European Journal of Translational Myology pISSN: 2037-7452 eISSN: 2037-7460 https://www.pagepressjournals.org/index.php/bam/index Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. The Early Access service lets users access peer-reviewed articles well before print / regular issue publication, significantly reducing the time it takes for critical findings to reach the research community. These articles are searchable and citable by their DOI (Digital Object Identifier). The European Journal of Translational Myology is, therefore, e-publishing PDF files of an early version of manuscripts that undergone a regular peer review and have been accepted for publication, but have not been through the typesetting, pagination and proofreading processes, which may lead to differences between this version and the final one. The final version of the manuscript will then appear on a regular issue of the journal. E-publishing of this PDF file has been approved by the authors. Eur J Transl Myol 2025 [Online ahead of print] To cite this Article: Li-dong X, Feng S, De-liang Y, et al. Antimicrobial resistance and virulence gene patterns of Staphylococcus aureus in infectious mastitis: implications for inflammatory myopathies of the lactating breast. Eur J Transl Myol doi: 10.4081/ejtm.2025.14261 ©The Author(s), 2025 Licensee PAGEPress, Italy Note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries should be directed to the corresponding author for the article. All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. Submi&ed: 18 August 2025 Accepted: 1 September 2025 Early access: 12 November 2025 https://www.pagepressjournals.org/index.php/bam/index https://www.pagepress.org/site Antimicrobial resistance and virulence gene patterns of Staphylococcus aureus in infectious mastitis: implications for inflammatory myopathies of the lactating breast Xu Li-dong, Shi Feng, Ye De-liang, Dong Li-qian, Wu Ya-ni Department of Hangzhou Linping District Maternal and Child Health Hospital, Hangzhou, China Abstract With the present work, we aimed to investigate antimicrobial resistance and virulence gene patterns of Staphylococcus aureus in lactating patients with infectious mastitis and evaluate their potential impact on inflammatory myopathies of the lactating breast. Between January 2021 and April 2024, 158 lactating patients with culture-confirmed infectious mastitis were treated at Hangzhou Linping District Maternal and Child Health Hospital. Among these, 119 isolates were identified as S. aureus (82 MRSA, 37 MSSA). Antimicrobial susceptibility and virulence genes were analyzed. Muscle involvement was inferred indirectly from clinical presentation, including marked local induration, tenderness extending to deeper breast tissue, and reduced breast mobility. No imaging or biopsy was performed to confirm myopathic changes directly. S. aureus was the predominant pathogen. Both MRSA and MSSA showed high resistance to penicillin G, erythromycin, and Clindamycin, while all isolates were susceptible to nitrofurantoin, linezolid, vancomycin, and rifampicin. MRSA exhibited higher resistance than MSSA (p<0.05). Frequent resistance genes included aac(6’)/aph(2’’), blaZ, mecA, aph(3’)-III, and qacA/B. Virulence genes hla, clfA, clfB, and fnbA were common; pvl was less frequent in MRSA (p<0.05). MRSA infections were associated with stronger local inflammation and increased clinical markers possibly related to muscle involvement, raising the possibility of an association with myopathic changes in lactating breast tissue. S. aureus, particularly MRSA, is the main pathogen in lactating mastitis. Specific virulence genes may influence the severity of local inflammation and myopathic changes, highlighting implications for inflammatory myopathies in the lactating breast. Key words: lactation; infectious mastitis; Staphylococcus aureus; antimicrobial resistance; virulence factors; myopathies; muscle inflammation. Infectious mastitis is a common condition with a high incidence among lactating women.1 It is usually caused by poor milk drainage and improper breastfeeding techniques, leading to milk stasis and subsequent infection during lactation. Clinically, patients often present with breast erythema, swelling, pain, and fever, accompanied by palpable masses and difficulty in milk expression.2,3 Pathogens may invade through erosions or wounds on the nipple, entering the subareolar lymphatic vessels and interlobular spaces, thereby causing breast cellulitis and seriously affecting breastfeeding.4,5 Staphylococcus aureus, a highly pathogenic Gram-positive bacterium, is a common causative agent of infectious mastitis in lactating women and can cause infections of the skin, soft tissues, bones, joints, and multiple organ systems. In recent years, the detection rate of Methicillin-Resistant S. aureus (MRSA) in breast milk and pus samples from lactating women has been increasing. MRSA is characterised by high levels of antimicrobial resistance and complex resistance mechanisms, which may contribute to increased infection-related mortality.6 Therefore, analysing the pathogen spectrum and antimicrobial resistance profiles in lactating patients with infectious mastitis is of great clinical significance for guiding the rational use of antibiotics. Previous studies7,8 have shown that the pathogenicity of S. aureus is closely related to the virulence genes it carries. Thus, investigating the distribution of virulence genes in MRSA and Methicillin-Susceptible S. aureus (MSSA) is essential. Based on this, the present study aimed to analyse the antimicrobial susceptibility and virulence gene profiles of S. aureus isolated from lactating patients with infectious mastitis, providing a reference for clinical diagnosis and treatment in this population, Notably, S. aureus infections are also implicated in muscle complications such as pyomyositis and inflammatory myopathies, suggesting that mastitis caused by virulent strains may have broader systemic muscular implications. The findings are presented as follows. Materials and Methods Clinical data A total of 158 lactating patients with culture-positive infectious mastitis, admitted to Hangzhou Linping District Maternal and Child Health Hospital between January 2021 and April 2024, were included in this study. Among them, Staphylococcus aureus was isolated in 119 cases, comprising 82 strains of MRSA and 37 strains of MSSA. Bilateral involvement was observed in 37 patients, and unilateral involvement in 121. Patients ranged in age from 20 to 45 years, with a mean age of (30.67 ± 2.58) years. Among them, 66 were outpatients and 92 were hospitalized. Inclusion criteria All patients met the diagnostic criteria for infectious mastitis during lactation,9 including breast pain, poor milk drainage, local masses in the mammary gland, and signs of inflammation in the affected area (increased skin temperature, redness, swelling, and tenderness). Systemic symptoms included fever, chills, generalized sweating, dizziness, and fatigue. All patients had positive pathogen cultures and no evidence of upper respiratory or other infections, fever, or pre-existing mastitis prior to lactation. Coagulation function was within the normal range. Exclusion criteria Patients were excluded if they had inflammatory breast cancer, non-lactational mastitis, untreated breast tuberculosis or other unresolved breast diseases, severe dysfunction of major organs (heart, liver, kidney), coexisting malignancies, recent use of immunosuppressants or antimicrobial agents, or a history of immunological disorders. This study was approved by the Medical Ethics Committee of our hospital. Detection of S. aureus resistance and virulence genes Colonies of S. aureus grown on sheep blood agar were selected and transferred to centrifuge tubes containing double-distilled water. After mixing, proteinase K (0.2 mg/mL) and lysostaphin (16 U/mL) were added. The mixture was incubated at 37 °C for 1 hour. Bacterial DNA was extracted using the boiling method. Briefly, a bacterial colony was transferred into 600 μL of lysis buffer, vortexed thoroughly, and boiled for 15 minutes. The sample was then cooled and centrifuged at 12,000 rpm for 10 minutes. The supernatant was collected and adjusted to a DNA concentration of 50–100 ng/μL to serve as the PCR template. Polymerase Chain Reaction (PCR) was employed to detect the expression of resistance and virulence genes in S. aureus. Primer sequences are shown in Table 1 and were designed and synthesized by GenScript Biotech (Nanjing, China). The PCR reaction mixture consisted of: 2 μL of DNA template, 1 μL each of forward and reverse primers, and 12.5 μL of 2× SYBR Premix Ex Taq; double-distilled water was added to a final volume of 25 μL. PCR conditions were as follows: initial denaturation at 94 °C for 5 minutes; 40 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds, and extension at 72 °C for 1 minute; followed by a final extension at 72 °C for 10 minutes. Distilled water served as the negative control, and target gene DNA fragments were used as positive controls. PCR products were subjected to 2% agarose gel electrophoresis and visualized using a gel documentation system. Pathogen detection and antimicrobial susceptibility testing In patients with suspected infection, breast milk or pus from the lactiferous ducts was collected prior to antimicrobial treatment after cleaning the nipple and surrounding skin. For patients with breast abscesses, puncture fluid or discharge from ruptured lesions was collected as the specimen. All samples were inoculated onto sheep blood agar and incubated at 37 °C for 24–48 hours. Bacterial identification was performed using a fully automated microbial identification system (VITEK-32, bioMérieux, France). Specimen collection and strain identification were conducted according to relevant standard operating procedures.10 Pathogens were identified based on colony morphology, Gram staining, biochemical characteristics, and other features. Duplicate isolates from the same patient were excluded. Antimicrobial susceptibility testing was performed using the disk diffusion method (OXOID, UK), and interpretative criteria were based on relevant references.11 MRSA was defined as isolates with an oxacillin Minimum Inhibitory Concentration (MIC) ≥ 4 mg/L. Colonising strains and contaminants were excluded. Quality control strains were obtained from the ATCC culture collection, including S. aureus ATCC 25923, Klebsiella pneumoniae ATCC 700603, and Escherichia coli ATCC 25922. Statistical analysis A p-value < 0.05 was considered statistically significant. Statistical analyses were conducted using SPSS version 26.0. Categorical variables were expressed as n (%) and compared using the chi- square test. Continuous variables were expressed as mean ± standard deviation (x̄ ± s), and between-group comparisons were performed using the independent samples t-test. Normality was assessed by the Shapiro-Wilk test. Results Detection of pathogenic bacteria in infectious mastitis during lactation A total of 158 pathogenic strains were isolated from 158 lactating patients with infectious mastitis. The majority were Gram-positive bacteria. Staphylococcus aureus was detected in 119 cases, accounting for the highest proportion (Table 2). Detection of drug resistance genes in S. aureus Among the 119 S. aureus isolates, the most frequently detected resistance genes were aac(6′)/aph(2″), blaZ, mecA, aph(3′)-III, and qacA/B, with detection rates of 100.00%, 100.00%, 100.00%, 94.96%, and 84.87%, respectively (Table 3). Antimicrobial resistance in MRSA and MSSA Both MRSA and MSSA strains showed high resistance to penicillin G, erythromycin, and Clindamycin, while remaining susceptible to nitrofurantoin, linezolid, vancomycin, and rifampicin. Compared with MSSA, MRSA showed significantly higher resistance rates to Penicillin G, Erythromycin, Clindamycin, and Tetracycline (p<0.05) (Table 4). Detection of virulence genes in MRSA and MSSA Virulence genes hla, clfB, clfA, and fnbA were commonly detected in both MRSA and MSSA isolates. The detection rate of pvl was significantly lower in MRSA compared with MSSA (p<0.05). No statistically significant differences were observed for the other virulence genes (p>0.05). Table 5. Detection of virulence genes in MRSA and MSSA [n (%)]. To provide a concise overview, the main resistance and virulence patterns are summarized in Table 6. Discussion Infectious mastitis during lactation is often caused by milk stasis resulting from inadequate milk drainage. The condition is closely associated with pathogen invasion, as microorganisms can directly enter the lactiferous ducts and ascend to the lobules where they proliferate. Additionally, the decomposition products of milk can serve as a nutrient medium for bacterial growth, which further facilitates infection.12,13 Clinically, infectious mastitis in lactating women is characterized by local signs of inflammation such as redness, swelling, heat, and pain, and it can significantly impair breastfeeding, maternal well-being, and infant nutrition and health.14,15 The main pathogen involved is Staphylococcus aureus, which often carries multiple virulence genes and exhibits strong pathogenicity. Inadequate or delayed treatment may result in recurrence and pose serious health risks to both mother and infant.16,17 Although a wide range of antibiotics is available for the treatment of infectious mastitis, the frequent use of broad-spectrum agents has led to increasing antimicrobial resistance. Therefore, understanding the distribution and resistance profiles of causative bacteria is essential for guiding rational antibiotic use in clinical practice. This study investigated the antimicrobial susceptibility and virulence gene characteristics of S. aureus in lactating patients with infectious mastitis and yielded several important findings. Among the 158 strains isolated, Gram-positive bacteria were predominant, consistent with previous studies.181,9 Based on susceptibility testing, targeted antimicrobial therapy may be applied. We further found that S. aureus was isolated in 119 cases, with MRSA and MSSA both showing high resistance to penicillin G, erythromycin, and clindamycin, while remaining susceptible to nitrofurantoin, linezolid, vancomycin, and rifampicin. MRSA demonstrated significantly higher resistance rates to penicillin G, erythromycin, clindamycin, and tetracycline compared with MSSA. These findings suggest that clinicians should avoid the use of agents with high resistance rates— such as penicillin G, erythromycin, clindamycin, and tetracycline—when treating MRSA-related mastitis. Instead, antibiotics with higher susceptibility rates, including nitrofurantoin, linezolid, vancomycin, and rifampicin, may be more appropriate. The elevated resistance could be related to increased and repeated exposure to antimicrobials, resulting in structural changes in pathogens and altered drug susceptibility. It should also be noted that certain antibiotics may be secreted into breast milk, and breastfeeding should be suspended during treatment when necessary. The pathogenicity of S. aureus is determined by its virulence factors, which play roles in colonization, invasion, and proliferation. Multiple virulence factors act in concert and are closely associated with the development of infectious mastitis during lactation.20,21 Previous studies22 have shown that important virulence genes of S. aureus include those encoding enterotoxins, hemolysins, exfoliative toxins, leukocidins, and toxic shock syndrome toxin. Among these, Panton–Valentine Leukocidin (PVL) is an extracellular toxin capable of disrupting cell membranes, leading to cell lysis and more severe infections.23 The hla gene encodes alpha-hemolysin, which induces hemolysis by inserting into the hydrophobic membrane of red blood cells and forming pores.24 The clfB gene, part of the clumping factor adhesin family, is critical for S. aureus colonization and infection, particularly in lactating women. ClfA, another clumping factor, is a surface-associated protein that mediates bacterial adherence to host extracellular matrix.25 FnbA encodes fibronectin-binding protein A, which promotes adhesion to fibronectin on host cells, facilitating tissue invasion.26 Our results showed high detection rates of hla, clfB, clfA, and fnbA in both MRSA and MSSA isolates. Interestingly, the detection rate of pvl was significantly lower in MRSA than in MSSA. This suggests that S. aureus strains causing infectious mastitis in lactating women often carry multiple virulence genes with strong pathogenic potential. The lower detection of pvl in MRSA may be attributed to the lysogenic conversion mechanism in MSSA via bacteriophage transduction, which enhances pvl expression and enables horizontal gene transfer among different strains. Therefore, greater attention should be paid to the presence of pvl in MSSA isolates. Resistance genes such as aac(6′)/aph(2″) and aph(3′)-III are aminoglycoside resistance determinants. blaZ is associated with penicillin resistance. The mecA gene encodes Penicillin- Binding Protein 2a (PBP2a), an alternative form of the native penicillin-binding protein in S. aureus. The qacA/B genes encode efflux pump proteins that confer resistance to antiseptics and disinfectants, including quaternary ammonium compounds, guanidine derivatives, and biguanides. In this study, the most frequently detected resistance genes in S. aureus were aac(6′)/aph(2″), blaZ, mecA, aph(3′)-III, and qacA/B, indicating that these genes are common in S. aureus strains isolated from lactating women with infectious mastitis. Although the presence of resistance genes does not always correspond directly to phenotypic resistance, it is likely influenced by the combined effects of multiple genes. This study has several limitations, including a relatively small sample size and its single-center design, which may introduce bias and limit the generalizability of the findings. Despite these limitations, the study provides valuable insights into the antimicrobial susceptibility and virulence gene characteristics of S. aureus in lactating women with infectious mastitis. Future research with a larger and more diverse patient population is warranted to validate and extend these findings. In conclusion, most pathogens isolated from lactating women with infectious mastitis were Gram- positive bacteria, with S. aureus being the most prevalent. MRSA exhibited higher resistance rates to penicillin G, erythromycin, clindamycin, and tetracycline than MSSA. The most frequently detected resistance genes included aac(6′)/aph(2″), blaZ, mecA, aph(3′)-III, and qacA/B. The pvl virulence gene was less frequently detected in MRSA than in MSSA. These findings may help guide targeted clinical management strategies to reduce the risk and progression of infectious mastitis during lactation. As presented in Table 6, there was a marked resistance to penicillin G, erythromycin, and clindamycin, however, Vancomycin and rifampicin continued to be effective. hla, clfB, and clfA were virulence genes that were common and pvl was more common in MSSA. These patterns directly impact clinical management. Our findings raise the possibility of muscular complications in severe S. aureus mastitis, although this link remains speculative. Certain virulence factors such as α-hemolysin and pvl have been implicated in tissue invasion and muscle injury in previous studies, but direct evidence from our cohort is lacking. Future investigations using muscle imaging, cytokine profiling, or biopsy samples are needed to confirm whether mastitis-related inflammation can contribute to secondary myopathic changes. Clinical implications Our results are important for the treatment of lactational mastitis. Both MRSA and MSSA strains showed significant resistance to penicillin G, erythromycin, clindamycin, and tetracycline, indicating empirical treatment with these antibiotics is inappropriate. This is in line with more recent evidence showing the global ineffectiveness of macrolides and tetracyclines for MRSA.27-29 On the other hand, all isolates were fully susceptible to vancomycin, rifampicin, linezolid, and nitrofurantoin, suggesting these antibiotics remain valid treatment options. Vancomycin is crucial for severe or treatment-resistant cases, and linezolid, although reserved for less severe cases, provides oral therapy and good tissue penetration.30,31 While nitrofurantoin is rarely employed for mastitis, its reliable antibiotic action might make it useful in select cases. Additionally, virulence gene profiling may help determine the severity of the infection. The presence of pvl or hla is associated with severe inflammation and tissue necrosis.30,32 Therefore, the clinician’s awareness that strains with these virulence factors mastitis necessitate enhanced surveillance and, in some cases, more intensive treatment adjustments is important. This is consistent with emerging literature on pyomyositis and infectious myopathies, where S. aureus virulence determinants are key drivers of muscle injury.33 From a translational standpoint, incorporating antimicrobial resistance data and virulence profiling into clinical decision-making may help optimize antibiotic selection, anticipate complications, and reduce recurrence rates. Future clinical guidelines should consider integrating such microbiological insights into standard mastitis management protocols. Potential confounding factors, such as prior antibiotic exposure or breastfeeding practices, were not controlled in this analysis. This may have influenced resistance rates and clinical outcomes. Given that this was a single-center study with a relatively small cohort, the results may not be completely generalizable. Patterns of resistance are shaped by local antibiotic prescribing habits as well as local infectious disease trends. For this reason, the results should be applied with caution when considering populations beyond the scope of our study region. List of Abbreviations MRSA – Methicillin-Resistant Staphylococcus aureus MSSA – Methicillin-Susceptible Staphylococcus aureus PCR – Polymerase Chain Reaction MIC – Minimum Inhibitory Concentration PVL – Panton–Valentine Leukocidin hla – Alpha-Hemolysin gene clfA – Clumping Factor A gene clfB – Clumping Factor B gene fnbA – Fibronectin-Binding Protein A gene aac(6’)/aph(2”) – Aminoglycoside Resistance Gene blaZ – Beta-Lactamase Gene mecA – Methicillin Resistance Gene aph(3’)-III – Aminoglycoside Resistance Gene qacA/B – Quaternary Ammonium Compound Resistance Genes SPSS – Statistical Package for the Social Sciences Corresponding Author Xu Li-dong, Hangzhou Linping District Maternal and Child Health Hospital, Hangzhou 311199, China. E-mail: 13093707107@163.com Shi Feng： Email： 935778135@qq.com Ye De-liang： Email： 497282831@qq.com DongLi-qian: Email： 422958527@qq.com WuYa-ni: Email： 349096368@qq.com ORCID: Shi Feng: 0009 0009 4811 4545 Ye Deliang: 0009 0006 0267 5417 Dong Liqian: 0009 0000 5908 4753 Wu Yan Ni: 0009 0002 9872 2046 Xu Lidong: 0009 0003 5573 4626 Funding Project No. 2024KY277, Zhejiang Provincial Health and Medical Science and Technology Project. Conflict of interest The authors declare no potential conflict of interest, and all authors confirm accuracy. Ethics approval This study was approved by the Medical Ethics Committee of Hangzhou Linping District Maternal and Child Health Hospital. mailto:13093707107@163.com mailto:935778135@qq.com mailto:497282831@qq.com mailto:422958527@qq.com mailto:349096368@qq.com Informed consent All patients participating in this study signed a written informed consent form for participating in this study. Patient consent for publication Written informed consent was obtained from a legally authorized representative(s) for anonymized patient information to be published in this article. Availability of data and materials All data generated or analyzed during this study are included in this published article. References 1. Tobore TO. On maternal Post-Partum/Natal depression. A global underrecognized problem and the need for better treatment strategies. Psychiatry Res 2020;290:160-3. 2. Rodriguez Z, Cabrera VE, Hogeveen H, et al. Economic impact of subclinical mastitis treatment in early lactation using intramammary nisin. J Dairy Sci 2024;107:4634-45. 3. Hussein Hany A, Fouad A, Mohammed T, et al. Study on prevalence and bacterial etiology of mastitis, and effects of subclinical mastitis and stage of lactation on SCC in dairy goats in Egypt. Trop Anim Health Pro 2020;52:46-9. 4. Mitchell KB, Johnson HM, Rodriguez JM, et al. Academy of Breastfeeding Medicine clinical protocol #36: the mastitis spectrum, revised 2022. Breastfeed Med 2022;17:360-76. 5. Olga L, Vervoort J, Van Diepen JA, et al. Associations between breastmilk intake volume, macronutrient intake and infant growth in a longitudinal birth cohort: the Cambridge Baby Growth and Breastfeeding Study (CBGS-BF). Br J Nutr 2023;30:56-64. 6. Rimoldi SG, Pileri P, Mazz I, et al. The role of Staphylococcus aureus in mastitis: a multidisciplinary working group experience. J Hum Lact 2020;36:503-9. 7. Li Y, Zhu F, Manna AC, et al. Gp05, a prophage-encoded virulence factor, contributes to persistent methicillin-resistant Staphylococcus aureus endovascular infection. Microb Spect 2023;11:39-42. 8. Imanishi I, Nicolas A, Caetano ACB, et al. Author Correction: Exfoliative toxin E, a new Staphylococcus aureus virulence factor with host-specific activity. Sci Rep 2020;10:21-4. 9. Wang Q, Ning P, Ma XJ, et al. Chinese clinical guidelines for the diagnosis and treatment of lactational mastitis. Chinese J Breast Dis 2020;14:10-4. 10. Medical Administration of the Ministry of Health of the People's Republic of China. National Clinical Laboratory Procedures. 3rd ed. Nanjing: Southeast University Press, 2006:126-37. 11. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing; Fifteenth informational supplement. CLSI document M100-S15. CLSI, 2005;25:1-167. 12. Lai BY, Yu BW, Chu A, et al. Risk factors for lactation mastitis in China: a systematic review and meta-analysis. PLoS One 2021;16:179-82. 13. Aziz TA, Lafta IJ. Developing multiplex POR for the rapid and simultaneous detection of Staphylococcus aureus, Pseudomonas aeruginosa and Klebsiella pneumoniae associated with sheep respiratory tract infections. Biologia 2022;77:1415-21. 14. Surana K, Sagrule D, Lanjewar S, et al. Primary closure with suction drain of acute breast abscess after incision, drainage, and curettage. Indian J Surg 2020;82:129-33. 15. Chao YK, Yang YQ, Han B, et al. Fecal microbiome transplant from patients with lactation mastitis promotes mastitis in conventional lactating mice. Front Microbiol 2023;3:12-4. 16. McDougall S, Clausen LM, Hussein HM, et al. Therapy of subclinical mastitis during lactation. Antibiotics 2022;11:3-7. 17. Yakovenko O, Yakovenko T, Akimov V, et al. Role of mini-invasive surgery in treatment of lactation mastitis. Surgical Practice 2021;3:73-6. 18. Wang LB, Yang L, Qu L, et al. Pathogen distribution and antibiotic resistance of acute lactational mastitis. Chinese J Maternal Child Health Res 2020;31:1030-4. 19. Zhu MH, Zhang YY, Zheng L, et al. Pathogen distribution and antibiotic resistance of pus specimens in lactational mastitis patients. Chinese J Health Laboratory Technol 2020;30:16- 8. 20. Deepashree R, Khanum S, Sujatha SR, et al. Methicillin-Resistant Staphylococcus aureus (MRSA) carriage among healthcare personnel in non-outbreak settings in a tertiary care hospital in Mysore. Am J Infect Control 2021;49:1499-502. 21. Li Y, Ma XJ, He XP, et al. Clinical characteristics of lactational breast abscess caused by methicillin-resistant Staphylococcus aureus: a hospital-based study in China. Int Breastfeed J 2021;16:77-80. 22. Bojer MS, Frees D, Ingmer H, et al. SrrA in Staphylococci: an addition to the paradigm of membrane-localized, SOS-induced cell division inhibition in bacteria. Curr Genet 2020;66:495-9. 23. Da JY, Song Q, Shi JL, et al. Antimicrobial resistance and virulence gene detection of Staphylococcus aureus isolated from cows in Yinchuan. Progress Veterinary Med 2023;44:33-40. 24. Sobhy M, Ali SS, Khalil MA, et al. Exploring the potential of zinc oxide nanoparticles against pathogenic multidrug-resistant Staphylococcus aureus from ready-to-eat meat and its proposed mechanism. Food Control 2024;4:153-6. 25. Jia J, Ji YY, Gao S, et al. Investigation of virulence genes, agr typing, and biofilm formation of Staphylococcus aureus causing bloodstream infections. J Clin Lab 2023;41:117-22. 26. Olia AHG, Ghahremani M, Sharifi Y, et al. Comparison of biofilm production and virulence gene distribution among community- and hospital-acquired Staphylococcus aureus isolates from northwestern Iran. Infection 2020;62:957-61. 27. Crum NF. Bacterial pyomyositis in the United States. Am J Med 2004;117:420-8. 28. Chiedozi LC. Pyomyositis: review of 205 cases in 112 patients. Am J Surgery 1979;137:255-9. 29. Touaitia R, Mairi A, Ibrahim NA, et al. Staphylococcus aureus: a review of the pathogenesis and virulence mechanisms. Antibiotics 2025;14:470. 30. Di Bella S, Marini B, Stroffolini G, et al. The virulence toolkit of Staphylococcus aureus: a comprehensive review of toxin diversity, molecular mechanisms, and clinical implications. Eur J Clin Microbiol Infect Dis 2025;44:1797816. 31. Lee AS, De Lencastre H, Garau J, et al. Methicillin-resistant Staphylococcus aureus. Nature Rev Dis Primers 2018;4:1-23. 32. Cruz AR, Van Strijp JA, Bagnoli F, Manetti AG. Virulence gene expression of Staphylococcus aureus in human skin. Front Microbiol 2021;12:692023. 33. Radcliffe C, Gisriel S, Niu YS, et al. Pyomyositis and infectious myositis: a comprehensive, single-center retrospective study. Open Forum Infect Dis 2021;8:ofab098. Table 1. Primer sequences used for resistance and virulence gene detection in S. aureus. Gene Forward primer (5′–3′) Reverse primer (5′–3′) Prod uct size (bp) aac(6′)/aph (2″) GTAGAAATGACTGAACGTCCGA TAA CCAATTCCACATTCTTTCGG TCTAA 310 blaZ ATCATTAGGTAAAATGTCTGGAC ATGATCCA GCATCAAGTGTATTGGATAG CAAAAGC 433 mecA GTGAAGATATACCAAGTGATT ATGCGCTATAGATTGAAAGG AT 147 aph(3′)-III CTGATTACTATCCAAGAAATTCG ATTG CTTTCCAGCCTACTTTTTTAT CAGT 209 qacA/B ATTGGCGTGGCTTCAGTGCT CGTTTCTTCCGTAGTTGCATT TG 292 ermA GTTCAAGAACAATCACAGAG GGATCAGGAAAAGGACATT TTAC 533 tetM ATGACAGAATACTTATTAAGTGC TGGC TGTATCAACCAATAATAGTC TGAATGT 360 ermB GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG 102 ermC GAAGATCTATCACAAGATGAAA TA ATGGATTTCACTGGTGTTAT TACA 210 msrB GCGTCAAAATAATTCCAAGG CAATCTGTCCAATCAAGCGA G 567 tetK ATGGAAATACAACAAACACAC CTGCTTGAATGCGCCAAAC 258 tetL CAATCTGTCCAATCAAGCGAG GCGTCAAAATAATTCCAAGG 642 linA CGCGGAAAGGAACGGGTTTT TTAGCGTCTAGCGTTCTGCC 519 msrA AATACACCAACGCCTCCAAG TTGTTGCCGCTTTTGCTCTC 400 hla AGTTTATAGCGAAGAAGG AGTTTATAGCGAAGAAGG 447 clfB GTTATGGTGGTGGAAGTGCTG CGCTCTTATCTCCTGTTTCTG G 1041 clfA ATGGGACAACGAAGTAGCA GCTTCATCTTCAGAACCTG 1149 fnbA TAGGAACTGAAAATGGTCAC GAAGCAATCAGAAAACACT C 1027 hlb GCCAAAGCCGAATCTAAG GCGATATACATCCCATGGC 834 fnbB TAGGAACTGAAAATGGTCAC GAGTATGTAATTATTTCTTG G 973 pvl ATCATTAGGTAAAATGTCTGGAC ATGATCCA GCATCAAGTGTATTGGATAG CAAAAGC 433 seh CAACTGCTGATTTAGCTCAG GTCGAATGAGTAATCTCTAG G 359 sec CTTGTATGTATGGAGGAATAAC AA TGCAGGCATCATATCATACC A 284 Table 2. Detection of pathogenic bacteria in infectious mastitis during lactation. Pathogen Number of isolates Proportion (%) Gram-negative bacteria 12 7.59 Escherichia coli 4 2.53 Enterobacter cloacae 4 2.53 Pseudomonas aeruginosa 3 1.90 Klebsiella pneumoniae 1 0.63 Gram-positive bacteria 146 89.87 Staphylococcus aureus – MRSA 82 51.90 Staphylococcus aureus – MSSA 37 23.42 Staphylococcus epidermidis 9 5.70 Enterococcus faecalis 8 5.06 Streptococcus agalactiae 6 3.80 Staphylococcus haemolyticus 4 2.53 Total 158 100.00 Table 3. Detection of resistance genes in S. aureus. Resistance gene Positive isolates (n) Detection rate (%) aac(6′)/aph(2″) 119 100.00 blaZ 119 100.00 mecA 119 100.00 aph(3′)-III 113 94.96 qacA/B 101 84.87 ermA 60 50.42 tetM 54 45.38 ermB 30 25.21 ermC 30 25.21 msrB 26 21.85 tetK 24 20.17 tetL 12 10.08 linA 6 5.04 msrA 6 5.04 Table 4. Antimicrobial resistance in MRSA and MSSA. Antimicrobial agent MRSA MSSA No. tested No. resis tant Resistanc e rate (%) No. teste d No. resis tant Resistance rate (%) Nitrofurantoin 82 2 2.44 37 0 0.00 Gentamicin 82 4 4.88 37 2 5.41 Levofloxacin 82 7 8.54 37 2 5.41 Ciprofloxacin 82 7 8.54 37 3 8.11 Penicillin G 82 75 91.46a 37 29 78.38 Erythromycin 82 54 65.85a 37 17 45.95 Linezolid 82 0 0.00 37 0 0.00 Vancomycin 82 0 0.00 37 0 0.00 Clindamycin 82 54 65.85a 37 17 45.95 Rifampicin 82 0 0.00 37 0 0.00 Tetracycline 82 41 50.00a 37 2 5.41 *p=0.034, (p<0.05) compared with MSSA group Table 5. MRSA and MSSA virulence gene carrying status [n(%)]. Virulence gene MRSA MSSA Total Number of isolates (n = 82) / Detection rate (%) Number of isolates (n = 37) / Detection rate (%) Hla 81(98.78) 35(94.59) 116(97.48) ClfB 80(97.56) 35(94.59) 115(96.64) ClfA 53(64.63) 28(75.68) 81(68.07) FnbA 56(68.29) 24(64.86) 80(67.23) Hlb 35(42.68) 14(37.84) 49(41.18) FnbB 32(39.02) 13(35.14) 45(37.82) PVL 29(35.37)a 21(56.76) 50(42.02) seh 11(13.41) 3(8.11) 14(11.76) Sec 6(7.32) 3(8.11) 9(7.56) *p=0.034, (p<0.05) compared with MSSA group Table 6. Summary of major resistance and virulence profiles of S. aureus in infectious mastitis. Category Key Findings Clinical Implication High resistance (>60%) Penicillin G (MRSA 91.5%, MSSA 78.4%), Erythromycin (MRSA 65.8%, MSSA 46.0%), Clindamycin (MRSA 65.8%, MSSA 46.0%) Avoid use in empirical therapy Low resistance (<10%) Nitrofurantoin, Linezolid, Vancomycin, Rifampicin Remain effective treatment options Common virulence genes (>90%) hla, clfB, clfA, fnbA Associated with strong pathogenicity Differential virulence pvl lower in MRSA (35.4%) vs MSSA (56.8%) May affect severity and muscle involvement