AUX
bam-8970	26	31	a	a	DET
bam-8970	26	32	chemotherapy	chemotherapy	NOUN
bam-8970	26	33	agent	agent	NOUN
bam-8970	26	34	that	that	PRON
bam-8970	26	35	has	have	AUX
bam-8970	26	36	entered	enter	VERB
bam-8970	26	37	the	the	DET
bam-8970	26	38	practice	practice	NOUN
bam-8970	26	39	clinic	clinic	NOUN
bam-8970	26	40	for	for	ADP
bam-8970	26	41	more	more	ADJ
bam-8970	26	42	than	than	ADP
bam-8970	26	43	40	40	NUM
bam-8970	26	44	years	year	NOUN
bam-8970	26	45	as	as	ADP
bam-8970	26	46	an	an	DET
bam-8970	26	47	elective	elective	ADJ
bam-8970	26	48	drug	drug	NOUN
bam-8970	26	49	for	for	ADP
bam-8970	26	50	the	the	DET
bam-8970	26	51	treatment	treatment	NOUN
bam-8970	26	52	of	of	ADP
bam-8970	26	53	colorectal	colorectal	NOUN
bam-8970	26	54	,	,	PUNCT
bam-8970	26	55	stomach	stomach	NOUN
bam-8970	26	56	,	,	PUNCT
bam-8970	26	57	pancreas	pancreas	NOUN
bam-8970	26	58	cancers	cancer	NOUN
bam-8970	26	59	and	and	CCONJ
bam-8970	26	60	,	,	PUNCT
bam-8970	26	61	in	in	ADP
bam-8970	26	62	some	some	DET
bam-8970	26	63	specific	specific	ADJ
bam-8970	26	64	cases	case	NOUN
bam-8970	26	65	,	,	PUNCT
bam-8970	26	66	breast	breast	NOUN
bam-8970	26	67	cancer.13	cancer.13	INTJ
bam-8970	26	68	the	the	DET
bam-8970	26	69	drug	drug	NOUN
bam-8970	26	70	interferes	interfere	VERB
bam-8970	26	71	with	with	ADP
bam-8970	26	72	the	the	DET
bam-8970	26	73	synthesis	synthesis	NOUN
bam-8970	26	74	of	of	ADP
bam-8970	26	75	thymidine	thymidine	ADJ
bam-8970	26	76	nucleotides	nucleotide	NOUN
bam-8970	26	77	,	,	PUNCT
bam-8970	26	78	fundamental	fundamental	ADJ
bam-8970	26	79	for	for	ADP
bam-8970	26	80	dna	dna	PROPN
bam-8970	26	81	synthesis	synthesis	NOUN
bam-8970	26	82	,	,	PUNCT
bam-8970	26	83	acting	act	VERB
bam-8970	26	84	on	on	ADP
bam-8970	26	85	thymidylate	thymidylate	NOUN
bam-8970	26	86	synthetase	synthetase	NOUN
bam-8970	26	87	,	,	PUNCT
bam-8970	26	88	which	which	PRON
bam-8970	26	89	is	be	AUX
bam-8970	26	90	the	the	DET
bam-8970	26	91	target	target	NOUN
bam-8970	26	92	of	of	ADP
bam-8970	26	93	chemotherapy14	chemotherapy14	NOUN
bam-8970	26	94	.	.	PUNCT
bam-8970	27	1	capecitabine	capecitabine	PROPN
bam-8970	27	2	is	be	AUX
bam-8970	27	3	a	a	DET
bam-8970	27	4	non	non	ADJ
bam-8970	27	5	-	-	ADJ
bam-8970	27	6	cytotoxic	cytotoxic	ADJ
bam-8970	27	7	fluoropyrimidine	fluoropyrimidine	NOUN
bam-8970	27	8	carbamate	carbamate	NOUN
bam-8970	27	9	,	,	PUNCT
bam-8970	27	10	which	which	PRON
bam-8970	27	11	acts	act	VERB
bam-8970	27	12	as	as	ADP
bam-8970	27	13	a	a	DET
bam-8970	27	14	precursor	precursor	NOUN
bam-8970	27	15	,	,	PUNCT
bam-8970	27	16	administered	administer	VERB
bam-8970	27	17	orally	orally	ADV
bam-8970	27	18	,	,	PUNCT
bam-8970	27	19	of	of	ADP
bam-8970	27	20	5	5	NUM
bam-8970	27	21	-	-	PUNCT
bam-8970	27	22	fluoruracil	fluoruracil	ADJ
bam-8970	27	23	;	;	PUNCT
bam-8970	27	24	is	be	AUX
bam-8970	27	25	a	a	DET
bam-8970	27	26	pro	pro	ADJ
bam-8970	27	27	-	-	ADJ
bam-8970	27	28	drug	drug	ADJ
bam-8970	27	29	enzymatically	enzymatically	ADV
bam-8970	27	30	converted	convert	VERB
bam-8970	27	31	to	to	ADP
bam-8970	27	32	5	5	NUM
bam-8970	27	33	-	-	PUNCT
bam-8970	27	34	fluoruracil	fluoruracil	NOUN
bam-8970	27	35	and	and	CCONJ
bam-8970	27	36	its	its	PRON
bam-8970	27	37	pathway	pathway	NOUN
bam-8970	27	38	of	of	ADP
bam-8970	27	39	activation	activation	NOUN
bam-8970	27	40	involves	involve	VERB
bam-8970	27	41	three	three	NUM
bam-8970	27	42	enzymatic	enzymatic	ADJ
bam-8970	27	43	steps	step	NOUN
bam-8970	27	44	and	and	CCONJ
bam-8970	27	45	two	two	NUM
bam-8970	27	46	intermediate	intermediate	ADJ
bam-8970	27	47	metabolites	metabolite	NOUN
bam-8970	27	48	,	,	PUNCT
bam-8970	27	49	the	the	DET
bam-8970	27	50	5'-deoxy-5	5'-deoxy-5	NUM
bam-8970	27	51	-	-	PUNCT
bam-8970	27	52	fluorocytidine	fluorocytidine	NOUN
bam-8970	27	53	(	(	PUNCT
bam-8970	27	54	5'-dfcr	5'-dfcr	NUM
bam-8970	27	55	)	)	PUNCT
bam-8970	27	56	and	and	CCONJ
bam-8970	27	57	5'-deoxy-5	5'-deoxy-5	NUM
bam-8970	27	58	-	-	PUNCT
bam-8970	27	59	fluorouridine	fluorouridine	NOUN
bam-8970	27	60	(	(	PUNCT
bam-8970	27	61	5'-dfur	5'-dfur	NUM
bam-8970	27	62	)	)	PUNCT
bam-8970	27	63	to	to	PART
bam-8970	27	64	form	form	VERB
bam-8970	27	65	the	the	DET
bam-8970	27	66	5	5	NUM
bam-8970	27	67	-	-	PUNCT
bam-8970	27	68	fluorouracil.15	fluorouracil.15	NOUN
bam-8970	27	69	after	after	ADP
bam-8970	27	70	oral	oral	ADJ
bam-8970	27	71	administration	administration	NOUN
bam-8970	27	72	it	it	PRON
bam-8970	27	73	comes	comes	AUX
bam-8970	27	74	absorbed	absorb	VERB
bam-8970	27	75	quickly	quickly	ADV
bam-8970	27	76	and	and	CCONJ
bam-8970	27	77	extensively	extensively	ADV
bam-8970	27	78	,	,	PUNCT
bam-8970	27	79	it	it	PRON
bam-8970	27	80	is	be	AUX
bam-8970	27	81	transported	transport	VERB
bam-8970	27	82	in	in	ADP
bam-8970	27	83	the	the	DET
bam-8970	27	84	bloodstream	bloodstream	NOUN
bam-8970	27	85	bound	bind	VERB
bam-8970	27	86	to	to	ADP
bam-8970	27	87	albumin	albumin	NOUN
bam-8970	27	88	and	and	CCONJ
bam-8970	27	89	eliminated	eliminate	VERB
bam-8970	27	90	via	via	ADP
bam-8970	27	91	the	the	DET
bam-8970	27	92	kidneys	kidney	NOUN
bam-8970	27	93	.	.	PUNCT
bam-8970	28	1	the	the	DET
bam-8970	28	2	chemotherapy	chemotherapy	NOUN
bam-8970	28	3	toxicity	toxicity	NOUN
bam-8970	28	4	is	be	AUX
bam-8970	28	5	almost	almost	ADV
bam-8970	28	6	always	always	ADV
bam-8970	28	7	the	the	DET
bam-8970	28	8	greatest	great	ADJ
bam-8970	28	9	limitation	limitation	NOUN
bam-8970	28	10	in	in	ADP
bam-8970	28	11	choosing	choose	VERB
bam-8970	28	12	the	the	DET
bam-8970	28	13	appropriate	appropriate	ADJ
bam-8970	28	14	therapeutic	therapeutic	ADJ
bam-8970	28	15	dosage	dosage	NOUN
bam-8970	28	16	that	that	PRON
bam-8970	28	17	could	could	AUX
bam-8970	28	18	ensure	ensure	VERB
bam-8970	28	19	a	a	DET
bam-8970	28	20	better	well	ADJ
bam-8970	28	21	outcome	outcome	NOUN
bam-8970	28	22	for	for	ADP
bam-8970	28	23	patients	patient	NOUN
bam-8970	28	24	,	,	PUNCT
bam-8970	28	25	in	in	ADP
bam-8970	28	26	terms	term	NOUN
bam-8970	28	27	of	of	ADP
bam-8970	28	28	improving	improve	VERB
bam-8970	28	29	both	both	DET
bam-8970	28	30	quality	quality	NOUN
bam-8970	28	31	of	of	ADP
bam-8970	28	32	life	life	NOUN
bam-8970	28	33	and	and	CCONJ
bam-8970	28	34	survival.16	survival.16	PRON
bam-8970	28	35	the	the	DET
bam-8970	28	36	aim	aim	NOUN
bam-8970	28	37	of	of	ADP
bam-8970	28	38	our	our	PRON
bam-8970	28	39	study	study	NOUN
bam-8970	28	40	was	be	AUX
bam-8970	28	41	to	to	PART
bam-8970	28	42	evaluate	evaluate	VERB
bam-8970	28	43	the	the	DET
bam-8970	28	44	possible	possible	ADJ
bam-8970	28	45	correlation	correlation	NOUN
bam-8970	28	46	between	between	ADP
bam-8970	28	47	the	the	DET
bam-8970	28	48	aforementioned	aforementioned	ADJ
bam-8970	28	49	gene	gene	NOUN
bam-8970	28	50	variants	variant	NOUN
bam-8970	28	51	and	and	CCONJ
bam-8970	28	52	the	the	DET
bam-8970	28	53	degree	degree	NOUN
bam-8970	28	54	of	of	ADP
bam-8970	28	55	toxicity	toxicity	NOUN
bam-8970	28	56	observed	observe	VERB
bam-8970	28	57	following	follow	VERB
bam-8970	28	58	chemotherapy	chemotherapy	NOUN
bam-8970	28	59	.	.	PUNCT
bam-8970	29	1	materials	material	NOUN
bam-8970	29	2	and	and	CCONJ
bam-8970	29	3	methods	method	NOUN
bam-8970	29	4	patients	patient	NOUN
bam-8970	29	5	we	we	PRON
bam-8970	29	6	enrolled	enrol	VERB
bam-8970	29	7	47	47	NUM
bam-8970	29	8	patients	patient	NOUN
bam-8970	29	9	from	from	ADP
bam-8970	29	10	the	the	DET
bam-8970	29	11	oncology	oncology	NOUN
bam-8970	29	12	operative	operative	ADJ
bam-8970	29	13	unit	unit	NOUN
bam-8970	29	14	of	of	ADP
bam-8970	29	15	the	the	DET
bam-8970	29	16	sant’elia	sant’elia	ADJ
bam-8970	29	17	hospital	hospital	NOUN
bam-8970	29	18	in	in	ADP
bam-8970	29	19	caltanissetta	caltanissetta	NOUN
bam-8970	29	20	,	,	PUNCT
bam-8970	29	21	sicily	sicily	ADV
bam-8970	29	22	.	.	PUNCT
bam-8970	30	1	the	the	DET
bam-8970	30	2	group	group	NOUN
bam-8970	30	3	consisted	consist	VERB
bam-8970	30	4	of	of	ADP
bam-8970	30	5	24	24	NUM
bam-8970	30	6	women	woman	NOUN
bam-8970	30	7	and	and	CCONJ
bam-8970	30	8	23	23	NUM
bam-8970	30	9	men	man	NOUN
bam-8970	30	10	aged	age	VERB
bam-8970	30	11	between	between	ADP
bam-8970	30	12	39	39	NUM
bam-8970	30	13	and	and	CCONJ
bam-8970	30	14	85	85	NUM
bam-8970	30	15	,	,	PUNCT
bam-8970	30	16	8	8	NUM
bam-8970	30	17	with	with	ADP
bam-8970	30	18	breast	breast	NOUN
bam-8970	30	19	cancer	cancer	NOUN
bam-8970	30	20	and	and	CCONJ
bam-8970	30	21	39	39	NUM
bam-8970	30	22	with	with	ADP
bam-8970	30	23	gastric	gastric	ADJ
bam-8970	30	24	cancer	cancer	NOUN
bam-8970	30	25	.	.	PUNCT
bam-8970	31	1	the	the	DET
bam-8970	31	2	aforementioned	aforementioned	ADJ
bam-8970	31	3	patients	patient	NOUN
bam-8970	31	4	performed	perform	VERB
bam-8970	31	5	the	the	DET
bam-8970	31	6	chemotherapy	chemotherapy	NOUN
bam-8970	31	7	treatment	treatment	NOUN
bam-8970	31	8	according	accord	VERB
bam-8970	31	9	to	to	ADP
bam-8970	31	10	the	the	DET
bam-8970	31	11	therapeutic	therapeutic	ADJ
bam-8970	31	12	protocol	protocol	NOUN
bam-8970	31	13	appropriate	appropriate	ADJ
bam-8970	31	14	to	to	ADP
bam-8970	31	15	their	their	PRON
bam-8970	31	16	pathology	pathology	NOUN
bam-8970	31	17	;	;	PUNCT
bam-8970	31	18	particularly	particularly	ADV
bam-8970	31	19	17	17	NUM
bam-8970	31	20	patients	patient	NOUN
bam-8970	31	21	in	in	ADP
bam-8970	31	22	the	the	DET
bam-8970	31	23	adjuvant	adjuvant	ADJ
bam-8970	31	24	stage	stage	NOUN
bam-8970	31	25	whilst	whilst	SCONJ
bam-8970	31	26	the	the	DET
bam-8970	31	27	others	other	NOUN
bam-8970	31	28	30	30	NUM
bam-8970	31	29	in	in	ADP
bam-8970	31	30	the	the	DET
bam-8970	31	31	metastatic	metastatic	ADJ
bam-8970	31	32	stage	stage	NOUN
bam-8970	31	33	.	.	PUNCT
bam-8970	32	1	the	the	DET
bam-8970	32	2	patients	patient	NOUN
bam-8970	32	3	received	receive	VERB
bam-8970	32	4	adjuvant	adjuvant	ADJ
bam-8970	32	5	5	5	NUM
bam-8970	32	6	-	-	PUNCT
bam-8970	32	7	fubased	fubase	VERB
bam-8970	32	8	chemotherapy	chemotherapy	NOUN
bam-8970	32	9	mixed	mix	VERB
bam-8970	32	10	with	with	ADP
bam-8970	32	11	a	a	DET
bam-8970	32	12	different	different	ADJ
bam-8970	32	13	concentration	concentration	NOUN
bam-8970	32	14	of	of	ADP
bam-8970	32	15	capecitabine	capecitabine	NOUN
bam-8970	32	16	.	.	PUNCT
bam-8970	33	1	toxicity	toxicity	NOUN
bam-8970	33	2	was	be	AUX
bam-8970	33	3	recorded	record	VERB
bam-8970	33	4	according	accord	VERB
bam-8970	33	5	to	to	ADP
bam-8970	33	6	the	the	DET
bam-8970	33	7	criteria	criterion	NOUN
bam-8970	33	8	of	of	ADP
bam-8970	33	9	the	the	DET
bam-8970	33	10	world	world	PROPN
bam-8970	33	11	health	health	PROPN
bam-8970	33	12	organization	organization	PROPN
bam-8970	33	13	.	.	PUNCT
bam-8970	34	1	physical	physical	ADJ
bam-8970	34	2	examination	examination	NOUN
bam-8970	34	3	and	and	CCONJ
bam-8970	34	4	a	a	DET
bam-8970	34	5	full	full	ADJ
bam-8970	34	6	blood	blood	NOUN
bam-8970	34	7	count	count	NOUN
bam-8970	34	8	were	be	AUX
bam-8970	34	9	performed	perform	VERB
bam-8970	34	10	before	before	ADP
bam-8970	34	11	the	the	DET
bam-8970	34	12	chemotherapy	chemotherapy	NOUN
bam-8970	34	13	treatment	treatment	NOUN
bam-8970	34	14	.	.	PUNCT
bam-8970	35	1	all	all	DET
bam-8970	35	2	the	the	DET
bam-8970	35	3	patients	patient	NOUN
bam-8970	35	4	who	who	PRON
bam-8970	35	5	had	have	AUX
bam-8970	35	6	received	receive	VERB
bam-8970	35	7	at	at	ADP
bam-8970	35	8	least	least	ADV
bam-8970	35	9	one	one	NUM
bam-8970	35	10	course	course	NOUN
bam-8970	35	11	of	of	ADP
bam-8970	35	12	chemotherapy	chemotherapy	NOUN
bam-8970	35	13	were	be	AUX
bam-8970	35	14	evaluated	evaluate	VERB
bam-8970	35	15	for	for	ADP
bam-8970	35	16	toxicity	toxicity	NOUN
bam-8970	35	17	.	.	PUNCT
bam-8970	36	1	the	the	DET
bam-8970	36	2	same	same	ADJ
bam-8970	36	3	chemotherapy	chemotherapy	NOUN
bam-8970	36	4	regimen	regiman	NOUN
bam-8970	36	5	was	be	AUX
bam-8970	36	6	maintained	maintain	VERB
bam-8970	36	7	until	until	ADP
bam-8970	36	8	disease	disease	NOUN
bam-8970	36	9	progression	progression	NOUN
bam-8970	36	10	or	or	CCONJ
bam-8970	36	11	severe	severe	ADJ
bam-8970	36	12	toxicity	toxicity	NOUN
bam-8970	36	13	.	.	PUNCT
bam-8970	37	1	dna	dna	PROPN
bam-8970	37	2	extraction	extraction	NOUN
bam-8970	37	3	and	and	CCONJ
bam-8970	37	4	genotyping	genotyping	NOUN
bam-8970	37	5	after	after	SCONJ
bam-8970	37	6	signed	sign	VERB
bam-8970	37	7	informed	informed	ADJ
bam-8970	37	8	consent	consent	NOUN
bam-8970	37	9	from	from	ADP
bam-8970	37	10	each	each	DET
bam-8970	37	11	patient	patient	NOUN
bam-8970	37	12	,	,	PUNCT
bam-8970	37	13	the	the	DET
bam-8970	37	14	blood	blood	NOUN
bam-8970	37	15	sample	sample	NOUN
bam-8970	37	16	was	be	AUX
bam-8970	37	17	collected	collect	VERB
bam-8970	37	18	in	in	ADP
bam-8970	37	19	sterile	sterile	ADJ
bam-8970	37	20	tubes	tube	NOUN
bam-8970	37	21	containing	contain	VERB
bam-8970	37	22	the	the	DET
bam-8970	37	23	anticoagulant	anticoagulant	ADJ
bam-8970	37	24	ethylenediamine	ethylenediamine	NOUN
bam-8970	37	25	tetraacetic	tetraacetic	ADJ
bam-8970	37	26	acid	acid	PROPN
bam-8970	37	27	(	(	PUNCT
bam-8970	37	28	edta	edta	NOUN
bam-8970	37	29	)	)	PUNCT
bam-8970	37	30	,	,	PUNCT
bam-8970	37	31	and	and	CCONJ
bam-8970	37	32	stored	store	VERB
bam-8970	37	33	at	at	ADP
bam-8970	37	34	-90	-90	NOUN
bam-8970	37	35	°	°	NOUN
bam-8970	37	36	c	c	NOUN
bam-8970	37	37	until	until	ADP
bam-8970	37	38	the	the	DET
bam-8970	37	39	analysis	analysis	NOUN
bam-8970	37	40	.	.	PUNCT
bam-8970	38	1	genomic	genomic	ADJ
bam-8970	38	2	dna	dna	PROPN
bam-8970	38	3	was	be	AUX
bam-8970	38	4	isolated	isolate	VERB
bam-8970	38	5	from	from	ADP
bam-8970	38	6	an	an	DET
bam-8970	38	7	aliquot	aliquot	NOUN
bam-8970	38	8	of	of	ADP
bam-8970	38	9	peripheral	peripheral	ADJ
bam-8970	38	10	blood	blood	NOUN
bam-8970	38	11	using	use	VERB
bam-8970	38	12	a	a	DET
bam-8970	38	13	purelink	purelink	NOUN
bam-8970	38	14	blood	blood	NOUN
bam-8970	38	15	kit	kit	NOUN
bam-8970	38	16	(	(	PUNCT
bam-8970	38	17	purelink	purelink	VERB
bam-8970	38	18	genomic	genomic	PROPN
bam-8970	38	19	dna	dna	NOUN
bam-8970	38	20	,	,	PUNCT
bam-8970	38	21	thermofisher	thermofisher	ADJ
bam-8970	38	22	scientific	scientific	NOUN
bam-8970	38	23	)	)	PUNCT
bam-8970	38	24	.	.	PUNCT
bam-8970	39	1	this	this	PRON
bam-8970	39	2	was	be	AUX
bam-8970	39	3	used	use	VERB
bam-8970	39	4	as	as	ADP
bam-8970	39	5	a	a	DET
bam-8970	39	6	template	template	NOUN
bam-8970	39	7	for	for	ADP
bam-8970	39	8	polymerase	polymerase	NOUN
bam-8970	39	9	chain	chain	NOUN
bam-8970	39	10	reaction	reaction	NOUN
bam-8970	39	11	and	and	CCONJ
bam-8970	39	12	subsequent	subsequent	ADJ
bam-8970	39	13	enzymatic	enzymatic	ADJ
bam-8970	39	14	table	table	NOUN
bam-8970	39	15	1	1	NUM
bam-8970	39	16	.	.	PUNCT
bam-8970	39	17	information	information	NOUN
bam-8970	39	18	on	on	ADP
bam-8970	39	19	genotyping	genotype	VERB
bam-8970	39	20	methods	method	NOUN
bam-8970	39	21	for	for	ADP
bam-8970	39	22	each	each	DET
bam-8970	39	23	polymorphism	polymorphism	NOUN
bam-8970	39	24	.	.	PUNCT
bam-8970	40	1	gene	gene	NOUN
bam-8970	40	2	polymorphism	polymorphism	NOUN
bam-8970	40	3	and	and	CCONJ
bam-8970	40	4	reference	reference	NOUN
bam-8970	40	5	i	i	PROPN
bam-8970	40	6	d	d	PROPN
bam-8970	40	7	nucleotide	nucleotide	NOUN
bam-8970	40	8	sequence	sequence	NOUN
bam-8970	40	9	annealing	anneal	VERB
bam-8970	40	10	temperature	temperature	NOUN
bam-8970	40	11	restricion	restricion	NOUN
bam-8970	40	12	enzyme	enzyme	NOUN
bam-8970	40	13	tyms	tym	NOUN
bam-8970	40	14	(	(	PUNCT
bam-8970	40	15	2r/3r	2r/3r	NUM
bam-8970	40	16	)	)	PUNCT
bam-8970	40	17	rs34743033	rs34743033	VERB
bam-8970	40	18	f-5’gtggctcctgcgtttccccc	f-5’gtggctcctgcgtttccccc	DET
bam-8970	40	19	3	3	NUM
bam-8970	40	20	’	'	PUNCT
bam-8970	40	21	r-5’gctccgagccggccacaggcatggcgcgg	r-5’gctccgagccggccacaggcatggcgcgg	NUM
bam-8970	40	22	-3	-3	PUNCT
bam-8970	40	23	’	'	PUNCT
bam-8970	40	24	62	62	NUM
bam-8970	40	25	°	°	VERB
bam-8970	41	1	dra	dra	PROPN
bam-8970	42	1	i	i	PRON
bam-8970	42	2	tyms	tyms	VERB
bam-8970	42	3	(	(	PUNCT
bam-8970	42	4	del	del	PROPN
bam-8970	42	5	/	/	SYM
bam-8970	42	6	ins	ins	PROPN
bam-8970	42	7	6	6	NUM
bam-8970	42	8	bp	bp	NOUN
bam-8970	42	9	)	)	PUNCT
bam-8970	42	10	rs16430	rs16430	NOUN
bam-8970	42	11	f-5’cacaagctatttttggaaaattt3	f-5’cacaagctatttttggaaaattt3	NOUN
bam-8970	42	12	’	'	PUNCT
bam-8970	42	13	r-5’gacgaatgcagaacacttct3	r-5’gacgaatgcagaacacttct3	ADJ
bam-8970	42	14	’	'	PUNCT
bam-8970	42	15	56	56	NUM
bam-8970	42	16	°	°	NOUN
bam-8970	42	17	_	_	PUNCT
bam-8970	43	1	_	_	PUNCT
bam-8970	43	2	_	_	PUNCT
bam-8970	44	1	tyms	tyms	PROPN
bam-8970	44	2	gene	gene	NOUN
bam-8970	44	3	polymorphism	polymorphism	NOUN
bam-8970	44	4	and	and	CCONJ
bam-8970	44	5	toxicity	toxicity	NOUN
bam-8970	44	6	response	response	NOUN
bam-8970	44	7	eur	eur	PROPN
bam-8970	44	8	j	j	PROPN
bam-8970	44	9	transl	transl	PROPN
bam-8970	44	10	myol	myol	NOUN
bam-8970	44	11	2020	2020	NUM
bam-8970	44	12	;	;	PUNCT
bam-8970	44	13	30	30	NUM
bam-8970	44	14	(	(	PUNCT
bam-8970	44	15	3	3	NUM
bam-8970	44	16	):	):	PUNCT
bam-8970	44	17	8970	8970	NUM
bam-8970	44	18	.	.	PUNCT
bam-8970	45	1	doi	doi	NOUN
bam-8970	45	2	:	:	PUNCT
bam-8970	45	3	10.4081	10.4081	NUM
bam-8970	45	4	/	/	SYM
bam-8970	45	5	ejtm.2020.8970	ejtm.2020.8970	PROPN
bam-8970	45	6	3	3	NUM
bam-8970	45	7	digestion	digestion	NOUN
bam-8970	45	8	when	when	SCONJ
bam-8970	45	9	request	request	NOUN
bam-8970	45	10	,	,	PUNCT
bam-8970	45	11	to	to	PART
bam-8970	45	12	detect	detect	VERB
bam-8970	45	13	the	the	DET
bam-8970	45	14	genotype	genotype	NOUN
bam-8970	45	15	of	of	ADP
bam-8970	45	16	tyms	tyms	PROPN
bam-8970	45	17	gene	gene	NOUN
bam-8970	45	18	variants	variant	NOUN
bam-8970	45	19	(	(	PUNCT
bam-8970	45	20	table	table	NOUN
bam-8970	45	21	1	1	NUM
bam-8970	45	22	)	)	PUNCT
bam-8970	45	23	.	.	PUNCT
bam-8970	46	1	statistical	statistical	ADJ
bam-8970	46	2	analysis	analysis	NOUN
bam-8970	46	3	in	in	ADP
bam-8970	46	4	order	order	NOUN
bam-8970	46	5	to	to	PART
bam-8970	46	6	evaluate	evaluate	VERB
bam-8970	46	7	the	the	DET
bam-8970	46	8	association	association	NOUN
bam-8970	46	9	between	between	ADP
bam-8970	46	10	dependent	dependent	ADJ
bam-8970	46	11	variables	variable	NOUN
bam-8970	46	12	(	(	PUNCT
bam-8970	46	13	gastric	gastric	ADJ
bam-8970	46	14	and	and	CCONJ
bam-8970	46	15	hematological	hematological	ADJ
bam-8970	46	16	toxicity	toxicity	NOUN
bam-8970	46	17	)	)	PUNCT
bam-8970	46	18	and	and	CCONJ
bam-8970	46	19	independent	independent	ADJ
bam-8970	46	20	variables	variable	NOUN
bam-8970	46	21	(	(	PUNCT
bam-8970	46	22	genotype	genotype	NOUN
bam-8970	46	23	1	1	NUM
bam-8970	46	24	,	,	PUNCT
bam-8970	46	25	genotype	genotype	NOUN
bam-8970	46	26	2	2	NUM
bam-8970	46	27	,	,	PUNCT
bam-8970	46	28	tumor	tumor	NOUN
bam-8970	46	29	stage	stage	NOUN
bam-8970	46	30	,	,	PUNCT
bam-8970	46	31	tumor	tumor	NOUN
bam-8970	46	32	type	type	NOUN
bam-8970	46	33	,	,	PUNCT
bam-8970	46	34	gender	gender	NOUN
bam-8970	46	35	)	)	PUNCT
bam-8970	46	36	.	.	PUNCT
bam-8970	47	1	the	the	DET
bam-8970	47	2	distribution	distribution	NOUN
bam-8970	47	3	frequencies	frequency	NOUN
bam-8970	47	4	of	of	ADP
bam-8970	47	5	independent	independent	ADJ
bam-8970	47	6	variable	variable	ADJ
bam-8970	47	7	parameters	parameter	NOUN
bam-8970	47	8	,	,	PUNCT
bam-8970	47	9	for	for	ADP
bam-8970	47	10	all	all	DET
bam-8970	47	11	subjects	subject	NOUN
bam-8970	47	12	were	be	AUX
bam-8970	47	13	calculated	calculate	VERB
bam-8970	47	14	.	.	PUNCT
bam-8970	48	1	dichotomic	dichotomic	ADJ
bam-8970	48	2	variables	variable	NOUN
bam-8970	48	3	were	be	AUX
bam-8970	48	4	expressed	express	VERB
bam-8970	48	5	as	as	ADP
bam-8970	48	6	number	number	NOUN
bam-8970	48	7	and	and	CCONJ
bam-8970	48	8	percentage	percentage	NOUN
bam-8970	48	9	and	and	CCONJ
bam-8970	48	10	analyzed	analyze	VERB
bam-8970	48	11	with	with	ADP
bam-8970	48	12	the	the	DET
bam-8970	48	13	fisher	fisher	NOUN
bam-8970	48	14	's	's	PART
bam-8970	48	15	exact	exact	ADJ
bam-8970	48	16	probability	probability	NOUN
bam-8970	48	17	test	test	NOUN
bam-8970	48	18	.	.	PUNCT
bam-8970	49	1	the	the	DET
bam-8970	49	2	chi	chi	ADJ
bam-8970	49	3	-	-	PUNCT
bam-8970	49	4	square	square	ADJ
bam-8970	49	5	test	test	NOUN
bam-8970	49	6	was	be	AUX
bam-8970	49	7	possible	possible	ADJ
bam-8970	49	8	perform	perform	NOUN
bam-8970	49	9	only	only	ADV
bam-8970	49	10	between	between	ADP
bam-8970	49	11	the	the	DET
bam-8970	49	12	dependent	dependent	ADJ
bam-8970	49	13	variable	variable	ADJ
bam-8970	49	14	table	table	NOUN
bam-8970	49	15	2	2	NUM
bam-8970	49	16	.	.	X
bam-8970	49	17	crosstab	crosstab	NOUN
bam-8970	49	18	:	:	PUNCT
bam-8970	49	19	hematological	hematological	ADJ
bam-8970	49	20	-toxicity*independent	-toxicity*independent	NOUN
bam-8970	49	21	variables	variable	VERB
bam-8970	49	22	independent	independent	ADJ
bam-8970	49	23	variable	variable	ADJ
bam-8970	49	24	level	level	NOUN
bam-8970	49	25	toxicity	toxicity	NOUN
bam-8970	49	26	(	(	PUNCT
bam-8970	49	27	subjects	subject	NOUN
bam-8970	49	28	number	number	NOUN
bam-8970	49	29	)	)	PUNCT
bam-8970	49	30	notoxicity	notoxicity	NOUN
bam-8970	49	31	(	(	PUNCT
bam-8970	49	32	subjects	subject	NOUN
bam-8970	49	33	number	number	NOUN
bam-8970	49	34	)	)	PUNCT
bam-8970	49	35	total	total	ADJ
bam-8970	49	36	gender	gender	NOUN
bam-8970	49	37	male	male	NOUN
bam-8970	49	38	13	13	NUM
bam-8970	49	39	10	10	NUM
bam-8970	49	40	23	23	NUM
bam-8970	49	41	female	female	ADJ
bam-8970	49	42	16	16	NUM
bam-8970	49	43	8	8	NUM
bam-8970	49	44	24	24	NUM
bam-8970	49	45	total	total	NOUN
bam-8970	49	46	29	29	NUM
bam-8970	49	47	18	18	NUM
bam-8970	49	48	47	47	NUM
bam-8970	49	49	genotype	genotype	NOUN
bam-8970	49	50	1	1	NUM
bam-8970	49	51	2r/2r	2r/2r	NUM
bam-8970	49	52	5	5	NUM
bam-8970	49	53	0	0	NUM
bam-8970	49	54	5	5	NUM
bam-8970	49	55	2r/3r	2r/3r	NUM
bam-8970	49	56	14	14	NUM
bam-8970	49	57	10	10	NUM
bam-8970	49	58	24	24	NUM
bam-8970	49	59	3r/3r	3r/3r	NUM
bam-8970	49	60	10	10	NUM
bam-8970	49	61	8	8	NUM
bam-8970	49	62	18	18	NUM
bam-8970	49	63	total	total	NOUN
bam-8970	49	64	29	29	NUM
bam-8970	49	65	18	18	NUM
bam-8970	49	66	47	47	NUM
bam-8970	49	67	genotype	genotype	NOUN
bam-8970	49	68	2	2	NUM
bam-8970	49	69	ins	in	NOUN
bam-8970	49	70	/	/	SYM
bam-8970	49	71	ins	ins	PROPN
bam-8970	49	72	7	7	NUM
bam-8970	49	73	8	8	NUM
bam-8970	49	74	15	15	NUM
bam-8970	49	75	del	del	PROPN
bam-8970	49	76	/	/	SYM
bam-8970	49	77	ins	ins	PROPN
bam-8970	49	78	13	13	NUM
bam-8970	49	79	7	7	NUM
bam-8970	49	80	20	20	NUM
bam-8970	49	81	del	del	PROPN
bam-8970	49	82	/	/	SYM
bam-8970	49	83	del	del	PROPN
bam-8970	49	84	9	9	NUM
bam-8970	49	85	3	3	NUM
bam-8970	49	86	12	12	NUM
bam-8970	49	87	total	total	NOUN
bam-8970	49	88	29	29	NUM
bam-8970	49	89	18	18	NUM
bam-8970	49	90	47	47	NUM
bam-8970	49	91	tumor	tumor	NOUN
bam-8970	49	92	type	type	NOUN
bam-8970	49	93	gastric	gastric	ADJ
bam-8970	49	94	23	23	NUM
bam-8970	49	95	16	16	NUM
bam-8970	49	96	39	39	NUM
bam-8970	49	97	breast	breast	NOUN
bam-8970	49	98	6	6	NUM
bam-8970	49	99	2	2	NUM
bam-8970	49	100	8	8	NUM
bam-8970	49	101	total	total	NOUN
bam-8970	49	102	29	29	NUM
bam-8970	49	103	18	18	NUM
bam-8970	49	104	47	47	NUM
bam-8970	49	105	tumor	tumor	NOUN
bam-8970	49	106	stage	stage	NOUN
bam-8970	49	107	adjuvant	adjuvant	ADJ
bam-8970	49	108	9	9	NUM
bam-8970	49	109	8	8	NUM
bam-8970	49	110	17	17	NUM
bam-8970	49	111	metastatic	metastatic	ADJ
bam-8970	49	112	20	20	NUM
bam-8970	49	113	10	10	NUM
bam-8970	49	114	30	30	NUM
bam-8970	49	115	total	total	NOUN
bam-8970	49	116	29	29	NUM
bam-8970	49	117	18	18	NUM
bam-8970	49	118	47	47	NUM
bam-8970	49	119	table	table	NOUN
bam-8970	50	1	3	3	NUM
bam-8970	50	2	.	.	X
bam-8970	50	3	crosstab	crosstab	NOUN
bam-8970	50	4	:	:	PUNCT
bam-8970	50	5	gastric	gastric	NOUN
bam-8970	50	6	-	-	PUNCT
bam-8970	50	7	toxicity*independent	toxicity*independent	NOUN
bam-8970	50	8	variables	variable	VERB
bam-8970	50	9	independent	independent	ADJ
bam-8970	50	10	variable	variable	ADJ
bam-8970	50	11	level	level	NOUN
bam-8970	50	12	toxicity	toxicity	NOUN
bam-8970	50	13	(	(	PUNCT
bam-8970	50	14	subjects	subject	NOUN
bam-8970	50	15	number	number	NOUN
bam-8970	50	16	)	)	PUNCT
bam-8970	50	17	notoxicity	notoxicity	NOUN
bam-8970	50	18	(	(	PUNCT
bam-8970	50	19	subjects	subject	NOUN
bam-8970	50	20	number	number	NOUN
bam-8970	50	21	)	)	PUNCT
bam-8970	50	22	total	total	ADJ
bam-8970	50	23	gender	gender	NOUN
bam-8970	50	24	male	male	NOUN
bam-8970	50	25	2	2	NUM
bam-8970	50	26	21	21	NUM
bam-8970	50	27	23	23	NUM
bam-8970	50	28	female	female	NOUN
bam-8970	50	29	6	6	NUM
bam-8970	50	30	18	18	NUM
bam-8970	50	31	24	24	NUM
bam-8970	50	32	total	total	NOUN
bam-8970	50	33	8	8	NUM
bam-8970	50	34	39	39	NUM
bam-8970	50	35	47	47	NUM
bam-8970	50	36	genotype	genotype	NOUN
bam-8970	50	37	1	1	NUM
bam-8970	50	38	2r/2r	2r/2r	NUM
bam-8970	50	39	0	0	NUM
bam-8970	50	40	5	5	NUM
bam-8970	50	41	5	5	NUM
bam-8970	50	42	2r/3r	2r/3r	NUM
bam-8970	50	43	5	5	NUM
bam-8970	50	44	19	19	NUM
bam-8970	50	45	24	24	NUM
bam-8970	50	46	3r/3r	3r/3r	NUM
bam-8970	50	47	3	3	NUM
bam-8970	50	48	15	15	NUM
bam-8970	50	49	18	18	NUM
bam-8970	50	50	total	total	NOUN
bam-8970	50	51	8	8	NUM
bam-8970	50	52	39	39	NUM
bam-8970	50	53	47	47	NUM
bam-8970	50	54	genotype	genotype	NOUN
bam-8970	50	55	2	2	NUM
bam-8970	50	56	ins	in	NOUN
bam-8970	50	57	/	/	SYM
bam-8970	50	58	ins	ins	PROPN
bam-8970	50	59	1	1	NUM
bam-8970	50	60	14	14	NUM
bam-8970	50	61	15	15	NUM
bam-8970	50	62	del	del	PROPN
bam-8970	50	63	/	/	SYM
bam-8970	50	64	ins	ins	PROPN
bam-8970	50	65	4	4	NUM
bam-8970	50	66	16	16	NUM
bam-8970	50	67	20	20	NUM
bam-8970	50	68	del	del	PROPN
bam-8970	50	69	/	/	SYM
bam-8970	50	70	del	del	PROPN
bam-8970	50	71	3	3	NUM
bam-8970	50	72	9	9	NUM
bam-8970	50	73	12	12	NUM
bam-8970	50	74	total	total	NOUN
bam-8970	50	75	8	8	NUM
bam-8970	50	76	39	39	NUM
bam-8970	50	77	47	47	NUM
bam-8970	50	78	tumor	tumor	NOUN
bam-8970	50	79	type	type	NOUN
bam-8970	50	80	gastric	gastric	ADJ
bam-8970	50	81	7	7	NUM
bam-8970	50	82	32	32	NUM
bam-8970	50	83	39	39	NUM
bam-8970	50	84	breast	breast	NOUN
bam-8970	50	85	1	1	NUM
bam-8970	50	86	7	7	NUM
bam-8970	50	87	8	8	NUM
bam-8970	50	88	total	total	NOUN
bam-8970	50	89	8	8	NUM
bam-8970	50	90	39	39	NUM
bam-8970	50	91	47	47	NUM
bam-8970	50	92	tumor	tumor	NOUN
bam-8970	50	93	stage	stage	NOUN
bam-8970	50	94	adjuvant	adjuvant	ADJ
bam-8970	50	95	1	1	NUM
bam-8970	50	96	16	16	NUM
bam-8970	50	97	17	17	NUM
bam-8970	50	98	metastatic	metastatic	ADJ
bam-8970	50	99	7	7	NUM
bam-8970	50	100	23	23	NUM
bam-8970	50	101	30	30	NUM
bam-8970	50	102	total	total	NOUN
bam-8970	50	103	8	8	NUM
bam-8970	50	104	39	39	NUM
bam-8970	50	105	47	47	NUM
bam-8970	50	106	tyms	tyms	PROPN
bam-8970	50	107	gene	gene	NOUN
bam-8970	50	108	polymorphism	polymorphism	NOUN
bam-8970	50	109	and	and	CCONJ
bam-8970	50	110	toxicity	toxicity	NOUN
bam-8970	50	111	response	response	NOUN
bam-8970	50	112	eur	eur	PROPN
bam-8970	50	113	j	j	PROPN
bam-8970	50	114	transl	transl	PROPN
bam-8970	50	115	myol	myol	NOUN
bam-8970	50	116	2020	2020	NUM
bam-8970	50	117	;	;	PUNCT
bam-8970	50	118	30	30	NUM
bam-8970	50	119	(	(	PUNCT
bam-8970	50	120	3	3	NUM
bam-8970	50	121	):	):	PUNCT
bam-8970	50	122	8970	8970	NUM
bam-8970	50	123	.	.	PUNCT
bam-8970	51	1	doi	doi	NOUN
bam-8970	51	2	:	:	PUNCT
bam-8970	51	3	10.4081	10.4081	NUM
bam-8970	51	4	/	/	SYM
bam-8970	51	5	ejtm.2020.8970	ejtm.2020.8970	NUM
bam-8970	51	6	4	4	NUM
bam-8970	51	7	hematological	hematological	ADJ
bam-8970	51	8	toxicity	toxicity	NOUN
bam-8970	51	9	and	and	CCONJ
bam-8970	51	10	the	the	DET
bam-8970	51	11	independent	independent	ADJ
bam-8970	51	12	variable	variable	ADJ
bam-8970	51	13	gender	gender	NOUN
bam-8970	51	14	.	.	PUNCT
bam-8970	52	1	results	result	NOUN
bam-8970	52	2	were	be	AUX
bam-8970	52	3	expressed	express	VERB
bam-8970	52	4	as	as	ADP
bam-8970	52	5	p	p	NOUN
bam-8970	52	6	-	-	PUNCT
bam-8970	52	7	value	value	NOUN
bam-8970	52	8	.	.	PUNCT
bam-8970	53	1	significance	significance	NOUN
bam-8970	53	2	was	be	AUX
bam-8970	53	3	defined	define	VERB
bam-8970	53	4	as	as	ADP
bam-8970	53	5	value	value	NOUN
bam-8970	53	6	of	of	ADP
bam-8970	53	7	p	p	NOUN
bam-8970	53	8	(	(	PUNCT
bam-8970	53	9	alpha	alpha	NOUN
bam-8970	53	10	error	error	NOUN
bam-8970	53	11	)	)	PUNCT
bam-8970	53	12	<	<	X
bam-8970	53	13	0.05	0.05	NUM
bam-8970	53	14	.	.	PUNCT
bam-8970	54	1	the	the	DET
bam-8970	54	2	analyzes	analyze	NOUN
bam-8970	54	3	were	be	AUX
bam-8970	54	4	performed	perform	VERB
bam-8970	54	5	using	use	VERB
bam-8970	54	6	ibm	ibm	PROPN
bam-8970	54	7	spss	spss	PROPN
bam-8970	54	8	statistics	statistic	NOUN
bam-8970	54	9	23.0	23.0	NUM
bam-8970	54	10	(	(	PUNCT
bam-8970	54	11	ibm	ibm	PROPN
bam-8970	54	12	spss	spss	PROPN
bam-8970	54	13	inc	inc	PROPN
bam-8970	54	14	.	.	PROPN
bam-8970	54	15	,	,	PUNCT
bam-8970	54	16	chicago	chicago	PROPN
bam-8970	54	17	,	,	PUNCT
bam-8970	54	18	il	il	PROPN
bam-8970	54	19	)	)	PUNCT
bam-8970	54	20	.	.	PUNCT
bam-8970	55	1	results	result	NOUN
bam-8970	55	2	and	and	CCONJ
bam-8970	55	3	discussion	discussion	NOUN
bam-8970	55	4	from	from	ADP
bam-8970	55	5	the	the	DET
bam-8970	55	6	entire	entire	ADJ
bam-8970	55	7	treatment	treatment	NOUN
bam-8970	55	8	sample	sample	NOUN
bam-8970	55	9	61.70	61.70	NUM
bam-8970	55	10	%	%	NOUN
bam-8970	55	11	shown	show	VERB
bam-8970	55	12	hematological	hematological	ADJ
bam-8970	55	13	toxicity	toxicity	NOUN
bam-8970	55	14	,	,	PUNCT
bam-8970	55	15	while	while	SCONJ
bam-8970	55	16	only	only	ADV
bam-8970	55	17	17,02	17,02	NUM
bam-8970	55	18	%	%	NOUN
bam-8970	55	19	shown	show	VERB
bam-8970	55	20	gastric	gastric	ADJ
bam-8970	55	21	toxicity	toxicity	NOUN
bam-8970	55	22	.	.	PUNCT
bam-8970	56	1	the	the	DET
bam-8970	56	2	remaining	remain	VERB
bam-8970	56	3	patients	patient	NOUN
bam-8970	56	4	did	do	AUX
bam-8970	56	5	n’t	not	PART
bam-8970	56	6	develop	develop	VERB
bam-8970	56	7	any	any	DET
bam-8970	56	8	toxicity	toxicity	NOUN
bam-8970	56	9	.	.	PUNCT
bam-8970	57	1	descriptive	descriptive	ADJ
bam-8970	57	2	analyses	analysis	NOUN
bam-8970	57	3	for	for	ADP
bam-8970	57	4	each	each	DET
bam-8970	57	5	variable	variable	NOUN
bam-8970	57	6	are	be	AUX
bam-8970	57	7	shown	show	VERB
bam-8970	57	8	in	in	ADP
bam-8970	57	9	table	table	NOUN
bam-8970	57	10	2	2	NUM
bam-8970	57	11	and	and	CCONJ
bam-8970	57	12	table	table	NOUN
bam-8970	57	13	3	3	NUM
bam-8970	57	14	.	.	PUNCT
bam-8970	58	1	the	the	DET
bam-8970	58	2	univariate	univariate	ADJ
bam-8970	58	3	analysis	analysis	NOUN
bam-8970	58	4	did	do	AUX
bam-8970	58	5	n’t	not	PART
bam-8970	58	6	show	show	VERB
bam-8970	58	7	any	any	DET
bam-8970	58	8	statistically	statistically	ADV
bam-8970	58	9	significant	significant	ADJ
bam-8970	58	10	effect	effect	NOUN
bam-8970	58	11	between	between	ADP
bam-8970	58	12	hematological	hematological	ADJ
bam-8970	58	13	toxicity	toxicity	NOUN
bam-8970	58	14	after	after	ADP
bam-8970	58	15	treatment	treatment	NOUN
bam-8970	58	16	and	and	CCONJ
bam-8970	58	17	independent	independent	ADJ
bam-8970	58	18	variable	variable	NOUN
bam-8970	58	19	:	:	PUNCT
bam-8970	58	20	gender	gender	NOUN
bam-8970	58	21	p>.05	p>.05	NOUN
bam-8970	58	22	chi	chi	ADJ
bam-8970	58	23	-	-	PUNCT
bam-8970	58	24	square	square	NOUN
bam-8970	58	25	.512	.512	NUM
bam-8970	58	26	,	,	PUNCT
bam-8970	58	27	genotype	genotype	NOUN
bam-8970	58	28	1	1	NUM
bam-8970	58	29	(	(	PUNCT
bam-8970	58	30	2r/3r	2r/3r	NUM
bam-8970	58	31	)	)	PUNCT
bam-8970	58	32	p>.05	p>.05	NOUN
bam-8970	58	33	,	,	PUNCT
bam-8970	58	34	genotype	genotype	NOUN
bam-8970	58	35	2	2	NUM
bam-8970	58	36	(	(	PUNCT
bam-8970	58	37	del	del	PROPN
bam-8970	58	38	/	/	SYM
bam-8970	58	39	ins	in	NOUN
bam-8970	58	40	)	)	PUNCT
bam-8970	58	41	p>.05	p>.05	NOUN
bam-8970	58	42	,	,	PUNCT
bam-8970	58	43	tumor	tumor	NOUN
bam-8970	58	44	type	type	NOUN
bam-8970	58	45	(	(	PUNCT
bam-8970	58	46	gastric	gastric	ADJ
bam-8970	58	47	or	or	CCONJ
bam-8970	58	48	breast	breast	NOUN
bam-8970	58	49	)	)	PUNCT
bam-8970	58	50	p>.05	p>.05	NOUN
bam-8970	58	51	,	,	PUNCT
bam-8970	58	52	tumor	tumor	NOUN
bam-8970	58	53	stage	stage	NOUN
bam-8970	58	54	p>.05	p>.05	NOUN
bam-8970	58	55	.	.	PUNCT
bam-8970	59	1	as	as	ADP
bam-8970	59	2	to	to	ADP
bam-8970	59	3	gastric	gastric	ADJ
bam-8970	59	4	toxicity	toxicity	NOUN
bam-8970	59	5	,	,	PUNCT
bam-8970	59	6	the	the	DET
bam-8970	59	7	univariate	univariate	ADJ
bam-8970	59	8	analysis	analysis	NOUN
bam-8970	59	9	did	do	AUX
bam-8970	59	10	n’t	not	PART
bam-8970	59	11	show	show	VERB
bam-8970	59	12	any	any	DET
bam-8970	59	13	statistically	statistically	ADV
bam-8970	59	14	significant	significant	ADJ
bam-8970	59	15	effect	effect	NOUN
bam-8970	59	16	between	between	ADP
bam-8970	59	17	treatment	treatment	NOUN
bam-8970	59	18	and	and	CCONJ
bam-8970	59	19	the	the	DET
bam-8970	59	20	independent	independent	ADJ
bam-8970	59	21	variable	variable	NOUN
bam-8970	59	22	:	:	PUNCT
bam-8970	59	23	gender	gender	NOUN
bam-8970	59	24	p>.05	p>.05	NOUN
bam-8970	59	25	,	,	PUNCT
bam-8970	59	26	genotype	genotype	NOUN
bam-8970	59	27	1	1	NUM
bam-8970	59	28	(	(	PUNCT
bam-8970	59	29	2r/3r	2r/3r	NUM
bam-8970	59	30	)	)	PUNCT
bam-8970	59	31	p>.05	p>.05	NOUN
bam-8970	59	32	,	,	PUNCT
bam-8970	59	33	genotype	genotype	NOUN
bam-8970	59	34	2	2	NUM
bam-8970	59	35	(	(	PUNCT
bam-8970	59	36	del	del	PROPN
bam-8970	59	37	/	/	SYM
bam-8970	59	38	ins	in	NOUN
bam-8970	59	39	)	)	PUNCT
bam-8970	59	40	p>.05	p>.05	NOUN
bam-8970	59	41	,	,	PUNCT
bam-8970	59	42	tumor	tumor	NOUN
bam-8970	59	43	type	type	NOUN
bam-8970	59	44	(	(	PUNCT
bam-8970	59	45	gastric	gastric	ADJ
bam-8970	59	46	or	or	CCONJ
bam-8970	59	47	breast	breast	NOUN
bam-8970	59	48	)	)	PUNCT
bam-8970	59	49	p>.05	p>.05	NOUN
bam-8970	59	50	,	,	PUNCT
bam-8970	59	51	tumor	tumor	NOUN
bam-8970	59	52	stage	stage	NOUN
bam-8970	59	53	p>.05	p>.05	NOUN
bam-8970	59	54	(	(	PUNCT
bam-8970	59	55	table	table	NOUN
bam-8970	59	56	4	4	NUM
bam-8970	59	57	)	)	PUNCT
bam-8970	59	58	.	.	PUNCT
bam-8970	60	1	the	the	DET
bam-8970	60	2	treatment	treatment	NOUN
bam-8970	60	3	of	of	ADP
bam-8970	60	4	the	the	DET
bam-8970	60	5	different	different	ADJ
bam-8970	60	6	cancer	cancer	NOUN
bam-8970	60	7	with	with	ADP
bam-8970	60	8	these	these	DET
bam-8970	60	9	two	two	NUM
bam-8970	60	10	effective	effective	ADJ
bam-8970	60	11	drugs	drug	NOUN
bam-8970	60	12	often	often	ADV
bam-8970	60	13	collides	collide	VERB
bam-8970	60	14	with	with	ADP
bam-8970	60	15	their	their	PRON
bam-8970	60	16	toxic	toxic	ADJ
bam-8970	60	17	.	.	PUNCT
bam-8970	61	1	this	this	DET
bam-8970	61	2	factor	factor	NOUN
bam-8970	61	3	represents	represent	VERB
bam-8970	61	4	the	the	DET
bam-8970	61	5	greatest	great	ADJ
bam-8970	61	6	limitation	limitation	NOUN
bam-8970	61	7	in	in	ADP
bam-8970	61	8	choosing	choose	VERB
bam-8970	61	9	appropriate	appropriate	ADJ
bam-8970	61	10	therapeutic	therapeutic	ADJ
bam-8970	61	11	dosage	dosage	NOUN
bam-8970	61	12	that	that	PRON
bam-8970	61	13	could	could	AUX
bam-8970	61	14	ensure	ensure	VERB
bam-8970	61	15	a	a	DET
bam-8970	61	16	better	well	ADJ
bam-8970	61	17	outcome	outcome	NOUN
bam-8970	61	18	for	for	ADP
bam-8970	61	19	the	the	DET
bam-8970	61	20	patients	patient	NOUN
bam-8970	61	21	.	.	PUNCT
bam-8970	62	1	during	during	ADP
bam-8970	62	2	the	the	DET
bam-8970	62	3	past	past	ADJ
bam-8970	62	4	fifty	fifty	NUM
bam-8970	62	5	years	year	NOUN
bam-8970	62	6	the	the	DET
bam-8970	62	7	use	use	NOUN
bam-8970	62	8	of	of	ADP
bam-8970	62	9	5fluoruracil	5fluoruracil	NUM
bam-8970	62	10	,	,	PUNCT
bam-8970	62	11	a	a	DET
bam-8970	62	12	chemotherapy	chemotherapy	NOUN
bam-8970	62	13	agent	agent	NOUN
bam-8970	62	14	that	that	PRON
bam-8970	62	15	belongs	belong	VERB
bam-8970	62	16	to	to	ADP
bam-8970	62	17	the	the	DET
bam-8970	62	18	family	family	NOUN
bam-8970	62	19	of	of	ADP
bam-8970	62	20	antimetabolites	antimetabolite	NOUN
bam-8970	62	21	and	and	CCONJ
bam-8970	62	22	,	,	PUNCT
bam-8970	62	23	specifically	specifically	ADV
bam-8970	62	24	,	,	PUNCT
bam-8970	62	25	it	it	PRON
bam-8970	62	26	is	be	AUX
bam-8970	62	27	an	an	DET
bam-8970	62	28	analogue	analogue	NOUN
bam-8970	62	29	of	of	ADP
bam-8970	62	30	pyrimidines	pyrimidine	NOUN
bam-8970	62	31	continued	continue	VERB
bam-8970	62	32	to	to	PART
bam-8970	62	33	improve	improve	VERB
bam-8970	62	34	.	.	PUNCT
bam-8970	63	1	the	the	DET
bam-8970	63	2	drug	drug	NOUN
bam-8970	63	3	interferes	interfere	VERB
bam-8970	63	4	with	with	ADP
bam-8970	63	5	the	the	DET
bam-8970	63	6	synthesis	synthesis	NOUN
bam-8970	63	7	of	of	ADP
bam-8970	63	8	thymidine	thymidine	ADJ
bam-8970	63	9	nucleotides	nucleotide	NOUN
bam-8970	63	10	,	,	PUNCT
bam-8970	63	11	fundamental	fundamental	ADJ
bam-8970	63	12	for	for	ADP
bam-8970	63	13	dna	dna	PROPN
bam-8970	63	14	synthesis	synthesis	NOUN
bam-8970	63	15	,	,	PUNCT
bam-8970	63	16	acting	act	VERB
bam-8970	63	17	on	on	ADP
bam-8970	63	18	thymidylate	thymidylate	NOUN
bam-8970	63	19	synthetase	synthetase	NOUN
bam-8970	63	20	,	,	PUNCT
bam-8970	63	21	which	which	PRON
bam-8970	63	22	becomed	become	VERB
bam-8970	63	23	the	the	DET
bam-8970	63	24	target	target	NOUN
bam-8970	63	25	of	of	ADP
bam-8970	63	26	chemotherapy.14	chemotherapy.14	PROPN
bam-8970	63	27	capecitabine	capecitabine	NOUN
bam-8970	63	28	is	be	AUX
bam-8970	63	29	a	a	DET
bam-8970	63	30	non	non	ADJ
bam-8970	63	31	-	-	ADJ
bam-8970	63	32	cytotoxic	cytotoxic	ADJ
bam-8970	63	33	fluoropyrimidine	fluoropyrimidine	NOUN
bam-8970	63	34	carbamate	carbamate	NOUN
bam-8970	63	35	,	,	PUNCT
bam-8970	63	36	which	which	PRON
bam-8970	63	37	acts	act	VERB
bam-8970	63	38	as	as	ADP
bam-8970	63	39	a	a	DET
bam-8970	63	40	precursor	precursor	NOUN
bam-8970	63	41	to	to	ADP
bam-8970	63	42	5	5	NUM
bam-8970	63	43	-	-	PUNCT
bam-8970	63	44	fluoruracil	fluoruracil	NOUN
bam-8970	63	45	.	.	PUNCT
bam-8970	64	1	in	in	ADP
bam-8970	64	2	this	this	DET
bam-8970	64	3	present	present	ADJ
bam-8970	64	4	study	study	NOUN
bam-8970	64	5	,	,	PUNCT
bam-8970	64	6	we	we	PRON
bam-8970	64	7	investigated	investigate	VERB
bam-8970	64	8	whether	whether	SCONJ
bam-8970	64	9	the	the	DET
bam-8970	64	10	analysis	analysis	NOUN
bam-8970	64	11	of	of	ADP
bam-8970	64	12	two	two	NUM
bam-8970	64	13	common	common	ADJ
bam-8970	64	14	polymorphisms	polymorphism	NOUN
bam-8970	64	15	of	of	ADP
bam-8970	64	16	the	the	DET
bam-8970	64	17	tyms	tyms	PROPN
bam-8970	64	18	gene	gene	NOUN
bam-8970	64	19	in	in	ADP
bam-8970	64	20	gastric	gastric	ADJ
bam-8970	64	21	and	and	CCONJ
bam-8970	64	22	breast	breast	NOUN
bam-8970	64	23	cancer	cancer	NOUN
bam-8970	64	24	patients	patient	NOUN
bam-8970	64	25	who	who	PRON
bam-8970	64	26	received	receive	VERB
bam-8970	64	27	5	5	NUM
bam-8970	64	28	-	-	PUNCT
bam-8970	64	29	fubased	fubase	VERB
bam-8970	64	30	chemotherapy	chemotherapy	NOUN
bam-8970	64	31	mixed	mix	VERB
bam-8970	64	32	with	with	ADP
bam-8970	64	33	capecitabine	capecitabine	NOUN
bam-8970	64	34	,	,	PUNCT
bam-8970	64	35	could	could	AUX
bam-8970	64	36	be	be	AUX
bam-8970	64	37	used	use	VERB
bam-8970	64	38	to	to	PART
bam-8970	64	39	predict	predict	VERB
bam-8970	64	40	the	the	DET
bam-8970	64	41	toxicity	toxicity	NOUN
bam-8970	64	42	to	to	ADP
bam-8970	64	43	the	the	DET
bam-8970	64	44	chemotherapy	chemotherapy	NOUN
bam-8970	64	45	treatment	treatment	NOUN
bam-8970	64	46	.	.	PUNCT
bam-8970	65	1	we	we	PRON
bam-8970	65	2	investigated	investigate	VERB
bam-8970	65	3	47	47	NUM
bam-8970	65	4	patients	patient	NOUN
bam-8970	65	5	who	who	PRON
bam-8970	65	6	were	be	AUX
bam-8970	65	7	treated	treat	VERB
bam-8970	65	8	at	at	ADP
bam-8970	65	9	the	the	DET
bam-8970	65	10	sant’elia	sant’elia	ADJ
bam-8970	65	11	hospital	hospital	NOUN
bam-8970	65	12	,	,	PUNCT
bam-8970	65	13	caltanissetta	caltanissetta	PROPN
bam-8970	65	14	sicily	sicily	ADV
bam-8970	65	15	.	.	PUNCT
bam-8970	66	1	in	in	ADP
bam-8970	66	2	genotypes	genotype	NOUN
bam-8970	66	3	distribution	distribution	NOUN
bam-8970	66	4	,	,	PUNCT
bam-8970	66	5	the	the	DET
bam-8970	66	6	most	most	ADV
bam-8970	66	7	frequent	frequent	ADJ
bam-8970	66	8	genotype	genotype	NOUN
bam-8970	66	9	for	for	ADP
bam-8970	66	10	the	the	DET
bam-8970	66	11	tyms	tyms	PROPN
bam-8970	66	12	gene	gene	NOUN
bam-8970	66	13	polymorphism	polymorphism	NOUN
bam-8970	66	14	rs16430	rs16430	PROPN
bam-8970	66	15	was	be	AUX
bam-8970	66	16	the	the	DET
bam-8970	66	17	heterozygous	heterozygous	ADJ
bam-8970	66	18	del	del	PROPN
bam-8970	66	19	/	/	SYM
bam-8970	66	20	ins	in	NOUN
bam-8970	66	21	(	(	PUNCT
bam-8970	66	22	42.5	42.5	NUM
bam-8970	66	23	%	%	NOUN
bam-8970	66	24	)	)	PUNCT
bam-8970	66	25	while	while	SCONJ
bam-8970	66	26	the	the	DET
bam-8970	66	27	rarest	rare	ADJ
bam-8970	66	28	one	one	NOUN
bam-8970	66	29	was	be	AUX
bam-8970	66	30	del	del	PROPN
bam-8970	66	31	/	/	SYM
bam-8970	66	32	del	del	NOUN
bam-8970	66	33	genotype	genotype	NOUN
bam-8970	66	34	(	(	PUNCT
bam-8970	66	35	25.5	25.5	NUM
bam-8970	66	36	%	%	NOUN
bam-8970	66	37	)	)	PUNCT
bam-8970	66	38	.	.	PUNCT
bam-8970	67	1	with	with	SCONJ
bam-8970	67	2	regards	regard	NOUN
bam-8970	67	3	to	to	ADP
bam-8970	67	4	the	the	DET
bam-8970	67	5	polymorphism	polymorphism	NOUN
bam-8970	67	6	rs34743033	rs34743033	VERB
bam-8970	67	7	,	,	PUNCT
bam-8970	67	8	there	there	PRON
bam-8970	67	9	was	be	VERB
bam-8970	67	10	a	a	DET
bam-8970	67	11	high	high	ADJ
bam-8970	67	12	incidence	incidence	NOUN
bam-8970	67	13	of	of	ADP
bam-8970	67	14	the	the	DET
bam-8970	67	15	2r/3r	2r/3r	NUM
bam-8970	67	16	genotype	genotype	NOUN
bam-8970	67	17	(	(	PUNCT
bam-8970	67	18	51	51	NUM
bam-8970	67	19	%	%	NOUN
bam-8970	67	20	)	)	PUNCT
bam-8970	67	21	and	and	CCONJ
bam-8970	67	22	a	a	DET
bam-8970	67	23	low	low	ADJ
bam-8970	67	24	presence	presence	NOUN
bam-8970	67	25	of	of	ADP
bam-8970	67	26	the	the	DET
bam-8970	67	27	2r/2r	2r/2r	NUM
bam-8970	67	28	genotype	genotype	NOUN
bam-8970	67	29	(	(	PUNCT
bam-8970	67	30	10.6	10.6	NUM
bam-8970	67	31	%	%	NOUN
bam-8970	67	32	)	)	PUNCT
bam-8970	67	33	.	.	PUNCT
bam-8970	68	1	no	no	DET
bam-8970	68	2	statistically	statistically	ADV
bam-8970	68	3	significant	significant	ADJ
bam-8970	68	4	correlation	correlation	NOUN
bam-8970	68	5	between	between	ADP
bam-8970	68	6	the	the	DET
bam-8970	68	7	genotypes	genotype	NOUN
bam-8970	68	8	and	and	CCONJ
bam-8970	68	9	the	the	DET
bam-8970	68	10	development	development	NOUN
bam-8970	68	11	of	of	ADP
bam-8970	68	12	the	the	DET
bam-8970	68	13	toxicity	toxicity	NOUN
bam-8970	68	14	was	be	AUX
bam-8970	68	15	detected	detect	VERB
bam-8970	68	16	but	but	CCONJ
bam-8970	68	17	particular	particular	ADJ
bam-8970	68	18	attention	attention	NOUN
bam-8970	68	19	must	must	AUX
bam-8970	68	20	be	be	AUX
bam-8970	68	21	paid	pay	VERB
bam-8970	68	22	to	to	PART
bam-8970	68	23	genotype	genotype	VERB
bam-8970	68	24	1	1	NUM
bam-8970	68	25	where	where	SCONJ
bam-8970	68	26	all	all	DET
bam-8970	68	27	the	the	DET
bam-8970	68	28	5	5	NUM
bam-8970	68	29	subjects	subject	NOUN
bam-8970	68	30	with	with	ADP
bam-8970	68	31	2r/2r	2r/2r	NUM
bam-8970	68	32	genotype	genotype	NOUN
bam-8970	68	33	showed	show	VERB
bam-8970	68	34	hematological	hematological	ADJ
bam-8970	68	35	toxicity	toxicity	NOUN
bam-8970	68	36	,	,	PUNCT
bam-8970	68	37	but	but	CCONJ
bam-8970	68	38	not	not	PART
bam-8970	68	39	gastric	gastric	ADJ
bam-8970	68	40	toxicity	toxicity	NOUN
bam-8970	68	41	development	development	NOUN
bam-8970	68	42	after	after	ADP
bam-8970	68	43	treatment	treatment	NOUN
bam-8970	68	44	.	.	PUNCT
bam-8970	69	1	these	these	DET
bam-8970	69	2	preliminary	preliminary	ADJ
bam-8970	69	3	results	result	NOUN
bam-8970	69	4	need	need	VERB
bam-8970	69	5	further	further	ADJ
bam-8970	69	6	investigations	investigation	NOUN
bam-8970	69	7	analyzing	analyze	VERB
bam-8970	69	8	a	a	DET
bam-8970	69	9	wider	wide	ADJ
bam-8970	69	10	variety	variety	NOUN
bam-8970	69	11	of	of	ADP
bam-8970	69	12	polymorphisms	polymorphism	NOUN
bam-8970	69	13	on	on	ADP
bam-8970	69	14	control	control	NOUN
bam-8970	69	15	subjects	subject	NOUN
bam-8970	69	16	and	and	CCONJ
bam-8970	69	17	on	on	ADP
bam-8970	69	18	a	a	DET
bam-8970	69	19	larger	large	ADJ
bam-8970	69	20	cohort	cohort	NOUN
bam-8970	69	21	of	of	ADP
bam-8970	69	22	patients	patient	NOUN
bam-8970	69	23	.	.	PUNCT
bam-8970	70	1	list	list	NOUN
bam-8970	70	2	of	of	ADP
bam-8970	70	3	acronyms	acronym	NOUN
bam-8970	70	4	cnvs	cnvs	PROPN
bam-8970	70	5	copy	copy	NOUN
bam-8970	70	6	-	-	PUNCT
bam-8970	70	7	number	number	NOUN
bam-8970	70	8	variations	variation	NOUN
bam-8970	70	9	,	,	PUNCT
bam-8970	70	10	exits	exit	VERB
bam-8970	70	11	escape	escape	NOUN
bam-8970	70	12	from	from	ADP
bam-8970	70	13	x	x	NOUN
bam-8970	70	14	-	-	NOUN
bam-8970	70	15	inactivation	inactivation	ADJ
bam-8970	70	16	tumor	tumor	NOUN
bam-8970	70	17	suppressor	suppressor	NOUN
bam-8970	70	18	snps	snps	PROPN
bam-8970	70	19	single	single	ADJ
bam-8970	70	20	nucleotide	nucleotide	ADJ
bam-8970	70	21	polymorphisms	polymorphism	NOUN
bam-8970	70	22	tyms	tyms	PROPN
bam-8970	70	23	thymidylate	thymidylate	NOUN
bam-8970	70	24	synthase	synthase	NOUN
bam-8970	70	25	vntr	vntr	NOUN
bam-8970	70	26	variable	variable	ADJ
bam-8970	70	27	number	number	NOUN
bam-8970	70	28	tandem	tandem	VERB
bam-8970	70	29	3’-utr	3’-utr	NUM
bam-8970	70	30	untranslated	untranslated	ADJ
bam-8970	70	31	end	end	NOUN
bam-8970	71	1	5'-dfcr	5'-dfcr	NUM
bam-8970	71	2	5'-deoxy-5	5'-deoxy-5	NUM
bam-8970	71	3	-	-	PUNCT
bam-8970	71	4	fluorocytidine	fluorocytidine	ADJ
bam-8970	71	5	5'-dfur	5'-dfur	NUM
bam-8970	71	6	-5'-deoxy-5	-5'-deoxy-5	NUM
bam-8970	71	7	-	-	PUNCT
bam-8970	71	8	fluorouridine	fluorouridine	NOUN
bam-8970	71	9	5’-utr	5’-utr	PROPN
bam-8970	71	10	–	–	PUNCT
bam-8970	71	11	untraslated	untraslate	VERB
bam-8970	71	12	end	end	NOUN
bam-8970	71	13	authors	author	NOUN
bam-8970	71	14	contributions	contribution	VERB
bam-8970	71	15	idl	idl	NOUN
bam-8970	71	16	,	,	PUNCT
bam-8970	71	17	sv	sv	INTJ
bam-8970	71	18	,	,	PUNCT
bam-8970	71	19	pp	pp	ADV
bam-8970	71	20	made	make	VERB
bam-8970	71	21	substantial	substantial	ADJ
bam-8970	71	22	contributions	contribution	NOUN
bam-8970	71	23	to	to	ADP
bam-8970	71	24	conception	conception	NOUN
bam-8970	71	25	and	and	CCONJ
bam-8970	71	26	design	design	NOUN
bam-8970	71	27	.	.	PUNCT
bam-8970	72	1	rrr	rrr	NOUN
bam-8970	72	2	and	and	CCONJ
bam-8970	72	3	cv	cv	PROPN
bam-8970	72	4	contributed	contribute	VERB
bam-8970	72	5	to	to	ADP
bam-8970	72	6	acquisition	acquisition	NOUN
bam-8970	72	7	of	of	ADP
bam-8970	72	8	data	datum	NOUN
bam-8970	72	9	.	.	PUNCT
bam-8970	73	1	aa	aa	PROPN
bam-8970	73	2	performed	perform	VERB
bam-8970	73	3	statistical	statistical	ADJ
bam-8970	73	4	analysis	analysis	NOUN
bam-8970	73	5	and	and	CCONJ
bam-8970	73	6	interpretation	interpretation	NOUN
bam-8970	73	7	of	of	ADP
bam-8970	73	8	data	data	PROPN
bam-8970	73	9	.	.	PUNCT
bam-8970	74	1	cmdl	cmdl	NOUN
bam-8970	74	2	and	and	CCONJ
bam-8970	74	3	gs	gs	PROPN
bam-8970	74	4	drafted	draft	VERB
bam-8970	74	5	the	the	DET
bam-8970	74	6	article	article	NOUN
bam-8970	74	7	with	with	ADP
bam-8970	74	8	the	the	DET
bam-8970	74	9	help	help	NOUN
bam-8970	74	10	of	of	ADP
bam-8970	74	11	gm	gm	PROPN
bam-8970	74	12	.	.	PUNCT
bam-8970	75	1	pp	pp	PROPN
bam-8970	75	2	revised	revise	VERB
bam-8970	75	3	the	the	DET
bam-8970	75	4	article	article	NOUN
bam-8970	75	5	critically	critically	ADV
bam-8970	75	6	for	for	ADP
bam-8970	75	7	important	important	ADJ
bam-8970	75	8	intellectual	intellectual	ADJ
bam-8970	75	9	content	content	NOUN
bam-8970	75	10	.	.	PUNCT
bam-8970	76	1	all	all	DET
bam-8970	76	2	authors	author	NOUN
bam-8970	76	3	approved	approve	VERB
bam-8970	76	4	the	the	DET
bam-8970	76	5	final	final	ADJ
bam-8970	76	6	version	version	NOUN
bam-8970	76	7	and	and	CCONJ
bam-8970	76	8	agreed	agree	VERB
bam-8970	76	9	to	to	PART
bam-8970	76	10	be	be	AUX
bam-8970	76	11	accountable	accountable	ADJ
bam-8970	76	12	for	for	ADP
bam-8970	76	13	all	all	DET
bam-8970	76	14	aspects	aspect	NOUN
bam-8970	76	15	of	of	ADP
bam-8970	76	16	the	the	DET
bam-8970	76	17	work	work	NOUN
bam-8970	76	18	in	in	ADP
bam-8970	76	19	ensuring	ensure	VERB
bam-8970	76	20	that	that	SCONJ
bam-8970	76	21	questions	question	NOUN
bam-8970	76	22	related	relate	VERB
bam-8970	76	23	to	to	ADP
bam-8970	76	24	the	the	DET
bam-8970	76	25	accuracy	accuracy	NOUN
bam-8970	76	26	and	and	CCONJ
bam-8970	76	27	integrity	integrity	NOUN
bam-8970	76	28	of	of	ADP
bam-8970	76	29	any	any	DET
bam-8970	76	30	part	part	NOUN
bam-8970	76	31	of	of	ADP
bam-8970	76	32	the	the	DET
bam-8970	76	33	work	work	NOUN
bam-8970	76	34	are	be	AUX
bam-8970	76	35	appropriately	appropriately	ADV
bam-8970	76	36	investigated	investigate	VERB
bam-8970	76	37	and	and	CCONJ
bam-8970	76	38	resolved	resolve	VERB
bam-8970	76	39	.	.	PUNCT
bam-8970	77	1	acknowledgments	acknowledgment	NOUN
bam-8970	77	2	the	the	DET
bam-8970	77	3	authors	author	NOUN
bam-8970	77	4	would	would	AUX
bam-8970	77	5	like	like	VERB
bam-8970	77	6	to	to	ADP
bam-8970	77	7	thanks	thank	NOUN
bam-8970	77	8	all	all	DET
bam-8970	77	9	the	the	DET
bam-8970	77	10	patients	patient	NOUN
bam-8970	77	11	involved	involve	VERB
bam-8970	77	12	in	in	ADP
bam-8970	77	13	the	the	DET
bam-8970	77	14	study	study	NOUN
bam-8970	77	15	and	and	CCONJ
bam-8970	77	16	the	the	DET
bam-8970	77	17	healthcare	healthcare	NOUN
bam-8970	77	18	professionals	professional	NOUN
bam-8970	77	19	that	that	PRON
bam-8970	77	20	cooperated	cooperate	VERB
bam-8970	77	21	with	with	ADP
bam-8970	77	22	us	we	PRON
bam-8970	77	23	.	.	PUNCT
bam-8970	78	1	funding	fund	VERB
bam-8970	78	2	none	none	NOUN
bam-8970	78	3	conflict	conflict	NOUN
bam-8970	78	4	of	of	ADP
bam-8970	78	5	interest	interest	NOUN
bam-8970	78	6	the	the	DET
bam-8970	78	7	authors	author	NOUN
bam-8970	78	8	declare	declare	VERB
bam-8970	78	9	they	they	PRON
bam-8970	78	10	have	have	VERB
bam-8970	78	11	no	no	DET
bam-8970	78	12	financial	financial	ADJ
bam-8970	78	13	,	,	PUNCT
bam-8970	78	14	personal	personal	ADJ
bam-8970	78	15	,	,	PUNCT
bam-8970	78	16	or	or	CCONJ
bam-8970	78	17	other	other	ADJ
bam-8970	78	18	conflicts	conflict	NOUN
bam-8970	78	19	of	of	ADP
bam-8970	78	20	interest	interest	NOUN
bam-8970	78	21	.	.	PUNCT
bam-8970	79	1	table	table	NOUN
bam-8970	79	2	4.univariate	4.univariate	NUM
bam-8970	79	3	analysis	analysis	NOUN
bam-8970	79	4	:	:	PUNCT
bam-8970	79	5	statistical	statistical	ADJ
bam-8970	79	6	data	datum	NOUN
bam-8970	79	7	of	of	ADP
bam-8970	79	8	fisher	fisher	PROPN
bam-8970	79	9	's	's	PART
bam-8970	79	10	test	test	NOUN
bam-8970	79	11	and	and	CCONJ
bam-8970	79	12	chi	chi	ADJ
bam-8970	79	13	-	-	PUNCT
bam-8970	79	14	square	square	NOUN
bam-8970	79	15	test	test	NOUN
bam-8970	79	16	,	,	PUNCT
bam-8970	79	17	(	(	PUNCT
bam-8970	79	18	p<0.05	p<0.05	NOUN
bam-8970	79	19	is	be	AUX
bam-8970	79	20	significant	significant	ADJ
bam-8970	79	21	)	)	PUNCT
bam-8970	79	22	.	.	PUNCT
bam-8970	80	1	independent	independent	ADJ
bam-8970	80	2	variables	variable	NOUN
bam-8970	80	3	hematological	hematological	ADJ
bam-8970	80	4	toxicity	toxicity	NOUN
bam-8970	80	5	gastric	gastric	ADJ
bam-8970	80	6	toxicity	toxicity	NOUN
bam-8970	80	7	fisher	fisher	NOUN
bam-8970	80	8	's	's	PART
bam-8970	80	9	exact	exact	ADJ
bam-8970	80	10	test	test	NOUN
bam-8970	80	11	value	value	NOUN
bam-8970	80	12	exact	exact	ADJ
bam-8970	80	13	significant	significant	ADJ
bam-8970	80	14	value	value	NOUN
bam-8970	80	15	(	(	PUNCT
bam-8970	80	16	p	p	NOUN
bam-8970	80	17	-	-	PUNCT
bam-8970	80	18	value	value	NOUN
bam-8970	80	19	)	)	PUNCT
bam-8970	80	20	fisher	fisher	PROPN
bam-8970	80	21	's	's	PART
bam-8970	80	22	exact	exact	ADJ
bam-8970	80	23	test	test	NOUN
bam-8970	80	24	value	value	NOUN
bam-8970	80	25	exact	exact	ADJ
bam-8970	80	26	significant	significant	ADJ
bam-8970	80	27	value	value	NOUN
bam-8970	80	28	(	(	PUNCT
bam-8970	80	29	p	p	NOUN
bam-8970	80	30	-	-	PUNCT
bam-8970	80	31	value	value	NOUN
bam-8970	80	32	)	)	PUNCT
bam-8970	80	33	gender	gender	NOUN
bam-8970	80	34	.512	.512	NUM
bam-8970	80	35	*	*	NOUN
bam-8970	80	36	.556	.556	NUM
bam-8970	80	37	*	*	SYM
bam-8970	80	38	2.303	2.303	NUM
bam-8970	80	39	.245	.245	NUM
bam-8970	80	40	genotype	genotype	NOUN
bam-8970	80	41	1	1	NUM
bam-8970	80	42	3.33	3.33	NUM
bam-8970	80	43	.225	.225	NUM
bam-8970	80	44	.820	.820	NUM
bam-8970	80	45	.862	.862	NUM
bam-8970	80	46	genotype	genotype	NOUN
bam-8970	80	47	2	2	NUM
bam-8970	80	48	2,33	2,33	NUM
bam-8970	80	49	.325	.325	NUM
bam-8970	80	50	1.86	1.86	NUM
bam-8970	80	51	.380	.380	NUM
bam-8970	80	52	tumor	tumor	NOUN
bam-8970	80	53	type	type	NOUN
bam-8970	80	54	.758	.758	NUM
bam-8970	80	55	.692	.692	NUM
bam-8970	80	56	.149	.149	NUM
bam-8970	80	57	1	1	NUM
bam-8970	80	58	tumor	tumor	NOUN
bam-8970	80	59	stage	stage	NOUN
bam-8970	80	60	2.06	2.06	NUM
bam-8970	80	61	.334	.334	NUM
bam-8970	80	62	2.45	2.45	NUM
bam-8970	80	63	.361	.361	NUM
bam-8970	80	64	*	*	PUNCT
bam-8970	80	65	the	the	DET
bam-8970	80	66	result	result	NOUN
bam-8970	80	67	refers	refer	VERB
bam-8970	80	68	to	to	ADP
bam-8970	80	69	the	the	DET
bam-8970	80	70	pearson	pearson	PROPN
bam-8970	80	71	chi	chi	PROPN
bam-8970	80	72	-	-	PUNCT
bam-8970	80	73	square	square	PROPN
bam-8970	80	74	test	test	NOUN
bam-8970	80	75	.	.	PUNCT
bam-8970	81	1	tyms	tyms	PROPN
bam-8970	81	2	gene	gene	NOUN
bam-8970	81	3	polymorphism	polymorphism	NOUN
bam-8970	81	4	and	and	CCONJ
bam-8970	81	5	toxicity	toxicity	NOUN
bam-8970	81	6	response	response	NOUN
bam-8970	81	7	eur	eur	PROPN
bam-8970	81	8	j	j	PROPN
bam-8970	81	9	transl	transl	PROPN
bam-8970	81	10	myol	myol	NOUN
bam-8970	81	11	2020	2020	NUM
bam-8970	81	12	;	;	PUNCT
bam-8970	81	13	30	30	NUM
bam-8970	81	14	(	(	PUNCT
bam-8970	81	15	3	3	NUM
bam-8970	81	16	):	):	PUNCT
bam-8970	81	17	8970	8970	NUM
bam-8970	81	18	.	.	PUNCT
bam-8970	82	1	doi	doi	NOUN
bam-8970	82	2	:	:	PUNCT
bam-8970	82	3	10.4081	10.4081	NUM
bam-8970	82	4	/	/	SYM
bam-8970	82	5	ejtm.2020.8970	ejtm.2020.8970	NUM
bam-8970	82	6	5	5	NUM
bam-8970	82	7	ethical	ethical	ADJ
bam-8970	82	8	publication	publication	NOUN
bam-8970	82	9	statement	statement	NOUN
bam-8970	82	10	we	we	PRON
bam-8970	82	11	confirm	confirm	VERB
bam-8970	82	12	that	that	SCONJ
bam-8970	82	13	we	we	PRON
bam-8970	82	14	have	have	AUX
bam-8970	82	15	read	read	VERB
bam-8970	82	16	the	the	DET
bam-8970	82	17	journal	journal	NOUN
bam-8970	82	18	’s	’s	PART
bam-8970	82	19	position	position	NOUN
bam-8970	82	20	on	on	ADP
bam-8970	82	21	issues	issue	NOUN
bam-8970	82	22	involved	involve	VERB
bam-8970	82	23	in	in	ADP
bam-8970	82	24	ethical	ethical	ADJ
bam-8970	82	25	publication	publication	NOUN
bam-8970	82	26	and	and	CCONJ
bam-8970	82	27	affirm	affirm	NOUN
bam-8970	82	28	that	that	SCONJ
bam-8970	82	29	this	this	DET
bam-8970	82	30	report	report	NOUN
bam-8970	82	31	is	be	AUX
bam-8970	82	32	consistent	consistent	ADJ
bam-8970	82	33	with	with	ADP
bam-8970	82	34	those	those	DET
bam-8970	82	35	guidelines	guideline	NOUN
bam-8970	82	36	.	.	PUNCT
bam-8970	83	1	corresponding	correspond	VERB
bam-8970	83	2	author	author	PROPN
bam-8970	83	3	giuseppe	giuseppe	PROPN
bam-8970	83	4	messina	messina	PROPN
bam-8970	83	5	,	,	PUNCT
bam-8970	83	6	department	department	NOUN
bam-8970	83	7	of	of	ADP
bam-8970	83	8	psychological	psychological	ADJ
bam-8970	83	9	,	,	PUNCT
bam-8970	83	10	pedagogical	pedagogical	ADJ
bam-8970	83	11	and	and	CCONJ
bam-8970	83	12	educational	educational	ADJ
bam-8970	83	13	sciences	science	NOUN
bam-8970	83	14	,	,	PUNCT
bam-8970	83	15	sport	sport	NOUN
bam-8970	83	16	and	and	CCONJ
bam-8970	83	17	exercise	exercise	NOUN
bam-8970	83	18	sciences	sciences	PROPN
bam-8970	83	19	research	research	NOUN
bam-8970	83	20	unit	unit	NOUN
bam-8970	83	21	,	,	PUNCT
bam-8970	83	22	university	university	PROPN
bam-8970	83	23	of	of	ADP
bam-8970	83	24	palermo	palermo	PROPN
bam-8970	83	25	,	,	PUNCT
bam-8970	83	26	palermo	palermo	NOUN
bam-8970	83	27	i-90128	i-90128	PROPN
bam-8970	83	28	,	,	PUNCT
bam-8970	83	29	italy	italy	PROPN
bam-8970	83	30	.	.	PUNCT
bam-8970	84	1	orcid	orcid	PROPN
bam-8970	85	1	i	i	PRON
bam-8970	85	2	d	d	NOUN
bam-8970	85	3	:	:	PUNCT
bam-8970	85	4	0000	0000	NUM
bam-8970	85	5	-	-	PUNCT
bam-8970	85	6	0003	0003	NUM
bam-8970	85	7	-	-	PUNCT
bam-8970	85	8	2774	2774	NUM
bam-8970	85	9	-	-	SYM
bam-8970	85	10	4950	4950	NUM
bam-8970	85	11	email	email	NOUN
bam-8970	85	12	:	:	PUNCT
bam-8970	85	13	giuseppe.messina17@unipa.it	giuseppe.messina17@unipa.it	NUM
bam-8970	85	14	emails	email	NOUN
bam-8970	85	15	and	and	CCONJ
bam-8970	85	16	orcid	orcid	NOUN
bam-8970	86	1	i	i	INTJ
bam-8970	86	2	d	d	PROPN
bam-8970	86	3	of	of	ADP
bam-8970	86	4	coauthors	coauthor	NOUN
bam-8970	86	5	stefano	stefano	PROPN
bam-8970	86	6	vitello	vitello	PROPN
bam-8970	86	7	:	:	PUNCT
bam-8970	86	8	stefano_vitello@teletu.it	stefano_vitello@teletu.it	PROPN
bam-8970	86	9	italia	italia	PROPN
bam-8970	86	10	di	di	PROPN
bam-8970	86	11	liegro	liegro	PROPN
bam-8970	86	12	:	:	PUNCT
bam-8970	86	13	italia.diliegro@unipa.it	italia.diliegro@unipa.it	ADJ
bam-8970	86	14	orcid	orcid	NOUN
bam-8970	87	1	i	i	NOUN
bam-8970	87	2	d	d	NOUN
bam-8970	87	3	:	:	PUNCT
bam-8970	87	4	0000	0000	NUM
bam-8970	87	5	-	-	PUNCT
bam-8970	87	6	0002	0002	NUM
bam-8970	87	7	-	-	PUNCT
bam-8970	87	8	0546	0546	NUM
bam-8970	87	9	-	-	PUNCT
bam-8970	87	10	1274	1274	NUM
bam-8970	87	11	maria	maria	PROPN
bam-8970	87	12	rita	rita	PROPN
bam-8970	87	13	ricciardi	ricciardi	PROPN
bam-8970	87	14	:	:	PUNCT
bam-8970	87	15	mariaritaricciardi88@gmail.com	mariaritaricciardi88@gmail.com	PROPN
bam-8970	87	16	chiara	chiara	PROPN
bam-8970	87	17	verga	verga	PROPN
bam-8970	87	18	:	:	PUNCT
bam-8970	87	19	chiaraverga@hotmail.it	chiaraverga@hotmail.it	PROPN
bam-8970	87	20	.	.	PUNCT
bam-8970	88	1	alessandra	alessandra	PROPN
bam-8970	88	2	amato	amato	PROPN
bam-8970	88	3	:	:	PUNCT
bam-8970	88	4	alessandra.amato02@unipa.it	alessandra.amato02@unipa.it	NUM
bam-8970	88	5	orcid	orcid	NOUN
bam-8970	89	1	i	i	PRON
bam-8970	89	2	d	d	NOUN
bam-8970	89	3	:	:	PUNCT
bam-8970	89	4	0000	0000	NUM
bam-8970	89	5	-	-	PUNCT
bam-8970	89	6	0002	0002	NUM
bam-8970	89	7	-	-	PUNCT
bam-8970	89	8	6512	6512	NUM
bam-8970	89	9	-	-	PUNCT
bam-8970	89	10	3840	3840	NUM
bam-8970	89	11	gabriella	gabriella	PROPN
bam-8970	89	12	schiera	schiera	NOUN
bam-8970	89	13	:	:	PUNCT
bam-8970	90	1	gabriella.schiera@unipa.it	gabriella.schiera@unipa.it	X
bam-8970	90	2	.	.	PUNCT
bam-8970	90	3	orcid	orcid	NOUN
bam-8970	91	1	i	i	PRON
bam-8970	91	2	d	d	NOUN
bam-8970	91	3	:	:	PUNCT
bam-8970	91	4	0000	0000	NUM
bam-8970	91	5	-	-	PUNCT
bam-8970	91	6	0002	0002	NUM
bam-8970	91	7	-	-	PUNCT
bam-8970	91	8	8638	8638	NUM
bam-8970	91	9	-	-	SYM
bam-8970	91	10	6455	6455	NUM
bam-8970	91	11	carlo	carlo	PROPN
bam-8970	91	12	di	di	PROPN
bam-8970	91	13	liegro	liegro	PROPN
bam-8970	91	14	:	:	PUNCT
bam-8970	91	15	carlomaria.diliegro@unipa.it	carlomaria.diliegro@unipa.it	PROPN
bam-8970	91	16	.	.	PUNCT
bam-8970	92	1	orcid	orcid	NOUN
bam-8970	93	1	i	i	PRON
bam-8970	93	2	d	d	NOUN
bam-8970	93	3	:	:	PUNCT
bam-8970	93	4	0000	0000	NUM
bam-8970	93	5	-	-	PUNCT
bam-8970	93	6	0001	0001	NUM
bam-8970	93	7	-	-	PUNCT
bam-8970	93	8	7362	7362	NUM
bam-8970	93	9	-	-	PUNCT
bam-8970	93	10	7814	7814	NUM
bam-8970	93	11	.	.	PUNCT
bam-8970	94	1	patrizia	patrizia	PROPN
bam-8970	94	2	proia	proia	PROPN
bam-8970	94	3	:	:	PUNCT
bam-8970	94	4	patrizia.proia@unipa.it	patrizia.proia@unipa.it	PROPN
bam-8970	94	5	orcid	orcid	NOUN
bam-8970	95	1	i	i	PRON
bam-8970	95	2	d	d	NOUN
bam-8970	95	3	:	:	PUNCT
bam-8970	95	4	0000	0000	NUM
bam-8970	95	5	-	-	PUNCT
bam-8970	95	6	0002	0002	NUM
bam-8970	95	7	-	-	PUNCT
bam-8970	95	8	0326	0326	NUM
bam-8970	95	9	-	-	PUNCT
bam-8970	95	10	5560	5560	NUM
bam-8970	95	11	references	reference	NOUN
bam-8970	95	12	1	1	NUM
bam-8970	95	13	.	.	PUNCT
bam-8970	96	1	pradeepkiran	pradeepkiran	PROPN
bam-8970	96	2	ja	ja	PROPN
bam-8970	96	3	,	,	PUNCT
bam-8970	96	4	sainath	sainath	PROPN
bam-8970	96	5	sb	sb	PROPN
bam-8970	96	6	,	,	PUNCT
bam-8970	96	7	kumar	kumar	PROPN
bam-8970	96	8	kk	kk	PROPN
bam-8970	96	9	,	,	PUNCT
bam-8970	96	10	et	et	PROPN
bam-8970	96	11	al	al	PROPN
bam-8970	96	12	.	.	PROPN
bam-8970	96	13	cgmd	cgmd	PROPN
bam-8970	96	14	:	:	PUNCT
bam-8970	96	15	an	an	DET
bam-8970	96	16	integrated	integrate	VERB
bam-8970	96	17	database	database	NOUN
bam-8970	96	18	of	of	ADP
bam-8970	96	19	cancer	cancer	NOUN
bam-8970	96	20	genes	gene	NOUN
bam-8970	96	21	and	and	CCONJ
bam-8970	96	22	markers	marker	NOUN
bam-8970	96	23	.	.	PUNCT
bam-8970	97	1	sci	sci	PROPN
bam-8970	97	2	rep	rep	PROPN
bam-8970	97	3	2015;5:12035	2015;5:12035	PROPN
bam-8970	97	4	.	.	PUNCT
bam-8970	98	1	doi	doi	NOUN
bam-8970	98	2	:	:	PUNCT
bam-8970	98	3	10.1038	10.1038	NUM
bam-8970	98	4	/srep12035	/srep12035	PUNCT
bam-8970	98	5	.	.	PUNCT
bam-8970	99	1	2	2	X
bam-8970	99	2	.	.	X
bam-8970	99	3	ebadi	ebadi	PROPN
bam-8970	99	4	mr	mr	PROPN
bam-8970	99	5	,	,	PUNCT
bam-8970	99	6	aghdam	aghdam	PROPN
bam-8970	99	7	mk	mk	PROPN
bam-8970	99	8	,	,	PUNCT
bam-8970	99	9	lima	lima	PROPN
bam-8970	99	10	zs	zs	PROPN
bam-8970	99	11	,	,	PUNCT
bam-8970	99	12	younesi	younesi	PROPN
bam-8970	99	13	l.	l.	PROPN
bam-8970	99	14	investigation	investigation	PROPN
bam-8970	99	15	into	into	ADP
bam-8970	99	16	breast	breast	NOUN
bam-8970	99	17	cancer	cancer	NOUN
bam-8970	99	18	and	and	CCONJ
bam-8970	99	19	partial	partial	ADJ
bam-8970	99	20	breast	breast	NOUN
bam-8970	99	21	reconstruction	reconstruction	NOUN
bam-8970	99	22	:	:	PUNCT
bam-8970	99	23	a	a	DET
bam-8970	99	24	review	review	NOUN
bam-8970	99	25	.	.	PUNCT
bam-8970	100	1	eur	eur	PROPN
bam-8970	100	2	j	j	PROPN
bam-8970	100	3	transl	transl	PROPN
bam-8970	100	4	myol	myol	PROPN
bam-8970	100	5	2019;29(2):8157	2019;29(2):8157	PROPN
bam-8970	100	6	.	.	PUNCT
bam-8970	101	1	doi	doi	NOUN
bam-8970	101	2	:	:	PUNCT
bam-8970	101	3	10.4081	10.4081	NUM
bam-8970	101	4	/	/	SYM
bam-8970	101	5	ejtm.2019.8157	ejtm.2019.8157	NOUN
bam-8970	101	6	3	3	NUM
bam-8970	101	7	.	.	PUNCT
bam-8970	102	1	bloomfield	bloomfield	PROPN
bam-8970	102	2	m	m	PROPN
bam-8970	102	3	,	,	PUNCT
bam-8970	102	4	duesberg	duesberg	PROPN
bam-8970	102	5	p.	p.	PROPN
bam-8970	102	6	inherent	inherent	ADJ
bam-8970	102	7	variability	variability	NOUN
bam-8970	102	8	of	of	ADP
bam-8970	102	9	cancer	cancer	NOUN
bam-8970	102	10	-	-	PUNCT
bam-8970	102	11	specific	specific	ADJ
bam-8970	102	12	aneuploidy	aneuploidy	NOUN
bam-8970	102	13	generates	generate	VERB
bam-8970	102	14	metastases	metastasis	NOUN
bam-8970	102	15	.	.	PUNCT
bam-8970	103	1	mol	mol	ADP
bam-8970	103	2	cytogenet	cytogenet	NOUN
bam-8970	103	3	.	.	PUNCT
bam-8970	104	1	2016;9:90	2016;9:90	NOUN
bam-8970	104	2	.	.	PUNCT
bam-8970	105	1	doi:10.1186	doi:10.1186	PROPN
bam-8970	105	2	/	/	SYM
bam-8970	106	1	s13039016	s13039016	PROPN
bam-8970	106	2	-	-	PUNCT
bam-8970	106	3	0297	0297	NUM
bam-8970	106	4	-	-	PUNCT
bam-8970	106	5	x	x	SYM
bam-8970	106	6	4	4	PROPN
bam-8970	106	7	.	.	X
bam-8970	106	8	abbasi	abbasi	PROPN
bam-8970	107	1	a	a	PRON
bam-8970	107	2	,	,	PUNCT
bam-8970	107	3	heydari	heydari	PROPN
bam-8970	107	4	s.	s.	PROPN
bam-8970	107	5	studying	study	VERB
bam-8970	107	6	the	the	DET
bam-8970	107	7	expression	expression	NOUN
bam-8970	107	8	rate	rate	NOUN
bam-8970	107	9	and	and	CCONJ
bam-8970	107	10	methylation	methylation	NOUN
bam-8970	107	11	of	of	ADP
bam-8970	107	12	reprimo	reprimo	ADJ
bam-8970	107	13	gene	gene	NOUN
bam-8970	107	14	in	in	ADP
bam-8970	107	15	the	the	DET
bam-8970	107	16	blood	blood	NOUN
bam-8970	107	17	of	of	ADP
bam-8970	107	18	patients	patient	NOUN
bam-8970	107	19	suffering	suffer	VERB
bam-8970	107	20	from	from	ADP
bam-8970	107	21	gastric	gastric	ADJ
bam-8970	107	22	cancer	cancer	NOUN
bam-8970	107	23	.	.	PUNCT
bam-8970	108	1	eur	eur	PROPN
bam-8970	108	2	j	j	PROPN
bam-8970	108	3	transl	transl	PROPN
bam-8970	108	4	myol	myol	PROPN
bam-8970	108	5	2018;28(2):7423	2018;28(2):7423	PROPN
bam-8970	108	6	.	.	PUNCT
bam-8970	109	1	doi	doi	NOUN
bam-8970	109	2	:	:	PUNCT
bam-8970	109	3	10.4081	10.4081	NUM
bam-8970	109	4	/	/	SYM
bam-8970	109	5	ejtm.2018	ejtm.2018	PROPN
bam-8970	109	6	.	.	PUNCT
bam-8970	109	7	7423	7423	NUM
bam-8970	109	8	.	.	PUNCT
bam-8970	110	1	5	5	X
bam-8970	110	2	.	.	X
bam-8970	110	3	dunford	dunford	PROPN
bam-8970	110	4	a	a	PRON
bam-8970	110	5	,	,	PUNCT
bam-8970	110	6	weinstock	weinstock	PROPN
bam-8970	110	7	dm	dm	PROPN
bam-8970	110	8	,	,	PUNCT
bam-8970	110	9	savova	savova	NOUN
bam-8970	110	10	v	v	ADP
bam-8970	110	11	,	,	PUNCT
bam-8970	110	12	et	et	PROPN
bam-8970	110	13	al	al	PROPN
bam-8970	110	14	.	.	PUNCT
bam-8970	110	15	tumor	tumor	NOUN
bam-8970	110	16	-	-	PUNCT
bam-8970	110	17	suppressor	suppressor	NOUN
bam-8970	110	18	genes	gene	NOUN
bam-8970	110	19	that	that	PRON
bam-8970	110	20	escape	escape	VERB
bam-8970	110	21	from	from	ADP
bam-8970	110	22	xinactivation	xinactivation	NOUN
bam-8970	110	23	contribute	contribute	NOUN
bam-8970	110	24	to	to	ADP
bam-8970	110	25	cancer	cancer	NOUN
bam-8970	110	26	sex	sex	NOUN
bam-8970	110	27	bias	bias	NOUN
bam-8970	110	28	.	.	PUNCT
bam-8970	111	1	nat	nat	PROPN
bam-8970	111	2	genet	genet	PROPN
bam-8970	111	3	2017;49(1):10‐16	2017;49(1):10‐16	PROPN
bam-8970	111	4	.	.	PUNCT
bam-8970	111	5	doi:10.1038	doi:10.1038	NOUN
bam-8970	111	6	/	/	SYM
bam-8970	111	7	ng.3726	ng.3726	PROPN
bam-8970	111	8	6	6	NUM
bam-8970	111	9	.	.	PUNCT
bam-8970	112	1	galvan	galvan	PROPN
bam-8970	112	2	a	a	PRON
bam-8970	112	3	,	,	PUNCT
bam-8970	112	4	ioannidis	ioannidis	NOUN
bam-8970	112	5	jp	jp	NOUN
bam-8970	112	6	,	,	PUNCT
bam-8970	112	7	dragani	dragani	PROPN
bam-8970	112	8	ta	ta	PROPN
bam-8970	112	9	.	.	PROPN
bam-8970	113	1	beyond	beyond	ADP
bam-8970	113	2	genome	genome	NOUN
bam-8970	113	3	-	-	PUNCT
bam-8970	113	4	wide	wide	ADJ
bam-8970	113	5	association	association	NOUN
bam-8970	113	6	studies	study	NOUN
bam-8970	113	7	:	:	PUNCT
bam-8970	113	8	genetic	genetic	ADJ
bam-8970	113	9	heterogeneity	heterogeneity	NOUN
bam-8970	113	10	and	and	CCONJ
bam-8970	113	11	individual	individual	ADJ
bam-8970	113	12	predisposition	predisposition	NOUN
bam-8970	113	13	to	to	ADP
bam-8970	113	14	cancer	cancer	NOUN
bam-8970	113	15	.	.	PUNCT
bam-8970	114	1	trends	trend	NOUN
bam-8970	114	2	genet	genet	PROPN
bam-8970	114	3	2010;26:132	2010;26:132	PROPN
bam-8970	114	4	-	-	SYM
bam-8970	114	5	41	41	NUM
bam-8970	114	6	.	.	PUNCT
bam-8970	115	1	doi	doi	NOUN
bam-8970	115	2	:	:	PUNCT
bam-8970	115	3	10.1016	10.1016	NUM
bam-8970	115	4	/	/	SYM
bam-8970	115	5	j.tig.2009.12.008	j.tig.2009.12.008	PROPN
bam-8970	115	6	7	7	NUM
bam-8970	115	7	.	.	PUNCT
bam-8970	115	8	ulrich	ulrich	PROPN
bam-8970	115	9	cm	cm	PROPN
bam-8970	115	10	,	,	PUNCT
bam-8970	115	11	bigler	bigler	PROPN
bam-8970	115	12	j	j	PROPN
bam-8970	115	13	,	,	PUNCT
bam-8970	115	14	velicer	velicer	PROPN
bam-8970	115	15	cm	cm	PROPN
bam-8970	115	16	,	,	PUNCT
bam-8970	115	17	et	et	PROPN
bam-8970	115	18	al	al	PROPN
bam-8970	115	19	.	.	PUNCT
bam-8970	116	1	searching	searching	PROPN
bam-8970	116	2	expressed	express	VERB
bam-8970	116	3	sequence	sequence	NOUN
bam-8970	116	4	tag	tag	NOUN
bam-8970	116	5	databases	database	NOUN
bam-8970	116	6	:	:	PUNCT
bam-8970	116	7	discovery	discovery	NOUN
bam-8970	116	8	and	and	CCONJ
bam-8970	116	9	confirmation	confirmation	NOUN
bam-8970	116	10	of	of	ADP
bam-8970	116	11	a	a	DET
bam-8970	116	12	common	common	ADJ
bam-8970	116	13	polymorphism	polymorphism	NOUN
bam-8970	116	14	in	in	ADP
bam-8970	116	15	the	the	DET
bam-8970	116	16	thymidylate	thymidylate	NOUN
bam-8970	116	17	synthase	synthase	NOUN
bam-8970	116	18	gene	gene	NOUN
bam-8970	116	19	.	.	PUNCT
bam-8970	117	1	cancer	cancer	NOUN
bam-8970	117	2	epidemiol	epidemiol	PROPN
bam-8970	117	3	biomarkers	biomarker	VERB
bam-8970	117	4	prev	prev	VERB
bam-8970	117	5	2000;91381	2000;91381	NUM
bam-8970	117	6	-	-	SYM
bam-8970	117	7	5	5	NUM
bam-8970	117	8	.	.	NOUN
bam-8970	117	9	8	8	NUM
bam-8970	117	10	.	.	PUNCT
bam-8970	118	1	guan	guan	PROPN
bam-8970	118	2	x	x	PROPN
bam-8970	118	3	,	,	PUNCT
bam-8970	118	4	liu	liu	PROPN
bam-8970	118	5	h	h	PROPN
bam-8970	118	6	,	,	PUNCT
bam-8970	118	7	ju	ju	PROPN
bam-8970	118	8	j	j	PROPN
bam-8970	118	9	,	,	PUNCT
bam-8970	118	10	et	et	PROPN
bam-8970	118	11	al	al	PROPN
bam-8970	118	12	.	.	PUNCT
bam-8970	119	1	genetic	genetic	ADJ
bam-8970	119	2	variant	variant	NOUN
bam-8970	119	3	rs16430	rs16430	NOUN
bam-8970	119	4	6bp	6bp	ADJ
bam-8970	119	5	>	>	X
bam-8970	119	6	0bp	0bp	NOUN
bam-8970	119	7	at	at	ADP
bam-8970	119	8	the	the	DET
bam-8970	119	9	microrna	microrna	PROPN
bam-8970	119	10	-	-	PUNCT
bam-8970	119	11	binding	bind	VERB
bam-8970	119	12	site	site	NOUN
bam-8970	119	13	in	in	ADP
bam-8970	119	14	tyms	tyms	PROPN
bam-8970	119	15	and	and	CCONJ
bam-8970	119	16	risk	risk	NOUN
bam-8970	119	17	of	of	ADP
bam-8970	119	18	sporadic	sporadic	ADJ
bam-8970	119	19	breast	breast	NOUN
bam-8970	119	20	cancer	cancer	NOUN
bam-8970	119	21	risk	risk	NOUN
bam-8970	119	22	in	in	ADP
bam-8970	119	23	nonhispanic	nonhispanic	ADJ
bam-8970	119	24	white	white	ADJ
bam-8970	119	25	women	woman	NOUN
bam-8970	119	26	aged	age	VERB
bam-8970	119	27	≤55	≤55	NOUN
bam-8970	119	28	years	year	NOUN
bam-8970	119	29	.	.	PUNCT
bam-8970	120	1	mol	mol	ADP
bam-8970	120	2	carcinog	carcinog	NOUN
bam-8970	120	3	2015;54:281	2015;54:281	PROPN
bam-8970	120	4	-	-	SYM
bam-8970	120	5	90	90	NUM
bam-8970	120	6	.	.	PUNCT
bam-8970	121	1	doi	doi	NOUN
bam-8970	121	2	:	:	PUNCT
bam-8970	121	3	10.1002	10.1002	NUM
bam-8970	121	4	/	/	SYM
bam-8970	121	5	mc.22097	mc.22097	PROPN
bam-8970	121	6	.	.	PUNCT
bam-8970	122	1	epub	epub	PROPN
bam-8970	122	2	2013	2013	NUM
bam-8970	122	3	oct	oct	NOUN
bam-8970	122	4	26	26	NUM
bam-8970	122	5	.	.	NOUN
bam-8970	123	1	9	9	NUM
bam-8970	123	2	.	.	X
bam-8970	123	3	vilmos	vilmos	PROPN
bam-8970	123	4	a	a	PRON
bam-8970	123	5	,	,	PUNCT
bam-8970	123	6	hitre	hitre	NOUN
bam-8970	123	7	e	e	NOUN
bam-8970	123	8	,	,	PUNCT
bam-8970	123	9	köves	köve	VERB
bam-8970	123	10	i	i	PRON
bam-8970	123	11	,	,	PUNCT
bam-8970	123	12	et	et	PROPN
bam-8970	123	13	al	al	PROPN
bam-8970	123	14	.	.	PROPN
bam-8970	124	1	heterozygote	heterozygote	NOUN
bam-8970	124	2	deficiency	deficiency	NOUN
bam-8970	124	3	in	in	ADP
bam-8970	124	4	thymidylate	thymidylate	ADJ
bam-8970	124	5	synthase	synthase	NOUN
bam-8970	124	6	enhancer	enhancer	NOUN
bam-8970	124	7	region	region	NOUN
bam-8970	124	8	polymorphism	polymorphism	NOUN
bam-8970	124	9	genotype	genotype	NOUN
bam-8970	124	10	distribution	distribution	NOUN
bam-8970	124	11	in	in	ADP
bam-8970	124	12	hungarian	hungarian	ADJ
bam-8970	124	13	colorectal	colorectal	ADJ
bam-8970	124	14	cancer	cancer	NOUN
bam-8970	124	15	patients	patient	NOUN
bam-8970	124	16	.	.	PUNCT
bam-8970	125	1	int	int	NOUN
bam-8970	125	2	j	j	PROPN
bam-8970	125	3	cancer	cancer	NOUN
bam-8970	125	4	2005;108	2005;108	NUM
bam-8970	125	5	:	:	PUNCT
bam-8970	125	6	852	852	NUM
bam-8970	125	7	-	-	SYM
bam-8970	125	8	6	6	NUM
bam-8970	125	9	.	.	NOUN
bam-8970	125	10	10	10	NUM
bam-8970	125	11	.	.	PUNCT
bam-8970	126	1	wang	wang	PROPN
bam-8970	126	2	x	x	PROPN
bam-8970	126	3	,	,	PUNCT
bam-8970	126	4	wang	wang	PROPN
bam-8970	126	5	y	y	PROPN
bam-8970	126	6	,	,	PUNCT
bam-8970	126	7	wang	wang	PROPN
bam-8970	126	8	y	y	PROPN
bam-8970	126	9	,	,	PUNCT
bam-8970	126	10	et	et	PROPN
bam-8970	126	11	al	al	PROPN
bam-8970	126	12	.	.	PROPN
bam-8970	126	13	association	association	PROPN
bam-8970	126	14	of	of	ADP
bam-8970	126	15	thymidylate	thymidylate	ADJ
bam-8970	126	16	synthase	synthase	NOUN
bam-8970	126	17	gene	gene	NOUN
bam-8970	126	18	3'-untranslated	3'-untranslate	VERB
bam-8970	126	19	region	region	NOUN
bam-8970	126	20	polymorphism	polymorphism	NOUN
bam-8970	126	21	with	with	ADP
bam-8970	126	22	sensitivity	sensitivity	NOUN
bam-8970	126	23	of	of	ADP
bam-8970	126	24	non	non	ADJ
bam-8970	126	25	-	-	ADJ
bam-8970	126	26	small	small	ADJ
bam-8970	126	27	cell	cell	NOUN
bam-8970	126	28	lung	lung	NOUN
bam-8970	126	29	cancer	cancer	NOUN
bam-8970	126	30	to	to	ADP
bam-8970	126	31	pemetrexed	pemetrexed	ADJ
bam-8970	126	32	treatment	treatment	NOUN
bam-8970	126	33	:	:	PUNCT
bam-8970	126	34	ts	ts	ADP
bam-8970	126	35	gene	gene	NOUN
bam-8970	126	36	polymorphism	polymorphism	NOUN
bam-8970	126	37	and	and	CCONJ
bam-8970	126	38	pemetrexed	pemetrexe	VERB
bam-8970	126	39	sensitivity	sensitivity	NOUN
bam-8970	126	40	in	in	ADP
bam-8970	126	41	nsclc	nsclc	NOUN
bam-8970	126	42	.	.	PUNCT
bam-8970	127	1	journal	journal	PROPN
bam-8970	127	2	of	of	ADP
bam-8970	127	3	biomedical	biomedical	ADJ
bam-8970	127	4	science	science	NOUN
bam-8970	127	5	,	,	PUNCT
bam-8970	127	6	2013;20:5	2013;20:5	PROPN
bam-8970	127	7	.	.	PUNCT
bam-8970	128	1	doi	doi	PROPN
bam-8970	128	2	10.1186/1423	10.1186/1423	NUM
bam-8970	128	3	-	-	SYM
bam-8970	128	4	0127	0127	NUM
bam-8970	128	5	-	-	PUNCT
bam-8970	128	6	20	20	NUM
bam-8970	128	7	-	-	SYM
bam-8970	128	8	5	5	NUM
bam-8970	128	9	11	11	NUM
bam-8970	128	10	.	.	PUNCT
bam-8970	129	1	mo	mo	PROPN
bam-8970	129	2	a	a	PROPN
bam-8970	129	3	,	,	PUNCT
bam-8970	129	4	zhao	zhao	PROPN
bam-8970	129	5	y	y	PROPN
bam-8970	129	6	,	,	PUNCT
bam-8970	129	7	shi	shi	PROPN
bam-8970	129	8	y	y	PROPN
bam-8970	129	9	,	,	PUNCT
bam-8970	129	10	et	et	PROPN
bam-8970	129	11	al	al	PROPN
bam-8970	129	12	.	.	PROPN
bam-8970	129	13	association	association	PROPN
bam-8970	129	14	between	between	ADP
bam-8970	129	15	polymorphisms	polymorphism	NOUN
bam-8970	129	16	of	of	ADP
bam-8970	129	17	thymidylate	thymidylate	ADJ
bam-8970	129	18	synthase	synthase	NOUN
bam-8970	129	19	gene	gene	NOUN
bam-8970	129	20	5	5	NUM
bam-8970	129	21	'	'	PUNCT
bam-8970	129	22	and	and	CCONJ
bam-8970	129	23	3'-utr	3'-utr	PROPN
bam-8970	129	24	and	and	CCONJ
bam-8970	129	25	gastric	gastric	ADJ
bam-8970	129	26	cancer	cancer	NOUN
bam-8970	129	27	risk	risk	NOUN
bam-8970	129	28	:	:	PUNCT
bam-8970	129	29	meta	meta	ADJ
bam-8970	129	30	-	-	PUNCT
bam-8970	129	31	analysis	analysis	NOUN
bam-8970	129	32	.	.	PUNCT
bam-8970	130	1	biosci	biosci	PROPN
bam-8970	130	2	rep	rep	PROPN
bam-8970	130	3	2016;36	2016;36	NUM
bam-8970	130	4	,	,	PUNCT
bam-8970	130	5	e00429	e00429	ADJ
bam-8970	130	6	.	.	PUNCT
bam-8970	131	1	org/10.1042	org/10.1042	PROPN
bam-8970	131	2	/	/	SYM
bam-8970	131	3	bsr	bsr	PROPN
bam-8970	131	4	20160273	20160273	NUM
bam-8970	131	5	12	12	NUM
bam-8970	131	6	.	.	PUNCT
bam-8970	132	1	fu	fu	PROPN
bam-8970	132	2	z	z	PROPN
bam-8970	132	3	,	,	PUNCT
bam-8970	132	4	jiao	jiao	PROPN
bam-8970	132	5	y	y	PROPN
bam-8970	132	6	,	,	PUNCT
bam-8970	132	7	li	li	PROPN
bam-8970	132	8	y	y	PROPN
bam-8970	132	9	,	,	PUNCT
bam-8970	132	10	et	et	PROPN
bam-8970	132	11	al	al	PROPN
bam-8970	132	12	.	.	PROPN
bam-8970	132	13	tyms	tyms	PROPN
bam-8970	132	14	presents	present	VERB
bam-8970	132	15	a	a	DET
bam-8970	132	16	novel	novel	NOUN
bam-8970	132	17	biomarker	biomarker	NOUN
bam-8970	132	18	for	for	ADP
bam-8970	132	19	diagnosis	diagnosis	NOUN
bam-8970	132	20	and	and	CCONJ
bam-8970	132	21	prognosis	prognosis	NOUN
bam-8970	132	22	in	in	ADP
bam-8970	132	23	patients	patient	NOUN
bam-8970	132	24	with	with	ADP
bam-8970	132	25	pancreatic	pancreatic	ADJ
bam-8970	132	26	cancer	cancer	NOUN
bam-8970	132	27	.	.	PUNCT
bam-8970	133	1	medicine	medicine	NOUN
bam-8970	133	2	(	(	PUNCT
bam-8970	133	3	baltimore	baltimore	PROPN
bam-8970	133	4	)	)	PUNCT
bam-8970	133	5	.	.	PUNCT
bam-8970	134	1	2019;98	2019;98	ADV
bam-8970	134	2	:	:	PUNCT
bam-8970	134	3	e18487	e18487	PROPN
bam-8970	134	4	.	.	PUNCT
bam-8970	135	1	doi	doi	NOUN
bam-8970	135	2	:	:	PUNCT
bam-8970	135	3	10.1097	10.1097	NUM
bam-8970	135	4	/	/	SYM
bam-8970	135	5	md.000000000001	md.000000000001	PROPN
bam-8970	135	6	8487	8487	NUM
bam-8970	135	7	.	.	PUNCT
bam-8970	136	1	13	13	NUM
bam-8970	136	2	.	.	PUNCT
bam-8970	137	1	bai	bai	PROPN
bam-8970	137	2	w	w	PROPN
bam-8970	137	3	,	,	PUNCT
bam-8970	137	4	wu	wu	PROPN
bam-8970	137	5	y	y	PROPN
bam-8970	137	6	,	,	PUNCT
bam-8970	137	7	zhang	zhang	PROPN
bam-8970	137	8	p	p	X
bam-8970	137	9	,	,	PUNCT
bam-8970	137	10	xi	xi	PROPN
bam-8970	137	11	y.	y.	PROPN
bam-8970	137	12	correlations	correlation	NOUN
bam-8970	137	13	between	between	ADP
bam-8970	137	14	expression	expression	NOUN
bam-8970	137	15	levels	level	NOUN
bam-8970	137	16	of	of	ADP
bam-8970	137	17	thymidylate	thymidylate	ADJ
bam-8970	137	18	synthase	synthase	NOUN
bam-8970	137	19	,	,	PUNCT
bam-8970	137	20	thymidine	thymidine	ADJ
bam-8970	137	21	phosphorylase	phosphorylase	NOUN
bam-8970	137	22	and	and	CCONJ
bam-8970	137	23	dihydropyrimidine	dihydropyrimidine	NOUN
bam-8970	137	24	dehydrogenase	dehydrogenase	NOUN
bam-8970	137	25	,	,	PUNCT
bam-8970	137	26	and	and	CCONJ
bam-8970	137	27	efficacy	efficacy	NOUN
bam-8970	137	28	of	of	ADP
bam-8970	137	29	5	5	NUM
bam-8970	137	30	-	-	PUNCT
bam-8970	137	31	fluorouracilbased	fluorouracilbase	VERB
bam-8970	137	32	chemotherapy	chemotherapy	NOUN
bam-8970	137	33	for	for	ADP
bam-8970	137	34	advanced	advanced	ADJ
bam-8970	137	35	colorectal	colorectal	ADJ
bam-8970	137	36	cancer	cancer	NOUN
bam-8970	137	37	.	.	PUNCT
bam-8970	138	1	int	int	PROPN
bam-8970	139	1	j	j	PROPN
bam-8970	139	2	clin	clin	PROPN
bam-8970	139	3	exp	exp	PROPN
bam-8970	139	4	pathol	pathol	NOUN
bam-8970	139	5	2015;201;8:12333–45	2015;201;8:12333–45	NUM
bam-8970	139	6	.	.	PUNCT
bam-8970	140	1	14	14	NUM
bam-8970	140	2	.	.	PUNCT
bam-8970	141	1	chu	chu	PROPN
bam-8970	141	2	e	e	PROPN
bam-8970	141	3	,	,	PUNCT
bam-8970	141	4	callender	callender	PROPN
bam-8970	141	5	ma	ma	PROPN
bam-8970	141	6	,	,	PUNCT
bam-8970	141	7	farrell	farrell	PROPN
bam-8970	141	8	mp	mp	PROPN
bam-8970	141	9	,	,	PUNCT
bam-8970	141	10	schmitz	schmitz	PROPN
bam-8970	141	11	jc	jc	PROPN
bam-8970	141	12	.	.	PROPN
bam-8970	141	13	thymidylate	thymidylate	PROPN
bam-8970	141	14	synthase	synthase	NOUN
bam-8970	141	15	inhibitors	inhibitor	NOUN
bam-8970	141	16	as	as	ADP
bam-8970	141	17	anticancer	anticancer	NOUN
bam-8970	141	18	agents	agent	NOUN
bam-8970	141	19	:	:	PUNCT
bam-8970	141	20	from	from	ADP
bam-8970	141	21	bench	bench	NOUN
bam-8970	141	22	to	to	ADP
bam-8970	141	23	bedside	bedside	NOUN
bam-8970	141	24	.	.	PUNCT
bam-8970	142	1	cancer	cancer	NOUN
bam-8970	142	2	chemother	chemother	PROPN
bam-8970	142	3	pharmacol	pharmacol	PROPN
bam-8970	142	4	2003;52	2003;52	NUM
bam-8970	142	5	suppl	suppl	ADJ
bam-8970	142	6	1	1	NUM
bam-8970	142	7	:	:	PUNCT
bam-8970	142	8	s80	s80	VERB
bam-8970	142	9	-	-	PUNCT
bam-8970	142	10	9	9	NUM
bam-8970	142	11	.	.	PUNCT
bam-8970	143	1	doi	doi	NOUN
bam-8970	143	2	:	:	PUNCT
bam-8970	143	3	10.1007	10.1007	NUM
bam-8970	143	4	/	/	SYM
bam-8970	143	5	s00280	s00280	NOUN
bam-8970	143	6	-	-	PUNCT
bam-8970	143	7	003	003	NUM
bam-8970	143	8	-	-	PUNCT
bam-8970	143	9	0625	0625	NUM
bam-8970	143	10	-	-	SYM
bam-8970	143	11	9	9	NUM
bam-8970	143	12	..	..	SYM
bam-8970	143	13	15	15	NUM
bam-8970	143	14	.	.	PUNCT
bam-8970	144	1	pellicer	pellicer	PROPN
bam-8970	144	2	m	m	PROPN
bam-8970	144	3	,	,	PUNCT
bam-8970	144	4	garcía	garcía	NOUN
bam-8970	144	5	-	-	PUNCT
bam-8970	144	6	gonzález	gonzález	NOUN
bam-8970	144	7	x	x	NOUN
bam-8970	144	8	,	,	PUNCT
bam-8970	144	9	garcía	garcía	PROPN
bam-8970	144	10	mi	mi	PROPN
bam-8970	144	11	,	,	PUNCT
bam-8970	144	12	et	et	PROPN
bam-8970	144	13	al	al	PROPN
bam-8970	144	14	.	.	PUNCT
bam-8970	145	1	identification	identification	NOUN
bam-8970	145	2	of	of	ADP
bam-8970	145	3	new	new	ADJ
bam-8970	145	4	snps	snps	PROPN
bam-8970	145	5	associated	associate	VERB
bam-8970	145	6	with	with	ADP
bam-8970	145	7	severe	severe	ADJ
bam-8970	145	8	toxicity	toxicity	NOUN
bam-8970	145	9	to	to	PART
bam-8970	145	10	capecitabine	capecitabine	VERB
bam-8970	145	11	.	.	PUNCT
bam-8970	146	1	pharmacol	pharmacol	PROPN
bam-8970	146	2	res	re	NOUN
bam-8970	146	3	2017;120:133	2017;120:133	NUM
bam-8970	146	4	-	-	SYM
bam-8970	146	5	7	7	NUM
bam-8970	146	6	.	.	PUNCT
bam-8970	146	7	doi	doi	NOUN
bam-8970	146	8	:	:	PUNCT
bam-8970	146	9	10.1016	10.1016	NUM
bam-8970	146	10	/	/	SYM
bam-8970	146	11	j.phrs.2017.03.021	j.phrs.2017.03.021	PROPN
bam-8970	146	12	16	16	NUM
bam-8970	146	13	.	.	PUNCT
bam-8970	147	1	miller	miller	PROPN
bam-8970	147	2	ab	ab	PROPN
bam-8970	147	3	,	,	PUNCT
bam-8970	147	4	hoogstraten	hoogstraten	PROPN
bam-8970	147	5	b	b	PROPN
bam-8970	147	6	,	,	PUNCT
bam-8970	147	7	staquet	staquet	NOUN
bam-8970	147	8	m	m	PROPN
bam-8970	147	9	,	,	PUNCT
bam-8970	147	10	winkler	winkler	PROPN
bam-8970	147	11	a.	a.	NOUN
bam-8970	147	12	reporting	reporting	NOUN
bam-8970	147	13	results	result	NOUN
bam-8970	147	14	of	of	ADP
bam-8970	147	15	cancer	cancer	NOUN
bam-8970	147	16	treatment	treatment	NOUN
bam-8970	147	17	.	.	PUNCT
bam-8970	148	1	cancer	cancer	NOUN
bam-8970	148	2	1981;47:207–14	1981;47:207–14	PROPN
bam-8970	148	3	.	.	PUNCT
bam-8970	148	4	doi	doi	PROPN
bam-8970	148	5	:	:	PUNCT
bam-8970	148	6	10.1002/1097	10.1002/1097	NUM
bam-8970	148	7	-	-	SYM
bam-8970	148	8	0142	0142	NUM
bam-8970	148	9	(	(	PUNCT
bam-8970	148	10	19810	19810	NUM
bam-8970	148	11	101)47:1<207::aid	101)47:1<207::aid	NUM
bam-8970	148	12	-	-	PUNCT
bam-8970	148	13	cncr2820470134>3	cncr2820470134>3	ADJ
bam-8970	148	14	.0.co;2	.0.co;2	PROPN
bam-8970	148	15	-	-	PUNCT
bam-8970	148	16	6	6	NUM
bam-8970	148	17	.	.	PUNCT
bam-8970	149	1	submissions	submission	NOUN
bam-8970	149	2	:	:	PUNCT
bam-8970	149	3	march	march	PROPN
bam-8970	149	4	19	19	NUM
bam-8970	149	5	,	,	PUNCT
bam-8970	149	6	2020	2020	NUM
bam-8970	149	7	revision	revision	NOUN
bam-8970	149	8	received	receive	VERB
bam-8970	149	9	:	:	PUNCT
bam-8970	149	10	may	may	AUX
bam-8970	149	11	13	13	NUM
bam-8970	149	12	,	,	PUNCT
bam-8970	149	13	2020	2020	NUM
bam-8970	149	14	accepted	accept	VERB
bam-8970	149	15	for	for	ADP
bam-8970	149	16	publication	publication	NOUN
bam-8970	149	17	:	:	PUNCT
bam-8970	149	18	may	may	AUX
bam-8970	149	19	13	13	NUM
bam-8970	149	20	,	,	PUNCT
bam-8970	149	21	2020	2020	NUM
bam-8970	149	22	mailto:giuseppe.messina17@unipa.it	mailto:giuseppe.messina17@unipa.it	PRON