Layout 1 Thematic Section: Advances in Musculoskeletal and Neuromuscular Rehabilitation | Maccarone & Masiero Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 Aging is associated with a decrease in physical activity and functional capacity concomitant with increases in fat mass1. Increased secretion of pro-inflammatory cytokines associated with aging can disrupt insulin signaling and increase systemic insulin resistance, predisposing individuals to diabetes.2 Moreover, inflammation and oxidative stress caused by obesity and diabetes act as regulators of cell signaling, leading to increased proteolysis and muscle atrophy.3 Stem cells (satellite cells) are closely associated with mus- cle fiber regeneration and their potential decreases with increasing age, leading to poor muscle regeneration after trauma or muscle injury.4 A popular method for estimating satellite cells activity is through myogenic regulatory fac- tors (MRFs), including MyoD, Myf5, myogenin, and myogenic regulatory factor4 (MRF4), which can provide comparisons of the number of cells between different sit- uations.5 Exercise training and nutritional support are effective modulators of skeletal muscle proteins that work synergis- tically to increase skeletal muscle mass.6 In this regard, high-intensity interval training (HIIT) has recently be- come popular for its benefits in clinical populations. As for diabetes, a review by Arrieta-Leandro et al. (2023) concluded that HIIT improves glycemic control, aerobic resistance, and % fat and waist circumference in individ- uals with diabetes.7 HIIT has also been shown to improve transcriptional and translational responses of muscle cells.8 Considering that a single bout of HIIT increased the activity of satellite cells (i.e., MyoD+/Pax7+ cells) 24 and 48 h after exercise in older men,9 investigating satellite cell activity in re- sponse to HIIT can provide mechanistic insights into the potential factors regulating skeletal muscle regeneration. Spirulina (SP) has been shown to be a potential supple- ment for controlling and reducing complications caused Abstract This study aimed to investigate changes in protein signaling associated with muscle regeneration in aged rats with obesity and diabetes following high-intensity interval training (HIIT) and SP supplementation. Forty male Wistar rats weighting 280-325 g were used in this study. Obesity was induced by eight weeks of a high-fat diet, and diabetes was induced by intraperitoneal injection of 40 mg/kg streptozocin. Rats were randomly divided into control (CON), sham, SP, HIIT, and HIIT+SP groups. HIIT was performed five times per week during the 8-week period. SP dose was 50 mg/kg. Real-time PCR was used to evaluate the expression of myogenin, MyoD1, and Pax7. The decreases in body mass in the HIIT, HIIT+SP and SP groups were significantly higher than those in the sham and CON groups (p=0.0001). The soleus muscle mass increased significantly only in the HIIT and HIIT+SP groups (p<0.01). HIIT+SP improved fasting blood glucose and insulin levels more than HIIT alone and SP (p<0.05), while HIIT increased the expression levels of myogenic factors more than other groups (p=0.0001). In conclusion HIIT alone had a significant impact on myogenic factors, whereas Spirulina had an effect only when combined with HIIT. Key Words: high-intensity interval training; Spirulina; muscle regeneration; rats; resistance training. Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins in aged rats with obesity and diabetes Roya Askari,1 Marzieh Sadat Azarniveh,1,2 Amir Hossein Haghighi,1 Hadi Shahrabadi,1 Paulo Gentil3,4 1Department of Exercise Physiology, Faculty of Sport Sciences, Hakim Sabzevari University, Sabzevar, Iran; 2Department of Sports Sciences, Faculty of Literature and Humani-ties, Zabol University, Zabol, Iran; 3College of Physical Education and Dance, Federal University of Goias, Goiânia, Brazil; 4Hypertension League Federal University of Goias, Goiânia, Brazil. This article is distributed under the terms of the Creative Commons Attribution Noncommercial License (CC BY-NC 4.0) which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. - 25 - Non -co mmerc ial us e o nly High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 by advanced age.10 SP could have antioxidant effects, pro- mote weight loss,11 anti-inflammatory effects, and im- prove glycemic control.12 A study on rats showed that SP supplementation, when combined with resistance training, improved antioxidant capacity and attenuated exercise-in- duced increases in ROS and inflammation without com- promising the positive physiological adaptations to exercise training.13 Lu et al. (2006) provided SP supple- mentation for three weeks before a muscle damaging pro- tocol and reported a reduction on skeletal muscle damage in trained men.14 A literature review by Calella et al. (2022) concluded that SP has ergogenic potential during submaximal exercise, increasing oxygen uptake, and improving exercise tol- erance. However, the authors highlighted that there is a lack of evidence supporting the benefits of SP supplemen- tation on the immune system, and the benefits of SP sup- plementation in healthy people performing physical exercise are not consistent.15 In contrast, Chauoachi et al. (2024) suggested positive effects of SP on body composi- tion, especially in overweight and obese subjects, which could not be the case in some pathologies. Moreover, this review highlights the improvements in aerobic fitness and muscle performance, especially in untrained and mod- erately trained subjects, and highlights that most studies show improvements in antioxidant status and a reduction in muscle damage in accelerated recovery.16 In addition to the apparent controversy, we are not aware of any studies investigating the effects of SP on skeletal muscle at the cellular and molecular levels in clinical sit- uations. Moreover, studies investigating the interaction between exercise training and SP supplementation have reported different results, with either improvement17 or no change18 in glycemic and weight control. Therefore, this study aimed to investigate the effects of HIIT and SP sup- plementation, alone or in combination, in the expression of myogenic factors (i.e., MyoD1, Pax7, myogenin, and MyoD1/Pax7) in aged rats with obesity and diabetes. Materials and Methods Animals This study was approved by the Research Ethics Commit- tee of Hakim Sabzevari University (code IR. HSU. REC.1400.007). Forty male Wistar rats, aged 20-month and with an average weight of 280-325 g were purchased and transferred to the laboratory environment. The rats were kept at a temperature of 22±2°C, humidity of 40- 50% and light and 12:12 h. Induction of obesity and diabetes Obesity was induced by a high-fat diet derived from soy- beans and vegetable oil (40% fat, 13% protein, and 47% carbohydrates), which was prepared and used under the supervision of livestock and poultry specialists for eight weeks. Rats required 10 g of pellets and 10-15 ml of water per 100 g of body weight daily19 and had free access to food and water. Type 1 diabetes was induced after the rats’ weight exceeded 310 g by an intraperitoneal single-dose injection of streptozotocin (STZ; Sigma, Germany). STZ (40 mg/kg body weight) was dissolved in sodium citrate buffer solution (pH 4.5) and injected into the rats after a 12-h fasting period. After five days, blood glucose levels were measured using blood samples collected from the tails of the animals using a glucometer (Beurer, GL42, Germany) and the glucose oxidase enzyme method. Rats were diagnosed with diabetes if their glucose concentra- tion was > 200 mg/ml.8 They were then weighed using a digital scale (Rat Grimace Scale) with an accuracy of 0.0001 g. The obese and diabetic rats were then randomly divided into four groups of eight: HIIT, SP, HIIT + SP and sham (normal saline). We also selected 8 rats as the con- trol (CON) group before induction of obesity and diabetes (Basic CON). Spirulina and placebo supplementation The supplement was SP algae powder (Far East Micro- algae, Taiwan), prepared by Sina Riz Algae (Qeshm, Iran). SP algae powder was diluted with normal saline solution at a rate of 50 mg/kg body weight,23 and was administered by gavage to the rats in the supplement-consuming groups, five days per week for a period of eight weeks. To establish the same conditions, the same amount of a nor- mal saline solution was used as a placebo in the groups that did not consume SP. Determination of VO2max and training protocol A progressive test was performed to determine the VO2max. 20 The rats were familiarized with the treadmill for one week at a speed of 5 m/min for 5 min in five sessions. The test began with a warm-up for 10 min at an intensity of 10 m/min. Then, every 2 min, the treadmill speed was automatically increased by 3 m/min until the rats were un- able to continue running. The VO2max was calculated ac- cording to the following formula, and the training intensity was adjusted accordingly:21 Y = 162 X -1 Y indicates VO2 (ml/kg/m0.75 per min) and X indicates the treadmill speed (m/s). The maximum speed obtained in the tests was 29.41±3.12 m/min. The rats had a one-week exercise adaptation period with a progressive increase in treadmill speed before starting the training protocol. After the adaptation period, the ani- mals exercised five times per week during the 8-week period with 90% VO2max for 30s, with no inclination,22 in- terspaced by 1 min of active recovery at 8.7 m/min. The number of intervals started at five and increased by one per week until it reached 12 in the eighth week. Five mi- nutes of warm-up and cool-down were performed at 40– 50% and 20–30% of the maximum speed, respectively. Blood sampling, tissue extraction and biochemical monitoring Blood sampling was performed 24 h after the last training session and after 8 h of fasting to eliminate the acute ef- fects of exercise. Rats were anesthetized by intraperitoneal - 26 - Non -co mmerc ial us e o nly High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 injection of xylazine (10 mg/kg) and ketamine (90 mg/kg) to collect samples. The chest of the animal was opened after complete anesthesia and a blood sample was col- lected directly from the heart of the animal. The soleus muscle was then separated from the left leg under sterile conditions, washed with physiological serum, and weighed. The tissue was frozen in liquid nitrogen and transferred to a-80°C freezer for further measurements. Fasting insulin levels were measured using enzyme imm- unoassay. Serum glucose levels were measured using a biochemical kit and an enzymatic method (the glucose ox- idase method). HOMA-IR was used to measure insulin re- sistance. The HOMA-IR index was calculated as [fasting serum glucose (mmol/L) × fasting serum insulin (µIU/ml)/22.5].8 RNA extraction, cDNA synthesis and real-time PCR The efficiency of the reference gene (GAPDH) was eval- uated based on the instructions of the real-time PCR tech- nique. The soleus muscle was homogenized at a 1:10 ratio in QlAzol® Lysis Reagent to extract the total RNA. It was then centrifuged at a temperature of 4С for 10 min at 12000 rpm in order to separate the protein components. The mixture was then mixed with chloroform at a 2:1 ratio and shaken vigorously for 15 s. The mixture was centri- fuged at a temperature of 4С for 15 min at 12000 rpm and the mineral and aqueous parts were separated. The re- maining content was mixed with isopropanol at a 2:1 ratio, incubated at room temperature for 10 min, and centrifuged at 4С for 10 min at 12000 rpm. The pellet containing RNA was washed in ethanol and dissolved in 20 μL RNAS-free water. RNA concentration was measured using an Eppen- dorff (Germany), and a 260:280 ratio between 1.8 and 2 was defined as the optimal purity. cDNA synthesis was done using 1μg of RNA, a cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA, cat NO: K1621), and Mulv Reverse Transcriptase enzyme. The expression levels of MyoD1, Pax7, and myogenin were measured by real-time quantitative PCR using Pri- mix syber Green II (Applied Biosystems, Step One, USA). Primers were designed based on the information on MyoD1, Pax7, myogenin, and Gapdh genes in the NCBI gene bank and by the Macrogen Company, Seoul, Korea. Primer sequences used are listed in Table 1. The tempera- ture program used in real-time PCR was 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min, and was repeated for 40 cycles, according to the manufacturer’s instructions. The expression levels of target genes were measured using the 2-ΔΔCT method. The primers used are listed in Table 1. Statistical analysis The means and standard deviations were used to describe the data. Shapiro-Wilk and Levene tests were used to check the normality of the data and homogeneity of vari- ances, respectively. One-way ANOVA was used to deter- mine the differences between variables among groups, and Tukey’s post-hoc test was used when necessary. Analyses were performed using the statistical software SPSS ver- sion 23, and the significance level was set at p < 0.05. Results Table 2 shows the total body and soleus muscle mass be- fore and after the training period, with the soleus muscle mass reported in absolute and relative terms, respectively. The results of the statistical test for body mass showed a significant difference between the studied groups (F=76.808; p=0.002), and the results of Tukey’s test indi- cated a significant decrease in body mass in the HIIT, HIIT+SP, and SP groups compared with the CON (p=0.0001) and sham (p=0.0001) groups. There was no significant difference in body mass among HIIT, HIIT+SP, and SP groups (p>0.05). There was a significant difference in the soleus muscle mass between the different groups (F=4.242; p=0.004). Tukey’s test showed a significant increase in the HIIT (p=0.002) and HIIT+ SP (p=0.010) groups compared with the basic CON group, and no significant difference was observed between the other groups (p>0.05). The glycemic indices are presented in Table 3. One-way ANOVA results showed significant differences in fasting glucose concentration (F=140.51; p=0.0001), insulin (F=136.52; p=0.0001), and HOMA-IR (F=14.04; p=0.0001) between the studied groups. Tukey’s post-hoc test showed that fasting glucose levels in the SP, HIIT+SP, and HIIT groups were significantly lower than those in the sham group (p=0.0001). Moreover, the values for the HIIT+SP group were lower than those for the sham, SP, and HIIT groups (p<0.05). - 27 - Table 1. Sequences of specific primers used for real-time PCR. Gene F-Primer R-Primer Product length MyoD1 AAGTGAACGAGGCCTTCGAG CCGCTGTAATCCATCATGCC 271 bp Pax7 TAAGAGGGAGAACCCCGGAA GGCTAATCGAACTCACTGAGGG 104 bp Myogenin GAAGCGCAGGCTCAAGAAAG GCTGCGAGCAAATGATCTCC 300 bp Gapdh GCATCTTCTTGTGCAGTGCC GATGGTGATGGGTTTCCCGT 262 bp Non -co mmerc ial us e o nly High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 Insulin levels were higher in the HIIT and SP groups than those in the sham group (p=0.0001), with higher values in the HIIT+SP group than those in the HIIT, supplement, and sham groups (p=0.0001). HOMA-IR decreased significantly in the HIIT, SP, and HIIT+SP groups compared with that in the sham group (p<0.05). There was no significant difference in HOMA- IR among HIIT, HIIT+SP, and SP groups (p>0.05). In ad- dition, a significant difference was observed in all glycemic indices between the CON and sham groups (p=0.0001). There were significant differences in MyoD1 (F=50.57; p=0.0001), myogenin (F=24.62; p=0.0001), Pax7 (F=79.95; p=0.0001), and MyoD1/Pax7 (F=13.93; p=0.0001) gene expression levels in the soleus muscle of rats in the different groups (Figure 1). The post-hoc test showed that MyoD1 gene expression levels in the soleus muscle of the HIIT and HIIT+SP groups were significantly higher than those in all other groups (p=0.0001) and were higher in HIIT than in HIIT+SP (p=0.0001). MyoD1 gene expression levels were higher in the SP group than in the CON group (p=0.033). Pax7 expression was higher in the HIIT group than in all investigated groups (p=0.0001), whereas the HIIT+SP group showed a significant increase compared with the SP (p=0.030), CON (p=0.020), and sham (p=0.0001) groups. No other significant differences were observed between the groups (p>0.05). According to post-hoc tests, myogenin gene expression levels in the HIIT group were significantly higher than those in all the investigated groups (p=0.0001). The HIIT+SP values were higher than those in the CON group (p=0.004). The results of the post-hoc test of the MyoD1/Pax7 ratio - 28 - Table 2. Changes in body mass and soleus muscle mass before and after the training period in the studied groups. Groups HIIT+SP HIIT SP CON Sham Baseline body mass(g) 508.18±6.83 504.55±9.57 507.48±7.33 508.54±7.08 507.65±7.33 Post body mass (g) 484.83±7.63B 486.65±8.08B 501.38±7.70B 569.23±15.36 568.63±26.59 Soleus muscle mass (g) 0.66±0.05A 0.67±0.02A 0.64±0.04 0.62±0.04 0.62±0.05 Sole muscle mass ratio 0.14 0.14 0.13 0.11 0.11 to body mass (%) CON, control; SP, Spirulina; HIIT, high-intensity interval training; HIIT + SP, high-intensity interval training combined with Spirulina. ASignificant differences compared with the basic CON group. BSignificant difference compared with the CON and sham groups. Table 3. Comparison of glycemic indices between the different groups. Groups Fasting blood glucose (mg/dl) Insulin (µIU/ml) HOMA-IR HIIT 201.12±16.84E 7.17±0.14A 3.55±0.23C HIIT+SP 165.25±18.51D 9.24±0.39D 3.73±0.34A SP 230.25±39.23A 6.99±0.29A 3.98±0.74A CON 90.37±8.07 13.12±1.56 2.94±0.53 Sham 372.00±28.83B 5.13±0.12B 4.71±0.39B CON, control; SP, Spirulina; HIIT, high-intensity interval training; HIIT + SP, high-intensity interval training combined with Spirulina. ASignificant differences compared to the CON and sham groups. BSignificant difference compared to the CON group; CSignificant difference compared to the sham group; DSignificant difference com- pared to all groups ESignificant difference compared to HIIT+SP, sham and CON groups. Non -co mmerc ial us e o nly High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 were higher in the CON group than in all other groups (p<0.05); however, no other significant differences were observed between the groups (p>0.05). Discussion This study aimed to investigate the changes in myogenic signaling proteins in aged rats with obesity and diabetes following HIIT or SP supplementation. The results of the present study showed that HIIT alone (14%) and in com- bination with SP (9%) caused a significant decrease in body mass. There was also an increase in soleus muscle mass in the HIIT+SP (17.8%) and HIIT (19.6%) groups compared to that in the basic CON group. Many studies have been conducted on the effect of HIIT on body mass, which is mostly consistent with the present findings, in- dicating the effects of weight loss following HIIT.24,25 Moreover, previous studies have shown that HIIT is likely associated with promote both anabolic and antica- tabolic stimuli and stimulate muscle hypertrophy.26 The results showed that SP alone and in combination with HIIT caused weight loss, reduced fasting blood glu- cose levels, increased insulin levels, and improved insu- lin resistance. Notably, these changes were significantly higher in the HIIT+SP group than in the SP group, indi- cating a synergy between HIIT and SP supplementation. However, some studies have reported results that are contrary to those of the current study. For example, Lee et al. (2008) indicated that there was no significant de- crease in serum glucose and insulin levels in diabetic pa- tients owing to supplementation.27 The positive effects of HIIT on diabetes management have been reported in several studies12,28,29 and is be associated with improve- ments in glucose metabolism,29 changes in insulin recep- tor signaling, increased expression of glucose transporter proteins, reduced release of free fatty acids, and in- creased release of blood glucose into the muscle.28 SP has also been found to improve diabetes control by re- ducing the weight and production of proinflammatory cytokines.12 The effectiveness of SP is mainly attributed to the water-soluble part of this alga, which consists of a protein called phycocyanin, and is considered a blood glucose-lowering agent. Furthermore, other factors that have been associated with the effects of SP on glycemic control are the high fiber content, which reduces the ab- sorption of glucose in the digestive system,30 and vitamin B6, which helps in insulin production.31 An important goal of the present study was to investigate the effects of HIIT and SP supplementation on the ex- pression of myogenic proteins in the soleus muscle. The results showed that the expression of myogenin, MyoD1 and Pax7 increased more in the HIIT group than in other groups and the MyoD1/Pax7 ratio in all groups was lower than the CON. This increase in myogenin expres- sion is consistent with the results of some studies.8,32 ho- wever, there are others that do not show significant changes.33,34 The increase in Pax7 expression and de- crease in the MyoD1/Pax7 ratio in the intervention - 29 - Figure 1. Changes in muscle regeneration signaling proteins in the studied groups. A, Significant difference compared to the HIIT group. B, Significant difference compared to the HIIT+SP group; C, Significant difference compared to the SP group; D, Significant difference compared to the sham group. Non -co mmerc ial us e o nly High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 groups in the present study are in agreement with the re- sults of previous study,35 whereas the increase in MyoD1 expression is in line with studies using different exercise modes (e.g., HIIT, resistance, and endurance train- ing).33,36 Although the present study did not directly test for some mechanisms associated with changes in myogenic fac- tors, there are some potential changes that could be pre- sented, such as muscle damage, stimulation of growth factors, and inhibition of myostatin following HIIT, which help activate satellite cells.37,38 Moreover, exercise training has been shown to increase the expression of MRFs, especially myogenin, via the activation of the IGF-1/PI3K/Akt pathway.38 Another possible mechanism for changing satellite cells is calcium stimulation, which activates calcineurin and MEF2 signals, ultimately lead- ing to the stimulation of myogenin transcription.39 Diabetes affects protein homeostasis by causing insulin resistance, leading to disruption of protein synthesis through the PI3K/Akt pathway.40 As a result, there is an interference in insulin signaling and reduction in the transport of amino acids into muscle cells and decreases in protein synthesis.41 The results of some studies con- firm the current findings that HIIT improves glycemic status and protein synthesis in patients with diabetes via the activation of the AKT/mTOR/4EBP1 pathway.42 From a practical standpoint, it is important to note that HIIT may be adapted for different populations, including older people with obesity and diabetes, due to the diverse possibilities and variables involved in interval training.43 For example, in light of musculoskeletal limitations, cy- cling and even water activities can be used. Intensity should also be individualized; for example, for frail people, high intensity can be achieved with slow walk- ing.44 When observing this, previous studies have shown that HIIT brought higher improvements, when compared to milder activities, in health markers, glycemic control and weight management in different populations.44,45 Spe- cifically in older people, a systematic review and meta- analysis concluded that HIIT is more effective than moderate-intensity exercise in improving glucose metab- olism.46 This study had some important limitations that should be addressed. The soleus muscle is predominantly (~75%) composed of type I fibers,47 and the responses could be associated with be different in muscles with different com- positions. However, we opted for a muscle predominantly composed of type I fibers to better reflect aging, as aging in humans is associated with an increase in type 1 and a decrease in the proportion of type 2 fibers.48 Another im- portant limitation is the lack of a more robust analysis of molecular mechanisms, PCR, and histological data, which are not possible due to logistical and financial constraints. Based on the present results, we conclude that the combi- nation of HIIT and SP supplementation and/or HIIT alone could be used to manage obesity and diabetes in older people. Nevertheless, future studies can be of great help in expanding our understanding of this issue, with more robust molecular analysis involving other muscles, with different fiber type distribution. List of acronyms HIIT, high-intensity interval training CON, control SP, Spirulina MRFs, myogenic regulatory factors ROS, reactive oxygen species AKT, protein kinase B PI3K, phosphatidylinositol 3-kinase mTOR, mammalian target of rapamycin 4EBP1, eukaryotic translation initiation factor 4E-binding protein 1 MyoD1, myoblast determination protein 1 MEF2, myocyte enhancer factor 2 HOMA-IR, homeostatic model assessment for insulin re- sistance GAPDH, glyceraldehyde-3-phosphate dehydrogenase VO2max, maximal oxygen consumption Contributions of Authors Conceptualization and Supervision, RA; Writing (original draft, and formal analyses), MSA and HS; Data curation and Investigation, MSA; Methodology, Project and Ad- ministration, AHH; Resources, MSA and HS; Review & editing and Validation, PG; Visualization, PG and AHH. All the authors have read and agreed to the published ver- sion of the manuscript. Funding This study received no external funding. Conflict of Interest The authors declare no financial, personal, or other con- flicts of interest. Ethics approval This study was approved by the Research Ethics Commit- tee of Hakim Sabzevari University (code IR. HSU. REC.1400.007). The study is conformed with the Helsinki Declaration of 1964, as revised in 2013, concerning human and animal rights. Availability of data and materials All data generated or analyzed during this study are in- cluded in this published article. Corresponding author Paulo Gentil, PhD. College of Physical Education and Dance, Federal University of Goias, Goiânia, 74690-900, Brazil. Tel./Fax: +55 62 3521-1141. ORCID ID: 0000-0003-2459-497 E-mail: paulogentil@hotmail.com - 30 - Non -co mmerc ial us e o nly mailto:paulogentil@hotmail.com High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 Roya Askari: ORCID ID: 0000-0003-4331-2293 E-mail: r.askari@hsu.ac.ir Marzie Sadat Azarnive ORCID ID: 0000-0003-2655-5947 E-mail: m.azarnive@uoz.ac.ir Amir Hossein Haghighi ORCID ID: 0000-0002-7258-9737 E-mail: ah.haghighi@hsu.ac.ir Hadi Shahrabadi ORCID ID: https://orcid.org/0000-0001-8404-6927 E-mail: h.shahrabadi@gmail.com References 1. Izquierdo M, Merchant RA, Morley JE, et al. Inter- national Exercise Recommendations in Older Adults (ICFSR): Expert Consensus Guidelines. J Nutr Health Aging 2021;25:824-853. 2. Kalyani RR, Corriere M, Ferrucci L. Age-related and disease-related muscle loss: the effect of diabetes, obesity, and other diseases. Lancet Diabetes Endocri- nol 2014;2:819-29. 3. Perry BD, Caldow MK, Brennan-Speranza TC, et al. Muscle atrophy in patients with Type 2 Diabetes Mel- litus: roles of inflammatory pathways, physical activ- ity and exercise. Exerc Immunol Rev 2016;22:94-109. 4. Snijders T, Nederveen JP, Bell KE, et al. Prolonged exercise training improves the acute type II muscle fibre satellite cell response in healthy older men. J Physiol 2019;597:105-19. 5. Hernández-Hernández JM, García-González EG, Brun CE, Rudnicki MA. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin Cell Dev Biol 2017;72:10-8. 6. Stokes T, Hector AJ, Morton RW, et al. Recent per- spectives regarding the role of dietary protein for the promotion of muscle hypertrophy with resistance ex- ercise training. Nutrients 2018;10:180. 7. Arrieta-Leandro MC, Moncada-Jiménez J, Morales- Scholz MG, Hernández-Elizondo J. The effect of chronic high-intensity interval training programs on glycaemic control, aerobic resistance, and body com- position in type 2 diabetic patients: a meta-analysis. J Endocrinol Invest 2023;46:2423-43. 8. Badri Z, Delfan M, Danesh-yar S. The combined ef- fect of high-intensity interval training and metformin on gene expression of myogenin and myostatin in skeletal muscle of type 2 diabetic mice. IJDLD 2022;22:199-212. 9. Nederveen JP, Joanisse S, Séguin CM, et al. The effect of exercise mode on the acute response of satellite cells in old men. Acta Physiol (Oxf) 2015;215:177-90. 10. Hernández-Lepe MA, Manríquez-Torres JJ, Ramos- Lopez O, et al. Impact of Spirulina maxima Intake and Exercise (SIE) on metabolic and fitness parameters in sedentary older adults with excessive body mass: study protocol of a randomized controlled trial. Int J Environ Res Public Health 2021;18:1605. 11. Gómez-Téllez A, Sierra-Puente D, Muñoz-Gómez R, et al. Effects of a low-dose spirulina/turmeric supple- ment on cardiometabolic and antioxidant serum markers of patients with abdominal obesity. Front Nutr 2020;7:65. 12. Hatami E, Ghalishourani SS, Najafgholizadeh A, et al. The effect of spirulina on type 2 diabetes: a systematic review and meta-analysis. J Diabetes Metab Disord 2021;20:883-92. 13. Brito AF, Silva AS, de Oliveira CVC, et al. Spirulina platensis prevents oxidative stress and inflammation promoted by strength training in rats: dose-response relation study. Sci Rep 2020;10:6382. 14. Lu HK, Hsieh CC, Hsu JJ, et al. Preventive effects of Spirulina platensis on skeletal muscle damage under exercise-induced oxidative stress. Eur J Appl Physiol 2006;98:220-6. 15. Calella P, Cerullo G, Di Dio M, et al. Antioxidant, anti- inflammatory and immunomodulatory effects of spi- rulina in exercise and sport: A systematic review. Front Nutr 2022;9:1048258. 16. Chaouachi M, Vincent S, Groussard C. A Review of the Health-Promoting Properties of Spirulina with a Focus on athletes’ Performance and Recovery. J Diet Suppl 2024;21:210-41. 17. Hernández-Lepe MA, López-Díaz JA, Juárez-Oropeza MA, et al. Effect of arthrospira (spirulina) maxima supplementation and a systematic physical exercise program on the body composition and cardiorespi- ratory fitness of overweight or obese subjects: a dou- ble-blind, randomized, and crossover controlled trial. Mar Drugs 2018;16:364. 18. Moura LP, Gurjão AL, Jambassi Filho JC, et al. Spi- rulina, exercício e controle da glicemia em ratos dia- béticos [Spirulina, exercise and serum glucose control in diabetic rats]. Arq Bras Endocrinol Metabol 2012;56:25-32. 19. Jalali S, Jafari M. Effects of High Intensity Interval (HIT) versus continuous trainings on ABCG5 and ABCG8 genes expression in male wistar rats after high fat diet. Res Med 2019;43:216–21. 20. Bedford TG, Tipton CM, Wilson NC, et al. Maximum oxygen consumption of rats and its changes with var- ious experimental procedures. J Appl Physiol Respir Environ Exerc Physiol 1979;47:1278-83. 21. Høydal MA, Wisløff U, Kemi OJ, Ellingsen O. Run- ning speed and maximal oxygen uptake in rats and mice: practical implications for exercise training. Eur J Cardiovasc Prev Rehabil 2007;14:753-60. 22. Toti L, Bartalucci A, Ferrucci M, et al. High-intensity exercise training induces morphological and biochem- ical changes in skeletal muscles. Biol Sport 2013;30: 301-9. 23. Simon JP, Baskaran UL, Shallauddin KB, et al. Ev- idence of antidiabetic activity of Spirulina fusiformis against streptozotocin-induced diabetic Wistar albino rats. 3 Biotech 2018;8:129. 24. Shen Y, Xu X, Yue K, Xu G. Effect of different exer- - 31 - Non -co mmerc ial us e o nly mailto:r.askari@hsu.ac.ir mailto:m.azarnive@uoz.ac.ir mailto:ah.haghighi@hsu.ac.ir https://orcid.org/0000-0001-8404-6927 mailto:h.shahrabadi@gmail.com High-intensity interval training, but not Spirulina supplementation, changes muscle regeneration signaling proteins Eur J Transl Myol 34 (4) 12761, 2024 doi: 10.4081/ejtm.2024.12761 cise protocols on metabolic profiles and fatty acid me- tabolism in skeletal muscle in high-fat diet-fed rats. Obesity (Silver Spring) 2015;23:1000-6. 25. Naves JPA, Rebelo ACS, Silva LRBE, et al. Cardio- respiratory and perceptual responses of two interval training and a continuous training protocol in healthy young men. Eur J Sport Sci 2019;19:653-60. 26. Ozaki H, Loenneke JP, Thiebaud RS, Abe T. Cycle training induces muscle hypertrophy and strength gain: strategies and mechanisms. Acta Physiol Hung 2015;102:1-22. 27. Lee EH, Park JE, Choi YJ, Huh KB, Kim WY. A ran- domized study to establish the effects of spirulina in type 2 diabetes mellitus patients. Nutr Res Pract 2008;2:295-300. 28. Ghadery B, Ghazalian F, Hosseini SA, et al. Effect of high-intensity interval training with eryngium campes- tre on lipid profile and glycemic indices in high-fat diet-induced obese rats. Hormozgan Med J 2020;24: e98982. 29. Goodwin ML. Blood glucose regulation during pro- longed, submaximal, continuous exercise: a guide for clinicians. J Diabetes Sci Technol 2010;4:694-705. 30. Ambrosi MA, Reinehr CO, Bertolin TE, et al. Proprie- dades de saúde de Spirulina spp. Rev Ciênc Farm Bá- sica Apl 2008;29:109-117. 31. Karkos PD, Leong SC, Karkos CD, et al. Spirulina in clinical practice: evidence-based human applications. Evid Based Complement Alternat Med 2011;2011: 531053. 32. Azhir S, Alijani E, Martínez-Huenchullán SF, et al. Ef- fects of exercise intensity on soleus muscle myostatin and follistatin levels ofhyperglycaemic rats. Retos: nuevas tendencias en educación física, deporte y rec- reación. 2022; 889–896. 33. Mathers JL, Farnfield MM, Garnham AP, et al Early inflammatory and myogenic responses to resistance exercise in the elderly. Muscle Nerve 2012;46:407-12. 34. Drummond MJ, Bell JA, Fujita S, et al. Amino acids are necessary for the insulin-induced activation of mTOR/S6K1 signaling and protein synthesis in healthy and insulin resistant human skeletal muscle. Clin Nutr 2008;27:447-56. 35. Hyatt JP, McCall GE, Kander EM, et al. PAX3/7 ex- pression coincides with MyoD during chronic skeletal muscle overload. Muscle Nerve 2008;38:861-6. 36. Raue U, Slivka D, Jemiolo B, et al. Myogenic gene expression at rest and after a bout of resistance exer- cise in young (18-30 yr) and old (80-89 yr) women. J Appl Physiol (1985) 2006;101:53-9. 37. Biglari S, Gaeini AA, Kordi MR, Ghardashi-Afousi A. The effect of 8 weeks high-intensity interval training on myostatin and follistatin gene expression in gas- trocnemius muscle of the rats. J Arak Uni Med Sci 2018;21:1-10. 38. Zhao Y, Chen M, Lian D, et al. Non-coding RNA reg- ulates the myogenesis of skeletal muscle satellite cells, injury repair and diseases. Cells 2019;8:988. 39. Gundersen K. Excitation-transcription coupling in skeletal muscle: the molecular pathways of exercise. Biol Rev Camb Philos Soc 2011;86:564-600. 40. Krook A, Roth RA, Jiang XJ, et al. Insulin-stimulated Akt kinase activity is reduced in skeletal muscle from NIDDM subjects. Diabetes 1998;47:1281-6. 41. Callahan MJ, Parr EB, Hawley JA, Camera DM. Can high-intensity interval training promote skeletal mus- cle anabolism? Sports Med 2021;51:405-21. 42. Mao Z, Zhang W. Role of mTOR in glucose and lipid metabolism. Int J Mol Sci 2018;19:2043. 43. Morgan A, Noguchi KS, Tang A, et al. Physical and cognitive effects of high-intensity interval or circuit- based strength training for community-dwelling older adults: a systematic review. J Aging Phys Act 2023;31: 1051-74. 44. Coswig VS, Barbalho M, Raiol R, et al. Effects of high vs moderate-intensity intermittent training on func- tionality, resting heart rate and blood pressure of eld- erly women. J Transl Med 2020;18:88. 45. Gentil P, Silva LRBE, Antunes DE, et al. The effects of three different low-volume aerobic training proto- cols on cardiometabolic parameters of type 2 diabetes patients: A randomized clinical trial. Front Endocrinol (Lausanne) 2023;14:985404. 46. Portela PFM, Neto VGC, Monteiro ER, et al. HIIT is most effective than mict on glycemic control of older people with glucose metabolism impairments: A sys- tematic review and metanalysis. Prim Care Diabetes 2023;17:129-36. 47. Lynch GS, Cuffe SA, Plant DR, Gregorevic P. IGF-I treatment improves the functional properties of fast- and slow-twitch skeletal muscles from dystrophic mice. Neuromuscul Disord 2001;11:260-8. 48. Meznaric M, Eržen I, Karen P, Cvetko E. Effect of ageing on the myosin heavy chain composition of the human sternocleidomastoid muscle. Ann Anat 2018; 216:95-99. Disclaimer All claims expressed in this article are solely those of the authors and do not necessarily represent those of their af- filiated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. Submitted: 30 June 2024. Accepted: 5 August 2024. Early access: 9 October 2024. - 32 - Non -co mmerc ial us e o nly