id	sid	tid	token	lemma	pos
finefocus-3320	1	1	54	54	NUM
finefocus-3320	1	2	|	|	ADV
finefocus-3320	1	3	fine	fine	ADJ
finefocus-3320	1	4	focus	focus	VERB
finefocus-3320	1	5	the	the	DET
finefocus-3320	1	6	prevalence	prevalence	NOUN
finefocus-3320	1	7	and	and	CCONJ
finefocus-3320	1	8	identification	identification	NOUN
finefocus-3320	1	9	of	of	ADP
finefocus-3320	1	10	multidrug	multidrug	NOUN
finefocus-3320	1	11	-	-	PUNCT
finefocus-3320	1	12	resistant	resistant	ADJ
finefocus-3320	1	13	bacteria	bacteria	NOUN
finefocus-3320	1	14	in	in	ADP
finefocus-3320	1	15	adjacent	adjacent	ADJ
finefocus-3320	1	16	ecological	ecological	ADJ
finefocus-3320	1	17	systems	system	NOUN
finefocus-3320	1	18	in	in	ADP
finefocus-3320	1	19	the	the	DET
finefocus-3320	1	20	hocking	hocking	PROPN
finefocus-3320	1	21	hills	hills	PROPN
finefocus-3320	1	22	region	region	NOUN
finefocus-3320	1	23	of	of	ADP
finefocus-3320	1	24	appalachia	appalachia	PROPN
finefocus-3320	1	25	orion	orion	PROPN
finefocus-3320	1	26	d.	d.	PROPN
finefocus-3320	1	27	brock	brock	PROPN
finefocus-3320	1	28	and	and	CCONJ
finefocus-3320	1	29	jennifer	jennifer	PROPN
finefocus-3320	1	30	r.	r.	PROPN
finefocus-3320	1	31	larson	larson	PROPN
finefocus-3320	1	32	orion	orion	PROPN
finefocus-3320	1	33	d.	d.	PROPN
finefocus-3320	1	34	brock	brock	PROPN
finefocus-3320	1	35	(	(	PUNCT
finefocus-3320	1	36	obrock@capital.edu)1	obrock@capital.edu)1	PROPN
finefocus-3320	1	37	,	,	PUNCT
finefocus-3320	1	38	jennifer	jennifer	PROPN
finefocus-3320	1	39	r.	r.	PROPN
finefocus-3320	1	40	larson	larson	PROPN
finefocus-3320	1	41	(	(	PUNCT
finefocus-3320	1	42	jlarson2@capital.edu)1	jlarson2@capital.edu)1	PROPN
finefocus-3320	1	43	*	*	PROPN
finefocus-3320	1	44	1department	1department	NUM
finefocus-3320	1	45	of	of	ADP
finefocus-3320	1	46	biological	biological	ADJ
finefocus-3320	1	47	and	and	CCONJ
finefocus-3320	1	48	environmental	environmental	ADJ
finefocus-3320	1	49	sciences	science	NOUN
finefocus-3320	1	50	,	,	PUNCT
finefocus-3320	1	51	capital	capital	NOUN
finefocus-3320	1	52	university	university	PROPN
finefocus-3320	1	53	,	,	PUNCT
finefocus-3320	1	54	columbus	columbus	PROPN
finefocus-3320	1	55	,	,	PUNCT
finefocus-3320	1	56	ohio	ohio	PROPN
finefocus-3320	1	57	,	,	PUNCT
finefocus-3320	1	58	usa	usa	PROPN
finefocus-3320	1	59	*	*	PUNCT
finefocus-3320	1	60	corresponding	correspond	VERB
finefocus-3320	1	61	author	author	NOUN
finefocus-3320	1	62	:	:	PUNCT
finefocus-3320	1	63	capital	capital	PROPN
finefocus-3320	1	64	university	university	NOUN
finefocus-3320	1	65	,	,	PUNCT
finefocus-3320	1	66	1	1	NUM
finefocus-3320	1	67	college	college	NOUN
finefocus-3320	1	68	and	and	CCONJ
finefocus-3320	1	69	main	main	ADJ
finefocus-3320	1	70	,	,	PUNCT
finefocus-3320	1	71	columbus	columbus	NOUN
finefocus-3320	1	72	,	,	PUNCT
finefocus-3320	1	73	oh	oh	INTJ
finefocus-3320	1	74	.	.	PUNCT
finefocus-3320	1	75	43209	43209	NUM
finefocus-3320	2	1	manuscript	manuscript	NOUN
finefocus-3320	2	2	received	receive	VERB
finefocus-3320	2	3	12	12	NUM
finefocus-3320	2	4	september	september	PROPN
finefocus-3320	2	5	2019	2019	NUM
finefocus-3320	2	6	;	;	PUNCT
finefocus-3320	2	7	accepted	accept	VERB
finefocus-3320	2	8	16	16	NUM
finefocus-3320	2	9	december	december	PROPN
finefocus-3320	2	10	2019	2019	NUM
finefocus-3320	2	11	.	.	PUNCT
finefocus-3320	3	1	volume	volume	NOUN
finefocus-3320	3	2	six	six	NUM
finefocus-3320	4	1	|	|	ADV
finefocus-3320	4	2	55	55	NUM
finefocus-3320	4	3	abstract	abstract	ADJ
finefocus-3320	4	4	multidrug	multidrug	NOUN
finefocus-3320	4	5	resistance	resistance	NOUN
finefocus-3320	4	6	in	in	ADP
finefocus-3320	4	7	clinical	clinical	ADJ
finefocus-3320	4	8	settings	setting	NOUN
finefocus-3320	4	9	is	be	AUX
finefocus-3320	4	10	a	a	DET
finefocus-3320	4	11	major	major	ADJ
finefocus-3320	4	12	threat	threat	NOUN
finefocus-3320	4	13	to	to	ADP
finefocus-3320	4	14	human	human	ADJ
finefocus-3320	4	15	health	health	NOUN
finefocus-3320	4	16	,	,	PUNCT
finefocus-3320	4	17	but	but	CCONJ
finefocus-3320	4	18	very	very	ADV
finefocus-3320	4	19	little	little	ADJ
finefocus-3320	4	20	is	be	AUX
finefocus-3320	4	21	known	know	VERB
finefocus-3320	4	22	regarding	regard	VERB
finefocus-3320	4	23	the	the	DET
finefocus-3320	4	24	prevalence	prevalence	NOUN
finefocus-3320	4	25	of	of	ADP
finefocus-3320	4	26	multidrug	multidrug	NOUN
finefocus-3320	4	27	-	-	PUNCT
finefocus-3320	4	28	resistant	resistant	ADJ
finefocus-3320	4	29	organisms	organism	NOUN
finefocus-3320	4	30	in	in	ADP
finefocus-3320	4	31	the	the	DET
finefocus-3320	4	32	natural	natural	ADJ
finefocus-3320	4	33	environment	environment	NOUN
finefocus-3320	4	34	.	.	PUNCT
finefocus-3320	5	1	studying	study	VERB
finefocus-3320	5	2	antibiotic	antibiotic	ADJ
finefocus-3320	5	3	resistance	resistance	NOUN
finefocus-3320	5	4	in	in	ADP
finefocus-3320	5	5	the	the	DET
finefocus-3320	5	6	environment	environment	NOUN
finefocus-3320	5	7	is	be	AUX
finefocus-3320	5	8	important	important	ADJ
finefocus-3320	5	9	for	for	ADP
finefocus-3320	5	10	understanding	understand	VERB
finefocus-3320	5	11	the	the	DET
finefocus-3320	5	12	transfer	transfer	NOUN
finefocus-3320	5	13	of	of	ADP
finefocus-3320	5	14	resistance	resistance	NOUN
finefocus-3320	5	15	between	between	ADP
finefocus-3320	5	16	environmental	environmental	ADJ
finefocus-3320	5	17	microorganisms	microorganism	NOUN
finefocus-3320	5	18	and	and	CCONJ
finefocus-3320	5	19	those	those	PRON
finefocus-3320	5	20	found	find	VERB
finefocus-3320	5	21	in	in	ADP
finefocus-3320	5	22	healthcare	healthcare	NOUN
finefocus-3320	5	23	settings	setting	NOUN
finefocus-3320	5	24	.	.	PUNCT
finefocus-3320	6	1	in	in	ADP
finefocus-3320	6	2	this	this	DET
finefocus-3320	6	3	study	study	NOUN
finefocus-3320	6	4	,	,	PUNCT
finefocus-3320	6	5	soil	soil	NOUN
finefocus-3320	6	6	samples	sample	NOUN
finefocus-3320	6	7	from	from	ADP
finefocus-3320	6	8	seven	seven	NUM
finefocus-3320	6	9	adjacent	adjacent	ADJ
finefocus-3320	6	10	ecological	ecological	ADJ
finefocus-3320	6	11	zones	zone	NOUN
finefocus-3320	6	12	were	be	AUX
finefocus-3320	6	13	evaluated	evaluate	VERB
finefocus-3320	6	14	to	to	PART
finefocus-3320	6	15	determine	determine	VERB
finefocus-3320	6	16	if	if	SCONJ
finefocus-3320	6	17	there	there	PRON
finefocus-3320	6	18	were	be	VERB
finefocus-3320	6	19	differences	difference	NOUN
finefocus-3320	6	20	in	in	ADP
finefocus-3320	6	21	the	the	DET
finefocus-3320	6	22	amount	amount	NOUN
finefocus-3320	6	23	and	and	CCONJ
finefocus-3320	6	24	types	type	NOUN
finefocus-3320	6	25	of	of	ADP
finefocus-3320	6	26	antibiotic	antibiotic	ADJ
finefocus-3320	6	27	-	-	PUNCT
finefocus-3320	6	28	resistant	resistant	ADJ
finefocus-3320	6	29	bacteria	bacteria	NOUN
finefocus-3320	6	30	present	present	ADJ
finefocus-3320	6	31	.	.	PUNCT
finefocus-3320	7	1	we	we	PRON
finefocus-3320	7	2	hypothesized	hypothesize	VERB
finefocus-3320	7	3	that	that	SCONJ
finefocus-3320	7	4	we	we	PRON
finefocus-3320	7	5	would	would	AUX
finefocus-3320	7	6	find	find	VERB
finefocus-3320	7	7	antibiotic	antibiotic	ADJ
finefocus-3320	7	8	-	-	PUNCT
finefocus-3320	7	9	resistant	resistant	ADJ
finefocus-3320	7	10	bacteria	bacteria	NOUN
finefocus-3320	7	11	in	in	ADP
finefocus-3320	7	12	all	all	DET
finefocus-3320	7	13	ecological	ecological	ADJ
finefocus-3320	7	14	zones	zone	NOUN
finefocus-3320	7	15	studied	study	VERB
finefocus-3320	7	16	and	and	CCONJ
finefocus-3320	7	17	that	that	SCONJ
finefocus-3320	7	18	these	these	DET
finefocus-3320	7	19	bacteria	bacteria	NOUN
finefocus-3320	7	20	would	would	AUX
finefocus-3320	7	21	be	be	AUX
finefocus-3320	7	22	unique	unique	ADJ
finefocus-3320	7	23	to	to	ADP
finefocus-3320	7	24	their	their	PRON
finefocus-3320	7	25	specific	specific	ADJ
finefocus-3320	7	26	niche	niche	NOUN
finefocus-3320	7	27	.	.	PUNCT
finefocus-3320	8	1	several	several	ADJ
finefocus-3320	8	2	resistant	resistant	ADJ
finefocus-3320	8	3	organisms	organism	NOUN
finefocus-3320	8	4	from	from	ADP
finefocus-3320	8	5	each	each	DET
finefocus-3320	8	6	site	site	NOUN
finefocus-3320	8	7	were	be	AUX
finefocus-3320	8	8	also	also	ADV
finefocus-3320	8	9	tested	test	VERB
finefocus-3320	8	10	for	for	ADP
finefocus-3320	8	11	multidrug	multidrug	NOUN
finefocus-3320	8	12	resistance	resistance	NOUN
finefocus-3320	8	13	and	and	CCONJ
finefocus-3320	8	14	subsequently	subsequently	ADV
finefocus-3320	8	15	identified	identify	VERB
finefocus-3320	8	16	through	through	ADP
finefocus-3320	8	17	dna	dna	NOUN
finefocus-3320	8	18	sequencing	sequencing	NOUN
finefocus-3320	8	19	of	of	ADP
finefocus-3320	8	20	the	the	DET
finefocus-3320	8	21	16s	16	NOUN
finefocus-3320	8	22	gene	gene	NOUN
finefocus-3320	8	23	.	.	PUNCT
finefocus-3320	9	1	antibiotic	antibiotic	ADJ
finefocus-3320	9	2	resistance	resistance	NOUN
finefocus-3320	9	3	was	be	AUX
finefocus-3320	9	4	discovered	discover	VERB
finefocus-3320	9	5	in	in	ADP
finefocus-3320	9	6	all	all	DET
finefocus-3320	9	7	sites	site	NOUN
finefocus-3320	9	8	at	at	ADP
finefocus-3320	9	9	varying	vary	VERB
finefocus-3320	9	10	percentages	percentage	NOUN
finefocus-3320	9	11	.	.	PUNCT
finefocus-3320	10	1	some	some	DET
finefocus-3320	10	2	forms	form	NOUN
finefocus-3320	10	3	of	of	ADP
finefocus-3320	10	4	bacteria	bacteria	NOUN
finefocus-3320	10	5	were	be	AUX
finefocus-3320	10	6	present	present	ADJ
finefocus-3320	10	7	at	at	ADP
finefocus-3320	10	8	all	all	DET
finefocus-3320	10	9	sites	site	NOUN
finefocus-3320	10	10	,	,	PUNCT
finefocus-3320	10	11	but	but	CCONJ
finefocus-3320	10	12	there	there	PRON
finefocus-3320	10	13	were	be	VERB
finefocus-3320	10	14	differences	difference	NOUN
finefocus-3320	10	15	in	in	ADP
finefocus-3320	10	16	types	type	NOUN
finefocus-3320	10	17	of	of	ADP
finefocus-3320	10	18	resistant	resistant	ADJ
finefocus-3320	10	19	bacteria	bacteria	NOUN
finefocus-3320	10	20	found	find	VERB
finefocus-3320	10	21	between	between	ADP
finefocus-3320	10	22	sites	site	NOUN
finefocus-3320	10	23	.	.	PUNCT
finefocus-3320	11	1	six	six	NUM
finefocus-3320	11	2	different	different	ADJ
finefocus-3320	11	3	genera	genera	NOUN
finefocus-3320	11	4	of	of	ADP
finefocus-3320	11	5	bacteria	bacteria	NOUN
finefocus-3320	11	6	were	be	AUX
finefocus-3320	11	7	identified	identify	VERB
finefocus-3320	11	8	,	,	PUNCT
finefocus-3320	11	9	and	and	CCONJ
finefocus-3320	11	10	multidrug	multidrug	NOUN
finefocus-3320	11	11	resistance	resistance	NOUN
finefocus-3320	11	12	was	be	AUX
finefocus-3320	11	13	found	find	VERB
finefocus-3320	11	14	in	in	ADP
finefocus-3320	11	15	all	all	DET
finefocus-3320	11	16	the	the	DET
finefocus-3320	11	17	isolates	isolate	NOUN
finefocus-3320	11	18	studied	study	VERB
finefocus-3320	11	19	.	.	PUNCT
finefocus-3320	12	1	our	our	PRON
finefocus-3320	12	2	findings	finding	NOUN
finefocus-3320	12	3	indicate	indicate	VERB
finefocus-3320	12	4	that	that	SCONJ
finefocus-3320	12	5	multidrug	multidrug	NOUN
finefocus-3320	12	6	resistance	resistance	NOUN
finefocus-3320	12	7	is	be	AUX
finefocus-3320	12	8	prevalent	prevalent	ADJ
finefocus-3320	12	9	in	in	ADP
finefocus-3320	12	10	many	many	ADJ
finefocus-3320	12	11	different	different	ADJ
finefocus-3320	12	12	types	type	NOUN
finefocus-3320	12	13	of	of	ADP
finefocus-3320	12	14	environments	environment	NOUN
finefocus-3320	12	15	,	,	PUNCT
finefocus-3320	12	16	including	include	VERB
finefocus-3320	12	17	those	those	PRON
finefocus-3320	12	18	that	that	PRON
finefocus-3320	12	19	have	have	AUX
finefocus-3320	12	20	never	never	ADV
finefocus-3320	12	21	been	be	AUX
finefocus-3320	12	22	directly	directly	ADV
finefocus-3320	12	23	used	use	VERB
finefocus-3320	12	24	for	for	ADP
finefocus-3320	12	25	agricultural	agricultural	ADJ
finefocus-3320	12	26	or	or	CCONJ
finefocus-3320	12	27	urban	urban	ADJ
finefocus-3320	12	28	development	development	NOUN
finefocus-3320	12	29	.	.	PUNCT
finefocus-3320	13	1	56	56	NUM
finefocus-3320	13	2	|	|	CCONJ
finefocus-3320	13	3	fine	fine	ADJ
finefocus-3320	13	4	focus	focus	NOUN
finefocus-3320	13	5	introduction	introduction	NOUN
finefocus-3320	13	6	antibiotic	antibiotic	ADJ
finefocus-3320	13	7	resistance	resistance	NOUN
finefocus-3320	13	8	(	(	PUNCT
finefocus-3320	13	9	ar	ar	NOUN
finefocus-3320	13	10	)	)	PUNCT
finefocus-3320	13	11	has	have	AUX
finefocus-3320	13	12	been	be	AUX
finefocus-3320	13	13	declared	declare	VERB
finefocus-3320	13	14	a	a	DET
finefocus-3320	13	15	global	global	ADJ
finefocus-3320	13	16	health	health	NOUN
finefocus-3320	13	17	epidemic	epidemic	NOUN
finefocus-3320	13	18	(	(	PUNCT
finefocus-3320	13	19	53	53	NUM
finefocus-3320	13	20	)	)	PUNCT
finefocus-3320	13	21	.	.	PUNCT
finefocus-3320	14	1	resistant	resistant	ADJ
finefocus-3320	14	2	bacteria	bacteria	NOUN
finefocus-3320	14	3	currently	currently	ADV
finefocus-3320	14	4	cause	cause	VERB
finefocus-3320	14	5	over	over	ADP
finefocus-3320	14	6	2	2	NUM
finefocus-3320	14	7	million	million	NUM
finefocus-3320	14	8	infections	infection	NOUN
finefocus-3320	14	9	and	and	CCONJ
finefocus-3320	14	10	23,000	23,000	NUM
finefocus-3320	14	11	deaths	death	NOUN
finefocus-3320	14	12	each	each	DET
finefocus-3320	14	13	year	year	NOUN
finefocus-3320	14	14	in	in	ADP
finefocus-3320	14	15	the	the	DET
finefocus-3320	14	16	usa	usa	PROPN
finefocus-3320	14	17	alone	alone	ADV
finefocus-3320	14	18	(	(	PUNCT
finefocus-3320	14	19	8)	8)	NUM
finefocus-3320	14	20	.	.	PUNCT
finefocus-3320	14	21	multidrug	multidrug	NOUN
finefocus-3320	14	22	resistance	resistance	NOUN
finefocus-3320	14	23	(	(	PUNCT
finefocus-3320	14	24	mdr	mdr	NOUN
finefocus-3320	14	25	)	)	PUNCT
finefocus-3320	14	26	has	have	AUX
finefocus-3320	14	27	amplified	amplify	VERB
finefocus-3320	14	28	this	this	DET
finefocus-3320	14	29	threat	threat	NOUN
finefocus-3320	14	30	by	by	ADP
finefocus-3320	14	31	making	make	VERB
finefocus-3320	14	32	some	some	DET
finefocus-3320	14	33	infections	infection	NOUN
finefocus-3320	14	34	difficult	difficult	ADJ
finefocus-3320	14	35	,	,	PUNCT
finefocus-3320	14	36	if	if	SCONJ
finefocus-3320	14	37	not	not	PART
finefocus-3320	14	38	impossible	impossible	ADJ
finefocus-3320	14	39	,	,	PUNCT
finefocus-3320	14	40	to	to	PART
finefocus-3320	14	41	treat	treat	VERB
finefocus-3320	14	42	with	with	ADP
finefocus-3320	14	43	antibiotics	antibiotic	NOUN
finefocus-3320	14	44	(	(	PUNCT
finefocus-3320	14	45	33	33	NUM
finefocus-3320	14	46	)	)	PUNCT
finefocus-3320	14	47	.	.	PUNCT
finefocus-3320	15	1	the	the	DET
finefocus-3320	15	2	escalation	escalation	NOUN
finefocus-3320	15	3	of	of	ADP
finefocus-3320	15	4	not	not	PART
finefocus-3320	15	5	only	only	ADV
finefocus-3320	15	6	antibioticresistant	antibioticresistant	ADJ
finefocus-3320	15	7	organisms	organism	NOUN
finefocus-3320	15	8	,	,	PUNCT
finefocus-3320	15	9	but	but	CCONJ
finefocus-3320	15	10	multidrug	multidrug	NOUN
finefocus-3320	15	11	-	-	PUNCT
finefocus-3320	15	12	resistant	resistant	ADJ
finefocus-3320	15	13	organisms	organism	NOUN
finefocus-3320	15	14	has	have	AUX
finefocus-3320	15	15	been	be	AUX
finefocus-3320	15	16	linked	link	VERB
finefocus-3320	15	17	to	to	ADP
finefocus-3320	15	18	overuse	overuse	NOUN
finefocus-3320	15	19	and	and	CCONJ
finefocus-3320	15	20	misuse	misuse	NOUN
finefocus-3320	15	21	of	of	ADP
finefocus-3320	15	22	antibiotics	antibiotic	NOUN
finefocus-3320	15	23	in	in	ADP
finefocus-3320	15	24	clinical	clinical	ADJ
finefocus-3320	15	25	and	and	CCONJ
finefocus-3320	15	26	agricultural	agricultural	ADJ
finefocus-3320	15	27	settings	setting	NOUN
finefocus-3320	15	28	(	(	PUNCT
finefocus-3320	15	29	48	48	NUM
finefocus-3320	15	30	)	)	PUNCT
finefocus-3320	15	31	.	.	PUNCT
finefocus-3320	16	1	this	this	DET
finefocus-3320	16	2	overuse	overuse	NOUN
finefocus-3320	16	3	has	have	AUX
finefocus-3320	16	4	led	lead	VERB
finefocus-3320	16	5	to	to	ADP
finefocus-3320	16	6	resistance	resistance	NOUN
finefocus-3320	16	7	to	to	ADP
finefocus-3320	16	8	every	every	DET
finefocus-3320	16	9	class	class	NOUN
finefocus-3320	16	10	of	of	ADP
finefocus-3320	16	11	antibiotics	antibiotic	NOUN
finefocus-3320	16	12	(	(	PUNCT
finefocus-3320	16	13	8)	8)	NUM
finefocus-3320	16	14	and	and	CCONJ
finefocus-3320	16	15	consequently	consequently	ADV
finefocus-3320	16	16	,	,	PUNCT
finefocus-3320	16	17	loss	loss	NOUN
finefocus-3320	16	18	of	of	ADP
finefocus-3320	16	19	antibiotic	antibiotic	ADJ
finefocus-3320	16	20	efficacy	efficacy	NOUN
finefocus-3320	16	21	for	for	ADP
finefocus-3320	16	22	treating	treat	VERB
finefocus-3320	16	23	common	common	ADJ
finefocus-3320	16	24	bacterial	bacterial	ADJ
finefocus-3320	16	25	infections	infection	NOUN
finefocus-3320	16	26	.	.	PUNCT
finefocus-3320	17	1	in	in	ADP
finefocus-3320	17	2	addition	addition	NOUN
finefocus-3320	17	3	,	,	PUNCT
finefocus-3320	17	4	lack	lack	NOUN
finefocus-3320	17	5	of	of	ADP
finefocus-3320	17	6	pharmaceutical	pharmaceutical	ADJ
finefocus-3320	17	7	investment	investment	NOUN
finefocus-3320	17	8	in	in	ADP
finefocus-3320	17	9	antibiotic	antibiotic	ADJ
finefocus-3320	17	10	discovery	discovery	NOUN
finefocus-3320	17	11	(	(	PUNCT
finefocus-3320	17	12	48	48	NUM
finefocus-3320	17	13	)	)	PUNCT
finefocus-3320	17	14	has	have	AUX
finefocus-3320	17	15	restricted	restrict	VERB
finefocus-3320	17	16	the	the	DET
finefocus-3320	17	17	availability	availability	NOUN
finefocus-3320	17	18	of	of	ADP
finefocus-3320	17	19	novel	novel	ADJ
finefocus-3320	17	20	treatment	treatment	NOUN
finefocus-3320	17	21	options	option	NOUN
finefocus-3320	17	22	.	.	PUNCT
finefocus-3320	18	1	antibiotics	antibiotic	NOUN
finefocus-3320	18	2	have	have	VERB
finefocus-3320	18	3	limited	limit	VERB
finefocus-3320	18	4	effectiveness	effectiveness	NOUN
finefocus-3320	18	5	as	as	ADP
finefocus-3320	18	6	introducing	introduce	VERB
finefocus-3320	18	7	them	they	PRON
finefocus-3320	18	8	to	to	ADP
finefocus-3320	18	9	bacterial	bacterial	ADJ
finefocus-3320	18	10	populations	population	NOUN
finefocus-3320	18	11	creates	create	VERB
finefocus-3320	18	12	a	a	DET
finefocus-3320	18	13	selective	selective	ADJ
finefocus-3320	18	14	pressure	pressure	NOUN
finefocus-3320	18	15	,	,	PUNCT
finefocus-3320	18	16	allowing	allow	VERB
finefocus-3320	18	17	resistant	resistant	ADJ
finefocus-3320	18	18	bacteria	bacteria	NOUN
finefocus-3320	18	19	to	to	PART
finefocus-3320	18	20	survive	survive	VERB
finefocus-3320	18	21	and	and	CCONJ
finefocus-3320	18	22	reproduce	reproduce	VERB
finefocus-3320	18	23	.	.	PUNCT
finefocus-3320	19	1	ar	ar	PROPN
finefocus-3320	19	2	can	can	AUX
finefocus-3320	19	3	be	be	AUX
finefocus-3320	19	4	acquired	acquire	VERB
finefocus-3320	19	5	via	via	ADP
finefocus-3320	19	6	a	a	DET
finefocus-3320	19	7	random	random	ADJ
finefocus-3320	19	8	mutation	mutation	NOUN
finefocus-3320	19	9	(	(	PUNCT
finefocus-3320	19	10	52	52	NUM
finefocus-3320	19	11	)	)	PUNCT
finefocus-3320	19	12	,	,	PUNCT
finefocus-3320	19	13	preexisting	preexist	VERB
finefocus-3320	19	14	efflux	efflux	NOUN
finefocus-3320	19	15	pumps	pump	NOUN
finefocus-3320	19	16	,	,	PUNCT
finefocus-3320	19	17	or	or	CCONJ
finefocus-3320	19	18	by	by	ADP
finefocus-3320	19	19	horizontal	horizontal	ADJ
finefocus-3320	19	20	gene	gene	NOUN
finefocus-3320	19	21	transfer	transfer	NOUN
finefocus-3320	19	22	(	(	PUNCT
finefocus-3320	19	23	hgt	hgt	PROPN
finefocus-3320	19	24	)	)	PUNCT
finefocus-3320	19	25	.	.	PUNCT
finefocus-3320	20	1	hgt	hgt	PROPN
finefocus-3320	20	2	has	have	AUX
finefocus-3320	20	3	been	be	AUX
finefocus-3320	20	4	linked	link	VERB
finefocus-3320	20	5	to	to	ADP
finefocus-3320	20	6	the	the	DET
finefocus-3320	20	7	spread	spread	NOUN
finefocus-3320	20	8	of	of	ADP
finefocus-3320	20	9	resistance	resistance	NOUN
finefocus-3320	20	10	since	since	SCONJ
finefocus-3320	20	11	ar	ar	NOUN
finefocus-3320	20	12	genes	gene	NOUN
finefocus-3320	20	13	are	be	AUX
finefocus-3320	20	14	often	often	ADV
finefocus-3320	20	15	carried	carry	VERB
finefocus-3320	20	16	on	on	ADP
finefocus-3320	20	17	mobile	mobile	ADJ
finefocus-3320	20	18	genetic	genetic	ADJ
finefocus-3320	20	19	elements	element	NOUN
finefocus-3320	20	20	such	such	ADJ
finefocus-3320	20	21	as	as	ADP
finefocus-3320	20	22	plasmids	plasmid	NOUN
finefocus-3320	20	23	(	(	PUNCT
finefocus-3320	20	24	28	28	NUM
finefocus-3320	20	25	)	)	PUNCT
finefocus-3320	20	26	,	,	PUNCT
finefocus-3320	20	27	integrons	integron	NOUN
finefocus-3320	20	28	(	(	PUNCT
finefocus-3320	20	29	51	51	NUM
finefocus-3320	20	30	)	)	PUNCT
finefocus-3320	20	31	,	,	PUNCT
finefocus-3320	20	32	transposons	transposon	NOUN
finefocus-3320	20	33	(	(	PUNCT
finefocus-3320	20	34	45	45	NUM
finefocus-3320	20	35	)	)	PUNCT
finefocus-3320	20	36	,	,	PUNCT
finefocus-3320	20	37	or	or	CCONJ
finefocus-3320	20	38	bacteriophages	bacteriophage	NOUN
finefocus-3320	20	39	(	(	PUNCT
finefocus-3320	20	40	9	9	NUM
finefocus-3320	20	41	)	)	PUNCT
finefocus-3320	20	42	.	.	PUNCT
finefocus-3320	21	1	through	through	ADP
finefocus-3320	21	2	hgt	hgt	PROPN
finefocus-3320	21	3	,	,	PUNCT
finefocus-3320	21	4	these	these	DET
finefocus-3320	21	5	genes	gene	NOUN
finefocus-3320	21	6	can	can	AUX
finefocus-3320	21	7	disseminate	disseminate	VERB
finefocus-3320	21	8	and	and	CCONJ
finefocus-3320	21	9	proliferate	proliferate	VERB
finefocus-3320	21	10	both	both	PRON
finefocus-3320	21	11	within	within	ADP
finefocus-3320	21	12	a	a	DET
finefocus-3320	21	13	population	population	NOUN
finefocus-3320	21	14	and	and	CCONJ
finefocus-3320	21	15	between	between	ADP
finefocus-3320	21	16	different	different	ADJ
finefocus-3320	21	17	populations	population	NOUN
finefocus-3320	21	18	of	of	ADP
finefocus-3320	21	19	bacteria	bacteria	NOUN
finefocus-3320	21	20	.	.	PUNCT
finefocus-3320	22	1	most	most	ADJ
finefocus-3320	22	2	research	research	NOUN
finefocus-3320	22	3	has	have	AUX
finefocus-3320	22	4	studied	study	VERB
finefocus-3320	22	5	ar	ar	NOUN
finefocus-3320	22	6	in	in	ADP
finefocus-3320	22	7	clinical	clinical	ADJ
finefocus-3320	22	8	settings	setting	NOUN
finefocus-3320	22	9	,	,	PUNCT
finefocus-3320	22	10	yet	yet	CCONJ
finefocus-3320	22	11	there	there	PRON
finefocus-3320	22	12	is	be	VERB
finefocus-3320	22	13	evidence	evidence	NOUN
finefocus-3320	22	14	that	that	SCONJ
finefocus-3320	22	15	some	some	DET
finefocus-3320	22	16	clinical	clinical	ADJ
finefocus-3320	22	17	ar	ar	NOUN
finefocus-3320	22	18	genes	gene	NOUN
finefocus-3320	22	19	have	have	AUX
finefocus-3320	22	20	environmental	environmental	ADJ
finefocus-3320	22	21	origins	origin	NOUN
finefocus-3320	22	22	(	(	PUNCT
finefocus-3320	22	23	50	50	NUM
finefocus-3320	22	24	)	)	PUNCT
finefocus-3320	22	25	.	.	PUNCT
finefocus-3320	23	1	naturally	naturally	ADV
finefocus-3320	23	2	occurring	occur	VERB
finefocus-3320	23	3	resistance	resistance	NOUN
finefocus-3320	23	4	is	be	AUX
finefocus-3320	23	5	widely	widely	ADV
finefocus-3320	23	6	abundant	abundant	ADJ
finefocus-3320	23	7	but	but	CCONJ
finefocus-3320	23	8	is	be	AUX
finefocus-3320	23	9	still	still	ADV
finefocus-3320	23	10	not	not	PART
finefocus-3320	23	11	entirely	entirely	ADV
finefocus-3320	23	12	understood	understand	VERB
finefocus-3320	23	13	(	(	PUNCT
finefocus-3320	23	14	10	10	NUM
finefocus-3320	23	15	,	,	PUNCT
finefocus-3320	23	16	12	12	NUM
finefocus-3320	23	17	,	,	PUNCT
finefocus-3320	23	18	41	41	NUM
finefocus-3320	23	19	)	)	PUNCT
finefocus-3320	23	20	.	.	PUNCT
finefocus-3320	24	1	specifically	specifically	ADV
finefocus-3320	24	2	,	,	PUNCT
finefocus-3320	24	3	it	it	PRON
finefocus-3320	24	4	is	be	AUX
finefocus-3320	24	5	not	not	PART
finefocus-3320	24	6	well	well	ADV
finefocus-3320	24	7	understood	understand	VERB
finefocus-3320	24	8	if	if	SCONJ
finefocus-3320	24	9	resistance	resistance	NOUN
finefocus-3320	24	10	is	be	AUX
finefocus-3320	24	11	found	find	VERB
finefocus-3320	24	12	only	only	ADV
finefocus-3320	24	13	in	in	ADP
finefocus-3320	24	14	specific	specific	ADJ
finefocus-3320	24	15	environments	environment	NOUN
finefocus-3320	24	16	or	or	CCONJ
finefocus-3320	24	17	in	in	ADP
finefocus-3320	24	18	certain	certain	ADJ
finefocus-3320	24	19	groups	group	NOUN
finefocus-3320	24	20	of	of	ADP
finefocus-3320	24	21	bacteria	bacteria	NOUN
finefocus-3320	24	22	.	.	PUNCT
finefocus-3320	25	1	previous	previous	ADJ
finefocus-3320	25	2	studies	study	NOUN
finefocus-3320	25	3	have	have	AUX
finefocus-3320	25	4	found	find	VERB
finefocus-3320	25	5	antibiotic	antibiotic	ADJ
finefocus-3320	25	6	-	-	PUNCT
finefocus-3320	25	7	resistant	resistant	ADJ
finefocus-3320	25	8	bacteria	bacteria	NOUN
finefocus-3320	25	9	in	in	ADP
finefocus-3320	25	10	pristine	pristine	ADJ
finefocus-3320	25	11	environments	environment	NOUN
finefocus-3320	25	12	including	include	VERB
finefocus-3320	25	13	remote	remote	ADJ
finefocus-3320	25	14	alaskan	alaskan	ADJ
finefocus-3320	25	15	soil	soil	NOUN
finefocus-3320	25	16	(	(	PUNCT
finefocus-3320	25	17	2	2	NUM
finefocus-3320	25	18	)	)	PUNCT
finefocus-3320	25	19	and	and	CCONJ
finefocus-3320	25	20	multidrug	multidrug	NOUN
finefocus-3320	25	21	-	-	PUNCT
finefocus-3320	25	22	resistant	resistant	ADJ
finefocus-3320	25	23	bacteria	bacteria	NOUN
finefocus-3320	25	24	in	in	ADP
finefocus-3320	25	25	isolated	isolated	ADJ
finefocus-3320	25	26	cave	cave	NOUN
finefocus-3320	25	27	systems	system	NOUN
finefocus-3320	25	28	(	(	PUNCT
finefocus-3320	25	29	5	5	NUM
finefocus-3320	25	30	)	)	PUNCT
finefocus-3320	25	31	.	.	PUNCT
finefocus-3320	26	1	a	a	DET
finefocus-3320	26	2	more	more	ADV
finefocus-3320	26	3	detailed	detailed	ADJ
finefocus-3320	26	4	surveillance	surveillance	NOUN
finefocus-3320	26	5	of	of	ADP
finefocus-3320	26	6	ar	ar	NOUN
finefocus-3320	26	7	in	in	ADP
finefocus-3320	26	8	the	the	DET
finefocus-3320	26	9	environment	environment	NOUN
finefocus-3320	26	10	could	could	AUX
finefocus-3320	26	11	allow	allow	VERB
finefocus-3320	26	12	us	we	PRON
finefocus-3320	26	13	to	to	PART
finefocus-3320	26	14	determine	determine	VERB
finefocus-3320	26	15	the	the	DET
finefocus-3320	26	16	relationship	relationship	NOUN
finefocus-3320	26	17	between	between	ADP
finefocus-3320	26	18	environmental	environmental	ADJ
finefocus-3320	26	19	reservoirs	reservoir	NOUN
finefocus-3320	26	20	and	and	CCONJ
finefocus-3320	26	21	clinical	clinical	ADJ
finefocus-3320	26	22	resistance	resistance	NOUN
finefocus-3320	26	23	.	.	PUNCT
finefocus-3320	27	1	the	the	DET
finefocus-3320	27	2	centers	center	NOUN
finefocus-3320	27	3	for	for	ADP
finefocus-3320	27	4	disease	disease	NOUN
finefocus-3320	27	5	control	control	NOUN
finefocus-3320	27	6	and	and	CCONJ
finefocus-3320	27	7	prevention	prevention	NOUN
finefocus-3320	27	8	(	(	PUNCT
finefocus-3320	27	9	cdc	cdc	PROPN
finefocus-3320	27	10	)	)	PUNCT
finefocus-3320	27	11	recommends	recommend	VERB
finefocus-3320	27	12	combatting	combat	VERB
finefocus-3320	27	13	deadly	deadly	ADJ
finefocus-3320	27	14	infections	infection	NOUN
finefocus-3320	27	15	and	and	CCONJ
finefocus-3320	27	16	the	the	DET
finefocus-3320	27	17	spread	spread	NOUN
finefocus-3320	27	18	of	of	ADP
finefocus-3320	27	19	resistance	resistance	NOUN
finefocus-3320	27	20	by	by	ADP
finefocus-3320	27	21	tracking	track	VERB
finefocus-3320	27	22	ar	ar	NOUN
finefocus-3320	27	23	patterns	pattern	NOUN
finefocus-3320	27	24	in	in	ADP
finefocus-3320	27	25	all	all	DET
finefocus-3320	27	26	environments	environment	NOUN
finefocus-3320	27	27	(	(	PUNCT
finefocus-3320	27	28	53	53	NUM
finefocus-3320	27	29	)	)	PUNCT
finefocus-3320	27	30	.	.	PUNCT
finefocus-3320	28	1	previous	previous	ADJ
finefocus-3320	28	2	research	research	NOUN
finefocus-3320	28	3	has	have	AUX
finefocus-3320	28	4	also	also	ADV
finefocus-3320	28	5	suggested	suggest	VERB
finefocus-3320	28	6	there	there	PRON
finefocus-3320	28	7	is	be	VERB
finefocus-3320	28	8	a	a	DET
finefocus-3320	28	9	need	need	NOUN
finefocus-3320	28	10	for	for	ADP
finefocus-3320	28	11	thorough	thorough	ADJ
finefocus-3320	28	12	environmental	environmental	ADJ
finefocus-3320	28	13	surveys	survey	NOUN
finefocus-3320	28	14	,	,	PUNCT
finefocus-3320	28	15	especially	especially	ADV
finefocus-3320	28	16	of	of	ADP
finefocus-3320	28	17	those	those	DET
finefocus-3320	28	18	environments	environment	NOUN
finefocus-3320	28	19	affected	affect	VERB
finefocus-3320	28	20	by	by	ADP
finefocus-3320	28	21	human	human	ADJ
finefocus-3320	28	22	activities	activity	NOUN
finefocus-3320	28	23	(	(	PUNCT
finefocus-3320	28	24	17	17	NUM
finefocus-3320	28	25	,	,	PUNCT
finefocus-3320	28	26	22	22	NUM
finefocus-3320	28	27	,	,	PUNCT
finefocus-3320	28	28	32	32	NUM
finefocus-3320	28	29	)	)	PUNCT
finefocus-3320	28	30	.	.	PUNCT
finefocus-3320	29	1	these	these	DET
finefocus-3320	29	2	areas	area	NOUN
finefocus-3320	29	3	are	be	AUX
finefocus-3320	29	4	of	of	ADP
finefocus-3320	29	5	interest	interest	NOUN
finefocus-3320	29	6	as	as	ADP
finefocus-3320	29	7	urban	urban	ADJ
finefocus-3320	29	8	environments	environment	NOUN
finefocus-3320	29	9	with	with	ADP
finefocus-3320	29	10	high	high	ADJ
finefocus-3320	29	11	population	population	NOUN
finefocus-3320	29	12	and	and	CCONJ
finefocus-3320	29	13	building	building	NOUN
finefocus-3320	29	14	density	density	NOUN
finefocus-3320	29	15	often	often	ADV
finefocus-3320	29	16	have	have	VERB
finefocus-3320	29	17	higher	high	ADJ
finefocus-3320	29	18	levels	level	NOUN
finefocus-3320	29	19	of	of	ADP
finefocus-3320	29	20	ar	ar	PROPN
finefocus-3320	29	21	(	(	PUNCT
finefocus-3320	29	22	19	19	NUM
finefocus-3320	29	23	,	,	PUNCT
finefocus-3320	29	24	32	32	NUM
finefocus-3320	29	25	)	)	PUNCT
finefocus-3320	29	26	,	,	PUNCT
finefocus-3320	29	27	possibly	possibly	ADV
finefocus-3320	29	28	due	due	ADP
finefocus-3320	29	29	to	to	ADP
finefocus-3320	29	30	antibiotic	antibiotic	ADJ
finefocus-3320	29	31	effluent	effluent	NOUN
finefocus-3320	29	32	from	from	ADP
finefocus-3320	29	33	hospitals	hospital	NOUN
finefocus-3320	29	34	or	or	CCONJ
finefocus-3320	29	35	from	from	ADP
finefocus-3320	29	36	farms	farm	NOUN
finefocus-3320	29	37	that	that	PRON
finefocus-3320	29	38	pollute	pollute	VERB
finefocus-3320	29	39	the	the	DET
finefocus-3320	29	40	surrounding	surround	VERB
finefocus-3320	29	41	environment	environment	NOUN
finefocus-3320	29	42	and	and	CCONJ
finefocus-3320	29	43	water	water	NOUN
finefocus-3320	29	44	bodies	body	NOUN
finefocus-3320	29	45	(	(	PUNCT
finefocus-3320	29	46	26	26	NUM
finefocus-3320	29	47	)	)	PUNCT
finefocus-3320	29	48	.	.	PUNCT
finefocus-3320	30	1	people	people	NOUN
finefocus-3320	30	2	living	live	VERB
finefocus-3320	30	3	or	or	CCONJ
finefocus-3320	30	4	working	work	VERB
finefocus-3320	30	5	in	in	ADP
finefocus-3320	30	6	these	these	DET
finefocus-3320	30	7	areas	area	NOUN
finefocus-3320	30	8	also	also	ADV
finefocus-3320	30	9	acquire	acquire	VERB
finefocus-3320	30	10	resistant	resistant	ADJ
finefocus-3320	30	11	bacteria	bacteria	NOUN
finefocus-3320	30	12	into	into	ADP
finefocus-3320	30	13	their	their	PRON
finefocus-3320	30	14	own	own	ADJ
finefocus-3320	30	15	microbiome	microbiome	NOUN
finefocus-3320	30	16	(	(	PUNCT
finefocus-3320	30	17	42	42	NUM
finefocus-3320	30	18	)	)	PUNCT
finefocus-3320	30	19	,	,	PUNCT
finefocus-3320	30	20	further	far	ADV
finefocus-3320	30	21	spreading	spread	VERB
finefocus-3320	30	22	the	the	DET
finefocus-3320	30	23	prevalence	prevalence	NOUN
finefocus-3320	30	24	of	of	ADP
finefocus-3320	30	25	ar	ar	PROPN
finefocus-3320	30	26	.	.	PROPN
finefocus-3320	30	27	to	to	PART
finefocus-3320	30	28	address	address	VERB
finefocus-3320	30	29	the	the	DET
finefocus-3320	30	30	cdc	cdc	PROPN
finefocus-3320	30	31	’s	’s	PART
finefocus-3320	30	32	recommendation	recommendation	NOUN
finefocus-3320	30	33	,	,	PUNCT
finefocus-3320	30	34	a	a	DET
finefocus-3320	30	35	project	project	NOUN
finefocus-3320	30	36	called	call	VERB
finefocus-3320	30	37	the	the	DET
finefocus-3320	30	38	prevalence	prevalence	NOUN
finefocus-3320	30	39	of	of	ADP
finefocus-3320	30	40	antibiotic	antibiotic	ADJ
finefocus-3320	30	41	-	-	PUNCT
finefocus-3320	30	42	resistant	resistant	ADJ
finefocus-3320	30	43	bacteria	bacteria	NOUN
finefocus-3320	30	44	in	in	ADP
finefocus-3320	30	45	the	the	DET
finefocus-3320	30	46	environment	environment	NOUN
finefocus-3320	30	47	(	(	PUNCT
finefocus-3320	30	48	pare	pare	NOUN
finefocus-3320	30	49	)	)	PUNCT
finefocus-3320	30	50	has	have	AUX
finefocus-3320	30	51	created	create	VERB
finefocus-3320	30	52	an	an	DET
finefocus-3320	30	53	infrastructure	infrastructure	NOUN
finefocus-3320	30	54	capable	capable	ADJ
finefocus-3320	30	55	of	of	ADP
finefocus-3320	30	56	organizing	organize	VERB
finefocus-3320	30	57	environmental	environmental	ADJ
finefocus-3320	30	58	data	datum	NOUN
finefocus-3320	30	59	collection	collection	NOUN
finefocus-3320	30	60	by	by	ADP
finefocus-3320	30	61	large	large	ADJ
finefocus-3320	30	62	numbers	number	NOUN
finefocus-3320	30	63	of	of	ADP
finefocus-3320	30	64	individual	individual	ADJ
finefocus-3320	30	65	researchers	researcher	NOUN
finefocus-3320	30	66	(	(	PUNCT
finefocus-3320	30	67	18	18	NUM
finefocus-3320	30	68	)	)	PUNCT
finefocus-3320	30	69	.	.	PUNCT
finefocus-3320	31	1	this	this	DET
finefocus-3320	31	2	project	project	NOUN
finefocus-3320	31	3	coordinates	coordinate	VERB
finefocus-3320	31	4	undergraduate	undergraduate	VERB
finefocus-3320	31	5	and	and	CCONJ
finefocus-3320	31	6	high	high	ADJ
finefocus-3320	31	7	school	school	NOUN
finefocus-3320	31	8	students	student	NOUN
finefocus-3320	31	9	across	across	ADP
finefocus-3320	31	10	the	the	DET
finefocus-3320	31	11	usa	usa	PROPN
finefocus-3320	31	12	to	to	PART
finefocus-3320	31	13	collect	collect	VERB
finefocus-3320	31	14	and	and	CCONJ
finefocus-3320	31	15	compile	compile	NOUN
finefocus-3320	31	16	data	datum	NOUN
finefocus-3320	31	17	using	use	VERB
finefocus-3320	31	18	identical	identical	ADJ
finefocus-3320	31	19	methodologies	methodology	NOUN
finefocus-3320	31	20	.	.	PUNCT
finefocus-3320	32	1	eventually	eventually	ADV
finefocus-3320	32	2	,	,	PUNCT
finefocus-3320	32	3	the	the	DET
finefocus-3320	32	4	pare	pare	ADJ
finefocus-3320	32	5	project	project	NOUN
finefocus-3320	32	6	will	will	AUX
finefocus-3320	32	7	make	make	VERB
finefocus-3320	32	8	it	it	PRON
finefocus-3320	32	9	possible	possible	ADJ
finefocus-3320	32	10	to	to	PART
finefocus-3320	32	11	track	track	VERB
finefocus-3320	32	12	resistance	resistance	NOUN
finefocus-3320	32	13	over	over	ADP
finefocus-3320	32	14	time	time	NOUN
finefocus-3320	32	15	,	,	PUNCT
finefocus-3320	32	16	identify	identify	VERB
finefocus-3320	32	17	areas	area	NOUN
finefocus-3320	32	18	with	with	ADP
finefocus-3320	32	19	high	high	ADJ
finefocus-3320	32	20	ar	ar	NOUN
finefocus-3320	32	21	,	,	PUNCT
finefocus-3320	32	22	and	and	CCONJ
finefocus-3320	32	23	find	find	VERB
finefocus-3320	32	24	relationships	relationship	NOUN
finefocus-3320	32	25	between	between	ADP
finefocus-3320	32	26	resistance	resistance	NOUN
finefocus-3320	32	27	and	and	CCONJ
finefocus-3320	32	28	different	different	ADJ
finefocus-3320	32	29	environments	environment	NOUN
finefocus-3320	32	30	.	.	PUNCT
finefocus-3320	33	1	the	the	DET
finefocus-3320	33	2	merl	merl	PROPN
finefocus-3320	33	3	and	and	CCONJ
finefocus-3320	33	4	margaret	margaret	PROPN
finefocus-3320	33	5	primmer	primmer	PROPN
finefocus-3320	33	6	outdoor	outdoor	PROPN
finefocus-3320	33	7	learning	learning	NOUN
finefocus-3320	33	8	center	center	NOUN
finefocus-3320	33	9	(	(	PUNCT
finefocus-3320	33	10	primmer	primmer	NOUN
finefocus-3320	33	11	)	)	PUNCT
finefocus-3320	33	12	,	,	PUNCT
finefocus-3320	33	13	is	be	AUX
finefocus-3320	33	14	an	an	DET
finefocus-3320	33	15	outdoor	outdoor	ADJ
finefocus-3320	33	16	education	education	NOUN
finefocus-3320	33	17	and	and	CCONJ
finefocus-3320	33	18	research	research	NOUN
finefocus-3320	33	19	property	property	NOUN
finefocus-3320	33	20	uniquely	uniquely	ADV
finefocus-3320	33	21	suited	suit	VERB
finefocus-3320	33	22	for	for	ADP
finefocus-3320	33	23	a	a	DET
finefocus-3320	33	24	study	study	NOUN
finefocus-3320	33	25	on	on	ADP
finefocus-3320	33	26	environmental	environmental	ADJ
finefocus-3320	33	27	drug	drug	NOUN
finefocus-3320	33	28	resistance	resistance	NOUN
finefocus-3320	33	29	because	because	SCONJ
finefocus-3320	33	30	of	of	ADP
finefocus-3320	33	31	its	its	PRON
finefocus-3320	33	32	location	location	NOUN
finefocus-3320	33	33	away	away	ADV
finefocus-3320	33	34	from	from	ADP
finefocus-3320	33	35	well	well	ADV
finefocus-3320	33	36	-	-	PUNCT
finefocus-3320	33	37	developed	develop	VERB
finefocus-3320	33	38	areas	area	NOUN
finefocus-3320	33	39	and	and	CCONJ
finefocus-3320	33	40	its	its	PRON
finefocus-3320	33	41	ecological	ecological	ADJ
finefocus-3320	33	42	diversity	diversity	NOUN
finefocus-3320	33	43	.	.	PUNCT
finefocus-3320	34	1	more	more	ADJ
finefocus-3320	34	2	than	than	ADP
finefocus-3320	34	3	40	40	NUM
finefocus-3320	34	4	plants	plant	NOUN
finefocus-3320	34	5	and	and	CCONJ
finefocus-3320	34	6	25	25	NUM
finefocus-3320	34	7	animals	animal	NOUN
finefocus-3320	34	8	have	have	AUX
finefocus-3320	34	9	been	be	AUX
finefocus-3320	34	10	documented	document	VERB
finefocus-3320	34	11	(	(	PUNCT
finefocus-3320	34	12	c.	c.	PROPN
finefocus-3320	34	13	anderson	anderson	PROPN
finefocus-3320	34	14	,	,	PUNCT
finefocus-3320	34	15	capital	capital	PROPN
finefocus-3320	34	16	university	university	NOUN
finefocus-3320	34	17	,	,	PUNCT
finefocus-3320	34	18	personal	personal	ADJ
finefocus-3320	34	19	communication	communication	NOUN
finefocus-3320	34	20	)	)	PUNCT
finefocus-3320	34	21	,	,	PUNCT
finefocus-3320	34	22	and	and	CCONJ
finefocus-3320	34	23	much	much	ADJ
finefocus-3320	34	24	of	of	ADP
finefocus-3320	34	25	this	this	DET
finefocus-3320	34	26	property	property	NOUN
finefocus-3320	34	27	has	have	AUX
finefocus-3320	34	28	never	never	ADV
finefocus-3320	34	29	been	be	AUX
finefocus-3320	34	30	developed	develop	VERB
finefocus-3320	34	31	or	or	CCONJ
finefocus-3320	34	32	used	use	VERB
finefocus-3320	34	33	for	for	ADP
finefocus-3320	34	34	agricultural	agricultural	ADJ
finefocus-3320	34	35	purposes	purpose	NOUN
finefocus-3320	34	36	(	(	PUNCT
finefocus-3320	34	37	mark	mark	PROPN
finefocus-3320	34	38	laughlin	laughlin	PROPN
finefocus-3320	34	39	,	,	PUNCT
finefocus-3320	34	40	capital	capital	NOUN
finefocus-3320	34	41	university	university	NOUN
finefocus-3320	34	42	,	,	PUNCT
finefocus-3320	34	43	personal	personal	ADJ
finefocus-3320	34	44	volume	volume	NOUN
finefocus-3320	34	45	six	six	NUM
finefocus-3320	34	46	|	|	ADV
finefocus-3320	34	47	57	57	NUM
finefocus-3320	34	48	communication	communication	NOUN
finefocus-3320	34	49	)	)	PUNCT
finefocus-3320	34	50	.	.	PUNCT
finefocus-3320	35	1	the	the	DET
finefocus-3320	35	2	primmer	primmer	NOUN
finefocus-3320	35	3	research	research	NOUN
finefocus-3320	35	4	property	property	NOUN
finefocus-3320	35	5	is	be	AUX
finefocus-3320	35	6	located	locate	VERB
finefocus-3320	35	7	in	in	ADP
finefocus-3320	35	8	appalachia	appalachia	PROPN
finefocus-3320	35	9	,	,	PUNCT
finefocus-3320	35	10	ohio	ohio	PROPN
finefocus-3320	35	11	,	,	PUNCT
finefocus-3320	35	12	a	a	DET
finefocus-3320	35	13	primarily	primarily	ADV
finefocus-3320	35	14	agricultural	agricultural	ADJ
finefocus-3320	35	15	region	region	NOUN
finefocus-3320	35	16	.	.	PUNCT
finefocus-3320	36	1	the	the	DET
finefocus-3320	36	2	hocking	hocking	PROPN
finefocus-3320	36	3	river	river	PROPN
finefocus-3320	36	4	,	,	PUNCT
finefocus-3320	36	5	adjacent	adjacent	ADJ
finefocus-3320	36	6	to	to	ADP
finefocus-3320	36	7	the	the	DET
finefocus-3320	36	8	property	property	NOUN
finefocus-3320	36	9	,	,	PUNCT
finefocus-3320	36	10	has	have	AUX
finefocus-3320	36	11	been	be	AUX
finefocus-3320	36	12	historically	historically	ADV
finefocus-3320	36	13	targeted	target	VERB
finefocus-3320	36	14	by	by	ADP
finefocus-3320	36	15	the	the	DET
finefocus-3320	36	16	environmental	environmental	PROPN
finefocus-3320	36	17	protection	protection	PROPN
finefocus-3320	36	18	agency	agency	PROPN
finefocus-3320	36	19	(	(	PUNCT
finefocus-3320	36	20	epa	epa	PROPN
finefocus-3320	36	21	)	)	PUNCT
finefocus-3320	36	22	as	as	SCONJ
finefocus-3320	36	23	it	it	PRON
finefocus-3320	36	24	had	have	AUX
finefocus-3320	36	25	been	be	AUX
finefocus-3320	36	26	contaminated	contaminate	VERB
finefocus-3320	36	27	by	by	ADP
finefocus-3320	36	28	industrial	industrial	ADJ
finefocus-3320	36	29	and	and	CCONJ
finefocus-3320	36	30	sewer	sewer	NOUN
finefocus-3320	36	31	discharges	discharge	NOUN
finefocus-3320	36	32	,	,	PUNCT
finefocus-3320	36	33	as	as	ADV
finefocus-3320	36	34	well	well	ADV
finefocus-3320	36	35	as	as	ADP
finefocus-3320	36	36	mine	mine	NOUN
finefocus-3320	36	37	drainage	drainage	NOUN
finefocus-3320	36	38	and	and	CCONJ
finefocus-3320	36	39	agricultural	agricultural	ADJ
finefocus-3320	36	40	runoff	runoff	NOUN
finefocus-3320	36	41	(	(	PUNCT
finefocus-3320	36	42	39	39	NUM
finefocus-3320	36	43	)	)	PUNCT
finefocus-3320	36	44	.	.	PUNCT
finefocus-3320	37	1	with	with	ADP
finefocus-3320	37	2	its	its	PRON
finefocus-3320	37	3	seven	seven	NUM
finefocus-3320	37	4	different	different	ADJ
finefocus-3320	37	5	ecological	ecological	ADJ
finefocus-3320	37	6	zones	zone	NOUN
finefocus-3320	37	7	located	locate	VERB
finefocus-3320	37	8	adjacent	adjacent	ADJ
finefocus-3320	37	9	to	to	ADP
finefocus-3320	37	10	one	one	NUM
finefocus-3320	37	11	another	another	DET
finefocus-3320	37	12	and	and	CCONJ
finefocus-3320	37	13	in	in	ADP
finefocus-3320	37	14	proximity	proximity	NOUN
finefocus-3320	37	15	to	to	ADP
finefocus-3320	37	16	a	a	DET
finefocus-3320	37	17	water	water	NOUN
finefocus-3320	37	18	source	source	NOUN
finefocus-3320	37	19	made	make	VERB
finefocus-3320	37	20	this	this	DET
finefocus-3320	37	21	property	property	NOUN
finefocus-3320	37	22	an	an	DET
finefocus-3320	37	23	ideal	ideal	ADJ
finefocus-3320	37	24	and	and	CCONJ
finefocus-3320	37	25	unique	unique	ADJ
finefocus-3320	37	26	setting	setting	NOUN
finefocus-3320	37	27	for	for	ADP
finefocus-3320	37	28	quantitatively	quantitatively	ADV
finefocus-3320	37	29	surveying	survey	VERB
finefocus-3320	37	30	both	both	CCONJ
finefocus-3320	37	31	the	the	DET
finefocus-3320	37	32	prevalence	prevalence	NOUN
finefocus-3320	37	33	of	of	ADP
finefocus-3320	37	34	antibiotic	antibiotic	ADJ
finefocus-3320	37	35	-	-	PUNCT
finefocus-3320	37	36	resistant	resistant	ADJ
finefocus-3320	37	37	bacteria	bacteria	NOUN
finefocus-3320	37	38	in	in	ADP
finefocus-3320	37	39	the	the	DET
finefocus-3320	37	40	different	different	ADJ
finefocus-3320	37	41	ecological	ecological	ADJ
finefocus-3320	37	42	zones	zone	NOUN
finefocus-3320	37	43	and	and	CCONJ
finefocus-3320	37	44	the	the	DET
finefocus-3320	37	45	diversity	diversity	NOUN
finefocus-3320	37	46	of	of	ADP
finefocus-3320	37	47	these	these	DET
finefocus-3320	37	48	antibiotic	antibiotic	ADJ
finefocus-3320	37	49	-	-	PUNCT
finefocus-3320	37	50	resistant	resistant	ADJ
finefocus-3320	37	51	organisms	organism	NOUN
finefocus-3320	37	52	.	.	PUNCT
finefocus-3320	38	1	select	select	ADJ
finefocus-3320	38	2	isolates	isolate	NOUN
finefocus-3320	38	3	were	be	AUX
finefocus-3320	38	4	additionally	additionally	ADV
finefocus-3320	38	5	tested	test	VERB
finefocus-3320	38	6	for	for	ADP
finefocus-3320	38	7	mdr	mdr	PROPN
finefocus-3320	38	8	.	.	PUNCT
finefocus-3320	39	1	we	we	PRON
finefocus-3320	39	2	hypothesized	hypothesize	VERB
finefocus-3320	39	3	that	that	SCONJ
finefocus-3320	39	4	antibiotic	antibiotic	ADJ
finefocus-3320	39	5	-	-	PUNCT
finefocus-3320	39	6	resistant	resistant	ADJ
finefocus-3320	39	7	bacteria	bacteria	NOUN
finefocus-3320	39	8	would	would	AUX
finefocus-3320	39	9	be	be	AUX
finefocus-3320	39	10	found	find	VERB
finefocus-3320	39	11	in	in	ADP
finefocus-3320	39	12	all	all	DET
finefocus-3320	39	13	ecological	ecological	ADJ
finefocus-3320	39	14	zones	zone	NOUN
finefocus-3320	39	15	studied	study	VERB
finefocus-3320	39	16	,	,	PUNCT
finefocus-3320	39	17	and	and	CCONJ
finefocus-3320	39	18	also	also	ADV
finefocus-3320	39	19	that	that	SCONJ
finefocus-3320	39	20	these	these	DET
finefocus-3320	39	21	bacteria	bacteria	NOUN
finefocus-3320	39	22	would	would	AUX
finefocus-3320	39	23	be	be	AUX
finefocus-3320	39	24	unique	unique	ADJ
finefocus-3320	39	25	to	to	ADP
finefocus-3320	39	26	their	their	PRON
finefocus-3320	39	27	specific	specific	ADJ
finefocus-3320	39	28	niche	niche	NOUN
finefocus-3320	39	29	.	.	PUNCT
finefocus-3320	40	1	our	our	PRON
finefocus-3320	40	2	findings	finding	NOUN
finefocus-3320	40	3	not	not	PART
finefocus-3320	40	4	only	only	ADV
finefocus-3320	40	5	supported	support	VERB
finefocus-3320	40	6	our	our	PRON
finefocus-3320	40	7	hypothesis	hypothesis	NOUN
finefocus-3320	40	8	by	by	ADP
finefocus-3320	40	9	showing	show	VERB
finefocus-3320	40	10	that	that	SCONJ
finefocus-3320	40	11	antibiotic	antibiotic	ADJ
finefocus-3320	40	12	-	-	PUNCT
finefocus-3320	40	13	resistant	resistant	ADJ
finefocus-3320	40	14	bacteria	bacteria	NOUN
finefocus-3320	40	15	were	be	AUX
finefocus-3320	40	16	found	find	VERB
finefocus-3320	40	17	in	in	ADP
finefocus-3320	40	18	all	all	DET
finefocus-3320	40	19	seven	seven	NUM
finefocus-3320	40	20	ecological	ecological	ADJ
finefocus-3320	40	21	zones	zone	NOUN
finefocus-3320	40	22	studied	study	VERB
finefocus-3320	40	23	,	,	PUNCT
finefocus-3320	40	24	but	but	CCONJ
finefocus-3320	40	25	that	that	DET
finefocus-3320	40	26	multidrug	multidrug	VERB
finefocus-3320	40	27	resistance	resistance	NOUN
finefocus-3320	40	28	can	can	AUX
finefocus-3320	40	29	also	also	ADV
finefocus-3320	40	30	be	be	AUX
finefocus-3320	40	31	prevalent	prevalent	ADJ
finefocus-3320	40	32	even	even	ADV
finefocus-3320	40	33	in	in	ADP
finefocus-3320	40	34	the	the	DET
finefocus-3320	40	35	absence	absence	NOUN
finefocus-3320	40	36	of	of	ADP
finefocus-3320	40	37	human	human	ADJ
finefocus-3320	40	38	development	development	NOUN
finefocus-3320	40	39	.	.	PUNCT
finefocus-3320	41	1	materials	material	NOUN
finefocus-3320	41	2	and	and	CCONJ
finefocus-3320	41	3	methods	method	NOUN
finefocus-3320	41	4	sample	sample	NOUN
finefocus-3320	41	5	collection	collection	NOUN
finefocus-3320	41	6	soil	soil	NOUN
finefocus-3320	41	7	samples	sample	NOUN
finefocus-3320	41	8	were	be	AUX
finefocus-3320	41	9	collected	collect	VERB
finefocus-3320	41	10	from	from	ADP
finefocus-3320	41	11	the	the	DET
finefocus-3320	41	12	primmer	primmer	NOUN
finefocus-3320	41	13	research	research	NOUN
finefocus-3320	41	14	property	property	NOUN
finefocus-3320	41	15	,	,	PUNCT
finefocus-3320	41	16	located	locate	VERB
finefocus-3320	41	17	in	in	ADP
finefocus-3320	41	18	logan	logan	PROPN
finefocus-3320	41	19	,	,	PUNCT
finefocus-3320	41	20	ohio	ohio	PROPN
finefocus-3320	41	21	.	.	PUNCT
finefocus-3320	42	1	fig	fig	NOUN
finefocus-3320	42	2	.	.	PUNCT
finefocus-3320	43	1	1	1	NUM
finefocus-3320	43	2	shows	show	VERB
finefocus-3320	43	3	a	a	DET
finefocus-3320	43	4	map	map	NOUN
finefocus-3320	43	5	of	of	ADP
finefocus-3320	43	6	primmer	primmer	NOUN
finefocus-3320	43	7	and	and	CCONJ
finefocus-3320	43	8	the	the	DET
finefocus-3320	43	9	locations	location	NOUN
finefocus-3320	43	10	of	of	ADP
finefocus-3320	43	11	the	the	DET
finefocus-3320	43	12	14	14	NUM
finefocus-3320	43	13	collection	collection	NOUN
finefocus-3320	43	14	sites	site	NOUN
finefocus-3320	43	15	from	from	ADP
finefocus-3320	43	16	the	the	DET
finefocus-3320	43	17	seven	seven	NUM
finefocus-3320	43	18	ecological	ecological	ADJ
finefocus-3320	43	19	zones	zone	NOUN
finefocus-3320	43	20	.	.	PUNCT
finefocus-3320	44	1	the	the	DET
finefocus-3320	44	2	distinct	distinct	ADJ
finefocus-3320	44	3	ecological	ecological	ADJ
finefocus-3320	44	4	zones	zone	NOUN
finefocus-3320	44	5	that	that	PRON
finefocus-3320	44	6	have	have	AUX
finefocus-3320	44	7	been	be	AUX
finefocus-3320	44	8	identified	identify	VERB
finefocus-3320	44	9	include	include	VERB
finefocus-3320	44	10	a	a	DET
finefocus-3320	44	11	grassland	grassland	NOUN
finefocus-3320	44	12	(	(	PUNCT
finefocus-3320	44	13	g	g	NOUN
finefocus-3320	44	14	)	)	PUNCT
finefocus-3320	44	15	,	,	PUNCT
finefocus-3320	44	16	a	a	DET
finefocus-3320	44	17	woodland	woodland	NOUN
finefocus-3320	44	18	(	(	PUNCT
finefocus-3320	44	19	wl	wl	PROPN
finefocus-3320	44	20	)	)	PUNCT
finefocus-3320	44	21	,	,	PUNCT
finefocus-3320	44	22	a	a	DET
finefocus-3320	44	23	wetland	wetland	NOUN
finefocus-3320	44	24	(	(	PUNCT
finefocus-3320	44	25	w	w	NOUN
finefocus-3320	44	26	)	)	PUNCT
finefocus-3320	44	27	,	,	PUNCT
finefocus-3320	44	28	a	a	DET
finefocus-3320	44	29	prairie	prairie	NOUN
finefocus-3320	44	30	(	(	PUNCT
finefocus-3320	44	31	f	f	NOUN
finefocus-3320	44	32	)	)	PUNCT
finefocus-3320	44	33	,	,	PUNCT
finefocus-3320	44	34	a	a	DET
finefocus-3320	44	35	spring	spring	NOUN
finefocus-3320	44	36	(	(	PUNCT
finefocus-3320	44	37	s	s	NOUN
finefocus-3320	44	38	)	)	PUNCT
finefocus-3320	44	39	and	and	CCONJ
finefocus-3320	44	40	a	a	DET
finefocus-3320	44	41	riparian	riparian	ADJ
finefocus-3320	44	42	zone	zone	NOUN
finefocus-3320	44	43	(	(	PUNCT
finefocus-3320	44	44	r	r	NOUN
finefocus-3320	44	45	)	)	PUNCT
finefocus-3320	44	46	.	.	PUNCT
finefocus-3320	45	1	since	since	SCONJ
finefocus-3320	45	2	clinical	clinical	ADJ
finefocus-3320	45	3	ar	ar	NOUN
finefocus-3320	45	4	genes	gene	NOUN
finefocus-3320	45	5	have	have	AUX
finefocus-3320	45	6	been	be	AUX
finefocus-3320	45	7	detected	detect	VERB
finefocus-3320	45	8	at	at	ADP
finefocus-3320	45	9	distances	distance	NOUN
finefocus-3320	45	10	up	up	ADP
finefocus-3320	45	11	to	to	PART
finefocus-3320	45	12	15	15	NUM
finefocus-3320	45	13	km	km	NOUN
finefocus-3320	45	14	from	from	ADP
finefocus-3320	45	15	the	the	DET
finefocus-3320	45	16	discharge	discharge	NOUN
finefocus-3320	45	17	point	point	NOUN
finefocus-3320	45	18	(	(	PUNCT
finefocus-3320	45	19	13	13	NUM
finefocus-3320	45	20	)	)	PUNCT
finefocus-3320	45	21	,	,	PUNCT
finefocus-3320	45	22	samples	sample	NOUN
finefocus-3320	45	23	were	be	AUX
finefocus-3320	45	24	also	also	ADV
finefocus-3320	45	25	collected	collect	VERB
finefocus-3320	45	26	from	from	ADP
finefocus-3320	45	27	the	the	DET
finefocus-3320	45	28	hocking	hocking	PROPN
finefocus-3320	45	29	river	river	PROPN
finefocus-3320	45	30	(	(	PUNCT
finefocus-3320	45	31	hr	hr	NOUN
finefocus-3320	45	32	)	)	PUNCT
finefocus-3320	45	33	to	to	PART
finefocus-3320	45	34	assess	assess	VERB
finefocus-3320	45	35	possible	possible	ADJ
finefocus-3320	45	36	pollution	pollution	NOUN
finefocus-3320	45	37	from	from	ADP
finefocus-3320	45	38	upstream	upstream	ADJ
finefocus-3320	45	39	locations	location	NOUN
finefocus-3320	45	40	.	.	PUNCT
finefocus-3320	46	1	soil	soil	NOUN
finefocus-3320	46	2	samples	sample	NOUN
finefocus-3320	46	3	were	be	AUX
finefocus-3320	46	4	collected	collect	VERB
finefocus-3320	46	5	between	between	ADP
finefocus-3320	46	6	may	may	PROPN
finefocus-3320	46	7	and	and	CCONJ
finefocus-3320	46	8	june	june	PROPN
finefocus-3320	46	9	2017	2017	NUM
finefocus-3320	46	10	.	.	PUNCT
finefocus-3320	47	1	gps	gps	PROPN
finefocus-3320	47	2	coordinates	coordinate	NOUN
finefocus-3320	47	3	in	in	ADP
finefocus-3320	47	4	decimal	decimal	ADJ
finefocus-3320	47	5	degrees	degree	NOUN
finefocus-3320	47	6	for	for	ADP
finefocus-3320	47	7	each	each	DET
finefocus-3320	47	8	collection	collection	NOUN
finefocus-3320	47	9	site	site	NOUN
finefocus-3320	47	10	were	be	AUX
finefocus-3320	47	11	recorded	record	VERB
finefocus-3320	47	12	(	(	PUNCT
finefocus-3320	47	13	table	table	NOUN
finefocus-3320	47	14	1	1	NUM
finefocus-3320	47	15	)	)	PUNCT
finefocus-3320	47	16	.	.	PUNCT
finefocus-3320	48	1	the	the	DET
finefocus-3320	48	2	sites	site	NOUN
finefocus-3320	48	3	were	be	AUX
finefocus-3320	48	4	primed	prime	VERB
finefocus-3320	48	5	by	by	ADP
finefocus-3320	48	6	loosening	loosen	VERB
finefocus-3320	48	7	up	up	ADP
finefocus-3320	48	8	the	the	DET
finefocus-3320	48	9	soil	soil	NOUN
finefocus-3320	48	10	with	with	ADP
finefocus-3320	48	11	a	a	DET
finefocus-3320	48	12	rock	rock	NOUN
finefocus-3320	48	13	or	or	CCONJ
finefocus-3320	48	14	piece	piece	NOUN
finefocus-3320	48	15	of	of	ADP
finefocus-3320	48	16	wood	wood	NOUN
finefocus-3320	48	17	from	from	ADP
finefocus-3320	48	18	the	the	DET
finefocus-3320	48	19	area	area	NOUN
finefocus-3320	48	20	.	.	PUNCT
finefocus-3320	49	1	soil	soil	NOUN
finefocus-3320	49	2	samples	sample	NOUN
finefocus-3320	49	3	were	be	AUX
finefocus-3320	49	4	isolated	isolate	VERB
finefocus-3320	49	5	an	an	DET
finefocus-3320	49	6	estimated	estimate	VERB
finefocus-3320	49	7	2.5	2.5	NUM
finefocus-3320	49	8	cm	cm	NOUN
finefocus-3320	49	9	below	below	ADP
finefocus-3320	49	10	the	the	DET
finefocus-3320	49	11	surface	surface	NOUN
finefocus-3320	49	12	from	from	ADP
finefocus-3320	49	13	the	the	DET
finefocus-3320	49	14	upper	upper	ADJ
finefocus-3320	49	15	soil	soil	NOUN
finefocus-3320	49	16	horizon	horizon	NOUN
finefocus-3320	49	17	,	,	PUNCT
finefocus-3320	49	18	or	or	CCONJ
finefocus-3320	49	19	topsoil	topsoil	NOUN
finefocus-3320	49	20	since	since	SCONJ
finefocus-3320	49	21	previous	previous	ADJ
finefocus-3320	49	22	studies	study	NOUN
finefocus-3320	49	23	have	have	AUX
finefocus-3320	49	24	showed	show	VERB
finefocus-3320	49	25	that	that	SCONJ
finefocus-3320	49	26	bacterial	bacterial	ADJ
finefocus-3320	49	27	populations	population	NOUN
finefocus-3320	49	28	are	be	AUX
finefocus-3320	49	29	most	most	ADV
finefocus-3320	49	30	abundant	abundant	ADJ
finefocus-3320	49	31	in	in	ADP
finefocus-3320	49	32	this	this	DET
finefocus-3320	49	33	soil	soil	NOUN
finefocus-3320	49	34	horizon	horizon	NOUN
finefocus-3320	49	35	(	(	PUNCT
finefocus-3320	49	36	15	15	NUM
finefocus-3320	49	37	)	)	PUNCT
finefocus-3320	49	38	.	.	PUNCT
finefocus-3320	50	1	samples	sample	NOUN
finefocus-3320	50	2	were	be	AUX
finefocus-3320	50	3	then	then	ADV
finefocus-3320	50	4	transported	transport	VERB
finefocus-3320	50	5	to	to	ADP
finefocus-3320	50	6	the	the	DET
finefocus-3320	50	7	laboratory	laboratory	NOUN
finefocus-3320	50	8	and	and	CCONJ
finefocus-3320	50	9	stored	store	VERB
finefocus-3320	50	10	at	at	ADP
finefocus-3320	50	11	4oc	4oc	ADJ
finefocus-3320	50	12	overnight	overnight	ADV
finefocus-3320	50	13	.	.	PUNCT
finefocus-3320	51	1	58	58	NUM
finefocus-3320	52	1	|	|	ADV
finefocus-3320	52	2	fine	fine	ADJ
finefocus-3320	52	3	focus	focus	NOUN
finefocus-3320	52	4	table	table	NOUN
finefocus-3320	52	5	1	1	NUM
finefocus-3320	52	6	.	.	PUNCT
finefocus-3320	53	1	gps	gps	PROPN
finefocus-3320	53	2	coordinates	coordinate	NOUN
finefocus-3320	53	3	of	of	ADP
finefocus-3320	53	4	sample	sample	NOUN
finefocus-3320	53	5	collection	collection	NOUN
finefocus-3320	53	6	sites	site	NOUN
finefocus-3320	53	7	.	.	PUNCT
finefocus-3320	54	1	volume	volume	NOUN
finefocus-3320	54	2	six	six	NUM
finefocus-3320	55	1	|	|	ADV
finefocus-3320	55	2	59	59	NUM
finefocus-3320	55	3	fig	fig	NOUN
finefocus-3320	55	4	1	1	NUM
finefocus-3320	55	5	.	.	PUNCT
finefocus-3320	55	6	map	map	NOUN
finefocus-3320	55	7	of	of	ADP
finefocus-3320	55	8	the	the	DET
finefocus-3320	55	9	primmer	primmer	NOUN
finefocus-3320	55	10	outdoor	outdoor	ADJ
finefocus-3320	55	11	learning	learning	NOUN
finefocus-3320	55	12	center	center	NOUN
finefocus-3320	55	13	and	and	CCONJ
finefocus-3320	55	14	sample	sample	NOUN
finefocus-3320	55	15	collection	collection	NOUN
finefocus-3320	55	16	sites	site	NOUN
finefocus-3320	55	17	.	.	PUNCT
finefocus-3320	56	1	primmer	primmer	NOUN
finefocus-3320	56	2	is	be	AUX
finefocus-3320	56	3	a	a	DET
finefocus-3320	56	4	0.3	0.3	NUM
finefocus-3320	56	5	km2	km2	NOUN
finefocus-3320	56	6	private	private	ADJ
finefocus-3320	56	7	research	research	NOUN
finefocus-3320	56	8	property	property	NOUN
finefocus-3320	56	9	with	with	ADP
finefocus-3320	56	10	seven	seven	NUM
finefocus-3320	56	11	unique	unique	ADJ
finefocus-3320	56	12	ecological	ecological	ADJ
finefocus-3320	56	13	zones	zone	NOUN
finefocus-3320	56	14	.	.	PUNCT
finefocus-3320	57	1	modified	modify	VERB
finefocus-3320	57	2	from	from	ADP
finefocus-3320	57	3	the	the	DET
finefocus-3320	57	4	usgs	usgs	PROPN
finefocus-3320	57	5	national	national	PROPN
finefocus-3320	57	6	map	map	NOUN
finefocus-3320	57	7	viewer	viewer	NOUN
finefocus-3320	57	8	(	(	PUNCT
finefocus-3320	57	9	2017	2017	NUM
finefocus-3320	57	10	)	)	PUNCT
finefocus-3320	57	11	.	.	PUNCT
finefocus-3320	58	1	sample	sample	NOUN
finefocus-3320	58	2	collection	collection	NOUN
finefocus-3320	58	3	sites	site	NOUN
finefocus-3320	58	4	are	be	AUX
finefocus-3320	58	5	noted	note	VERB
finefocus-3320	58	6	by	by	ADP
finefocus-3320	58	7	the	the	DET
finefocus-3320	58	8	pins	pin	NOUN
finefocus-3320	58	9	and	and	CCONJ
finefocus-3320	58	10	correspond	correspond	VERB
finefocus-3320	58	11	to	to	ADP
finefocus-3320	58	12	the	the	DET
finefocus-3320	58	13	ecosystems	ecosystem	NOUN
finefocus-3320	58	14	noted	note	VERB
finefocus-3320	58	15	in	in	ADP
finefocus-3320	58	16	the	the	DET
finefocus-3320	58	17	key	key	NOUN
finefocus-3320	58	18	.	.	PUNCT
finefocus-3320	59	1	60	60	NUM
finefocus-3320	60	1	|	|	ADV
finefocus-3320	60	2	fine	fine	ADJ
finefocus-3320	60	3	focus	focus	NOUN
finefocus-3320	60	4	determining	determine	VERB
finefocus-3320	60	5	the	the	DET
finefocus-3320	60	6	prevalence	prevalence	NOUN
finefocus-3320	60	7	of	of	ADP
finefocus-3320	60	8	antibiotic	antibiotic	ADJ
finefocus-3320	60	9	resistance	resistance	NOUN
finefocus-3320	60	10	macconkey	macconkey	NOUN
finefocus-3320	60	11	agar	agar	NOUN
finefocus-3320	60	12	and	and	CCONJ
finefocus-3320	60	13	nutrient	nutrient	NOUN
finefocus-3320	60	14	agar	agar	NOUN
finefocus-3320	60	15	plates	plate	NOUN
finefocus-3320	60	16	without	without	ADP
finefocus-3320	60	17	tetracycline	tetracycline	NOUN
finefocus-3320	60	18	(	(	PUNCT
finefocus-3320	60	19	na	na	NOUN
finefocus-3320	60	20	)	)	PUNCT
finefocus-3320	60	21	,	,	PUNCT
finefocus-3320	60	22	with	with	ADP
finefocus-3320	60	23	3	3	NUM
finefocus-3320	60	24	μg	μg	NOUN
finefocus-3320	60	25	/	/	SYM
finefocus-3320	60	26	ml	ml	PROPN
finefocus-3320	60	27	(	(	PUNCT
finefocus-3320	60	28	3tet	3tet	NOUN
finefocus-3320	60	29	)	)	PUNCT
finefocus-3320	60	30	,	,	PUNCT
finefocus-3320	60	31	or	or	CCONJ
finefocus-3320	60	32	30	30	NUM
finefocus-3320	60	33	μg/	μg/	NOUN
finefocus-3320	60	34	ml	ml	ADP
finefocus-3320	60	35	(	(	PUNCT
finefocus-3320	60	36	30tet	30tet	NOUN
finefocus-3320	60	37	)	)	PUNCT
finefocus-3320	60	38	tetracycline	tetracycline	PROPN
finefocus-3320	60	39	were	be	AUX
finefocus-3320	60	40	prepared	prepare	VERB
finefocus-3320	60	41	as	as	ADP
finefocus-3320	60	42	per	per	ADP
finefocus-3320	60	43	the	the	DET
finefocus-3320	60	44	manufacturer	manufacturer	NOUN
finefocus-3320	60	45	’s	’s	PART
finefocus-3320	60	46	instructions	instruction	NOUN
finefocus-3320	60	47	(	(	PUNCT
finefocus-3320	60	48	bd	bd	PROPN
finefocus-3320	60	49	biosciences	bioscience	NOUN
finefocus-3320	60	50	,	,	PUNCT
finefocus-3320	60	51	san	san	PROPN
finefocus-3320	60	52	jose	jose	PROPN
finefocus-3320	60	53	,	,	PUNCT
finefocus-3320	60	54	ca	ca	NOUN
finefocus-3320	60	55	)	)	PUNCT
finefocus-3320	60	56	.	.	PUNCT
finefocus-3320	61	1	all	all	DET
finefocus-3320	61	2	plates	plate	NOUN
finefocus-3320	61	3	also	also	ADV
finefocus-3320	61	4	contained	contain	VERB
finefocus-3320	61	5	10	10	NUM
finefocus-3320	61	6	μg	μg	NOUN
finefocus-3320	61	7	/	/	SYM
finefocus-3320	61	8	ml	ml	VERB
finefocus-3320	61	9	amphotericin	amphotericin	ADP
finefocus-3320	61	10	b	b	NOUN
finefocus-3320	61	11	to	to	PART
finefocus-3320	61	12	prevent	prevent	VERB
finefocus-3320	61	13	overgrowth	overgrowth	NOUN
finefocus-3320	61	14	on	on	ADP
finefocus-3320	61	15	plates	plate	NOUN
finefocus-3320	61	16	by	by	ADP
finefocus-3320	61	17	fungi	fungus	NOUN
finefocus-3320	61	18	in	in	ADP
finefocus-3320	61	19	the	the	DET
finefocus-3320	61	20	soil	soil	NOUN
finefocus-3320	61	21	.	.	PUNCT
finefocus-3320	62	1	one	one	NUM
finefocus-3320	62	2	gram	gram	NOUN
finefocus-3320	62	3	of	of	ADP
finefocus-3320	62	4	soil	soil	NOUN
finefocus-3320	62	5	was	be	AUX
finefocus-3320	62	6	measured	measure	VERB
finefocus-3320	62	7	,	,	PUNCT
finefocus-3320	62	8	serially	serially	ADV
finefocus-3320	62	9	diluted	dilute	VERB
finefocus-3320	62	10	for	for	ADP
finefocus-3320	62	11	five	five	NUM
finefocus-3320	62	12	1:10	1:10	NUM
finefocus-3320	62	13	dilutions	dilution	NOUN
finefocus-3320	62	14	in	in	ADP
finefocus-3320	62	15	sterile	sterile	ADJ
finefocus-3320	62	16	distilled	distil	VERB
finefocus-3320	62	17	water	water	NOUN
finefocus-3320	62	18	,	,	PUNCT
finefocus-3320	62	19	and	and	CCONJ
finefocus-3320	62	20	0.2	0.2	NUM
finefocus-3320	62	21	ml	ml	NOUN
finefocus-3320	62	22	of	of	ADP
finefocus-3320	62	23	each	each	DET
finefocus-3320	62	24	dilution	dilution	NOUN
finefocus-3320	62	25	were	be	AUX
finefocus-3320	62	26	plated	plate	VERB
finefocus-3320	62	27	on	on	ADP
finefocus-3320	62	28	all	all	DET
finefocus-3320	62	29	types	type	NOUN
finefocus-3320	62	30	of	of	ADP
finefocus-3320	62	31	media	medium	NOUN
finefocus-3320	62	32	using	use	VERB
finefocus-3320	62	33	sterile	sterile	ADJ
finefocus-3320	62	34	glass	glass	NOUN
finefocus-3320	62	35	beads	bead	NOUN
finefocus-3320	62	36	.	.	PUNCT
finefocus-3320	63	1	the	the	DET
finefocus-3320	63	2	plating	plating	NOUN
finefocus-3320	63	3	of	of	ADP
finefocus-3320	63	4	bacteria	bacteria	NOUN
finefocus-3320	63	5	was	be	AUX
finefocus-3320	63	6	done	do	VERB
finefocus-3320	63	7	in	in	ADP
finefocus-3320	63	8	duplicate	duplicate	NOUN
finefocus-3320	63	9	.	.	PUNCT
finefocus-3320	64	1	inoculated	inoculate	VERB
finefocus-3320	64	2	plates	plate	NOUN
finefocus-3320	64	3	were	be	AUX
finefocus-3320	64	4	wrapped	wrap	VERB
finefocus-3320	64	5	in	in	ADP
finefocus-3320	64	6	parafilm	parafilm	NOUN
finefocus-3320	64	7	and	and	CCONJ
finefocus-3320	64	8	incubated	incubate	VERB
finefocus-3320	64	9	at	at	ADP
finefocus-3320	64	10	28oc	28oc	NOUN
finefocus-3320	64	11	for	for	ADP
finefocus-3320	64	12	72	72	NUM
finefocus-3320	64	13	hours	hour	NOUN
finefocus-3320	64	14	.	.	PUNCT
finefocus-3320	65	1	the	the	DET
finefocus-3320	65	2	total	total	ADJ
finefocus-3320	65	3	number	number	NOUN
finefocus-3320	65	4	of	of	ADP
finefocus-3320	65	5	colony	colony	NOUN
finefocus-3320	65	6	-	-	PUNCT
finefocus-3320	65	7	forming	form	VERB
finefocus-3320	65	8	units	unit	NOUN
finefocus-3320	65	9	(	(	PUNCT
finefocus-3320	65	10	cfus	cfus	NOUN
finefocus-3320	65	11	)	)	PUNCT
finefocus-3320	65	12	was	be	AUX
finefocus-3320	65	13	determined	determine	VERB
finefocus-3320	65	14	from	from	ADP
finefocus-3320	65	15	countable	countable	ADJ
finefocus-3320	65	16	plates	plate	NOUN
finefocus-3320	65	17	without	without	ADP
finefocus-3320	65	18	tetracycline	tetracycline	NOUN
finefocus-3320	65	19	(	(	PUNCT
finefocus-3320	65	20	plates	plate	NOUN
finefocus-3320	65	21	with	with	ADP
finefocus-3320	65	22	30	30	NUM
finefocus-3320	65	23	-	-	SYM
finefocus-3320	65	24	300	300	NUM
finefocus-3320	65	25	colonies	colony	NOUN
finefocus-3320	65	26	and	and	CCONJ
finefocus-3320	65	27	no	no	DET
finefocus-3320	65	28	overgrowth	overgrowth	NOUN
finefocus-3320	65	29	)	)	PUNCT
finefocus-3320	65	30	.	.	PUNCT
finefocus-3320	66	1	the	the	DET
finefocus-3320	66	2	percent	percent	NOUN
finefocus-3320	66	3	tetracycline	tetracycline	NOUN
finefocus-3320	66	4	-	-	PUNCT
finefocus-3320	66	5	resistant	resistant	ADJ
finefocus-3320	66	6	colonies	colony	NOUN
finefocus-3320	66	7	were	be	AUX
finefocus-3320	66	8	determined	determine	VERB
finefocus-3320	66	9	by	by	ADP
finefocus-3320	66	10	counting	count	VERB
finefocus-3320	66	11	cfus	cfus	NOUN
finefocus-3320	66	12	from	from	ADP
finefocus-3320	66	13	the	the	DET
finefocus-3320	66	14	plates	plate	NOUN
finefocus-3320	66	15	containing	contain	VERB
finefocus-3320	66	16	tetracycline	tetracycline	NOUN
finefocus-3320	66	17	and	and	CCONJ
finefocus-3320	66	18	comparing	compare	VERB
finefocus-3320	66	19	them	they	PRON
finefocus-3320	66	20	with	with	ADP
finefocus-3320	66	21	the	the	DET
finefocus-3320	66	22	plates	plate	NOUN
finefocus-3320	66	23	lacking	lack	VERB
finefocus-3320	66	24	tetracycline	tetracycline	NOUN
finefocus-3320	66	25	.	.	PUNCT
finefocus-3320	67	1	colony	colony	NOUN
finefocus-3320	67	2	characterization	characterization	NOUN
finefocus-3320	67	3	after	after	ADP
finefocus-3320	67	4	incubation	incubation	NOUN
finefocus-3320	67	5	,	,	PUNCT
finefocus-3320	67	6	colonies	colony	NOUN
finefocus-3320	67	7	were	be	AUX
finefocus-3320	67	8	characterized	characterize	VERB
finefocus-3320	67	9	according	accord	VERB
finefocus-3320	67	10	to	to	ADP
finefocus-3320	67	11	morphological	morphological	ADJ
finefocus-3320	67	12	appearances	appearance	NOUN
finefocus-3320	67	13	as	as	ADP
finefocus-3320	67	14	in	in	ADP
finefocus-3320	67	15	breakwell	breakwell	ADJ
finefocus-3320	67	16	,	,	PUNCT
finefocus-3320	67	17	et	et	PROPN
finefocus-3320	67	18	al	al	PROPN
finefocus-3320	67	19	.	.	PROPN
finefocus-3320	67	20	,	,	PUNCT
finefocus-3320	67	21	2007	2007	NUM
finefocus-3320	67	22	(	(	PUNCT
finefocus-3320	67	23	7	7	NUM
finefocus-3320	67	24	)	)	PUNCT
finefocus-3320	67	25	.	.	PUNCT
finefocus-3320	68	1	colonies	colony	NOUN
finefocus-3320	68	2	of	of	ADP
finefocus-3320	68	3	different	different	ADJ
finefocus-3320	68	4	morphotypes	morphotype	NOUN
finefocus-3320	68	5	from	from	ADP
finefocus-3320	68	6	each	each	DET
finefocus-3320	68	7	ecological	ecological	ADJ
finefocus-3320	68	8	zone	zone	NOUN
finefocus-3320	68	9	were	be	AUX
finefocus-3320	68	10	selected	select	VERB
finefocus-3320	68	11	to	to	PART
finefocus-3320	68	12	test	test	VERB
finefocus-3320	68	13	for	for	ADP
finefocus-3320	68	14	additional	additional	ADJ
finefocus-3320	68	15	ar	ar	NOUN
finefocus-3320	68	16	.	.	PUNCT
finefocus-3320	69	1	all	all	DET
finefocus-3320	69	2	colonies	colony	NOUN
finefocus-3320	69	3	selected	select	VERB
finefocus-3320	69	4	were	be	AUX
finefocus-3320	69	5	resistant	resistant	ADJ
finefocus-3320	69	6	to	to	ADP
finefocus-3320	69	7	either	either	PRON
finefocus-3320	69	8	3	3	NUM
finefocus-3320	69	9	or	or	CCONJ
finefocus-3320	69	10	30	30	NUM
finefocus-3320	69	11	µg	µg	NOUN
finefocus-3320	69	12	/	/	SYM
finefocus-3320	69	13	ml	ml	NOUN
finefocus-3320	69	14	tetracycline	tetracycline	NOUN
finefocus-3320	69	15	.	.	PUNCT
finefocus-3320	70	1	the	the	DET
finefocus-3320	70	2	kirby	kirby	PROPN
finefocus-3320	70	3	-	-	PUNCT
finefocus-3320	70	4	bauer	bauer	PROPN
finefocus-3320	70	5	test	test	NOUN
finefocus-3320	70	6	for	for	ADP
finefocus-3320	70	7	antibiotic	antibiotic	ADJ
finefocus-3320	70	8	susceptibility	susceptibility	NOUN
finefocus-3320	70	9	was	be	AUX
finefocus-3320	70	10	performed	perform	VERB
finefocus-3320	70	11	as	as	ADP
finefocus-3320	70	12	in	in	ADP
finefocus-3320	70	13	hudzicki	hudzicki	NOUN
finefocus-3320	70	14	,	,	PUNCT
finefocus-3320	70	15	et	et	PROPN
finefocus-3320	70	16	al	al	PROPN
finefocus-3320	70	17	.	.	PROPN
finefocus-3320	70	18	,	,	PUNCT
finefocus-3320	70	19	2017	2017	NUM
finefocus-3320	70	20	(	(	PUNCT
finefocus-3320	70	21	24	24	NUM
finefocus-3320	70	22	)	)	PUNCT
finefocus-3320	70	23	.	.	PUNCT
finefocus-3320	71	1	tested	test	VERB
finefocus-3320	71	2	antibiotic	antibiotic	ADJ
finefocus-3320	71	3	discs	disc	NOUN
finefocus-3320	71	4	(	(	PUNCT
finefocus-3320	71	5	thermofisher	thermofisher	PROPN
finefocus-3320	71	6	scientific	scientific	PROPN
finefocus-3320	71	7	,	,	PUNCT
finefocus-3320	71	8	waltham	waltham	PROPN
finefocus-3320	71	9	,	,	PUNCT
finefocus-3320	71	10	ma	ma	PROPN
finefocus-3320	71	11	)	)	PUNCT
finefocus-3320	71	12	contained	contain	VERB
finefocus-3320	71	13	one	one	NUM
finefocus-3320	71	14	of	of	ADP
finefocus-3320	71	15	the	the	DET
finefocus-3320	71	16	following	following	NOUN
finefocus-3320	71	17	:	:	PUNCT
finefocus-3320	71	18	ciprofloxacin	ciprofloxacin	PROPN
finefocus-3320	71	19	(	(	PUNCT
finefocus-3320	71	20	5	5	NUM
finefocus-3320	71	21	μg	μg	NOUN
finefocus-3320	71	22	)	)	PUNCT
finefocus-3320	71	23	,	,	PUNCT
finefocus-3320	71	24	ampicillin	ampicillin	NOUN
finefocus-3320	71	25	(	(	PUNCT
finefocus-3320	71	26	10	10	NUM
finefocus-3320	71	27	μg	μg	NOUN
finefocus-3320	71	28	)	)	PUNCT
finefocus-3320	71	29	,	,	PUNCT
finefocus-3320	71	30	penicillin	penicillin	NOUN
finefocus-3320	71	31	(	(	PUNCT
finefocus-3320	71	32	10u	10u	NOUN
finefocus-3320	71	33	)	)	PUNCT
finefocus-3320	71	34	,	,	PUNCT
finefocus-3320	71	35	and	and	CCONJ
finefocus-3320	71	36	a	a	DET
finefocus-3320	71	37	tetracycline	tetracycline	NOUN
finefocus-3320	71	38	control	control	NOUN
finefocus-3320	71	39	(	(	PUNCT
finefocus-3320	71	40	30	30	NUM
finefocus-3320	71	41	μg	μg	NOUN
finefocus-3320	71	42	)	)	PUNCT
finefocus-3320	71	43	.	.	PUNCT
finefocus-3320	72	1	these	these	DET
finefocus-3320	72	2	antibiotics	antibiotic	NOUN
finefocus-3320	72	3	were	be	AUX
finefocus-3320	72	4	chosen	choose	VERB
finefocus-3320	72	5	based	base	VERB
finefocus-3320	72	6	on	on	ADP
finefocus-3320	72	7	their	their	PRON
finefocus-3320	72	8	use	use	NOUN
finefocus-3320	72	9	in	in	ADP
finefocus-3320	72	10	human	human	ADJ
finefocus-3320	72	11	and	and	CCONJ
finefocus-3320	72	12	veterinary	veterinary	ADJ
finefocus-3320	72	13	medicine	medicine	NOUN
finefocus-3320	72	14	(	(	PUNCT
finefocus-3320	72	15	11	11	NUM
finefocus-3320	72	16	,	,	PUNCT
finefocus-3320	72	17	54	54	NUM
finefocus-3320	72	18	)	)	PUNCT
finefocus-3320	72	19	.	.	PUNCT
finefocus-3320	73	1	the	the	DET
finefocus-3320	73	2	diameter	diameter	NOUN
finefocus-3320	73	3	of	of	ADP
finefocus-3320	73	4	each	each	DET
finefocus-3320	73	5	zone	zone	NOUN
finefocus-3320	73	6	of	of	ADP
finefocus-3320	73	7	inhibition	inhibition	NOUN
finefocus-3320	73	8	was	be	AUX
finefocus-3320	73	9	compared	compare	VERB
finefocus-3320	73	10	to	to	ADP
finefocus-3320	73	11	the	the	DET
finefocus-3320	73	12	standard	standard	NOUN
finefocus-3320	73	13	set	set	VERB
finefocus-3320	73	14	by	by	ADP
finefocus-3320	73	15	the	the	DET
finefocus-3320	73	16	national	national	PROPN
finefocus-3320	73	17	committee	committee	PROPN
finefocus-3320	73	18	of	of	ADP
finefocus-3320	73	19	clinical	clinical	ADJ
finefocus-3320	73	20	laboratory	laboratory	NOUN
finefocus-3320	73	21	studies	study	NOUN
finefocus-3320	73	22	(	(	PUNCT
finefocus-3320	73	23	nccls	nccls	NOUN
finefocus-3320	73	24	)	)	PUNCT
finefocus-3320	73	25	to	to	PART
finefocus-3320	73	26	determine	determine	VERB
finefocus-3320	73	27	if	if	SCONJ
finefocus-3320	73	28	the	the	DET
finefocus-3320	73	29	isolate	isolate	NOUN
finefocus-3320	73	30	displayed	display	VERB
finefocus-3320	73	31	resistance	resistance	NOUN
finefocus-3320	73	32	(	(	PUNCT
finefocus-3320	73	33	r	r	NOUN
finefocus-3320	73	34	)	)	PUNCT
finefocus-3320	73	35	,	,	PUNCT
finefocus-3320	73	36	susceptibility	susceptibility	NOUN
finefocus-3320	73	37	(	(	PUNCT
finefocus-3320	73	38	s	s	NOUN
finefocus-3320	73	39	)	)	PUNCT
finefocus-3320	73	40	,	,	PUNCT
finefocus-3320	73	41	or	or	CCONJ
finefocus-3320	73	42	was	be	AUX
finefocus-3320	73	43	intermediate	intermediate	ADJ
finefocus-3320	73	44	(	(	PUNCT
finefocus-3320	73	45	i	i	NOUN
finefocus-3320	73	46	)	)	PUNCT
finefocus-3320	73	47	.	.	PUNCT
finefocus-3320	74	1	pcr	pcr	PROPN
finefocus-3320	74	2	and	and	CCONJ
finefocus-3320	74	3	sequencing	sequence	VERB
finefocus-3320	74	4	dna	dna	NOUN
finefocus-3320	74	5	was	be	AUX
finefocus-3320	74	6	extracted	extract	VERB
finefocus-3320	74	7	from	from	ADP
finefocus-3320	74	8	isolates	isolate	NOUN
finefocus-3320	74	9	by	by	ADP
finefocus-3320	74	10	a	a	DET
finefocus-3320	74	11	boiling	boiling	NOUN
finefocus-3320	74	12	lysis	lysis	NOUN
finefocus-3320	74	13	protocol	protocol	NOUN
finefocus-3320	74	14	as	as	SCONJ
finefocus-3320	74	15	found	find	VERB
finefocus-3320	74	16	in	in	ADP
finefocus-3320	74	17	queipo	queipo	NOUN
finefocus-3320	74	18	-	-	PUNCT
finefocus-3320	74	19	ortuño	ortuño	PROPN
finefocus-3320	74	20	et	et	PROPN
finefocus-3320	74	21	al	al	PROPN
finefocus-3320	74	22	.	.	PROPN
finefocus-3320	74	23	,	,	PUNCT
finefocus-3320	74	24	2008	2008	NUM
finefocus-3320	74	25	(	(	PUNCT
finefocus-3320	74	26	37	37	NUM
finefocus-3320	74	27	)	)	PUNCT
finefocus-3320	74	28	.	.	PUNCT
finefocus-3320	75	1	for	for	ADP
finefocus-3320	75	2	each	each	DET
finefocus-3320	75	3	sample	sample	NOUN
finefocus-3320	75	4	,	,	PUNCT
finefocus-3320	75	5	pcr	pcr	PROPN
finefocus-3320	75	6	was	be	AUX
finefocus-3320	75	7	performed	perform	VERB
finefocus-3320	75	8	using	use	VERB
finefocus-3320	75	9	one	one	NUM
finefocus-3320	75	10	of	of	ADP
finefocus-3320	75	11	two	two	NUM
finefocus-3320	75	12	different	different	ADJ
finefocus-3320	75	13	primer	primer	NOUN
finefocus-3320	75	14	pairs	pair	NOUN
finefocus-3320	75	15	for	for	ADP
finefocus-3320	75	16	part	part	NOUN
finefocus-3320	75	17	of	of	ADP
finefocus-3320	75	18	the	the	DET
finefocus-3320	75	19	16s	16s	PROPN
finefocus-3320	75	20	rrna	rrna	PROPN
finefocus-3320	75	21	gene	gene	NOUN
finefocus-3320	75	22	.	.	PUNCT
finefocus-3320	76	1	primer	primer	NOUN
finefocus-3320	76	2	pairs	pair	NOUN
finefocus-3320	76	3	were	be	AUX
finefocus-3320	76	4	:	:	PUNCT
finefocus-3320	76	5	(	(	PUNCT
finefocus-3320	76	6	i	i	NOUN
finefocus-3320	76	7	):	):	PUNCT
finefocus-3320	76	8	bakt_341f	bakt_341f	PROPN
finefocus-3320	76	9	,	,	PUNCT
finefocus-3320	76	10	(	(	PUNCT
finefocus-3320	76	11	cctacgggnggcwgcag	cctacgggnggcwgcag	ADP
finefocus-3320	76	12	)	)	PUNCT
finefocus-3320	76	13	,	,	PUNCT
finefocus-3320	76	14	and	and	CCONJ
finefocus-3320	76	15	bakt_805r	bakt_805r	PROPN
finefocus-3320	76	16	,	,	PUNCT
finefocus-3320	76	17	(	(	PUNCT
finefocus-3320	76	18	gactachvgggtatctaatcc	gactachvgggtatctaatcc	NOUN
finefocus-3320	76	19	)	)	PUNCT
finefocus-3320	76	20	(	(	PUNCT
finefocus-3320	76	21	21	21	NUM
finefocus-3320	76	22	,	,	PUNCT
finefocus-3320	76	23	25	25	NUM
finefocus-3320	76	24	)	)	PUNCT
finefocus-3320	76	25	and	and	CCONJ
finefocus-3320	76	26	(	(	PUNCT
finefocus-3320	76	27	ii	ii	NOUN
finefocus-3320	76	28	):	):	PUNCT
finefocus-3320	76	29	pa/27f	pa/27f	PROPN
finefocus-3320	76	30	,	,	PUNCT
finefocus-3320	76	31	(	(	PUNCT
finefocus-3320	76	32	agagtttgatcctggctcag	agagtttgatcctggctcag	X
finefocus-3320	76	33	)	)	PUNCT
finefocus-3320	76	34	(	(	PUNCT
finefocus-3320	76	35	14	14	NUM
finefocus-3320	76	36	,	,	PUNCT
finefocus-3320	76	37	27	27	NUM
finefocus-3320	76	38	)	)	PUNCT
finefocus-3320	76	39	,	,	PUNCT
finefocus-3320	76	40	and	and	CCONJ
finefocus-3320	76	41	1492r	1492r	NUM
finefocus-3320	76	42	,	,	PUNCT
finefocus-3320	76	43	(	(	PUNCT
finefocus-3320	76	44	tacgggtaccttgttacgactt	tacgggtaccttgttacgactt	NOUN
finefocus-3320	76	45	)	)	PUNCT
finefocus-3320	76	46	(	(	PUNCT
finefocus-3320	76	47	27	27	NUM
finefocus-3320	76	48	,	,	PUNCT
finefocus-3320	76	49	44	44	NUM
finefocus-3320	76	50	)	)	PUNCT
finefocus-3320	76	51	.	.	PUNCT
finefocus-3320	77	1	pcr	pcr	ADJ
finefocus-3320	77	2	products	product	NOUN
finefocus-3320	77	3	were	be	AUX
finefocus-3320	77	4	purified	purify	VERB
finefocus-3320	77	5	using	use	VERB
finefocus-3320	77	6	the	the	DET
finefocus-3320	77	7	dna	dna	PROPN
finefocus-3320	77	8	clean	clean	ADJ
finefocus-3320	77	9	and	and	CCONJ
finefocus-3320	77	10	concentrator	concentrator	PROPN
finefocus-3320	77	11	kit	kit	NOUN
finefocus-3320	77	12	(	(	PUNCT
finefocus-3320	77	13	zymo	zymo	NOUN
finefocus-3320	77	14	research	research	NOUN
finefocus-3320	77	15	,	,	PUNCT
finefocus-3320	77	16	irvine	irvine	PROPN
finefocus-3320	77	17	,	,	PUNCT
finefocus-3320	77	18	ca	ca	PROPN
finefocus-3320	77	19	)	)	PUNCT
finefocus-3320	77	20	and	and	CCONJ
finefocus-3320	77	21	then	then	ADV
finefocus-3320	77	22	sequenced	sequence	VERB
finefocus-3320	77	23	using	use	VERB
finefocus-3320	77	24	the	the	DET
finefocus-3320	77	25	forward	forward	ADJ
finefocus-3320	77	26	primer	primer	NOUN
finefocus-3320	77	27	used	use	VERB
finefocus-3320	77	28	for	for	ADP
finefocus-3320	77	29	amplification	amplification	NOUN
finefocus-3320	77	30	by	by	ADP
finefocus-3320	77	31	the	the	DET
finefocus-3320	77	32	ohio	ohio	PROPN
finefocus-3320	77	33	state	state	PROPN
finefocus-3320	77	34	university	university	PROPN
finefocus-3320	77	35	comprehensive	comprehensive	ADJ
finefocus-3320	77	36	cancer	cancer	NOUN
finefocus-3320	77	37	center	center	NOUN
finefocus-3320	77	38	genomics	genomic	NOUN
finefocus-3320	77	39	shared	share	VERB
finefocus-3320	77	40	resource	resource	NOUN
finefocus-3320	77	41	facility	facility	NOUN
finefocus-3320	77	42	.	.	PUNCT
finefocus-3320	78	1	resulting	result	VERB
finefocus-3320	78	2	sequences	sequence	NOUN
finefocus-3320	78	3	were	be	AUX
finefocus-3320	78	4	compared	compare	VERB
finefocus-3320	78	5	to	to	ADP
finefocus-3320	78	6	previously	previously	ADV
finefocus-3320	78	7	published	publish	VERB
finefocus-3320	78	8	sequences	sequence	NOUN
finefocus-3320	78	9	using	use	VERB
finefocus-3320	78	10	the	the	DET
finefocus-3320	78	11	basic	basic	ADJ
finefocus-3320	78	12	local	local	ADJ
finefocus-3320	78	13	alignment	alignment	NOUN
finefocus-3320	78	14	search	search	NOUN
finefocus-3320	78	15	tool	tool	NOUN
finefocus-3320	78	16	(	(	PUNCT
finefocus-3320	78	17	blast	blast	NOUN
finefocus-3320	78	18	)	)	PUNCT
finefocus-3320	78	19	program	program	NOUN
finefocus-3320	78	20	(	(	PUNCT
finefocus-3320	78	21	national	national	ADJ
finefocus-3320	78	22	center	center	NOUN
finefocus-3320	78	23	for	for	ADP
finefocus-3320	78	24	biotechnology	biotechnology	NOUN
finefocus-3320	78	25	information	information	NOUN
finefocus-3320	78	26	)	)	PUNCT
finefocus-3320	78	27	.	.	PUNCT
finefocus-3320	79	1	results	result	VERB
finefocus-3320	79	2	percentage	percentage	NOUN
finefocus-3320	79	3	of	of	ADP
finefocus-3320	79	4	antibiotic	antibiotic	ADJ
finefocus-3320	79	5	-	-	PUNCT
finefocus-3320	79	6	resistant	resistant	ADJ
finefocus-3320	79	7	bacteria	bacteria	NOUN
finefocus-3320	79	8	present	present	ADJ
finefocus-3320	79	9	in	in	ADP
finefocus-3320	79	10	soil	soil	NOUN
finefocus-3320	79	11	to	to	PART
finefocus-3320	79	12	assess	assess	VERB
finefocus-3320	79	13	the	the	DET
finefocus-3320	79	14	prevalence	prevalence	NOUN
finefocus-3320	79	15	of	of	ADP
finefocus-3320	79	16	ar	ar	NOUN
finefocus-3320	79	17	in	in	ADP
finefocus-3320	79	18	the	the	DET
finefocus-3320	79	19	seven	seven	NUM
finefocus-3320	79	20	different	different	ADJ
finefocus-3320	79	21	ecosystems	ecosystem	NOUN
finefocus-3320	79	22	,	,	PUNCT
finefocus-3320	79	23	we	we	PRON
finefocus-3320	79	24	collected	collect	VERB
finefocus-3320	79	25	samples	sample	NOUN
finefocus-3320	79	26	from	from	ADP
finefocus-3320	79	27	two	two	NUM
finefocus-3320	79	28	different	different	ADJ
finefocus-3320	79	29	sites	site	NOUN
finefocus-3320	79	30	from	from	ADP
finefocus-3320	79	31	each	each	PRON
finefocus-3320	79	32	of	of	ADP
finefocus-3320	79	33	the	the	DET
finefocus-3320	79	34	seven	seven	NUM
finefocus-3320	79	35	ecological	ecological	ADJ
finefocus-3320	79	36	zones	zone	NOUN
finefocus-3320	79	37	present	present	ADJ
finefocus-3320	79	38	within	within	ADP
finefocus-3320	79	39	the	the	DET
finefocus-3320	79	40	primmer	primmer	NOUN
finefocus-3320	79	41	research	research	NOUN
finefocus-3320	79	42	property	property	NOUN
finefocus-3320	79	43	(	(	PUNCT
finefocus-3320	79	44	fig	fig	NOUN
finefocus-3320	79	45	1	1	NUM
finefocus-3320	79	46	)	)	PUNCT
finefocus-3320	79	47	.	.	PUNCT
finefocus-3320	80	1	soil	soil	NOUN
finefocus-3320	80	2	samples	sample	NOUN
finefocus-3320	80	3	were	be	AUX
finefocus-3320	80	4	serially	serially	ADV
finefocus-3320	80	5	-	-	PUNCT
finefocus-3320	80	6	diluted	dilute	VERB
finefocus-3320	80	7	and	and	CCONJ
finefocus-3320	80	8	plated	plate	VERB
finefocus-3320	80	9	onto	onto	ADP
finefocus-3320	80	10	media	medium	NOUN
finefocus-3320	80	11	with	with	ADP
finefocus-3320	80	12	or	or	CCONJ
finefocus-3320	80	13	without	without	ADP
finefocus-3320	80	14	tetracycline	tetracycline	NOUN
finefocus-3320	80	15	.	.	PUNCT
finefocus-3320	81	1	two	two	NUM
finefocus-3320	81	2	different	different	ADJ
finefocus-3320	81	3	types	type	NOUN
finefocus-3320	81	4	of	of	ADP
finefocus-3320	81	5	media	medium	NOUN
finefocus-3320	81	6	and	and	CCONJ
finefocus-3320	81	7	two	two	NUM
finefocus-3320	81	8	different	different	ADJ
finefocus-3320	81	9	concentrations	concentration	NOUN
finefocus-3320	81	10	(	(	PUNCT
finefocus-3320	81	11	3	3	NUM
finefocus-3320	81	12	or	or	CCONJ
finefocus-3320	81	13	30	30	NUM
finefocus-3320	81	14	μg	μg	NOUN
finefocus-3320	81	15	/	/	SYM
finefocus-3320	81	16	ml	ml	NOUN
finefocus-3320	81	17	)	)	PUNCT
finefocus-3320	81	18	of	of	ADP
finefocus-3320	81	19	tetracycline	tetracycline	NOUN
finefocus-3320	81	20	were	be	AUX
finefocus-3320	81	21	used	use	VERB
finefocus-3320	81	22	.	.	PUNCT
finefocus-3320	82	1	macconkey	macconkey	NOUN
finefocus-3320	82	2	agar	agar	NOUN
finefocus-3320	82	3	was	be	AUX
finefocus-3320	82	4	used	use	VERB
finefocus-3320	82	5	so	so	SCONJ
finefocus-3320	82	6	that	that	SCONJ
finefocus-3320	82	7	a	a	DET
finefocus-3320	82	8	portion	portion	NOUN
finefocus-3320	82	9	of	of	ADP
finefocus-3320	82	10	our	our	PRON
finefocus-3320	82	11	results	result	NOUN
finefocus-3320	82	12	could	could	AUX
finefocus-3320	82	13	be	be	AUX
finefocus-3320	82	14	contributed	contribute	VERB
finefocus-3320	82	15	to	to	ADP
finefocus-3320	82	16	the	the	DET
finefocus-3320	82	17	pare	pare	PROPN
finefocus-3320	82	18	database	database	NOUN
finefocus-3320	82	19	,	,	PUNCT
finefocus-3320	82	20	allowing	allow	VERB
finefocus-3320	82	21	future	future	ADJ
finefocus-3320	82	22	volume	volume	NOUN
finefocus-3320	82	23	six	six	NUM
finefocus-3320	82	24	|	|	ADV
finefocus-3320	82	25	61	61	NUM
finefocus-3320	82	26	comparisons	comparison	NOUN
finefocus-3320	82	27	between	between	ADP
finefocus-3320	82	28	additional	additional	ADJ
finefocus-3320	82	29	data	datum	NOUN
finefocus-3320	82	30	collected	collect	VERB
finefocus-3320	82	31	from	from	ADP
finefocus-3320	82	32	other	other	ADJ
finefocus-3320	82	33	sites	site	NOUN
finefocus-3320	82	34	.	.	PUNCT
finefocus-3320	83	1	macconkey	macconkey	NOUN
finefocus-3320	83	2	agar	agar	NOUN
finefocus-3320	83	3	is	be	AUX
finefocus-3320	83	4	the	the	DET
finefocus-3320	83	5	current	current	ADJ
finefocus-3320	83	6	standard	standard	ADJ
finefocus-3320	83	7	media	medium	NOUN
finefocus-3320	83	8	used	use	VERB
finefocus-3320	83	9	by	by	ADP
finefocus-3320	83	10	the	the	DET
finefocus-3320	83	11	pare	pare	PROPN
finefocus-3320	83	12	project	project	NOUN
finefocus-3320	83	13	as	as	SCONJ
finefocus-3320	83	14	it	it	PRON
finefocus-3320	83	15	commonly	commonly	ADV
finefocus-3320	83	16	results	result	VERB
finefocus-3320	83	17	in	in	ADP
finefocus-3320	83	18	more	more	ADJ
finefocus-3320	83	19	uniform	uniform	ADJ
finefocus-3320	83	20	colony	colony	NOUN
finefocus-3320	83	21	morphology	morphology	NOUN
finefocus-3320	83	22	,	,	PUNCT
finefocus-3320	83	23	which	which	PRON
finefocus-3320	83	24	makes	make	VERB
finefocus-3320	83	25	colony	colony	NOUN
finefocus-3320	83	26	counting	count	VERB
finefocus-3320	83	27	more	more	ADV
finefocus-3320	83	28	accurate	accurate	ADJ
finefocus-3320	83	29	(	(	PUNCT
finefocus-3320	83	30	18	18	NUM
finefocus-3320	83	31	)	)	PUNCT
finefocus-3320	83	32	.	.	PUNCT
finefocus-3320	84	1	nutrient	nutrient	NOUN
finefocus-3320	84	2	agar	agar	NOUN
finefocus-3320	84	3	was	be	AUX
finefocus-3320	84	4	used	use	VERB
finefocus-3320	84	5	to	to	PART
finefocus-3320	84	6	better	well	ADV
finefocus-3320	84	7	assess	assess	VERB
finefocus-3320	84	8	the	the	DET
finefocus-3320	84	9	diversity	diversity	NOUN
finefocus-3320	84	10	of	of	ADP
finefocus-3320	84	11	bacteria	bacteria	NOUN
finefocus-3320	84	12	present	present	ADJ
finefocus-3320	84	13	.	.	PUNCT
finefocus-3320	85	1	of	of	ADP
finefocus-3320	85	2	the	the	DET
finefocus-3320	85	3	macconkey	macconkey	NOUN
finefocus-3320	85	4	agar	agar	NOUN
finefocus-3320	85	5	data	datum	NOUN
finefocus-3320	85	6	,	,	PUNCT
finefocus-3320	85	7	sites	site	NOUN
finefocus-3320	85	8	f2	f2	PROPN
finefocus-3320	85	9	,	,	PUNCT
finefocus-3320	85	10	hr1	hr1	PROPN
finefocus-3320	85	11	,	,	PUNCT
finefocus-3320	85	12	and	and	CCONJ
finefocus-3320	85	13	g1	g1	PROPN
finefocus-3320	85	14	exhibited	exhibit	VERB
finefocus-3320	85	15	the	the	DET
finefocus-3320	85	16	highest	high	ADJ
finefocus-3320	85	17	percentage	percentage	NOUN
finefocus-3320	85	18	of	of	ADP
finefocus-3320	85	19	resistance	resistance	NOUN
finefocus-3320	85	20	to	to	ADP
finefocus-3320	85	21	3	3	NUM
finefocus-3320	85	22	µg	µg	NOUN
finefocus-3320	85	23	/	/	SYM
finefocus-3320	85	24	ml	ml	NOUN
finefocus-3320	85	25	of	of	ADP
finefocus-3320	85	26	tetracycline	tetracycline	NOUN
finefocus-3320	85	27	with	with	ADP
finefocus-3320	85	28	the	the	DET
finefocus-3320	85	29	number	number	NOUN
finefocus-3320	85	30	of	of	ADP
finefocus-3320	85	31	resistant	resistant	ADJ
finefocus-3320	85	32	colonies	colony	NOUN
finefocus-3320	85	33	at	at	ADP
finefocus-3320	85	34	greater	great	ADJ
finefocus-3320	85	35	than	than	ADP
finefocus-3320	85	36	10	10	NUM
finefocus-3320	85	37	%	%	NOUN
finefocus-3320	85	38	(	(	PUNCT
finefocus-3320	85	39	table	table	NOUN
finefocus-3320	85	40	2	2	NUM
finefocus-3320	85	41	)	)	PUNCT
finefocus-3320	85	42	.	.	PUNCT
finefocus-3320	86	1	only	only	ADV
finefocus-3320	86	2	five	five	NUM
finefocus-3320	86	3	sites	site	NOUN
finefocus-3320	86	4	(	(	PUNCT
finefocus-3320	86	5	s1	s1	NOUN
finefocus-3320	86	6	,	,	PUNCT
finefocus-3320	86	7	wl1	wl1	PROPN
finefocus-3320	86	8	,	,	PUNCT
finefocus-3320	86	9	hr1	hr1	PROPN
finefocus-3320	86	10	,	,	PUNCT
finefocus-3320	86	11	hr2	hr2	PROPN
finefocus-3320	86	12	,	,	PUNCT
finefocus-3320	86	13	and	and	CCONJ
finefocus-3320	86	14	r1	r1	PROPN
finefocus-3320	86	15	)	)	PUNCT
finefocus-3320	86	16	displayed	display	VERB
finefocus-3320	86	17	resistance	resistance	NOUN
finefocus-3320	86	18	to	to	ADP
finefocus-3320	86	19	the	the	DET
finefocus-3320	86	20	higher	high	ADJ
finefocus-3320	86	21	concentration	concentration	NOUN
finefocus-3320	86	22	of	of	ADP
finefocus-3320	86	23	tetracycline	tetracycline	NOUN
finefocus-3320	86	24	(	(	PUNCT
finefocus-3320	86	25	30	30	NUM
finefocus-3320	86	26	µg/	µg/	NOUN
finefocus-3320	86	27	ml	ml	NOUN
finefocus-3320	86	28	)	)	PUNCT
finefocus-3320	86	29	.	.	PUNCT
finefocus-3320	87	1	with	with	ADP
finefocus-3320	87	2	the	the	DET
finefocus-3320	87	3	exception	exception	NOUN
finefocus-3320	87	4	of	of	ADP
finefocus-3320	87	5	hr2	hr2	NOUN
finefocus-3320	87	6	,	,	PUNCT
finefocus-3320	87	7	these	these	DET
finefocus-3320	87	8	sites	site	NOUN
finefocus-3320	87	9	showed	show	VERB
finefocus-3320	87	10	a	a	DET
finefocus-3320	87	11	decrease	decrease	NOUN
finefocus-3320	87	12	in	in	ADP
finefocus-3320	87	13	the	the	DET
finefocus-3320	87	14	percentage	percentage	NOUN
finefocus-3320	87	15	of	of	ADP
finefocus-3320	87	16	resistant	resistant	ADJ
finefocus-3320	87	17	colonies	colony	NOUN
finefocus-3320	87	18	to	to	ADP
finefocus-3320	87	19	the	the	DET
finefocus-3320	87	20	higher	high	ADJ
finefocus-3320	87	21	concentration	concentration	NOUN
finefocus-3320	87	22	of	of	ADP
finefocus-3320	87	23	tetracycline	tetracycline	NOUN
finefocus-3320	87	24	.	.	PUNCT
finefocus-3320	88	1	all	all	PRON
finefocus-3320	88	2	but	but	SCONJ
finefocus-3320	88	3	one	one	NUM
finefocus-3320	88	4	site	site	NOUN
finefocus-3320	88	5	(	(	PUNCT
finefocus-3320	88	6	s2	s2	PROPN
finefocus-3320	88	7	)	)	PUNCT
finefocus-3320	88	8	showed	show	VERB
finefocus-3320	88	9	resistant	resistant	ADJ
finefocus-3320	88	10	colonies	colony	NOUN
finefocus-3320	88	11	at	at	ADP
finefocus-3320	88	12	some	some	DET
finefocus-3320	88	13	level	level	NOUN
finefocus-3320	88	14	of	of	ADP
finefocus-3320	88	15	tetracycline	tetracycline	ADJ
finefocus-3320	88	16	concentration	concentration	NOUN
finefocus-3320	88	17	.	.	PUNCT
finefocus-3320	89	1	62	62	NUM
finefocus-3320	89	2	|	|	ADV
finefocus-3320	89	3	fine	fine	ADJ
finefocus-3320	89	4	focus	focus	NOUN
finefocus-3320	89	5	table	table	NOUN
finefocus-3320	89	6	2	2	NUM
finefocus-3320	89	7	.	.	PUNCT
finefocus-3320	89	8	percentage	percentage	NOUN
finefocus-3320	89	9	of	of	ADP
finefocus-3320	89	10	bacterial	bacterial	ADJ
finefocus-3320	89	11	colomes	colome	NOUN
finefocus-3320	89	12	plated	plate	VERB
finefocus-3320	89	13	on	on	ADP
finefocus-3320	89	14	macconkey	macconkey	NOUN
finefocus-3320	89	15	agar	agar	NOUN
finefocus-3320	89	16	and	and	CCONJ
finefocus-3320	89	17	nutrient	nutrient	NOUN
finefocus-3320	89	18	agar	agar	NOUN
finefocus-3320	89	19	media	medium	NOUN
finefocus-3320	89	20	resistant	resistant	ADJ
finefocus-3320	89	21	to	to	ADP
finefocus-3320	89	22	3	3	NUM
finefocus-3320	89	23	µg	µg	NOUN
finefocus-3320	89	24	/	/	SYM
finefocus-3320	89	25	ml	ml	NOUN
finefocus-3320	89	26	or	or	CCONJ
finefocus-3320	89	27	30	30	NUM
finefocus-3320	89	28	µg	µg	NOUN
finefocus-3320	89	29	/	/	SYM
finefocus-3320	89	30	ml	ml	NOUN
finefocus-3320	89	31	tetracycline	tetracycline	NOUN
finefocus-3320	89	32	.	.	PUNCT
finefocus-3320	90	1	and	and	CCONJ
finefocus-3320	90	2	:	:	PUNCT
finefocus-3320	90	3	not	not	PART
finefocus-3320	90	4	determined	determine	VERB
finefocus-3320	90	5	due	due	ADJ
finefocus-3320	90	6	to	to	ADP
finefocus-3320	90	7	low	low	ADJ
finefocus-3320	90	8	coloy	coloy	PROPN
finefocus-3320	90	9	counts	count	NOUN
finefocus-3320	90	10	(	(	PUNCT
finefocus-3320	90	11	<	<	NOUN
finefocus-3320	90	12	30	30	NUM
finefocus-3320	90	13	)	)	PUNCT
finefocus-3320	90	14	present	present	NOUN
finefocus-3320	90	15	on	on	ADP
finefocus-3320	90	16	plates	plate	NOUN
finefocus-3320	90	17	without	without	ADP
finefocus-3320	90	18	tetracyline	tetracyline	PROPN
finefocus-3320	90	19	.	.	PUNCT
finefocus-3320	91	1	btm	btm	PROPN
finefocus-3320	91	2	:	:	PUNCT
finefocus-3320	91	3	not	not	PART
finefocus-3320	91	4	determined	determine	VERB
finefocus-3320	91	5	due	due	ADJ
finefocus-3320	91	6	to	to	ADP
finefocus-3320	91	7	high	high	ADJ
finefocus-3320	91	8	colony	colony	NOUN
finefocus-3320	91	9	counts	count	NOUN
finefocus-3320	91	10	on	on	ADP
finefocus-3320	91	11	plates	plate	NOUN
finefocus-3320	91	12	with	with	ADP
finefocus-3320	91	13	no	no	DET
finefocus-3320	91	14	antibiotic	antibiotic	ADJ
finefocus-3320	91	15	.	.	PUNCT
finefocus-3320	92	1	volume	volume	NOUN
finefocus-3320	92	2	six	six	NUM
finefocus-3320	92	3	|	|	ADV
finefocus-3320	92	4	63	63	NUM
finefocus-3320	92	5	as	as	SCONJ
finefocus-3320	92	6	expected	expect	VERB
finefocus-3320	92	7	,	,	PUNCT
finefocus-3320	92	8	overall	overall	ADJ
finefocus-3320	92	9	colony	colony	NOUN
finefocus-3320	92	10	counts	count	NOUN
finefocus-3320	92	11	were	be	AUX
finefocus-3320	92	12	higher	high	ADJ
finefocus-3320	92	13	on	on	ADP
finefocus-3320	92	14	nutrient	nutrient	NOUN
finefocus-3320	92	15	agar	agar	NOUN
finefocus-3320	92	16	compared	compare	VERB
finefocus-3320	92	17	to	to	ADP
finefocus-3320	92	18	macconkey	macconkey	NOUN
finefocus-3320	92	19	,	,	PUNCT
finefocus-3320	92	20	which	which	PRON
finefocus-3320	92	21	facilitated	facilitate	VERB
finefocus-3320	92	22	the	the	DET
finefocus-3320	92	23	ability	ability	NOUN
finefocus-3320	92	24	to	to	PART
finefocus-3320	92	25	accurately	accurately	ADV
finefocus-3320	92	26	determine	determine	VERB
finefocus-3320	92	27	the	the	DET
finefocus-3320	92	28	percent	percent	NOUN
finefocus-3320	92	29	resistance	resistance	NOUN
finefocus-3320	92	30	for	for	ADP
finefocus-3320	92	31	more	more	ADJ
finefocus-3320	92	32	samples	sample	NOUN
finefocus-3320	92	33	at	at	ADP
finefocus-3320	92	34	more	more	ADJ
finefocus-3320	92	35	sites	site	NOUN
finefocus-3320	92	36	(	(	PUNCT
finefocus-3320	92	37	table	table	NOUN
finefocus-3320	92	38	2	2	NUM
finefocus-3320	92	39	)	)	PUNCT
finefocus-3320	92	40	.	.	PUNCT
finefocus-3320	93	1	every	every	DET
finefocus-3320	93	2	sample	sample	NOUN
finefocus-3320	93	3	of	of	ADP
finefocus-3320	93	4	soil	soil	NOUN
finefocus-3320	93	5	showed	show	VERB
finefocus-3320	93	6	some	some	DET
finefocus-3320	93	7	level	level	NOUN
finefocus-3320	93	8	of	of	ADP
finefocus-3320	93	9	resistant	resistant	ADJ
finefocus-3320	93	10	bacteria	bacteria	NOUN
finefocus-3320	93	11	.	.	PUNCT
finefocus-3320	94	1	however	however	ADV
finefocus-3320	94	2	,	,	PUNCT
finefocus-3320	94	3	the	the	DET
finefocus-3320	94	4	percent	percent	NOUN
finefocus-3320	94	5	resistance	resistance	NOUN
finefocus-3320	94	6	for	for	ADP
finefocus-3320	94	7	one	one	NUM
finefocus-3320	94	8	of	of	ADP
finefocus-3320	94	9	the	the	DET
finefocus-3320	94	10	wetland	wetland	NOUN
finefocus-3320	94	11	samples	sample	NOUN
finefocus-3320	94	12	(	(	PUNCT
finefocus-3320	94	13	w2	w2	NOUN
finefocus-3320	94	14	)	)	PUNCT
finefocus-3320	94	15	could	could	AUX
finefocus-3320	94	16	not	not	PART
finefocus-3320	94	17	be	be	AUX
finefocus-3320	94	18	determined	determine	VERB
finefocus-3320	94	19	due	due	ADP
finefocus-3320	94	20	to	to	ADP
finefocus-3320	94	21	high	high	ADJ
finefocus-3320	94	22	colony	colony	NOUN
finefocus-3320	94	23	counts	count	NOUN
finefocus-3320	94	24	on	on	ADP
finefocus-3320	94	25	plates	plate	NOUN
finefocus-3320	94	26	without	without	ADP
finefocus-3320	94	27	antibiotic	antibiotic	ADJ
finefocus-3320	94	28	.	.	PUNCT
finefocus-3320	95	1	both	both	DET
finefocus-3320	95	2	samples	sample	NOUN
finefocus-3320	95	3	from	from	ADP
finefocus-3320	95	4	the	the	DET
finefocus-3320	95	5	groundwater	groundwater	NOUN
finefocus-3320	95	6	spring	spring	NOUN
finefocus-3320	95	7	zone	zone	NOUN
finefocus-3320	95	8	(	(	PUNCT
finefocus-3320	95	9	s1	s1	NOUN
finefocus-3320	95	10	and	and	CCONJ
finefocus-3320	95	11	s2	s2	PROPN
finefocus-3320	95	12	)	)	PUNCT
finefocus-3320	95	13	exhibited	exhibit	VERB
finefocus-3320	95	14	resistance	resistance	NOUN
finefocus-3320	95	15	to	to	ADP
finefocus-3320	95	16	both	both	DET
finefocus-3320	95	17	concentrations	concentration	NOUN
finefocus-3320	95	18	of	of	ADP
finefocus-3320	95	19	tetracycline	tetracycline	NOUN
finefocus-3320	95	20	on	on	ADP
finefocus-3320	95	21	nutrient	nutrient	NOUN
finefocus-3320	95	22	agar	agar	NOUN
finefocus-3320	95	23	.	.	PUNCT
finefocus-3320	96	1	s2	s2	NOUN
finefocus-3320	96	2	and	and	CCONJ
finefocus-3320	96	3	hr1	hr1	PROPN
finefocus-3320	96	4	had	have	VERB
finefocus-3320	96	5	the	the	DET
finefocus-3320	96	6	highest	high	ADJ
finefocus-3320	96	7	percentage	percentage	NOUN
finefocus-3320	96	8	of	of	ADP
finefocus-3320	96	9	resistant	resistant	ADJ
finefocus-3320	96	10	bacteria	bacteria	NOUN
finefocus-3320	96	11	to	to	ADP
finefocus-3320	96	12	3	3	NUM
finefocus-3320	96	13	µg	µg	NOUN
finefocus-3320	96	14	/	/	SYM
finefocus-3320	96	15	ml	ml	NOUN
finefocus-3320	96	16	tetracycline	tetracycline	NOUN
finefocus-3320	96	17	at	at	ADP
finefocus-3320	96	18	greater	great	ADJ
finefocus-3320	96	19	than	than	ADP
finefocus-3320	96	20	10	10	NUM
finefocus-3320	96	21	%	%	NOUN
finefocus-3320	96	22	.	.	PUNCT
finefocus-3320	97	1	eleven	eleven	NUM
finefocus-3320	97	2	of	of	ADP
finefocus-3320	97	3	the	the	DET
finefocus-3320	97	4	fourteen	fourteen	NUM
finefocus-3320	97	5	samples	sample	NOUN
finefocus-3320	97	6	showed	show	VERB
finefocus-3320	97	7	less	less	ADJ
finefocus-3320	97	8	than	than	ADP
finefocus-3320	97	9	1	1	NUM
finefocus-3320	97	10	%	%	NOUN
finefocus-3320	97	11	resistance	resistance	NOUN
finefocus-3320	97	12	to	to	ADP
finefocus-3320	97	13	30	30	NUM
finefocus-3320	97	14	µg	µg	NOUN
finefocus-3320	97	15	/	/	SYM
finefocus-3320	97	16	ml	ml	NOUN
finefocus-3320	97	17	of	of	ADP
finefocus-3320	97	18	tetracycline	tetracycline	NOUN
finefocus-3320	97	19	.	.	PUNCT
finefocus-3320	98	1	when	when	SCONJ
finefocus-3320	98	2	comparing	compare	VERB
finefocus-3320	98	3	results	result	NOUN
finefocus-3320	98	4	from	from	ADP
finefocus-3320	98	5	both	both	DET
finefocus-3320	98	6	macconkey	macconkey	NOUN
finefocus-3320	98	7	and	and	CCONJ
finefocus-3320	98	8	nutrient	nutrient	ADJ
finefocus-3320	98	9	media	medium	NOUN
finefocus-3320	98	10	,	,	PUNCT
finefocus-3320	98	11	samples	sample	NOUN
finefocus-3320	98	12	s1	s1	NOUN
finefocus-3320	98	13	,	,	PUNCT
finefocus-3320	98	14	wl1	wl1	PROPN
finefocus-3320	98	15	,	,	PUNCT
finefocus-3320	98	16	and	and	CCONJ
finefocus-3320	98	17	hr1	hr1	PROPN
finefocus-3320	98	18	had	have	VERB
finefocus-3320	98	19	identical	identical	ADJ
finefocus-3320	98	20	ranges	range	NOUN
finefocus-3320	98	21	for	for	ADP
finefocus-3320	98	22	each	each	DET
finefocus-3320	98	23	concentration	concentration	NOUN
finefocus-3320	98	24	of	of	ADP
finefocus-3320	98	25	tetracycline	tetracycline	NOUN
finefocus-3320	98	26	.	.	PUNCT
finefocus-3320	99	1	all	all	DET
finefocus-3320	99	2	other	other	ADJ
finefocus-3320	99	3	samples	sample	NOUN
finefocus-3320	99	4	,	,	PUNCT
finefocus-3320	99	5	except	except	SCONJ
finefocus-3320	99	6	f2	f2	PROPN
finefocus-3320	99	7	,	,	PUNCT
finefocus-3320	99	8	showed	show	VERB
finefocus-3320	99	9	a	a	DET
finefocus-3320	99	10	slightly	slightly	ADV
finefocus-3320	99	11	higher	high	ADJ
finefocus-3320	99	12	percent	percent	NOUN
finefocus-3320	99	13	of	of	ADP
finefocus-3320	99	14	resistant	resistant	ADJ
finefocus-3320	99	15	bacteria	bacteria	NOUN
finefocus-3320	99	16	on	on	ADP
finefocus-3320	99	17	nutrient	nutrient	NOUN
finefocus-3320	99	18	agar	agar	NOUN
finefocus-3320	99	19	compared	compare	VERB
finefocus-3320	99	20	with	with	ADP
finefocus-3320	99	21	macconkey	macconkey	NOUN
finefocus-3320	99	22	.	.	PUNCT
finefocus-3320	100	1	these	these	DET
finefocus-3320	100	2	data	datum	NOUN
finefocus-3320	100	3	suggest	suggest	VERB
finefocus-3320	100	4	that	that	SCONJ
finefocus-3320	100	5	naturally	naturally	ADV
finefocus-3320	100	6	occurring	occur	VERB
finefocus-3320	100	7	ar	ar	NOUN
finefocus-3320	100	8	is	be	AUX
finefocus-3320	100	9	even	even	ADV
finefocus-3320	100	10	more	more	ADV
finefocus-3320	100	11	prevalent	prevalent	ADJ
finefocus-3320	100	12	than	than	SCONJ
finefocus-3320	100	13	originally	originally	ADV
finefocus-3320	100	14	expected	expect	VERB
finefocus-3320	100	15	.	.	PUNCT
finefocus-3320	101	1	identification	identification	NOUN
finefocus-3320	101	2	of	of	ADP
finefocus-3320	101	3	isolated	isolated	ADJ
finefocus-3320	101	4	antibiotic	antibiotic	ADJ
finefocus-3320	101	5	-	-	PUNCT
finefocus-3320	101	6	resistant	resistant	ADJ
finefocus-3320	101	7	bacteria	bacteria	NOUN
finefocus-3320	101	8	we	we	PRON
finefocus-3320	101	9	next	next	ADV
finefocus-3320	101	10	tested	test	VERB
finefocus-3320	101	11	our	our	PRON
finefocus-3320	101	12	second	second	ADJ
finefocus-3320	101	13	hypothesis	hypothesis	NOUN
finefocus-3320	101	14	that	that	PRON
finefocus-3320	101	15	tetresistant	tetresistant	ADJ
finefocus-3320	101	16	bacteria	bacteria	NOUN
finefocus-3320	101	17	would	would	AUX
finefocus-3320	101	18	be	be	AUX
finefocus-3320	101	19	unique	unique	ADJ
finefocus-3320	101	20	to	to	ADP
finefocus-3320	101	21	their	their	PRON
finefocus-3320	101	22	particular	particular	ADJ
finefocus-3320	101	23	environment	environment	NOUN
finefocus-3320	101	24	.	.	PUNCT
finefocus-3320	102	1	tetracycline	tetracycline	NOUN
finefocus-3320	102	2	-	-	PUNCT
finefocus-3320	102	3	resistant	resistant	ADJ
finefocus-3320	102	4	colonies	colony	NOUN
finefocus-3320	102	5	on	on	ADP
finefocus-3320	102	6	countable	countable	ADJ
finefocus-3320	102	7	nutrient	nutrient	NOUN
finefocus-3320	102	8	agar	agar	NOUN
finefocus-3320	102	9	plates	plate	NOUN
finefocus-3320	102	10	were	be	AUX
finefocus-3320	102	11	analyzed	analyze	VERB
finefocus-3320	102	12	and	and	CCONJ
finefocus-3320	102	13	classified	classify	VERB
finefocus-3320	102	14	based	base	VERB
finefocus-3320	102	15	on	on	ADP
finefocus-3320	102	16	their	their	PRON
finefocus-3320	102	17	phenotypic	phenotypic	ADJ
finefocus-3320	102	18	characteristics	characteristic	NOUN
finefocus-3320	102	19	(	(	PUNCT
finefocus-3320	102	20	table	table	NOUN
finefocus-3320	102	21	3	3	NUM
finefocus-3320	102	22	)	)	PUNCT
finefocus-3320	102	23	.	.	PUNCT
finefocus-3320	103	1	thirty	thirty	NUM
finefocus-3320	103	2	-	-	PUNCT
finefocus-3320	103	3	six	six	NUM
finefocus-3320	103	4	morphotypes	morphotype	NOUN
finefocus-3320	103	5	were	be	AUX
finefocus-3320	103	6	identified	identify	VERB
finefocus-3320	103	7	from	from	ADP
finefocus-3320	103	8	the	the	DET
finefocus-3320	103	9	fourteen	fourteen	NUM
finefocus-3320	103	10	collection	collection	NOUN
finefocus-3320	103	11	sites	site	NOUN
finefocus-3320	103	12	(	(	PUNCT
finefocus-3320	103	13	morphotypes	morphotype	NOUN
finefocus-3320	103	14	i	i	NOUN
finefocus-3320	103	15	-	-	PUNCT
finefocus-3320	103	16	xxxvi	xxxvi	ADJ
finefocus-3320	103	17	)	)	PUNCT
finefocus-3320	103	18	.	.	PUNCT
finefocus-3320	104	1	morphotype	morphotype	PROPN
finefocus-3320	104	2	i	i	PROPN
finefocus-3320	104	3	,	,	PUNCT
finefocus-3320	104	4	the	the	DET
finefocus-3320	104	5	most	most	ADV
finefocus-3320	104	6	common	common	ADJ
finefocus-3320	104	7	,	,	PUNCT
finefocus-3320	104	8	was	be	AUX
finefocus-3320	104	9	found	find	VERB
finefocus-3320	104	10	at	at	ADP
finefocus-3320	104	11	all	all	DET
finefocus-3320	104	12	14	14	NUM
finefocus-3320	104	13	collection	collection	NOUN
finefocus-3320	104	14	sites	site	NOUN
finefocus-3320	104	15	and	and	CCONJ
finefocus-3320	104	16	at	at	ADP
finefocus-3320	104	17	percentages	percentage	NOUN
finefocus-3320	104	18	ranging	range	VERB
finefocus-3320	104	19	from	from	ADP
finefocus-3320	104	20	54.05	54.05	NUM
finefocus-3320	104	21	%	%	NOUN
finefocus-3320	104	22	(	(	PUNCT
finefocus-3320	104	23	s1	s1	NOUN
finefocus-3320	104	24	)	)	PUNCT
finefocus-3320	104	25	to	to	ADP
finefocus-3320	104	26	98.9	98.9	NUM
finefocus-3320	104	27	%	%	NOUN
finefocus-3320	104	28	(	(	PUNCT
finefocus-3320	104	29	w2	w2	NOUN
finefocus-3320	104	30	)	)	PUNCT
finefocus-3320	104	31	of	of	ADP
finefocus-3320	104	32	the	the	DET
finefocus-3320	104	33	total	total	ADJ
finefocus-3320	104	34	antibiotic	antibiotic	ADJ
finefocus-3320	104	35	-	-	PUNCT
finefocus-3320	104	36	resistant	resistant	ADJ
finefocus-3320	104	37	population	population	NOUN
finefocus-3320	104	38	.	.	PUNCT
finefocus-3320	105	1	morphotype	morphotype	PROPN
finefocus-3320	105	2	i	i	PRON
finefocus-3320	105	3	also	also	ADV
finefocus-3320	105	4	represented	represent	VERB
finefocus-3320	105	5	83.54	83.54	NUM
finefocus-3320	105	6	%	%	NOUN
finefocus-3320	105	7	of	of	ADP
finefocus-3320	105	8	all	all	DET
finefocus-3320	105	9	antibiotic	antibiotic	ADJ
finefocus-3320	105	10	-	-	PUNCT
finefocus-3320	105	11	resistant	resistant	ADJ
finefocus-3320	105	12	bacteria	bacteria	NOUN
finefocus-3320	105	13	.	.	PUNCT
finefocus-3320	106	1	the	the	DET
finefocus-3320	106	2	woodland	woodland	NOUN
finefocus-3320	106	3	zone	zone	NOUN
finefocus-3320	106	4	(	(	PUNCT
finefocus-3320	106	5	wl1	wl1	PROPN
finefocus-3320	106	6	and	and	CCONJ
finefocus-3320	106	7	wl2	wl2	PROPN
finefocus-3320	106	8	)	)	PUNCT
finefocus-3320	106	9	displayed	display	VERB
finefocus-3320	106	10	the	the	DET
finefocus-3320	106	11	highest	high	ADJ
finefocus-3320	106	12	diversity	diversity	NOUN
finefocus-3320	106	13	of	of	ADP
finefocus-3320	106	14	morphology	morphology	NOUN
finefocus-3320	106	15	with	with	ADP
finefocus-3320	106	16	12	12	NUM
finefocus-3320	106	17	unique	unique	ADJ
finefocus-3320	106	18	morphotypes	morphotype	NOUN
finefocus-3320	106	19	.	.	PUNCT
finefocus-3320	107	1	these	these	DET
finefocus-3320	107	2	results	result	NOUN
finefocus-3320	107	3	suggest	suggest	VERB
finefocus-3320	107	4	that	that	SCONJ
finefocus-3320	107	5	,	,	PUNCT
finefocus-3320	107	6	while	while	SCONJ
finefocus-3320	107	7	at	at	ADP
finefocus-3320	107	8	low	low	ADJ
finefocus-3320	107	9	frequencies	frequency	NOUN
finefocus-3320	107	10	,	,	PUNCT
finefocus-3320	107	11	adjacent	adjacent	ADJ
finefocus-3320	107	12	ecological	ecological	ADJ
finefocus-3320	107	13	zones	zone	NOUN
finefocus-3320	107	14	contain	contain	VERB
finefocus-3320	107	15	distinct	distinct	ADJ
finefocus-3320	107	16	sub	sub	NOUN
finefocus-3320	107	17	-	-	NOUN
finefocus-3320	107	18	populations	population	NOUN
finefocus-3320	107	19	of	of	ADP
finefocus-3320	107	20	bacteria	bacteria	NOUN
finefocus-3320	107	21	.	.	PUNCT
finefocus-3320	108	1	64	64	NUM
finefocus-3320	108	2	|	|	CCONJ
finefocus-3320	108	3	fine	fine	ADJ
finefocus-3320	108	4	focus	focus	NOUN
finefocus-3320	108	5	table	table	NOUN
finefocus-3320	108	6	3a	3a	NUM
finefocus-3320	108	7	.	.	PUNCT
finefocus-3320	109	1	colony	colony	NOUN
finefocus-3320	109	2	morphology	morphology	NOUN
finefocus-3320	109	3	for	for	ADP
finefocus-3320	109	4	countable	countable	ADJ
finefocus-3320	109	5	nutrient	nutrient	ADJ
finefocus-3320	109	6	media	medium	NOUN
finefocus-3320	109	7	plates	plate	NOUN
finefocus-3320	109	8	.	.	PUNCT
finefocus-3320	110	1	apercentage	apercentage	NOUN
finefocus-3320	110	2	of	of	ADP
finefocus-3320	110	3	antibiotic	antibiotic	ADJ
finefocus-3320	110	4	-	-	PUNCT
finefocus-3320	110	5	resistant	resistant	ADJ
finefocus-3320	110	6	colonies	colony	NOUN
finefocus-3320	110	7	with	with	ADP
finefocus-3320	110	8	the	the	DET
finefocus-3320	110	9	population	population	NOUN
finefocus-3320	110	10	at	at	ADP
finefocus-3320	110	11	a	a	DET
finefocus-3320	110	12	single	single	ADJ
finefocus-3320	110	13	soil	soil	NOUN
finefocus-3320	110	14	sample	sample	NOUN
finefocus-3320	110	15	collection	collection	NOUN
finefocus-3320	110	16	site	site	NOUN
finefocus-3320	110	17	.	.	PUNCT
finefocus-3320	111	1	*	*	PUNCT
finefocus-3320	111	2	selected	select	VERB
finefocus-3320	111	3	fror	fror	NOUN
finefocus-3320	111	4	isolation	isolation	NOUN
finefocus-3320	111	5	volume	volume	NOUN
finefocus-3320	111	6	six	six	NUM
finefocus-3320	112	1	|	|	ADV
finefocus-3320	112	2	65	65	NUM
finefocus-3320	112	3	table	table	NOUN
finefocus-3320	112	4	3b	3b	NOUN
finefocus-3320	112	5	.	.	PUNCT
finefocus-3320	113	1	colony	colony	NOUN
finefocus-3320	113	2	morphology	morphology	NOUN
finefocus-3320	113	3	for	for	ADP
finefocus-3320	113	4	countable	countable	ADJ
finefocus-3320	113	5	nutrient	nutrient	ADJ
finefocus-3320	113	6	media	medium	NOUN
finefocus-3320	113	7	plates	plate	NOUN
finefocus-3320	113	8	.	.	PUNCT
finefocus-3320	114	1	apercentage	apercentage	NOUN
finefocus-3320	114	2	of	of	ADP
finefocus-3320	114	3	antibiotic	antibiotic	ADJ
finefocus-3320	114	4	-	-	PUNCT
finefocus-3320	114	5	resistant	resistant	ADJ
finefocus-3320	114	6	colonies	colony	NOUN
finefocus-3320	114	7	with	with	ADP
finefocus-3320	114	8	the	the	DET
finefocus-3320	114	9	population	population	NOUN
finefocus-3320	114	10	at	at	ADP
finefocus-3320	114	11	a	a	DET
finefocus-3320	114	12	single	single	ADJ
finefocus-3320	114	13	soil	soil	NOUN
finefocus-3320	114	14	sample	sample	NOUN
finefocus-3320	114	15	collection	collection	NOUN
finefocus-3320	114	16	site	site	NOUN
finefocus-3320	114	17	.	.	PUNCT
finefocus-3320	115	1	*	*	PUNCT
finefocus-3320	115	2	selected	select	VERB
finefocus-3320	115	3	fror	fror	NOUN
finefocus-3320	115	4	isolation	isolation	NOUN
finefocus-3320	115	5	66	66	NUM
finefocus-3320	115	6	|	|	CCONJ
finefocus-3320	115	7	fine	fine	ADJ
finefocus-3320	115	8	focus	focus	NOUN
finefocus-3320	115	9	table	table	NOUN
finefocus-3320	115	10	3c	3c	NUM
finefocus-3320	115	11	.	.	PUNCT
finefocus-3320	116	1	colony	colony	NOUN
finefocus-3320	116	2	morphology	morphology	NOUN
finefocus-3320	116	3	for	for	ADP
finefocus-3320	116	4	countable	countable	ADJ
finefocus-3320	116	5	nutrient	nutrient	ADJ
finefocus-3320	116	6	media	medium	NOUN
finefocus-3320	116	7	plates	plate	NOUN
finefocus-3320	116	8	.	.	PUNCT
finefocus-3320	117	1	apercentage	apercentage	NOUN
finefocus-3320	117	2	of	of	ADP
finefocus-3320	117	3	antibiotic	antibiotic	ADJ
finefocus-3320	117	4	-	-	PUNCT
finefocus-3320	117	5	resistant	resistant	ADJ
finefocus-3320	117	6	colonies	colony	NOUN
finefocus-3320	117	7	with	with	ADP
finefocus-3320	117	8	the	the	DET
finefocus-3320	117	9	population	population	NOUN
finefocus-3320	117	10	at	at	ADP
finefocus-3320	117	11	a	a	DET
finefocus-3320	117	12	single	single	ADJ
finefocus-3320	117	13	soil	soil	NOUN
finefocus-3320	117	14	sample	sample	NOUN
finefocus-3320	117	15	collection	collection	NOUN
finefocus-3320	117	16	site	site	NOUN
finefocus-3320	117	17	.	.	PUNCT
finefocus-3320	118	1	*	*	PUNCT
finefocus-3320	118	2	selected	select	VERB
finefocus-3320	118	3	fror	fror	NOUN
finefocus-3320	118	4	isolation	isolation	NOUN
finefocus-3320	118	5	volume	volume	NOUN
finefocus-3320	118	6	six	six	NUM
finefocus-3320	118	7	|	|	ADV
finefocus-3320	118	8	67	67	NUM
finefocus-3320	118	9	to	to	PART
finefocus-3320	118	10	determine	determine	VERB
finefocus-3320	118	11	if	if	SCONJ
finefocus-3320	118	12	the	the	DET
finefocus-3320	118	13	resistant	resistant	ADJ
finefocus-3320	118	14	bacteria	bacteria	NOUN
finefocus-3320	118	15	were	be	AUX
finefocus-3320	118	16	unique	unique	ADJ
finefocus-3320	118	17	to	to	ADP
finefocus-3320	118	18	their	their	PRON
finefocus-3320	118	19	ecological	ecological	ADJ
finefocus-3320	118	20	zone	zone	NOUN
finefocus-3320	118	21	,	,	PUNCT
finefocus-3320	118	22	we	we	PRON
finefocus-3320	118	23	selected	select	VERB
finefocus-3320	118	24	a	a	DET
finefocus-3320	118	25	subset	subset	NOUN
finefocus-3320	118	26	of	of	ADP
finefocus-3320	118	27	colonies	colony	NOUN
finefocus-3320	118	28	from	from	ADP
finefocus-3320	118	29	different	different	ADJ
finefocus-3320	118	30	ecosystems	ecosystem	NOUN
finefocus-3320	118	31	and	and	CCONJ
finefocus-3320	118	32	of	of	ADP
finefocus-3320	118	33	different	different	ADJ
finefocus-3320	118	34	morphology	morphology	NOUN
finefocus-3320	118	35	.	.	PUNCT
finefocus-3320	119	1	some	some	DET
finefocus-3320	119	2	colonies	colony	NOUN
finefocus-3320	119	3	were	be	AUX
finefocus-3320	119	4	selected	select	VERB
finefocus-3320	119	5	from	from	ADP
finefocus-3320	119	6	3tet	3tet	PROPN
finefocus-3320	119	7	plates	plate	NOUN
finefocus-3320	119	8	while	while	SCONJ
finefocus-3320	119	9	others	other	NOUN
finefocus-3320	119	10	were	be	AUX
finefocus-3320	119	11	selected	select	VERB
finefocus-3320	119	12	from	from	ADP
finefocus-3320	119	13	30tet	30tet	NOUN
finefocus-3320	119	14	plates	plate	NOUN
finefocus-3320	119	15	.	.	PUNCT
finefocus-3320	120	1	we	we	PRON
finefocus-3320	120	2	performed	perform	VERB
finefocus-3320	120	3	pcr	pcr	NOUN
finefocus-3320	120	4	on	on	ADP
finefocus-3320	120	5	these	these	DET
finefocus-3320	120	6	isolates	isolate	NOUN
finefocus-3320	120	7	using	use	VERB
finefocus-3320	120	8	primers	primer	NOUN
finefocus-3320	120	9	designed	design	VERB
finefocus-3320	120	10	to	to	PART
finefocus-3320	120	11	amplify	amplify	VERB
finefocus-3320	120	12	the	the	DET
finefocus-3320	120	13	16s	16	NOUN
finefocus-3320	120	14	ribosomal	ribosomal	NOUN
finefocus-3320	120	15	rna	rna	NOUN
finefocus-3320	120	16	gene	gene	NOUN
finefocus-3320	120	17	.	.	PUNCT
finefocus-3320	121	1	sequence	sequence	NOUN
finefocus-3320	121	2	analysis	analysis	NOUN
finefocus-3320	121	3	of	of	ADP
finefocus-3320	121	4	these	these	DET
finefocus-3320	121	5	genes	gene	NOUN
finefocus-3320	121	6	allowed	allow	VERB
finefocus-3320	121	7	identification	identification	NOUN
finefocus-3320	121	8	at	at	ADP
finefocus-3320	121	9	the	the	DET
finefocus-3320	121	10	genus	genus	ADJ
finefocus-3320	121	11	level	level	NOUN
finefocus-3320	121	12	.	.	PUNCT
finefocus-3320	122	1	surprisingly	surprisingly	ADV
finefocus-3320	122	2	,	,	PUNCT
finefocus-3320	122	3	of	of	ADP
finefocus-3320	122	4	the	the	DET
finefocus-3320	122	5	ten	ten	NUM
finefocus-3320	122	6	bacterial	bacterial	ADJ
finefocus-3320	122	7	colonies	colony	NOUN
finefocus-3320	122	8	successfully	successfully	ADV
finefocus-3320	122	9	sequenced	sequence	VERB
finefocus-3320	122	10	(	(	PUNCT
finefocus-3320	122	11	table	table	NOUN
finefocus-3320	122	12	4	4	NUM
finefocus-3320	122	13	)	)	PUNCT
finefocus-3320	122	14	,	,	PUNCT
finefocus-3320	122	15	nearly	nearly	ADV
finefocus-3320	122	16	all	all	PRON
finefocus-3320	122	17	of	of	ADP
finefocus-3320	122	18	the	the	DET
finefocus-3320	122	19	bacteria	bacteria	NOUN
finefocus-3320	122	20	identified	identify	VERB
finefocus-3320	122	21	were	be	AUX
finefocus-3320	122	22	of	of	ADP
finefocus-3320	122	23	different	different	ADJ
finefocus-3320	122	24	genera	genera	NOUN
finefocus-3320	122	25	.	.	PUNCT
finefocus-3320	123	1	as	as	SCONJ
finefocus-3320	123	2	expected	expect	VERB
finefocus-3320	123	3	,	,	PUNCT
finefocus-3320	123	4	streptomyces	streptomyce	NOUN
finefocus-3320	123	5	,	,	PUNCT
finefocus-3320	123	6	which	which	PRON
finefocus-3320	123	7	is	be	AUX
finefocus-3320	123	8	prevalent	prevalent	ADJ
finefocus-3320	123	9	in	in	ADP
finefocus-3320	123	10	soil	soil	NOUN
finefocus-3320	123	11	(	(	PUNCT
finefocus-3320	123	12	23	23	NUM
finefocus-3320	123	13	)	)	PUNCT
finefocus-3320	123	14	,	,	PUNCT
finefocus-3320	123	15	was	be	AUX
finefocus-3320	123	16	identified	identify	VERB
finefocus-3320	123	17	in	in	ADP
finefocus-3320	123	18	four	four	NUM
finefocus-3320	123	19	different	different	ADJ
finefocus-3320	123	20	ecological	ecological	ADJ
finefocus-3320	123	21	zones	zone	NOUN
finefocus-3320	123	22	(	(	PUNCT
finefocus-3320	123	23	g	g	NOUN
finefocus-3320	123	24	,	,	PUNCT
finefocus-3320	123	25	wl	wl	PROPN
finefocus-3320	123	26	,	,	PUNCT
finefocus-3320	123	27	s	s	PROPN
finefocus-3320	123	28	,	,	PUNCT
finefocus-3320	123	29	and	and	CCONJ
finefocus-3320	123	30	hr	hr	NOUN
finefocus-3320	123	31	)	)	PUNCT
finefocus-3320	123	32	.	.	PUNCT
finefocus-3320	124	1	morphotype	morphotype	PROPN
finefocus-3320	124	2	xxvi	xxvi	NOUN
finefocus-3320	124	3	from	from	ADP
finefocus-3320	124	4	the	the	DET
finefocus-3320	124	5	wetland	wetland	NOUN
finefocus-3320	124	6	zone	zone	NOUN
finefocus-3320	124	7	(	(	PUNCT
finefocus-3320	124	8	w2	w2	NOUN
finefocus-3320	124	9	)	)	PUNCT
finefocus-3320	124	10	and	and	CCONJ
finefocus-3320	124	11	morphotype	morphotype	PROPN
finefocus-3320	124	12	xxv	xxv	PROPN
finefocus-3320	124	13	from	from	ADP
finefocus-3320	124	14	the	the	DET
finefocus-3320	124	15	riparian	riparian	ADJ
finefocus-3320	124	16	zone	zone	NOUN
finefocus-3320	124	17	(	(	PUNCT
finefocus-3320	124	18	r2	r2	PROPN
finefocus-3320	124	19	)	)	PUNCT
finefocus-3320	124	20	were	be	AUX
finefocus-3320	124	21	identified	identify	VERB
finefocus-3320	124	22	as	as	ADP
finefocus-3320	124	23	bacillus	bacillus	NOUN
finefocus-3320	124	24	with	with	ADP
finefocus-3320	124	25	99	99	NUM
finefocus-3320	124	26	%	%	NOUN
finefocus-3320	124	27	confidence	confidence	NOUN
finefocus-3320	124	28	.	.	PUNCT
finefocus-3320	125	1	the	the	DET
finefocus-3320	125	2	duplicate	duplicate	ADJ
finefocus-3320	125	3	genera	genera	NOUN
finefocus-3320	125	4	suggest	suggest	VERB
finefocus-3320	125	5	that	that	SCONJ
finefocus-3320	125	6	antibiotic	antibiotic	ADJ
finefocus-3320	125	7	-	-	PUNCT
finefocus-3320	125	8	resistant	resistant	ADJ
finefocus-3320	125	9	bacteria	bacteria	NOUN
finefocus-3320	125	10	are	be	AUX
finefocus-3320	125	11	not	not	PART
finefocus-3320	125	12	entirely	entirely	ADV
finefocus-3320	125	13	specific	specific	ADJ
finefocus-3320	125	14	to	to	ADP
finefocus-3320	125	15	their	their	PRON
finefocus-3320	125	16	ecological	ecological	ADJ
finefocus-3320	125	17	zone	zone	NOUN
finefocus-3320	125	18	.	.	PUNCT
finefocus-3320	126	1	these	these	DET
finefocus-3320	126	2	data	datum	NOUN
finefocus-3320	126	3	showed	show	VERB
finefocus-3320	126	4	that	that	SCONJ
finefocus-3320	126	5	while	while	SCONJ
finefocus-3320	126	6	some	some	DET
finefocus-3320	126	7	species	specie	NOUN
finefocus-3320	126	8	of	of	ADP
finefocus-3320	126	9	antibiotic	antibiotic	ADJ
finefocus-3320	126	10	-	-	PUNCT
finefocus-3320	126	11	resistant	resistant	ADJ
finefocus-3320	126	12	bacteria	bacteria	NOUN
finefocus-3320	126	13	were	be	AUX
finefocus-3320	126	14	present	present	ADJ
finefocus-3320	126	15	in	in	ADP
finefocus-3320	126	16	multiple	multiple	ADJ
finefocus-3320	126	17	zones	zone	NOUN
finefocus-3320	126	18	,	,	PUNCT
finefocus-3320	126	19	there	there	PRON
finefocus-3320	126	20	were	be	VERB
finefocus-3320	126	21	some	some	PRON
finefocus-3320	126	22	that	that	PRON
finefocus-3320	126	23	were	be	AUX
finefocus-3320	126	24	specific	specific	ADJ
finefocus-3320	126	25	to	to	ADP
finefocus-3320	126	26	different	different	ADJ
finefocus-3320	126	27	zones	zone	NOUN
finefocus-3320	126	28	,	,	PUNCT
finefocus-3320	126	29	supporting	support	VERB
finefocus-3320	126	30	our	our	PRON
finefocus-3320	126	31	initial	initial	ADJ
finefocus-3320	126	32	hypothesis	hypothesis	NOUN
finefocus-3320	126	33	.	.	PUNCT
finefocus-3320	127	1	these	these	DET
finefocus-3320	127	2	data	datum	NOUN
finefocus-3320	127	3	also	also	ADV
finefocus-3320	127	4	showed	show	VERB
finefocus-3320	127	5	that	that	SCONJ
finefocus-3320	127	6	a	a	DET
finefocus-3320	127	7	variety	variety	NOUN
finefocus-3320	127	8	of	of	ADP
finefocus-3320	127	9	different	different	ADJ
finefocus-3320	127	10	bacteria	bacteria	NOUN
finefocus-3320	127	11	are	be	AUX
finefocus-3320	127	12	capable	capable	ADJ
finefocus-3320	127	13	of	of	ADP
finefocus-3320	127	14	possessing	possess	VERB
finefocus-3320	127	15	ar	ar	NOUN
finefocus-3320	127	16	.	.	PROPN
finefocus-3320	128	1	antibiotic	antibiotic	ADJ
finefocus-3320	128	2	susceptibility	susceptibility	NOUN
finefocus-3320	128	3	test	test	NOUN
finefocus-3320	128	4	since	since	SCONJ
finefocus-3320	128	5	all	all	PRON
finefocus-3320	128	6	of	of	ADP
finefocus-3320	128	7	our	our	PRON
finefocus-3320	128	8	isolates	isolate	NOUN
finefocus-3320	128	9	were	be	AUX
finefocus-3320	128	10	found	find	VERB
finefocus-3320	128	11	to	to	PART
finefocus-3320	128	12	be	be	AUX
finefocus-3320	128	13	resistant	resistant	ADJ
finefocus-3320	128	14	to	to	ADP
finefocus-3320	128	15	tetracycline	tetracycline	NOUN
finefocus-3320	129	1	,	,	PUNCT
finefocus-3320	129	2	we	we	PRON
finefocus-3320	129	3	wanted	want	VERB
finefocus-3320	129	4	to	to	PART
finefocus-3320	129	5	know	know	VERB
finefocus-3320	129	6	if	if	SCONJ
finefocus-3320	129	7	they	they	PRON
finefocus-3320	129	8	were	be	AUX
finefocus-3320	129	9	resistant	resistant	ADJ
finefocus-3320	129	10	to	to	ADP
finefocus-3320	129	11	other	other	ADJ
finefocus-3320	129	12	antibiotics	antibiotic	NOUN
finefocus-3320	129	13	.	.	PUNCT
finefocus-3320	130	1	to	to	PART
finefocus-3320	130	2	test	test	VERB
finefocus-3320	130	3	this	this	PRON
finefocus-3320	130	4	,	,	PUNCT
finefocus-3320	130	5	we	we	PRON
finefocus-3320	130	6	performed	perform	VERB
finefocus-3320	130	7	a	a	DET
finefocus-3320	130	8	kirby	kirby	PROPN
finefocus-3320	130	9	-	-	PUNCT
finefocus-3320	130	10	bauer	bauer	PROPN
finefocus-3320	130	11	disk	disk	NOUN
finefocus-3320	130	12	diffusion	diffusion	NOUN
finefocus-3320	130	13	test	test	NOUN
finefocus-3320	130	14	allowing	allow	VERB
finefocus-3320	130	15	us	we	PRON
finefocus-3320	130	16	to	to	PART
finefocus-3320	130	17	test	test	VERB
finefocus-3320	130	18	other	other	ADJ
finefocus-3320	130	19	antibiotics	antibiotic	NOUN
finefocus-3320	130	20	used	use	VERB
finefocus-3320	130	21	in	in	ADP
finefocus-3320	130	22	human	human	ADJ
finefocus-3320	130	23	and	and	CCONJ
finefocus-3320	130	24	veterinary	veterinary	ADJ
finefocus-3320	130	25	medicine	medicine	NOUN
finefocus-3320	130	26	.	.	PUNCT
finefocus-3320	131	1	the	the	DET
finefocus-3320	131	2	antibiotics	antibiotic	NOUN
finefocus-3320	131	3	chosen	choose	VERB
finefocus-3320	131	4	for	for	ADP
finefocus-3320	131	5	testing	testing	NOUN
finefocus-3320	131	6	were	be	AUX
finefocus-3320	131	7	ciprofloxacin	ciprofloxacin	NOUN
finefocus-3320	131	8	,	,	PUNCT
finefocus-3320	131	9	which	which	PRON
finefocus-3320	131	10	has	have	VERB
finefocus-3320	131	11	a	a	DET
finefocus-3320	131	12	synthetic	synthetic	ADJ
finefocus-3320	131	13	origin	origin	NOUN
finefocus-3320	131	14	(	(	PUNCT
finefocus-3320	131	15	49	49	NUM
finefocus-3320	131	16	)	)	PUNCT
finefocus-3320	131	17	,	,	PUNCT
finefocus-3320	131	18	and	and	CCONJ
finefocus-3320	131	19	ampicillin	ampicillin	PROPN
finefocus-3320	131	20	and	and	CCONJ
finefocus-3320	131	21	penicillin	penicillin	PROPN
finefocus-3320	131	22	,	,	PUNCT
finefocus-3320	131	23	which	which	PRON
finefocus-3320	131	24	are	be	AUX
finefocus-3320	131	25	both	both	PRON
finefocus-3320	131	26	naturally	naturally	ADV
finefocus-3320	131	27	occurring	occur	VERB
finefocus-3320	131	28	β	β	NOUN
finefocus-3320	131	29	-	-	NOUN
finefocus-3320	131	30	lactam	lactam	NOUN
finefocus-3320	131	31	antibiotics	antibiotic	NOUN
finefocus-3320	131	32	(	(	PUNCT
finefocus-3320	131	33	1	1	NUM
finefocus-3320	131	34	,	,	PUNCT
finefocus-3320	131	35	16	16	NUM
finefocus-3320	131	36	)	)	PUNCT
finefocus-3320	131	37	.	.	PUNCT
finefocus-3320	132	1	some	some	PRON
finefocus-3320	132	2	of	of	ADP
finefocus-3320	132	3	our	our	PRON
finefocus-3320	132	4	isolates	isolate	NOUN
finefocus-3320	132	5	selected	select	VERB
finefocus-3320	132	6	from	from	ADP
finefocus-3320	132	7	3tet	3tet	PROPN
finefocus-3320	132	8	plates	plate	NOUN
finefocus-3320	132	9	were	be	AUX
finefocus-3320	132	10	sensitive	sensitive	ADJ
finefocus-3320	132	11	to	to	ADP
finefocus-3320	132	12	the	the	DET
finefocus-3320	132	13	disk	disk	NOUN
finefocus-3320	132	14	with	with	ADP
finefocus-3320	132	15	30	30	NUM
finefocus-3320	132	16	µg	µg	NOUN
finefocus-3320	132	17	of	of	ADP
finefocus-3320	132	18	tetracycline	tetracycline	NOUN
finefocus-3320	132	19	(	(	PUNCT
finefocus-3320	132	20	isolates	isolate	NOUN
finefocus-3320	132	21	b	b	PROPN
finefocus-3320	132	22	,	,	PUNCT
finefocus-3320	132	23	e	e	NOUN
finefocus-3320	132	24	,	,	PUNCT
finefocus-3320	132	25	h	h	NOUN
finefocus-3320	132	26	,	,	PUNCT
finefocus-3320	132	27	and	and	CCONJ
finefocus-3320	132	28	i	i	PROPN
finefocus-3320	132	29	)	)	PUNCT
finefocus-3320	132	30	,	,	PUNCT
finefocus-3320	132	31	showing	show	VERB
finefocus-3320	132	32	that	that	SCONJ
finefocus-3320	132	33	their	their	PRON
finefocus-3320	132	34	resistance	resistance	NOUN
finefocus-3320	132	35	is	be	AUX
finefocus-3320	132	36	concentrationdependent	concentrationdependent	NOUN
finefocus-3320	132	37	.	.	PUNCT
finefocus-3320	133	1	since	since	SCONJ
finefocus-3320	133	2	all	all	DET
finefocus-3320	133	3	isolates	isolate	NOUN
finefocus-3320	133	4	were	be	AUX
finefocus-3320	133	5	resistant	resistant	ADJ
finefocus-3320	133	6	to	to	ADP
finefocus-3320	133	7	some	some	DET
finefocus-3320	133	8	concentration	concentration	NOUN
finefocus-3320	133	9	of	of	ADP
finefocus-3320	133	10	tetracycline	tetracycline	NOUN
finefocus-3320	133	11	and	and	CCONJ
finefocus-3320	133	12	one	one	NUM
finefocus-3320	133	13	or	or	CCONJ
finefocus-3320	133	14	more	more	ADJ
finefocus-3320	133	15	antibiotics	antibiotic	NOUN
finefocus-3320	133	16	,	,	PUNCT
finefocus-3320	133	17	100	100	NUM
finefocus-3320	133	18	%	%	NOUN
finefocus-3320	133	19	of	of	ADP
finefocus-3320	133	20	the	the	DET
finefocus-3320	133	21	isolates	isolate	NOUN
finefocus-3320	133	22	were	be	AUX
finefocus-3320	133	23	multidrugresistant	multidrugresistant	ADJ
finefocus-3320	133	24	(	(	PUNCT
finefocus-3320	133	25	table	table	NOUN
finefocus-3320	133	26	5	5	NUM
finefocus-3320	133	27	)	)	PUNCT
finefocus-3320	133	28	.	.	PUNCT
finefocus-3320	134	1	interestingly	interestingly	ADV
finefocus-3320	134	2	,	,	PUNCT
finefocus-3320	134	3	every	every	DET
finefocus-3320	134	4	isolate	isolate	NOUN
finefocus-3320	134	5	displayed	display	VERB
finefocus-3320	134	6	resistance	resistance	NOUN
finefocus-3320	134	7	to	to	ADP
finefocus-3320	134	8	penicillin	penicillin	PROPN
finefocus-3320	134	9	.	.	PUNCT
finefocus-3320	135	1	isolates	isolate	NOUN
finefocus-3320	135	2	a	a	DET
finefocus-3320	135	3	,	,	PUNCT
finefocus-3320	135	4	d	d	PROPN
finefocus-3320	135	5	,	,	PUNCT
finefocus-3320	135	6	f	f	X
finefocus-3320	135	7	,	,	PUNCT
finefocus-3320	135	8	k	k	NOUN
finefocus-3320	135	9	,	,	PUNCT
finefocus-3320	135	10	and	and	CCONJ
finefocus-3320	135	11	n	n	CCONJ
finefocus-3320	135	12	(	(	PUNCT
finefocus-3320	135	13	36	36	NUM
finefocus-3320	135	14	%	%	NOUN
finefocus-3320	135	15	of	of	ADP
finefocus-3320	135	16	isolates	isolate	NOUN
finefocus-3320	135	17	)	)	PUNCT
finefocus-3320	135	18	were	be	AUX
finefocus-3320	135	19	resistant	resistant	ADJ
finefocus-3320	135	20	to	to	ADP
finefocus-3320	135	21	all	all	DET
finefocus-3320	135	22	four	four	NUM
finefocus-3320	135	23	antibiotics	antibiotic	NOUN
finefocus-3320	135	24	.	.	PUNCT
finefocus-3320	136	1	discovery	discovery	NOUN
finefocus-3320	136	2	of	of	ADP
finefocus-3320	136	3	mdr	mdr	PROPN
finefocus-3320	136	4	in	in	ADP
finefocus-3320	136	5	each	each	DET
finefocus-3320	136	6	ecological	ecological	ADJ
finefocus-3320	136	7	zone	zone	NOUN
finefocus-3320	136	8	indicates	indicate	VERB
finefocus-3320	136	9	that	that	SCONJ
finefocus-3320	136	10	there	there	PRON
finefocus-3320	136	11	must	must	AUX
finefocus-3320	136	12	be	be	AUX
finefocus-3320	136	13	some	some	DET
finefocus-3320	136	14	selective	selective	ADJ
finefocus-3320	136	15	advantage	advantage	NOUN
finefocus-3320	136	16	for	for	ADP
finefocus-3320	136	17	this	this	PRON
finefocus-3320	136	18	,	,	PUNCT
finefocus-3320	136	19	even	even	ADV
finefocus-3320	136	20	in	in	ADP
finefocus-3320	136	21	naturally	naturally	ADV
finefocus-3320	136	22	occurring	occur	VERB
finefocus-3320	136	23	environments	environment	NOUN
finefocus-3320	136	24	.	.	PUNCT
finefocus-3320	137	1	68	68	NUM
finefocus-3320	137	2	|	|	CCONJ
finefocus-3320	137	3	fine	fine	ADJ
finefocus-3320	137	4	focus	focus	NOUN
finefocus-3320	137	5	table	table	NOUN
finefocus-3320	137	6	4	4	NUM
finefocus-3320	137	7	.	.	PUNCT
finefocus-3320	137	8	designation	designation	NOUN
finefocus-3320	137	9	for	for	ADP
finefocus-3320	137	10	identification	identification	NOUN
finefocus-3320	137	11	and	and	CCONJ
finefocus-3320	137	12	:	:	PUNCT
finefocus-3320	137	13	not	not	PART
finefocus-3320	137	14	determined	determine	VERB
finefocus-3320	137	15	volume	volume	NOUN
finefocus-3320	137	16	six	six	NUM
finefocus-3320	137	17	|	|	ADV
finefocus-3320	137	18	69	69	NUM
finefocus-3320	137	19	table	table	NOUN
finefocus-3320	137	20	5	5	NUM
finefocus-3320	137	21	.	.	PUNCT
finefocus-3320	137	22	zone	zone	NOUN
finefocus-3320	137	23	of	of	ADP
finefocus-3320	137	24	inhibition	inhibition	NOUN
finefocus-3320	137	25	diameter	diameter	NOUN
finefocus-3320	137	26	measurements	measurement	NOUN
finefocus-3320	137	27	of	of	ADP
finefocus-3320	137	28	selected	select	VERB
finefocus-3320	137	29	bacterial	bacterial	ADJ
finefocus-3320	137	30	colonies	colony	NOUN
finefocus-3320	137	31	azone	azone	NOUN
finefocus-3320	137	32	of	of	ADP
finefocus-3320	137	33	inhibition	inhibition	NOUN
finefocus-3320	137	34	diameter	diameter	NOUN
finefocus-3320	137	35	measured	measure	VERB
finefocus-3320	137	36	in	in	ADP
finefocus-3320	137	37	mm	mm	PROPN
finefocus-3320	137	38	bresistance	bresistance	NOUN
finefocus-3320	137	39	determined	determine	VERB
finefocus-3320	137	40	by	by	ADP
finefocus-3320	137	41	diameter	diameter	NOUN
finefocus-3320	137	42	standard	standard	NOUN
finefocus-3320	137	43	(	(	PUNCT
finefocus-3320	137	44	clsi	clsi	ADJ
finefocus-3320	137	45	,	,	PUNCT
finefocus-3320	137	46	2013	2013	NUM
finefocus-3320	137	47	)	)	PUNCT
finefocus-3320	137	48	cresistant	cresistant	PROPN
finefocus-3320	137	49	dsusceptible	dsusceptible	ADJ
finefocus-3320	137	50	eintermediate	eintermediate	NOUN
finefocus-3320	137	51	70	70	NUM
finefocus-3320	137	52	|	|	CCONJ
finefocus-3320	137	53	fine	fine	ADJ
finefocus-3320	137	54	focus	focus	NOUN
finefocus-3320	137	55	discussion	discussion	NOUN
finefocus-3320	137	56	ar	ar	PROPN
finefocus-3320	137	57	is	be	AUX
finefocus-3320	137	58	naturally	naturally	ADV
finefocus-3320	137	59	occurring	occur	VERB
finefocus-3320	137	60	,	,	PUNCT
finefocus-3320	137	61	even	even	ADV
finefocus-3320	137	62	in	in	ADP
finefocus-3320	137	63	environments	environment	NOUN
finefocus-3320	137	64	away	away	ADV
finefocus-3320	137	65	from	from	ADP
finefocus-3320	137	66	anthropogenic	anthropogenic	ADJ
finefocus-3320	137	67	selection	selection	NOUN
finefocus-3320	137	68	pressures	pressure	NOUN
finefocus-3320	137	69	.	.	PUNCT
finefocus-3320	138	1	studying	study	VERB
finefocus-3320	138	2	this	this	DET
finefocus-3320	138	3	naturally	naturally	ADV
finefocus-3320	138	4	occurring	occur	VERB
finefocus-3320	138	5	ar	ar	NOUN
finefocus-3320	138	6	is	be	AUX
finefocus-3320	138	7	important	important	ADJ
finefocus-3320	138	8	for	for	ADP
finefocus-3320	138	9	understanding	understanding	NOUN
finefocus-3320	138	10	and	and	CCONJ
finefocus-3320	138	11	dealing	deal	VERB
finefocus-3320	138	12	with	with	ADP
finefocus-3320	138	13	the	the	DET
finefocus-3320	138	14	growing	grow	VERB
finefocus-3320	138	15	resistance	resistance	NOUN
finefocus-3320	138	16	of	of	ADP
finefocus-3320	138	17	pathogenic	pathogenic	ADJ
finefocus-3320	138	18	microorganisms	microorganism	NOUN
finefocus-3320	138	19	in	in	ADP
finefocus-3320	138	20	clinical	clinical	ADJ
finefocus-3320	138	21	settings	setting	NOUN
finefocus-3320	138	22	.	.	PUNCT
finefocus-3320	139	1	previous	previous	ADJ
finefocus-3320	139	2	evidence	evidence	NOUN
finefocus-3320	139	3	of	of	ADP
finefocus-3320	139	4	natural	natural	ADJ
finefocus-3320	139	5	ar	ar	NOUN
finefocus-3320	139	6	has	have	AUX
finefocus-3320	139	7	been	be	AUX
finefocus-3320	139	8	found	find	VERB
finefocus-3320	139	9	in	in	ADP
finefocus-3320	139	10	remote	remote	ADJ
finefocus-3320	139	11	soil	soil	NOUN
finefocus-3320	139	12	and	and	CCONJ
finefocus-3320	139	13	isolated	isolated	ADJ
finefocus-3320	139	14	cave	cave	NOUN
finefocus-3320	139	15	systems	system	NOUN
finefocus-3320	139	16	(	(	PUNCT
finefocus-3320	139	17	2,5	2,5	NUM
finefocus-3320	139	18	)	)	PUNCT
finefocus-3320	139	19	.	.	PUNCT
finefocus-3320	140	1	while	while	SCONJ
finefocus-3320	140	2	the	the	DET
finefocus-3320	140	3	primmer	primmer	NOUN
finefocus-3320	140	4	research	research	NOUN
finefocus-3320	140	5	property	property	NOUN
finefocus-3320	140	6	is	be	AUX
finefocus-3320	140	7	not	not	PART
finefocus-3320	140	8	as	as	ADV
finefocus-3320	140	9	isolated	isolated	ADJ
finefocus-3320	140	10	as	as	ADP
finefocus-3320	140	11	a	a	DET
finefocus-3320	140	12	cave	cave	NOUN
finefocus-3320	140	13	system	system	NOUN
finefocus-3320	140	14	,	,	PUNCT
finefocus-3320	140	15	our	our	PRON
finefocus-3320	140	16	samples	sample	NOUN
finefocus-3320	140	17	were	be	AUX
finefocus-3320	140	18	collected	collect	VERB
finefocus-3320	140	19	from	from	ADP
finefocus-3320	140	20	a	a	DET
finefocus-3320	140	21	site	site	NOUN
finefocus-3320	140	22	that	that	PRON
finefocus-3320	140	23	has	have	AUX
finefocus-3320	140	24	never	never	ADV
finefocus-3320	140	25	been	be	AUX
finefocus-3320	140	26	developed	develop	VERB
finefocus-3320	140	27	.	.	PUNCT
finefocus-3320	141	1	because	because	SCONJ
finefocus-3320	141	2	resistant	resistant	ADJ
finefocus-3320	141	3	organisms	organism	NOUN
finefocus-3320	141	4	were	be	AUX
finefocus-3320	141	5	found	find	VERB
finefocus-3320	141	6	in	in	ADP
finefocus-3320	141	7	each	each	PRON
finefocus-3320	141	8	of	of	ADP
finefocus-3320	141	9	the	the	DET
finefocus-3320	141	10	ecological	ecological	ADJ
finefocus-3320	141	11	zones	zone	NOUN
finefocus-3320	141	12	tested	test	VERB
finefocus-3320	141	13	,	,	PUNCT
finefocus-3320	141	14	our	our	PRON
finefocus-3320	141	15	results	result	NOUN
finefocus-3320	141	16	support	support	VERB
finefocus-3320	141	17	what	what	PRON
finefocus-3320	141	18	previous	previous	ADJ
finefocus-3320	141	19	research	research	NOUN
finefocus-3320	141	20	has	have	AUX
finefocus-3320	141	21	found	find	VERB
finefocus-3320	141	22	,	,	PUNCT
finefocus-3320	141	23	that	that	PRON
finefocus-3320	141	24	ar	ar	NOUN
finefocus-3320	141	25	occurs	occur	VERB
finefocus-3320	141	26	naturally	naturally	ADV
finefocus-3320	141	27	in	in	ADP
finefocus-3320	141	28	bacterial	bacterial	ADJ
finefocus-3320	141	29	populations	population	NOUN
finefocus-3320	141	30	.	.	PUNCT
finefocus-3320	142	1	not	not	PART
finefocus-3320	142	2	much	much	ADV
finefocus-3320	142	3	is	be	AUX
finefocus-3320	142	4	known	know	VERB
finefocus-3320	142	5	yet	yet	ADV
finefocus-3320	142	6	regarding	regard	VERB
finefocus-3320	142	7	how	how	SCONJ
finefocus-3320	142	8	frequently	frequently	ADV
finefocus-3320	142	9	ar	ar	NOUN
finefocus-3320	142	10	gene	gene	NOUN
finefocus-3320	142	11	transfer	transfer	NOUN
finefocus-3320	142	12	takes	take	VERB
finefocus-3320	142	13	place	place	NOUN
finefocus-3320	142	14	in	in	ADP
finefocus-3320	142	15	natural	natural	ADJ
finefocus-3320	142	16	environments	environment	NOUN
finefocus-3320	142	17	.	.	PUNCT
finefocus-3320	143	1	mdr	mdr	PROPN
finefocus-3320	143	2	can	can	AUX
finefocus-3320	143	3	occur	occur	VERB
finefocus-3320	143	4	through	through	ADP
finefocus-3320	143	5	various	various	ADJ
finefocus-3320	143	6	mechanisms	mechanism	NOUN
finefocus-3320	143	7	,	,	PUNCT
finefocus-3320	143	8	one	one	NUM
finefocus-3320	143	9	of	of	ADP
finefocus-3320	143	10	which	which	PRON
finefocus-3320	143	11	is	be	AUX
finefocus-3320	143	12	efflux	efflux	NOUN
finefocus-3320	143	13	of	of	ADP
finefocus-3320	143	14	the	the	DET
finefocus-3320	143	15	drugs	drug	NOUN
finefocus-3320	143	16	by	by	ADP
finefocus-3320	143	17	membrane	membrane	NOUN
finefocus-3320	143	18	transport	transport	NOUN
finefocus-3320	143	19	proteins	protein	NOUN
finefocus-3320	143	20	.	.	PUNCT
finefocus-3320	144	1	efflux	efflux	NOUN
finefocus-3320	144	2	pumps	pump	NOUN
finefocus-3320	144	3	are	be	AUX
finefocus-3320	144	4	able	able	ADJ
finefocus-3320	144	5	to	to	PART
finefocus-3320	144	6	transport	transport	VERB
finefocus-3320	144	7	specific	specific	ADJ
finefocus-3320	144	8	substrates	substrate	NOUN
finefocus-3320	144	9	or	or	CCONJ
finefocus-3320	144	10	expel	expel	VERB
finefocus-3320	144	11	cytotoxic	cytotoxic	ADJ
finefocus-3320	144	12	compounds	compound	NOUN
finefocus-3320	144	13	(	(	PUNCT
finefocus-3320	144	14	6	6	NUM
finefocus-3320	144	15	,	,	PUNCT
finefocus-3320	144	16	29	29	NUM
finefocus-3320	144	17	)	)	PUNCT
finefocus-3320	144	18	.	.	PUNCT
finefocus-3320	145	1	while	while	SCONJ
finefocus-3320	145	2	there	there	PRON
finefocus-3320	145	3	is	be	VERB
finefocus-3320	145	4	evidence	evidence	NOUN
finefocus-3320	145	5	that	that	PRON
finefocus-3320	145	6	efflux	efflux	NOUN
finefocus-3320	145	7	pumps	pump	NOUN
finefocus-3320	145	8	are	be	AUX
finefocus-3320	145	9	physiologically	physiologically	ADV
finefocus-3320	145	10	important	important	ADJ
finefocus-3320	145	11	(	(	PUNCT
finefocus-3320	145	12	35	35	NUM
finefocus-3320	145	13	)	)	PUNCT
finefocus-3320	145	14	,	,	PUNCT
finefocus-3320	145	15	they	they	PRON
finefocus-3320	145	16	commonly	commonly	ADV
finefocus-3320	145	17	mediate	mediate	VERB
finefocus-3320	145	18	mdr	mdr	PROPN
finefocus-3320	145	19	.	.	PUNCT
finefocus-3320	146	1	this	this	PRON
finefocus-3320	146	2	has	have	AUX
finefocus-3320	146	3	led	lead	VERB
finefocus-3320	146	4	to	to	ADP
finefocus-3320	146	5	the	the	DET
finefocus-3320	146	6	occurrence	occurrence	NOUN
finefocus-3320	146	7	of	of	ADP
finefocus-3320	146	8	microorganisms	microorganism	NOUN
finefocus-3320	146	9	intrinsically	intrinsically	ADV
finefocus-3320	146	10	resistant	resistant	ADJ
finefocus-3320	146	11	to	to	ADP
finefocus-3320	146	12	multiple	multiple	ADJ
finefocus-3320	146	13	antibiotics	antibiotic	NOUN
finefocus-3320	146	14	(	(	PUNCT
finefocus-3320	146	15	33	33	NUM
finefocus-3320	146	16	)	)	PUNCT
finefocus-3320	146	17	.	.	PUNCT
finefocus-3320	147	1	our	our	PRON
finefocus-3320	147	2	data	datum	NOUN
finefocus-3320	147	3	support	support	VERB
finefocus-3320	147	4	this	this	DET
finefocus-3320	147	5	claim	claim	NOUN
finefocus-3320	147	6	,	,	PUNCT
finefocus-3320	147	7	as	as	SCONJ
finefocus-3320	147	8	resistance	resistance	NOUN
finefocus-3320	147	9	was	be	AUX
finefocus-3320	147	10	found	find	VERB
finefocus-3320	147	11	to	to	ADP
finefocus-3320	147	12	ciprofloxacin	ciprofloxacin	PRON
finefocus-3320	147	13	,	,	PUNCT
finefocus-3320	147	14	despite	despite	SCONJ
finefocus-3320	147	15	a	a	DET
finefocus-3320	147	16	seemingly	seemingly	ADV
finefocus-3320	147	17	absence	absence	NOUN
finefocus-3320	147	18	of	of	ADP
finefocus-3320	147	19	evolutionary	evolutionary	ADJ
finefocus-3320	147	20	pressures	pressure	NOUN
finefocus-3320	147	21	.	.	PUNCT
finefocus-3320	148	1	interestingly	interestingly	ADV
finefocus-3320	148	2	,	,	PUNCT
finefocus-3320	148	3	more	more	ADJ
finefocus-3320	148	4	of	of	ADP
finefocus-3320	148	5	our	our	PRON
finefocus-3320	148	6	isolates	isolate	NOUN
finefocus-3320	148	7	exhibited	exhibit	VERB
finefocus-3320	148	8	resistance	resistance	NOUN
finefocus-3320	148	9	to	to	ADP
finefocus-3320	148	10	penicillin	penicillin	NOUN
finefocus-3320	148	11	than	than	ADP
finefocus-3320	148	12	ampicillin	ampicillin	PROPN
finefocus-3320	148	13	,	,	PUNCT
finefocus-3320	148	14	yet	yet	CCONJ
finefocus-3320	148	15	both	both	PRON
finefocus-3320	148	16	are	be	AUX
finefocus-3320	148	17	β	β	NOUN
finefocus-3320	148	18	-	-	NOUN
finefocus-3320	148	19	lactam	lactam	NOUN
finefocus-3320	148	20	antibiotics	antibiotic	NOUN
finefocus-3320	148	21	.	.	PUNCT
finefocus-3320	149	1	this	this	PRON
finefocus-3320	149	2	could	could	AUX
finefocus-3320	149	3	be	be	AUX
finefocus-3320	149	4	attributed	attribute	VERB
finefocus-3320	149	5	to	to	ADP
finefocus-3320	149	6	the	the	DET
finefocus-3320	149	7	fact	fact	NOUN
finefocus-3320	149	8	that	that	SCONJ
finefocus-3320	149	9	penicillin	penicillin	NOUN
finefocus-3320	149	10	has	have	AUX
finefocus-3320	149	11	natural	natural	ADJ
finefocus-3320	149	12	origins	origin	NOUN
finefocus-3320	149	13	whereas	whereas	SCONJ
finefocus-3320	149	14	ampicillin	ampicillin	NOUN
finefocus-3320	149	15	is	be	AUX
finefocus-3320	149	16	semi	semi	ADJ
finefocus-3320	149	17	-	-	ADJ
finefocus-3320	149	18	synthetic	synthetic	ADJ
finefocus-3320	149	19	.	.	PUNCT
finefocus-3320	150	1	overall	overall	ADV
finefocus-3320	150	2	,	,	PUNCT
finefocus-3320	150	3	our	our	PRON
finefocus-3320	150	4	results	result	NOUN
finefocus-3320	150	5	suggest	suggest	VERB
finefocus-3320	150	6	that	that	SCONJ
finefocus-3320	150	7	mdr	mdr	PROPN
finefocus-3320	150	8	in	in	ADP
finefocus-3320	150	9	a	a	DET
finefocus-3320	150	10	bacterial	bacterial	ADJ
finefocus-3320	150	11	population	population	NOUN
finefocus-3320	150	12	is	be	AUX
finefocus-3320	150	13	a	a	DET
finefocus-3320	150	14	naturally	naturally	ADV
finefocus-3320	150	15	occurring	occur	VERB
finefocus-3320	150	16	phenomenon	phenomenon	NOUN
finefocus-3320	150	17	.	.	PUNCT
finefocus-3320	151	1	hgt	hgt	PROPN
finefocus-3320	151	2	of	of	ADP
finefocus-3320	151	3	naturally	naturally	ADV
finefocus-3320	151	4	occurring	occur	VERB
finefocus-3320	151	5	resistance	resistance	NOUN
finefocus-3320	151	6	genes	gene	NOUN
finefocus-3320	151	7	to	to	ADP
finefocus-3320	151	8	pathogens	pathogen	NOUN
finefocus-3320	151	9	could	could	AUX
finefocus-3320	151	10	also	also	ADV
finefocus-3320	151	11	be	be	AUX
finefocus-3320	151	12	a	a	DET
finefocus-3320	151	13	factor	factor	NOUN
finefocus-3320	151	14	for	for	ADP
finefocus-3320	151	15	the	the	DET
finefocus-3320	151	16	acceleration	acceleration	NOUN
finefocus-3320	151	17	of	of	ADP
finefocus-3320	151	18	resistance	resistance	NOUN
finefocus-3320	151	19	found	find	VERB
finefocus-3320	151	20	in	in	ADP
finefocus-3320	151	21	clinical	clinical	ADJ
finefocus-3320	151	22	and	and	CCONJ
finefocus-3320	151	23	agricultural	agricultural	ADJ
finefocus-3320	151	24	settings	setting	NOUN
finefocus-3320	151	25	.	.	PUNCT
finefocus-3320	152	1	to	to	PART
finefocus-3320	152	2	characterize	characterize	VERB
finefocus-3320	152	3	the	the	DET
finefocus-3320	152	4	diversity	diversity	NOUN
finefocus-3320	152	5	of	of	ADP
finefocus-3320	152	6	the	the	DET
finefocus-3320	152	7	bacterial	bacterial	ADJ
finefocus-3320	152	8	populations	population	NOUN
finefocus-3320	152	9	present	present	ADJ
finefocus-3320	152	10	in	in	ADP
finefocus-3320	152	11	the	the	DET
finefocus-3320	152	12	different	different	ADJ
finefocus-3320	152	13	ecological	ecological	ADJ
finefocus-3320	152	14	zones	zone	NOUN
finefocus-3320	152	15	,	,	PUNCT
finefocus-3320	152	16	we	we	PRON
finefocus-3320	152	17	analyzed	analyze	VERB
finefocus-3320	152	18	colony	colony	NOUN
finefocus-3320	152	19	morphology	morphology	NOUN
finefocus-3320	152	20	present	present	ADJ
finefocus-3320	152	21	on	on	ADP
finefocus-3320	152	22	our	our	PRON
finefocus-3320	152	23	nonselective	nonselective	ADJ
finefocus-3320	152	24	media	medium	NOUN
finefocus-3320	152	25	plates	plate	NOUN
finefocus-3320	152	26	and	and	CCONJ
finefocus-3320	152	27	selected	select	VERB
finefocus-3320	152	28	antibiotic	antibiotic	ADJ
finefocus-3320	152	29	-	-	PUNCT
finefocus-3320	152	30	resistant	resistant	ADJ
finefocus-3320	152	31	isolates	isolate	NOUN
finefocus-3320	152	32	to	to	PART
finefocus-3320	152	33	be	be	AUX
finefocus-3320	152	34	sequenced	sequence	VERB
finefocus-3320	152	35	.	.	PUNCT
finefocus-3320	153	1	previous	previous	ADJ
finefocus-3320	153	2	research	research	NOUN
finefocus-3320	153	3	has	have	AUX
finefocus-3320	153	4	shown	show	VERB
finefocus-3320	153	5	a	a	DET
finefocus-3320	153	6	wide	wide	ADJ
finefocus-3320	153	7	variety	variety	NOUN
finefocus-3320	153	8	of	of	ADP
finefocus-3320	153	9	taxonomic	taxonomic	ADJ
finefocus-3320	153	10	groups	group	NOUN
finefocus-3320	153	11	to	to	PART
finefocus-3320	153	12	have	have	VERB
finefocus-3320	153	13	ar	ar	NOUN
finefocus-3320	153	14	and	and	CCONJ
finefocus-3320	153	15	mdr	mdr	PROPN
finefocus-3320	153	16	bacteria	bacteria	NOUN
finefocus-3320	153	17	(	(	PUNCT
finefocus-3320	153	18	31	31	NUM
finefocus-3320	153	19	)	)	PUNCT
finefocus-3320	153	20	and	and	CCONJ
finefocus-3320	153	21	also	also	ADV
finefocus-3320	153	22	that	that	SCONJ
finefocus-3320	153	23	bacteria	bacteria	NOUN
finefocus-3320	153	24	are	be	AUX
finefocus-3320	153	25	capable	capable	ADJ
finefocus-3320	153	26	of	of	ADP
finefocus-3320	153	27	transferring	transfer	VERB
finefocus-3320	153	28	ar	ar	NOUN
finefocus-3320	153	29	genes	gene	NOUN
finefocus-3320	153	30	either	either	CCONJ
finefocus-3320	153	31	between	between	ADP
finefocus-3320	153	32	bacteria	bacteria	NOUN
finefocus-3320	153	33	of	of	ADP
finefocus-3320	153	34	the	the	DET
finefocus-3320	153	35	same	same	ADJ
finefocus-3320	153	36	species	specie	NOUN
finefocus-3320	153	37	or	or	CCONJ
finefocus-3320	153	38	between	between	ADP
finefocus-3320	153	39	different	different	ADJ
finefocus-3320	153	40	species	specie	NOUN
finefocus-3320	153	41	(	(	PUNCT
finefocus-3320	153	42	4	4	NUM
finefocus-3320	153	43	)	)	PUNCT
finefocus-3320	153	44	.	.	PUNCT
finefocus-3320	154	1	we	we	PRON
finefocus-3320	154	2	found	find	VERB
finefocus-3320	154	3	a	a	DET
finefocus-3320	154	4	high	high	ADJ
finefocus-3320	154	5	diversity	diversity	NOUN
finefocus-3320	154	6	of	of	ADP
finefocus-3320	154	7	colony	colony	NOUN
finefocus-3320	154	8	morphologies	morphology	NOUN
finefocus-3320	154	9	(	(	PUNCT
finefocus-3320	154	10	table	table	NOUN
finefocus-3320	154	11	3	3	NUM
finefocus-3320	154	12	)	)	PUNCT
finefocus-3320	154	13	and	and	CCONJ
finefocus-3320	154	14	identified	identify	VERB
finefocus-3320	154	15	six	six	NUM
finefocus-3320	154	16	unique	unique	ADJ
finefocus-3320	154	17	bacteria	bacteria	NOUN
finefocus-3320	154	18	genera	genera	NOUN
finefocus-3320	154	19	(	(	PUNCT
finefocus-3320	154	20	table	table	NOUN
finefocus-3320	154	21	4	4	NUM
finefocus-3320	154	22	)	)	PUNCT
finefocus-3320	154	23	from	from	ADP
finefocus-3320	154	24	a	a	DET
finefocus-3320	154	25	small	small	ADJ
finefocus-3320	154	26	subset	subset	NOUN
finefocus-3320	154	27	of	of	ADP
finefocus-3320	154	28	total	total	ADJ
finefocus-3320	154	29	colonies	colony	NOUN
finefocus-3320	154	30	.	.	PUNCT
finefocus-3320	155	1	since	since	SCONJ
finefocus-3320	155	2	all	all	DET
finefocus-3320	155	3	selected	select	VERB
finefocus-3320	155	4	isolates	isolate	NOUN
finefocus-3320	155	5	were	be	AUX
finefocus-3320	155	6	found	find	VERB
finefocus-3320	155	7	to	to	PART
finefocus-3320	155	8	be	be	AUX
finefocus-3320	155	9	multidrugresistant	multidrugresistant	ADJ
finefocus-3320	155	10	,	,	PUNCT
finefocus-3320	155	11	it	it	PRON
finefocus-3320	155	12	is	be	AUX
finefocus-3320	155	13	possible	possible	ADJ
finefocus-3320	155	14	that	that	SCONJ
finefocus-3320	155	15	hgt	hgt	PROPN
finefocus-3320	155	16	of	of	ADP
finefocus-3320	155	17	ar	ar	PROPN
finefocus-3320	155	18	genes	gene	NOUN
finefocus-3320	155	19	occurs	occur	VERB
finefocus-3320	155	20	naturally	naturally	ADV
finefocus-3320	155	21	at	at	ADP
finefocus-3320	155	22	some	some	DET
finefocus-3320	155	23	frequency	frequency	NOUN
finefocus-3320	155	24	.	.	PUNCT
finefocus-3320	156	1	these	these	DET
finefocus-3320	156	2	data	datum	NOUN
finefocus-3320	156	3	support	support	VERB
finefocus-3320	156	4	our	our	PRON
finefocus-3320	156	5	hypothesis	hypothesis	NOUN
finefocus-3320	156	6	that	that	PRON
finefocus-3320	156	7	unique	unique	ADJ
finefocus-3320	156	8	bacteria	bacteria	NOUN
finefocus-3320	156	9	would	would	AUX
finefocus-3320	156	10	be	be	AUX
finefocus-3320	156	11	found	find	VERB
finefocus-3320	156	12	in	in	ADP
finefocus-3320	156	13	the	the	DET
finefocus-3320	156	14	different	different	ADJ
finefocus-3320	156	15	ecological	ecological	ADJ
finefocus-3320	156	16	zones	zone	NOUN
finefocus-3320	156	17	,	,	PUNCT
finefocus-3320	156	18	and	and	CCONJ
finefocus-3320	156	19	more	more	ADV
finefocus-3320	156	20	importantly	importantly	ADV
finefocus-3320	156	21	,	,	PUNCT
finefocus-3320	156	22	that	that	SCONJ
finefocus-3320	156	23	antibiotic	antibiotic	ADJ
finefocus-3320	156	24	-	-	PUNCT
finefocus-3320	156	25	resistant	resistant	ADJ
finefocus-3320	156	26	bacteria	bacteria	NOUN
finefocus-3320	156	27	can	can	AUX
finefocus-3320	156	28	be	be	AUX
finefocus-3320	156	29	from	from	ADP
finefocus-3320	156	30	a	a	DET
finefocus-3320	156	31	highly	highly	ADV
finefocus-3320	156	32	diverse	diverse	ADJ
finefocus-3320	156	33	group	group	NOUN
finefocus-3320	156	34	.	.	PUNCT
finefocus-3320	157	1	soil	soil	NOUN
finefocus-3320	157	2	is	be	AUX
finefocus-3320	157	3	rich	rich	ADJ
finefocus-3320	157	4	in	in	ADP
finefocus-3320	157	5	microbial	microbial	ADJ
finefocus-3320	157	6	abundance	abundance	NOUN
finefocus-3320	157	7	and	and	CCONJ
finefocus-3320	157	8	species	species	NOUN
finefocus-3320	157	9	diversity	diversity	NOUN
finefocus-3320	157	10	.	.	PUNCT
finefocus-3320	158	1	it	it	PRON
finefocus-3320	158	2	has	have	AUX
finefocus-3320	158	3	been	be	AUX
finefocus-3320	158	4	estimated	estimate	VERB
finefocus-3320	158	5	that	that	SCONJ
finefocus-3320	158	6	a	a	DET
finefocus-3320	158	7	single	single	ADJ
finefocus-3320	158	8	gram	gram	NOUN
finefocus-3320	158	9	of	of	ADP
finefocus-3320	158	10	soil	soil	NOUN
finefocus-3320	158	11	can	can	AUX
finefocus-3320	158	12	have	have	VERB
finefocus-3320	158	13	up	up	ADP
finefocus-3320	158	14	to	to	ADP
finefocus-3320	158	15	1010	1010	NUM
finefocus-3320	158	16	bacterial	bacterial	ADJ
finefocus-3320	158	17	cells	cell	NOUN
finefocus-3320	158	18	and	and	CCONJ
finefocus-3320	158	19	more	more	ADJ
finefocus-3320	158	20	than	than	ADP
finefocus-3320	158	21	4×103	4×103	NUM
finefocus-3320	158	22	different	different	ADJ
finefocus-3320	158	23	bacteria	bacteria	NOUN
finefocus-3320	158	24	species	specie	NOUN
finefocus-3320	158	25	(	(	PUNCT
finefocus-3320	158	26	20	20	NUM
finefocus-3320	158	27	,	,	PUNCT
finefocus-3320	158	28	34	34	NUM
finefocus-3320	158	29	,	,	PUNCT
finefocus-3320	158	30	36	36	NUM
finefocus-3320	158	31	,	,	PUNCT
finefocus-3320	158	32	40	40	NUM
finefocus-3320	158	33	,	,	PUNCT
finefocus-3320	158	34	46	46	NUM
finefocus-3320	158	35	,	,	PUNCT
finefocus-3320	158	36	47	47	NUM
finefocus-3320	158	37	)	)	PUNCT
finefocus-3320	158	38	.	.	PUNCT
finefocus-3320	159	1	in	in	ADP
finefocus-3320	159	2	addition	addition	NOUN
finefocus-3320	159	3	,	,	PUNCT
finefocus-3320	159	4	bacteria	bacteria	NOUN
finefocus-3320	159	5	populations	population	NOUN
finefocus-3320	159	6	can	can	AUX
finefocus-3320	159	7	differ	differ	VERB
finefocus-3320	159	8	between	between	ADP
finefocus-3320	159	9	geography	geography	NOUN
finefocus-3320	159	10	and	and	CCONJ
finefocus-3320	159	11	altitude	altitude	NOUN
finefocus-3320	159	12	(	(	PUNCT
finefocus-3320	159	13	30	30	NUM
finefocus-3320	159	14	)	)	PUNCT
finefocus-3320	159	15	.	.	PUNCT
finefocus-3320	160	1	using	use	VERB
finefocus-3320	160	2	a	a	DET
finefocus-3320	160	3	site	site	NOUN
finefocus-3320	160	4	with	with	ADP
finefocus-3320	160	5	seven	seven	NUM
finefocus-3320	160	6	adjacent	adjacent	ADJ
finefocus-3320	160	7	ecological	ecological	ADJ
finefocus-3320	160	8	zones	zone	NOUN
finefocus-3320	160	9	gave	give	VERB
finefocus-3320	160	10	us	we	PRON
finefocus-3320	160	11	the	the	DET
finefocus-3320	160	12	unique	unique	ADJ
finefocus-3320	160	13	ability	ability	NOUN
finefocus-3320	160	14	to	to	PART
finefocus-3320	160	15	directly	directly	ADV
finefocus-3320	160	16	compare	compare	VERB
finefocus-3320	160	17	both	both	CCONJ
finefocus-3320	160	18	the	the	DET
finefocus-3320	160	19	prevalence	prevalence	NOUN
finefocus-3320	160	20	and	and	CCONJ
finefocus-3320	160	21	diversity	diversity	NOUN
finefocus-3320	160	22	of	of	ADP
finefocus-3320	160	23	antibiotic	antibiotic	ADJ
finefocus-3320	160	24	-	-	PUNCT
finefocus-3320	160	25	resistant	resistant	ADJ
finefocus-3320	160	26	organisms	organism	NOUN
finefocus-3320	160	27	in	in	ADP
finefocus-3320	160	28	these	these	DET
finefocus-3320	160	29	different	different	ADJ
finefocus-3320	160	30	ecosystems	ecosystem	NOUN
finefocus-3320	160	31	.	.	PUNCT
finefocus-3320	161	1	we	we	PRON
finefocus-3320	161	2	found	find	VERB
finefocus-3320	161	3	a	a	DET
finefocus-3320	161	4	large	large	ADJ
finefocus-3320	161	5	range	range	NOUN
finefocus-3320	161	6	in	in	ADP
finefocus-3320	161	7	the	the	DET
finefocus-3320	161	8	overall	overall	ADJ
finefocus-3320	161	9	percentages	percentage	NOUN
finefocus-3320	161	10	of	of	ADP
finefocus-3320	161	11	resistant	resistant	ADJ
finefocus-3320	161	12	organisms	organism	NOUN
finefocus-3320	161	13	in	in	ADP
finefocus-3320	161	14	each	each	PRON
finefocus-3320	161	15	of	of	ADP
finefocus-3320	161	16	the	the	DET
finefocus-3320	161	17	ecological	ecological	ADJ
finefocus-3320	161	18	zones	zone	NOUN
finefocus-3320	161	19	.	.	PUNCT
finefocus-3320	162	1	the	the	DET
finefocus-3320	162	2	highest	high	ADJ
finefocus-3320	162	3	percent	percent	NOUN
finefocus-3320	162	4	resistant	resistant	ADJ
finefocus-3320	162	5	organisms	organism	NOUN
finefocus-3320	162	6	were	be	AUX
finefocus-3320	162	7	found	find	VERB
finefocus-3320	162	8	in	in	ADP
finefocus-3320	162	9	the	the	DET
finefocus-3320	162	10	spring	spring	NOUN
finefocus-3320	162	11	(	(	PUNCT
finefocus-3320	162	12	s	s	NOUN
finefocus-3320	162	13	)	)	PUNCT
finefocus-3320	162	14	,	,	PUNCT
finefocus-3320	162	15	woodland	woodland	NOUN
finefocus-3320	162	16	(	(	PUNCT
finefocus-3320	162	17	wl	wl	PROPN
finefocus-3320	162	18	)	)	PUNCT
finefocus-3320	162	19	,	,	PUNCT
finefocus-3320	162	20	and	and	CCONJ
finefocus-3320	162	21	river	river	NOUN
finefocus-3320	162	22	(	(	PUNCT
finefocus-3320	162	23	hr	hr	NOUN
finefocus-3320	162	24	)	)	PUNCT
finefocus-3320	162	25	zones	zone	NOUN
finefocus-3320	162	26	.	.	PUNCT
finefocus-3320	163	1	high	high	ADJ
finefocus-3320	163	2	percentages	percentage	NOUN
finefocus-3320	163	3	in	in	ADP
finefocus-3320	163	4	the	the	DET
finefocus-3320	163	5	woodland	woodland	NOUN
finefocus-3320	163	6	areas	area	NOUN
finefocus-3320	163	7	could	could	AUX
finefocus-3320	163	8	be	be	AUX
finefocus-3320	163	9	due	due	ADJ
finefocus-3320	163	10	to	to	ADP
finefocus-3320	163	11	availability	availability	NOUN
finefocus-3320	163	12	of	of	ADP
finefocus-3320	163	13	nutrients	nutrient	NOUN
finefocus-3320	163	14	around	around	ADP
finefocus-3320	163	15	the	the	DET
finefocus-3320	163	16	rhizosphere	rhizosphere	ADJ
finefocus-3320	163	17	,	,	PUNCT
finefocus-3320	163	18	an	an	DET
finefocus-3320	163	19	active	active	ADJ
finefocus-3320	163	20	region	region	NOUN
finefocus-3320	163	21	around	around	ADP
finefocus-3320	163	22	a	a	DET
finefocus-3320	163	23	plant	plant	NOUN
finefocus-3320	163	24	root	root	NOUN
finefocus-3320	163	25	that	that	PRON
finefocus-3320	163	26	microorganisms	microorganism	NOUN
finefocus-3320	163	27	inhabit	inhabit	NOUN
finefocus-3320	163	28	(	(	PUNCT
finefocus-3320	163	29	3	3	NUM
finefocus-3320	163	30	)	)	PUNCT
finefocus-3320	163	31	.	.	PUNCT
finefocus-3320	164	1	the	the	DET
finefocus-3320	164	2	river	river	NOUN
finefocus-3320	164	3	and	and	CCONJ
finefocus-3320	164	4	spring	spring	NOUN
finefocus-3320	164	5	zones	zone	NOUN
finefocus-3320	164	6	could	could	AUX
finefocus-3320	164	7	have	have	VERB
finefocus-3320	164	8	high	high	ADJ
finefocus-3320	164	9	resistance	resistance	NOUN
finefocus-3320	164	10	from	from	ADP
finefocus-3320	164	11	upstream	upstream	ADJ
finefocus-3320	164	12	pollution	pollution	NOUN
finefocus-3320	164	13	sources	source	NOUN
finefocus-3320	164	14	,	,	PUNCT
finefocus-3320	164	15	especially	especially	ADV
finefocus-3320	164	16	since	since	SCONJ
finefocus-3320	164	17	the	the	DET
finefocus-3320	164	18	primmer	primmer	NOUN
finefocus-3320	164	19	research	research	NOUN
finefocus-3320	164	20	property	property	NOUN
finefocus-3320	164	21	is	be	AUX
finefocus-3320	164	22	located	locate	VERB
finefocus-3320	164	23	within	within	ADP
finefocus-3320	164	24	an	an	DET
finefocus-3320	164	25	agriculturally	agriculturally	ADV
finefocus-3320	164	26	focused	focused	ADJ
finefocus-3320	164	27	region	region	NOUN
finefocus-3320	164	28	.	.	PUNCT
finefocus-3320	165	1	this	this	PRON
finefocus-3320	165	2	is	be	AUX
finefocus-3320	165	3	not	not	PART
finefocus-3320	165	4	surprising	surprising	ADJ
finefocus-3320	165	5	as	as	SCONJ
finefocus-3320	165	6	other	other	ADJ
finefocus-3320	165	7	bacteria	bacteria	NOUN
finefocus-3320	165	8	have	have	AUX
finefocus-3320	165	9	been	be	AUX
finefocus-3320	165	10	previously	previously	ADV
finefocus-3320	165	11	found	find	VERB
finefocus-3320	165	12	to	to	PART
finefocus-3320	165	13	survive	survive	VERB
finefocus-3320	165	14	volume	volume	NOUN
finefocus-3320	165	15	six	six	NUM
finefocus-3320	165	16	|	|	ADV
finefocus-3320	165	17	71	71	NUM
finefocus-3320	165	18	in	in	ADP
finefocus-3320	165	19	water	water	NOUN
finefocus-3320	165	20	for	for	ADP
finefocus-3320	165	21	a	a	DET
finefocus-3320	165	22	long	long	ADJ
finefocus-3320	165	23	time	time	NOUN
finefocus-3320	165	24	,	,	PUNCT
finefocus-3320	165	25	such	such	ADJ
finefocus-3320	165	26	as	as	ADP
finefocus-3320	165	27	those	those	PRON
finefocus-3320	165	28	from	from	ADP
finefocus-3320	165	29	the	the	DET
finefocus-3320	165	30	genera	genera	NOUN
finefocus-3320	165	31	pseudomonas	pseudomona	NOUN
finefocus-3320	165	32	(	(	PUNCT
finefocus-3320	165	33	38	38	NUM
finefocus-3320	165	34	,	,	PUNCT
finefocus-3320	165	35	43	43	NUM
finefocus-3320	165	36	)	)	PUNCT
finefocus-3320	165	37	.	.	PUNCT
finefocus-3320	166	1	in	in	ADP
finefocus-3320	166	2	conclusion	conclusion	NOUN
finefocus-3320	166	3	,	,	PUNCT
finefocus-3320	166	4	the	the	DET
finefocus-3320	166	5	differences	difference	NOUN
finefocus-3320	166	6	we	we	PRON
finefocus-3320	166	7	found	find	VERB
finefocus-3320	166	8	between	between	ADP
finefocus-3320	166	9	the	the	DET
finefocus-3320	166	10	adjacent	adjacent	ADJ
finefocus-3320	166	11	sites	site	NOUN
finefocus-3320	166	12	show	show	VERB
finefocus-3320	166	13	that	that	SCONJ
finefocus-3320	166	14	while	while	SCONJ
finefocus-3320	166	15	there	there	PRON
finefocus-3320	166	16	is	be	VERB
finefocus-3320	166	17	a	a	DET
finefocus-3320	166	18	relationship	relationship	NOUN
finefocus-3320	166	19	between	between	ADP
finefocus-3320	166	20	ecology	ecology	NOUN
finefocus-3320	166	21	,	,	PUNCT
finefocus-3320	166	22	prevalence	prevalence	NOUN
finefocus-3320	166	23	of	of	ADP
finefocus-3320	166	24	antibiotic	antibiotic	ADJ
finefocus-3320	166	25	-	-	PUNCT
finefocus-3320	166	26	resistant	resistant	ADJ
finefocus-3320	166	27	organisms	organism	NOUN
finefocus-3320	166	28	,	,	PUNCT
finefocus-3320	166	29	and	and	CCONJ
finefocus-3320	166	30	types	type	NOUN
finefocus-3320	166	31	of	of	ADP
finefocus-3320	166	32	bacteria	bacteria	NOUN
finefocus-3320	166	33	present	present	ADJ
finefocus-3320	166	34	,	,	PUNCT
finefocus-3320	166	35	multidrugresistance	multidrugresistance	NOUN
finefocus-3320	166	36	was	be	AUX
finefocus-3320	166	37	found	find	VERB
finefocus-3320	166	38	in	in	ADP
finefocus-3320	166	39	all	all	DET
finefocus-3320	166	40	sites	site	NOUN
finefocus-3320	166	41	and	and	CCONJ
finefocus-3320	166	42	all	all	DET
finefocus-3320	166	43	types	type	NOUN
finefocus-3320	166	44	of	of	ADP
finefocus-3320	166	45	bacteria	bacteria	NOUN
finefocus-3320	166	46	tested	test	VERB
finefocus-3320	166	47	and	and	CCONJ
finefocus-3320	166	48	is	be	AUX
finefocus-3320	166	49	likely	likely	ADV
finefocus-3320	166	50	more	more	ADV
finefocus-3320	166	51	common	common	ADJ
finefocus-3320	166	52	in	in	ADP
finefocus-3320	166	53	the	the	DET
finefocus-3320	166	54	environment	environment	NOUN
finefocus-3320	166	55	than	than	SCONJ
finefocus-3320	166	56	we	we	PRON
finefocus-3320	166	57	thought	think	VERB
finefocus-3320	166	58	.	.	PUNCT
finefocus-3320	167	1	additional	additional	ADJ
finefocus-3320	167	2	surveillance	surveillance	NOUN
finefocus-3320	167	3	of	of	ADP
finefocus-3320	167	4	the	the	DET
finefocus-3320	167	5	resistome	resistome	NOUN
finefocus-3320	167	6	present	present	NOUN
finefocus-3320	167	7	in	in	ADP
finefocus-3320	167	8	different	different	ADJ
finefocus-3320	167	9	ecological	ecological	ADJ
finefocus-3320	167	10	locations	location	NOUN
finefocus-3320	167	11	will	will	AUX
finefocus-3320	167	12	likely	likely	ADV
finefocus-3320	167	13	be	be	AUX
finefocus-3320	167	14	essential	essential	ADJ
finefocus-3320	167	15	for	for	ADP
finefocus-3320	167	16	developing	develop	VERB
finefocus-3320	167	17	novel	novel	ADJ
finefocus-3320	167	18	antibiotic	antibiotic	ADJ
finefocus-3320	167	19	treatments	treatment	NOUN
finefocus-3320	167	20	.	.	PUNCT
finefocus-3320	168	1	acknowledgments	acknowledgment	NOUN
finefocus-3320	168	2	the	the	DET
finefocus-3320	168	3	authors	author	NOUN
finefocus-3320	168	4	acknowledge	acknowledge	VERB
finefocus-3320	168	5	dr	dr	PROPN
finefocus-3320	168	6	.	.	PROPN
finefocus-3320	168	7	carol	carol	PROPN
finefocus-3320	168	8	bascom	bascom	PROPN
finefocus-3320	168	9	-	-	PUNCT
finefocus-3320	168	10	slack	slack	PROPN
finefocus-3320	168	11	(	(	PUNCT
finefocus-3320	168	12	tufts	tuft	NOUN
finefocus-3320	168	13	university	university	NOUN
finefocus-3320	168	14	)	)	PUNCT
finefocus-3320	168	15	for	for	ADP
finefocus-3320	168	16	collaborating	collaborate	VERB
finefocus-3320	168	17	on	on	ADP
finefocus-3320	168	18	this	this	DET
finefocus-3320	168	19	project	project	NOUN
finefocus-3320	168	20	,	,	PUNCT
finefocus-3320	168	21	the	the	DET
finefocus-3320	168	22	merl	merl	PROPN
finefocus-3320	168	23	and	and	CCONJ
finefocus-3320	168	24	margaret	margaret	PROPN
finefocus-3320	168	25	primmer	primmer	PROPN
finefocus-3320	168	26	outdoor	outdoor	PROPN
finefocus-3320	168	27	learning	learning	NOUN
finefocus-3320	168	28	center	center	NOUN
finefocus-3320	168	29	(	(	PUNCT
finefocus-3320	168	30	capital	capital	NOUN
finefocus-3320	168	31	university	university	NOUN
finefocus-3320	168	32	)	)	PUNCT
finefocus-3320	168	33	for	for	ADP
finefocus-3320	168	34	financial	financial	ADJ
finefocus-3320	168	35	support	support	NOUN
finefocus-3320	168	36	,	,	PUNCT
finefocus-3320	168	37	and	and	CCONJ
finefocus-3320	168	38	dr	dr	PROPN
finefocus-3320	168	39	.	.	PROPN
finefocus-3320	168	40	stephen	stephen	PROPN
finefocus-3320	168	41	osmani	osmani	PROPN
finefocus-3320	168	42	(	(	PUNCT
finefocus-3320	168	43	the	the	DET
finefocus-3320	168	44	ohio	ohio	PROPN
finefocus-3320	168	45	state	state	PROPN
finefocus-3320	168	46	university	university	PROPN
finefocus-3320	168	47	)	)	PUNCT
finefocus-3320	168	48	for	for	ADP
finefocus-3320	168	49	use	use	NOUN
finefocus-3320	168	50	of	of	ADP
finefocus-3320	168	51	his	his	PRON
finefocus-3320	168	52	laboratory	laboratory	NOUN
finefocus-3320	168	53	and	and	CCONJ
finefocus-3320	168	54	reagents	reagent	NOUN
finefocus-3320	168	55	.	.	PUNCT
finefocus-3320	169	1	we	we	PRON
finefocus-3320	169	2	would	would	AUX
finefocus-3320	169	3	also	also	ADV
finefocus-3320	169	4	like	like	VERB
finefocus-3320	169	5	to	to	PART
finefocus-3320	169	6	thank	thank	VERB
finefocus-3320	169	7	dr	dr	PROPN
finefocus-3320	169	8	.	.	PROPN
finefocus-3320	169	9	kelly	kelly	PROPN
finefocus-3320	169	10	tatchell	tatchell	PROPN
finefocus-3320	169	11	(	(	PUNCT
finefocus-3320	169	12	louisiana	louisiana	PROPN
finefocus-3320	169	13	state	state	PROPN
finefocus-3320	169	14	university	university	PROPN
finefocus-3320	169	15	health	health	PROPN
finefocus-3320	169	16	sciences	sciences	PROPN
finefocus-3320	169	17	center	center	PROPN
finefocus-3320	169	18	)	)	PUNCT
finefocus-3320	169	19	and	and	CCONJ
finefocus-3320	169	20	dr	dr	PROPN
finefocus-3320	169	21	.	.	PROPN
finefocus-3320	169	22	christine	christine	PROPN
finefocus-3320	169	23	anderson	anderson	PROPN
finefocus-3320	170	1	(	(	PUNCT
finefocus-3320	170	2	capital	capital	PROPN
finefocus-3320	170	3	university	university	PROPN
finefocus-3320	170	4	)	)	PUNCT
finefocus-3320	170	5	for	for	ADP
finefocus-3320	170	6	critically	critically	ADV
finefocus-3320	170	7	reading	read	VERB
finefocus-3320	170	8	the	the	DET
finefocus-3320	170	9	manuscript	manuscript	NOUN
finefocus-3320	170	10	.	.	PUNCT
finefocus-3320	171	1	72	72	NUM
finefocus-3320	172	1	|	|	CCONJ
finefocus-3320	172	2	fine	fine	ADJ
finefocus-3320	172	3	focus	focus	NOUN
finefocus-3320	172	4	references	reference	NOUN
finefocus-3320	172	5	1	1	NUM
finefocus-3320	172	6	.	.	PUNCT
finefocus-3320	173	1	acred	acre	VERB
finefocus-3320	173	2	,	,	PUNCT
finefocus-3320	173	3	p.	p.	PROPN
finefocus-3320	173	4	,	,	PUNCT
finefocus-3320	173	5	brown	brown	PROPN
finefocus-3320	173	6	,	,	PUNCT
finefocus-3320	173	7	d.	d.	PROPN
finefocus-3320	173	8	m.	m.	PROPN
finefocus-3320	173	9	,	,	PUNCT
finefocus-3320	173	10	turner	turner	PROPN
finefocus-3320	173	11	,	,	PUNCT
finefocus-3320	173	12	d.	d.	PROPN
finefocus-3320	173	13	h.	h.	PROPN
finefocus-3320	173	14	,	,	PUNCT
finefocus-3320	173	15	&	&	CCONJ
finefocus-3320	173	16	wilson	wilson	PROPN
finefocus-3320	173	17	,	,	PUNCT
finefocus-3320	173	18	m.	m.	NOUN
finefocus-3320	173	19	j.	j.	PROPN
finefocus-3320	173	20	1962	1962	PROPN
finefocus-3320	173	21	.	.	PUNCT
finefocus-3320	174	1	pharmacology	pharmacology	NOUN
finefocus-3320	174	2	and	and	CCONJ
finefocus-3320	174	3	chemotherapy	chemotherapy	NOUN
finefocus-3320	174	4	of	of	ADP
finefocus-3320	174	5	ampicillin	ampicillin	NOUN
finefocus-3320	174	6	--	--	PUNCT
finefocus-3320	174	7	a	a	DET
finefocus-3320	174	8	newbroad	newbroad	NOUN
finefocus-3320	174	9	-	-	PUNCT
finefocus-3320	174	10	spectrum	spectrum	NOUN
finefocus-3320	174	11	penicillin	penicillin	NOUN
finefocus-3320	174	12	.	.	PUNCT
finefocus-3320	175	1	br	br	PROPN
finefocus-3320	175	2	.	.	PUNCT
finefocus-3320	176	1	j.	j.	PROPN
finefocus-3320	176	2	pharmacol	pharmacol	PROPN
finefocus-3320	176	3	.	.	PUNCT
finefocus-3320	177	1	chemother	chemother	PROPN
finefocus-3320	177	2	.	.	PUNCT
finefocus-3320	178	1	18	18	NUM
finefocus-3320	178	2	:	:	SYM
finefocus-3320	178	3	356–69	356–69	NUM
finefocus-3320	178	4	.	.	X
finefocus-3320	179	1	2	2	NUM
finefocus-3320	179	2	.	.	X
finefocus-3320	179	3	allen	allen	PROPN
finefocus-3320	179	4	,	,	PUNCT
finefocus-3320	179	5	h.	h.	PROPN
finefocus-3320	179	6	k.	k.	PROPN
finefocus-3320	179	7	,	,	PUNCT
finefocus-3320	179	8	moe	moe	PROPN
finefocus-3320	179	9	,	,	PUNCT
finefocus-3320	179	10	l.	l.	PROPN
finefocus-3320	179	11	,	,	PUNCT
finefocus-3320	179	12	a.	a.	PROPN
finefocus-3320	179	13	,	,	PUNCT
finefocus-3320	179	14	rodbumrer	rodbumrer	PROPN
finefocus-3320	179	15	,	,	PUNCT
finefocus-3320	179	16	j.	j.	PROPN
finefocus-3320	179	17	,	,	PUNCT
finefocus-3320	179	18	gaarder	gaarder	PROPN
finefocus-3320	179	19	,	,	PUNCT
finefocus-3320	179	20	a.	a.	PROPN
finefocus-3320	179	21	,	,	PUNCT
finefocus-3320	179	22	&	&	CCONJ
finefocus-3320	179	23	handelsman	handelsman	PROPN
finefocus-3320	179	24	,	,	PUNCT
finefocus-3320	179	25	j.	j.	PROPN
finefocus-3320	179	26	2009	2009	NUM
finefocus-3320	179	27	.	.	PUNCT
finefocus-3320	180	1	functional	functional	ADJ
finefocus-3320	180	2	metagenomics	metagenomic	NOUN
finefocus-3320	180	3	reveals	reveal	VERB
finefocus-3320	180	4	diverse	diverse	ADJ
finefocus-3320	180	5	β	β	NOUN
finefocus-3320	180	6	-	-	PUNCT
finefocus-3320	180	7	lactamasesin	lactamasesin	VERB
finefocus-3320	180	8	a	a	DET
finefocus-3320	180	9	remote	remote	ADJ
finefocus-3320	180	10	alaskan	alaskan	ADJ
finefocus-3320	180	11	soil	soil	NOUN
finefocus-3320	180	12	.	.	PUNCT
finefocus-3320	181	1	isme	isme	PROPN
finefocus-3320	181	2	3:243–251	3:243–251	PROPN
finefocus-3320	181	3	.	.	PUNCT
finefocus-3320	182	1	3	3	X
finefocus-3320	182	2	.	.	X
finefocus-3320	182	3	bais	bais	PROPN
finefocus-3320	182	4	,	,	PUNCT
finefocus-3320	182	5	h.	h.	PROPN
finefocus-3320	182	6	p.	p.	PROPN
finefocus-3320	182	7	,	,	PUNCT
finefocus-3320	182	8	park	park	PROPN
finefocus-3320	182	9	,	,	PUNCT
finefocus-3320	182	10	s.	s.	PROPN
finefocus-3320	182	11	w.	w.	PROPN
finefocus-3320	182	12	,	,	PUNCT
finefocus-3320	182	13	weir	weir	PROPN
finefocus-3320	182	14	,	,	PUNCT
finefocus-3320	182	15	t.	t.	PROPN
finefocus-3320	182	16	l.	l.	PROPN
finefocus-3320	182	17	,	,	PUNCT
finefocus-3320	182	18	callaway	callaway	PROPN
finefocus-3320	182	19	,	,	PUNCT
finefocus-3320	182	20	r.	r.	PROPN
finefocus-3320	182	21	m.	m.	PROPN
finefocus-3320	182	22	,	,	PUNCT
finefocus-3320	182	23	&	&	CCONJ
finefocus-3320	182	24	vivanco	vivanco	PROPN
finefocus-3320	182	25	,	,	PUNCT
finefocus-3320	182	26	j.	j.	PROPN
finefocus-3320	182	27	m.	m.	PROPN
finefocus-3320	182	28	2004	2004	NUM
finefocus-3320	182	29	.	.	PUNCT
finefocus-3320	183	1	how	how	SCONJ
finefocus-3320	183	2	plants	plant	NOUN
finefocus-3320	183	3	communicate	communicate	VERB
finefocus-3320	183	4	using	use	VERB
finefocus-3320	183	5	the	the	DET
finefocus-3320	183	6	underground	underground	ADJ
finefocus-3320	183	7	information	information	PROPN
finefocus-3320	183	8	superhighway	superhighway	PROPN
finefocus-3320	183	9	.	.	PUNCT
finefocus-3320	184	1	trends	trend	NOUN
finefocus-3320	184	2	plant	plant	VERB
finefocus-3320	184	3	sci	sci	PROPN
finefocus-3320	184	4	.	.	PUNCT
finefocus-3320	185	1	9:2632	9:2632	NUM
finefocus-3320	185	2	.	.	NOUN
finefocus-3320	186	1	4	4	NUM
finefocus-3320	186	2	.	.	X
finefocus-3320	186	3	barlow	barlow	NOUN
finefocus-3320	186	4	,	,	PUNCT
finefocus-3320	186	5	m.	m.	NOUN
finefocus-3320	186	6	2009	2009	NUM
finefocus-3320	186	7	.	.	PUNCT
finefocus-3320	187	1	what	what	PRON
finefocus-3320	187	2	antimicrobial	antimicrobial	ADJ
finefocus-3320	187	3	resistance	resistance	NOUN
finefocus-3320	187	4	has	have	AUX
finefocus-3320	187	5	taught	teach	VERB
finefocus-3320	187	6	us	we	PRON
finefocus-3320	187	7	about	about	ADP
finefocus-3320	187	8	horizontal	horizontal	ADJ
finefocus-3320	187	9	gene	gene	NOUN
finefocus-3320	187	10	transfer	transfer	NOUN
finefocus-3320	187	11	.	.	PUNCT
finefocus-3320	188	1	methods	method	NOUN
finefocus-3320	188	2	mol	mol	PROPN
finefocus-3320	188	3	.	.	PUNCT
finefocus-3320	189	1	biol	biol	PROPN
finefocus-3320	189	2	.	.	PUNCT
finefocus-3320	190	1	532:397	532:397	NUM
finefocus-3320	190	2	-	-	SYM
finefocus-3320	190	3	411	411	NUM
finefocus-3320	190	4	5	5	NUM
finefocus-3320	190	5	.	.	NOUN
finefocus-3320	190	6	bhullar	bhullar	ADJ
finefocus-3320	190	7	,	,	PUNCT
finefocus-3320	190	8	k.	k.	PROPN
finefocus-3320	190	9	,	,	PUNCT
finefocus-3320	190	10	waglechner	waglechner	PROPN
finefocus-3320	190	11	,	,	PUNCT
finefocus-3320	190	12	n.	n.	NOUN
finefocus-3320	190	13	,	,	PUNCT
finefocus-3320	190	14	pawlowski	pawlowski	NOUN
finefocus-3320	190	15	,	,	PUNCT
finefocus-3320	190	16	a.	a.	PROPN
finefocus-3320	190	17	,	,	PUNCT
finefocus-3320	190	18	koteva	koteva	PROPN
finefocus-3320	190	19	,	,	PUNCT
finefocus-3320	190	20	k.	k.	PROPN
finefocus-3320	190	21	,	,	PUNCT
finefocus-3320	190	22	banks	banks	PROPN
finefocus-3320	190	23	,	,	PUNCT
finefocus-3320	190	24	e.	e.	PROPN
finefocus-3320	190	25	d.	d.	PROPN
finefocus-3320	190	26	,	,	PUNCT
finefocus-3320	190	27	johnston	johnston	PROPN
finefocus-3320	190	28	,	,	PUNCT
finefocus-3320	190	29	m.	m.	PROPN
finefocus-3320	190	30	d.	d.	PROPN
finefocus-3320	190	31	,	,	PUNCT
finefocus-3320	190	32	barton	barton	PROPN
finefocus-3320	190	33	,	,	PUNCT
finefocus-3320	190	34	h.	h.	PROPN
finefocus-3320	190	35	a.	a.	PROPN
finefocus-3320	190	36	,	,	PUNCT
finefocus-3320	190	37	&	&	CCONJ
finefocus-3320	190	38	wright	wright	PROPN
finefocus-3320	190	39	,	,	PUNCT
finefocus-3320	190	40	g.	g.	PROPN
finefocus-3320	190	41	d.	d.	PROPN
finefocus-3320	190	42	2012	2012	NUM
finefocus-3320	190	43	.	.	PUNCT
finefocus-3320	191	1	antibiotic	antibiotic	ADJ
finefocus-3320	191	2	resistance	resistance	NOUN
finefocus-3320	191	3	is	be	AUX
finefocus-3320	191	4	prevalent	prevalent	ADJ
finefocus-3320	191	5	in	in	ADP
finefocus-3320	191	6	an	an	DET
finefocus-3320	191	7	isolated	isolated	ADJ
finefocus-3320	191	8	cave	cave	NOUN
finefocus-3320	191	9	microbiome	microbiome	NOUN
finefocus-3320	191	10	.	.	PUNCT
finefocus-3320	192	1	plos	plos	PROPN
finefocus-3320	192	2	one	one	NUM
finefocus-3320	192	3	doi	doi	NOUN
finefocus-3320	192	4	:	:	PUNCT
finefocus-3320	192	5	10.1371	10.1371	NUM
finefocus-3320	192	6	/	/	SYM
finefocus-3320	192	7	journal.pone.0034953	journal.pone.0034953	ADJ
finefocus-3320	192	8	.	.	PROPN
finefocus-3320	193	1	6	6	NUM
finefocus-3320	193	2	.	.	X
finefocus-3320	193	3	borges	borge	NOUN
finefocus-3320	193	4	-	-	PUNCT
finefocus-3320	193	5	walmsley	walmsley	PROPN
finefocus-3320	193	6	,	,	PUNCT
finefocus-3320	193	7	m.	m.	NOUN
finefocus-3320	193	8	i.	i.	PROPN
finefocus-3320	193	9	,	,	PUNCT
finefocus-3320	193	10	mckeegan	mckeegan	PROPN
finefocus-3320	193	11	,	,	PUNCT
finefocus-3320	193	12	k.	k.	PROPN
finefocus-3320	193	13	s.	s.	PROPN
finefocus-3320	193	14	,	,	PUNCT
finefocus-3320	193	15	&	&	CCONJ
finefocus-3320	193	16	walmsley	walmsley	PROPN
finefocus-3320	193	17	,	,	PUNCT
finefocus-3320	193	18	a.	a.	PROPN
finefocus-3320	193	19	r.	r.	PROPN
finefocus-3320	193	20	2003	2003	NUM
finefocus-3320	193	21	.	.	PUNCT
finefocus-3320	194	1	structure	structure	NOUN
finefocus-3320	194	2	and	and	CCONJ
finefocus-3320	194	3	function	function	NOUN
finefocus-3320	194	4	of	of	ADP
finefocus-3320	194	5	efflux	efflux	NOUN
finefocus-3320	194	6	pumps	pump	NOUN
finefocus-3320	194	7	that	that	PRON
finefocus-3320	194	8	confer	confer	VERB
finefocus-3320	194	9	resistance	resistance	NOUN
finefocus-3320	194	10	to	to	ADP
finefocus-3320	194	11	drugs	drug	NOUN
finefocus-3320	194	12	.	.	PUNCT
finefocus-3320	195	1	biochem	biochem	PROPN
finefocus-3320	195	2	.	.	PUNCT
finefocus-3320	196	1	j.	j.	PROPN
finefocus-3320	196	2	376:313–38	376:313–38	PROPN
finefocus-3320	196	3	.	.	PUNCT
finefocus-3320	197	1	7	7	NUM
finefocus-3320	197	2	.	.	X
finefocus-3320	197	3	breakwell	breakwell	PROPN
finefocus-3320	197	4	,	,	PUNCT
finefocus-3320	197	5	d.	d.	PROPN
finefocus-3320	197	6	,	,	PUNCT
finefocus-3320	197	7	macdonald	macdonald	PROPN
finefocus-3320	197	8	,	,	PUNCT
finefocus-3320	197	9	b.	b.	PROPN
finefocus-3320	197	10	,	,	PUNCT
finefocus-3320	197	11	woolverton	woolverton	PROPN
finefocus-3320	197	12	,	,	PUNCT
finefocus-3320	197	13	c.	c.	PROPN
finefocus-3320	197	14	,	,	PUNCT
finefocus-3320	197	15	smith	smith	PROPN
finefocus-3320	197	16	,	,	PUNCT
finefocus-3320	197	17	k.	k.	PROPN
finefocus-3320	197	18	,	,	PUNCT
finefocus-3320	197	19	&	&	CCONJ
finefocus-3320	197	20	robison	robison	PROPN
finefocus-3320	197	21	,	,	PUNCT
finefocus-3320	197	22	r.	r.	PROPN
finefocus-3320	197	23	colony	colony	PROPN
finefocus-3320	197	24	morphology	morphology	NOUN
finefocus-3320	197	25	protocol	protocol	NOUN
finefocus-3320	197	26	.	.	PUNCT
finefocus-3320	198	1	american	american	ADJ
finefocus-3320	198	2	society	society	PROPN
finefocus-3320	198	3	for	for	ADP
finefocus-3320	198	4	microbiology	microbiology	NOUN
finefocus-3320	198	5	.	.	PUNCT
finefocus-3320	199	1	8	8	X
finefocus-3320	199	2	.	.	X
finefocus-3320	199	3	centers	center	NOUN
finefocus-3320	199	4	for	for	ADP
finefocus-3320	199	5	disease	disease	NOUN
finefocus-3320	199	6	control	control	NOUN
finefocus-3320	199	7	and	and	CCONJ
finefocus-3320	199	8	prevention	prevention	NOUN
finefocus-3320	199	9	.	.	PUNCT
finefocus-3320	200	1	antibiotic	antibiotic	ADJ
finefocus-3320	200	2	resistance	resistance	NOUN
finefocus-3320	200	3	threats	threat	NOUN
finefocus-3320	200	4	in	in	ADP
finefocus-3320	200	5	the	the	DET
finefocus-3320	200	6	united	united	PROPN
finefocus-3320	200	7	states	states	PROPN
finefocus-3320	200	8	,	,	PUNCT
finefocus-3320	200	9	2013	2013	NUM
finefocus-3320	200	10	.	.	PUNCT
finefocus-3320	201	1	9	9	NUM
finefocus-3320	201	2	.	.	X
finefocus-3320	201	3	colomer	colomer	NOUN
finefocus-3320	201	4	-	-	PUNCT
finefocus-3320	201	5	lluch	lluch	ADJ
finefocus-3320	201	6	,	,	PUNCT
finefocus-3320	201	7	m.	m.	NOUN
finefocus-3320	201	8	,	,	PUNCT
finefocus-3320	201	9	jofre	jofre	PROPN
finefocus-3320	201	10	,	,	PUNCT
finefocus-3320	201	11	j.	j.	PROPN
finefocus-3320	201	12	,	,	PUNCT
finefocus-3320	201	13	&	&	CCONJ
finefocus-3320	201	14	muniesa	muniesa	PROPN
finefocus-3320	201	15	,	,	PUNCT
finefocus-3320	201	16	m.	m.	NOUN
finefocus-3320	201	17	2011	2011	NUM
finefocus-3320	201	18	.	.	PUNCT
finefocus-3320	202	1	antibiotic	antibiotic	ADJ
finefocus-3320	202	2	resistance	resistance	NOUN
finefocus-3320	202	3	genes	gene	NOUN
finefocus-3320	202	4	in	in	ADP
finefocus-3320	202	5	the	the	DET
finefocus-3320	202	6	bacteriophage	bacteriophage	NOUN
finefocus-3320	202	7	dna	dna	NOUN
finefocus-3320	202	8	fraction	fraction	NOUN
finefocus-3320	202	9	of	of	ADP
finefocus-3320	202	10	environmental	environmental	ADJ
finefocus-3320	202	11	samples	sample	NOUN
finefocus-3320	202	12	.	.	PUNCT
finefocus-3320	203	1	plos	plos	PROPN
finefocus-3320	203	2	one	one	NUM
finefocus-3320	203	3	doi:10.1371	doi:10.1371	NOUN
finefocus-3320	203	4	/	/	SYM
finefocus-3320	203	5	journal.pone.0017549	journal.pone.0017549	NOUN
finefocus-3320	203	6	.	.	PROPN
finefocus-3320	203	7	10	10	NUM
finefocus-3320	203	8	.	.	PUNCT
finefocus-3320	204	1	d’costa	d’costa	PROPN
finefocus-3320	204	2	,	,	PUNCT
finefocus-3320	204	3	v.	v.	ADP
finefocus-3320	204	4	m.	m.	NOUN
finefocus-3320	204	5	,	,	PUNCT
finefocus-3320	204	6	mcgrann	mcgrann	PROPN
finefocus-3320	204	7	,	,	PUNCT
finefocus-3320	204	8	k.	k.	PROPN
finefocus-3320	204	9	m.	m.	PROPN
finefocus-3320	204	10	,	,	PUNCT
finefocus-3320	204	11	hughes	hughes	PROPN
finefocus-3320	204	12	,	,	PUNCT
finefocus-3320	204	13	d.	d.	PROPN
finefocus-3320	204	14	w.	w.	PROPN
finefocus-3320	204	15	,	,	PUNCT
finefocus-3320	204	16	&	&	CCONJ
finefocus-3320	204	17	wright	wright	PROPN
finefocus-3320	204	18	,	,	PUNCT
finefocus-3320	204	19	g.	g.	PROPN
finefocus-3320	204	20	d.	d.	PROPN
finefocus-3320	204	21	2006	2006	NUM
finefocus-3320	204	22	.	.	PUNCT
finefocus-3320	205	1	sampling	sample	VERB
finefocus-3320	205	2	the	the	DET
finefocus-3320	205	3	antibiotic	antibiotic	ADJ
finefocus-3320	205	4	resistome	resistome	NOUN
finefocus-3320	205	5	.	.	PUNCT
finefocus-3320	206	1	science	science	NOUN
finefocus-3320	206	2	311:374–7	311:374–7	NUM
finefocus-3320	206	3	.	.	PUNCT
finefocus-3320	207	1	11	11	NUM
finefocus-3320	207	2	.	.	X
finefocus-3320	207	3	de	de	PROPN
finefocus-3320	207	4	briyne	briyne	PROPN
finefocus-3320	207	5	,	,	PUNCT
finefocus-3320	207	6	n.	n.	NOUN
finefocus-3320	207	7	,	,	PUNCT
finefocus-3320	207	8	atkinson	atkinson	PROPN
finefocus-3320	207	9	,	,	PUNCT
finefocus-3320	207	10	j.	j.	PROPN
finefocus-3320	207	11	,	,	PUNCT
finefocus-3320	207	12	pokludová	pokludová	PROPN
finefocus-3320	207	13	,	,	PUNCT
finefocus-3320	207	14	l.	l.	PROPN
finefocus-3320	207	15	,	,	PUNCT
finefocus-3320	207	16	&	&	CCONJ
finefocus-3320	207	17	borriello	borriello	PROPN
finefocus-3320	207	18	,	,	PUNCT
finefocus-3320	207	19	s.	s.	PROPN
finefocus-3320	207	20	p.	p.	PROPN
finefocus-3320	207	21	2014	2014	NUM
finefocus-3320	207	22	.	.	PUNCT
finefocus-3320	208	1	antibiotics	antibiotic	NOUN
finefocus-3320	208	2	used	use	VERB
finefocus-3320	208	3	most	most	ADV
finefocus-3320	208	4	commonly	commonly	ADV
finefocus-3320	208	5	to	to	PART
finefocus-3320	208	6	treat	treat	VERB
finefocus-3320	208	7	animals	animal	NOUN
finefocus-3320	208	8	in	in	ADP
finefocus-3320	208	9	europe	europe	PROPN
finefocus-3320	208	10	.	.	PUNCT
finefocus-3320	209	1	vet	vet	NOUN
finefocus-3320	209	2	.	.	PUNCT
finefocus-3320	210	1	rec	rec	PROPN
finefocus-3320	210	2	.	.	PUNCT
finefocus-3320	211	1	175:325	175:325	PROPN
finefocus-3320	211	2	.	.	PROPN
finefocus-3320	212	1	12	12	NUM
finefocus-3320	212	2	.	.	PUNCT
finefocus-3320	213	1	demanèche	demanèche	PROPN
finefocus-3320	213	2	,	,	PUNCT
finefocus-3320	213	3	s.	s.	PROPN
finefocus-3320	213	4	,	,	PUNCT
finefocus-3320	213	5	sanguin	sanguin	PROPN
finefocus-3320	213	6	,	,	PUNCT
finefocus-3320	213	7	h.	h.	PROPN
finefocus-3320	213	8	,	,	PUNCT
finefocus-3320	213	9	poté	poté	PROPN
finefocus-3320	213	10	,	,	PUNCT
finefocus-3320	213	11	j.	j.	PROPN
finefocus-3320	213	12	,	,	PUNCT
finefocus-3320	213	13	navarro	navarro	PROPN
finefocus-3320	213	14	,	,	PUNCT
finefocus-3320	213	15	e.	e.	PROPN
finefocus-3320	213	16	,	,	PUNCT
finefocus-3320	213	17	bernillon	bernillon	PROPN
finefocus-3320	213	18	,	,	PUNCT
finefocus-3320	213	19	d.	d.	PROPN
finefocus-3320	213	20	,	,	PUNCT
finefocus-3320	213	21	mavingui	mavingui	NOUN
finefocus-3320	213	22	,	,	PUNCT
finefocus-3320	213	23	p.	p.	NOUN
finefocus-3320	213	24	,	,	PUNCT
finefocus-3320	213	25	wildi	wildi	PROPN
finefocus-3320	213	26	,	,	PUNCT
finefocus-3320	213	27	w.	w.	PROPN
finefocus-3320	213	28	,	,	PUNCT
finefocus-3320	213	29	vogel	vogel	NOUN
finefocus-3320	213	30	,	,	PUNCT
finefocus-3320	213	31	t.	t.	NOUN
finefocus-3320	213	32	m.	m.	NOUN
finefocus-3320	213	33	,	,	PUNCT
finefocus-3320	213	34	&	&	CCONJ
finefocus-3320	213	35	simonet	simonet	PROPN
finefocus-3320	213	36	,	,	PUNCT
finefocus-3320	213	37	p.	p.	NOUN
finefocus-3320	213	38	2008	2008	NUM
finefocus-3320	213	39	.	.	PUNCT
finefocus-3320	214	1	antibiotic	antibiotic	ADJ
finefocus-3320	214	2	-	-	PUNCT
finefocus-3320	214	3	resistant	resistant	ADJ
finefocus-3320	214	4	soil	soil	NOUN
finefocus-3320	214	5	bacteria	bacteria	NOUN
finefocus-3320	214	6	in	in	ADP
finefocus-3320	214	7	transgenic	transgenic	NOUN
finefocus-3320	214	8	plant	plant	NOUN
finefocus-3320	214	9	fields	field	NOUN
finefocus-3320	214	10	.	.	PUNCT
finefocus-3320	215	1	proc	proc	NOUN
finefocus-3320	215	2	.	.	PUNCT
finefocus-3320	216	1	natl	natl	PROPN
finefocus-3320	216	2	.	.	PUNCT
finefocus-3320	217	1	acad	acad	PROPN
finefocus-3320	217	2	.	.	PUNCT
finefocus-3320	218	1	sci	sci	PROPN
finefocus-3320	218	2	.	.	PUNCT
finefocus-3320	218	3	u.	u.	PROPN
finefocus-3320	218	4	s.	s.	PROPN
finefocus-3320	218	5	a.	a.	PROPN
finefocus-3320	218	6	105:3957–62	105:3957–62	NUM
finefocus-3320	218	7	.	.	PROPN
finefocus-3320	218	8	13	13	NUM
finefocus-3320	218	9	.	.	X
finefocus-3320	218	10	devarajan	devarajan	NOUN
finefocus-3320	218	11	,	,	PUNCT
finefocus-3320	218	12	n.	n.	NOUN
finefocus-3320	218	13	,	,	PUNCT
finefocus-3320	218	14	laffite	laffite	PROPN
finefocus-3320	218	15	,	,	PUNCT
finefocus-3320	218	16	a.	a.	NOUN
finefocus-3320	218	17	,	,	PUNCT
finefocus-3320	218	18	mulaji	mulaji	NOUN
finefocus-3320	218	19	,	,	PUNCT
finefocus-3320	218	20	c.	c.	PROPN
finefocus-3320	218	21	k.	k.	PROPN
finefocus-3320	218	22	,	,	PUNCT
finefocus-3320	218	23	otamonga	otamonga	PROPN
finefocus-3320	218	24	,	,	PUNCT
finefocus-3320	218	25	j	j	PROPN
finefocus-3320	218	26	-	-	PUNCT
finefocus-3320	218	27	p	p	X
finefocus-3320	218	28	,	,	PUNCT
finefocus-3320	218	29	mpiana	mpiana	NOUN
finefocus-3320	218	30	,	,	PUNCT
finefocus-3320	218	31	p.	p.	PROPN
finefocus-3320	218	32	t.	t.	PROPN
finefocus-3320	218	33	,	,	PUNCT
finefocus-3320	218	34	mubedi	mubedi	PROPN
finefocus-3320	218	35	,	,	PUNCT
finefocus-3320	218	36	j.	j.	PROPN
finefocus-3320	218	37	i.	i.	PROPN
finefocus-3320	218	38	,	,	PUNCT
finefocus-3320	218	39	prabakar	prabakar	NOUN
finefocus-3320	218	40	,	,	PUNCT
finefocus-3320	218	41	k.	k.	PROPN
finefocus-3320	218	42	,	,	PUNCT
finefocus-3320	218	43	ibelings	ibeling	NOUN
finefocus-3320	218	44	,	,	PUNCT
finefocus-3320	218	45	b.	b.	PROPN
finefocus-3320	218	46	w.	w.	PROPN
finefocus-3320	218	47	,	,	PUNCT
finefocus-3320	218	48	&	&	CCONJ
finefocus-3320	218	49	poté	poté	PROPN
finefocus-3320	218	50	,	,	PUNCT
finefocus-3320	218	51	j.	j.	PROPN
finefocus-3320	218	52	2016	2016	NUM
finefocus-3320	218	53	.	.	PUNCT
finefocus-3320	219	1	occurrence	occurrence	NOUN
finefocus-3320	219	2	of	of	ADP
finefocus-3320	219	3	antibiotic	antibiotic	ADJ
finefocus-3320	219	4	resistance	resistance	NOUN
finefocus-3320	219	5	genes	gene	NOUN
finefocus-3320	219	6	and	and	CCONJ
finefocus-3320	219	7	bacterial	bacterial	ADJ
finefocus-3320	219	8	markers	marker	NOUN
finefocus-3320	219	9	in	in	ADP
finefocus-3320	219	10	a	a	DET
finefocus-3320	219	11	tropical	tropical	ADJ
finefocus-3320	219	12	river	river	NOUN
finefocus-3320	219	13	receiving	receive	VERB
finefocus-3320	219	14	hospital	hospital	NOUN
finefocus-3320	219	15	and	and	CCONJ
finefocus-3320	219	16	urban	urban	ADJ
finefocus-3320	219	17	wastewaters	wastewater	NOUN
finefocus-3320	219	18	.	.	PUNCT
finefocus-3320	220	1	plos	plos	PROPN
finefocus-3320	220	2	one	one	NUM
finefocus-3320	220	3	doi	doi	NOUN
finefocus-3320	220	4	:	:	PUNCT
finefocus-3320	220	5	10.1371	10.1371	NUM
finefocus-3320	220	6	/	/	SYM
finefocus-3320	220	7	journal.pone.0149211	journal.pone.0149211	NOUN
finefocus-3320	220	8	.	.	PUNCT
finefocus-3320	221	1	14	14	NUM
finefocus-3320	221	2	.	.	PUNCT
finefocus-3320	222	1	edwards	edwards	PROPN
finefocus-3320	222	2	,	,	PUNCT
finefocus-3320	222	3	u.	u.	PROPN
finefocus-3320	222	4	,	,	PUNCT
finefocus-3320	222	5	rogall	rogall	NOUN
finefocus-3320	222	6	,	,	PUNCT
finefocus-3320	222	7	t.	t.	NOUN
finefocus-3320	222	8	,	,	PUNCT
finefocus-3320	222	9	blöcker	blöcker	PROPN
finefocus-3320	222	10	,	,	PUNCT
finefocus-3320	222	11	h.	h.	PROPN
finefocus-3320	222	12	,	,	PUNCT
finefocus-3320	222	13	emde	emde	NOUN
finefocus-3320	222	14	,	,	PUNCT
finefocus-3320	222	15	m.	m.	NOUN
finefocus-3320	222	16	,	,	PUNCT
finefocus-3320	222	17	&	&	CCONJ
finefocus-3320	222	18	böttger	böttger	NOUN
finefocus-3320	222	19	,	,	PUNCT
finefocus-3320	222	20	e.	e.	PROPN
finefocus-3320	222	21	c.	c.	PROPN
finefocus-3320	222	22	1989	1989	NUM
finefocus-3320	222	23	.	.	PUNCT
finefocus-3320	223	1	isolation	isolation	NOUN
finefocus-3320	223	2	and	and	CCONJ
finefocus-3320	223	3	direct	direct	ADJ
finefocus-3320	223	4	complete	complete	ADJ
finefocus-3320	223	5	nucleotide	nucleotide	ADJ
finefocus-3320	223	6	determination	determination	NOUN
finefocus-3320	223	7	of	of	ADP
finefocus-3320	223	8	entire	entire	ADJ
finefocus-3320	223	9	genes	gene	NOUN
finefocus-3320	223	10	.	.	PUNCT
finefocus-3320	224	1	characterization	characterization	NOUN
finefocus-3320	224	2	of	of	ADP
finefocus-3320	224	3	a	a	DET
finefocus-3320	224	4	gene	gene	NOUN
finefocus-3320	224	5	coding	code	VERB
finefocus-3320	224	6	for	for	ADP
finefocus-3320	224	7	16s	16	NOUN
finefocus-3320	224	8	ribosomal	ribosomal	NOUN
finefocus-3320	224	9	rna	rna	PROPN
finefocus-3320	224	10	.	.	PUNCT
finefocus-3320	225	1	nucleic	nucleic	ADJ
finefocus-3320	225	2	acids	acid	NOUN
finefocus-3320	225	3	res	re	NOUN
finefocus-3320	225	4	.	.	PUNCT
finefocus-3320	226	1	17:7843	17:7843	NUM
finefocus-3320	226	2	-	-	SYM
finefocus-3320	226	3	7853	7853	NUM
finefocus-3320	226	4	.	.	PUNCT
finefocus-3320	227	1	15	15	NUM
finefocus-3320	227	2	.	.	PUNCT
finefocus-3320	227	3	fierer	fierer	NOUN
finefocus-3320	227	4	,	,	PUNCT
finefocus-3320	227	5	n.	n.	NOUN
finefocus-3320	227	6	,	,	PUNCT
finefocus-3320	227	7	schimel	schimel	NOUN
finefocus-3320	227	8	,	,	PUNCT
finefocus-3320	227	9	j.	j.	PROPN
finefocus-3320	227	10	p.	p.	PROPN
finefocus-3320	227	11	,	,	PUNCT
finefocus-3320	227	12	&	&	CCONJ
finefocus-3320	227	13	holden	holden	PROPN
finefocus-3320	227	14	,	,	PUNCT
finefocus-3320	227	15	pa	pa	PROPN
finefocus-3320	227	16	.	.	PROPN
finefocus-3320	227	17	2003	2003	NUM
finefocus-3320	227	18	.	.	PUNCT
finefocus-3320	228	1	variations	variation	NOUN
finefocus-3320	228	2	in	in	ADP
finefocus-3320	228	3	microbial	microbial	ADJ
finefocus-3320	228	4	community	community	NOUN
finefocus-3320	228	5	composition	composition	NOUN
finefocus-3320	228	6	through	through	ADP
finefocus-3320	228	7	two	two	NUM
finefocus-3320	228	8	soil	soil	NOUN
finefocus-3320	228	9	depth	depth	NOUN
finefocus-3320	228	10	profiles	profile	NOUN
finefocus-3320	228	11	.	.	PUNCT
finefocus-3320	229	1	soil	soil	NOUN
finefocus-3320	229	2	biol	biol	PROPN
finefocus-3320	229	3	.	.	PUNCT
finefocus-3320	230	1	biochem	biochem	PROPN
finefocus-3320	230	2	.	.	PUNCT
finefocus-3320	231	1	35:167–176	35:167–176	PROPN
finefocus-3320	231	2	.	.	PUNCT
finefocus-3320	232	1	volume	volume	NOUN
finefocus-3320	232	2	six	six	NUM
finefocus-3320	233	1	|	|	ADV
finefocus-3320	233	2	73	73	NUM
finefocus-3320	233	3	16	16	NUM
finefocus-3320	233	4	.	.	PUNCT
finefocus-3320	234	1	fleming	fleming	PROPN
finefocus-3320	234	2	,	,	PUNCT
finefocus-3320	234	3	a.	a.	NOUN
finefocus-3320	234	4	1929	1929	NUM
finefocus-3320	234	5	.	.	PUNCT
finefocus-3320	235	1	on	on	ADP
finefocus-3320	235	2	the	the	DET
finefocus-3320	235	3	antibacterial	antibacterial	ADJ
finefocus-3320	235	4	action	action	NOUN
finefocus-3320	235	5	of	of	ADP
finefocus-3320	235	6	cultures	culture	NOUN
finefocus-3320	235	7	of	of	ADP
finefocus-3320	235	8	a	a	DET
finefocus-3320	235	9	penicillium	penicillium	NOUN
finefocus-3320	235	10	,	,	PUNCT
finefocus-3320	235	11	with	with	ADP
finefocus-3320	235	12	special	special	ADJ
finefocus-3320	235	13	reference	reference	NOUN
finefocus-3320	235	14	to	to	ADP
finefocus-3320	235	15	their	their	PRON
finefocus-3320	235	16	use	use	NOUN
finefocus-3320	235	17	in	in	ADP
finefocus-3320	235	18	the	the	DET
finefocus-3320	235	19	isolation	isolation	NOUN
finefocus-3320	235	20	of	of	ADP
finefocus-3320	235	21	b.	b.	PROPN
finefocus-3320	235	22	influenzae	influenzae	PROPN
finefocus-3320	235	23	.	.	PUNCT
finefocus-3320	236	1	br	br	PROPN
finefocus-3320	236	2	.	.	PUNCT
finefocus-3320	237	1	j.	j.	PROPN
finefocus-3320	237	2	exp	exp	PROPN
finefocus-3320	237	3	.	.	PUNCT
finefocus-3320	237	4	pathol	pathol	NOUN
finefocus-3320	237	5	.	.	PUNCT
finefocus-3320	238	1	79:780–90	79:780–90	NOUN
finefocus-3320	238	2	.	.	PUNCT
finefocus-3320	239	1	17	17	NUM
finefocus-3320	239	2	.	.	X
finefocus-3320	239	3	gaze	gaze	NOUN
finefocus-3320	239	4	,	,	PUNCT
finefocus-3320	239	5	w.	w.	PROPN
finefocus-3320	239	6	h.	h.	PROPN
finefocus-3320	239	7	,	,	PUNCT
finefocus-3320	239	8	zhang	zhang	PROPN
finefocus-3320	239	9	,	,	PUNCT
finefocus-3320	239	10	l.	l.	PROPN
finefocus-3320	239	11	,	,	PUNCT
finefocus-3320	239	12	abdouslam	abdouslam	PROPN
finefocus-3320	239	13	,	,	PUNCT
finefocus-3320	239	14	n.	n.	PROPN
finefocus-3320	239	15	a.	a.	PROPN
finefocus-3320	239	16	,	,	PUNCT
finefocus-3320	239	17	hawkey	hawkey	NOUN
finefocus-3320	239	18	,	,	PUNCT
finefocus-3320	239	19	p.	p.	NOUN
finefocus-3320	239	20	m.	m.	NOUN
finefocus-3320	239	21	,	,	PUNCT
finefocus-3320	239	22	calvo	calvo	NOUN
finefocus-3320	239	23	-	-	PUNCT
finefocus-3320	239	24	bado	bado	ADJ
finefocus-3320	239	25	,	,	PUNCT
finefocus-3320	239	26	l.	l.	PROPN
finefocus-3320	239	27	,	,	PUNCT
finefocus-3320	239	28	royle	royle	PROPN
finefocus-3320	239	29	,	,	PUNCT
finefocus-3320	239	30	j.	j.	PROPN
finefocus-3320	239	31	brown	brown	PROPN
finefocus-3320	239	32	,	,	PUNCT
finefocus-3320	239	33	h.	h.	PROPN
finefocus-3320	239	34	,	,	PUNCT
finefocus-3320	239	35	davis	davis	PROPN
finefocus-3320	239	36	,	,	PUNCT
finefocus-3320	239	37	s.	s.	PROPN
finefocus-3320	239	38	,	,	PUNCT
finefocus-3320	239	39	kay	kay	PROPN
finefocus-3320	239	40	,	,	PUNCT
finefocus-3320	239	41	p.	p.	PROPN
finefocus-3320	239	42	,	,	PUNCT
finefocus-3320	239	43	boxall	boxall	PROPN
finefocus-3320	239	44	,	,	PUNCT
finefocus-3320	239	45	a.	a.	PROPN
finefocus-3320	239	46	b.	b.	PROPN
finefocus-3320	239	47	,	,	PUNCT
finefocus-3320	239	48	&	&	CCONJ
finefocus-3320	239	49	wellington	wellington	PROPN
finefocus-3320	239	50	,	,	PUNCT
finefocus-3320	239	51	e.	e.	PROPN
finefocus-3320	239	52	m.	m.	PROPN
finefocus-3320	239	53	2011	2011	NUM
finefocus-3320	239	54	.	.	PUNCT
finefocus-3320	240	1	impacts	impact	NOUN
finefocus-3320	240	2	of	of	ADP
finefocus-3320	240	3	anthropogenic	anthropogenic	ADJ
finefocus-3320	240	4	activity	activity	NOUN
finefocus-3320	240	5	on	on	ADP
finefocus-3320	240	6	the	the	DET
finefocus-3320	240	7	ecology	ecology	NOUN
finefocus-3320	240	8	of	of	ADP
finefocus-3320	240	9	class	class	NOUN
finefocus-3320	240	10	1	1	NUM
finefocus-3320	240	11	integrons	integron	NOUN
finefocus-3320	240	12	and	and	CCONJ
finefocus-3320	240	13	integron	integron	NOUN
finefocus-3320	240	14	-	-	PUNCT
finefocus-3320	240	15	associated	associate	VERB
finefocus-3320	240	16	genes	gene	NOUN
finefocus-3320	240	17	in	in	ADP
finefocus-3320	240	18	the	the	DET
finefocus-3320	240	19	environment	environment	NOUN
finefocus-3320	240	20	.	.	PUNCT
finefocus-3320	241	1	isme	isme	PROPN
finefocus-3320	241	2	j.	j.	PROPN
finefocus-3320	241	3	5:1253–61	5:1253–61	PROPN
finefocus-3320	241	4	.	.	PUNCT
finefocus-3320	242	1	18	18	NUM
finefocus-3320	242	2	.	.	PUNCT
finefocus-3320	243	1	genné	genné	NOUN
finefocus-3320	243	2	-	-	PUNCT
finefocus-3320	243	3	bacon	bacon	NOUN
finefocus-3320	243	4	,	,	PUNCT
finefocus-3320	243	5	e.	e.	PROPN
finefocus-3320	243	6	a.	a.	PROPN
finefocus-3320	243	7	&	&	CCONJ
finefocus-3320	243	8	bascom	bascom	PROPN
finefocus-3320	243	9	-	-	PROPN
finefocus-3320	243	10	slack	slack	PROPN
finefocus-3320	243	11	,	,	PUNCT
finefocus-3320	243	12	c.	c.	PROPN
finefocus-3320	243	13	a.	a.	NOUN
finefocus-3320	243	14	2018	2018	NUM
finefocus-3320	243	15	.	.	PUNCT
finefocus-3320	244	1	the	the	DET
finefocus-3320	244	2	pare	pare	PROPN
finefocus-3320	244	3	project	project	NOUN
finefocus-3320	244	4	:	:	PUNCT
finefocus-3320	244	5	a	a	DET
finefocus-3320	244	6	short	short	ADJ
finefocus-3320	244	7	course	course	NOUN
finefocus-3320	244	8	-	-	PUNCT
finefocus-3320	244	9	based	base	VERB
finefocus-3320	244	10	research	research	NOUN
finefocus-3320	244	11	project	project	NOUN
finefocus-3320	244	12	for	for	ADP
finefocus-3320	244	13	national	national	ADJ
finefocus-3320	244	14	surveillance	surveillance	NOUN
finefocus-3320	244	15	of	of	ADP
finefocus-3320	244	16	antibiotic	antibiotic	ADJ
finefocus-3320	244	17	-	-	PUNCT
finefocus-3320	244	18	resistant	resistant	ADJ
finefocus-3320	244	19	microbes	microbe	NOUN
finefocus-3320	244	20	in	in	ADP
finefocus-3320	244	21	environmental	environmental	ADJ
finefocus-3320	244	22	samples	sample	NOUN
finefocus-3320	244	23	.	.	PUNCT
finefocus-3320	245	1	j.	j.	PROPN
finefocus-3320	245	2	microbiol	microbiol	PROPN
finefocus-3320	245	3	.	.	PUNCT
finefocus-3320	246	1	biol	biol	PROPN
finefocus-3320	246	2	.	.	PUNCT
finefocus-3320	247	1	educ	educ	PROPN
finefocus-3320	247	2	.	.	PUNCT
finefocus-3320	248	1	19:19.3.97	19:19.3.97	NUM
finefocus-3320	248	2	.	.	X
finefocus-3320	249	1	19	19	NUM
finefocus-3320	249	2	.	.	PUNCT
finefocus-3320	249	3	gillings	gilling	NOUN
finefocus-3320	249	4	,	,	PUNCT
finefocus-3320	249	5	m.	m.	PROPN
finefocus-3320	249	6	r.	r.	PROPN
finefocus-3320	249	7	2013	2013	NUM
finefocus-3320	249	8	.	.	PUNCT
finefocus-3320	250	1	evolutionary	evolutionary	ADJ
finefocus-3320	250	2	consequences	consequence	NOUN
finefocus-3320	250	3	of	of	ADP
finefocus-3320	250	4	antibiotic	antibiotic	ADJ
finefocus-3320	250	5	use	use	NOUN
finefocus-3320	250	6	for	for	ADP
finefocus-3320	250	7	the	the	DET
finefocus-3320	250	8	resistome	resistome	NOUN
finefocus-3320	250	9	,	,	PUNCT
finefocus-3320	250	10	mobilome	mobilome	NOUN
finefocus-3320	250	11	and	and	CCONJ
finefocus-3320	250	12	microbial	microbial	ADJ
finefocus-3320	250	13	pangenome	pangenome	NOUN
finefocus-3320	250	14	.	.	PUNCT
finefocus-3320	251	1	front	front	NOUN
finefocus-3320	251	2	.	.	PUNCT
finefocus-3320	252	1	microbiol	microbiol	PROPN
finefocus-3320	252	2	.	.	PUNCT
finefocus-3320	253	1	4:4	4:4	NUM
finefocus-3320	253	2	.	.	PUNCT
finefocus-3320	254	1	20	20	NUM
finefocus-3320	254	2	.	.	PUNCT
finefocus-3320	254	3	girvan	girvan	PROPN
finefocus-3320	254	4	,	,	PUNCT
finefocus-3320	254	5	m.	m.	NOUN
finefocus-3320	254	6	s.	s.	PROPN
finefocus-3320	254	7	,	,	PUNCT
finefocus-3320	254	8	bullimore	bullimore	PROPN
finefocus-3320	254	9	,	,	PUNCT
finefocus-3320	254	10	j.	j.	PROPN
finefocus-3320	254	11	,	,	PUNCT
finefocus-3320	254	12	pretty	pretty	PROPN
finefocus-3320	254	13	,	,	PUNCT
finefocus-3320	254	14	j.	j.	PROPN
finefocus-3320	254	15	n.	n.	PROPN
finefocus-3320	254	16	,	,	PUNCT
finefocus-3320	254	17	osborn	osborn	PROPN
finefocus-3320	254	18	,	,	PUNCT
finefocus-3320	254	19	a.	a.	NOUN
finefocus-3320	254	20	m.	m.	NOUN
finefocus-3320	254	21	,	,	PUNCT
finefocus-3320	254	22	&	&	CCONJ
finefocus-3320	254	23	ball	ball	PROPN
finefocus-3320	254	24	,	,	PUNCT
finefocus-3320	254	25	a.	a.	PROPN
finefocus-3320	254	26	s.	s.	PROPN
finefocus-3320	254	27	2003	2003	NUM
finefocus-3320	254	28	.	.	PUNCT
finefocus-3320	255	1	soil	soil	NOUN
finefocus-3320	255	2	type	type	NOUN
finefocus-3320	255	3	is	be	AUX
finefocus-3320	255	4	the	the	DET
finefocus-3320	255	5	primary	primary	ADJ
finefocus-3320	255	6	determinant	determinant	NOUN
finefocus-3320	255	7	of	of	ADP
finefocus-3320	255	8	the	the	DET
finefocus-3320	255	9	composition	composition	NOUN
finefocus-3320	255	10	of	of	ADP
finefocus-3320	255	11	the	the	DET
finefocus-3320	255	12	total	total	ADJ
finefocus-3320	255	13	and	and	CCONJ
finefocus-3320	255	14	active	active	ADJ
finefocus-3320	255	15	bacterial	bacterial	ADJ
finefocus-3320	255	16	communities	community	NOUN
finefocus-3320	255	17	in	in	ADP
finefocus-3320	255	18	arable	arable	ADJ
finefocus-3320	255	19	soils	soil	NOUN
finefocus-3320	255	20	.	.	PUNCT
finefocus-3320	256	1	appl	appl	PROPN
finefocus-3320	256	2	.	.	PUNCT
finefocus-3320	257	1	environ	environ	PROPN
finefocus-3320	257	2	.	.	PUNCT
finefocus-3320	257	3	microbiol	microbiol	PROPN
finefocus-3320	257	4	.	.	PUNCT
finefocus-3320	258	1	69:1800–9	69:1800–9	NUM
finefocus-3320	258	2	.	.	PUNCT
finefocus-3320	259	1	21	21	NUM
finefocus-3320	259	2	.	.	PUNCT
finefocus-3320	259	3	herlemann	herlemann	PROPN
finefocus-3320	259	4	,	,	PUNCT
finefocus-3320	259	5	d.	d.	PROPN
finefocus-3320	259	6	p.	p.	PROPN
finefocus-3320	259	7	,	,	PUNCT
finefocus-3320	259	8	labrenz	labrenz	PROPN
finefocus-3320	259	9	,	,	PUNCT
finefocus-3320	259	10	m.	m.	NOUN
finefocus-3320	259	11	,	,	PUNCT
finefocus-3320	259	12	ju	ju	PROPN
finefocus-3320	259	13	̈rgens	̈rgens	PROPN
finefocus-3320	259	14	,	,	PUNCT
finefocus-3320	259	15	k.	k.	PROPN
finefocus-3320	259	16	,	,	PUNCT
finefocus-3320	259	17	bertilsson	bertilsson	PROPN
finefocus-3320	259	18	,	,	PUNCT
finefocus-3320	259	19	s.	s.	PROPN
finefocus-3320	259	20	,	,	PUNCT
finefocus-3320	259	21	wanick	wanick	PROPN
finefocus-3320	259	22	,	,	PUNCT
finefocus-3320	259	23	j.	j.	PROPN
finefocus-3320	259	24	j	j	PROPN
finefocus-3320	259	25	,	,	PUNCT
finefocus-3320	259	26	&	&	CCONJ
finefocus-3320	259	27	andersson	andersson	PROPN
finefocus-3320	259	28	,	,	PUNCT
finefocus-3320	259	29	a.	a.	PROPN
finefocus-3320	259	30	f.	f.	PROPN
finefocus-3320	259	31	2011	2011	NUM
finefocus-3320	259	32	.	.	PUNCT
finefocus-3320	260	1	transitions	transition	NOUN
finefocus-3320	260	2	in	in	ADP
finefocus-3320	260	3	bacterial	bacterial	ADJ
finefocus-3320	260	4	communities	community	NOUN
finefocus-3320	260	5	along	along	ADP
finefocus-3320	260	6	the	the	DET
finefocus-3320	260	7	2000	2000	NUM
finefocus-3320	260	8	km	km	NOUN
finefocus-3320	260	9	salinity	salinity	NOUN
finefocus-3320	260	10	gradient	gradient	NOUN
finefocus-3320	260	11	of	of	ADP
finefocus-3320	260	12	the	the	DET
finefocus-3320	260	13	baltic	baltic	PROPN
finefocus-3320	260	14	sea	sea	PROPN
finefocus-3320	260	15	.	.	PUNCT
finefocus-3320	261	1	isme	isme	PROPN
finefocus-3320	261	2	j.	j.	PROPN
finefocus-3320	261	3	5:1571–9	5:1571–9	PROPN
finefocus-3320	261	4	.	.	PUNCT
finefocus-3320	262	1	22	22	NUM
finefocus-3320	262	2	.	.	PUNCT
finefocus-3320	263	1	heuer	heuer	PROPN
finefocus-3320	263	2	,	,	PUNCT
finefocus-3320	263	3	h.	h.	PROPN
finefocus-3320	263	4	&	&	CCONJ
finefocus-3320	263	5	smalla	smalla	PROPN
finefocus-3320	263	6	,	,	PUNCT
finefocus-3320	263	7	k.	k.	PROPN
finefocus-3320	263	8	2007	2007	NUM
finefocus-3320	263	9	.	.	PUNCT
finefocus-3320	264	1	manure	manure	NOUN
finefocus-3320	264	2	and	and	CCONJ
finefocus-3320	264	3	sulfadiazine	sulfadiazine	PROPN
finefocus-3320	264	4	synergistically	synergistically	ADV
finefocus-3320	264	5	increased	increase	VERB
finefocus-3320	264	6	bacterial	bacterial	ADJ
finefocus-3320	264	7	antibiotic	antibiotic	ADJ
finefocus-3320	264	8	resistance	resistance	NOUN
finefocus-3320	264	9	in	in	ADP
finefocus-3320	264	10	soil	soil	NOUN
finefocus-3320	264	11	over	over	ADP
finefocus-3320	264	12	at	at	ADV
finefocus-3320	264	13	least	least	ADV
finefocus-3320	264	14	two	two	NUM
finefocus-3320	264	15	months	month	NOUN
finefocus-3320	264	16	.	.	PUNCT
finefocus-3320	265	1	environ	environ	PROPN
finefocus-3320	265	2	.	.	PUNCT
finefocus-3320	265	3	microbiol	microbiol	PROPN
finefocus-3320	265	4	.	.	PUNCT
finefocus-3320	266	1	9:657–666	9:657–666	ADJ
finefocus-3320	266	2	.	.	PUNCT
finefocus-3320	267	1	23	23	NUM
finefocus-3320	267	2	.	.	PUNCT
finefocus-3320	268	1	hopwood	hopwood	PROPN
finefocus-3320	268	2	,	,	PUNCT
finefocus-3320	268	3	d.	d.	PROPN
finefocus-3320	268	4	a.	a.	PROPN
finefocus-3320	268	5	2006	2006	NUM
finefocus-3320	268	6	.	.	PUNCT
finefocus-3320	269	1	soil	soil	NOUN
finefocus-3320	269	2	to	to	ADP
finefocus-3320	269	3	genomics	genomic	NOUN
finefocus-3320	269	4	:	:	PUNCT
finefocus-3320	269	5	the	the	DET
finefocus-3320	269	6	streptomyces	streptomyce	NOUN
finefocus-3320	269	7	chromosome	chromosome	VERB
finefocus-3320	269	8	.	.	PUNCT
finefocus-3320	270	1	annu	annu	NOUN
finefocus-3320	270	2	.	.	PUNCT
finefocus-3320	271	1	rev	rev	PROPN
finefocus-3320	271	2	.	.	PROPN
finefocus-3320	271	3	genet	genet	PROPN
finefocus-3320	271	4	.	.	PUNCT
finefocus-3320	272	1	40:1	40:1	NUM
finefocus-3320	272	2	-	-	SYM
finefocus-3320	272	3	23	23	NUM
finefocus-3320	272	4	.	.	PUNCT
finefocus-3320	273	1	24	24	NUM
finefocus-3320	273	2	.	.	PUNCT
finefocus-3320	274	1	hudzicki	hudzicki	PROPN
finefocus-3320	274	2	j.	j.	PROPN
finefocus-3320	274	3	2009	2009	NUM
finefocus-3320	274	4	.	.	PUNCT
finefocus-3320	275	1	kirby	kirby	PROPN
finefocus-3320	275	2	-	-	PUNCT
finefocus-3320	275	3	bauer	bauer	PROPN
finefocus-3320	275	4	disk	disk	NOUN
finefocus-3320	275	5	diffusion	diffusion	NOUN
finefocus-3320	275	6	susceptibility	susceptibility	NOUN
finefocus-3320	275	7	test	test	NOUN
finefocus-3320	275	8	protocol	protocol	NOUN
finefocus-3320	275	9	.	.	PUNCT
finefocus-3320	276	1	american	american	ADJ
finefocus-3320	276	2	society	society	PROPN
finefocus-3320	276	3	for	for	ADP
finefocus-3320	276	4	microbiology	microbiology	NOUN
finefocus-3320	276	5	.	.	PUNCT
finefocus-3320	277	1	25	25	NUM
finefocus-3320	277	2	.	.	PUNCT
finefocus-3320	277	3	klindworth	klindworth	PROPN
finefocus-3320	277	4	,	,	PUNCT
finefocus-3320	277	5	a.	a.	NOUN
finefocus-3320	277	6	,	,	PUNCT
finefocus-3320	277	7	pruesse	pruesse	NOUN
finefocus-3320	277	8	,	,	PUNCT
finefocus-3320	277	9	e.	e.	PROPN
finefocus-3320	277	10	,	,	PUNCT
finefocus-3320	277	11	schweer	schweer	NOUN
finefocus-3320	277	12	,	,	PUNCT
finefocus-3320	277	13	t.	t.	NOUN
finefocus-3320	277	14	,	,	PUNCT
finefocus-3320	277	15	peplies	peplie	NOUN
finefocus-3320	277	16	,	,	PUNCT
finefocus-3320	277	17	j.	j.	PROPN
finefocus-3320	277	18	,	,	PUNCT
finefocus-3320	277	19	quast	quast	NOUN
finefocus-3320	277	20	,	,	PUNCT
finefocus-3320	277	21	c.	c.	NOUN
finefocus-3320	277	22	,	,	PUNCT
finefocus-3320	277	23	horn	horn	NOUN
finefocus-3320	277	24	,	,	PUNCT
finefocus-3320	277	25	m.	m.	NOUN
finefocus-3320	277	26	&	&	CCONJ
finefocus-3320	277	27	glöckner	glöckner	PROPN
finefocus-3320	277	28	,	,	PUNCT
finefocus-3320	277	29	f.	f.	PROPN
finefocus-3320	277	30	o.	o.	PROPN
finefocus-3320	277	31	2013	2013	NUM
finefocus-3320	277	32	.	.	PUNCT
finefocus-3320	278	1	evaluation	evaluation	NOUN
finefocus-3320	278	2	of	of	ADP
finefocus-3320	278	3	general	general	ADJ
finefocus-3320	278	4	16s	16s	PROPN
finefocus-3320	278	5	ribosomal	ribosomal	NOUN
finefocus-3320	278	6	rna	rna	NOUN
finefocus-3320	278	7	gene	gene	NOUN
finefocus-3320	278	8	pcr	pcr	NOUN
finefocus-3320	278	9	primers	primer	NOUN
finefocus-3320	278	10	for	for	ADP
finefocus-3320	278	11	classical	classical	ADJ
finefocus-3320	278	12	and	and	CCONJ
finefocus-3320	278	13	next	next	ADJ
finefocus-3320	278	14	-	-	PUNCT
finefocus-3320	278	15	generation	generation	NOUN
finefocus-3320	278	16	sequencing	sequencing	NOUN
finefocus-3320	278	17	-	-	PUNCT
finefocus-3320	278	18	based	base	VERB
finefocus-3320	278	19	diversity	diversity	NOUN
finefocus-3320	278	20	studies	study	NOUN
finefocus-3320	278	21	.	.	PUNCT
finefocus-3320	279	1	nucleic	nucleic	ADJ
finefocus-3320	279	2	acids	acid	NOUN
finefocus-3320	279	3	res	re	NOUN
finefocus-3320	279	4	.	.	PUNCT
finefocus-3320	280	1	41	41	NUM
finefocus-3320	280	2	:	:	PUNCT
finefocus-3320	280	3	e1	e1	VERB
finefocus-3320	280	4	26	26	NUM
finefocus-3320	280	5	.	.	PUNCT
finefocus-3320	281	1	kummerer	kummerer	PROPN
finefocus-3320	281	2	,	,	PUNCT
finefocus-3320	281	3	k.	k.	PROPN
finefocus-3320	281	4	2004	2004	NUM
finefocus-3320	281	5	.	.	PUNCT
finefocus-3320	282	1	resistance	resistance	NOUN
finefocus-3320	282	2	in	in	ADP
finefocus-3320	282	3	the	the	DET
finefocus-3320	282	4	environment	environment	NOUN
finefocus-3320	282	5	.	.	PUNCT
finefocus-3320	283	1	j.	j.	PROPN
finefocus-3320	283	2	antimicrob	antimicrob	PROPN
finefocus-3320	283	3	.	.	PUNCT
finefocus-3320	284	1	chemother	chemother	PROPN
finefocus-3320	284	2	.	.	PUNCT
finefocus-3320	285	1	54:311–320	54:311–320	NOUN
finefocus-3320	285	2	.	.	PUNCT
finefocus-3320	286	1	27	27	NUM
finefocus-3320	286	2	.	.	X
finefocus-3320	286	3	lane	lane	PROPN
finefocus-3320	286	4	,	,	PUNCT
finefocus-3320	286	5	d.	d.	PROPN
finefocus-3320	286	6	j.	j.	PROPN
finefocus-3320	286	7	1991	1991	NUM
finefocus-3320	286	8	.	.	PUNCT
finefocus-3320	287	1	16s/23s	16s/23s	NUM
finefocus-3320	287	2	rrna	rrna	NOUN
finefocus-3320	287	3	sequencing	sequence	VERB
finefocus-3320	287	4	.	.	PUNCT
finefocus-3320	288	1	in	in	ADP
finefocus-3320	288	2	:	:	PUNCT
finefocus-3320	288	3	nucleic	nucleic	ADJ
finefocus-3320	288	4	acid	acid	NOUN
finefocus-3320	288	5	techniques	technique	NOUN
finefocus-3320	288	6	in	in	ADP
finefocus-3320	288	7	bacterial	bacterial	ADJ
finefocus-3320	288	8	systematics	systematic	NOUN
finefocus-3320	288	9	.	.	PUNCT
finefocus-3320	289	1	chichester	chichester	PROPN
finefocus-3320	289	2	;	;	PUNCT
finefocus-3320	289	3	new	new	PROPN
finefocus-3320	289	4	york	york	PROPN
finefocus-3320	289	5	:	:	PUNCT
finefocus-3320	289	6	wiley	wiley	PROPN
finefocus-3320	289	7	.	.	PUNCT
finefocus-3320	290	1	28	28	NUM
finefocus-3320	290	2	.	.	PUNCT
finefocus-3320	291	1	liu	liu	PROPN
finefocus-3320	291	2	,	,	PUNCT
finefocus-3320	291	3	y.	y.	PROPN
finefocus-3320	291	4	y.	y.	PROPN
finefocus-3320	291	5	,	,	PUNCT
finefocus-3320	291	6	wang	wang	PROPN
finefocus-3320	291	7	,	,	PUNCT
finefocus-3320	291	8	y.	y.	PROPN
finefocus-3320	291	9	,	,	PUNCT
finefocus-3320	291	10	walsh	walsh	NOUN
finefocus-3320	291	11	,	,	PUNCT
finefocus-3320	291	12	t.	t.	PROPN
finefocus-3320	291	13	r.	r.	PROPN
finefocus-3320	291	14	,	,	PUNCT
finefocus-3320	291	15	yi	yi	PROPN
finefocus-3320	291	16	,	,	PUNCT
finefocus-3320	291	17	l.	l.	PROPN
finefocus-3320	291	18	x.	x.	PROPN
finefocus-3320	291	19	,	,	PUNCT
finefocus-3320	291	20	zhang	zhang	PROPN
finefocus-3320	291	21	,	,	PUNCT
finefocus-3320	291	22	r.	r.	PROPN
finefocus-3320	291	23	,	,	PUNCT
finefocus-3320	291	24	spencer	spencer	PROPN
finefocus-3320	291	25	,	,	PUNCT
finefocus-3320	291	26	j.	j.	PROPN
finefocus-3320	291	27	,	,	PUNCT
finefocus-3320	291	28	doi	doi	PROPN
finefocus-3320	291	29	,	,	PUNCT
finefocus-3320	291	30	y.	y.	PROPN
finefocus-3320	291	31	,	,	PUNCT
finefocus-3320	291	32	tian	tian	PROPN
finefocus-3320	291	33	,	,	PUNCT
finefocus-3320	291	34	g.	g.	PROPN
finefocus-3320	291	35	,	,	PUNCT
finefocus-3320	291	36	dong	dong	PROPN
finefocus-3320	291	37	,	,	PUNCT
finefocus-3320	291	38	b.	b.	PROPN
finefocus-3320	291	39	,	,	PUNCT
finefocus-3320	291	40	huang	huang	PROPN
finefocus-3320	291	41	,	,	PUNCT
finefocus-3320	291	42	x.	x.	PROPN
finefocus-3320	291	43	,	,	PUNCT
finefocus-3320	291	44	yu	yu	PROPN
finefocus-3320	291	45	,	,	PUNCT
finefocus-3320	291	46	l.	l.	PROPN
finefocus-3320	291	47	f.	f.	PROPN
finefocus-3320	291	48	,	,	PUNCT
finefocus-3320	291	49	gu	gu	PROPN
finefocus-3320	291	50	,	,	PUNCT
finefocus-3320	291	51	d.	d.	PROPN
finefocus-3320	291	52	,	,	PUNCT
finefocus-3320	291	53	ren	ren	PROPN
finefocus-3320	291	54	,	,	PUNCT
finefocus-3320	291	55	h.	h.	PROPN
finefocus-3320	291	56	,	,	PUNCT
finefocus-3320	291	57	chen	chen	PROPN
finefocus-3320	291	58	,	,	PUNCT
finefocus-3320	291	59	x.	x.	PROPN
finefocus-3320	291	60	,	,	PUNCT
finefocus-3320	291	61	lv	lv	PROPN
finefocus-3320	291	62	,	,	PUNCT
finefocus-3320	291	63	l.	l.	PROPN
finefocus-3320	291	64	,	,	PUNCT
finefocus-3320	291	65	he	he	PRON
finefocus-3320	291	66	,	,	PUNCT
finefocus-3320	291	67	d.	d.	PROPN
finefocus-3320	291	68	,	,	PUNCT
finefocus-3320	291	69	zhou	zhou	PROPN
finefocus-3320	291	70	,	,	PUNCT
finefocus-3320	291	71	h.	h.	PROPN
finefocus-3320	291	72	,	,	PUNCT
finefocus-3320	291	73	liang	liang	PROPN
finefocus-3320	291	74	,	,	PUNCT
finefocus-3320	291	75	z.	z.	PROPN
finefocus-3320	291	76	,	,	PUNCT
finefocus-3320	291	77	liu	liu	PROPN
finefocus-3320	291	78	,	,	PUNCT
finefocus-3320	291	79	j.	j.	PROPN
finefocus-3320	291	80	h.	h.	PROPN
finefocus-3320	291	81	,	,	PUNCT
finefocus-3320	291	82	&	&	CCONJ
finefocus-3320	291	83	shen	shen	PROPN
finefocus-3320	291	84	,	,	PUNCT
finefocus-3320	291	85	j.	j.	PROPN
finefocus-3320	291	86	2016	2016	NUM
finefocus-3320	291	87	.	.	PUNCT
finefocus-3320	292	1	emergence	emergence	NOUN
finefocus-3320	292	2	of	of	ADP
finefocus-3320	292	3	plasmid	plasmid	NOUN
finefocus-3320	292	4	-	-	PUNCT
finefocus-3320	292	5	mediated	mediate	VERB
finefocus-3320	292	6	colistin	colistin	NOUN
finefocus-3320	292	7	resistance	resistance	NOUN
finefocus-3320	292	8	mechanism	mechanism	NOUN
finefocus-3320	292	9	mcr-1	mcr-1	PUNCT
finefocus-3320	292	10	in	in	ADP
finefocus-3320	292	11	animals	animal	NOUN
finefocus-3320	292	12	and	and	CCONJ
finefocus-3320	292	13	human	human	ADJ
finefocus-3320	292	14	beings	being	NOUN
finefocus-3320	292	15	in	in	ADP
finefocus-3320	292	16	china	china	PROPN
finefocus-3320	292	17	:	:	PUNCT
finefocus-3320	292	18	a	a	DET
finefocus-3320	292	19	microbiological	microbiological	ADJ
finefocus-3320	292	20	and	and	CCONJ
finefocus-3320	292	21	molecular	molecular	ADJ
finefocus-3320	292	22	biological	biological	ADJ
finefocus-3320	292	23	study	study	NOUN
finefocus-3320	292	24	.	.	PUNCT
finefocus-3320	293	1	lancet	lancet	PROPN
finefocus-3320	293	2	infect	infect	PROPN
finefocus-3320	293	3	.	.	PUNCT
finefocus-3320	294	1	dis	dis	PROPN
finefocus-3320	294	2	.	.	PUNCT
finefocus-3320	295	1	16:161	16:161	NUM
finefocus-3320	295	2	-	-	SYM
finefocus-3320	295	3	168	168	NUM
finefocus-3320	295	4	.	.	PUNCT
finefocus-3320	296	1	29	29	NUM
finefocus-3320	296	2	.	.	X
finefocus-3320	296	3	mckeegan	mckeegan	PROPN
finefocus-3320	296	4	,	,	PUNCT
finefocus-3320	296	5	k.	k.	PROPN
finefocus-3320	296	6	s.	s.	PROPN
finefocus-3320	296	7	,	,	PUNCT
finefocus-3320	297	1	borges	borges	PROPN
finefocus-3320	297	2	-	-	PUNCT
finefocus-3320	297	3	walmsley	walmsley	PROPN
finefocus-3320	297	4	,	,	PUNCT
finefocus-3320	297	5	m.	m.	NOUN
finefocus-3320	297	6	i.	i.	PROPN
finefocus-3320	297	7	,	,	PUNCT
finefocus-3320	297	8	&	&	CCONJ
finefocus-3320	297	9	walmsley	walmsley	PROPN
finefocus-3320	297	10	,	,	PUNCT
finefocus-3320	297	11	a.	a.	PROPN
finefocus-3320	297	12	r.	r.	PROPN
finefocus-3320	297	13	2013	2013	NUM
finefocus-3320	297	14	.	.	PUNCT
finefocus-3320	298	1	the	the	DET
finefocus-3320	298	2	structure	structure	NOUN
finefocus-3320	298	3	and	and	CCONJ
finefocus-3320	298	4	function	function	NOUN
finefocus-3320	298	5	of	of	ADP
finefocus-3320	298	6	drug	drug	NOUN
finefocus-3320	298	7	pumps	pump	NOUN
finefocus-3320	298	8	:	:	PUNCT
finefocus-3320	298	9	an	an	DET
finefocus-3320	298	10	update	update	NOUN
finefocus-3320	298	11	.	.	PUNCT
finefocus-3320	299	1	trends	trend	NOUN
finefocus-3320	299	2	in	in	ADP
finefocus-3320	299	3	microbiology	microbiology	NOUN
finefocus-3320	299	4	11:21	11:21	NUM
finefocus-3320	299	5	-	-	SYM
finefocus-3320	299	6	9	9	NUM
finefocus-3320	299	7	.	.	NOUN
finefocus-3320	299	8	74	74	NUM
finefocus-3320	299	9	|	|	ADV
finefocus-3320	299	10	fine	fine	ADJ
finefocus-3320	299	11	focus	focus	NOUN
finefocus-3320	299	12	30	30	NUM
finefocus-3320	299	13	.	.	PUNCT
finefocus-3320	300	1	muletz	muletz	VERB
finefocus-3320	300	2	-	-	PUNCT
finefocus-3320	300	3	wolz	wolz	NOUN
finefocus-3320	300	4	,	,	PUNCT
finefocus-3320	300	5	c.	c.	PROPN
finefocus-3320	300	6	r.	r.	PROPN
finefocus-3320	300	7	,	,	PUNCT
finefocus-3320	300	8	direnzo	direnzo	PROPN
finefocus-3320	300	9	,	,	PUNCT
finefocus-3320	300	10	g.	g.	PROPN
finefocus-3320	300	11	v.	v.	PROPN
finefocus-3320	300	12	,	,	PUNCT
finefocus-3320	300	13	yarwood	yarwood	NOUN
finefocus-3320	300	14	,	,	PUNCT
finefocus-3320	300	15	s.	s.	PROPN
finefocus-3320	300	16	a.	a.	PROPN
finefocus-3320	300	17	,	,	PUNCT
finefocus-3320	300	18	campbell	campbell	PROPN
finefocus-3320	300	19	grant	grant	PROPN
finefocus-3320	300	20	,	,	PUNCT
finefocus-3320	300	21	e.	e.	PROPN
finefocus-3320	300	22	h.	h.	PROPN
finefocus-3320	300	23	,	,	PUNCT
finefocus-3320	300	24	fleischer	fleischer	PROPN
finefocus-3320	300	25	,	,	PUNCT
finefocus-3320	300	26	r.	r.	PROPN
finefocus-3320	300	27	c.	c.	PROPN
finefocus-3320	300	28	,	,	PUNCT
finefocus-3320	300	29	&	&	CCONJ
finefocus-3320	300	30	lips	lip	NOUN
finefocus-3320	300	31	,	,	PUNCT
finefocus-3320	300	32	k.	k.	PROPN
finefocus-3320	300	33	r.	r.	PROPN
finefocus-3320	300	34	2017	2017	NUM
finefocus-3320	300	35	.	.	PUNCT
finefocus-3320	301	1	antifungal	antifungal	ADJ
finefocus-3320	301	2	bacteria	bacteria	NOUN
finefocus-3320	301	3	on	on	ADP
finefocus-3320	301	4	woodland	woodland	NOUN
finefocus-3320	301	5	salamander	salamander	NOUN
finefocus-3320	301	6	skin	skin	NOUN
finefocus-3320	301	7	exhibit	exhibit	VERB
finefocus-3320	301	8	high	high	ADJ
finefocus-3320	301	9	taxonomic	taxonomic	ADJ
finefocus-3320	301	10	diversity	diversity	NOUN
finefocus-3320	301	11	and	and	CCONJ
finefocus-3320	301	12	geographic	geographic	ADJ
finefocus-3320	301	13	variability	variability	NOUN
finefocus-3320	301	14	.	.	PUNCT
finefocus-3320	302	1	appl	appl	PROPN
finefocus-3320	302	2	.	.	PUNCT
finefocus-3320	303	1	environ	environ	PROPN
finefocus-3320	303	2	.	.	PUNCT
finefocus-3320	303	3	microbiol	microbiol	PROPN
finefocus-3320	303	4	.	.	PUNCT
finefocus-3320	304	1	83	83	NUM
finefocus-3320	304	2	:	:	PUNCT
finefocus-3320	304	3	e001	e001	PROPN
finefocus-3320	304	4	86	86	NUM
finefocus-3320	304	5	-	-	SYM
finefocus-3320	304	6	17	17	NUM
finefocus-3320	304	7	.	.	PUNCT
finefocus-3320	305	1	31	31	NUM
finefocus-3320	305	2	.	.	PUNCT
finefocus-3320	306	1	narciso	narciso	PROPN
finefocus-3320	306	2	-	-	PUNCT
finefocus-3320	306	3	da	da	PROPN
finefocus-3320	306	4	-	-	PUNCT
finefocus-3320	306	5	rocha	rocha	PROPN
finefocus-3320	306	6	,	,	PUNCT
finefocus-3320	306	7	c.	c.	PROPN
finefocus-3320	306	8	&	&	CCONJ
finefocus-3320	306	9	manaia	manaia	PROPN
finefocus-3320	306	10	,	,	PUNCT
finefocus-3320	306	11	c.	c.	PROPN
finefocus-3320	306	12	m.	m.	PROPN
finefocus-3320	306	13	2016	2016	NUM
finefocus-3320	306	14	.	.	PUNCT
finefocus-3320	307	1	multidrug	multidrug	NOUN
finefocus-3320	307	2	resistance	resistance	NOUN
finefocus-3320	307	3	phenotypes	phenotype	NOUN
finefocus-3320	307	4	are	be	AUX
finefocus-3320	307	5	widespread	widespread	ADJ
finefocus-3320	307	6	over	over	ADP
finefocus-3320	307	7	different	different	ADJ
finefocus-3320	307	8	bacterial	bacterial	ADJ
finefocus-3320	307	9	taxonomic	taxonomic	ADJ
finefocus-3320	307	10	groups	group	NOUN
finefocus-3320	307	11	thriving	thrive	VERB
finefocus-3320	307	12	in	in	ADP
finefocus-3320	307	13	surface	surface	NOUN
finefocus-3320	307	14	water	water	NOUN
finefocus-3320	307	15	.	.	PUNCT
finefocus-3320	308	1	sci	sci	PROPN
finefocus-3320	308	2	.	.	PUNCT
finefocus-3320	308	3	total	total	PROPN
finefocus-3320	308	4	environ	environ	PROPN
finefocus-3320	308	5	.	.	PUNCT
finefocus-3320	309	1	563–564:1–9	563–564:1–9	NUM
finefocus-3320	309	2	.	.	PUNCT
finefocus-3320	310	1	32	32	NUM
finefocus-3320	310	2	.	.	PUNCT
finefocus-3320	311	1	nardelli	nardelli	PROPN
finefocus-3320	311	2	,	,	PUNCT
finefocus-3320	311	3	m.	m.	NOUN
finefocus-3320	311	4	,	,	PUNCT
finefocus-3320	311	5	scalzo	scalzo	NOUN
finefocus-3320	311	6	,	,	PUNCT
finefocus-3320	311	7	p.	p.	NOUN
finefocus-3320	311	8	m.	m.	NOUN
finefocus-3320	311	9	,	,	PUNCT
finefocus-3320	311	10	ramírez	ramírez	NOUN
finefocus-3320	311	11	,	,	PUNCT
finefocus-3320	311	12	m.	m.	NOUN
finefocus-3320	311	13	s.	s.	PROPN
finefocus-3320	311	14	,	,	PUNCT
finefocus-3320	311	15	quiroga	quiroga	PROPN
finefocus-3320	311	16	,	,	PUNCT
finefocus-3320	311	17	m.	m.	NOUN
finefocus-3320	311	18	p.	p.	PROPN
finefocus-3320	311	19	,	,	PUNCT
finefocus-3320	311	20	cassini	cassini	PROPN
finefocus-3320	311	21	,	,	PUNCT
finefocus-3320	311	22	m.	m.	NOUN
finefocus-3320	311	23	h.	h.	PROPN
finefocus-3320	311	24	&	&	CCONJ
finefocus-3320	311	25	centrón	centrón	PROPN
finefocus-3320	311	26	,	,	PUNCT
finefocus-3320	311	27	d.	d.	PROPN
finefocus-3320	311	28	2012	2012	NUM
finefocus-3320	311	29	.	.	PUNCT
finefocus-3320	312	1	class	class	NOUN
finefocus-3320	312	2	1	1	NUM
finefocus-3320	312	3	integrons	integron	NOUN
finefocus-3320	312	4	in	in	ADP
finefocus-3320	312	5	environments	environment	NOUN
finefocus-3320	312	6	with	with	ADP
finefocus-3320	312	7	different	different	ADJ
finefocus-3320	312	8	degrees	degree	NOUN
finefocus-3320	312	9	of	of	ADP
finefocus-3320	312	10	urbanization	urbanization	NOUN
finefocus-3320	312	11	.	.	PUNCT
finefocus-3320	313	1	plos	plos	PROPN
finefocus-3320	313	2	one	one	NUM
finefocus-3320	313	3	doi	doi	NOUN
finefocus-3320	313	4	:	:	PUNCT
finefocus-3320	313	5	10.1371	10.1371	NUM
finefocus-3320	313	6	/	/	SYM
finefocus-3320	313	7	journal	journal	NOUN
finefocus-3320	313	8	.	.	PUNCT
finefocus-3320	314	1	pone.0039223	pone.0039223	PROPN
finefocus-3320	314	2	.	.	PROPN
finefocus-3320	315	1	33	33	NUM
finefocus-3320	315	2	.	.	PUNCT
finefocus-3320	316	1	nikaido	nikaido	PROPN
finefocus-3320	316	2	,	,	PUNCT
finefocus-3320	316	3	h.	h.	PROPN
finefocus-3320	316	4	2009	2009	NUM
finefocus-3320	316	5	.	.	PUNCT
finefocus-3320	317	1	multidrug	multidrug	VERB
finefocus-3320	317	2	resistance	resistance	NOUN
finefocus-3320	317	3	in	in	ADP
finefocus-3320	317	4	bacteria	bacteria	NOUN
finefocus-3320	317	5	.	.	PUNCT
finefocus-3320	318	1	annu	annu	PROPN
finefocus-3320	318	2	rev	rev	VERB
finefocus-3320	318	3	biochem	biochem	NOUN
finefocus-3320	318	4	78:119	78:119	NUM
finefocus-3320	318	5	–	–	PUNCT
finefocus-3320	318	6	146	146	NUM
finefocus-3320	318	7	.	.	PUNCT
finefocus-3320	319	1	34	34	NUM
finefocus-3320	319	2	.	.	PUNCT
finefocus-3320	320	1	peay	peay	PROPN
finefocus-3320	320	2	,	,	PUNCT
finefocus-3320	320	3	k.	k.	PROPN
finefocus-3320	320	4	g.	g.	PROPN
finefocus-3320	320	5	,	,	PUNCT
finefocus-3320	320	6	bruns	brun	NOUN
finefocus-3320	320	7	,	,	PUNCT
finefocus-3320	320	8	t.	t.	PROPN
finefocus-3320	320	9	d.	d.	PROPN
finefocus-3320	320	10	,	,	PUNCT
finefocus-3320	320	11	kennedy	kennedy	PROPN
finefocus-3320	320	12	,	,	PUNCT
finefocus-3320	320	13	p.	p.	PROPN
finefocus-3320	320	14	g.	g.	PROPN
finefocus-3320	320	15	,	,	PUNCT
finefocus-3320	320	16	bergemann	bergemann	PROPN
finefocus-3320	320	17	,	,	PUNCT
finefocus-3320	320	18	s.	s.	PROPN
finefocus-3320	320	19	e.	e.	PROPN
finefocus-3320	320	20	,	,	PUNCT
finefocus-3320	320	21	&	&	CCONJ
finefocus-3320	320	22	garbelotto	garbelotto	PROPN
finefocus-3320	320	23	,	,	PUNCT
finefocus-3320	320	24	m.	m.	NOUN
finefocus-3320	320	25	2007	2007	NUM
finefocus-3320	320	26	.	.	PUNCT
finefocus-3320	321	1	a	a	DET
finefocus-3320	321	2	strong	strong	ADJ
finefocus-3320	321	3	speciesarea	speciesarea	NOUN
finefocus-3320	321	4	relationship	relationship	NOUN
finefocus-3320	321	5	for	for	ADP
finefocus-3320	321	6	eukaryotic	eukaryotic	ADJ
finefocus-3320	321	7	soil	soil	NOUN
finefocus-3320	321	8	microbes	microbe	NOUN
finefocus-3320	321	9	:	:	PUNCT
finefocus-3320	321	10	island	island	NOUN
finefocus-3320	321	11	size	size	NOUN
finefocus-3320	321	12	matters	matter	VERB
finefocus-3320	321	13	for	for	ADP
finefocus-3320	321	14	ectomycorrhizal	ectomycorrhizal	NOUN
finefocus-3320	321	15	fungi	fungus	NOUN
finefocus-3320	321	16	.	.	PUNCT
finefocus-3320	322	1	ecol	ecol	PROPN
finefocus-3320	322	2	.	.	PUNCT
finefocus-3320	323	1	lett.10:470–480	lett.10:470–480	PROPN
finefocus-3320	323	2	.	.	PUNCT
finefocus-3320	324	1	35	35	NUM
finefocus-3320	324	2	.	.	PUNCT
finefocus-3320	325	1	piddock	piddock	PROPN
finefocus-3320	325	2	,	,	PUNCT
finefocus-3320	325	3	l.	l.	PROPN
finefocus-3320	325	4	j.	j.	PROPN
finefocus-3320	325	5	2006	2006	PROPN
finefocus-3320	325	6	.	.	PUNCT
finefocus-3320	326	1	multidrug	multidrug	NOUN
finefocus-3320	326	2	-	-	PUNCT
finefocus-3320	326	3	resistance	resistance	NOUN
finefocus-3320	326	4	efflux	efflux	NOUN
finefocus-3320	326	5	pumps	pump	NOUN
finefocus-3320	326	6	?	?	PUNCT
finefocus-3320	327	1	not	not	PART
finefocus-3320	327	2	just	just	ADV
finefocus-3320	327	3	for	for	ADP
finefocus-3320	327	4	resistance	resistance	NOUN
finefocus-3320	327	5	.	.	PUNCT
finefocus-3320	328	1	nat	nat	PROPN
finefocus-3320	328	2	.	.	PUNCT
finefocus-3320	329	1	rev	rev	PROPN
finefocus-3320	329	2	.	.	PROPN
finefocus-3320	329	3	microbiol	microbiol	PROPN
finefocus-3320	329	4	.	.	PUNCT
finefocus-3320	330	1	4:629–636	4:629–636	NOUN
finefocus-3320	330	2	.	.	PUNCT
finefocus-3320	331	1	36	36	NUM
finefocus-3320	331	2	.	.	X
finefocus-3320	331	3	poté	poté	PROPN
finefocus-3320	331	4	,	,	PUNCT
finefocus-3320	331	5	j.	j.	PROPN
finefocus-3320	331	6	,	,	PUNCT
finefocus-3320	331	7	bravo	bravo	PROPN
finefocus-3320	331	8	,	,	PUNCT
finefocus-3320	331	9	a.	a.	NOUN
finefocus-3320	331	10	g.	g.	PROPN
finefocus-3320	331	11	,	,	PUNCT
finefocus-3320	331	12	mavingui	mavingui	NOUN
finefocus-3320	331	13	,	,	PUNCT
finefocus-3320	331	14	p.	p.	NOUN
finefocus-3320	331	15	,	,	PUNCT
finefocus-3320	331	16	ariztegui	ariztegui	ADJ
finefocus-3320	331	17	,	,	PUNCT
finefocus-3320	331	18	d.	d.	PROPN
finefocus-3320	331	19	&	&	CCONJ
finefocus-3320	331	20	wildi	wildi	PROPN
finefocus-3320	331	21	,	,	PUNCT
finefocus-3320	331	22	w.	w.	PROPN
finefocus-3320	331	23	2010	2010	NUM
finefocus-3320	331	24	.	.	PUNCT
finefocus-3320	332	1	evaluation	evaluation	NOUN
finefocus-3320	332	2	of	of	ADP
finefocus-3320	332	3	quantitative	quantitative	ADJ
finefocus-3320	332	4	recovery	recovery	NOUN
finefocus-3320	332	5	of	of	ADP
finefocus-3320	332	6	bacterial	bacterial	ADJ
finefocus-3320	332	7	cells	cell	NOUN
finefocus-3320	332	8	and	and	CCONJ
finefocus-3320	332	9	dna	dna	NOUN
finefocus-3320	332	10	from	from	ADP
finefocus-3320	332	11	different	different	ADJ
finefocus-3320	332	12	lake	lake	NOUN
finefocus-3320	332	13	sediments	sediment	NOUN
finefocus-3320	332	14	by	by	ADP
finefocus-3320	332	15	nycodenz	nycodenz	NOUN
finefocus-3320	332	16	density	density	PROPN
finefocus-3320	332	17	gradient	gradient	NOUN
finefocus-3320	332	18	centrifugation	centrifugation	NOUN
finefocus-3320	332	19	.	.	PUNCT
finefocus-3320	333	1	ecol	ecol	NOUN
finefocus-3320	333	2	.	.	PUNCT
finefocus-3320	334	1	indic	indic	ADJ
finefocus-3320	334	2	.	.	PUNCT
finefocus-3320	335	1	10:234–240	10:234–240	NUM
finefocus-3320	335	2	.	.	PUNCT
finefocus-3320	336	1	37	37	NUM
finefocus-3320	336	2	.	.	PUNCT
finefocus-3320	337	1	queipo	queipo	NOUN
finefocus-3320	337	2	-	-	PUNCT
finefocus-3320	337	3	ortuño	ortuño	PROPN
finefocus-3320	337	4	,	,	PUNCT
finefocus-3320	337	5	m.	m.	NOUN
finefocus-3320	337	6	i.	i.	PROPN
finefocus-3320	337	7	,	,	PUNCT
finefocus-3320	337	8	de	de	X
finefocus-3320	337	9	dios	dios	X
finefocus-3320	337	10	colmenero	colmenero	NOUN
finefocus-3320	337	11	,	,	PUNCT
finefocus-3320	337	12	j.	j.	PROPN
finefocus-3320	337	13	,	,	PUNCT
finefocus-3320	337	14	macias	macias	PROPN
finefocus-3320	337	15	,	,	PUNCT
finefocus-3320	337	16	m.	m.	NOUN
finefocus-3320	337	17	,	,	PUNCT
finefocus-3320	337	18	bravo	bravo	PROPN
finefocus-3320	337	19	,	,	PUNCT
finefocus-3320	337	20	m.	m.	NOUN
finefocus-3320	337	21	j.	j.	PROPN
finefocus-3320	337	22	,	,	PUNCT
finefocus-3320	337	23	&	&	CCONJ
finefocus-3320	337	24	morata	morata	PROPN
finefocus-3320	337	25	,	,	PUNCT
finefocus-3320	337	26	p.	p.	NOUN
finefocus-3320	337	27	2008	2008	NUM
finefocus-3320	337	28	.	.	PUNCT
finefocus-3320	338	1	preparation	preparation	NOUN
finefocus-3320	338	2	of	of	ADP
finefocus-3320	338	3	bacterial	bacterial	ADJ
finefocus-3320	338	4	dna	dna	NOUN
finefocus-3320	338	5	template	template	NOUN
finefocus-3320	338	6	by	by	ADP
finefocus-3320	338	7	boiling	boiling	NOUN
finefocus-3320	338	8	and	and	CCONJ
finefocus-3320	338	9	effect	effect	NOUN
finefocus-3320	338	10	of	of	ADP
finefocus-3320	338	11	immunoglobulin	immunoglobulin	NOUN
finefocus-3320	338	12	g	g	PROPN
finefocus-3320	338	13	as	as	ADP
finefocus-3320	338	14	an	an	DET
finefocus-3320	338	15	inhibitor	inhibitor	NOUN
finefocus-3320	338	16	in	in	ADP
finefocus-3320	338	17	real	real	ADJ
finefocus-3320	338	18	-	-	PUNCT
finefocus-3320	338	19	time	time	NOUN
finefocus-3320	338	20	pcr	pcr	NOUN
finefocus-3320	338	21	for	for	ADP
finefocus-3320	338	22	serum	serum	NOUN
finefocus-3320	338	23	samples	sample	NOUN
finefocus-3320	338	24	from	from	ADP
finefocus-3320	338	25	patients	patient	NOUN
finefocus-3320	338	26	with	with	ADP
finefocus-3320	338	27	brucellosis	brucellosis	NOUN
finefocus-3320	338	28	.	.	PUNCT
finefocus-3320	339	1	clin	clin	PROPN
finefocus-3320	339	2	.	.	PUNCT
finefocus-3320	340	1	vaccine	vaccine	NOUN
finefocus-3320	340	2	immunol	immunol	NOUN
finefocus-3320	340	3	.	.	PUNCT
finefocus-3320	341	1	15:293–6	15:293–6	NUM
finefocus-3320	341	2	.	.	PUNCT
finefocus-3320	342	1	38	38	NUM
finefocus-3320	342	2	.	.	PUNCT
finefocus-3320	342	3	quinteira	quinteira	NOUN
finefocus-3320	342	4	,	,	PUNCT
finefocus-3320	342	5	s.	s.	PROPN
finefocus-3320	342	6	,	,	PUNCT
finefocus-3320	342	7	ferreira	ferreira	PROPN
finefocus-3320	342	8	,	,	PUNCT
finefocus-3320	342	9	h.	h.	PROPN
finefocus-3320	342	10	,	,	PUNCT
finefocus-3320	342	11	&	&	CCONJ
finefocus-3320	342	12	peixe	peixe	PROPN
finefocus-3320	342	13	,	,	PUNCT
finefocus-3320	342	14	l.	l.	PROPN
finefocus-3320	342	15	2005	2005	NUM
finefocus-3320	342	16	.	.	PUNCT
finefocus-3320	343	1	first	first	ADJ
finefocus-3320	343	2	isolation	isolation	NOUN
finefocus-3320	343	3	of	of	ADP
finefocus-3320	343	4	blavim-2	blavim-2	NUM
finefocus-3320	343	5	in	in	ADP
finefocus-3320	343	6	an	an	DET
finefocus-3320	343	7	environmental	environmental	ADJ
finefocus-3320	343	8	isolate	isolate	NOUN
finefocus-3320	343	9	of	of	ADP
finefocus-3320	343	10	pseudomonas	pseudomona	NOUN
finefocus-3320	343	11	pseudoalcaligenes	pseudoalcaligene	NOUN
finefocus-3320	343	12	.	.	PUNCT
finefocus-3320	344	1	antimicrob	antimicrob	PROPN
finefocus-3320	344	2	.	.	PUNCT
finefocus-3320	345	1	agents	agent	NOUN
finefocus-3320	345	2	chemother	chemother	PROPN
finefocus-3320	345	3	.	.	PUNCT
finefocus-3320	346	1	49:2140–1	49:2140–1	NUM
finefocus-3320	346	2	.	.	X
finefocus-3320	347	1	39	39	NUM
finefocus-3320	347	2	.	.	PUNCT
finefocus-3320	348	1	rankin	rankin	PROPN
finefocus-3320	348	2	,	,	PUNCT
finefocus-3320	348	3	e.	e.	PROPN
finefocus-3320	348	4	t.	t.	PROPN
finefocus-3320	348	5	1995	1995	NUM
finefocus-3320	348	6	.	.	PUNCT
finefocus-3320	349	1	habitat	habitat	NOUN
finefocus-3320	349	2	indices	index	NOUN
finefocus-3320	349	3	in	in	ADP
finefocus-3320	349	4	water	water	NOUN
finefocus-3320	349	5	resource	resource	NOUN
finefocus-3320	349	6	quality	quality	NOUN
finefocus-3320	349	7	assessments	assessment	NOUN
finefocus-3320	349	8	.	.	PUNCT
finefocus-3320	350	1	in	in	ADP
finefocus-3320	350	2	:	:	PUNCT
finefocus-3320	350	3	biological	biological	ADJ
finefocus-3320	350	4	assessment	assessment	NOUN
finefocus-3320	350	5	and	and	CCONJ
finefocus-3320	350	6	criteria	criterion	NOUN
finefocus-3320	350	7	:	:	PUNCT
finefocus-3320	350	8	tools	tool	NOUN
finefocus-3320	350	9	for	for	ADP
finefocus-3320	350	10	water	water	NOUN
finefocus-3320	350	11	resource	resource	NOUN
finefocus-3320	350	12	planning	planning	NOUN
finefocus-3320	350	13	and	and	CCONJ
finefocus-3320	350	14	decision	decision	NOUN
finefocus-3320	350	15	making	making	NOUN
finefocus-3320	350	16	.	.	PUNCT
finefocus-3320	351	1	boca	boca	PROPN
finefocus-3320	351	2	raton	raton	PROPN
finefocus-3320	351	3	:	:	PUNCT
finefocus-3320	351	4	crc	crc	PROPN
finefocus-3320	351	5	press	press	PROPN
finefocus-3320	351	6	llc	llc	PROPN
finefocus-3320	351	7	.	.	PUNCT
finefocus-3320	352	1	40	40	NUM
finefocus-3320	352	2	.	.	PUNCT
finefocus-3320	353	1	raynaud	raynaud	PROPN
finefocus-3320	353	2	,	,	PUNCT
finefocus-3320	353	3	x.	x.	PROPN
finefocus-3320	353	4	&	&	CCONJ
finefocus-3320	353	5	nunan	nunan	PROPN
finefocus-3320	353	6	,	,	PUNCT
finefocus-3320	353	7	n.	n.	PROPN
finefocus-3320	353	8	2014	2014	NUM
finefocus-3320	353	9	.	.	PUNCT
finefocus-3320	354	1	spatial	spatial	ADJ
finefocus-3320	354	2	ecology	ecology	NOUN
finefocus-3320	354	3	of	of	ADP
finefocus-3320	354	4	bacteria	bacteria	NOUN
finefocus-3320	354	5	at	at	ADP
finefocus-3320	354	6	the	the	DET
finefocus-3320	354	7	microscale	microscale	NOUN
finefocus-3320	354	8	in	in	ADP
finefocus-3320	354	9	soil	soil	NOUN
finefocus-3320	354	10	.	.	PUNCT
finefocus-3320	355	1	plos	plos	PROPN
finefocus-3320	355	2	one	one	NUM
finefocus-3320	355	3	9	9	NUM
finefocus-3320	355	4	:	:	PUNCT
finefocus-3320	355	5	e87217	e87217	NOUN
finefocus-3320	355	6	.	.	PROPN
finefocus-3320	355	7	41	41	NUM
finefocus-3320	355	8	.	.	PUNCT
finefocus-3320	356	1	riesenfeld	riesenfeld	PROPN
finefocus-3320	356	2	,	,	PUNCT
finefocus-3320	356	3	c.	c.	PROPN
finefocus-3320	356	4	s.	s.	PROPN
finefocus-3320	356	5	,	,	PUNCT
finefocus-3320	356	6	goodman	goodman	PROPN
finefocus-3320	356	7	,	,	PUNCT
finefocus-3320	356	8	r.	r.	PROPN
finefocus-3320	356	9	m.	m.	PROPN
finefocus-3320	356	10	,	,	PUNCT
finefocus-3320	356	11	&	&	CCONJ
finefocus-3320	356	12	handelsman	handelsman	PROPN
finefocus-3320	356	13	,	,	PUNCT
finefocus-3320	356	14	j.	j.	PROPN
finefocus-3320	356	15	2004	2004	PROPN
finefocus-3320	356	16	.	.	PUNCT
finefocus-3320	357	1	uncultured	uncultured	ADJ
finefocus-3320	357	2	soil	soil	NOUN
finefocus-3320	357	3	bacteria	bacteria	NOUN
finefocus-3320	357	4	are	be	AUX
finefocus-3320	357	5	a	a	DET
finefocus-3320	357	6	reservoir	reservoir	NOUN
finefocus-3320	357	7	of	of	ADP
finefocus-3320	357	8	new	new	ADJ
finefocus-3320	357	9	antibiotic	antibiotic	ADJ
finefocus-3320	357	10	resistance	resistance	NOUN
finefocus-3320	357	11	genes	gene	NOUN
finefocus-3320	357	12	.	.	PUNCT
finefocus-3320	358	1	environ	environ	PROPN
finefocus-3320	358	2	.	.	PUNCT
finefocus-3320	358	3	microbiol	microbiol	PROPN
finefocus-3320	358	4	.	.	PUNCT
finefocus-3320	359	1	6:781	6:781	NUM
finefocus-3320	359	2	-	-	SYM
finefocus-3320	359	3	9	9	NUM
finefocus-3320	359	4	.	.	NUM
finefocus-3320	359	5	42	42	NUM
finefocus-3320	359	6	.	.	PUNCT
finefocus-3320	360	1	smith	smith	PROPN
finefocus-3320	360	2	,	,	PUNCT
finefocus-3320	360	3	t.	t.	PROPN
finefocus-3320	360	4	c.	c.	PROPN
finefocus-3320	360	5	,	,	PUNCT
finefocus-3320	360	6	male	male	NOUN
finefocus-3320	360	7	,	,	PUNCT
finefocus-3320	360	8	m.	m.	NOUN
finefocus-3320	360	9	j.	j.	PROPN
finefocus-3320	360	10	,	,	PUNCT
finefocus-3320	360	11	harper	harper	PROPN
finefocus-3320	360	12	,	,	PUNCT
finefocus-3320	360	13	a.	a.	PROPN
finefocus-3320	360	14	l.	l.	PROPN
finefocus-3320	360	15	,	,	PUNCT
finefocus-3320	360	16	kroeger	kroeger	PROPN
finefocus-3320	360	17	,	,	PUNCT
finefocus-3320	360	18	j.	j.	PROPN
finefocus-3320	360	19	s.	s.	PROPN
finefocus-3320	360	20	,	,	PUNCT
finefocus-3320	360	21	tinkler	tinkler	PROPN
finefocus-3320	360	22	,	,	PUNCT
finefocus-3320	360	23	g.	g.	PROPN
finefocus-3320	360	24	p.	p.	PROPN
finefocus-3320	360	25	,	,	PUNCT
finefocus-3320	360	26	moritz	moritz	PROPN
finefocus-3320	360	27	,	,	PUNCT
finefocus-3320	360	28	e.	e.	PROPN
finefocus-3320	360	29	d.	d.	PROPN
finefocus-3320	360	30	,	,	PUNCT
finefocus-3320	360	31	capuano	capuano	PROPN
finefocus-3320	360	32	,	,	PUNCT
finefocus-3320	360	33	a.	a.	PROPN
finefocus-3320	360	34	,	,	PUNCT
finefocus-3320	360	35	herwaldt	herwaldt	PROPN
finefocus-3320	360	36	,	,	PUNCT
finefocus-3320	360	37	l.	l.	PROPN
finefocus-3320	360	38	a.	a.	PROPN
finefocus-3320	360	39	,	,	PUNCT
finefocus-3320	360	40	&	&	CCONJ
finefocus-3320	360	41	diekema	diekema	PROPN
finefocus-3320	360	42	,	,	PUNCT
finefocus-3320	360	43	d.	d.	PROPN
finefocus-3320	360	44	j.	j.	PROPN
finefocus-3320	360	45	2009	2009	NUM
finefocus-3320	360	46	.	.	PUNCT
finefocus-3320	361	1	methicillin	methicillin	NOUN
finefocus-3320	361	2	-	-	PUNCT
finefocus-3320	361	3	resistant	resistant	ADJ
finefocus-3320	361	4	staphylococcus	staphylococcus	NOUN
finefocus-3320	361	5	aureus	aureus	NOUN
finefocus-3320	361	6	(	(	PUNCT
finefocus-3320	361	7	mrsa	mrsa	NOUN
finefocus-3320	361	8	)	)	PUNCT
finefocus-3320	361	9	strain	strain	NOUN
finefocus-3320	361	10	st398	st398	PROPN
finefocus-3320	361	11	is	be	AUX
finefocus-3320	361	12	present	present	ADJ
finefocus-3320	361	13	in	in	ADP
finefocus-3320	361	14	midwestern	midwestern	ADJ
finefocus-3320	361	15	u.s	u.s	PROPN
finefocus-3320	361	16	.	.	PROPN
finefocus-3320	361	17	swine	swine	PROPN
finefocus-3320	361	18	and	and	CCONJ
finefocus-3320	361	19	swine	swine	ADJ
finefocus-3320	361	20	workers	worker	NOUN
finefocus-3320	361	21	.	.	PUNCT
finefocus-3320	362	1	plos	plos	PROPN
finefocus-3320	362	2	one	one	NUM
finefocus-3320	362	3	doi	doi	NOUN
finefocus-3320	362	4	:	:	PUNCT
finefocus-3320	362	5	10.1371	10.1371	NUM
finefocus-3320	362	6	/	/	SYM
finefocus-3320	362	7	journal	journal	NOUN
finefocus-3320	362	8	.	.	PUNCT
finefocus-3320	363	1	pone.0004258	pone.0004258	PROPN
finefocus-3320	363	2	.	.	PROPN
finefocus-3320	363	3	43	43	NUM
finefocus-3320	363	4	.	.	PUNCT
finefocus-3320	364	1	spindler	spindler	PROPN
finefocus-3320	364	2	,	,	PUNCT
finefocus-3320	364	3	a.	a.	PROPN
finefocus-3320	364	4	,	,	PUNCT
finefocus-3320	364	5	otton	otton	PROPN
finefocus-3320	364	6	,	,	PUNCT
finefocus-3320	364	7	l.	l.	PROPN
finefocus-3320	364	8	m.	m.	PROPN
finefocus-3320	364	9	,	,	PUNCT
finefocus-3320	364	10	fuentefria	fuentefria	PROPN
finefocus-3320	364	11	,	,	PUNCT
finefocus-3320	364	12	d.	d.	PROPN
finefocus-3320	364	13	b.	b.	PROPN
finefocus-3320	364	14	,	,	PUNCT
finefocus-3320	364	15	&	&	CCONJ
finefocus-3320	364	16	corção	corção	PROPN
finefocus-3320	364	17	,	,	PUNCT
finefocus-3320	364	18	g.	g.	PROPN
finefocus-3320	364	19	2012	2012	NUM
finefocus-3320	364	20	.	.	PUNCT
finefocus-3320	365	1	beta	beta	NOUN
finefocus-3320	365	2	-	-	PUNCT
finefocus-3320	365	3	lactams	lactam	NOUN
finefocus-3320	365	4	resistance	resistance	NOUN
finefocus-3320	365	5	and	and	CCONJ
finefocus-3320	365	6	presence	presence	NOUN
finefocus-3320	365	7	of	of	ADP
finefocus-3320	365	8	class	class	NOUN
finefocus-3320	365	9	1	1	NUM
finefocus-3320	365	10	integron	integron	NOUN
finefocus-3320	365	11	in	in	ADP
finefocus-3320	365	12	pseudomonas	pseudomona	NOUN
finefocus-3320	365	13	spp	spp	NOUN
finefocus-3320	365	14	.	.	PUNCT
finefocus-3320	366	1	isolated	isolate	VERB
finefocus-3320	366	2	from	from	ADP
finefocus-3320	366	3	untreated	untreated	ADJ
finefocus-3320	366	4	hospital	hospital	NOUN
finefocus-3320	366	5	effluents	effluent	NOUN
finefocus-3320	366	6	in	in	ADP
finefocus-3320	366	7	brazil	brazil	PROPN
finefocus-3320	366	8	.	.	PUNCT
finefocus-3320	367	1	antonie	antonie	PROPN
finefocus-3320	367	2	van	van	PROPN
finefocus-3320	367	3	leeuwenhoek	leeuwenhoek	PROPN
finefocus-3320	367	4	102:73–81	102:73–81	NUM
finefocus-3320	367	5	.	.	PUNCT
finefocus-3320	368	1	volume	volume	NOUN
finefocus-3320	368	2	six	six	NUM
finefocus-3320	369	1	|	|	ADV
finefocus-3320	369	2	75	75	NUM
finefocus-3320	369	3	44	44	NUM
finefocus-3320	369	4	.	.	PUNCT
finefocus-3320	370	1	spradbery	spradbery	NOUN
finefocus-3320	370	2	,	,	PUNCT
finefocus-3320	370	3	p.	p.	NOUN
finefocus-3320	370	4	2010	2010	NUM
finefocus-3320	370	5	.	.	PUNCT
finefocus-3320	371	1	restriction	restriction	NOUN
finefocus-3320	371	2	fragment	fragment	NOUN
finefocus-3320	371	3	length	length	NOUN
finefocus-3320	371	4	polymorphisms	polymorphism	NOUN
finefocus-3320	371	5	of	of	ADP
finefocus-3320	371	6	mutans	mutan	NOUN
finefocus-3320	371	7	streptococci	streptococci	NOUN
finefocus-3320	371	8	in	in	ADP
finefocus-3320	371	9	forensic	forensic	ADJ
finefocus-3320	371	10	odontological	odontological	ADJ
finefocus-3320	371	11	analysis	analysis	NOUN
finefocus-3320	371	12	.	.	PUNCT
finefocus-3320	372	1	biosci	biosci	PROPN
finefocus-3320	372	2	.	.	PUNCT
finefocus-3320	373	1	horizons	horizon	NOUN
finefocus-3320	373	2	3:166–178	3:166–178	NUM
finefocus-3320	373	3	.	.	PUNCT
finefocus-3320	374	1	45	45	NUM
finefocus-3320	374	2	.	.	PUNCT
finefocus-3320	374	3	sundin	sundin	PROPN
finefocus-3320	374	4	,	,	PUNCT
finefocus-3320	374	5	g.	g.	PROPN
finefocus-3320	374	6	w.	w.	PROPN
finefocus-3320	374	7	,	,	PUNCT
finefocus-3320	374	8	monks	monks	PROPN
finefocus-3320	374	9	,	,	PUNCT
finefocus-3320	374	10	d.	d.	PROPN
finefocus-3320	374	11	e.	e.	PROPN
finefocus-3320	374	12	,	,	PUNCT
finefocus-3320	374	13	&	&	CCONJ
finefocus-3320	374	14	bender	bender	PROPN
finefocus-3320	374	15	,	,	PUNCT
finefocus-3320	374	16	c.	c.	PROPN
finefocus-3320	374	17	l.	l.	PROPN
finefocus-3320	374	18	1995	1995	NUM
finefocus-3320	374	19	.	.	PUNCT
finefocus-3320	375	1	distribution	distribution	NOUN
finefocus-3320	375	2	of	of	ADP
finefocus-3320	375	3	the	the	DET
finefocus-3320	375	4	streptomycin	streptomycin	PROPN
finefocus-3320	375	5	-	-	PUNCT
finefocus-3320	375	6	resistance	resistance	PROPN
finefocus-3320	375	7	transposon	transposon	NOUN
finefocus-3320	375	8	tn5393	tn5393	PROPN
finefocus-3320	375	9	among	among	ADP
finefocus-3320	375	10	phylloplane	phylloplane	NOUN
finefocus-3320	375	11	and	and	CCONJ
finefocus-3320	375	12	soil	soil	NOUN
finefocus-3320	375	13	bacteria	bacteria	NOUN
finefocus-3320	375	14	from	from	ADP
finefocus-3320	375	15	managed	manage	VERB
finefocus-3320	375	16	agricultural	agricultural	ADJ
finefocus-3320	375	17	habitats	habitat	NOUN
finefocus-3320	375	18	.	.	PUNCT
finefocus-3320	376	1	can	can	AUX
finefocus-3320	376	2	.	.	PUNCT
finefocus-3320	377	1	j.	j.	PROPN
finefocus-3320	377	2	microbiol	microbiol	PROPN
finefocus-3320	377	3	.	.	PUNCT
finefocus-3320	378	1	41:792	41:792	NUM
finefocus-3320	378	2	-	-	SYM
finefocus-3320	378	3	799	799	NUM
finefocus-3320	378	4	.	.	PUNCT
finefocus-3320	379	1	46	46	NUM
finefocus-3320	379	2	.	.	PUNCT
finefocus-3320	379	3	torsvik	torsvik	NOUN
finefocus-3320	379	4	,	,	PUNCT
finefocus-3320	379	5	v.	v.	ADV
finefocus-3320	379	6	,	,	PUNCT
finefocus-3320	379	7	goksøyr	goksøyr	NOUN
finefocus-3320	379	8	,	,	PUNCT
finefocus-3320	379	9	j.	j.	PROPN
finefocus-3320	379	10	,	,	PUNCT
finefocus-3320	379	11	&	&	CCONJ
finefocus-3320	379	12	daae	daae	PROPN
finefocus-3320	379	13	,	,	PUNCT
finefocus-3320	379	14	f.	f.	PROPN
finefocus-3320	379	15	l.	l.	PROPN
finefocus-3320	379	16	1990	1990	NUM
finefocus-3320	379	17	.	.	PUNCT
finefocus-3320	380	1	high	high	ADJ
finefocus-3320	380	2	diversity	diversity	NOUN
finefocus-3320	380	3	in	in	ADP
finefocus-3320	380	4	dna	dna	NOUN
finefocus-3320	380	5	of	of	ADP
finefocus-3320	380	6	soil	soil	NOUN
finefocus-3320	380	7	bacteria	bacteria	NOUN
finefocus-3320	380	8	.	.	PUNCT
finefocus-3320	381	1	appl	appl	PROPN
finefocus-3320	381	2	.	.	PUNCT
finefocus-3320	382	1	environ	environ	PROPN
finefocus-3320	382	2	.	.	PUNCT
finefocus-3320	382	3	microbiol	microbiol	PROPN
finefocus-3320	382	4	.	.	PUNCT
finefocus-3320	383	1	56;782–7	56;782–7	X
finefocus-3320	383	2	.	.	PUNCT
finefocus-3320	384	1	47	47	NUM
finefocus-3320	384	2	.	.	PUNCT
finefocus-3320	384	3	torsvik	torsvik	NOUN
finefocus-3320	384	4	,	,	PUNCT
finefocus-3320	384	5	v.	v.	ADV
finefocus-3320	384	6	,	,	PUNCT
finefocus-3320	384	7	øvrea	øvrea	NOUN
finefocus-3320	384	8	̊s	̊s	PROPN
finefocus-3320	384	9	,	,	PUNCT
finefocus-3320	384	10	l.	l.	PROPN
finefocus-3320	384	11	,	,	PUNCT
finefocus-3320	384	12	&	&	CCONJ
finefocus-3320	384	13	thingstad	thingstad	PROPN
finefocus-3320	384	14	,	,	PUNCT
finefocus-3320	384	15	t.	t.	PROPN
finefocus-3320	384	16	f.	f.	PROPN
finefocus-3320	384	17	2002	2002	NUM
finefocus-3320	384	18	.	.	PUNCT
finefocus-3320	385	1	prokaryotic	prokaryotic	ADJ
finefocus-3320	385	2	diversity	diversity	NOUN
finefocus-3320	385	3	magnitude	magnitude	NOUN
finefocus-3320	385	4	,	,	PUNCT
finefocus-3320	385	5	dynamics	dynamic	NOUN
finefocus-3320	385	6	,	,	PUNCT
finefocus-3320	385	7	and	and	CCONJ
finefocus-3320	385	8	controlling	control	VERB
finefocus-3320	385	9	factors	factor	NOUN
finefocus-3320	385	10	.	.	PUNCT
finefocus-3320	386	1	science	science	NOUN
finefocus-3320	386	2	.	.	PUNCT
finefocus-3320	387	1	296:1064–1066	296:1064–1066	NUM
finefocus-3320	387	2	.	.	PROPN
finefocus-3320	387	3	48	48	NUM
finefocus-3320	387	4	.	.	PUNCT
finefocus-3320	387	5	ventola	ventola	PROPN
finefocus-3320	387	6	,	,	PUNCT
finefocus-3320	387	7	c.	c.	PROPN
finefocus-3320	387	8	l.	l.	PROPN
finefocus-3320	387	9	2015	2015	NUM
finefocus-3320	387	10	.	.	PUNCT
finefocus-3320	388	1	the	the	DET
finefocus-3320	388	2	antibiotic	antibiotic	ADJ
finefocus-3320	388	3	resistance	resistance	NOUN
finefocus-3320	388	4	crisis	crisis	NOUN
finefocus-3320	388	5	:	:	PUNCT
finefocus-3320	388	6	part	part	NOUN
finefocus-3320	388	7	1	1	NUM
finefocus-3320	388	8	:	:	PUNCT
finefocus-3320	388	9	causes	cause	NOUN
finefocus-3320	388	10	and	and	CCONJ
finefocus-3320	388	11	threats	threat	NOUN
finefocus-3320	388	12	.	.	PUNCT
finefocus-3320	389	1	p	p	NOUN
finefocus-3320	389	2	t	t	PROPN
finefocus-3320	389	3	40:277–83	40:277–83	PROPN
finefocus-3320	389	4	.	.	PUNCT
finefocus-3320	390	1	49	49	NUM
finefocus-3320	390	2	.	.	PUNCT
finefocus-3320	391	1	wise	wise	ADJ
finefocus-3320	391	2	,	,	PUNCT
finefocus-3320	391	3	r.	r.	PROPN
finefocus-3320	391	4	,	,	PUNCT
finefocus-3320	391	5	andrews	andrews	PROPN
finefocus-3320	391	6	,	,	PUNCT
finefocus-3320	391	7	j.	j.	PROPN
finefocus-3320	391	8	m.	m.	PROPN
finefocus-3320	391	9	,	,	PUNCT
finefocus-3320	391	10	&	&	CCONJ
finefocus-3320	391	11	edwards	edwards	PROPN
finefocus-3320	391	12	,	,	PUNCT
finefocus-3320	391	13	l.	l.	PROPN
finefocus-3320	391	14	j.	j.	PROPN
finefocus-3320	391	15	1983	1983	PROPN
finefocus-3320	391	16	.	.	PUNCT
finefocus-3320	392	1	in	in	ADP
finefocus-3320	392	2	vitro	vitro	X
finefocus-3320	392	3	activity	activity	NOUN
finefocus-3320	392	4	of	of	ADP
finefocus-3320	392	5	bay	bay	PROPN
finefocus-3320	392	6	09867	09867	NUM
finefocus-3320	392	7	,	,	PUNCT
finefocus-3320	392	8	a	a	DET
finefocus-3320	392	9	new	new	ADJ
finefocus-3320	392	10	quinoline	quinoline	NOUN
finefocus-3320	392	11	derivative	derivative	NOUN
finefocus-3320	392	12	,	,	PUNCT
finefocus-3320	392	13	compared	compare	VERB
finefocus-3320	392	14	with	with	ADP
finefocus-3320	392	15	those	those	PRON
finefocus-3320	392	16	of	of	ADP
finefocus-3320	392	17	other	other	ADJ
finefocus-3320	392	18	antimicrobial	antimicrobial	ADJ
finefocus-3320	392	19	agents	agent	NOUN
finefocus-3320	392	20	.	.	PUNCT
finefocus-3320	393	1	antimicrob	antimicrob	PROPN
finefocus-3320	393	2	.	.	PUNCT
finefocus-3320	394	1	agents	agents	PROPN
finefocus-3320	394	2	chemother	chemother	PROPN
finefocus-3320	394	3	.	.	PUNCT
finefocus-3320	395	1	23:559	23:559	NUM
finefocus-3320	395	2	–	–	PUNCT
finefocus-3320	395	3	64	64	NUM
finefocus-3320	395	4	.	.	X
finefocus-3320	396	1	50	50	NUM
finefocus-3320	396	2	.	.	PUNCT
finefocus-3320	397	1	wright	wright	PROPN
finefocus-3320	397	2	,	,	PUNCT
finefocus-3320	397	3	g.	g.	PROPN
finefocus-3320	397	4	d.	d.	PROPN
finefocus-3320	397	5	2010	2010	NUM
finefocus-3320	397	6	.	.	PUNCT
finefocus-3320	398	1	antibiotic	antibiotic	ADJ
finefocus-3320	398	2	resistance	resistance	NOUN
finefocus-3320	398	3	in	in	ADP
finefocus-3320	398	4	the	the	DET
finefocus-3320	398	5	environment	environment	NOUN
finefocus-3320	398	6	:	:	PUNCT
finefocus-3320	398	7	a	a	DET
finefocus-3320	398	8	link	link	NOUN
finefocus-3320	398	9	to	to	ADP
finefocus-3320	398	10	the	the	DET
finefocus-3320	398	11	clinic	clinic	NOUN
finefocus-3320	398	12	?	?	PUNCT
finefocus-3320	399	1	curr	curr	PROPN
finefocus-3320	399	2	.	.	PUNCT
finefocus-3320	400	1	opin	opin	NOUN
finefocus-3320	400	2	.	.	PUNCT
finefocus-3320	401	1	microbiol	microbiol	PROPN
finefocus-3320	401	2	.	.	PUNCT
finefocus-3320	402	1	13:589	13:589	NUM
finefocus-3320	402	2	-	-	SYM
finefocus-3320	402	3	94	94	NUM
finefocus-3320	402	4	.	.	PUNCT
finefocus-3320	403	1	51	51	NUM
finefocus-3320	403	2	.	.	PUNCT
finefocus-3320	404	1	wright	wright	PROPN
finefocus-3320	404	2	,	,	PUNCT
finefocus-3320	404	3	m.	m.	PROPN
finefocus-3320	404	4	s.	s.	PROPN
finefocus-3320	404	5	,	,	PUNCT
finefocus-3320	404	6	baker	baker	PROPN
finefocus-3320	404	7	-	-	PUNCT
finefocus-3320	404	8	austin	austin	PROPN
finefocus-3320	404	9	,	,	PUNCT
finefocus-3320	404	10	c.	c.	PROPN
finefocus-3320	404	11	,	,	PUNCT
finefocus-3320	404	12	lindell	lindell	PROPN
finefocus-3320	404	13	,	,	PUNCT
finefocus-3320	404	14	a.	a.	PROPN
finefocus-3320	404	15	h.	h.	PROPN
finefocus-3320	404	16	,	,	PUNCT
finefocus-3320	404	17	stepanauskas	stepanauskas	PROPN
finefocus-3320	404	18	,	,	PUNCT
finefocus-3320	404	19	r.	r.	PROPN
finefocus-3320	404	20	,	,	PUNCT
finefocus-3320	404	21	stokes	stokes	PROPN
finefocus-3320	404	22	,	,	PUNCT
finefocus-3320	404	23	h.	h.	PROPN
finefocus-3320	404	24	w.	w.	PROPN
finefocus-3320	404	25	,	,	PUNCT
finefocus-3320	404	26	&	&	CCONJ
finefocus-3320	404	27	mcarthur	mcarthur	PROPN
finefocus-3320	404	28	,	,	PUNCT
finefocus-3320	404	29	j.	j.	PROPN
finefocus-3320	404	30	v.	v.	PROPN
finefocus-3320	404	31	2008	2008	NUM
finefocus-3320	404	32	.	.	PUNCT
finefocus-3320	405	1	influence	influence	NOUN
finefocus-3320	405	2	of	of	ADP
finefocus-3320	405	3	industrial	industrial	ADJ
finefocus-3320	405	4	contamination	contamination	NOUN
finefocus-3320	405	5	on	on	ADP
finefocus-3320	405	6	mobile	mobile	ADJ
finefocus-3320	405	7	genetic	genetic	ADJ
finefocus-3320	405	8	elements	element	NOUN
finefocus-3320	405	9	:	:	PUNCT
finefocus-3320	405	10	class	class	NOUN
finefocus-3320	405	11	1	1	NUM
finefocus-3320	405	12	integron	integron	NOUN
finefocus-3320	405	13	abundance	abundance	NOUN
finefocus-3320	405	14	and	and	CCONJ
finefocus-3320	405	15	gene	gene	NOUN
finefocus-3320	405	16	cassette	cassette	NOUN
finefocus-3320	405	17	structure	structure	NOUN
finefocus-3320	405	18	in	in	ADP
finefocus-3320	405	19	aquatic	aquatic	ADJ
finefocus-3320	405	20	bacterial	bacterial	ADJ
finefocus-3320	405	21	communities	community	NOUN
finefocus-3320	405	22	.	.	PUNCT
finefocus-3320	406	1	isme	isme	PROPN
finefocus-3320	406	2	j.	j.	PROPN
finefocus-3320	406	3	2	2	NUM
finefocus-3320	406	4	:	:	PUNCT
finefocus-3320	406	5	417–428	417–428	NUM
finefocus-3320	406	6	.	.	PUNCT
finefocus-3320	406	7	52	52	NUM
finefocus-3320	406	8	.	.	PUNCT
finefocus-3320	407	1	woodford	woodford	PROPN
finefocus-3320	407	2	,	,	PUNCT
finefocus-3320	407	3	n.	n.	PROPN
finefocus-3320	407	4	&	&	CCONJ
finefocus-3320	407	5	ellington	ellington	PROPN
finefocus-3320	407	6	,	,	PUNCT
finefocus-3320	407	7	m.	m.	NOUN
finefocus-3320	407	8	j.	j.	PROPN
finefocus-3320	407	9	2007	2007	NUM
finefocus-3320	407	10	.	.	PUNCT
finefocus-3320	408	1	the	the	DET
finefocus-3320	408	2	emergence	emergence	NOUN
finefocus-3320	408	3	of	of	ADP
finefocus-3320	408	4	antibiotic	antibiotic	ADJ
finefocus-3320	408	5	resistance	resistance	NOUN
finefocus-3320	408	6	by	by	ADP
finefocus-3320	408	7	mutation	mutation	NOUN
finefocus-3320	408	8	.	.	PUNCT
finefocus-3320	409	1	clin	clin	PROPN
finefocus-3320	409	2	.	.	PUNCT
finefocus-3320	410	1	microbiol	microbiol	PROPN
finefocus-3320	410	2	.	.	PUNCT
finefocus-3320	411	1	infect	infect	VERB
finefocus-3320	411	2	.	.	PUNCT
finefocus-3320	412	1	13:5–18	13:5–18	NUM
finefocus-3320	412	2	.	.	PUNCT
finefocus-3320	413	1	53	53	NUM
finefocus-3320	413	2	.	.	PUNCT
finefocus-3320	413	3	world	world	PROPN
finefocus-3320	413	4	health	health	PROPN
finefocus-3320	413	5	organization	organization	PROPN
finefocus-3320	413	6	.	.	PUNCT
finefocus-3320	414	1	2014	2014	NUM
finefocus-3320	414	2	.	.	PUNCT
finefocus-3320	415	1	antimicrobial	antimicrobial	ADJ
finefocus-3320	415	2	resistance	resistance	NOUN
finefocus-3320	415	3	:	:	PUNCT
finefocus-3320	415	4	global	global	ADJ
finefocus-3320	415	5	report	report	NOUN
finefocus-3320	415	6	on	on	ADP
finefocus-3320	415	7	surveillance	surveillance	NOUN
finefocus-3320	415	8	2014	2014	NUM
finefocus-3320	415	9	.	.	PUNCT
finefocus-3320	416	1	54	54	NUM
finefocus-3320	416	2	.	.	PUNCT
finefocus-3320	417	1	world	world	PROPN
finefocus-3320	417	2	health	health	PROPN
finefocus-3320	417	3	organization	organization	NOUN
finefocus-3320	417	4	.	.	PUNCT
finefocus-3320	418	1	2016	2016	NUM
finefocus-3320	418	2	.	.	PUNCT
finefocus-3320	419	1	critically	critically	ADV
finefocus-3320	419	2	important	important	ADJ
finefocus-3320	419	3	antimicrobials	antimicrobial	NOUN
finefocus-3320	419	4	for	for	ADP
finefocus-3320	419	5	human	human	ADJ
finefocus-3320	419	6	medicine	medicine	NOUN
finefocus-3320	419	7	,	,	PUNCT
finefocus-3320	419	8	5th	5th	ADJ
finefocus-3320	419	9	revision	revision	NOUN
finefocus-3320	419	10	2016	2016	NUM
finefocus-3320	419	11	.	.	PUNCT