id	sid	tid	token	lemma	pos
finefocus-4294	1	1	phillip	phillip	PROPN
finefocus-4294	1	2	c.	c.	PROPN
finefocus-4294	1	3	betts	betts	PROPN
finefocus-4294	1	4	jordan	jordan	PROPN
finefocus-4294	1	5	t.	t.	PROPN
finefocus-4294	1	6	froese	froese	PROPN
finefocus-4294	1	7	*	*	PROPN
finefocus-4294	1	8	department	department	PROPN
finefocus-4294	1	9	of	of	ADP
finefocus-4294	1	10	chemistry	chemistry	NOUN
finefocus-4294	1	11	,	,	PUNCT
finefocus-4294	1	12	ball	ball	NOUN
finefocus-4294	1	13	state	state	PROPN
finefocus-4294	1	14	university	university	PROPN
finefocus-4294	1	15	,	,	PUNCT
finefocus-4294	1	16	muncie	muncie	PROPN
finefocus-4294	1	17	,	,	PUNCT
finefocus-4294	1	18	in	in	ADP
finefocus-4294	1	19	47306	47306	NUM
finefocus-4294	1	20	investigation	investigation	NOUN
finefocus-4294	1	21	of	of	ADP
finefocus-4294	1	22	the	the	DET
finefocus-4294	1	23	effects	effect	NOUN
finefocus-4294	1	24	of	of	ADP
finefocus-4294	1	25	mutating	mutate	VERB
finefocus-4294	1	26	iron	iron	NOUN
finefocus-4294	1	27	-	-	PUNCT
finefocus-4294	1	28	coordinating	coordinate	VERB
finefocus-4294	1	29	residues	residue	NOUN
finefocus-4294	1	30	in	in	ADP
finefocus-4294	1	31	rieske	rieske	ADJ
finefocus-4294	1	32	dioxygenases	dioxygenase	NOUN
finefocus-4294	1	33	keywords	keyword	NOUN
finefocus-4294	1	34	:	:	PUNCT
finefocus-4294	1	35	rieske	rieske	ADJ
finefocus-4294	1	36	dioxygenase	dioxygenase	NOUN
finefocus-4294	1	37	,	,	PUNCT
finefocus-4294	1	38	toluene	toluene	NOUN
finefocus-4294	1	39	dioxygenase	dioxygenase	NOUN
finefocus-4294	1	40	,	,	PUNCT
finefocus-4294	1	41	oxidative	oxidative	ADJ
finefocus-4294	1	42	dearomatization	dearomatization	NOUN
finefocus-4294	1	43	,	,	PUNCT
finefocus-4294	1	44	green	green	ADJ
finefocus-4294	1	45	chemistry	chemistry	NOUN
finefocus-4294	1	46	,	,	PUNCT
finefocus-4294	1	47	enzyme	enzyme	NOUN
finefocus-4294	1	48	engineering	engineering	NOUN
finefocus-4294	1	49	,	,	PUNCT
finefocus-4294	1	50	bioremediation	bioremediation	NOUN
finefocus-4294	1	51	©	©	PROPN
finefocus-4294	1	52	2024	2024	NUM
finefocus-4294	1	53	betts	betts	PROPN
finefocus-4294	1	54	,	,	PUNCT
finefocus-4294	1	55	froese	froese	PROPN
finefocus-4294	1	56	.	.	PUNCT
finefocus-4294	2	1	fine	fine	ADJ
finefocus-4294	2	2	focus	focus	NOUN
finefocus-4294	2	3	,	,	PUNCT
finefocus-4294	2	4	10(1	10(1	NUM
finefocus-4294	2	5	)	)	PUNCT
finefocus-4294	2	6	,	,	PUNCT
finefocus-4294	2	7	90	90	NUM
finefocus-4294	2	8	-	-	SYM
finefocus-4294	2	9	108	108	NUM
finefocus-4294	2	10	.	.	PUNCT
finefocus-4294	3	1	doi	doi	NOUN
finefocus-4294	3	2	:	:	PUNCT
finefocus-4294	3	3	10.33043	10.33043	NUM
finefocus-4294	3	4	/	/	SYM
finefocus-4294	3	5	ff.10.1.90	ff.10.1.90	ADV
finefocus-4294	3	6	-	-	PUNCT
finefocus-4294	3	7	108	108	NUM
finefocus-4294	3	8	.	.	PUNCT
finefocus-4294	4	1	shared	share	VERB
finefocus-4294	4	2	with	with	ADP
finefocus-4294	4	3	cc	cc	NOUN
finefocus-4294	4	4	-	-	PUNCT
finefocus-4294	4	5	by	by	ADP
finefocus-4294	4	6	-	-	PUNCT
finefocus-4294	4	7	nc	nc	VERB
finefocus-4294	4	8	-	-	PROPN
finefocus-4294	4	9	nd	nd	ADV
finefocus-4294	4	10	4.0	4.0	NUM
finefocus-4294	4	11	license	license	NOUN
finefocus-4294	4	12	.	.	PUNCT
finefocus-4294	5	1	manuscript	manuscript	NOUN
finefocus-4294	5	2	received	receive	VERB
finefocus-4294	5	3	8	8	NUM
finefocus-4294	5	4	april	april	PROPN
finefocus-4294	5	5	2023	2023	NUM
finefocus-4294	5	6	;	;	PUNCT
finefocus-4294	5	7	accepted	accept	VERB
finefocus-4294	5	8	19	19	NUM
finefocus-4294	5	9	may	may	PROPN
finefocus-4294	5	10	2023	2023	NUM
finefocus-4294	5	11	abstract	abstract	ADV
finefocus-4294	5	12	rieske	rieske	ADJ
finefocus-4294	5	13	dioxygenases	dioxygenase	NOUN
finefocus-4294	5	14	are	be	AUX
finefocus-4294	5	15	multi	multi	ADJ
finefocus-4294	5	16	-	-	ADJ
finefocus-4294	5	17	component	component	ADJ
finefocus-4294	5	18	enzyme	enzyme	NOUN
finefocus-4294	5	19	systems	system	NOUN
finefocus-4294	5	20	,	,	PUNCT
finefocus-4294	5	21	naturally	naturally	ADV
finefocus-4294	5	22	found	find	VERB
finefocus-4294	5	23	in	in	ADP
finefocus-4294	5	24	many	many	ADJ
finefocus-4294	5	25	soil	soil	NOUN
finefocus-4294	5	26	bacteria	bacteria	NOUN
finefocus-4294	5	27	,	,	PUNCT
finefocus-4294	5	28	that	that	PRON
finefocus-4294	5	29	have	have	AUX
finefocus-4294	5	30	been	be	AUX
finefocus-4294	5	31	widely	widely	ADV
finefocus-4294	5	32	applied	apply	VERB
finefocus-4294	5	33	in	in	ADP
finefocus-4294	5	34	the	the	DET
finefocus-4294	5	35	production	production	NOUN
finefocus-4294	5	36	of	of	ADP
finefocus-4294	5	37	fine	fine	ADJ
finefocus-4294	5	38	chemicals	chemical	NOUN
finefocus-4294	5	39	,	,	PUNCT
finefocus-4294	5	40	owing	owe	VERB
finefocus-4294	5	41	to	to	ADP
finefocus-4294	5	42	the	the	DET
finefocus-4294	5	43	unique	unique	ADJ
finefocus-4294	5	44	and	and	CCONJ
finefocus-4294	5	45	valuable	valuable	ADJ
finefocus-4294	5	46	oxidative	oxidative	ADJ
finefocus-4294	5	47	dearomatization	dearomatization	NOUN
finefocus-4294	5	48	reactions	reaction	NOUN
finefocus-4294	5	49	they	they	PRON
finefocus-4294	5	50	catalyze	catalyze	VERB
finefocus-4294	5	51	.	.	PUNCT
finefocus-4294	6	1	the	the	DET
finefocus-4294	6	2	range	range	NOUN
finefocus-4294	6	3	of	of	ADP
finefocus-4294	6	4	practical	practical	ADJ
finefocus-4294	6	5	applications	application	NOUN
finefocus-4294	6	6	for	for	ADP
finefocus-4294	6	7	these	these	DET
finefocus-4294	6	8	enzymes	enzyme	NOUN
finefocus-4294	6	9	in	in	ADP
finefocus-4294	6	10	this	this	DET
finefocus-4294	6	11	context	context	NOUN
finefocus-4294	6	12	has	have	AUX
finefocus-4294	6	13	historically	historically	ADV
finefocus-4294	6	14	been	be	AUX
finefocus-4294	6	15	limited	limit	VERB
finefocus-4294	6	16	,	,	PUNCT
finefocus-4294	6	17	however	however	ADV
finefocus-4294	6	18	,	,	PUNCT
finefocus-4294	6	19	due	due	ADP
finefocus-4294	6	20	to	to	ADP
finefocus-4294	6	21	their	their	PRON
finefocus-4294	6	22	limited	limited	ADJ
finefocus-4294	6	23	substrate	substrate	NOUN
finefocus-4294	6	24	scope	scope	NOUN
finefocus-4294	6	25	and	and	CCONJ
finefocus-4294	6	26	strict	strict	ADJ
finefocus-4294	6	27	selectivity	selectivity	NOUN
finefocus-4294	6	28	.	.	PUNCT
finefocus-4294	7	1	to	to	PART
finefocus-4294	7	2	overcome	overcome	VERB
finefocus-4294	7	3	these	these	DET
finefocus-4294	7	4	limitations	limitation	NOUN
finefocus-4294	7	5	,	,	PUNCT
finefocus-4294	7	6	our	our	PRON
finefocus-4294	7	7	research	research	NOUN
finefocus-4294	7	8	group	group	NOUN
finefocus-4294	7	9	has	have	AUX
finefocus-4294	7	10	employed	employ	VERB
finefocus-4294	7	11	the	the	DET
finefocus-4294	7	12	tools	tool	NOUN
finefocus-4294	7	13	of	of	ADP
finefocus-4294	7	14	enzyme	enzyme	NOUN
finefocus-4294	7	15	engineering	engineering	NOUN
finefocus-4294	7	16	to	to	PART
finefocus-4294	7	17	expand	expand	VERB
finefocus-4294	7	18	the	the	DET
finefocus-4294	7	19	substrate	substrate	NOUN
finefocus-4294	7	20	scope	scope	NOUN
finefocus-4294	7	21	or	or	CCONJ
finefocus-4294	7	22	improve	improve	VERB
finefocus-4294	7	23	the	the	DET
finefocus-4294	7	24	reactivity	reactivity	NOUN
finefocus-4294	7	25	of	of	ADP
finefocus-4294	7	26	these	these	DET
finefocus-4294	7	27	enzyme	enzyme	NOUN
finefocus-4294	7	28	systems	system	NOUN
finefocus-4294	7	29	in	in	ADP
finefocus-4294	7	30	specific	specific	ADJ
finefocus-4294	7	31	contexts	contexts	NOUN
finefocus-4294	7	32	.	.	PUNCT
finefocus-4294	8	1	traditionally	traditionally	ADV
finefocus-4294	8	2	,	,	PUNCT
finefocus-4294	8	3	enzyme	enzyme	NOUN
finefocus-4294	8	4	engineering	engineering	NOUN
finefocus-4294	8	5	campaigns	campaign	NOUN
finefocus-4294	8	6	targeting	target	VERB
finefocus-4294	8	7	metalloenzymes	metalloenzyme	NOUN
finefocus-4294	8	8	have	have	AUX
finefocus-4294	8	9	avoided	avoid	VERB
finefocus-4294	8	10	mutations	mutation	NOUN
finefocus-4294	8	11	to	to	ADP
finefocus-4294	8	12	metal	metal	NOUN
finefocus-4294	8	13	-	-	PUNCT
finefocus-4294	8	14	coordinating	coordinate	VERB
finefocus-4294	8	15	residues	residue	NOUN
finefocus-4294	8	16	,	,	PUNCT
finefocus-4294	8	17	based	base	VERB
finefocus-4294	8	18	on	on	ADP
finefocus-4294	8	19	the	the	DET
finefocus-4294	8	20	assumption	assumption	NOUN
finefocus-4294	8	21	that	that	SCONJ
finefocus-4294	8	22	these	these	DET
finefocus-4294	8	23	residues	residue	NOUN
finefocus-4294	8	24	are	be	AUX
finefocus-4294	8	25	essential	essential	ADJ
finefocus-4294	8	26	for	for	ADP
finefocus-4294	8	27	enzyme	enzyme	NOUN
finefocus-4294	8	28	activity	activity	NOUN
finefocus-4294	8	29	.	.	PUNCT
finefocus-4294	9	1	inspired	inspire	VERB
finefocus-4294	9	2	by	by	ADP
finefocus-4294	9	3	the	the	DET
finefocus-4294	9	4	success	success	NOUN
finefocus-4294	9	5	of	of	ADP
finefocus-4294	9	6	other	other	ADJ
finefocus-4294	9	7	recent	recent	ADJ
finefocus-4294	9	8	enzyme	enzyme	NOUN
finefocus-4294	9	9	engineering	engineering	NOUN
finefocus-4294	9	10	reports	report	NOUN
finefocus-4294	9	11	,	,	PUNCT
finefocus-4294	9	12	our	our	PRON
finefocus-4294	9	13	research	research	NOUN
finefocus-4294	9	14	group	group	NOUN
finefocus-4294	9	15	investigated	investigate	VERB
finefocus-4294	9	16	the	the	DET
finefocus-4294	9	17	potential	potential	NOUN
finefocus-4294	9	18	to	to	PART
finefocus-4294	9	19	alter	alter	VERB
finefocus-4294	9	20	or	or	CCONJ
finefocus-4294	9	21	improve	improve	VERB
finefocus-4294	9	22	the	the	DET
finefocus-4294	9	23	reactivity	reactivity	NOUN
finefocus-4294	9	24	of	of	ADP
finefocus-4294	9	25	rieske	rieske	ADJ
finefocus-4294	9	26	dioxygenases	dioxygenase	NOUN
finefocus-4294	9	27	by	by	ADP
finefocus-4294	9	28	altering	alter	VERB
finefocus-4294	9	29	or	or	CCONJ
finefocus-4294	9	30	eliminating	eliminate	VERB
finefocus-4294	9	31	iron	iron	NOUN
finefocus-4294	9	32	coordination	coordination	NOUN
finefocus-4294	9	33	in	in	ADP
finefocus-4294	9	34	the	the	DET
finefocus-4294	9	35	active	active	ADJ
finefocus-4294	9	36	site	site	NOUN
finefocus-4294	9	37	of	of	ADP
finefocus-4294	9	38	these	these	DET
finefocus-4294	9	39	enzymes	enzyme	NOUN
finefocus-4294	9	40	.	.	PUNCT
finefocus-4294	10	1	herein	herein	NOUN
finefocus-4294	10	2	,	,	PUNCT
finefocus-4294	10	3	we	we	PRON
finefocus-4294	10	4	report	report	VERB
finefocus-4294	10	5	the	the	DET
finefocus-4294	10	6	modification	modification	NOUN
finefocus-4294	10	7	of	of	ADP
finefocus-4294	10	8	all	all	DET
finefocus-4294	10	9	three	three	NUM
finefocus-4294	10	10	iron	iron	NOUN
finefocus-4294	10	11	-	-	PUNCT
finefocus-4294	10	12	coordinating	coordinate	VERB
finefocus-4294	10	13	residues	residue	NOUN
finefocus-4294	10	14	in	in	ADP
finefocus-4294	10	15	the	the	DET
finefocus-4294	10	16	active	active	ADJ
finefocus-4294	10	17	site	site	NOUN
finefocus-4294	10	18	of	of	ADP
finefocus-4294	10	19	toluene	toluene	ADJ
finefocus-4294	10	20	dioxygenase	dioxygenase	NOUN
finefocus-4294	10	21	both	both	PRON
finefocus-4294	10	22	to	to	PART
finefocus-4294	10	23	alternate	alternate	VERB
finefocus-4294	10	24	residues	residue	NOUN
finefocus-4294	10	25	capable	capable	ADJ
finefocus-4294	10	26	of	of	ADP
finefocus-4294	10	27	coordinating	coordinate	VERB
finefocus-4294	10	28	iron	iron	NOUN
finefocus-4294	10	29	,	,	PUNCT
finefocus-4294	10	30	and	and	CCONJ
finefocus-4294	10	31	to	to	ADP
finefocus-4294	10	32	a	a	DET
finefocus-4294	10	33	residue	residue	NOUN
finefocus-4294	10	34	that	that	PRON
finefocus-4294	10	35	would	would	AUX
finefocus-4294	10	36	eliminate	eliminate	VERB
finefocus-4294	10	37	iron	iron	NOUN
finefocus-4294	10	38	coordination	coordination	NOUN
finefocus-4294	10	39	.	.	PUNCT
finefocus-4294	11	1	the	the	DET
finefocus-4294	11	2	enzyme	enzyme	NOUN
finefocus-4294	11	3	variants	variant	NOUN
finefocus-4294	11	4	produced	produce	VERB
finefocus-4294	11	5	in	in	ADP
finefocus-4294	11	6	this	this	DET
finefocus-4294	11	7	way	way	NOUN
finefocus-4294	11	8	were	be	AUX
finefocus-4294	11	9	tested	test	VERB
finefocus-4294	11	10	for	for	ADP
finefocus-4294	11	11	their	their	PRON
finefocus-4294	11	12	activity	activity	NOUN
finefocus-4294	11	13	in	in	ADP
finefocus-4294	11	14	the	the	DET
finefocus-4294	11	15	cis	cis	NOUN
finefocus-4294	11	16	-	-	PUNCT
finefocus-4294	11	17	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	11	18	of	of	ADP
finefocus-4294	11	19	a	a	DET
finefocus-4294	11	20	small	small	ADJ
finefocus-4294	11	21	library	library	NOUN
finefocus-4294	11	22	of	of	ADP
finefocus-4294	11	23	potential	potential	ADJ
finefocus-4294	11	24	aromatic	aromatic	ADJ
finefocus-4294	11	25	substrates	substrate	NOUN
finefocus-4294	11	26	.	.	PUNCT
finefocus-4294	12	1	the	the	DET
finefocus-4294	12	2	results	result	NOUN
finefocus-4294	12	3	of	of	ADP
finefocus-4294	12	4	these	these	DET
finefocus-4294	12	5	studies	study	NOUN
finefocus-4294	12	6	demonstrated	demonstrate	VERB
finefocus-4294	12	7	that	that	SCONJ
finefocus-4294	12	8	all	all	DET
finefocus-4294	12	9	three	three	NUM
finefocus-4294	12	10	iron	iron	NOUN
finefocus-4294	12	11	-	-	PUNCT
finefocus-4294	12	12	coordinating	coordinate	VERB
finefocus-4294	12	13	residues	residue	NOUN
finefocus-4294	12	14	,	,	PUNCT
finefocus-4294	12	15	in	in	ADP
finefocus-4294	12	16	their	their	PRON
finefocus-4294	12	17	natural	natural	ADJ
finefocus-4294	12	18	state	state	NOUN
finefocus-4294	12	19	,	,	PUNCT
finefocus-4294	12	20	are	be	AUX
finefocus-4294	12	21	essential	essential	ADJ
finefocus-4294	12	22	for	for	ADP
finefocus-4294	12	23	enzyme	enzyme	NOUN
finefocus-4294	12	24	activity	activity	NOUN
finefocus-4294	12	25	in	in	ADP
finefocus-4294	12	26	toluene	toluene	NOUN
finefocus-4294	12	27	dioxygenase	dioxygenase	NOUN
finefocus-4294	12	28	,	,	PUNCT
finefocus-4294	12	29	as	as	SCONJ
finefocus-4294	12	30	the	the	DET
finefocus-4294	12	31	introduction	introduction	NOUN
finefocus-4294	12	32	of	of	ADP
finefocus-4294	12	33	any	any	DET
finefocus-4294	12	34	mutations	mutation	NOUN
finefocus-4294	12	35	at	at	ADP
finefocus-4294	12	36	these	these	DET
finefocus-4294	12	37	sites	site	NOUN
finefocus-4294	12	38	resulted	result	VERB
finefocus-4294	12	39	in	in	ADP
finefocus-4294	12	40	a	a	DET
finefocus-4294	12	41	complete	complete	ADJ
finefocus-4294	12	42	loss	loss	NOUN
finefocus-4294	12	43	of	of	ADP
finefocus-4294	12	44	cis	cis	NOUN
finefocus-4294	12	45	-	-	PUNCT
finefocus-4294	12	46	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	12	47	activity	activity	NOUN
finefocus-4294	12	48	for	for	ADP
finefocus-4294	12	49	all	all	DET
finefocus-4294	12	50	substrates	substrate	NOUN
finefocus-4294	12	51	tested	test	VERB
finefocus-4294	12	52	.	.	PUNCT
finefocus-4294	13	1	https://creativecommons.org/licenses/by-nc-nd/4.0/	https://creativecommons.org/licenses/by-nc-nd/4.0/	PROPN
finefocus-4294	13	2	betts	betts	PROPN
finefocus-4294	13	3	&	&	CCONJ
finefocus-4294	13	4	froese	froese	PROPN
finefocus-4294	13	5	|	|	ADV
finefocus-4294	13	6	investigation	investigation	NOUN
finefocus-4294	13	7	of	of	ADP
finefocus-4294	13	8	the	the	DET
finefocus-4294	13	9	effects	effect	NOUN
finefocus-4294	13	10	of	of	ADP
finefocus-4294	13	11	mutating	mutate	VERB
finefocus-4294	13	12	iron	iron	NOUN
finefocus-4294	13	13	-	-	PUNCT
finefocus-4294	13	14	coordinating	coordinate	VERB
finefocus-4294	13	15	residues	residue	NOUN
finefocus-4294	13	16	in	in	ADP
finefocus-4294	13	17	rieske	rieske	ADJ
finefocus-4294	13	18	dioxygenases	dioxygenase	NOUN
finefocus-4294	13	19	91	91	NUM
finefocus-4294	13	20	introduction	introduction	NOUN
finefocus-4294	13	21	in	in	ADP
finefocus-4294	13	22	recent	recent	ADJ
finefocus-4294	13	23	years	year	NOUN
finefocus-4294	13	24	,	,	PUNCT
finefocus-4294	13	25	the	the	DET
finefocus-4294	13	26	environmentally	environmentally	ADV
finefocus-4294	13	27	deleterious	deleterious	ADJ
finefocus-4294	13	28	effects	effect	NOUN
finefocus-4294	13	29	of	of	ADP
finefocus-4294	13	30	the	the	DET
finefocus-4294	13	31	chemical	chemical	NOUN
finefocus-4294	13	32	industry	industry	NOUN
finefocus-4294	13	33	have	have	AUX
finefocus-4294	13	34	increasingly	increasingly	ADV
finefocus-4294	13	35	been	be	AUX
finefocus-4294	13	36	recognized	recognize	VERB
finefocus-4294	13	37	,	,	PUNCT
finefocus-4294	13	38	leading	lead	VERB
finefocus-4294	13	39	to	to	ADP
finefocus-4294	13	40	a	a	DET
finefocus-4294	13	41	concerted	concerted	ADJ
finefocus-4294	13	42	effort	effort	NOUN
finefocus-4294	13	43	to	to	PART
finefocus-4294	13	44	employ	employ	VERB
finefocus-4294	13	45	more	more	ADV
finefocus-4294	13	46	sustainable	sustainable	ADJ
finefocus-4294	13	47	methods	method	NOUN
finefocus-4294	13	48	for	for	ADP
finefocus-4294	13	49	the	the	DET
finefocus-4294	13	50	production	production	NOUN
finefocus-4294	13	51	of	of	ADP
finefocus-4294	13	52	fine	fine	ADJ
finefocus-4294	13	53	chemicals	chemical	NOUN
finefocus-4294	13	54	(	(	PUNCT
finefocus-4294	13	55	19	19	NUM
finefocus-4294	13	56	,	,	PUNCT
finefocus-4294	13	57	36	36	NUM
finefocus-4294	13	58	)	)	PUNCT
finefocus-4294	13	59	.	.	PUNCT
finefocus-4294	14	1	these	these	DET
finefocus-4294	14	2	environmentally	environmentally	ADV
finefocus-4294	14	3	sustainable	sustainable	ADJ
finefocus-4294	14	4	chemical	chemical	NOUN
finefocus-4294	14	5	methods	method	NOUN
finefocus-4294	14	6	have	have	AUX
finefocus-4294	14	7	collectively	collectively	ADV
finefocus-4294	14	8	been	be	AUX
finefocus-4294	14	9	referred	refer	VERB
finefocus-4294	14	10	to	to	ADP
finefocus-4294	14	11	as	as	ADP
finefocus-4294	14	12	“	"	PUNCT
finefocus-4294	14	13	green	green	ADJ
finefocus-4294	14	14	chemistry	chemistry	NOUN
finefocus-4294	14	15	”	"	PUNCT
finefocus-4294	14	16	,	,	PUNCT
finefocus-4294	14	17	which	which	PRON
finefocus-4294	14	18	has	have	AUX
finefocus-4294	14	19	been	be	AUX
finefocus-4294	14	20	defined	define	VERB
finefocus-4294	14	21	by	by	ADP
finefocus-4294	14	22	a	a	DET
finefocus-4294	14	23	series	series	NOUN
finefocus-4294	14	24	of	of	ADP
finefocus-4294	14	25	principles	principle	NOUN
finefocus-4294	14	26	that	that	PRON
finefocus-4294	14	27	serve	serve	VERB
finefocus-4294	14	28	to	to	PART
finefocus-4294	14	29	guide	guide	VERB
finefocus-4294	14	30	the	the	DET
finefocus-4294	14	31	application	application	NOUN
finefocus-4294	14	32	of	of	ADP
finefocus-4294	14	33	sustainable	sustainable	ADJ
finefocus-4294	14	34	chemistry	chemistry	NOUN
finefocus-4294	14	35	(	(	PUNCT
finefocus-4294	14	36	15	15	NUM
finefocus-4294	14	37	,	,	PUNCT
finefocus-4294	14	38	34	34	NUM
finefocus-4294	14	39	)	)	PUNCT
finefocus-4294	14	40	.	.	PUNCT
finefocus-4294	15	1	owing	owe	VERB
finefocus-4294	15	2	to	to	ADP
finefocus-4294	15	3	this	this	DET
finefocus-4294	15	4	increased	increase	VERB
finefocus-4294	15	5	focus	focus	NOUN
finefocus-4294	15	6	on	on	ADP
finefocus-4294	15	7	green	green	ADJ
finefocus-4294	15	8	chemistry	chemistry	NOUN
finefocus-4294	15	9	,	,	PUNCT
finefocus-4294	15	10	the	the	DET
finefocus-4294	15	11	application	application	NOUN
finefocus-4294	15	12	of	of	ADP
finefocus-4294	15	13	enzymes	enzyme	NOUN
finefocus-4294	15	14	as	as	ADP
finefocus-4294	15	15	catalysts	catalyst	NOUN
finefocus-4294	15	16	in	in	ADP
finefocus-4294	15	17	the	the	DET
finefocus-4294	15	18	chemical	chemical	NOUN
finefocus-4294	15	19	industry	industry	NOUN
finefocus-4294	15	20	has	have	AUX
finefocus-4294	15	21	grown	grow	VERB
finefocus-4294	15	22	in	in	ADP
finefocus-4294	15	23	popularity	popularity	NOUN
finefocus-4294	15	24	(	(	PUNCT
finefocus-4294	15	25	7	7	NUM
finefocus-4294	15	26	)	)	PUNCT
finefocus-4294	15	27	.	.	PUNCT
finefocus-4294	16	1	enzymatic	enzymatic	ADJ
finefocus-4294	16	2	catalysts	catalyst	NOUN
finefocus-4294	16	3	are	be	AUX
finefocus-4294	16	4	entirely	entirely	ADV
finefocus-4294	16	5	biodegradable	biodegradable	ADJ
finefocus-4294	16	6	,	,	PUNCT
finefocus-4294	16	7	they	they	PRON
finefocus-4294	16	8	operate	operate	VERB
finefocus-4294	16	9	in	in	ADP
finefocus-4294	16	10	aqueous	aqueous	ADJ
finefocus-4294	16	11	media	medium	NOUN
finefocus-4294	16	12	as	as	SCONJ
finefocus-4294	16	13	opposed	oppose	VERB
finefocus-4294	16	14	to	to	ADP
finefocus-4294	16	15	petroleum	petroleum	NOUN
finefocus-4294	16	16	-	-	PUNCT
finefocus-4294	16	17	derived	derive	VERB
finefocus-4294	16	18	solvents	solvent	NOUN
finefocus-4294	16	19	,	,	PUNCT
finefocus-4294	16	20	they	they	PRON
finefocus-4294	16	21	do	do	AUX
finefocus-4294	16	22	not	not	PART
finefocus-4294	16	23	require	require	VERB
finefocus-4294	16	24	high	high	ADJ
finefocus-4294	16	25	-	-	PUNCT
finefocus-4294	16	26	temperature	temperature	NOUN
finefocus-4294	16	27	applications	application	NOUN
finefocus-4294	16	28	,	,	PUNCT
finefocus-4294	16	29	and	and	CCONJ
finefocus-4294	16	30	they	they	PRON
finefocus-4294	16	31	are	be	AUX
finefocus-4294	16	32	produced	produce	VERB
finefocus-4294	16	33	from	from	ADP
finefocus-4294	16	34	renewable	renewable	ADJ
finefocus-4294	16	35	resources	resource	NOUN
finefocus-4294	16	36	,	,	PUNCT
finefocus-4294	16	37	complying	comply	VERB
finefocus-4294	16	38	with	with	ADP
finefocus-4294	16	39	many	many	ADJ
finefocus-4294	16	40	of	of	ADP
finefocus-4294	16	41	the	the	DET
finefocus-4294	16	42	principles	principle	NOUN
finefocus-4294	16	43	of	of	ADP
finefocus-4294	16	44	green	green	ADJ
finefocus-4294	16	45	chemistry	chemistry	NOUN
finefocus-4294	16	46	(	(	PUNCT
finefocus-4294	16	47	15	15	NUM
finefocus-4294	16	48	,	,	PUNCT
finefocus-4294	16	49	34	34	NUM
finefocus-4294	16	50	)	)	PUNCT
finefocus-4294	16	51	.	.	PUNCT
finefocus-4294	17	1	one	one	NUM
finefocus-4294	17	2	class	class	NOUN
finefocus-4294	17	3	of	of	ADP
finefocus-4294	17	4	enzymes	enzyme	NOUN
finefocus-4294	17	5	that	that	PRON
finefocus-4294	17	6	have	have	AUX
finefocus-4294	17	7	been	be	AUX
finefocus-4294	17	8	widely	widely	ADV
finefocus-4294	17	9	applied	apply	VERB
finefocus-4294	17	10	as	as	ADP
finefocus-4294	17	11	catalysts	catalyst	NOUN
finefocus-4294	17	12	in	in	ADP
finefocus-4294	17	13	the	the	DET
finefocus-4294	17	14	production	production	NOUN
finefocus-4294	17	15	of	of	ADP
finefocus-4294	17	16	fine	fine	ADJ
finefocus-4294	17	17	chemicals	chemical	NOUN
finefocus-4294	17	18	are	be	AUX
finefocus-4294	17	19	the	the	DET
finefocus-4294	17	20	rieske	rieske	ADJ
finefocus-4294	17	21	dioxygenases	dioxygenase	NOUN
finefocus-4294	17	22	(	(	PUNCT
finefocus-4294	17	23	16	16	NUM
finefocus-4294	17	24	,	,	PUNCT
finefocus-4294	17	25	23	23	NUM
finefocus-4294	17	26	)	)	PUNCT
finefocus-4294	17	27	.	.	PUNCT
finefocus-4294	18	1	rieske	rieske	ADJ
finefocus-4294	18	2	dioxygenases	dioxygenase	NOUN
finefocus-4294	18	3	are	be	AUX
finefocus-4294	18	4	non	non	ADJ
finefocus-4294	18	5	-	-	ADJ
finefocus-4294	18	6	heme	heme	ADJ
finefocus-4294	18	7	iron	iron	NOUN
finefocus-4294	18	8	dioxygenases	dioxygenase	NOUN
finefocus-4294	18	9	that	that	PRON
finefocus-4294	18	10	are	be	AUX
finefocus-4294	18	11	commonly	commonly	ADV
finefocus-4294	18	12	found	find	VERB
finefocus-4294	18	13	in	in	ADP
finefocus-4294	18	14	soil	soil	NOUN
finefocus-4294	18	15	bacteria	bacteria	NOUN
finefocus-4294	18	16	(	(	PUNCT
finefocus-4294	18	17	39	39	NUM
finefocus-4294	18	18	)	)	PUNCT
finefocus-4294	18	19	.	.	PUNCT
finefocus-4294	19	1	these	these	DET
finefocus-4294	19	2	enzymes	enzyme	NOUN
finefocus-4294	19	3	have	have	AUX
finefocus-4294	19	4	frequently	frequently	ADV
finefocus-4294	19	5	evolved	evolve	VERB
finefocus-4294	19	6	as	as	ADP
finefocus-4294	19	7	a	a	DET
finefocus-4294	19	8	means	means	NOUN
finefocus-4294	19	9	for	for	SCONJ
finefocus-4294	19	10	soil	soil	NOUN
finefocus-4294	19	11	bacteria	bacteria	NOUN
finefocus-4294	19	12	to	to	PART
finefocus-4294	19	13	metabolize	metabolize	VERB
finefocus-4294	19	14	aromatic	aromatic	ADJ
finefocus-4294	19	15	pollutants	pollutant	NOUN
finefocus-4294	19	16	in	in	ADP
finefocus-4294	19	17	their	their	PRON
finefocus-4294	19	18	environment	environment	NOUN
finefocus-4294	19	19	and	and	CCONJ
finefocus-4294	19	20	to	to	PART
finefocus-4294	19	21	use	use	VERB
finefocus-4294	19	22	these	these	DET
finefocus-4294	19	23	pollutants	pollutant	NOUN
finefocus-4294	19	24	as	as	ADP
finefocus-4294	19	25	carbon	carbon	NOUN
finefocus-4294	19	26	and	and	CCONJ
finefocus-4294	19	27	energy	energy	NOUN
finefocus-4294	19	28	sources	source	NOUN
finefocus-4294	19	29	(	(	PUNCT
finefocus-4294	19	30	figure	figure	NOUN
finefocus-4294	19	31	1	1	NUM
finefocus-4294	19	32	)	)	PUNCT
finefocus-4294	19	33	(	(	PUNCT
finefocus-4294	19	34	12	12	NUM
finefocus-4294	19	35	,	,	PUNCT
finefocus-4294	19	36	42	42	NUM
finefocus-4294	19	37	)	)	PUNCT
finefocus-4294	19	38	.	.	PUNCT
finefocus-4294	20	1	the	the	DET
finefocus-4294	20	2	ability	ability	NOUN
finefocus-4294	20	3	of	of	ADP
finefocus-4294	20	4	these	these	DET
finefocus-4294	20	5	enzymes	enzyme	NOUN
finefocus-4294	20	6	to	to	PART
finefocus-4294	20	7	catalyze	catalyze	VERB
finefocus-4294	20	8	the	the	DET
finefocus-4294	20	9	cis	cis	NOUN
finefocus-4294	20	10	-	-	PUNCT
finefocus-4294	20	11	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	20	12	of	of	ADP
finefocus-4294	20	13	aromatics	aromatic	NOUN
finefocus-4294	20	14	to	to	PART
finefocus-4294	20	15	produce	produce	VERB
finefocus-4294	20	16	chemically	chemically	ADV
finefocus-4294	20	17	versatile	versatile	ADJ
finefocus-4294	20	18	cis	cis	NOUN
finefocus-4294	20	19	-	-	PUNCT
finefocus-4294	20	20	diene	diene	ADJ
finefocus-4294	20	21	-	-	PUNCT
finefocus-4294	20	22	diol	diol	NOUN
finefocus-4294	20	23	metabolites	metabolite	NOUN
finefocus-4294	20	24	with	with	ADP
finefocus-4294	20	25	high	high	ADJ
finefocus-4294	20	26	selectivity	selectivity	NOUN
finefocus-4294	20	27	has	have	AUX
finefocus-4294	20	28	made	make	VERB
finefocus-4294	20	29	them	they	PRON
finefocus-4294	20	30	very	very	ADV
finefocus-4294	20	31	useful	useful	ADJ
finefocus-4294	20	32	catalysts	catalyst	NOUN
finefocus-4294	20	33	in	in	ADP
finefocus-4294	20	34	the	the	DET
finefocus-4294	20	35	production	production	NOUN
finefocus-4294	20	36	of	of	ADP
finefocus-4294	20	37	valuable	valuable	ADJ
finefocus-4294	20	38	compounds	compound	NOUN
finefocus-4294	20	39	(	(	PUNCT
finefocus-4294	20	40	16	16	NUM
finefocus-4294	20	41	,	,	PUNCT
finefocus-4294	20	42	23	23	NUM
finefocus-4294	20	43	)	)	PUNCT
finefocus-4294	20	44	.	.	PUNCT
finefocus-4294	21	1	rieske	rieske	ADJ
finefocus-4294	21	2	dioxygenases	dioxygenase	NOUN
finefocus-4294	21	3	are	be	AUX
finefocus-4294	21	4	produced	produce	VERB
finefocus-4294	21	5	by	by	ADP
finefocus-4294	21	6	a	a	DET
finefocus-4294	21	7	wide	wide	ADJ
finefocus-4294	21	8	range	range	NOUN
finefocus-4294	21	9	of	of	ADP
finefocus-4294	21	10	soil	soil	NOUN
finefocus-4294	21	11	bacteria	bacteria	NOUN
finefocus-4294	21	12	strains	strain	VERB
finefocus-4294	21	13	,	,	PUNCT
finefocus-4294	21	14	including	include	VERB
finefocus-4294	21	15	pseudomonas	pseudomona	NOUN
finefocus-4294	21	16	(	(	PUNCT
finefocus-4294	21	17	42	42	NUM
finefocus-4294	21	18	)	)	PUNCT
finefocus-4294	21	19	,	,	PUNCT
finefocus-4294	21	20	burkholderia	burkholderia	PROPN
finefocus-4294	21	21	(	(	PUNCT
finefocus-4294	21	22	6	6	NUM
finefocus-4294	21	23	)	)	PUNCT
finefocus-4294	21	24	,	,	PUNCT
finefocus-4294	21	25	nocardioides	nocardioide	NOUN
finefocus-4294	21	26	(	(	PUNCT
finefocus-4294	21	27	32	32	NUM
finefocus-4294	21	28	)	)	PUNCT
finefocus-4294	21	29	,	,	PUNCT
finefocus-4294	21	30	and	and	CCONJ
finefocus-4294	21	31	comamonas	comamonas	PROPN
finefocus-4294	21	32	(	(	PUNCT
finefocus-4294	21	33	22	22	NUM
finefocus-4294	21	34	)	)	PUNCT
finefocus-4294	21	35	.	.	PUNCT
finefocus-4294	22	1	in	in	ADP
finefocus-4294	22	2	fact	fact	NOUN
finefocus-4294	22	3	,	,	PUNCT
finefocus-4294	22	4	metagenomic	metagenomic	ADJ
finefocus-4294	22	5	sequencing	sequence	VERB
finefocus-4294	22	6	studies	study	NOUN
finefocus-4294	22	7	have	have	AUX
finefocus-4294	22	8	revealed	reveal	VERB
finefocus-4294	22	9	that	that	SCONJ
finefocus-4294	22	10	aromatic	aromatic	ADJ
finefocus-4294	22	11	dioxygenases	dioxygenase	NOUN
finefocus-4294	22	12	are	be	AUX
finefocus-4294	22	13	ubiquitous	ubiquitous	ADJ
finefocus-4294	22	14	,	,	PUNCT
finefocus-4294	22	15	particularly	particularly	ADV
finefocus-4294	22	16	in	in	ADP
finefocus-4294	22	17	contaminated	contaminated	ADJ
finefocus-4294	22	18	environments	environment	NOUN
finefocus-4294	22	19	(	(	PUNCT
finefocus-4294	22	20	17	17	NUM
finefocus-4294	22	21	)	)	PUNCT
finefocus-4294	22	22	.	.	PUNCT
finefocus-4294	23	1	owing	owe	VERB
finefocus-4294	23	2	to	to	ADP
finefocus-4294	23	3	their	their	PRON
finefocus-4294	23	4	natural	natural	ADJ
finefocus-4294	23	5	role	role	NOUN
finefocus-4294	23	6	in	in	ADP
finefocus-4294	23	7	the	the	DET
finefocus-4294	23	8	remediation	remediation	NOUN
finefocus-4294	23	9	of	of	ADP
finefocus-4294	23	10	aromatics	aromatic	NOUN
finefocus-4294	23	11	in	in	ADP
finefocus-4294	23	12	the	the	DET
finefocus-4294	23	13	soil	soil	NOUN
finefocus-4294	23	14	and	and	CCONJ
finefocus-4294	23	15	therefore	therefore	ADV
finefocus-4294	23	16	the	the	DET
finefocus-4294	23	17	detoxification	detoxification	NOUN
finefocus-4294	23	18	of	of	ADP
finefocus-4294	23	19	these	these	DET
finefocus-4294	23	20	environments	environment	NOUN
finefocus-4294	23	21	(	(	PUNCT
finefocus-4294	23	22	12,42	12,42	NUM
finefocus-4294	23	23	)	)	PUNCT
finefocus-4294	23	24	,	,	PUNCT
finefocus-4294	23	25	these	these	DET
finefocus-4294	23	26	enzymes	enzyme	NOUN
finefocus-4294	23	27	play	play	VERB
finefocus-4294	23	28	crucial	crucial	ADJ
finefocus-4294	23	29	roles	role	NOUN
finefocus-4294	23	30	in	in	ADP
finefocus-4294	23	31	soil	soil	NOUN
finefocus-4294	23	32	ecology	ecology	NOUN
finefocus-4294	23	33	.	.	PUNCT
finefocus-4294	24	1	because	because	SCONJ
finefocus-4294	24	2	of	of	ADP
finefocus-4294	24	3	this	this	DET
finefocus-4294	24	4	role	role	NOUN
finefocus-4294	24	5	for	for	ADP
finefocus-4294	24	6	rieske	rieske	ADJ
finefocus-4294	24	7	dioxygenases	dioxygenase	NOUN
finefocus-4294	24	8	,	,	PUNCT
finefocus-4294	24	9	these	these	DET
finefocus-4294	24	10	enzymes	enzyme	NOUN
finefocus-4294	24	11	also	also	ADV
finefocus-4294	24	12	have	have	VERB
finefocus-4294	24	13	tremendous	tremendous	ADJ
finefocus-4294	24	14	potential	potential	NOUN
finefocus-4294	24	15	for	for	ADP
finefocus-4294	24	16	utility	utility	NOUN
finefocus-4294	24	17	in	in	ADP
finefocus-4294	24	18	the	the	DET
finefocus-4294	24	19	field	field	NOUN
finefocus-4294	24	20	of	of	ADP
finefocus-4294	24	21	bioremediation	bioremediation	NOUN
finefocus-4294	24	22	,	,	PUNCT
finefocus-4294	24	23	the	the	DET
finefocus-4294	24	24	use	use	NOUN
finefocus-4294	24	25	of	of	ADP
finefocus-4294	24	26	microorganisms	microorganism	NOUN
finefocus-4294	24	27	to	to	PART
finefocus-4294	24	28	degrade	degrade	VERB
finefocus-4294	24	29	anthropogenic	anthropogenic	ADJ
finefocus-4294	24	30	pollutants	pollutant	NOUN
finefocus-4294	24	31	in	in	ADP
finefocus-4294	24	32	an	an	DET
finefocus-4294	24	33	environment	environment	NOUN
finefocus-4294	24	34	.	.	PUNCT
finefocus-4294	25	1	aromatic	aromatic	ADJ
finefocus-4294	25	2	pollutants	pollutant	NOUN
finefocus-4294	25	3	such	such	ADJ
finefocus-4294	25	4	as	as	ADP
finefocus-4294	25	5	benzene	benzene	NOUN
finefocus-4294	25	6	and	and	CCONJ
finefocus-4294	25	7	toluene	toluene	NOUN
finefocus-4294	25	8	are	be	AUX
finefocus-4294	25	9	ubiquitous	ubiquitous	ADJ
finefocus-4294	25	10	in	in	ADP
finefocus-4294	25	11	the	the	DET
finefocus-4294	25	12	environment	environment	NOUN
finefocus-4294	25	13	and	and	CCONJ
finefocus-4294	25	14	pose	pose	VERB
finefocus-4294	25	15	significant	significant	ADJ
finefocus-4294	25	16	threats	threat	NOUN
finefocus-4294	25	17	to	to	ADP
finefocus-4294	25	18	human	human	ADJ
finefocus-4294	25	19	health	health	NOUN
finefocus-4294	25	20	,	,	PUNCT
finefocus-4294	25	21	as	as	SCONJ
finefocus-4294	25	22	these	these	DET
finefocus-4294	25	23	compounds	compound	NOUN
finefocus-4294	25	24	are	be	AUX
finefocus-4294	25	25	often	often	ADV
finefocus-4294	25	26	figure	figure	VERB
finefocus-4294	25	27	1	1	NUM
finefocus-4294	25	28	metabolic	metabolic	NOUN
finefocus-4294	25	29	pathway	pathway	NOUN
finefocus-4294	25	30	by	by	ADP
finefocus-4294	25	31	which	which	PRON
finefocus-4294	25	32	soil	soil	NOUN
finefocus-4294	25	33	organisms	organism	NOUN
finefocus-4294	25	34	break	break	VERB
finefocus-4294	25	35	down	down	ADP
finefocus-4294	25	36	aromatic	aromatic	ADJ
finefocus-4294	25	37	pollutants	pollutant	NOUN
finefocus-4294	25	38	in	in	ADP
finefocus-4294	25	39	their	their	PRON
finefocus-4294	25	40	environment	environment	NOUN
finefocus-4294	25	41	(	(	PUNCT
finefocus-4294	25	42	12	12	NUM
finefocus-4294	25	43	,	,	PUNCT
finefocus-4294	25	44	42	42	NUM
finefocus-4294	25	45	)	)	PUNCT
finefocus-4294	25	46	.	.	PUNCT
finefocus-4294	26	1	note	note	VERB
finefocus-4294	26	2	.	.	PUNCT
finefocus-4294	27	1	the	the	DET
finefocus-4294	27	2	role	role	NOUN
finefocus-4294	27	3	of	of	ADP
finefocus-4294	27	4	rieske	rieske	ADJ
finefocus-4294	27	5	dioxygenases	dioxygenase	NOUN
finefocus-4294	27	6	in	in	ADP
finefocus-4294	27	7	this	this	DET
finefocus-4294	27	8	metabolic	metabolic	NOUN
finefocus-4294	27	9	pathway	pathway	NOUN
finefocus-4294	27	10	is	be	AUX
finefocus-4294	27	11	highlighted	highlight	VERB
finefocus-4294	27	12	(	(	PUNCT
finefocus-4294	27	13	red	red	ADJ
finefocus-4294	27	14	)	)	PUNCT
finefocus-4294	27	15	.	.	PUNCT
finefocus-4294	28	1	fine	fine	ADJ
finefocus-4294	28	2	focus	focus	NOUN
finefocus-4294	28	3	|	|	ADV
finefocus-4294	28	4	volume	volume	VERB
finefocus-4294	28	5	1092	1092	NUM
finefocus-4294	28	6	carcinogenic	carcinogenic	ADJ
finefocus-4294	28	7	and	and	CCONJ
finefocus-4294	28	8	endocrine	endocrine	ADJ
finefocus-4294	28	9	disruptors	disruptor	NOUN
finefocus-4294	28	10	(	(	PUNCT
finefocus-4294	28	11	4	4	NUM
finefocus-4294	28	12	)	)	PUNCT
finefocus-4294	28	13	.	.	PUNCT
finefocus-4294	29	1	these	these	DET
finefocus-4294	29	2	aromatic	aromatic	ADJ
finefocus-4294	29	3	pollutants	pollutant	NOUN
finefocus-4294	29	4	are	be	AUX
finefocus-4294	29	5	frequently	frequently	ADV
finefocus-4294	29	6	introduced	introduce	VERB
finefocus-4294	29	7	into	into	ADP
finefocus-4294	29	8	the	the	DET
finefocus-4294	29	9	environment	environment	NOUN
finefocus-4294	29	10	through	through	ADP
finefocus-4294	29	11	fossil	fossil	NOUN
finefocus-4294	29	12	fuel	fuel	NOUN
finefocus-4294	29	13	combustion	combustion	NOUN
finefocus-4294	29	14	,	,	PUNCT
finefocus-4294	29	15	oil	oil	NOUN
finefocus-4294	29	16	spills	spill	NOUN
finefocus-4294	29	17	,	,	PUNCT
finefocus-4294	29	18	and	and	CCONJ
finefocus-4294	29	19	the	the	DET
finefocus-4294	29	20	misuse	misuse	NOUN
finefocus-4294	29	21	of	of	ADP
finefocus-4294	29	22	petroleum	petroleum	NOUN
finefocus-4294	29	23	products	product	NOUN
finefocus-4294	29	24	and	and	CCONJ
finefocus-4294	29	25	solvents	solvent	NOUN
finefocus-4294	29	26	,	,	PUNCT
finefocus-4294	29	27	creating	create	VERB
finefocus-4294	29	28	a	a	DET
finefocus-4294	29	29	need	need	NOUN
finefocus-4294	29	30	for	for	ADP
finefocus-4294	29	31	a	a	DET
finefocus-4294	29	32	means	means	NOUN
finefocus-4294	29	33	to	to	PART
finefocus-4294	29	34	remove	remove	VERB
finefocus-4294	29	35	these	these	DET
finefocus-4294	29	36	toxic	toxic	ADJ
finefocus-4294	29	37	compounds	compound	NOUN
finefocus-4294	29	38	from	from	ADP
finefocus-4294	29	39	the	the	DET
finefocus-4294	29	40	environment	environment	NOUN
finefocus-4294	29	41	(	(	PUNCT
finefocus-4294	29	42	4	4	NUM
finefocus-4294	29	43	)	)	PUNCT
finefocus-4294	29	44	.	.	PUNCT
finefocus-4294	30	1	to	to	ADP
finefocus-4294	30	2	this	this	DET
finefocus-4294	30	3	end	end	NOUN
finefocus-4294	30	4	,	,	PUNCT
finefocus-4294	30	5	rieske	rieske	ADJ
finefocus-4294	30	6	dioxygenases	dioxygenase	NOUN
finefocus-4294	30	7	have	have	AUX
finefocus-4294	30	8	been	be	AUX
finefocus-4294	30	9	employed	employ	VERB
finefocus-4294	30	10	as	as	ADP
finefocus-4294	30	11	bioremediation	bioremediation	NOUN
finefocus-4294	30	12	catalysts	catalyst	NOUN
finefocus-4294	30	13	,	,	PUNCT
finefocus-4294	30	14	including	include	VERB
finefocus-4294	30	15	applications	application	NOUN
finefocus-4294	30	16	in	in	ADP
finefocus-4294	30	17	the	the	DET
finefocus-4294	30	18	degradation	degradation	NOUN
finefocus-4294	30	19	of	of	ADP
finefocus-4294	30	20	polychlorinated	polychlorinate	VERB
finefocus-4294	30	21	biphenyls	biphenyls	NOUN
finefocus-4294	30	22	(	(	PUNCT
finefocus-4294	30	23	pcbs	pcbs	PROPN
finefocus-4294	30	24	)	)	PUNCT
finefocus-4294	30	25	,	,	PUNCT
finefocus-4294	30	26	which	which	PRON
finefocus-4294	30	27	remain	remain	VERB
finefocus-4294	30	28	a	a	DET
finefocus-4294	30	29	hazardous	hazardous	ADJ
finefocus-4294	30	30	presence	presence	NOUN
finefocus-4294	30	31	in	in	ADP
finefocus-4294	30	32	many	many	ADJ
finefocus-4294	30	33	environments	environment	NOUN
finefocus-4294	30	34	(	(	PUNCT
finefocus-4294	30	35	14	14	NUM
finefocus-4294	30	36	,	,	PUNCT
finefocus-4294	30	37	21	21	NUM
finefocus-4294	30	38	)	)	PUNCT
finefocus-4294	30	39	.	.	PUNCT
finefocus-4294	31	1	despite	despite	SCONJ
finefocus-4294	31	2	their	their	PRON
finefocus-4294	31	3	applications	application	NOUN
finefocus-4294	31	4	in	in	ADP
finefocus-4294	31	5	chemical	chemical	ADJ
finefocus-4294	31	6	synthesis	synthesis	NOUN
finefocus-4294	31	7	and	and	CCONJ
finefocus-4294	31	8	in	in	ADP
finefocus-4294	31	9	bioremediation	bioremediation	NOUN
finefocus-4294	31	10	,	,	PUNCT
finefocus-4294	31	11	the	the	DET
finefocus-4294	31	12	utility	utility	NOUN
finefocus-4294	31	13	of	of	ADP
finefocus-4294	31	14	rieske	rieske	ADJ
finefocus-4294	31	15	dioxygenases	dioxygenase	NOUN
finefocus-4294	31	16	in	in	ADP
finefocus-4294	31	17	these	these	DET
finefocus-4294	31	18	contexts	contexts	NOUN
finefocus-4294	31	19	has	have	AUX
finefocus-4294	31	20	remained	remain	VERB
finefocus-4294	31	21	limited	limit	VERB
finefocus-4294	31	22	by	by	ADP
finefocus-4294	31	23	their	their	PRON
finefocus-4294	31	24	strict	strict	ADJ
finefocus-4294	31	25	selectivity	selectivity	NOUN
finefocus-4294	31	26	and	and	CCONJ
finefocus-4294	31	27	by	by	ADP
finefocus-4294	31	28	their	their	PRON
finefocus-4294	31	29	finite	finite	ADJ
finefocus-4294	31	30	substrate	substrate	NOUN
finefocus-4294	31	31	scopes	scope	NOUN
finefocus-4294	31	32	.	.	PUNCT
finefocus-4294	32	1	as	as	ADV
finefocus-4294	32	2	many	many	ADJ
finefocus-4294	32	3	rieske	rieske	ADJ
finefocus-4294	32	4	dioxygenases	dioxygenase	NOUN
finefocus-4294	32	5	have	have	AUX
finefocus-4294	32	6	evolved	evolve	VERB
finefocus-4294	32	7	to	to	PART
finefocus-4294	32	8	metabolize	metabolize	VERB
finefocus-4294	32	9	non	non	ADJ
finefocus-4294	32	10	-	-	ADJ
finefocus-4294	32	11	polar	polar	ADJ
finefocus-4294	32	12	aromatics	aromatic	NOUN
finefocus-4294	32	13	,	,	PUNCT
finefocus-4294	32	14	their	their	PRON
finefocus-4294	32	15	active	active	ADJ
finefocus-4294	32	16	sites	site	NOUN
finefocus-4294	32	17	are	be	AUX
finefocus-4294	32	18	organized	organize	VERB
finefocus-4294	32	19	to	to	PART
finefocus-4294	32	20	effectively	effectively	ADV
finefocus-4294	32	21	bind	bind	VERB
finefocus-4294	32	22	non	non	ADJ
finefocus-4294	32	23	-	-	ADJ
finefocus-4294	32	24	polar	polar	ADJ
finefocus-4294	32	25	substrates	substrate	NOUN
finefocus-4294	32	26	and	and	CCONJ
finefocus-4294	32	27	orient	orient	VERB
finefocus-4294	32	28	them	they	PRON
finefocus-4294	32	29	for	for	ADP
finefocus-4294	32	30	2,3	2,3	NUM
finefocus-4294	32	31	-	-	NOUN
finefocus-4294	32	32	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	32	33	(	(	PUNCT
finefocus-4294	32	34	9	9	NUM
finefocus-4294	32	35	,	,	PUNCT
finefocus-4294	32	36	18	18	NUM
finefocus-4294	32	37	,	,	PUNCT
finefocus-4294	32	38	28	28	NUM
finefocus-4294	32	39	)	)	PUNCT
finefocus-4294	32	40	.	.	PUNCT
finefocus-4294	33	1	this	this	DET
finefocus-4294	33	2	results	result	VERB
finefocus-4294	33	3	in	in	ADP
finefocus-4294	33	4	the	the	DET
finefocus-4294	33	5	substrate	substrate	NOUN
finefocus-4294	33	6	scopes	scope	NOUN
finefocus-4294	33	7	and	and	CCONJ
finefocus-4294	33	8	the	the	DET
finefocus-4294	33	9	activities	activity	NOUN
finefocus-4294	33	10	of	of	ADP
finefocus-4294	33	11	these	these	DET
finefocus-4294	33	12	enzymes	enzyme	NOUN
finefocus-4294	33	13	being	be	AUX
finefocus-4294	33	14	restricted	restrict	VERB
finefocus-4294	33	15	by	by	ADP
finefocus-4294	33	16	the	the	DET
finefocus-4294	33	17	size	size	NOUN
finefocus-4294	33	18	and	and	CCONJ
finefocus-4294	33	19	by	by	ADP
finefocus-4294	33	20	the	the	DET
finefocus-4294	33	21	electronics	electronic	NOUN
finefocus-4294	33	22	of	of	ADP
finefocus-4294	33	23	any	any	DET
finefocus-4294	33	24	potential	potential	ADJ
finefocus-4294	33	25	substrates	substrate	NOUN
finefocus-4294	33	26	(	(	PUNCT
finefocus-4294	33	27	10	10	NUM
finefocus-4294	33	28	,	,	PUNCT
finefocus-4294	33	29	35	35	NUM
finefocus-4294	33	30	)	)	PUNCT
finefocus-4294	33	31	.	.	PUNCT
finefocus-4294	34	1	to	to	PART
finefocus-4294	34	2	alleviate	alleviate	VERB
finefocus-4294	34	3	these	these	DET
finefocus-4294	34	4	restrictions	restriction	NOUN
finefocus-4294	34	5	on	on	ADP
finefocus-4294	34	6	the	the	DET
finefocus-4294	34	7	utility	utility	NOUN
finefocus-4294	34	8	of	of	ADP
finefocus-4294	34	9	rieske	rieske	ADJ
finefocus-4294	34	10	dioxygenases	dioxygenase	NOUN
finefocus-4294	34	11	,	,	PUNCT
finefocus-4294	34	12	multiple	multiple	ADJ
finefocus-4294	34	13	research	research	NOUN
finefocus-4294	34	14	groups	group	NOUN
finefocus-4294	34	15	have	have	AUX
finefocus-4294	34	16	applied	apply	VERB
finefocus-4294	34	17	the	the	DET
finefocus-4294	34	18	tools	tool	NOUN
finefocus-4294	34	19	of	of	ADP
finefocus-4294	34	20	enzyme	enzyme	NOUN
finefocus-4294	34	21	engineering	engineering	NOUN
finefocus-4294	34	22	to	to	PART
finefocus-4294	34	23	improve	improve	VERB
finefocus-4294	34	24	their	their	PRON
finefocus-4294	34	25	reactivity	reactivity	NOUN
finefocus-4294	34	26	or	or	CCONJ
finefocus-4294	34	27	to	to	PART
finefocus-4294	34	28	expand	expand	VERB
finefocus-4294	34	29	their	their	PRON
finefocus-4294	34	30	substrate	substrate	NOUN
finefocus-4294	34	31	scopes	scope	NOUN
finefocus-4294	34	32	(	(	PUNCT
finefocus-4294	34	33	5	5	NUM
finefocus-4294	34	34	,	,	PUNCT
finefocus-4294	34	35	3	3	NUM
finefocus-4294	34	36	,	,	PUNCT
finefocus-4294	34	37	11	11	NUM
finefocus-4294	34	38	,	,	PUNCT
finefocus-4294	34	39	20	20	NUM
finefocus-4294	34	40	,	,	PUNCT
finefocus-4294	34	41	26	26	NUM
finefocus-4294	34	42	,	,	PUNCT
finefocus-4294	34	43	33	33	NUM
finefocus-4294	34	44	,	,	PUNCT
finefocus-4294	34	45	37	37	NUM
finefocus-4294	34	46	,	,	PUNCT
finefocus-4294	34	47	38	38	NUM
finefocus-4294	34	48	)	)	PUNCT
finefocus-4294	34	49	.	.	PUNCT
finefocus-4294	35	1	this	this	PRON
finefocus-4294	35	2	has	have	AUX
finefocus-4294	35	3	included	include	VERB
finefocus-4294	35	4	studies	study	NOUN
finefocus-4294	35	5	that	that	PRON
finefocus-4294	35	6	have	have	AUX
finefocus-4294	35	7	engineered	engineer	VERB
finefocus-4294	35	8	rieske	rieske	ADJ
finefocus-4294	35	9	dioxygenases	dioxygenase	NOUN
finefocus-4294	35	10	specifically	specifically	ADV
finefocus-4294	35	11	to	to	PART
finefocus-4294	35	12	improve	improve	VERB
finefocus-4294	35	13	their	their	PRON
finefocus-4294	35	14	utility	utility	NOUN
finefocus-4294	35	15	in	in	ADP
finefocus-4294	35	16	the	the	DET
finefocus-4294	35	17	bioremediation	bioremediation	NOUN
finefocus-4294	35	18	of	of	ADP
finefocus-4294	35	19	aromatic	aromatic	ADJ
finefocus-4294	35	20	pollutants	pollutant	NOUN
finefocus-4294	35	21	in	in	ADP
finefocus-4294	35	22	the	the	DET
finefocus-4294	35	23	soil	soil	NOUN
finefocus-4294	35	24	(	(	PUNCT
finefocus-4294	35	25	1	1	NUM
finefocus-4294	35	26	,	,	PUNCT
finefocus-4294	35	27	21	21	NUM
finefocus-4294	35	28	)	)	PUNCT
finefocus-4294	35	29	.	.	PUNCT
finefocus-4294	36	1	our	our	PRON
finefocus-4294	36	2	lab	lab	NOUN
finefocus-4294	36	3	has	have	AUX
finefocus-4294	36	4	recently	recently	ADV
finefocus-4294	36	5	reported	report	VERB
finefocus-4294	36	6	the	the	DET
finefocus-4294	36	7	development	development	NOUN
finefocus-4294	36	8	of	of	ADP
finefocus-4294	36	9	improved	improve	VERB
finefocus-4294	36	10	rieske	rieske	ADJ
finefocus-4294	36	11	dioxygenase	dioxygenase	NOUN
finefocus-4294	36	12	variants	variant	NOUN
finefocus-4294	36	13	through	through	ADP
finefocus-4294	36	14	the	the	DET
finefocus-4294	36	15	application	application	NOUN
finefocus-4294	36	16	of	of	ADP
finefocus-4294	36	17	rational	rational	ADJ
finefocus-4294	36	18	enzyme	enzyme	NOUN
finefocus-4294	36	19	engineering	engineering	NOUN
finefocus-4294	36	20	(	(	PUNCT
finefocus-4294	36	21	27	27	NUM
finefocus-4294	36	22	)	)	PUNCT
finefocus-4294	36	23	.	.	PUNCT
finefocus-4294	37	1	these	these	DET
finefocus-4294	37	2	studies	study	NOUN
finefocus-4294	37	3	have	have	AUX
finefocus-4294	37	4	led	lead	VERB
finefocus-4294	37	5	to	to	ADP
finefocus-4294	37	6	the	the	DET
finefocus-4294	37	7	development	development	NOUN
finefocus-4294	37	8	of	of	ADP
finefocus-4294	37	9	rieske	rieske	ADJ
finefocus-4294	37	10	dioxygenases	dioxygenase	NOUN
finefocus-4294	37	11	with	with	ADP
finefocus-4294	37	12	improved	improved	ADJ
finefocus-4294	37	13	reactivity	reactivity	NOUN
finefocus-4294	37	14	or	or	CCONJ
finefocus-4294	37	15	expanded	expand	VERB
finefocus-4294	37	16	substrate	substrate	NOUN
finefocus-4294	37	17	scopes	scope	NOUN
finefocus-4294	37	18	,	,	PUNCT
finefocus-4294	37	19	increasing	increase	VERB
finefocus-4294	37	20	the	the	DET
finefocus-4294	37	21	practical	practical	ADJ
finefocus-4294	37	22	utility	utility	NOUN
finefocus-4294	37	23	of	of	ADP
finefocus-4294	37	24	these	these	DET
finefocus-4294	37	25	green	green	ADJ
finefocus-4294	37	26	chemical	chemical	NOUN
finefocus-4294	37	27	tools	tool	NOUN
finefocus-4294	37	28	(	(	PUNCT
finefocus-4294	37	29	1	1	NUM
finefocus-4294	37	30	,	,	PUNCT
finefocus-4294	37	31	3	3	NUM
finefocus-4294	37	32	,	,	PUNCT
finefocus-4294	37	33	5	5	NUM
finefocus-4294	37	34	,	,	PUNCT
finefocus-4294	37	35	11	11	NUM
finefocus-4294	37	36	,	,	PUNCT
finefocus-4294	37	37	20	20	NUM
finefocus-4294	37	38	,	,	PUNCT
finefocus-4294	37	39	21	21	NUM
finefocus-4294	37	40	,	,	PUNCT
finefocus-4294	37	41	26	26	NUM
finefocus-4294	37	42	,	,	PUNCT
finefocus-4294	37	43	27	27	NUM
finefocus-4294	37	44	,	,	PUNCT
finefocus-4294	37	45	33	33	NUM
finefocus-4294	37	46	,	,	PUNCT
finefocus-4294	37	47	37	37	NUM
finefocus-4294	37	48	,	,	PUNCT
finefocus-4294	37	49	38	38	NUM
finefocus-4294	37	50	)	)	PUNCT
finefocus-4294	37	51	.	.	PUNCT
finefocus-4294	38	1	when	when	SCONJ
finefocus-4294	38	2	engineering	engineering	NOUN
finefocus-4294	38	3	metalloenzymes	metalloenzyme	NOUN
finefocus-4294	38	4	,	,	PUNCT
finefocus-4294	38	5	studies	study	NOUN
finefocus-4294	38	6	have	have	AUX
finefocus-4294	38	7	traditionally	traditionally	ADV
finefocus-4294	38	8	avoided	avoid	VERB
finefocus-4294	38	9	mutations	mutation	NOUN
finefocus-4294	38	10	to	to	ADP
finefocus-4294	38	11	the	the	DET
finefocus-4294	38	12	residues	residue	NOUN
finefocus-4294	38	13	responsible	responsible	ADJ
finefocus-4294	38	14	for	for	ADP
finefocus-4294	38	15	coordinating	coordinate	VERB
finefocus-4294	38	16	metal	metal	NOUN
finefocus-4294	38	17	ions	ion	NOUN
finefocus-4294	38	18	,	,	PUNCT
finefocus-4294	38	19	based	base	VERB
finefocus-4294	38	20	upon	upon	SCONJ
finefocus-4294	38	21	the	the	DET
finefocus-4294	38	22	assumption	assumption	NOUN
finefocus-4294	38	23	that	that	SCONJ
finefocus-4294	38	24	these	these	DET
finefocus-4294	38	25	residues	residue	NOUN
finefocus-4294	38	26	are	be	AUX
finefocus-4294	38	27	essential	essential	ADJ
finefocus-4294	38	28	for	for	ADP
finefocus-4294	38	29	enzyme	enzyme	NOUN
finefocus-4294	38	30	activity	activity	NOUN
finefocus-4294	38	31	.	.	PUNCT
finefocus-4294	39	1	recently	recently	ADV
finefocus-4294	39	2	,	,	PUNCT
finefocus-4294	39	3	however	however	ADV
finefocus-4294	39	4	,	,	PUNCT
finefocus-4294	39	5	studies	study	NOUN
finefocus-4294	39	6	have	have	AUX
finefocus-4294	39	7	shown	show	VERB
finefocus-4294	39	8	this	this	DET
finefocus-4294	39	9	assumption	assumption	NOUN
finefocus-4294	39	10	to	to	PART
finefocus-4294	39	11	be	be	AUX
finefocus-4294	39	12	incorrect	incorrect	ADJ
finefocus-4294	39	13	(	(	PUNCT
finefocus-4294	39	14	29	29	NUM
finefocus-4294	39	15	,	,	PUNCT
finefocus-4294	39	16	40	40	NUM
finefocus-4294	39	17	)	)	PUNCT
finefocus-4294	39	18	.	.	PUNCT
finefocus-4294	40	1	these	these	DET
finefocus-4294	40	2	studies	study	NOUN
finefocus-4294	40	3	have	have	AUX
finefocus-4294	40	4	shown	show	VERB
finefocus-4294	40	5	that	that	SCONJ
finefocus-4294	40	6	mutations	mutation	NOUN
finefocus-4294	40	7	altering	alter	VERB
finefocus-4294	40	8	,	,	PUNCT
finefocus-4294	40	9	or	or	CCONJ
finefocus-4294	40	10	even	even	ADV
finefocus-4294	40	11	eliminating	eliminate	VERB
finefocus-4294	40	12	,	,	PUNCT
finefocus-4294	40	13	iron	iron	NOUN
finefocus-4294	40	14	coordination	coordination	NOUN
finefocus-4294	40	15	in	in	ADP
finefocus-4294	40	16	heme	heme	ADJ
finefocus-4294	40	17	proteins	protein	NOUN
finefocus-4294	40	18	can	can	AUX
finefocus-4294	40	19	alter	alter	VERB
finefocus-4294	40	20	or	or	CCONJ
finefocus-4294	40	21	improve	improve	VERB
finefocus-4294	40	22	the	the	DET
finefocus-4294	40	23	reactivity	reactivity	NOUN
finefocus-4294	40	24	of	of	ADP
finefocus-4294	40	25	these	these	DET
finefocus-4294	40	26	proteins	protein	NOUN
finefocus-4294	40	27	in	in	ADP
finefocus-4294	40	28	specific	specific	ADJ
finefocus-4294	40	29	contexts	context	NOUN
finefocus-4294	40	30	(	(	PUNCT
finefocus-4294	40	31	29	29	NUM
finefocus-4294	40	32	,	,	PUNCT
finefocus-4294	40	33	40	40	NUM
finefocus-4294	40	34	)	)	PUNCT
finefocus-4294	40	35	.	.	PUNCT
finefocus-4294	41	1	our	our	PRON
finefocus-4294	41	2	laboratory	laboratory	NOUN
finefocus-4294	41	3	was	be	AUX
finefocus-4294	41	4	inspired	inspire	VERB
finefocus-4294	41	5	by	by	ADP
finefocus-4294	41	6	these	these	DET
finefocus-4294	41	7	studies	study	NOUN
finefocus-4294	41	8	to	to	PART
finefocus-4294	41	9	investigate	investigate	VERB
finefocus-4294	41	10	whether	whether	SCONJ
finefocus-4294	41	11	a	a	DET
finefocus-4294	41	12	similar	similar	ADJ
finefocus-4294	41	13	strategy	strategy	NOUN
finefocus-4294	41	14	could	could	AUX
finefocus-4294	41	15	result	result	VERB
finefocus-4294	41	16	in	in	ADP
finefocus-4294	41	17	the	the	DET
finefocus-4294	41	18	development	development	NOUN
finefocus-4294	41	19	of	of	ADP
finefocus-4294	41	20	improved	improve	VERB
finefocus-4294	41	21	rieske	rieske	ADJ
finefocus-4294	41	22	dioxygenase	dioxygenase	NOUN
finefocus-4294	41	23	variants	variant	NOUN
finefocus-4294	41	24	.	.	PUNCT
finefocus-4294	42	1	to	to	ADP
finefocus-4294	42	2	our	our	PRON
finefocus-4294	42	3	knowledge	knowledge	NOUN
finefocus-4294	42	4	,	,	PUNCT
finefocus-4294	42	5	no	no	DET
finefocus-4294	42	6	such	such	ADJ
finefocus-4294	42	7	study	study	NOUN
finefocus-4294	42	8	has	have	AUX
finefocus-4294	42	9	been	be	AUX
finefocus-4294	42	10	reported	report	VERB
finefocus-4294	42	11	for	for	ADP
finefocus-4294	42	12	rieske	rieske	ADJ
finefocus-4294	42	13	dioxygenases	dioxygenase	NOUN
finefocus-4294	42	14	,	,	PUNCT
finefocus-4294	42	15	thus	thus	ADV
finefocus-4294	42	16	this	this	DET
finefocus-4294	42	17	investigation	investigation	NOUN
finefocus-4294	42	18	would	would	AUX
finefocus-4294	42	19	serve	serve	VERB
finefocus-4294	42	20	to	to	PART
finefocus-4294	42	21	inform	inform	VERB
finefocus-4294	42	22	future	future	ADJ
finefocus-4294	42	23	engineering	engineering	NOUN
finefocus-4294	42	24	studies	study	NOUN
finefocus-4294	42	25	performed	perform	VERB
finefocus-4294	42	26	with	with	ADP
finefocus-4294	42	27	this	this	DET
finefocus-4294	42	28	enzyme	enzyme	NOUN
finefocus-4294	42	29	class	class	NOUN
finefocus-4294	42	30	.	.	PUNCT
finefocus-4294	43	1	based	base	VERB
finefocus-4294	43	2	upon	upon	SCONJ
finefocus-4294	43	3	reported	report	VERB
finefocus-4294	43	4	results	result	NOUN
finefocus-4294	43	5	with	with	ADP
finefocus-4294	43	6	other	other	ADJ
finefocus-4294	43	7	metalloenzymes	metalloenzyme	NOUN
finefocus-4294	43	8	(	(	PUNCT
finefocus-4294	43	9	29	29	NUM
finefocus-4294	43	10	,	,	PUNCT
finefocus-4294	43	11	40	40	NUM
finefocus-4294	43	12	)	)	PUNCT
finefocus-4294	43	13	,	,	PUNCT
finefocus-4294	43	14	it	it	PRON
finefocus-4294	43	15	is	be	AUX
finefocus-4294	43	16	predicted	predict	VERB
finefocus-4294	43	17	that	that	SCONJ
finefocus-4294	43	18	mutating	mutate	VERB
finefocus-4294	43	19	the	the	DET
finefocus-4294	43	20	iron	iron	NOUN
finefocus-4294	43	21	-	-	PUNCT
finefocus-4294	43	22	coordinating	coordinate	VERB
finefocus-4294	43	23	residues	residue	NOUN
finefocus-4294	43	24	of	of	ADP
finefocus-4294	43	25	a	a	DET
finefocus-4294	43	26	rieske	rieske	ADJ
finefocus-4294	43	27	dioxygenase	dioxygenase	NOUN
finefocus-4294	43	28	enzyme	enzyme	NOUN
finefocus-4294	43	29	will	will	AUX
finefocus-4294	43	30	result	result	VERB
finefocus-4294	43	31	in	in	ADP
finefocus-4294	43	32	altered	altered	ADJ
finefocus-4294	43	33	enzyme	enzyme	NOUN
finefocus-4294	43	34	activity	activity	NOUN
finefocus-4294	43	35	and/or	and/or	CCONJ
finefocus-4294	43	36	substrate	substrate	NOUN
finefocus-4294	43	37	scope	scope	NOUN
finefocus-4294	43	38	.	.	PUNCT
finefocus-4294	44	1	this	this	DET
finefocus-4294	44	2	strategy	strategy	NOUN
finefocus-4294	44	3	has	have	VERB
finefocus-4294	44	4	the	the	DET
finefocus-4294	44	5	potential	potential	NOUN
finefocus-4294	44	6	to	to	PART
finefocus-4294	44	7	improve	improve	VERB
finefocus-4294	44	8	the	the	DET
finefocus-4294	44	9	activity	activity	NOUN
finefocus-4294	44	10	of	of	ADP
finefocus-4294	44	11	rieske	rieske	ADJ
finefocus-4294	44	12	dioxygenases	dioxygenase	NOUN
finefocus-4294	44	13	for	for	ADP
finefocus-4294	44	14	specific	specific	ADJ
finefocus-4294	44	15	substrates	substrate	NOUN
finefocus-4294	44	16	or	or	CCONJ
finefocus-4294	44	17	expand	expand	VERB
finefocus-4294	44	18	their	their	PRON
finefocus-4294	44	19	substrate	substrate	NOUN
finefocus-4294	44	20	scopes	scope	NOUN
finefocus-4294	44	21	.	.	PUNCT
finefocus-4294	45	1	materials	material	NOUN
finefocus-4294	45	2	and	and	CCONJ
finefocus-4294	45	3	methods	method	NOUN
finefocus-4294	45	4	general	general	PROPN
finefocus-4294	45	5	experimental	experimental	PROPN
finefocus-4294	45	6	e.	e.	PROPN
finefocus-4294	45	7	coli	coli	PROPN
finefocus-4294	46	1	bl21	bl21	PROPN
finefocus-4294	46	2	(	(	PUNCT
finefocus-4294	46	3	de3	de3	NOUN
finefocus-4294	46	4	)	)	PUNCT
finefocus-4294	46	5	competent	competent	ADJ
finefocus-4294	46	6	cells	cell	NOUN
finefocus-4294	46	7	were	be	AUX
finefocus-4294	46	8	obtained	obtain	VERB
finefocus-4294	46	9	from	from	ADP
finefocus-4294	46	10	thermofisher	thermofisher	PROPN
finefocus-4294	46	11	.	.	PUNCT
finefocus-4294	47	1	plasmid	plasmid	ADJ
finefocus-4294	47	2	isolation	isolation	NOUN
finefocus-4294	47	3	/	/	SYM
finefocus-4294	47	4	purification	purification	NOUN
finefocus-4294	47	5	was	be	AUX
finefocus-4294	47	6	performed	perform	VERB
finefocus-4294	47	7	using	use	VERB
finefocus-4294	47	8	new	new	ADJ
finefocus-4294	47	9	betts	betts	PROPN
finefocus-4294	47	10	&	&	CCONJ
finefocus-4294	47	11	froese	froese	PROPN
finefocus-4294	48	1	|	|	ADV
finefocus-4294	48	2	investigation	investigation	NOUN
finefocus-4294	48	3	of	of	ADP
finefocus-4294	48	4	the	the	DET
finefocus-4294	48	5	effects	effect	NOUN
finefocus-4294	48	6	of	of	ADP
finefocus-4294	48	7	mutating	mutate	VERB
finefocus-4294	48	8	iron	iron	NOUN
finefocus-4294	48	9	-	-	PUNCT
finefocus-4294	48	10	coordinating	coordinate	VERB
finefocus-4294	48	11	residues	residue	NOUN
finefocus-4294	48	12	in	in	ADP
finefocus-4294	48	13	rieske	rieske	ADJ
finefocus-4294	48	14	dioxygenases	dioxygenase	NOUN
finefocus-4294	48	15	93	93	NUM
finefocus-4294	48	16	table	table	NOUN
finefocus-4294	48	17	1	1	NUM
finefocus-4294	48	18	sequences	sequence	NOUN
finefocus-4294	48	19	of	of	ADP
finefocus-4294	48	20	mutagenic	mutagenic	ADJ
finefocus-4294	48	21	primers	primer	NOUN
finefocus-4294	48	22	used	use	VERB
finefocus-4294	48	23	.	.	PUNCT
finefocus-4294	49	1	primer	primer	NOUN
finefocus-4294	49	2	name	name	NOUN
finefocus-4294	49	3	primer	primer	NOUN
finefocus-4294	49	4	sequence	sequence	NOUN
finefocus-4294	49	5	tdo	tdo	PROPN
finefocus-4294	49	6	h222a	h222a	PROPN
finefocus-4294	50	1	fwd	fwd	PROPN
finefocus-4294	50	2	cgacatgtacgcggccgggacgacctcgcatctgtctggcatcctg	cgacatgtacgcggccgggacgacctcgcatctgtctggcatcctg	NOUN
finefocus-4294	50	3	tdo	tdo	PROPN
finefocus-4294	50	4	h222a	h222a	PROPN
finefocus-4294	50	5	rev	rev	PROPN
finefocus-4294	50	6	gtcgtcccggccgcgtacatgtcgctgcaaaactgctctgcggcg	gtcgtcccggccgcgtacatgtcgctgcaaaactgctctgcggcg	PROPN
finefocus-4294	50	7	tdo	tdo	PROPN
finefocus-4294	50	8	h222c	h222c	PROPN
finefocus-4294	50	9	fwd	fwd	VERB
finefocus-4294	50	10	cgacatgtactgcgccgggacgacctcgcatctgtctggcatcctg	cgacatgtactgcgccgggacgacctcgcatctgtctggcatcctg	NOUN
finefocus-4294	50	11	tdo	tdo	PROPN
finefocus-4294	50	12	h222c	h222c	PROPN
finefocus-4294	50	13	rev	rev	PROPN
finefocus-4294	50	14	gtcgtcccggcgcagtacatgtcgctgcaaaactgctctgcggcg	gtcgtcccggcgcagtacatgtcgctgcaaaactgctctgcggcg	PROPN
finefocus-4294	50	15	tdo	tdo	PROPN
finefocus-4294	50	16	h222d	h222d	PROPN
finefocus-4294	50	17	fwd	fwd	PROPN
finefocus-4294	50	18	cgacatgtacgatgccgggacgacctcgcatctgtctggcatcctg	cgacatgtacgatgccgggacgacctcgcatctgtctggcatcctg	NOUN
finefocus-4294	50	19	tdo	tdo	PROPN
finefocus-4294	50	20	h222d	h222d	PROPN
finefocus-4294	50	21	rev	rev	PROPN
finefocus-4294	50	22	gtcgtcccggcatcgtacatgtcgctgcaaaactgctctgcggcg	gtcgtcccggcatcgtacatgtcgctgcaaaactgctctgcggcg	PROPN
finefocus-4294	50	23	tdo	tdo	PROPN
finefocus-4294	50	24	h222e	h222e	PROPN
finefocus-4294	50	25	fwd	fwd	PROPN
finefocus-4294	50	26	cgacatgtacgaagccgggacgacctcgcatctgtctggcatcctg	cgacatgtacgaagccgggacgacctcgcatctgtctggcatcctg	PROPN
finefocus-4294	50	27	tdo	tdo	PROPN
finefocus-4294	50	28	h222e	h222e	PROPN
finefocus-4294	50	29	rev	rev	PROPN
finefocus-4294	50	30	gtcgtcccggcttcgtacatgtcgctgcaaaactgctctgcggcg	gtcgtcccggcttcgtacatgtcgctgcaaaactgctctgcggcg	PROPN
finefocus-4294	50	31	tdo	tdo	PROPN
finefocus-4294	50	32	h228a	h228a	PROPN
finefocus-4294	50	33	fwd	fwd	PROPN
finefocus-4294	50	34	gacgacctcggcgctgtctggcatcctggcaggcctgccagaagac	gacgacctcggcgctgtctggcatcctggcaggcctgccagaagac	PROPN
finefocus-4294	50	35	tdo	tdo	PROPN
finefocus-4294	50	36	h228a	h228a	PROPN
finefocus-4294	50	37	rev	rev	PROPN
finefocus-4294	50	38	gatgccagacagcgccgaggtcgtcccggcatggtacatgtcgctgc	gatgccagacagcgccgaggtcgtcccggcatggtacatgtcgctgc	PROPN
finefocus-4294	50	39	tdo	tdo	PROPN
finefocus-4294	50	40	h228c	h228c	PROPN
finefocus-4294	50	41	fwd	fwd	PROPN
finefocus-4294	50	42	gacgacctcgtgcctgtctggcatcctggcaggcctgccagaagac	gacgacctcgtgcctgtctggcatcctggcaggcctgccagaagac	PROPN
finefocus-4294	50	43	tdo	tdo	PROPN
finefocus-4294	50	44	h228c	h228c	PROPN
finefocus-4294	50	45	rev	rev	PROPN
finefocus-4294	50	46	gatgccagacaggcacgaggtcgtcccggcatggtacatgtcgctgc	gatgccagacaggcacgaggtcgtcccggcatggtacatgtcgctgc	VERB
finefocus-4294	50	47	tdo	tdo	PROPN
finefocus-4294	50	48	h228d	h228d	X
finefocus-4294	50	49	fwd	fwd	PROPN
finefocus-4294	50	50	gacgacctcggatctgtctggcatcctggcaggcctgccagaagac	gacgacctcggatctgtctggcatcctggcaggcctgccagaagac	PROPN
finefocus-4294	50	51	tdo	tdo	PROPN
finefocus-4294	50	52	h228d	h228d	PROPN
finefocus-4294	50	53	rev	rev	VERB
finefocus-4294	50	54	gatgccagacagatccgaggtcgtcccggcatggtacatgtcgctgc	gatgccagacagatccgaggtcgtcccggcatggtacatgtcgctgc	PROPN
finefocus-4294	50	55	tdo	tdo	PROPN
finefocus-4294	50	56	h228e	h228e	PROPN
finefocus-4294	50	57	fwd	fwd	PROPN
finefocus-4294	50	58	gacgacctcggaactgtctggcatcctggcaggcctgccagaagac	gacgacctcggaactgtctggcatcctggcaggcctgccagaagac	PROPN
finefocus-4294	50	59	tdo	tdo	PROPN
finefocus-4294	50	60	h228e	h228e	PROPN
finefocus-4294	50	61	rev	rev	PROPN
finefocus-4294	50	62	gatgccagacagttccgaggtcgtcccggcatggtacatgtcgctgc	gatgccagacagttccgaggtcgtcccggcatggtacatgtcgctgc	PROPN
finefocus-4294	50	63	tdo	tdo	PROPN
finefocus-4294	50	64	d376a	d376a	PROPN
finefocus-4294	50	65	fwd	fwd	ADJ
finefocus-4294	50	66	cgagcaggacgcgggggagaactgggtcgagatccagcacatcctg	cgagcaggacgcgggggagaactgggtcgagatccagcacatcctg	NOUN
finefocus-4294	50	67	tdo	tdo	PROPN
finefocus-4294	50	68	d376a	d376a	PROPN
finefocus-4294	50	69	rev	rev	PROPN
finefocus-4294	50	70	cagttctcccccgcgtcctgctcgaacacgccaccggcagagaagg	cagttctcccccgcgtcctgctcgaacacgccaccggcagagaagg	PROPN
finefocus-4294	50	71	tdo	tdo	PROPN
finefocus-4294	50	72	d376c	d376c	PROPN
finefocus-4294	50	73	fwd	fwd	VERB
finefocus-4294	50	74	cgagcaggactgcggggagaactgggtcgagatccagcacatcctg	cgagcaggactgcggggagaactgggtcgagatccagcacatcctg	PROPN
finefocus-4294	50	75	tdo	tdo	PROPN
finefocus-4294	50	76	d376c	d376c	PROPN
finefocus-4294	50	77	rev	rev	VERB
finefocus-4294	50	78	cagttctccccgcagtcctgctcgaacacgccaccggcagagaagg	cagttctccccgcagtcctgctcgaacacgccaccggcagagaagg	PROPN
finefocus-4294	50	79	tdo	tdo	PROPN
finefocus-4294	50	80	d376e	d376e	PROPN
finefocus-4294	50	81	fwd	fwd	VERB
finefocus-4294	50	82	cgagcaggacgaaggggagaactgggtcgagatccagcacatcctg	cgagcaggacgaaggggagaactgggtcgagatccagcacatcctg	VERB
finefocus-4294	50	83	tdo	tdo	PROPN
finefocus-4294	50	84	d376e	d376e	PROPN
finefocus-4294	50	85	rev	rev	VERB
finefocus-4294	50	86	cagttctccccttcgtcctgctcgaacacgccaccggcagagaagg	cagttctccccttcgtcctgctcgaacacgccaccggcagagaagg	PROPN
finefocus-4294	50	87	tdo	tdo	PROPN
finefocus-4294	50	88	d376h	d376h	PROPN
finefocus-4294	50	89	fwd	fwd	PROPN
finefocus-4294	50	90	cgagcaggaccatggggagaactgggtcgagatccagcacatcctg	cgagcaggaccatggggagaactgggtcgagatccagcacatcctg	NOUN
finefocus-4294	50	91	tdo	tdo	PROPN
finefocus-4294	50	92	d376h	d376h	PROPN
finefocus-4294	50	93	rev	rev	PROPN
finefocus-4294	50	94	cagttctccccatggtcctgctcgaacacgccaccggcagagaagg	cagttctccccatggtcctgctcgaacacgccaccggcagagaagg	PROPN
finefocus-4294	50	95	fine	fine	ADJ
finefocus-4294	50	96	focus	focus	NOUN
finefocus-4294	50	97	|	|	ADV
finefocus-4294	50	98	volume	volume	NOUN
finefocus-4294	50	99	1094	1094	NUM
finefocus-4294	50	100	england	england	PROPN
finefocus-4294	50	101	biolabs	biolabs	PROPN
finefocus-4294	50	102	monarch	monarch	PROPN
finefocus-4294	50	103	®	®	PROPN
finefocus-4294	50	104	miniprep	miniprep	PROPN
finefocus-4294	50	105	kit	kit	PROPN
finefocus-4294	50	106	.	.	PUNCT
finefocus-4294	51	1	transformations	transformation	NOUN
finefocus-4294	51	2	of	of	ADP
finefocus-4294	51	3	electrocompetent	electrocompetent	ADJ
finefocus-4294	51	4	cells	cell	NOUN
finefocus-4294	51	5	were	be	AUX
finefocus-4294	51	6	performed	perform	VERB
finefocus-4294	51	7	on	on	ADP
finefocus-4294	51	8	an	an	DET
finefocus-4294	51	9	eppendorf	eppendorf	PROPN
finefocus-4294	51	10	eporator	eporator	PROPN
finefocus-4294	51	11	®	®	PROPN
finefocus-4294	51	12	.	.	PUNCT
finefocus-4294	52	1	whole	whole	ADJ
finefocus-4294	52	2	-	-	PUNCT
finefocus-4294	52	3	cell	cell	NOUN
finefocus-4294	52	4	assay	assay	NOUN
finefocus-4294	52	5	cultures	culture	NOUN
finefocus-4294	52	6	were	be	AUX
finefocus-4294	52	7	grown	grow	VERB
finefocus-4294	52	8	in	in	ADP
finefocus-4294	52	9	greiner	greiner	PROPN
finefocus-4294	52	10	bio	bio	PROPN
finefocus-4294	52	11	-	-	ADJ
finefocus-4294	52	12	one	one	NUM
finefocus-4294	52	13	polystyrene	polystyrene	NOUN
finefocus-4294	52	14	clear	clear	ADJ
finefocus-4294	52	15	,	,	PUNCT
finefocus-4294	52	16	round	round	ADJ
finefocus-4294	52	17	-	-	PUNCT
finefocus-4294	52	18	bottom	bottom	NOUN
finefocus-4294	52	19	96	96	NUM
finefocus-4294	52	20	-	-	PUNCT
finefocus-4294	52	21	well	well	NOUN
finefocus-4294	52	22	plates	plate	NOUN
finefocus-4294	52	23	.	.	PUNCT
finefocus-4294	53	1	all	all	DET
finefocus-4294	53	2	cultures	culture	NOUN
finefocus-4294	53	3	were	be	AUX
finefocus-4294	53	4	incubated	incubate	VERB
finefocus-4294	53	5	in	in	ADP
finefocus-4294	53	6	a	a	DET
finefocus-4294	53	7	barnstead	barnstead	NOUN
finefocus-4294	53	8	maxq	maxq	NOUN
finefocus-4294	53	9	4000	4000	NUM
finefocus-4294	53	10	digital	digital	ADJ
finefocus-4294	53	11	orbital	orbital	ADJ
finefocus-4294	53	12	incubator	incubator	NOUN
finefocus-4294	53	13	shaker	shaker	NOUN
finefocus-4294	53	14	equipped	equip	VERB
finefocus-4294	53	15	with	with	ADP
finefocus-4294	53	16	an	an	DET
finefocus-4294	53	17	enzyscreen	enzyscreen	ADJ
finefocus-4294	53	18	universal	universal	ADJ
finefocus-4294	53	19	clamp	clamp	NOUN
finefocus-4294	53	20	system	system	NOUN
finefocus-4294	53	21	unless	unless	SCONJ
finefocus-4294	53	22	otherwise	otherwise	ADV
finefocus-4294	53	23	stated	state	VERB
finefocus-4294	53	24	.	.	PUNCT
finefocus-4294	54	1	fluorescence	fluorescence	NOUN
finefocus-4294	54	2	analyses	analysis	NOUN
finefocus-4294	54	3	were	be	AUX
finefocus-4294	54	4	performed	perform	VERB
finefocus-4294	54	5	using	use	VERB
finefocus-4294	54	6	a	a	DET
finefocus-4294	54	7	biotek	biotek	NOUN
finefocus-4294	54	8	®	®	NOUN
finefocus-4294	54	9	synergy	synergy	NOUN
finefocus-4294	54	10	™	™	VERB
finefocus-4294	54	11	h1	h1	NOUN
finefocus-4294	54	12	monochromator	monochromator	NOUN
finefocus-4294	54	13	-	-	PUNCT
finefocus-4294	54	14	based	base	VERB
finefocus-4294	54	15	multi	multi	ADJ
finefocus-4294	54	16	-	-	ADJ
finefocus-4294	54	17	mode	mode	ADJ
finefocus-4294	54	18	plate	plate	NOUN
finefocus-4294	54	19	reader	reader	NOUN
finefocus-4294	54	20	,	,	PUNCT
finefocus-4294	54	21	using	use	VERB
finefocus-4294	54	22	corning	corning	NOUN
finefocus-4294	54	23	®	®	NOUN
finefocus-4294	54	24	polystyrene	polystyrene	NOUN
finefocus-4294	54	25	black	black	ADJ
finefocus-4294	54	26	,	,	PUNCT
finefocus-4294	54	27	opaque	opaque	ADJ
finefocus-4294	54	28	,	,	PUNCT
finefocus-4294	54	29	flat	flat	ADJ
finefocus-4294	54	30	-	-	PUNCT
finefocus-4294	54	31	bottom	bottom	NOUN
finefocus-4294	54	32	96	96	NUM
finefocus-4294	54	33	-	-	PUNCT
finefocus-4294	54	34	well	well	NOUN
finefocus-4294	54	35	plates	plate	NOUN
finefocus-4294	54	36	.	.	PUNCT
finefocus-4294	55	1	all	all	DET
finefocus-4294	55	2	reagents	reagent	NOUN
finefocus-4294	55	3	were	be	AUX
finefocus-4294	55	4	obtained	obtain	VERB
finefocus-4294	55	5	from	from	ADP
finefocus-4294	55	6	milliporesigma	milliporesigma	NOUN
finefocus-4294	55	7	unless	unless	SCONJ
finefocus-4294	55	8	otherwise	otherwise	ADV
finefocus-4294	55	9	stated	state	VERB
finefocus-4294	55	10	.	.	PUNCT
finefocus-4294	56	1	media	medium	NOUN
finefocus-4294	56	2	were	be	AUX
finefocus-4294	56	3	made	make	VERB
finefocus-4294	56	4	at	at	ADP
finefocus-4294	56	5	ph	ph	PROPN
finefocus-4294	56	6	7.2	7.2	NUM
finefocus-4294	56	7	and	and	CCONJ
finefocus-4294	56	8	streptomycin	streptomycin	PROPN
finefocus-4294	56	9	was	be	AUX
finefocus-4294	56	10	added	add	VERB
finefocus-4294	56	11	at	at	ADP
finefocus-4294	56	12	50	50	NUM
finefocus-4294	56	13	μg	μg	PROPN
finefocus-4294	56	14	ml−1	ml−1	PROPN
finefocus-4294	56	15	.	.	PUNCT
finefocus-4294	57	1	all	all	DET
finefocus-4294	57	2	e.	e.	PROPN
finefocus-4294	57	3	coli	coli	NOUN
finefocus-4294	57	4	cultures	culture	NOUN
finefocus-4294	57	5	were	be	AUX
finefocus-4294	57	6	maintained	maintain	VERB
finefocus-4294	57	7	at	at	ADP
finefocus-4294	57	8	37	37	NUM
finefocus-4294	57	9	°	°	NOUN
finefocus-4294	57	10	c	c	NOUN
finefocus-4294	57	11	unless	unless	SCONJ
finefocus-4294	57	12	otherwise	otherwise	ADV
finefocus-4294	57	13	stated	state	VERB
finefocus-4294	57	14	.	.	PUNCT
finefocus-4294	58	1	targeted	target	VERB
finefocus-4294	58	2	mutagenesis	mutagenesis	NOUN
finefocus-4294	58	3	protocol	protocol	VERB
finefocus-4294	58	4	the	the	DET
finefocus-4294	58	5	pcp-02	pcp-02	ADJ
finefocus-4294	58	6	expression	expression	NOUN
finefocus-4294	58	7	system	system	NOUN
finefocus-4294	58	8	was	be	AUX
finefocus-4294	58	9	used	use	VERB
finefocus-4294	58	10	as	as	ADP
finefocus-4294	58	11	the	the	DET
finefocus-4294	58	12	template	template	NOUN
finefocus-4294	58	13	for	for	ADP
finefocus-4294	58	14	toluene	toluene	NOUN
finefocus-4294	58	15	dioxygenase	dioxygenase	NOUN
finefocus-4294	58	16	mutant	mutant	NOUN
finefocus-4294	58	17	generation	generation	NOUN
finefocus-4294	58	18	(	(	PUNCT
finefocus-4294	58	19	30	30	NUM
finefocus-4294	58	20	)	)	PUNCT
finefocus-4294	58	21	.	.	PUNCT
finefocus-4294	59	1	saturation	saturation	NOUN
finefocus-4294	59	2	mutagenesis	mutagenesis	NOUN
finefocus-4294	59	3	was	be	AUX
finefocus-4294	59	4	performed	perform	VERB
finefocus-4294	59	5	following	follow	VERB
finefocus-4294	59	6	the	the	DET
finefocus-4294	59	7	polymerase	polymerase	NOUN
finefocus-4294	59	8	chain	chain	NOUN
finefocus-4294	59	9	reaction	reaction	NOUN
finefocus-4294	59	10	(	(	PUNCT
finefocus-4294	59	11	pcr)-based	pcr)-base	VERB
finefocus-4294	59	12	procedure	procedure	NOUN
finefocus-4294	59	13	of	of	ADP
finefocus-4294	59	14	liu	liu	PROPN
finefocus-4294	59	15	and	and	CCONJ
finefocus-4294	59	16	naismith	naismith	PROPN
finefocus-4294	59	17	(	(	PUNCT
finefocus-4294	59	18	24	24	NUM
finefocus-4294	59	19	,	,	PUNCT
finefocus-4294	59	20	41	41	NUM
finefocus-4294	59	21	)	)	PUNCT
finefocus-4294	59	22	.	.	PUNCT
finefocus-4294	60	1	amplification	amplification	NOUN
finefocus-4294	60	2	was	be	AUX
finefocus-4294	60	3	performed	perform	VERB
finefocus-4294	60	4	using	use	VERB
finefocus-4294	60	5	an	an	DET
finefocus-4294	60	6	abi	abi	PROPN
finefocus-4294	60	7	geneamp	geneamp	PROPN
finefocus-4294	60	8	®	®	PROPN
finefocus-4294	60	9	9700	9700	NUM
finefocus-4294	60	10	thermal	thermal	ADJ
finefocus-4294	60	11	cycler	cycler	PROPN
finefocus-4294	60	12	and	and	CCONJ
finefocus-4294	60	13	q5	q5	PROPN
finefocus-4294	60	14	®	®	NOUN
finefocus-4294	60	15	dna	dna	NOUN
finefocus-4294	60	16	polymerase	polymerase	NOUN
finefocus-4294	60	17	(	(	PUNCT
finefocus-4294	60	18	new	new	PROPN
finefocus-4294	60	19	england	england	PROPN
finefocus-4294	60	20	biolabs	biolabs	PROPN
finefocus-4294	60	21	)	)	PUNCT
finefocus-4294	60	22	.	.	PUNCT
finefocus-4294	61	1	mutagenic	mutagenic	ADJ
finefocus-4294	61	2	primers	primer	NOUN
finefocus-4294	61	3	were	be	AUX
finefocus-4294	61	4	designed	design	VERB
finefocus-4294	61	5	according	accord	VERB
finefocus-4294	61	6	to	to	ADP
finefocus-4294	61	7	the	the	DET
finefocus-4294	61	8	procedure	procedure	NOUN
finefocus-4294	61	9	of	of	ADP
finefocus-4294	61	10	liu	liu	PROPN
finefocus-4294	61	11	and	and	CCONJ
finefocus-4294	61	12	naismith	naismith	PROPN
finefocus-4294	61	13	(	(	PUNCT
finefocus-4294	61	14	24	24	NUM
finefocus-4294	61	15	,	,	PUNCT
finefocus-4294	61	16	41	41	NUM
finefocus-4294	61	17	)	)	PUNCT
finefocus-4294	61	18	.	.	PUNCT
finefocus-4294	62	1	primer	primer	NOUN
finefocus-4294	62	2	sequences	sequence	NOUN
finefocus-4294	62	3	are	be	AUX
finefocus-4294	62	4	shown	show	VERB
finefocus-4294	62	5	below	below	ADP
finefocus-4294	62	6	(	(	PUNCT
finefocus-4294	62	7	table	table	NOUN
finefocus-4294	62	8	1	1	NUM
finefocus-4294	62	9	)	)	PUNCT
finefocus-4294	62	10	.	.	PUNCT
finefocus-4294	63	1	parameters	parameter	NOUN
finefocus-4294	63	2	for	for	ADP
finefocus-4294	63	3	the	the	DET
finefocus-4294	63	4	relevant	relevant	ADJ
finefocus-4294	63	5	pcr	pcr	ADJ
finefocus-4294	63	6	reactions	reaction	NOUN
finefocus-4294	63	7	are	be	AUX
finefocus-4294	63	8	shown	show	VERB
finefocus-4294	63	9	below	below	ADP
finefocus-4294	63	10	(	(	PUNCT
finefocus-4294	63	11	table	table	NOUN
finefocus-4294	63	12	2	2	NUM
finefocus-4294	63	13	)	)	PUNCT
finefocus-4294	63	14	.	.	PUNCT
finefocus-4294	64	1	sequencing	sequence	VERB
finefocus-4294	64	2	analyses	analysis	NOUN
finefocus-4294	64	3	were	be	AUX
finefocus-4294	64	4	performed	perform	VERB
finefocus-4294	64	5	by	by	ADP
finefocus-4294	64	6	eurofins	eurofin	NOUN
finefocus-4294	64	7	genomics	genomics	PROPN
finefocus-4294	64	8	©	©	PROPN
finefocus-4294	64	9	(	(	PUNCT
finefocus-4294	64	10	louisville	louisville	PROPN
finefocus-4294	64	11	,	,	PUNCT
finefocus-4294	64	12	ky	ky	PROPN
finefocus-4294	64	13	)	)	PUNCT
finefocus-4294	64	14	.	.	PUNCT
finefocus-4294	65	1	whole	whole	ADJ
finefocus-4294	65	2	-	-	PUNCT
finefocus-4294	65	3	cell	cell	NOUN
finefocus-4294	65	4	fermentation	fermentation	NOUN
finefocus-4294	65	5	96	96	NUM
finefocus-4294	65	6	well	well	ADJ
finefocus-4294	65	7	-	-	PUNCT
finefocus-4294	65	8	plate	plate	NOUN
finefocus-4294	65	9	assay	assay	NOUN
finefocus-4294	65	10	protocol	protocol	NOUN
finefocus-4294	65	11	e.	e.	PROPN
finefocus-4294	65	12	coli	coli	PROPN
finefocus-4294	66	1	(	(	PUNCT
finefocus-4294	66	2	bl21	bl21	PROPN
finefocus-4294	66	3	(	(	PUNCT
finefocus-4294	66	4	de3	de3	NOUN
finefocus-4294	66	5	)	)	PUNCT
finefocus-4294	66	6	)	)	PUNCT
finefocus-4294	66	7	electrocompetent	electrocompetent	ADJ
finefocus-4294	66	8	cells	cell	NOUN
finefocus-4294	66	9	were	be	AUX
finefocus-4294	66	10	transformed	transform	VERB
finefocus-4294	66	11	with	with	ADP
finefocus-4294	66	12	isolated	isolate	VERB
finefocus-4294	66	13	pcp-02	pcp-02	ADP
finefocus-4294	66	14	plasmids	plasmid	NOUN
finefocus-4294	66	15	expressing	express	VERB
finefocus-4294	66	16	toluene	toluene	ADJ
finefocus-4294	66	17	dioxygenase	dioxygenase	NOUN
finefocus-4294	66	18	(	(	PUNCT
finefocus-4294	66	19	parent	parent	NOUN
finefocus-4294	66	20	and/or	and/or	CCONJ
finefocus-4294	66	21	mutant	mutant	ADJ
finefocus-4294	66	22	libraries	library	NOUN
finefocus-4294	66	23	)	)	PUNCT
finefocus-4294	66	24	,	,	PUNCT
finefocus-4294	66	25	and	and	CCONJ
finefocus-4294	66	26	with	with	ADP
finefocus-4294	66	27	isolated	isolated	ADJ
finefocus-4294	66	28	pcp-01	pcp-01	ADJ
finefocus-4294	66	29	plasmids	plasmid	NOUN
finefocus-4294	66	30	as	as	ADP
finefocus-4294	66	31	negative	negative	ADJ
finefocus-4294	66	32	controls	control	NOUN
finefocus-4294	66	33	(	(	PUNCT
finefocus-4294	66	34	30	30	NUM
finefocus-4294	66	35	)	)	PUNCT
finefocus-4294	66	36	.	.	PUNCT
finefocus-4294	67	1	the	the	DET
finefocus-4294	67	2	transformation	transformation	NOUN
finefocus-4294	67	3	cultures	culture	NOUN
finefocus-4294	67	4	were	be	AUX
finefocus-4294	67	5	selected	select	VERB
finefocus-4294	67	6	on	on	ADP
finefocus-4294	67	7	lb	lb	DET
finefocus-4294	67	8	+	+	CCONJ
finefocus-4294	67	9	streptomycin	streptomycin	PROPN
finefocus-4294	67	10	plates	plate	NOUN
finefocus-4294	67	11	overnight	overnight	ADV
finefocus-4294	67	12	.	.	PUNCT
finefocus-4294	68	1	single	single	ADJ
finefocus-4294	68	2	colonies	colony	NOUN
finefocus-4294	68	3	were	be	AUX
finefocus-4294	68	4	inoculated	inoculate	VERB
finefocus-4294	68	5	into	into	ADP
finefocus-4294	68	6	160	160	NUM
finefocus-4294	68	7	µl	µl	PART
finefocus-4294	68	8	lb	lb	NOUN
finefocus-4294	68	9	+	+	CCONJ
finefocus-4294	68	10	streptomycin	streptomycin	PROPN
finefocus-4294	68	11	media	medium	NOUN
finefocus-4294	68	12	with	with	ADP
finefocus-4294	68	13	0.3	0.3	NUM
finefocus-4294	68	14	%	%	NOUN
finefocus-4294	68	15	glucose	glucose	NOUN
finefocus-4294	68	16	in	in	ADP
finefocus-4294	68	17	a	a	DET
finefocus-4294	68	18	96	96	NUM
finefocus-4294	68	19	-	-	PUNCT
finefocus-4294	68	20	well	well	NOUN
finefocus-4294	68	21	round	round	ADJ
finefocus-4294	68	22	bottom	bottom	ADJ
finefocus-4294	68	23	seed	seed	NOUN
finefocus-4294	68	24	plate	plate	NOUN
finefocus-4294	68	25	and	and	CCONJ
finefocus-4294	68	26	incubated	incubate	VERB
finefocus-4294	68	27	table	table	NOUN
finefocus-4294	68	28	2	2	NUM
finefocus-4294	68	29	pcr	pcr	NOUN
finefocus-4294	68	30	reaction	reaction	NOUN
finefocus-4294	68	31	components	component	NOUN
finefocus-4294	68	32	and	and	CCONJ
finefocus-4294	68	33	thermocycling	thermocycle	VERB
finefocus-4294	68	34	protocol	protocol	NOUN
finefocus-4294	68	35	utilized	utilize	VERB
finefocus-4294	68	36	for	for	ADP
finefocus-4294	68	37	the	the	DET
finefocus-4294	68	38	generation	generation	NOUN
finefocus-4294	68	39	of	of	ADP
finefocus-4294	68	40	toluene	toluene	ADJ
finefocus-4294	68	41	dioxygenase	dioxygenase	NOUN
finefocus-4294	68	42	mutants	mutant	NOUN
finefocus-4294	68	43	.	.	PUNCT
finefocus-4294	69	1	pcr	pcr	ADJ
finefocus-4294	69	2	reaction	reaction	NOUN
finefocus-4294	69	3	components	component	NOUN
finefocus-4294	69	4	thermocycling	thermocycle	VERB
finefocus-4294	69	5	protocol	protocol	NOUN
finefocus-4294	69	6	sterile	sterile	ADJ
finefocus-4294	69	7	h2o	h2o	NOUN
finefocus-4294	69	8	–	–	PUNCT
finefocus-4294	69	9	22.5	22.5	NUM
finefocus-4294	69	10	µl	µl	ADP
finefocus-4294	69	11	98	98	NUM
finefocus-4294	69	12	°	°	ADP
finefocus-4294	69	13	c	c	NOUN
finefocus-4294	69	14	–	–	PUNCT
finefocus-4294	69	15	30	30	NUM
finefocus-4294	69	16	s	s	PART
finefocus-4294	69	17	q5	q5	PROPN
finefocus-4294	69	18	®	®	NOUN
finefocus-4294	69	19	reaction	reaction	NOUN
finefocus-4294	69	20	buffer	buffer	NOUN
finefocus-4294	69	21	–	–	PUNCT
finefocus-4294	69	22	10	10	NUM
finefocus-4294	69	23	µl	µl	ADP
finefocus-4294	69	24	98	98	NUM
finefocus-4294	69	25	°	°	ADP
finefocus-4294	69	26	c	c	NOUN
finefocus-4294	69	27	–	–	PUNCT
finefocus-4294	69	28	10	10	NUM
finefocus-4294	69	29	s	s	PART
finefocus-4294	69	30	}	}	PUNCT
finefocus-4294	69	31	x20q5	x20q5	PROPN
finefocus-4294	69	32	®	®	VERB
finefocus-4294	69	33	high	high	PROPN
finefocus-4294	69	34	gc	gc	PROPN
finefocus-4294	69	35	enhancer	enhancer	NOUN
finefocus-4294	69	36	–	–	PUNCT
finefocus-4294	69	37	10	10	NUM
finefocus-4294	69	38	µl	µl	ADP
finefocus-4294	69	39	72	72	NUM
finefocus-4294	69	40	°	°	ADP
finefocus-4294	69	41	c	c	NOUN
finefocus-4294	69	42	–	–	PUNCT
finefocus-4294	69	43	4	4	NUM
finefocus-4294	69	44	min	min	NOUN
finefocus-4294	69	45	dntps	dntps	ADJ
finefocus-4294	69	46	(	(	PUNCT
finefocus-4294	69	47	10	10	NUM
finefocus-4294	69	48	mm	mm	NOUN
finefocus-4294	69	49	)	)	PUNCT
finefocus-4294	69	50	–	–	PUNCT
finefocus-4294	69	51	1	1	NUM
finefocus-4294	69	52	µl	µl	ADP
finefocus-4294	69	53	72	72	NUM
finefocus-4294	69	54	°	°	ADP
finefocus-4294	69	55	c	c	NOUN
finefocus-4294	69	56	–	–	PUNCT
finefocus-4294	69	57	2	2	NUM
finefocus-4294	69	58	min	min	NOUN
finefocus-4294	69	59	forward	forward	ADJ
finefocus-4294	69	60	primer	primer	NOUN
finefocus-4294	69	61	(	(	PUNCT
finefocus-4294	69	62	10	10	NUM
finefocus-4294	69	63	µm)2.5	µm)2.5	NOUN
finefocus-4294	69	64	µl	µl	PART
finefocus-4294	69	65	reverse	reverse	VERB
finefocus-4294	69	66	primer	primer	NOUN
finefocus-4294	69	67	(	(	PUNCT
finefocus-4294	69	68	10	10	NUM
finefocus-4294	69	69	µm)2.5	µm)2.5	NOUN
finefocus-4294	69	70	µl	µl	PART
finefocus-4294	69	71	template	template	VERB
finefocus-4294	69	72	dna	dna	PROPN
finefocus-4294	69	73	(	(	PUNCT
finefocus-4294	69	74	pcp-02	pcp-02	NOUN
finefocus-4294	69	75	)	)	PUNCT
finefocus-4294	69	76	–	–	PUNCT
finefocus-4294	69	77	1	1	NUM
finefocus-4294	69	78	µl	µl	ADP
finefocus-4294	69	79	q5	q5	PROPN
finefocus-4294	69	80	®	®	PROPN
finefocus-4294	69	81	dna	dna	NOUN
finefocus-4294	69	82	polymerase	polymerase	NOUN
finefocus-4294	69	83	–	–	PUNCT
finefocus-4294	69	84	0.5	0.5	NUM
finefocus-4294	69	85	µl	µl	ADP
finefocus-4294	69	86	total	total	ADJ
finefocus-4294	69	87	–	–	PUNCT
finefocus-4294	69	88	50	50	NUM
finefocus-4294	69	89	µl	µl	ADP
finefocus-4294	69	90	betts	betts	PROPN
finefocus-4294	69	91	&	&	CCONJ
finefocus-4294	69	92	froese	froese	PROPN
finefocus-4294	69	93	|	|	ADV
finefocus-4294	69	94	investigation	investigation	NOUN
finefocus-4294	69	95	of	of	ADP
finefocus-4294	69	96	the	the	DET
finefocus-4294	69	97	effects	effect	NOUN
finefocus-4294	69	98	of	of	ADP
finefocus-4294	69	99	mutating	mutate	VERB
finefocus-4294	69	100	iron	iron	NOUN
finefocus-4294	69	101	-	-	PUNCT
finefocus-4294	69	102	coordinating	coordinate	VERB
finefocus-4294	69	103	residues	residue	NOUN
finefocus-4294	69	104	in	in	ADP
finefocus-4294	69	105	rieske	rieske	ADJ
finefocus-4294	69	106	dioxygenases	dioxygenase	NOUN
finefocus-4294	69	107	95	95	NUM
finefocus-4294	69	108	with	with	ADP
finefocus-4294	69	109	shaking	shake	VERB
finefocus-4294	69	110	overnight	overnight	ADV
finefocus-4294	69	111	.	.	PUNCT
finefocus-4294	70	1	all	all	DET
finefocus-4294	70	2	plates	plate	NOUN
finefocus-4294	70	3	included	include	VERB
finefocus-4294	70	4	3	3	NUM
finefocus-4294	70	5	or	or	CCONJ
finefocus-4294	70	6	more	more	ADJ
finefocus-4294	70	7	wells	well	NOUN
finefocus-4294	70	8	containing	contain	VERB
finefocus-4294	70	9	e.	e.	PROPN
finefocus-4294	70	10	coli	coli	PROPN
finefocus-4294	70	11	(	(	PUNCT
finefocus-4294	70	12	bl21	bl21	PROPN
finefocus-4294	70	13	(	(	PUNCT
finefocus-4294	70	14	de3	de3	PROPN
finefocus-4294	70	15	)	)	PUNCT
finefocus-4294	70	16	)	)	PUNCT
finefocus-4294	71	1	pcp-02	pcp-02	ADP
finefocus-4294	71	2	cells	cell	NOUN
finefocus-4294	71	3	expressing	express	VERB
finefocus-4294	71	4	the	the	DET
finefocus-4294	71	5	parent	parent	NOUN
finefocus-4294	71	6	toluene	toluene	ADJ
finefocus-4294	71	7	dioxygenase	dioxygenase	NOUN
finefocus-4294	71	8	enzyme	enzyme	NOUN
finefocus-4294	71	9	,	,	PUNCT
finefocus-4294	71	10	and	and	CCONJ
finefocus-4294	71	11	3	3	NUM
finefocus-4294	71	12	or	or	CCONJ
finefocus-4294	71	13	more	more	ADJ
finefocus-4294	71	14	wells	well	NOUN
finefocus-4294	71	15	containing	contain	VERB
finefocus-4294	71	16	e.	e.	PROPN
finefocus-4294	71	17	coli	coli	PROPN
finefocus-4294	71	18	(	(	PUNCT
finefocus-4294	71	19	bl21	bl21	PROPN
finefocus-4294	71	20	(	(	PUNCT
finefocus-4294	71	21	de3	de3	NOUN
finefocus-4294	71	22	)	)	PUNCT
finefocus-4294	71	23	)	)	PUNCT
finefocus-4294	71	24	pcp-01	pcp-01	VERB
finefocus-4294	71	25	(	(	PUNCT
finefocus-4294	71	26	negative	negative	ADJ
finefocus-4294	71	27	control	control	NOUN
finefocus-4294	71	28	)	)	PUNCT
finefocus-4294	71	29	(	(	PUNCT
finefocus-4294	71	30	30	30	NUM
finefocus-4294	71	31	)	)	PUNCT
finefocus-4294	71	32	.	.	PUNCT
finefocus-4294	72	1	seed	seed	NOUN
finefocus-4294	72	2	plates	plate	NOUN
finefocus-4294	72	3	were	be	AUX
finefocus-4294	72	4	used	use	VERB
finefocus-4294	72	5	to	to	PART
finefocus-4294	72	6	inoculate	inoculate	VERB
finefocus-4294	72	7	5	5	NUM
finefocus-4294	72	8	µl	µl	NOUN
finefocus-4294	72	9	into	into	ADP
finefocus-4294	72	10	155	155	NUM
finefocus-4294	72	11	µl	µl	PART
finefocus-4294	72	12	lb	lb	NUM
finefocus-4294	72	13	media	medium	NOUN
finefocus-4294	72	14	containing	contain	VERB
finefocus-4294	72	15	streptomycin	streptomycin	PROPN
finefocus-4294	72	16	in	in	ADP
finefocus-4294	72	17	a	a	DET
finefocus-4294	72	18	fresh	fresh	ADJ
finefocus-4294	72	19	96	96	NUM
finefocus-4294	72	20	-	-	PUNCT
finefocus-4294	72	21	well	well	NOUN
finefocus-4294	72	22	round	round	ADJ
finefocus-4294	72	23	bottom	bottom	ADJ
finefocus-4294	72	24	assay	assay	NOUN
finefocus-4294	72	25	plate	plate	NOUN
finefocus-4294	72	26	,	,	PUNCT
finefocus-4294	72	27	and	and	CCONJ
finefocus-4294	72	28	the	the	DET
finefocus-4294	72	29	cultures	culture	NOUN
finefocus-4294	72	30	were	be	AUX
finefocus-4294	72	31	incubated	incubate	VERB
finefocus-4294	72	32	with	with	ADP
finefocus-4294	72	33	shaking	shake	VERB
finefocus-4294	72	34	for	for	ADP
finefocus-4294	72	35	2.75	2.75	NUM
finefocus-4294	72	36	h.	h.	NOUN
finefocus-4294	72	37	the	the	DET
finefocus-4294	72	38	assay	assay	NOUN
finefocus-4294	72	39	plates	plate	NOUN
finefocus-4294	72	40	were	be	AUX
finefocus-4294	72	41	then	then	ADV
finefocus-4294	72	42	pelleted	pellete	VERB
finefocus-4294	72	43	,	,	PUNCT
finefocus-4294	72	44	and	and	CCONJ
finefocus-4294	72	45	the	the	DET
finefocus-4294	72	46	supernatant	supernatant	NOUN
finefocus-4294	72	47	discarded	discard	VERB
finefocus-4294	72	48	.	.	PUNCT
finefocus-4294	73	1	cultures	culture	NOUN
finefocus-4294	73	2	were	be	AUX
finefocus-4294	73	3	resuspended	resuspend	VERB
finefocus-4294	73	4	in	in	ADP
finefocus-4294	73	5	150	150	NUM
finefocus-4294	73	6	µl	µl	ADP
finefocus-4294	73	7	minimal	minimal	ADJ
finefocus-4294	73	8	media	medium	NOUN
finefocus-4294	73	9	(	(	PUNCT
finefocus-4294	73	10	kh2po4	kh2po4	PROPN
finefocus-4294	73	11	–	–	PUNCT
finefocus-4294	73	12	7.5	7.5	NUM
finefocus-4294	73	13	g	g	ADP
finefocus-4294	73	14	l−1	l−1	PROPN
finefocus-4294	73	15	;	;	PUNCT
finefocus-4294	73	16	citric	citric	ADJ
finefocus-4294	73	17	acid	acid	NOUN
finefocus-4294	73	18	–	–	PUNCT
finefocus-4294	73	19	2	2	NUM
finefocus-4294	73	20	g	g	ADP
finefocus-4294	73	21	l−1	l−1	PROPN
finefocus-4294	73	22	;	;	PUNCT
finefocus-4294	73	23	mgso4·7h2o	mgso4·7h2o	NOUN
finefocus-4294	73	24	–	–	PUNCT
finefocus-4294	73	25	5	5	NUM
finefocus-4294	73	26	g	g	ADP
finefocus-4294	73	27	l−1	l−1	PROPN
finefocus-4294	73	28	;	;	PUNCT
finefocus-4294	73	29	trace	trace	NOUN
finefocus-4294	73	30	metal	metal	NOUN
finefocus-4294	73	31	solution	solution	NOUN
finefocus-4294	73	32	–	–	PUNCT
finefocus-4294	74	1	2	2	NUM
finefocus-4294	74	2	ml	ml	X
finefocus-4294	74	3	l−1	l−1	PROPN
finefocus-4294	75	1	[	[	X
finefocus-4294	75	2	na2so4	na2so4	NOUN
finefocus-4294	75	3	–	–	PUNCT
finefocus-4294	75	4	1	1	NUM
finefocus-4294	75	5	g	g	ADP
finefocus-4294	75	6	l−1	l−1	PROPN
finefocus-4294	75	7	;	;	PUNCT
finefocus-4294	75	8	mnso4	mnso4	NOUN
finefocus-4294	75	9	–	–	PUNCT
finefocus-4294	75	10	2	2	NUM
finefocus-4294	75	11	g	g	ADP
finefocus-4294	75	12	l−1	l−1	PROPN
finefocus-4294	75	13	;	;	PUNCT
finefocus-4294	75	14	zncl2	zncl2	X
finefocus-4294	75	15	–	–	PUNCT
finefocus-4294	75	16	2	2	NUM
finefocus-4294	75	17	g	g	ADP
finefocus-4294	75	18	l−1	l−1	PROPN
finefocus-4294	75	19	;	;	PUNCT
finefocus-4294	75	20	cocl2·6h2o	cocl2·6h2o	NOUN
finefocus-4294	75	21	–	–	PUNCT
finefocus-4294	75	22	2	2	NUM
finefocus-4294	75	23	g	g	ADP
finefocus-4294	75	24	l−1	l−1	PROPN
finefocus-4294	75	25	;	;	PUNCT
finefocus-4294	75	26	cuso4·5h2o	cuso4·5h2o	NOUN
finefocus-4294	75	27	–	–	PUNCT
finefocus-4294	75	28	0.3	0.3	NUM
finefocus-4294	75	29	g	g	X
finefocus-4294	75	30	l−1	l−1	PROPN
finefocus-4294	75	31	;	;	PUNCT
finefocus-4294	75	32	feso4·7h2o	feso4·7h2o	NOUN
finefocus-4294	75	33	–	–	PUNCT
finefocus-4294	75	34	10	10	NUM
finefocus-4294	75	35	g	g	ADP
finefocus-4294	75	36	l−1	l−1	PROPN
finefocus-4294	75	37	;	;	PUNCT
finefocus-4294	75	38	ph	ph	NOUN
finefocus-4294	75	39	1.0	1.0	NUM
finefocus-4294	75	40	]	]	PUNCT
finefocus-4294	75	41	;	;	PUNCT
finefocus-4294	75	42	conc	conc	X
finefocus-4294	75	43	.	.	PUNCT
finefocus-4294	76	1	h2so4	h2so4	PROPN
finefocus-4294	76	2	–	–	PUNCT
finefocus-4294	76	3	1.2	1.2	NUM
finefocus-4294	76	4	ml	ml	NOUN
finefocus-4294	76	5	l−1	l−1	NOUN
finefocus-4294	76	6	;	;	PUNCT
finefocus-4294	76	7	ferric	ferric	ADJ
finefocus-4294	76	8	ammonium	ammonium	NOUN
finefocus-4294	76	9	citrate	citrate	NOUN
finefocus-4294	76	10	–	–	PUNCT
finefocus-4294	76	11	0.3	0.3	NUM
finefocus-4294	76	12	g	g	X
finefocus-4294	76	13	l−1	l−1	PROPN
finefocus-4294	76	14	;	;	PUNCT
finefocus-4294	76	15	glucose	glucose	NOUN
finefocus-4294	76	16	–	–	PUNCT
finefocus-4294	76	17	4	4	NUM
finefocus-4294	76	18	g	g	ADP
finefocus-4294	76	19	l−1	l−1	PROPN
finefocus-4294	76	20	;	;	PUNCT
finefocus-4294	76	21	thiamine	thiamine	NOUN
finefocus-4294	76	22	–	–	PUNCT
finefocus-4294	76	23	0.034	0.034	NUM
finefocus-4294	76	24	g	g	ADP
finefocus-4294	76	25	l−1	l−1	PROPN
finefocus-4294	76	26	;	;	PUNCT
finefocus-4294	76	27	ph	ph	NOUN
finefocus-4294	76	28	7.2	7.2	NUM
finefocus-4294	76	29	)	)	PUNCT
finefocus-4294	76	30	(	(	PUNCT
finefocus-4294	76	31	8)	8)	NUM
finefocus-4294	76	32	containing	contain	VERB
finefocus-4294	76	33	streptomycin	streptomycin	PROPN
finefocus-4294	76	34	and	and	CCONJ
finefocus-4294	76	35	incubated	incubate	VERB
finefocus-4294	76	36	for	for	ADP
finefocus-4294	76	37	a	a	DET
finefocus-4294	76	38	1	1	NUM
finefocus-4294	76	39	h	h	NOUN
finefocus-4294	76	40	recovery	recovery	NOUN
finefocus-4294	76	41	period	period	NOUN
finefocus-4294	76	42	.	.	PUNCT
finefocus-4294	77	1	following	follow	VERB
finefocus-4294	77	2	this	this	PRON
finefocus-4294	77	3	,	,	PUNCT
finefocus-4294	77	4	the	the	DET
finefocus-4294	77	5	cultures	culture	NOUN
finefocus-4294	77	6	were	be	AUX
finefocus-4294	77	7	induced	induce	VERB
finefocus-4294	77	8	to	to	ADP
finefocus-4294	77	9	a	a	DET
finefocus-4294	77	10	final	final	ADJ
finefocus-4294	77	11	concentration	concentration	NOUN
finefocus-4294	77	12	of	of	ADP
finefocus-4294	77	13	0.5	0.5	NUM
finefocus-4294	77	14	mm	mm	NOUN
finefocus-4294	77	15	iptg	iptg	NOUN
finefocus-4294	77	16	and	and	CCONJ
finefocus-4294	77	17	the	the	DET
finefocus-4294	77	18	incubation	incubation	NOUN
finefocus-4294	77	19	temperature	temperature	NOUN
finefocus-4294	77	20	was	be	AUX
finefocus-4294	77	21	reduced	reduce	VERB
finefocus-4294	77	22	to	to	ADP
finefocus-4294	77	23	30	30	NUM
finefocus-4294	77	24	°	°	NOUN
finefocus-4294	77	25	c	c	NOUN
finefocus-4294	77	26	.	.	PUNCT
finefocus-4294	78	1	after	after	ADP
finefocus-4294	78	2	a	a	DET
finefocus-4294	78	3	2	2	NUM
finefocus-4294	78	4	h	h	NOUN
finefocus-4294	78	5	induction	induction	NOUN
finefocus-4294	78	6	period	period	NOUN
finefocus-4294	78	7	,	,	PUNCT
finefocus-4294	78	8	aromatic	aromatic	ADJ
finefocus-4294	78	9	substrates	substrate	NOUN
finefocus-4294	78	10	were	be	AUX
finefocus-4294	78	11	added	add	VERB
finefocus-4294	78	12	as	as	ADP
finefocus-4294	78	13	68	68	NUM
finefocus-4294	78	14	mm	mm	NOUN
finefocus-4294	78	15	stock	stock	NOUN
finefocus-4294	78	16	solutions	solution	NOUN
finefocus-4294	78	17	in	in	ADP
finefocus-4294	78	18	dmso	dmso	NOUN
finefocus-4294	78	19	to	to	ADP
finefocus-4294	78	20	a	a	DET
finefocus-4294	78	21	final	final	ADJ
finefocus-4294	78	22	concentration	concentration	NOUN
finefocus-4294	78	23	of	of	ADP
finefocus-4294	78	24	2	2	NUM
finefocus-4294	78	25	mm	mm	NOUN
finefocus-4294	78	26	.	.	PUNCT
finefocus-4294	79	1	cultures	culture	NOUN
finefocus-4294	79	2	were	be	AUX
finefocus-4294	79	3	incubated	incubate	VERB
finefocus-4294	79	4	with	with	ADP
finefocus-4294	79	5	aromatic	aromatic	ADJ
finefocus-4294	79	6	substrates	substrate	NOUN
finefocus-4294	79	7	for	for	ADP
finefocus-4294	79	8	1.5	1.5	NUM
finefocus-4294	79	9	h	h	NOUN
finefocus-4294	79	10	at	at	ADP
finefocus-4294	79	11	30	30	NUM
finefocus-4294	79	12	°	°	NOUN
finefocus-4294	79	13	c	c	NOUN
finefocus-4294	79	14	,	,	PUNCT
finefocus-4294	79	15	after	after	ADP
finefocus-4294	79	16	which	which	PRON
finefocus-4294	79	17	the	the	DET
finefocus-4294	79	18	cultures	culture	NOUN
finefocus-4294	79	19	were	be	AUX
finefocus-4294	79	20	pelleted	pellete	VERB
finefocus-4294	79	21	.	.	PUNCT
finefocus-4294	80	1	a	a	DET
finefocus-4294	80	2	100	100	NUM
finefocus-4294	80	3	µl	µl	ADP
finefocus-4294	80	4	portion	portion	NOUN
finefocus-4294	80	5	of	of	ADP
finefocus-4294	80	6	supernatant	supernatant	NOUN
finefocus-4294	80	7	from	from	ADP
finefocus-4294	80	8	each	each	DET
finefocus-4294	80	9	well	well	NOUN
finefocus-4294	80	10	was	be	AUX
finefocus-4294	80	11	transferred	transfer	VERB
finefocus-4294	80	12	to	to	ADP
finefocus-4294	80	13	96	96	NUM
finefocus-4294	80	14	-	-	PUNCT
finefocus-4294	80	15	well	well	ADV
finefocus-4294	80	16	black	black	ADJ
finefocus-4294	80	17	opaque	opaque	NOUN
finefocus-4294	80	18	assay	assay	NOUN
finefocus-4294	80	19	plates	plate	NOUN
finefocus-4294	80	20	.	.	PUNCT
finefocus-4294	81	1	the	the	DET
finefocus-4294	81	2	reaction	reaction	NOUN
finefocus-4294	81	3	was	be	AUX
finefocus-4294	81	4	initiated	initiate	VERB
finefocus-4294	81	5	by	by	ADP
finefocus-4294	81	6	adding	add	VERB
finefocus-4294	81	7	a	a	DET
finefocus-4294	81	8	50	50	NUM
finefocus-4294	81	9	µl	µl	NOUN
finefocus-4294	81	10	of	of	ADP
finefocus-4294	81	11	naio4	naio4	NOUN
finefocus-4294	81	12	stock	stock	NOUN
finefocus-4294	81	13	solution	solution	NOUN
finefocus-4294	81	14	to	to	ADP
finefocus-4294	81	15	each	each	DET
finefocus-4294	81	16	well	well	NOUN
finefocus-4294	81	17	to	to	ADP
finefocus-4294	81	18	a	a	DET
finefocus-4294	81	19	final	final	ADJ
finefocus-4294	81	20	concentration	concentration	NOUN
finefocus-4294	81	21	of	of	ADP
finefocus-4294	81	22	10	10	NUM
finefocus-4294	81	23	mm	mm	NOUN
finefocus-4294	81	24	,	,	PUNCT
finefocus-4294	81	25	and	and	CCONJ
finefocus-4294	81	26	the	the	DET
finefocus-4294	81	27	assay	assay	ADJ
finefocus-4294	81	28	plates	plate	NOUN
finefocus-4294	81	29	were	be	AUX
finefocus-4294	81	30	incubated	incubate	VERB
finefocus-4294	81	31	with	with	ADP
finefocus-4294	81	32	shaking	shake	VERB
finefocus-4294	81	33	at	at	ADP
finefocus-4294	81	34	room	room	NOUN
finefocus-4294	81	35	temperature	temperature	NOUN
finefocus-4294	81	36	for	for	ADP
finefocus-4294	81	37	30	30	NUM
finefocus-4294	81	38	min	min	NOUN
finefocus-4294	81	39	.	.	PROPN
finefocus-4294	81	40	cleaved	cleaved	ADJ
finefocus-4294	81	41	diols	diol	NOUN
finefocus-4294	81	42	were	be	AUX
finefocus-4294	81	43	detected	detect	VERB
finefocus-4294	81	44	by	by	ADP
finefocus-4294	81	45	adding	add	VERB
finefocus-4294	81	46	50	50	NUM
finefocus-4294	81	47	µl	µl	NOUN
finefocus-4294	81	48	of	of	ADP
finefocus-4294	81	49	fluoresceinamine	fluoresceinamine	NOUN
finefocus-4294	81	50	stock	stock	NOUN
finefocus-4294	81	51	solution	solution	NOUN
finefocus-4294	81	52	(	(	PUNCT
finefocus-4294	81	53	prepared	prepare	VERB
finefocus-4294	81	54	with	with	ADP
finefocus-4294	81	55	3	3	NUM
finefocus-4294	81	56	µl	µl	ADP
finefocus-4294	81	57	conc	conc	NOUN
finefocus-4294	81	58	.	.	PUNCT
finefocus-4294	82	1	hcl	hcl	PROPN
finefocus-4294	82	2	(	(	PUNCT
finefocus-4294	82	3	11.65	11.65	NUM
finefocus-4294	82	4	m)/1	m)/1	PROPN
finefocus-4294	82	5	ml	ml	NOUN
finefocus-4294	82	6	fluoresceinamine	fluoresceinamine	NOUN
finefocus-4294	82	7	solution	solution	NOUN
finefocus-4294	82	8	)	)	PUNCT
finefocus-4294	82	9	to	to	ADP
finefocus-4294	82	10	each	each	DET
finefocus-4294	82	11	well	well	NOUN
finefocus-4294	82	12	to	to	ADP
finefocus-4294	82	13	a	a	DET
finefocus-4294	82	14	final	final	ADJ
finefocus-4294	82	15	concentration	concentration	NOUN
finefocus-4294	82	16	of	of	ADP
finefocus-4294	82	17	0.1	0.1	NUM
finefocus-4294	82	18	mm	mm	NOUN
finefocus-4294	82	19	(	(	PUNCT
finefocus-4294	82	20	30	30	NUM
finefocus-4294	82	21	)	)	PUNCT
finefocus-4294	82	22	.	.	PUNCT
finefocus-4294	83	1	assay	assay	PROPN
finefocus-4294	83	2	plates	plate	NOUN
finefocus-4294	83	3	were	be	AUX
finefocus-4294	83	4	incubated	incubate	VERB
finefocus-4294	83	5	with	with	ADP
finefocus-4294	83	6	shaking	shake	VERB
finefocus-4294	83	7	at	at	ADP
finefocus-4294	83	8	room	room	NOUN
finefocus-4294	83	9	temperature	temperature	NOUN
finefocus-4294	83	10	for	for	ADP
finefocus-4294	83	11	5	5	NUM
finefocus-4294	83	12	h.	h.	NOUN
finefocus-4294	83	13	the	the	DET
finefocus-4294	83	14	fluorescence	fluorescence	ADJ
finefocus-4294	83	15	response	response	NOUN
finefocus-4294	83	16	from	from	ADP
finefocus-4294	83	17	each	each	DET
finefocus-4294	83	18	well	well	NOUN
finefocus-4294	83	19	was	be	AUX
finefocus-4294	83	20	analyzed	analyze	VERB
finefocus-4294	83	21	at	at	ADP
finefocus-4294	83	22	485	485	NUM
finefocus-4294	83	23	nm	nm	NOUN
finefocus-4294	83	24	(	(	PUNCT
finefocus-4294	83	25	ex	ex	NOUN
finefocus-4294	83	26	)	)	PUNCT
finefocus-4294	83	27	,	,	PUNCT
finefocus-4294	83	28	520	520	NUM
finefocus-4294	83	29	nm	nm	NOUN
finefocus-4294	83	30	(	(	PUNCT
finefocus-4294	83	31	em	em	NOUN
finefocus-4294	83	32	)	)	PUNCT
finefocus-4294	83	33	,	,	PUNCT
finefocus-4294	83	34	and	and	CCONJ
finefocus-4294	83	35	normalized	normalize	VERB
finefocus-4294	83	36	to	to	ADP
finefocus-4294	83	37	the	the	DET
finefocus-4294	83	38	mean	mean	ADJ
finefocus-4294	83	39	fluorescence	fluorescence	ADJ
finefocus-4294	83	40	response	response	NOUN
finefocus-4294	83	41	of	of	ADP
finefocus-4294	83	42	the	the	DET
finefocus-4294	83	43	negative	negative	ADJ
finefocus-4294	83	44	controls	control	NOUN
finefocus-4294	83	45	(	(	PUNCT
finefocus-4294	83	46	[	[	X
finefocus-4294	83	47	i	i	PRON
finefocus-4294	83	48	−	−	PROPN
finefocus-4294	83	49	i0]/i0	i0]/i0	PROPN
finefocus-4294	83	50	)	)	PUNCT
finefocus-4294	83	51	.	.	PUNCT
finefocus-4294	84	1	results	result	VERB
finefocus-4294	84	2	identification	identification	NOUN
finefocus-4294	84	3	of	of	ADP
finefocus-4294	84	4	iron	iron	NOUN
finefocus-4294	84	5	-	-	PUNCT
finefocus-4294	84	6	coordinating	coordinate	VERB
finefocus-4294	84	7	residues	residue	NOUN
finefocus-4294	84	8	because	because	SCONJ
finefocus-4294	84	9	our	our	PRON
finefocus-4294	84	10	lab	lab	NOUN
finefocus-4294	84	11	has	have	VERB
finefocus-4294	84	12	extensive	extensive	ADJ
finefocus-4294	84	13	experience	experience	NOUN
finefocus-4294	84	14	working	work	VERB
finefocus-4294	84	15	with	with	ADP
finefocus-4294	84	16	toluene	toluene	NOUN
finefocus-4294	84	17	dioxygenase	dioxygenase	NOUN
finefocus-4294	84	18	(	(	PUNCT
finefocus-4294	84	19	tdo	tdo	PROPN
finefocus-4294	84	20	)	)	PUNCT
finefocus-4294	84	21	(	(	PUNCT
finefocus-4294	84	22	27	27	NUM
finefocus-4294	84	23	,	,	PUNCT
finefocus-4294	84	24	30	30	NUM
finefocus-4294	84	25	)	)	PUNCT
finefocus-4294	84	26	,	,	PUNCT
finefocus-4294	84	27	and	and	CCONJ
finefocus-4294	84	28	because	because	SCONJ
finefocus-4294	84	29	tdo	tdo	PROPN
finefocus-4294	84	30	has	have	AUX
finefocus-4294	84	31	been	be	AUX
finefocus-4294	84	32	one	one	NUM
finefocus-4294	84	33	of	of	ADP
finefocus-4294	84	34	the	the	DET
finefocus-4294	84	35	most	most	ADV
finefocus-4294	84	36	widely	widely	ADV
finefocus-4294	84	37	used	use	VERB
finefocus-4294	84	38	rieske	rieske	ADJ
finefocus-4294	84	39	dioxygenases	dioxygenase	NOUN
finefocus-4294	84	40	in	in	ADP
finefocus-4294	84	41	the	the	DET
finefocus-4294	84	42	field	field	NOUN
finefocus-4294	84	43	of	of	ADP
finefocus-4294	84	44	organic	organic	ADJ
finefocus-4294	84	45	synthesis	synthesis	NOUN
finefocus-4294	84	46	(	(	PUNCT
finefocus-4294	84	47	16	16	NUM
finefocus-4294	84	48	)	)	PUNCT
finefocus-4294	84	49	,	,	PUNCT
finefocus-4294	84	50	this	this	DET
finefocus-4294	84	51	enzyme	enzyme	NOUN
finefocus-4294	84	52	was	be	AUX
finefocus-4294	84	53	selected	select	VERB
finefocus-4294	84	54	as	as	ADP
finefocus-4294	84	55	the	the	DET
finefocus-4294	84	56	template	template	NOUN
finefocus-4294	84	57	for	for	ADP
finefocus-4294	84	58	mutagenesis	mutagenesis	NOUN
finefocus-4294	84	59	in	in	ADP
finefocus-4294	84	60	this	this	DET
finefocus-4294	84	61	study	study	NOUN
finefocus-4294	84	62	.	.	PUNCT
finefocus-4294	85	1	to	to	PART
finefocus-4294	85	2	identify	identify	VERB
finefocus-4294	85	3	the	the	DET
finefocus-4294	85	4	residues	residue	NOUN
finefocus-4294	85	5	that	that	PRON
finefocus-4294	85	6	would	would	AUX
finefocus-4294	85	7	be	be	AUX
finefocus-4294	85	8	targeted	target	VERB
finefocus-4294	85	9	for	for	ADP
finefocus-4294	85	10	mutagenesis	mutagenesis	NOUN
finefocus-4294	85	11	,	,	PUNCT
finefocus-4294	85	12	the	the	DET
finefocus-4294	85	13	reported	report	VERB
finefocus-4294	85	14	crystal	crystal	NOUN
finefocus-4294	85	15	structure	structure	NOUN
finefocus-4294	85	16	of	of	ADP
finefocus-4294	85	17	toluene	toluene	ADJ
finefocus-4294	85	18	dioxygenase	dioxygenase	NOUN
finefocus-4294	85	19	was	be	AUX
finefocus-4294	85	20	analyzed	analyze	VERB
finefocus-4294	85	21	using	use	VERB
finefocus-4294	85	22	the	the	DET
finefocus-4294	85	23	molecular	molecular	ADJ
finefocus-4294	85	24	visualization	visualization	NOUN
finefocus-4294	85	25	software	software	NOUN
finefocus-4294	85	26	chimerax	chimerax	NOUN
finefocus-4294	85	27	(	(	PUNCT
finefocus-4294	85	28	9	9	NUM
finefocus-4294	85	29	,	,	PUNCT
finefocus-4294	85	30	13	13	NUM
finefocus-4294	85	31	)	)	PUNCT
finefocus-4294	85	32	.	.	PUNCT
finefocus-4294	86	1	this	this	DET
finefocus-4294	86	2	analysis	analysis	NOUN
finefocus-4294	86	3	revealed	reveal	VERB
finefocus-4294	86	4	that	that	SCONJ
finefocus-4294	86	5	the	the	DET
finefocus-4294	86	6	catalytic	catalytic	ADJ
finefocus-4294	86	7	iron	iron	NOUN
finefocus-4294	86	8	atom	atom	NOUN
finefocus-4294	86	9	of	of	ADP
finefocus-4294	86	10	toluene	toluene	NOUN
finefocus-4294	86	11	dioxygenase	dioxygenase	NOUN
finefocus-4294	86	12	is	be	AUX
finefocus-4294	86	13	coordinated	coordinate	VERB
finefocus-4294	86	14	by	by	ADP
finefocus-4294	86	15	two	two	NUM
finefocus-4294	86	16	histidine	histidine	NOUN
finefocus-4294	86	17	residues	residue	NOUN
finefocus-4294	86	18	(	(	PUNCT
finefocus-4294	86	19	his222	his222	NOUN
finefocus-4294	86	20	and	and	CCONJ
finefocus-4294	86	21	his228	his228	PROPN
finefocus-4294	86	22	)	)	PUNCT
finefocus-4294	86	23	and	and	CCONJ
finefocus-4294	86	24	by	by	ADP
finefocus-4294	86	25	one	one	NUM
finefocus-4294	86	26	aspartate	aspartate	ADJ
finefocus-4294	86	27	residue	residue	NOUN
finefocus-4294	86	28	(	(	PUNCT
finefocus-4294	86	29	asp376	asp376	PROPN
finefocus-4294	86	30	)	)	PUNCT
finefocus-4294	86	31	(	(	PUNCT
finefocus-4294	86	32	figure	figure	NOUN
finefocus-4294	86	33	1	1	NUM
finefocus-4294	86	34	)	)	PUNCT
finefocus-4294	86	35	.	.	PUNCT
finefocus-4294	87	1	these	these	DET
finefocus-4294	87	2	residues	residue	NOUN
finefocus-4294	87	3	were	be	AUX
finefocus-4294	87	4	therefore	therefore	ADV
finefocus-4294	87	5	determined	determined	ADJ
finefocus-4294	87	6	to	to	PART
finefocus-4294	87	7	be	be	AUX
finefocus-4294	87	8	the	the	DET
finefocus-4294	87	9	appropriate	appropriate	ADJ
finefocus-4294	87	10	targets	target	NOUN
finefocus-4294	87	11	for	for	ADP
finefocus-4294	87	12	mutagenesis	mutagenesis	NOUN
finefocus-4294	87	13	in	in	ADP
finefocus-4294	87	14	this	this	DET
finefocus-4294	87	15	study	study	NOUN
finefocus-4294	87	16	.	.	PUNCT
finefocus-4294	88	1	production	production	NOUN
finefocus-4294	88	2	of	of	ADP
finefocus-4294	88	3	targeted	target	VERB
finefocus-4294	88	4	toluene	toluene	NOUN
finefocus-4294	88	5	dioxygenase	dioxygenase	NOUN
finefocus-4294	88	6	variants	variant	NOUN
finefocus-4294	88	7	to	to	PART
finefocus-4294	88	8	test	test	VERB
finefocus-4294	88	9	the	the	DET
finefocus-4294	88	10	hypothesis	hypothesis	NOUN
finefocus-4294	88	11	of	of	ADP
finefocus-4294	88	12	this	this	DET
finefocus-4294	88	13	study	study	NOUN
finefocus-4294	88	14	,	,	PUNCT
finefocus-4294	88	15	it	it	PRON
finefocus-4294	88	16	was	be	AUX
finefocus-4294	88	17	determined	determine	VERB
finefocus-4294	88	18	that	that	SCONJ
finefocus-4294	88	19	each	each	DET
finefocus-4294	88	20	iron	iron	NOUN
finefocus-4294	88	21	-	-	PUNCT
finefocus-4294	88	22	coordinating	coordinate	VERB
finefocus-4294	88	23	residue	residue	NOUN
finefocus-4294	88	24	of	of	ADP
finefocus-4294	88	25	tdo	tdo	PROPN
finefocus-4294	88	26	would	would	AUX
finefocus-4294	88	27	be	be	AUX
finefocus-4294	88	28	mutated	mutate	VERB
finefocus-4294	88	29	to	to	ADP
finefocus-4294	88	30	three	three	NUM
finefocus-4294	88	31	alternate	alternate	ADJ
finefocus-4294	88	32	residues	residue	NOUN
finefocus-4294	88	33	capable	capable	ADJ
finefocus-4294	88	34	of	of	ADP
finefocus-4294	88	35	coordinating	coordinate	VERB
finefocus-4294	88	36	iron	iron	NOUN
finefocus-4294	88	37	(	(	PUNCT
finefocus-4294	88	38	aspartate	aspartate	NOUN
finefocus-4294	88	39	,	,	PUNCT
finefocus-4294	88	40	glutamate	glutamate	NOUN
finefocus-4294	88	41	,	,	PUNCT
finefocus-4294	88	42	and	and	CCONJ
finefocus-4294	88	43	cysteine	cysteine	NOUN
finefocus-4294	88	44	for	for	ADP
finefocus-4294	88	45	native	native	ADJ
finefocus-4294	88	46	histidine	histidine	NOUN
finefocus-4294	88	47	residues	residue	NOUN
finefocus-4294	88	48	;	;	PUNCT
finefocus-4294	88	49	glutamate	glutamate	NOUN
finefocus-4294	88	50	,	,	PUNCT
finefocus-4294	88	51	cysteine	cysteine	NOUN
finefocus-4294	88	52	,	,	PUNCT
finefocus-4294	88	53	and	and	CCONJ
finefocus-4294	88	54	histidine	histidine	NOUN
finefocus-4294	88	55	for	for	ADP
finefocus-4294	88	56	the	the	DET
finefocus-4294	88	57	native	native	ADJ
finefocus-4294	88	58	aspartate	aspartate	NOUN
finefocus-4294	88	59	residue	residue	NOUN
finefocus-4294	88	60	)	)	PUNCT
finefocus-4294	88	61	and	and	CCONJ
finefocus-4294	88	62	to	to	ADP
finefocus-4294	88	63	one	one	NUM
finefocus-4294	88	64	residue	residue	NOUN
finefocus-4294	88	65	that	that	PRON
finefocus-4294	88	66	would	would	AUX
finefocus-4294	88	67	eliminate	eliminate	VERB
finefocus-4294	88	68	iron	iron	NOUN
finefocus-4294	88	69	-	-	PUNCT
finefocus-4294	88	70	coordination	coordination	NOUN
finefocus-4294	88	71	at	at	ADP
finefocus-4294	88	72	that	that	DET
finefocus-4294	88	73	fine	fine	ADJ
finefocus-4294	88	74	focus	focus	NOUN
finefocus-4294	88	75	|	|	ADV
finefocus-4294	88	76	volume	volume	VERB
finefocus-4294	88	77	1096	1096	NUM
finefocus-4294	88	78	site	site	NOUN
finefocus-4294	88	79	(	(	PUNCT
finefocus-4294	88	80	alanine	alanine	NOUN
finefocus-4294	88	81	)	)	PUNCT
finefocus-4294	88	82	.	.	PUNCT
finefocus-4294	89	1	to	to	PART
finefocus-4294	89	2	generate	generate	VERB
finefocus-4294	89	3	the	the	DET
finefocus-4294	89	4	desired	desire	VERB
finefocus-4294	89	5	variants	variant	NOUN
finefocus-4294	89	6	of	of	ADP
finefocus-4294	89	7	toluene	toluene	NOUN
finefocus-4294	89	8	dioxygenase	dioxygenase	NOUN
finefocus-4294	89	9	,	,	PUNCT
finefocus-4294	89	10	targeted	target	VERB
finefocus-4294	89	11	mutations	mutation	NOUN
finefocus-4294	89	12	were	be	AUX
finefocus-4294	89	13	introduced	introduce	VERB
finefocus-4294	89	14	through	through	ADP
finefocus-4294	89	15	the	the	DET
finefocus-4294	89	16	pcr	pcr	NOUN
finefocus-4294	89	17	-	-	PUNCT
finefocus-4294	89	18	based	base	VERB
finefocus-4294	89	19	method	method	NOUN
finefocus-4294	89	20	of	of	ADP
finefocus-4294	89	21	liu	liu	PROPN
finefocus-4294	89	22	and	and	CCONJ
finefocus-4294	89	23	naismith	naismith	PROPN
finefocus-4294	89	24	(	(	PUNCT
finefocus-4294	89	25	24	24	NUM
finefocus-4294	89	26	,	,	PUNCT
finefocus-4294	89	27	41	41	NUM
finefocus-4294	89	28	)	)	PUNCT
finefocus-4294	89	29	.	.	PUNCT
finefocus-4294	90	1	mutagenic	mutagenic	ADJ
finefocus-4294	90	2	primers	primer	NOUN
finefocus-4294	90	3	were	be	AUX
finefocus-4294	90	4	designed	design	VERB
finefocus-4294	90	5	according	accord	VERB
finefocus-4294	90	6	to	to	ADP
finefocus-4294	90	7	this	this	DET
finefocus-4294	90	8	well	well	ADV
finefocus-4294	90	9	-	-	PUNCT
finefocus-4294	90	10	established	establish	VERB
finefocus-4294	90	11	protocol	protocol	NOUN
finefocus-4294	90	12	(	(	PUNCT
finefocus-4294	90	13	table	table	NOUN
finefocus-4294	90	14	1	1	NUM
finefocus-4294	90	15	)	)	PUNCT
finefocus-4294	90	16	,	,	PUNCT
finefocus-4294	90	17	and	and	CCONJ
finefocus-4294	90	18	the	the	DET
finefocus-4294	90	19	corresponding	corresponding	ADJ
finefocus-4294	90	20	mutagenic	mutagenic	ADJ
finefocus-4294	90	21	pcr	pcr	ADJ
finefocus-4294	90	22	reactions	reaction	NOUN
finefocus-4294	90	23	were	be	AUX
finefocus-4294	90	24	carried	carry	VERB
finefocus-4294	90	25	out	out	ADP
finefocus-4294	90	26	as	as	ADP
finefocus-4294	90	27	described	describe	VERB
finefocus-4294	90	28	.	.	PUNCT
finefocus-4294	91	1	the	the	DET
finefocus-4294	91	2	successful	successful	ADJ
finefocus-4294	91	3	introduction	introduction	NOUN
finefocus-4294	91	4	of	of	ADP
finefocus-4294	91	5	the	the	DET
finefocus-4294	91	6	targeted	target	VERB
finefocus-4294	91	7	mutations	mutation	NOUN
finefocus-4294	91	8	was	be	AUX
finefocus-4294	91	9	confirmed	confirm	VERB
finefocus-4294	91	10	through	through	ADP
finefocus-4294	91	11	sequencing	sequence	VERB
finefocus-4294	91	12	analysis	analysis	NOUN
finefocus-4294	91	13	performed	perform	VERB
finefocus-4294	91	14	by	by	ADP
finefocus-4294	91	15	a	a	DET
finefocus-4294	91	16	third	third	ADJ
finefocus-4294	91	17	-	-	PUNCT
finefocus-4294	91	18	party	party	NOUN
finefocus-4294	91	19	contractor	contractor	NOUN
finefocus-4294	91	20	.	.	PUNCT
finefocus-4294	92	1	representative	representative	PROPN
finefocus-4294	92	2	aligned	aligned	ADJ
finefocus-4294	92	3	sequencing	sequence	VERB
finefocus-4294	92	4	data	datum	NOUN
finefocus-4294	92	5	is	be	AUX
finefocus-4294	92	6	shown	show	VERB
finefocus-4294	92	7	for	for	ADP
finefocus-4294	92	8	the	the	DET
finefocus-4294	92	9	h222	h222	PROPN
finefocus-4294	92	10	mutants	mutant	NOUN
finefocus-4294	92	11	in	in	ADP
finefocus-4294	92	12	figure	figure	NOUN
finefocus-4294	92	13	3	3	NUM
finefocus-4294	92	14	.	.	NOUN
finefocus-4294	93	1	upon	upon	SCONJ
finefocus-4294	93	2	completion	completion	NOUN
finefocus-4294	93	3	of	of	ADP
finefocus-4294	93	4	this	this	DET
finefocus-4294	93	5	work	work	NOUN
finefocus-4294	93	6	,	,	PUNCT
finefocus-4294	93	7	expression	expression	NOUN
finefocus-4294	93	8	systems	system	NOUN
finefocus-4294	93	9	had	have	AUX
finefocus-4294	93	10	been	be	AUX
finefocus-4294	93	11	developed	develop	VERB
finefocus-4294	93	12	for	for	ADP
finefocus-4294	93	13	twelve	twelve	NUM
finefocus-4294	93	14	novel	novel	ADJ
finefocus-4294	93	15	toluene	toluene	NOUN
finefocus-4294	93	16	dioxygenase	dioxygenase	NOUN
finefocus-4294	93	17	variants	variant	NOUN
finefocus-4294	93	18	with	with	ADP
finefocus-4294	93	19	mutations	mutation	NOUN
finefocus-4294	93	20	introduced	introduce	VERB
finefocus-4294	93	21	at	at	ADP
finefocus-4294	93	22	the	the	DET
finefocus-4294	93	23	iron	iron	NOUN
finefocus-4294	93	24	-	-	PUNCT
finefocus-4294	93	25	coordinating	coordinate	VERB
finefocus-4294	93	26	residues	residue	NOUN
finefocus-4294	93	27	(	(	PUNCT
finefocus-4294	93	28	h222a	h222a	PROPN
finefocus-4294	93	29	,	,	PUNCT
finefocus-4294	93	30	h222c	h222c	NUM
finefocus-4294	93	31	,	,	PUNCT
finefocus-4294	93	32	h222d	h222d	PROPN
finefocus-4294	93	33	,	,	PUNCT
finefocus-4294	93	34	h222e	h222e	PROPN
finefocus-4294	93	35	,	,	PUNCT
finefocus-4294	93	36	h228a	h228a	PROPN
finefocus-4294	93	37	,	,	PUNCT
finefocus-4294	93	38	h228c	h228c	PROPN
finefocus-4294	93	39	,	,	PUNCT
finefocus-4294	93	40	h228d	h228d	PROPN
finefocus-4294	93	41	,	,	PUNCT
finefocus-4294	93	42	h228e	h228e	PROPN
finefocus-4294	93	43	,	,	PUNCT
finefocus-4294	93	44	d376a	d376a	PROPN
finefocus-4294	93	45	,	,	PUNCT
finefocus-4294	93	46	d376c	d376c	PROPN
finefocus-4294	93	47	,	,	PUNCT
finefocus-4294	93	48	d376e	d376e	PROPN
finefocus-4294	93	49	,	,	PUNCT
finefocus-4294	93	50	d376h	d376h	PROPN
finefocus-4294	93	51	)	)	PUNCT
finefocus-4294	93	52	.	.	PUNCT
finefocus-4294	94	1	figure	figure	NOUN
finefocus-4294	94	2	2	2	NUM
finefocus-4294	94	3	visualization	visualization	NOUN
finefocus-4294	94	4	of	of	ADP
finefocus-4294	94	5	the	the	DET
finefocus-4294	94	6	tdo	tdo	PROPN
finefocus-4294	94	7	active	active	ADJ
finefocus-4294	94	8	site	site	NOUN
finefocus-4294	94	9	with	with	ADP
finefocus-4294	94	10	bound	bind	VERB
finefocus-4294	94	11	substrate	substrate	NOUN
finefocus-4294	94	12	(	(	PUNCT
finefocus-4294	94	13	toluene	toluene	NOUN
finefocus-4294	94	14	,	,	PUNCT
finefocus-4294	94	15	purple	purple	ADJ
finefocus-4294	94	16	)	)	PUNCT
finefocus-4294	94	17	(	(	PUNCT
finefocus-4294	94	18	9	9	NUM
finefocus-4294	94	19	)	)	PUNCT
finefocus-4294	94	20	.	.	PUNCT
finefocus-4294	95	1	note	note	VERB
finefocus-4294	95	2	.	.	PUNCT
finefocus-4294	96	1	the	the	DET
finefocus-4294	96	2	catalytic	catalytic	ADJ
finefocus-4294	96	3	iron	iron	NOUN
finefocus-4294	96	4	atom	atom	NOUN
finefocus-4294	96	5	(	(	PUNCT
finefocus-4294	96	6	orange	orange	ADJ
finefocus-4294	96	7	)	)	PUNCT
finefocus-4294	96	8	and	and	CCONJ
finefocus-4294	96	9	iron	iron	NOUN
finefocus-4294	96	10	-	-	PUNCT
finefocus-4294	96	11	coordinating	coordinate	VERB
finefocus-4294	96	12	residues	residue	NOUN
finefocus-4294	96	13	are	be	AUX
finefocus-4294	96	14	highlighted	highlight	VERB
finefocus-4294	96	15	(	(	PUNCT
finefocus-4294	96	16	yellow	yellow	ADJ
finefocus-4294	96	17	)	)	PUNCT
finefocus-4294	96	18	.	.	PUNCT
finefocus-4294	97	1	residues	residue	NOUN
finefocus-4294	97	2	within	within	ADP
finefocus-4294	97	3	7	7	NUM
finefocus-4294	97	4	å	å	NOUN
finefocus-4294	97	5	of	of	ADP
finefocus-4294	97	6	the	the	DET
finefocus-4294	97	7	substrate	substrate	NOUN
finefocus-4294	97	8	(	(	PUNCT
finefocus-4294	97	9	toluene	toluene	NOUN
finefocus-4294	97	10	)	)	PUNCT
finefocus-4294	97	11	are	be	AUX
finefocus-4294	97	12	shown	show	VERB
finefocus-4294	97	13	.	.	PUNCT
finefocus-4294	98	1	image	image	NOUN
finefocus-4294	98	2	generated	generate	VERB
finefocus-4294	98	3	with	with	ADP
finefocus-4294	98	4	chimerax	chimerax	NOUN
finefocus-4294	98	5	software	software	NOUN
finefocus-4294	98	6	(	(	PUNCT
finefocus-4294	98	7	13	13	NUM
finefocus-4294	98	8	)	)	PUNCT
finefocus-4294	98	9	.	.	PUNCT
finefocus-4294	99	1	betts	betts	PROPN
finefocus-4294	99	2	&	&	CCONJ
finefocus-4294	99	3	froese	froese	PROPN
finefocus-4294	99	4	|	|	ADV
finefocus-4294	99	5	investigation	investigation	NOUN
finefocus-4294	99	6	of	of	ADP
finefocus-4294	99	7	the	the	DET
finefocus-4294	99	8	effects	effect	NOUN
finefocus-4294	99	9	of	of	ADP
finefocus-4294	99	10	mutating	mutate	VERB
finefocus-4294	99	11	iron	iron	NOUN
finefocus-4294	99	12	-	-	PUNCT
finefocus-4294	99	13	coordinating	coordinate	VERB
finefocus-4294	99	14	residues	residue	NOUN
finefocus-4294	99	15	in	in	ADP
finefocus-4294	99	16	rieske	rieske	ADJ
finefocus-4294	99	17	dioxygenases	dioxygenase	NOUN
finefocus-4294	99	18	97	97	NUM
finefocus-4294	99	19	figure	figure	NOUN
finefocus-4294	99	20	3	3	NUM
finefocus-4294	99	21	multiple	multiple	ADJ
finefocus-4294	99	22	sequence	sequence	NOUN
finefocus-4294	99	23	alignment	alignment	NOUN
finefocus-4294	99	24	of	of	ADP
finefocus-4294	99	25	sequencing	sequence	VERB
finefocus-4294	99	26	data	datum	NOUN
finefocus-4294	99	27	from	from	ADP
finefocus-4294	99	28	tdo	tdo	PROPN
finefocus-4294	99	29	variants	variant	NOUN
finefocus-4294	99	30	with	with	ADP
finefocus-4294	99	31	single	single	ADJ
finefocus-4294	99	32	active	active	ADJ
finefocus-4294	99	33	site	site	NOUN
finefocus-4294	99	34	mutations	mutation	NOUN
finefocus-4294	99	35	.	.	PUNCT
finefocus-4294	100	1	note	note	VERB
finefocus-4294	100	2	.	.	PUNCT
finefocus-4294	101	1	alignment	alignment	NOUN
finefocus-4294	101	2	performed	perform	VERB
finefocus-4294	101	3	with	with	ADP
finefocus-4294	101	4	m	m	NOUN
finefocus-4294	101	5	-	-	NOUN
finefocus-4294	101	6	coffee	coffee	NOUN
finefocus-4294	101	7	(	(	PUNCT
finefocus-4294	101	8	25	25	NUM
finefocus-4294	101	9	)	)	PUNCT
finefocus-4294	101	10	.	.	PUNCT
finefocus-4294	102	1	image	image	NOUN
finefocus-4294	102	2	generated	generate	VERB
finefocus-4294	102	3	with	with	ADP
finefocus-4294	102	4	espript	espript	NOUN
finefocus-4294	102	5	(	(	PUNCT
finefocus-4294	102	6	31	31	NUM
finefocus-4294	102	7	)	)	PUNCT
finefocus-4294	102	8	.	.	PUNCT
finefocus-4294	103	1	fine	fine	ADJ
finefocus-4294	103	2	focus	focus	NOUN
finefocus-4294	103	3	|	|	ADV
finefocus-4294	103	4	volume	volume	VERB
finefocus-4294	103	5	1098	1098	NUM
finefocus-4294	103	6	screening	screening	NOUN
finefocus-4294	103	7	of	of	ADP
finefocus-4294	103	8	toluene	toluene	NOUN
finefocus-4294	103	9	dioxygenase	dioxygenase	NOUN
finefocus-4294	103	10	variants	variant	NOUN
finefocus-4294	103	11	to	to	PART
finefocus-4294	103	12	test	test	VERB
finefocus-4294	103	13	the	the	DET
finefocus-4294	103	14	cis	cis	NOUN
finefocus-4294	103	15	-	-	PUNCT
finefocus-4294	103	16	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	103	17	activity	activity	NOUN
finefocus-4294	103	18	of	of	ADP
finefocus-4294	103	19	the	the	DET
finefocus-4294	103	20	tdo	tdo	PROPN
finefocus-4294	103	21	variants	variant	NOUN
finefocus-4294	103	22	produced	produce	VERB
finefocus-4294	103	23	in	in	ADP
finefocus-4294	103	24	this	this	DET
finefocus-4294	103	25	study	study	NOUN
finefocus-4294	103	26	,	,	PUNCT
finefocus-4294	103	27	a	a	DET
finefocus-4294	103	28	fluorescence	fluorescence	NOUN
finefocus-4294	103	29	-	-	PUNCT
finefocus-4294	103	30	based	base	VERB
finefocus-4294	103	31	assay	assay	NOUN
finefocus-4294	103	32	that	that	PRON
finefocus-4294	103	33	had	have	AUX
finefocus-4294	103	34	previously	previously	ADV
finefocus-4294	103	35	been	be	AUX
finefocus-4294	103	36	reported	report	VERB
finefocus-4294	103	37	by	by	ADP
finefocus-4294	103	38	our	our	PRON
finefocus-4294	103	39	laboratory	laboratory	NOUN
finefocus-4294	103	40	was	be	AUX
finefocus-4294	103	41	applied	apply	VERB
finefocus-4294	103	42	(	(	PUNCT
finefocus-4294	103	43	30	30	NUM
finefocus-4294	103	44	)	)	PUNCT
finefocus-4294	103	45	.	.	PUNCT
finefocus-4294	104	1	this	this	DET
finefocus-4294	104	2	assay	assay	PROPN
finefocus-4294	104	3	,	,	PUNCT
finefocus-4294	104	4	performed	perform	VERB
finefocus-4294	104	5	in	in	ADP
finefocus-4294	104	6	96	96	NUM
finefocus-4294	104	7	-	-	PUNCT
finefocus-4294	104	8	well	well	NOUN
finefocus-4294	104	9	plates	plate	NOUN
finefocus-4294	104	10	,	,	PUNCT
finefocus-4294	104	11	detects	detect	VERB
finefocus-4294	104	12	the	the	DET
finefocus-4294	104	13	presence	presence	NOUN
finefocus-4294	104	14	of	of	ADP
finefocus-4294	104	15	cis	cis	NOUN
finefocus-4294	104	16	-	-	PUNCT
finefocus-4294	104	17	diol	diol	NOUN
finefocus-4294	104	18	metabolites	metabolite	NOUN
finefocus-4294	104	19	produced	produce	VERB
finefocus-4294	104	20	by	by	ADP
finefocus-4294	104	21	active	active	ADJ
finefocus-4294	104	22	dioxygenases	dioxygenase	NOUN
finefocus-4294	104	23	in	in	ADP
finefocus-4294	104	24	the	the	DET
finefocus-4294	104	25	bacterial	bacterial	ADJ
finefocus-4294	104	26	growth	growth	NOUN
finefocus-4294	104	27	media	medium	NOUN
finefocus-4294	104	28	through	through	ADP
finefocus-4294	104	29	the	the	DET
finefocus-4294	104	30	conversion	conversion	NOUN
finefocus-4294	104	31	of	of	ADP
finefocus-4294	104	32	the	the	DET
finefocus-4294	104	33	cis	cis	NOUN
finefocus-4294	104	34	-	-	PUNCT
finefocus-4294	104	35	diol	diol	NOUN
finefocus-4294	104	36	metabolites	metabolite	NOUN
finefocus-4294	104	37	to	to	ADP
finefocus-4294	104	38	a	a	DET
finefocus-4294	104	39	corresponding	corresponding	ADJ
finefocus-4294	104	40	dialdehyde	dialdehyde	NOUN
finefocus-4294	104	41	,	,	PUNCT
finefocus-4294	104	42	and	and	CCONJ
finefocus-4294	104	43	subsequent	subsequent	ADJ
finefocus-4294	104	44	conjugation	conjugation	NOUN
finefocus-4294	104	45	of	of	ADP
finefocus-4294	104	46	the	the	DET
finefocus-4294	104	47	dialdehyde	dialdehyde	NOUN
finefocus-4294	104	48	to	to	ADP
finefocus-4294	104	49	a	a	DET
finefocus-4294	104	50	fluorescent	fluorescent	ADJ
finefocus-4294	104	51	probe	probe	NOUN
finefocus-4294	104	52	(	(	PUNCT
finefocus-4294	104	53	30	30	NUM
finefocus-4294	104	54	)	)	PUNCT
finefocus-4294	104	55	(	(	PUNCT
finefocus-4294	104	56	figure	figure	VERB
finefocus-4294	104	57	4	4	NUM
finefocus-4294	104	58	)	)	PUNCT
finefocus-4294	104	59	.	.	PUNCT
finefocus-4294	105	1	in	in	ADP
finefocus-4294	105	2	this	this	DET
finefocus-4294	105	3	way	way	NOUN
finefocus-4294	105	4	,	,	PUNCT
finefocus-4294	105	5	the	the	DET
finefocus-4294	105	6	amount	amount	NOUN
finefocus-4294	105	7	of	of	ADP
finefocus-4294	105	8	fluorescence	fluorescence	NOUN
finefocus-4294	105	9	detected	detect	VERB
finefocus-4294	105	10	in	in	ADP
finefocus-4294	105	11	each	each	DET
finefocus-4294	105	12	well	well	ADV
finefocus-4294	105	13	provides	provide	VERB
finefocus-4294	105	14	information	information	NOUN
finefocus-4294	105	15	as	as	ADP
finefocus-4294	105	16	to	to	ADP
finefocus-4294	105	17	the	the	DET
finefocus-4294	105	18	amount	amount	NOUN
finefocus-4294	105	19	of	of	ADP
finefocus-4294	105	20	cis	cis	NOUN
finefocus-4294	105	21	-	-	PUNCT
finefocus-4294	105	22	diol	diol	NOUN
finefocus-4294	105	23	metabolite	metabolite	NOUN
finefocus-4294	105	24	produced	produce	VERB
finefocus-4294	105	25	by	by	ADP
finefocus-4294	105	26	the	the	DET
finefocus-4294	105	27	enzyme	enzyme	NOUN
finefocus-4294	105	28	variant	variant	NOUN
finefocus-4294	105	29	present	present	ADJ
finefocus-4294	105	30	in	in	ADP
finefocus-4294	105	31	the	the	DET
finefocus-4294	105	32	corresponding	correspond	VERB
finefocus-4294	105	33	well	well	NOUN
finefocus-4294	105	34	.	.	PUNCT
finefocus-4294	106	1	as	as	SCONJ
finefocus-4294	106	2	the	the	DET
finefocus-4294	106	3	possibility	possibility	NOUN
finefocus-4294	106	4	existed	exist	VERB
finefocus-4294	106	5	that	that	SCONJ
finefocus-4294	106	6	the	the	DET
finefocus-4294	106	7	introduced	introduce	VERB
finefocus-4294	106	8	mutations	mutation	NOUN
finefocus-4294	106	9	would	would	AUX
finefocus-4294	106	10	cause	cause	VERB
finefocus-4294	106	11	the	the	DET
finefocus-4294	106	12	structure	structure	NOUN
finefocus-4294	106	13	of	of	ADP
finefocus-4294	106	14	the	the	DET
finefocus-4294	106	15	tdo	tdo	PROPN
finefocus-4294	106	16	active	active	ADJ
finefocus-4294	106	17	site	site	NOUN
finefocus-4294	106	18	to	to	PART
finefocus-4294	106	19	be	be	AUX
finefocus-4294	106	20	altered	alter	VERB
finefocus-4294	106	21	,	,	PUNCT
finefocus-4294	106	22	while	while	SCONJ
finefocus-4294	106	23	retaining	retain	VERB
finefocus-4294	106	24	some	some	DET
finefocus-4294	106	25	cis	cis	NOUN
finefocus-4294	106	26	-	-	PUNCT
finefocus-4294	106	27	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	106	28	activity	activity	NOUN
finefocus-4294	106	29	,	,	PUNCT
finefocus-4294	106	30	it	it	PRON
finefocus-4294	106	31	was	be	AUX
finefocus-4294	106	32	determined	determine	VERB
finefocus-4294	106	33	that	that	SCONJ
finefocus-4294	106	34	the	the	DET
finefocus-4294	106	35	enzyme	enzyme	NOUN
finefocus-4294	106	36	variants	variant	NOUN
finefocus-4294	106	37	should	should	AUX
finefocus-4294	106	38	be	be	AUX
finefocus-4294	106	39	tested	test	VERB
finefocus-4294	106	40	on	on	ADP
finefocus-4294	106	41	a	a	DET
finefocus-4294	106	42	small	small	ADJ
finefocus-4294	106	43	library	library	NOUN
finefocus-4294	106	44	of	of	ADP
finefocus-4294	106	45	diverse	diverse	ADJ
finefocus-4294	106	46	aromatic	aromatic	ADJ
finefocus-4294	106	47	substrates	substrate	NOUN
finefocus-4294	106	48	(	(	PUNCT
finefocus-4294	106	49	figure	figure	NOUN
finefocus-4294	106	50	5	5	NUM
finefocus-4294	106	51	)	)	PUNCT
finefocus-4294	106	52	.	.	PUNCT
finefocus-4294	107	1	this	this	PRON
finefocus-4294	107	2	would	would	AUX
finefocus-4294	107	3	afford	afford	VERB
finefocus-4294	107	4	the	the	DET
finefocus-4294	107	5	opportunity	opportunity	NOUN
finefocus-4294	107	6	to	to	PART
finefocus-4294	107	7	determine	determine	VERB
finefocus-4294	107	8	the	the	DET
finefocus-4294	107	9	effect	effect	NOUN
finefocus-4294	107	10	of	of	ADP
finefocus-4294	107	11	the	the	DET
finefocus-4294	107	12	introduced	introduce	VERB
finefocus-4294	107	13	mutations	mutation	NOUN
finefocus-4294	107	14	on	on	ADP
finefocus-4294	107	15	the	the	DET
finefocus-4294	107	16	enzyme	enzyme	NOUN
finefocus-4294	107	17	’s	’s	PART
finefocus-4294	107	18	activity	activity	NOUN
finefocus-4294	107	19	for	for	ADP
finefocus-4294	107	20	a	a	DET
finefocus-4294	107	21	wide	wide	ADJ
finefocus-4294	107	22	range	range	NOUN
finefocus-4294	107	23	of	of	ADP
finefocus-4294	107	24	substrates	substrate	NOUN
finefocus-4294	107	25	,	,	PUNCT
finefocus-4294	107	26	including	include	VERB
finefocus-4294	107	27	those	those	PRON
finefocus-4294	107	28	the	the	DET
finefocus-4294	107	29	native	native	ADJ
finefocus-4294	107	30	enzyme	enzyme	NOUN
finefocus-4294	107	31	has	have	VERB
finefocus-4294	107	32	high	high	ADJ
finefocus-4294	107	33	activity	activity	NOUN
finefocus-4294	107	34	for	for	ADP
finefocus-4294	107	35	,	,	PUNCT
finefocus-4294	107	36	those	those	PRON
finefocus-4294	107	37	the	the	DET
finefocus-4294	107	38	native	native	ADJ
finefocus-4294	107	39	enzyme	enzyme	NOUN
finefocus-4294	107	40	has	have	VERB
finefocus-4294	107	41	low	low	ADJ
finefocus-4294	107	42	activity	activity	NOUN
finefocus-4294	107	43	for	for	ADP
finefocus-4294	107	44	,	,	PUNCT
finefocus-4294	107	45	and	and	CCONJ
finefocus-4294	107	46	those	those	PRON
finefocus-4294	107	47	the	the	DET
finefocus-4294	107	48	native	native	ADJ
finefocus-4294	107	49	enzyme	enzyme	NOUN
finefocus-4294	107	50	has	have	VERB
finefocus-4294	107	51	no	no	DET
finefocus-4294	107	52	activity	activity	NOUN
finefocus-4294	107	53	for	for	ADP
finefocus-4294	107	54	.	.	PUNCT
finefocus-4294	108	1	to	to	PART
finefocus-4294	108	2	test	test	VERB
finefocus-4294	108	3	the	the	DET
finefocus-4294	108	4	cis	cis	NOUN
finefocus-4294	108	5	-	-	PUNCT
finefocus-4294	108	6	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	108	7	activity	activity	NOUN
finefocus-4294	108	8	of	of	ADP
finefocus-4294	108	9	the	the	DET
finefocus-4294	108	10	designed	design	VERB
finefocus-4294	108	11	tdo	tdo	PROPN
finefocus-4294	108	12	variants	variant	NOUN
finefocus-4294	108	13	,	,	PUNCT
finefocus-4294	108	14	vectors	vector	NOUN
finefocus-4294	108	15	expressing	express	VERB
finefocus-4294	108	16	each	each	DET
finefocus-4294	108	17	set	set	NOUN
finefocus-4294	108	18	of	of	ADP
finefocus-4294	108	19	variants	variant	NOUN
finefocus-4294	108	20	were	be	AUX
finefocus-4294	108	21	separately	separately	ADV
finefocus-4294	108	22	transformed	transform	VERB
finefocus-4294	108	23	into	into	ADP
finefocus-4294	108	24	e.	e.	PROPN
finefocus-4294	108	25	coli	coli	PROPN
finefocus-4294	108	26	(	(	PUNCT
finefocus-4294	108	27	bl21	bl21	PROPN
finefocus-4294	108	28	(	(	PUNCT
finefocus-4294	108	29	de3	de3	PROPN
finefocus-4294	108	30	)	)	PUNCT
finefocus-4294	108	31	)	)	PUNCT
finefocus-4294	108	32	alongside	alongside	ADP
finefocus-4294	108	33	vectors	vector	NOUN
finefocus-4294	108	34	expressing	express	VERB
finefocus-4294	108	35	the	the	DET
finefocus-4294	108	36	parent	parent	NOUN
finefocus-4294	108	37	enzyme	enzyme	NOUN
finefocus-4294	108	38	(	(	PUNCT
finefocus-4294	108	39	pcp-02	pcp-02	NOUN
finefocus-4294	108	40	)	)	PUNCT
finefocus-4294	108	41	and	and	CCONJ
finefocus-4294	108	42	a	a	DET
finefocus-4294	108	43	negative	negative	ADJ
finefocus-4294	108	44	control	control	NOUN
finefocus-4294	108	45	(	(	PUNCT
finefocus-4294	108	46	pcp-01	pcp-01	NOUN
finefocus-4294	108	47	)	)	PUNCT
finefocus-4294	108	48	(	(	PUNCT
finefocus-4294	108	49	30	30	NUM
finefocus-4294	108	50	)	)	PUNCT
finefocus-4294	108	51	.	.	PUNCT
finefocus-4294	109	1	six	six	NUM
finefocus-4294	109	2	colonies	colony	NOUN
finefocus-4294	109	3	expressing	express	VERB
finefocus-4294	109	4	each	each	DET
finefocus-4294	109	5	variant	variant	NOUN
finefocus-4294	109	6	were	be	AUX
finefocus-4294	109	7	then	then	ADV
finefocus-4294	109	8	inoculated	inoculate	VERB
finefocus-4294	109	9	into	into	ADP
finefocus-4294	109	10	separate	separate	ADJ
finefocus-4294	109	11	wells	well	NOUN
finefocus-4294	109	12	of	of	ADP
finefocus-4294	109	13	a	a	DET
finefocus-4294	109	14	96	96	NUM
finefocus-4294	109	15	-	-	PUNCT
finefocus-4294	109	16	well	well	NOUN
finefocus-4294	109	17	plate	plate	NOUN
finefocus-4294	109	18	and	and	CCONJ
finefocus-4294	109	19	cultured	cultured	ADJ
finefocus-4294	109	20	according	accord	VERB
finefocus-4294	109	21	to	to	ADP
finefocus-4294	109	22	an	an	DET
finefocus-4294	109	23	optimized	optimize	VERB
finefocus-4294	109	24	assay	assay	NOUN
finefocus-4294	109	25	protocol	protocol	NOUN
finefocus-4294	109	26	(	(	PUNCT
finefocus-4294	109	27	30	30	NUM
finefocus-4294	109	28	)	)	PUNCT
finefocus-4294	109	29	,	,	PUNCT
finefocus-4294	109	30	before	before	ADP
finefocus-4294	109	31	being	be	AUX
finefocus-4294	109	32	treated	treat	VERB
finefocus-4294	109	33	with	with	ADP
finefocus-4294	109	34	the	the	DET
finefocus-4294	109	35	relevant	relevant	ADJ
finefocus-4294	109	36	aromatic	aromatic	ADJ
finefocus-4294	109	37	substrate	substrate	NOUN
finefocus-4294	109	38	.	.	PUNCT
finefocus-4294	110	1	following	follow	VERB
finefocus-4294	110	2	an	an	DET
finefocus-4294	110	3	incubation	incubation	NOUN
finefocus-4294	110	4	period	period	NOUN
finefocus-4294	110	5	in	in	ADP
finefocus-4294	110	6	the	the	DET
finefocus-4294	110	7	presence	presence	NOUN
finefocus-4294	110	8	of	of	ADP
finefocus-4294	110	9	the	the	DET
finefocus-4294	110	10	relevant	relevant	ADJ
finefocus-4294	110	11	substrate	substrate	NOUN
finefocus-4294	110	12	,	,	PUNCT
finefocus-4294	110	13	the	the	DET
finefocus-4294	110	14	cells	cell	NOUN
finefocus-4294	110	15	were	be	AUX
finefocus-4294	110	16	removed	remove	VERB
finefocus-4294	110	17	,	,	PUNCT
finefocus-4294	110	18	and	and	CCONJ
finefocus-4294	110	19	the	the	DET
finefocus-4294	110	20	growth	growth	NOUN
finefocus-4294	110	21	media	medium	NOUN
finefocus-4294	110	22	was	be	AUX
finefocus-4294	110	23	carried	carry	VERB
finefocus-4294	110	24	through	through	ADP
finefocus-4294	110	25	the	the	DET
finefocus-4294	110	26	fluorescence	fluorescence	NOUN
finefocus-4294	110	27	-	-	PUNCT
finefocus-4294	110	28	based	base	VERB
finefocus-4294	110	29	assay	assay	NOUN
finefocus-4294	110	30	protocol	protocol	NOUN
finefocus-4294	110	31	(	(	PUNCT
finefocus-4294	110	32	figure	figure	NOUN
finefocus-4294	110	33	4	4	NUM
finefocus-4294	110	34	)	)	PUNCT
finefocus-4294	110	35	.	.	PUNCT
finefocus-4294	111	1	analysis	analysis	NOUN
finefocus-4294	111	2	of	of	ADP
finefocus-4294	111	3	the	the	DET
finefocus-4294	111	4	resultant	resultant	NOUN
finefocus-4294	111	5	data	datum	NOUN
finefocus-4294	111	6	from	from	ADP
finefocus-4294	111	7	these	these	DET
finefocus-4294	111	8	assays	assay	NOUN
finefocus-4294	111	9	revealed	reveal	VERB
finefocus-4294	111	10	that	that	SCONJ
finefocus-4294	111	11	all	all	DET
finefocus-4294	111	12	twelve	twelve	NUM
finefocus-4294	111	13	of	of	ADP
finefocus-4294	111	14	the	the	DET
finefocus-4294	111	15	designed	design	VERB
finefocus-4294	111	16	tdo	tdo	PROPN
finefocus-4294	111	17	variants	variant	NOUN
finefocus-4294	111	18	(	(	PUNCT
finefocus-4294	111	19	h222a	h222a	PROPN
finefocus-4294	111	20	,	,	PUNCT
finefocus-4294	111	21	h222c	h222c	NUM
finefocus-4294	111	22	,	,	PUNCT
finefocus-4294	111	23	h222d	h222d	PROPN
finefocus-4294	111	24	,	,	PUNCT
finefocus-4294	111	25	h222e	h222e	PROPN
finefocus-4294	111	26	,	,	PUNCT
finefocus-4294	111	27	h228a	h228a	PROPN
finefocus-4294	111	28	,	,	PUNCT
finefocus-4294	111	29	h228c	h228c	PROPN
finefocus-4294	111	30	,	,	PUNCT
finefocus-4294	111	31	h228d	h228d	PROPN
finefocus-4294	111	32	,	,	PUNCT
finefocus-4294	111	33	h228e	h228e	PROPN
finefocus-4294	111	34	,	,	PUNCT
finefocus-4294	111	35	d376a	d376a	PROPN
finefocus-4294	111	36	,	,	PUNCT
finefocus-4294	111	37	d376c	d376c	PROPN
finefocus-4294	111	38	,	,	PUNCT
finefocus-4294	111	39	d376e	d376e	PROPN
finefocus-4294	111	40	,	,	PUNCT
finefocus-4294	111	41	d376h	d376h	PROPN
finefocus-4294	111	42	)	)	PUNCT
finefocus-4294	111	43	lacked	lack	VERB
finefocus-4294	111	44	any	any	DET
finefocus-4294	111	45	activity	activity	NOUN
finefocus-4294	111	46	for	for	ADP
finefocus-4294	111	47	all	all	DET
finefocus-4294	111	48	eight	eight	NUM
finefocus-4294	111	49	substrates	substrate	NOUN
finefocus-4294	111	50	used	use	VERB
finefocus-4294	111	51	in	in	ADP
finefocus-4294	111	52	the	the	DET
finefocus-4294	111	53	screens	screen	NOUN
finefocus-4294	111	54	(	(	PUNCT
finefocus-4294	111	55	figure	figure	NOUN
finefocus-4294	111	56	6	6	NUM
finefocus-4294	111	57	)	)	PUNCT
finefocus-4294	111	58	.	.	PUNCT
finefocus-4294	112	1	this	this	PRON
finefocus-4294	112	2	included	include	VERB
finefocus-4294	112	3	a	a	DET
finefocus-4294	112	4	figure	figure	NOUN
finefocus-4294	112	5	4	4	NUM
finefocus-4294	112	6	coupled	couple	VERB
finefocus-4294	112	7	reactions	reaction	NOUN
finefocus-4294	112	8	employed	employ	VERB
finefocus-4294	112	9	by	by	ADP
finefocus-4294	112	10	the	the	DET
finefocus-4294	112	11	fluorescence	fluorescence	NOUN
finefocus-4294	112	12	-	-	PUNCT
finefocus-4294	112	13	based	base	VERB
finefocus-4294	112	14	assay	assay	NOUN
finefocus-4294	112	15	to	to	PART
finefocus-4294	112	16	detect	detect	VERB
finefocus-4294	112	17	and	and	CCONJ
finefocus-4294	112	18	quantify	quantify	VERB
finefocus-4294	112	19	the	the	DET
finefocus-4294	112	20	cis	cis	NOUN
finefocus-4294	112	21	-	-	PUNCT
finefocus-4294	112	22	diol	diol	NOUN
finefocus-4294	112	23	metabolites	metabolite	NOUN
finefocus-4294	112	24	produced	produce	VERB
finefocus-4294	112	25	by	by	ADP
finefocus-4294	112	26	active	active	ADJ
finefocus-4294	112	27	dioxygenases	dioxygenase	NOUN
finefocus-4294	112	28	(	(	PUNCT
finefocus-4294	112	29	30	30	NUM
finefocus-4294	112	30	)	)	PUNCT
finefocus-4294	112	31	.	.	PUNCT
finefocus-4294	113	1	betts	betts	PROPN
finefocus-4294	113	2	&	&	CCONJ
finefocus-4294	113	3	froese	froese	PROPN
finefocus-4294	113	4	|	|	ADV
finefocus-4294	113	5	investigation	investigation	NOUN
finefocus-4294	113	6	of	of	ADP
finefocus-4294	113	7	the	the	DET
finefocus-4294	113	8	effects	effect	NOUN
finefocus-4294	113	9	of	of	ADP
finefocus-4294	113	10	mutating	mutate	VERB
finefocus-4294	113	11	iron	iron	NOUN
finefocus-4294	113	12	-	-	PUNCT
finefocus-4294	113	13	coordinating	coordinate	VERB
finefocus-4294	113	14	residues	residue	NOUN
finefocus-4294	113	15	in	in	ADP
finefocus-4294	113	16	rieske	rieske	ADJ
finefocus-4294	113	17	dioxygenases	dioxygenase	NOUN
finefocus-4294	113	18	99	99	NUM
finefocus-4294	113	19	complete	complete	ADJ
finefocus-4294	113	20	loss	loss	NOUN
finefocus-4294	113	21	of	of	ADP
finefocus-4294	113	22	activity	activity	NOUN
finefocus-4294	113	23	for	for	ADP
finefocus-4294	113	24	the	the	DET
finefocus-4294	113	25	native	native	ADJ
finefocus-4294	113	26	substrate	substrate	NOUN
finefocus-4294	113	27	(	(	PUNCT
finefocus-4294	113	28	toluene	toluene	NOUN
finefocus-4294	113	29	)	)	PUNCT
finefocus-4294	113	30	,	,	PUNCT
finefocus-4294	113	31	and	and	CCONJ
finefocus-4294	113	32	other	other	ADJ
finefocus-4294	113	33	substrates	substrate	NOUN
finefocus-4294	113	34	for	for	ADP
finefocus-4294	113	35	which	which	PRON
finefocus-4294	113	36	the	the	DET
finefocus-4294	113	37	native	native	ADJ
finefocus-4294	113	38	enzyme	enzyme	NOUN
finefocus-4294	113	39	possesses	possesse	NOUN
finefocus-4294	113	40	activity	activity	NOUN
finefocus-4294	113	41	(	(	PUNCT
finefocus-4294	113	42	benzyl	benzyl	NOUN
finefocus-4294	113	43	alcohol	alcohol	NOUN
finefocus-4294	113	44	,	,	PUNCT
finefocus-4294	113	45	benzyl	benzyl	NOUN
finefocus-4294	113	46	acetate	acetate	NOUN
finefocus-4294	113	47	,	,	PUNCT
finefocus-4294	113	48	n	n	CCONJ
finefocus-4294	113	49	-	-	PUNCT
finefocus-4294	113	50	butyl	butyl	NOUN
finefocus-4294	113	51	benzene	benzene	NOUN
finefocus-4294	113	52	,	,	PUNCT
finefocus-4294	113	53	t	t	NOUN
finefocus-4294	113	54	-	-	PUNCT
finefocus-4294	113	55	butyl	butyl	NOUN
finefocus-4294	113	56	benzene	benzene	NOUN
finefocus-4294	113	57	,	,	PUNCT
finefocus-4294	113	58	methyl	methyl	NOUN
finefocus-4294	113	59	benzoate	benzoate	NOUN
finefocus-4294	113	60	)	)	PUNCT
finefocus-4294	113	61	and	and	CCONJ
finefocus-4294	113	62	no	no	DET
finefocus-4294	113	63	gain	gain	NOUN
finefocus-4294	113	64	in	in	ADP
finefocus-4294	113	65	activity	activity	NOUN
finefocus-4294	113	66	for	for	ADP
finefocus-4294	113	67	substrates	substrate	NOUN
finefocus-4294	113	68	that	that	PRON
finefocus-4294	113	69	are	be	AUX
finefocus-4294	113	70	not	not	PART
finefocus-4294	113	71	metabolized	metabolize	VERB
finefocus-4294	113	72	by	by	ADP
finefocus-4294	113	73	the	the	DET
finefocus-4294	113	74	parent	parent	NOUN
finefocus-4294	113	75	enzyme	enzyme	NOUN
finefocus-4294	113	76	(	(	PUNCT
finefocus-4294	113	77	benzyl	benzyl	NOUN
finefocus-4294	113	78	acetamide	acetamide	NOUN
finefocus-4294	113	79	and	and	CCONJ
finefocus-4294	113	80	benzylamine	benzylamine	NOUN
finefocus-4294	113	81	)	)	PUNCT
finefocus-4294	113	82	(	(	PUNCT
finefocus-4294	113	83	figure	figure	NOUN
finefocus-4294	113	84	6	6	NUM
finefocus-4294	113	85	)	)	PUNCT
finefocus-4294	113	86	.	.	PUNCT
finefocus-4294	114	1	discussion	discussion	NOUN
finefocus-4294	114	2	to	to	PART
finefocus-4294	114	3	study	study	VERB
finefocus-4294	114	4	the	the	DET
finefocus-4294	114	5	effect	effect	NOUN
finefocus-4294	114	6	of	of	ADP
finefocus-4294	114	7	mutating	mutate	VERB
finefocus-4294	114	8	the	the	DET
finefocus-4294	114	9	iron	iron	NOUN
finefocus-4294	114	10	-	-	PUNCT
finefocus-4294	114	11	coordinating	coordinate	VERB
finefocus-4294	114	12	residues	residue	NOUN
finefocus-4294	114	13	of	of	ADP
finefocus-4294	114	14	rieske	rieske	ADJ
finefocus-4294	114	15	dioxygenases	dioxygenase	NOUN
finefocus-4294	114	16	on	on	ADP
finefocus-4294	114	17	the	the	DET
finefocus-4294	114	18	activity	activity	NOUN
finefocus-4294	114	19	of	of	ADP
finefocus-4294	114	20	these	these	DET
finefocus-4294	114	21	enzymes	enzyme	NOUN
finefocus-4294	114	22	,	,	PUNCT
finefocus-4294	114	23	the	the	DET
finefocus-4294	114	24	first	first	ADJ
finefocus-4294	114	25	step	step	NOUN
finefocus-4294	114	26	was	be	AUX
finefocus-4294	114	27	to	to	PART
finefocus-4294	114	28	select	select	VERB
finefocus-4294	114	29	a	a	DET
finefocus-4294	114	30	member	member	NOUN
finefocus-4294	114	31	of	of	ADP
finefocus-4294	114	32	this	this	DET
finefocus-4294	114	33	class	class	NOUN
finefocus-4294	114	34	of	of	ADP
finefocus-4294	114	35	enzymes	enzyme	NOUN
finefocus-4294	114	36	to	to	PART
finefocus-4294	114	37	act	act	VERB
finefocus-4294	114	38	as	as	ADP
finefocus-4294	114	39	the	the	DET
finefocus-4294	114	40	template	template	NOUN
finefocus-4294	114	41	for	for	ADP
finefocus-4294	114	42	mutagenesis	mutagenesis	NOUN
finefocus-4294	114	43	.	.	PUNCT
finefocus-4294	115	1	toluene	toluene	ADJ
finefocus-4294	115	2	dioxygenase	dioxygenase	NOUN
finefocus-4294	115	3	(	(	PUNCT
finefocus-4294	115	4	tdo	tdo	PROPN
finefocus-4294	115	5	)	)	PUNCT
finefocus-4294	115	6	is	be	AUX
finefocus-4294	115	7	a	a	DET
finefocus-4294	115	8	well	well	ADV
finefocus-4294	115	9	-	-	PUNCT
finefocus-4294	115	10	characterized	characterize	VERB
finefocus-4294	115	11	member	member	NOUN
finefocus-4294	115	12	of	of	ADP
finefocus-4294	115	13	the	the	DET
finefocus-4294	115	14	rieske	rieske	ADJ
finefocus-4294	115	15	dioxygenase	dioxygenase	NOUN
finefocus-4294	115	16	enzyme	enzyme	NOUN
finefocus-4294	115	17	family	family	NOUN
finefocus-4294	115	18	,	,	PUNCT
finefocus-4294	115	19	which	which	PRON
finefocus-4294	115	20	is	be	AUX
finefocus-4294	115	21	derived	derive	VERB
finefocus-4294	115	22	from	from	ADP
finefocus-4294	115	23	the	the	DET
finefocus-4294	115	24	soil	soil	NOUN
finefocus-4294	115	25	bacterium	bacterium	NOUN
finefocus-4294	115	26	pseudomonas	pseudomonas	PROPN
finefocus-4294	115	27	putida	putida	PROPN
finefocus-4294	115	28	f1	f1	NOUN
finefocus-4294	115	29	(	(	PUNCT
finefocus-4294	115	30	42	42	NUM
finefocus-4294	115	31	)	)	PUNCT
finefocus-4294	115	32	.	.	PUNCT
finefocus-4294	116	1	due	due	ADP
finefocus-4294	116	2	to	to	ADP
finefocus-4294	116	3	the	the	DET
finefocus-4294	116	4	historic	historic	ADJ
finefocus-4294	116	5	importance	importance	NOUN
finefocus-4294	116	6	of	of	ADP
finefocus-4294	116	7	tdo	tdo	PROPN
finefocus-4294	116	8	in	in	ADP
finefocus-4294	116	9	the	the	DET
finefocus-4294	116	10	production	production	NOUN
finefocus-4294	116	11	of	of	ADP
finefocus-4294	116	12	valuable	valuable	ADJ
finefocus-4294	116	13	compounds	compound	NOUN
finefocus-4294	116	14	(	(	PUNCT
finefocus-4294	116	15	16	16	NUM
finefocus-4294	116	16	)	)	PUNCT
finefocus-4294	116	17	,	,	PUNCT
finefocus-4294	116	18	and	and	CCONJ
finefocus-4294	116	19	because	because	SCONJ
finefocus-4294	116	20	of	of	ADP
finefocus-4294	116	21	our	our	PRON
finefocus-4294	116	22	laboratory	laboratory	NOUN
finefocus-4294	116	23	’s	’s	PART
finefocus-4294	116	24	experience	experience	NOUN
finefocus-4294	116	25	working	work	VERB
finefocus-4294	116	26	with	with	ADP
finefocus-4294	116	27	this	this	DET
finefocus-4294	116	28	rieske	rieske	ADJ
finefocus-4294	116	29	dioxygenase	dioxygenase	NOUN
finefocus-4294	116	30	system	system	NOUN
finefocus-4294	116	31	(	(	PUNCT
finefocus-4294	116	32	27	27	NUM
finefocus-4294	116	33	,	,	PUNCT
finefocus-4294	116	34	30	30	NUM
finefocus-4294	116	35	)	)	PUNCT
finefocus-4294	116	36	,	,	PUNCT
finefocus-4294	116	37	tdo	tdo	PROPN
finefocus-4294	116	38	was	be	AUX
finefocus-4294	116	39	chosen	choose	VERB
finefocus-4294	116	40	as	as	ADP
finefocus-4294	116	41	the	the	DET
finefocus-4294	116	42	engineering	engineering	NOUN
finefocus-4294	116	43	scaffold	scaffold	NOUN
finefocus-4294	116	44	for	for	ADP
finefocus-4294	116	45	this	this	DET
finefocus-4294	116	46	study	study	NOUN
finefocus-4294	116	47	.	.	PUNCT
finefocus-4294	117	1	due	due	ADP
finefocus-4294	117	2	to	to	ADP
finefocus-4294	117	3	the	the	DET
finefocus-4294	117	4	structural	structural	ADJ
finefocus-4294	117	5	similarity	similarity	NOUN
finefocus-4294	117	6	observed	observe	VERB
finefocus-4294	117	7	with	with	ADP
finefocus-4294	117	8	many	many	ADJ
finefocus-4294	117	9	rieske	rieske	ADJ
finefocus-4294	117	10	dioxygenases	dioxygenase	NOUN
finefocus-4294	117	11	(	(	PUNCT
finefocus-4294	117	12	2	2	NUM
finefocus-4294	117	13	)	)	PUNCT
finefocus-4294	117	14	,	,	PUNCT
finefocus-4294	117	15	the	the	DET
finefocus-4294	117	16	results	result	NOUN
finefocus-4294	117	17	of	of	ADP
finefocus-4294	117	18	this	this	DET
finefocus-4294	117	19	study	study	NOUN
finefocus-4294	117	20	would	would	AUX
finefocus-4294	117	21	be	be	AUX
finefocus-4294	117	22	expected	expect	VERB
finefocus-4294	117	23	to	to	PART
finefocus-4294	117	24	be	be	AUX
finefocus-4294	117	25	applicable	applicable	ADJ
finefocus-4294	117	26	across	across	ADP
finefocus-4294	117	27	many	many	ADJ
finefocus-4294	117	28	members	member	NOUN
finefocus-4294	117	29	of	of	ADP
finefocus-4294	117	30	this	this	DET
finefocus-4294	117	31	enzyme	enzyme	NOUN
finefocus-4294	117	32	family	family	NOUN
finefocus-4294	117	33	.	.	PUNCT
finefocus-4294	118	1	the	the	DET
finefocus-4294	118	2	goals	goal	NOUN
finefocus-4294	118	3	of	of	ADP
finefocus-4294	118	4	this	this	DET
finefocus-4294	118	5	study	study	NOUN
finefocus-4294	118	6	were	be	AUX
finefocus-4294	118	7	to	to	PART
finefocus-4294	118	8	investigate	investigate	VERB
finefocus-4294	118	9	the	the	DET
finefocus-4294	118	10	effects	effect	NOUN
finefocus-4294	118	11	of	of	ADP
finefocus-4294	118	12	both	both	DET
finefocus-4294	118	13	altering	alter	VERB
finefocus-4294	118	14	and	and	CCONJ
finefocus-4294	118	15	eliminating	eliminate	VERB
finefocus-4294	118	16	the	the	DET
finefocus-4294	118	17	iron	iron	NOUN
finefocus-4294	118	18	-	-	PUNCT
finefocus-4294	118	19	coordination	coordination	NOUN
finefocus-4294	118	20	of	of	ADP
finefocus-4294	118	21	key	key	ADJ
finefocus-4294	118	22	residues	residue	NOUN
finefocus-4294	118	23	in	in	ADP
finefocus-4294	118	24	the	the	DET
finefocus-4294	118	25	active	active	ADJ
finefocus-4294	118	26	site	site	NOUN
finefocus-4294	118	27	of	of	ADP
finefocus-4294	118	28	toluene	toluene	NOUN
finefocus-4294	118	29	dioxygenase	dioxygenase	NOUN
finefocus-4294	118	30	.	.	PUNCT
finefocus-4294	119	1	as	as	SCONJ
finefocus-4294	119	2	tdo	tdo	PROPN
finefocus-4294	119	3	has	have	AUX
finefocus-4294	119	4	been	be	AUX
finefocus-4294	119	5	well	well	ADV
finefocus-4294	119	6	characterized	characterize	VERB
finefocus-4294	119	7	(	(	PUNCT
finefocus-4294	119	8	9	9	NUM
finefocus-4294	119	9	)	)	PUNCT
finefocus-4294	119	10	,	,	PUNCT
finefocus-4294	119	11	the	the	DET
finefocus-4294	119	12	identification	identification	NOUN
finefocus-4294	119	13	of	of	ADP
finefocus-4294	119	14	the	the	DET
finefocus-4294	119	15	iron	iron	NOUN
finefocus-4294	119	16	-	-	PUNCT
finefocus-4294	119	17	coordinating	coordinate	VERB
finefocus-4294	119	18	residues	residue	NOUN
finefocus-4294	119	19	of	of	ADP
finefocus-4294	119	20	this	this	DET
finefocus-4294	119	21	enzyme	enzyme	NOUN
finefocus-4294	119	22	(	(	PUNCT
finefocus-4294	119	23	his222	his222	PROPN
finefocus-4294	119	24	/	/	SYM
finefocus-4294	119	25	his228	his228	PROPN
finefocus-4294	119	26	/	/	SYM
finefocus-4294	119	27	asp376	asp376	PROPN
finefocus-4294	119	28	)	)	PUNCT
finefocus-4294	119	29	using	use	VERB
finefocus-4294	119	30	chimerax	chimerax	NOUN
finefocus-4294	119	31	(	(	PUNCT
finefocus-4294	119	32	13	13	NUM
finefocus-4294	119	33	)	)	PUNCT
finefocus-4294	119	34	was	be	AUX
finefocus-4294	119	35	trivial	trivial	ADJ
finefocus-4294	119	36	(	(	PUNCT
finefocus-4294	119	37	figure	figure	NOUN
finefocus-4294	119	38	2	2	NUM
finefocus-4294	119	39	)	)	PUNCT
finefocus-4294	119	40	.	.	PUNCT
finefocus-4294	120	1	to	to	PART
finefocus-4294	120	2	effectively	effectively	ADV
finefocus-4294	120	3	test	test	VERB
finefocus-4294	120	4	the	the	DET
finefocus-4294	120	5	hypothesis	hypothesis	NOUN
finefocus-4294	120	6	of	of	ADP
finefocus-4294	120	7	this	this	DET
finefocus-4294	120	8	study	study	NOUN
finefocus-4294	120	9	,	,	PUNCT
finefocus-4294	120	10	it	it	PRON
finefocus-4294	120	11	was	be	AUX
finefocus-4294	120	12	determined	determined	ADJ
finefocus-4294	120	13	figure	figure	NOUN
finefocus-4294	120	14	5	5	NUM
finefocus-4294	120	15	aromatic	aromatic	ADJ
finefocus-4294	120	16	substrates	substrate	NOUN
finefocus-4294	120	17	used	use	VERB
finefocus-4294	120	18	to	to	PART
finefocus-4294	120	19	screen	screen	VERB
finefocus-4294	120	20	for	for	ADP
finefocus-4294	120	21	cis	cis	NOUN
finefocus-4294	120	22	-	-	PUNCT
finefocus-4294	120	23	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	120	24	activity	activity	NOUN
finefocus-4294	120	25	among	among	ADP
finefocus-4294	120	26	the	the	DET
finefocus-4294	120	27	tdo	tdo	PROPN
finefocus-4294	120	28	mutants	mutant	NOUN
finefocus-4294	120	29	produced	produce	VERB
finefocus-4294	120	30	.	.	PUNCT
finefocus-4294	121	1	fine	fine	ADJ
finefocus-4294	121	2	focus	focus	NOUN
finefocus-4294	121	3	|	|	ADV
finefocus-4294	121	4	volume	volume	VERB
finefocus-4294	121	5	10100	10100	NUM
finefocus-4294	121	6	note	note	NOUN
finefocus-4294	121	7	.	.	PUNCT
finefocus-4294	122	1	fluorescence	fluorescence	ADJ
finefocus-4294	122	2	response	response	NOUN
finefocus-4294	122	3	was	be	AUX
finefocus-4294	122	4	normalized	normalize	VERB
finefocus-4294	122	5	to	to	ADP
finefocus-4294	122	6	the	the	DET
finefocus-4294	122	7	mean	mean	ADJ
finefocus-4294	122	8	fluorescence	fluorescence	ADJ
finefocus-4294	122	9	response	response	NOUN
finefocus-4294	122	10	of	of	ADP
finefocus-4294	122	11	the	the	DET
finefocus-4294	122	12	negative	negative	ADJ
finefocus-4294	122	13	control	control	NOUN
finefocus-4294	122	14	(	(	PUNCT
finefocus-4294	122	15	e.	e.	PROPN
finefocus-4294	122	16	coli	coli	NOUN
finefocus-4294	123	1	bl21	bl21	PROPN
finefocus-4294	123	2	(	(	PUNCT
finefocus-4294	123	3	de3	de3	NOUN
finefocus-4294	123	4	)	)	PUNCT
finefocus-4294	123	5	pcp-01	pcp-01	NOUN
finefocus-4294	123	6	)	)	PUNCT
finefocus-4294	123	7	(	(	PUNCT
finefocus-4294	123	8	[	[	X
finefocus-4294	123	9	i	i	X
finefocus-4294	123	10	–	–	PUNCT
finefocus-4294	123	11	i0]/i0	i0]/i0	PROPN
finefocus-4294	123	12	)	)	PUNCT
finefocus-4294	123	13	(	(	PUNCT
finefocus-4294	123	14	21	21	NUM
finefocus-4294	123	15	)	)	PUNCT
finefocus-4294	123	16	.	.	PUNCT
finefocus-4294	124	1	parent	parent	NOUN
finefocus-4294	124	2	activity	activity	NOUN
finefocus-4294	124	3	was	be	AUX
finefocus-4294	124	4	determined	determine	VERB
finefocus-4294	124	5	from	from	ADP
finefocus-4294	124	6	positive	positive	ADJ
finefocus-4294	124	7	controls	control	NOUN
finefocus-4294	124	8	(	(	PUNCT
finefocus-4294	124	9	e.	e.	PROPN
finefocus-4294	124	10	coli	coli	NOUN
finefocus-4294	125	1	bl21	bl21	PROPN
finefocus-4294	125	2	(	(	PUNCT
finefocus-4294	125	3	de3	de3	PROPN
finefocus-4294	125	4	)	)	PUNCT
finefocus-4294	125	5	pcp-02	pcp-02	PROPN
finefocus-4294	125	6	)	)	PUNCT
finefocus-4294	125	7	,	,	PUNCT
finefocus-4294	125	8	with	with	ADP
finefocus-4294	125	9	the	the	DET
finefocus-4294	125	10	fluorescence	fluorescence	NOUN
finefocus-4294	125	11	response	response	NOUN
finefocus-4294	125	12	normalized	normalize	VERB
finefocus-4294	125	13	to	to	ADP
finefocus-4294	125	14	the	the	DET
finefocus-4294	125	15	negative	negative	ADJ
finefocus-4294	125	16	control	control	NOUN
finefocus-4294	125	17	(	(	PUNCT
finefocus-4294	125	18	[	[	X
finefocus-4294	125	19	i	i	X
finefocus-4294	125	20	–	–	PUNCT
finefocus-4294	125	21	i0]/	i0]/	NOUN
finefocus-4294	125	22	i0	i0	PROPN
finefocus-4294	125	23	)	)	PUNCT
finefocus-4294	125	24	(	(	PUNCT
finefocus-4294	125	25	30	30	NUM
finefocus-4294	125	26	)	)	PUNCT
finefocus-4294	125	27	.	.	PUNCT
finefocus-4294	126	1	figure	figure	VERB
finefocus-4294	126	2	6	6	NUM
finefocus-4294	126	3	cis	cis	NOUN
finefocus-4294	126	4	-	-	PUNCT
finefocus-4294	126	5	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	126	6	activity	activity	NOUN
finefocus-4294	126	7	of	of	ADP
finefocus-4294	126	8	h222	h222	PROPN
finefocus-4294	126	9	tdo	tdo	PROPN
finefocus-4294	126	10	variants	variant	NOUN
finefocus-4294	126	11	(	(	PUNCT
finefocus-4294	126	12	a	a	X
finefocus-4294	126	13	)	)	PUNCT
finefocus-4294	126	14	,	,	PUNCT
finefocus-4294	126	15	h228	h228	PROPN
finefocus-4294	126	16	tdo	tdo	PROPN
finefocus-4294	126	17	variants	variant	NOUN
finefocus-4294	126	18	(	(	PUNCT
finefocus-4294	126	19	b	b	NOUN
finefocus-4294	126	20	)	)	PUNCT
finefocus-4294	126	21	and	and	CCONJ
finefocus-4294	126	22	d376	d376	PROPN
finefocus-4294	126	23	tdo	tdo	PROPN
finefocus-4294	126	24	variants	variant	NOUN
finefocus-4294	126	25	(	(	PUNCT
finefocus-4294	126	26	c	c	NOUN
finefocus-4294	126	27	)	)	PUNCT
finefocus-4294	126	28	for	for	ADP
finefocus-4294	126	29	representative	representative	ADJ
finefocus-4294	126	30	aromatic	aromatic	ADJ
finefocus-4294	126	31	substrates	substrate	NOUN
finefocus-4294	126	32	(	(	PUNCT
finefocus-4294	126	33	n	n	NOUN
finefocus-4294	126	34	=	=	SYM
finefocus-4294	126	35	6	6	NUM
finefocus-4294	126	36	)	)	PUNCT
finefocus-4294	126	37	.	.	PUNCT
finefocus-4294	127	1	betts	betts	PROPN
finefocus-4294	127	2	&	&	CCONJ
finefocus-4294	127	3	froese	froese	PROPN
finefocus-4294	127	4	|	|	ADV
finefocus-4294	127	5	investigation	investigation	NOUN
finefocus-4294	127	6	of	of	ADP
finefocus-4294	127	7	the	the	DET
finefocus-4294	127	8	effects	effect	NOUN
finefocus-4294	127	9	of	of	ADP
finefocus-4294	127	10	mutating	mutate	VERB
finefocus-4294	127	11	iron	iron	NOUN
finefocus-4294	127	12	-	-	PUNCT
finefocus-4294	127	13	coordinating	coordinate	VERB
finefocus-4294	127	14	residues	residue	NOUN
finefocus-4294	127	15	in	in	ADP
finefocus-4294	127	16	rieske	rieske	ADJ
finefocus-4294	127	17	dioxygenases	dioxygenase	NOUN
finefocus-4294	127	18	101	101	NUM
finefocus-4294	127	19	that	that	PRON
finefocus-4294	127	20	all	all	DET
finefocus-4294	127	21	three	three	NUM
finefocus-4294	127	22	of	of	ADP
finefocus-4294	127	23	the	the	DET
finefocus-4294	127	24	residues	residue	NOUN
finefocus-4294	127	25	coordinating	coordinate	VERB
finefocus-4294	127	26	the	the	DET
finefocus-4294	127	27	catalytic	catalytic	ADJ
finefocus-4294	127	28	iron	iron	NOUN
finefocus-4294	127	29	would	would	AUX
finefocus-4294	127	30	be	be	AUX
finefocus-4294	127	31	mutated	mutate	VERB
finefocus-4294	127	32	to	to	ADP
finefocus-4294	127	33	three	three	NUM
finefocus-4294	127	34	alternate	alternate	ADJ
finefocus-4294	127	35	residues	residue	NOUN
finefocus-4294	127	36	capable	capable	ADJ
finefocus-4294	127	37	of	of	ADP
finefocus-4294	127	38	coordinating	coordinate	VERB
finefocus-4294	127	39	iron	iron	NOUN
finefocus-4294	127	40	(	(	PUNCT
finefocus-4294	127	41	aspartate	aspartate	NOUN
finefocus-4294	127	42	,	,	PUNCT
finefocus-4294	127	43	glutamate	glutamate	NOUN
finefocus-4294	127	44	,	,	PUNCT
finefocus-4294	127	45	and	and	CCONJ
finefocus-4294	127	46	cysteine	cysteine	NOUN
finefocus-4294	127	47	for	for	ADP
finefocus-4294	127	48	native	native	ADJ
finefocus-4294	127	49	histidine	histidine	NOUN
finefocus-4294	127	50	residues	residue	NOUN
finefocus-4294	127	51	;	;	PUNCT
finefocus-4294	127	52	glutamate	glutamate	NOUN
finefocus-4294	127	53	,	,	PUNCT
finefocus-4294	127	54	cysteine	cysteine	NOUN
finefocus-4294	127	55	,	,	PUNCT
finefocus-4294	127	56	and	and	CCONJ
finefocus-4294	127	57	histidine	histidine	NOUN
finefocus-4294	127	58	for	for	ADP
finefocus-4294	127	59	the	the	DET
finefocus-4294	127	60	native	native	ADJ
finefocus-4294	127	61	aspartate	aspartate	NOUN
finefocus-4294	127	62	residue	residue	NOUN
finefocus-4294	127	63	)	)	PUNCT
finefocus-4294	127	64	and	and	CCONJ
finefocus-4294	127	65	to	to	ADP
finefocus-4294	127	66	one	one	NUM
finefocus-4294	127	67	residue	residue	NOUN
finefocus-4294	127	68	that	that	PRON
finefocus-4294	127	69	would	would	AUX
finefocus-4294	127	70	eliminate	eliminate	VERB
finefocus-4294	127	71	iron	iron	NOUN
finefocus-4294	127	72	-	-	PUNCT
finefocus-4294	127	73	coordination	coordination	NOUN
finefocus-4294	127	74	at	at	ADP
finefocus-4294	127	75	that	that	DET
finefocus-4294	127	76	site	site	NOUN
finefocus-4294	127	77	(	(	PUNCT
finefocus-4294	127	78	alanine	alanine	NOUN
finefocus-4294	127	79	)	)	PUNCT
finefocus-4294	127	80	.	.	PUNCT
finefocus-4294	128	1	this	this	PRON
finefocus-4294	128	2	afforded	afford	VERB
finefocus-4294	128	3	the	the	DET
finefocus-4294	128	4	opportunity	opportunity	NOUN
finefocus-4294	128	5	to	to	PART
finefocus-4294	128	6	evaluate	evaluate	VERB
finefocus-4294	128	7	the	the	DET
finefocus-4294	128	8	effects	effect	NOUN
finefocus-4294	128	9	not	not	PART
finefocus-4294	128	10	only	only	ADV
finefocus-4294	128	11	of	of	ADP
finefocus-4294	128	12	eliminating	eliminate	VERB
finefocus-4294	128	13	iron	iron	NOUN
finefocus-4294	128	14	coordination	coordination	NOUN
finefocus-4294	128	15	at	at	ADP
finefocus-4294	128	16	specific	specific	ADJ
finefocus-4294	128	17	sites	site	NOUN
finefocus-4294	128	18	,	,	PUNCT
finefocus-4294	128	19	but	but	CCONJ
finefocus-4294	128	20	also	also	ADV
finefocus-4294	128	21	the	the	DET
finefocus-4294	128	22	potential	potential	ADJ
finefocus-4294	128	23	beneficial	beneficial	ADJ
finefocus-4294	128	24	effects	effect	NOUN
finefocus-4294	128	25	of	of	ADP
finefocus-4294	128	26	remodeling	remodel	VERB
finefocus-4294	128	27	the	the	DET
finefocus-4294	128	28	active	active	ADJ
finefocus-4294	128	29	site	site	NOUN
finefocus-4294	128	30	and/or	and/or	CCONJ
finefocus-4294	128	31	altering	alter	VERB
finefocus-4294	128	32	the	the	DET
finefocus-4294	128	33	electronics	electronic	NOUN
finefocus-4294	128	34	of	of	ADP
finefocus-4294	128	35	the	the	DET
finefocus-4294	128	36	catalytic	catalytic	ADJ
finefocus-4294	128	37	iron	iron	NOUN
finefocus-4294	128	38	center	center	NOUN
finefocus-4294	128	39	by	by	ADP
finefocus-4294	128	40	changing	change	VERB
finefocus-4294	128	41	the	the	DET
finefocus-4294	128	42	iron	iron	NOUN
finefocus-4294	128	43	coordinating	coordinating	NOUN
finefocus-4294	128	44	residues	residue	NOUN
finefocus-4294	128	45	while	while	SCONJ
finefocus-4294	128	46	maintaining	maintain	VERB
finefocus-4294	128	47	iron	iron	NOUN
finefocus-4294	128	48	coordination	coordination	NOUN
finefocus-4294	128	49	.	.	PUNCT
finefocus-4294	129	1	once	once	ADV
finefocus-4294	129	2	the	the	DET
finefocus-4294	129	3	successful	successful	ADJ
finefocus-4294	129	4	generation	generation	NOUN
finefocus-4294	129	5	of	of	ADP
finefocus-4294	129	6	the	the	DET
finefocus-4294	129	7	targeted	target	VERB
finefocus-4294	129	8	tdo	tdo	PROPN
finefocus-4294	129	9	variants	variant	NOUN
finefocus-4294	129	10	had	have	AUX
finefocus-4294	129	11	been	be	AUX
finefocus-4294	129	12	confirmed	confirm	VERB
finefocus-4294	129	13	,	,	PUNCT
finefocus-4294	129	14	the	the	DET
finefocus-4294	129	15	next	next	ADJ
finefocus-4294	129	16	step	step	NOUN
finefocus-4294	129	17	was	be	AUX
finefocus-4294	129	18	to	to	PART
finefocus-4294	129	19	test	test	VERB
finefocus-4294	129	20	the	the	DET
finefocus-4294	129	21	cis	cis	NOUN
finefocus-4294	129	22	-	-	PUNCT
finefocus-4294	129	23	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	129	24	activity	activity	NOUN
finefocus-4294	129	25	of	of	ADP
finefocus-4294	129	26	these	these	DET
finefocus-4294	129	27	variants	variant	NOUN
finefocus-4294	129	28	.	.	PUNCT
finefocus-4294	130	1	as	as	SCONJ
finefocus-4294	130	2	the	the	DET
finefocus-4294	130	3	possibility	possibility	NOUN
finefocus-4294	130	4	existed	exist	VERB
finefocus-4294	130	5	that	that	SCONJ
finefocus-4294	130	6	the	the	DET
finefocus-4294	130	7	introduced	introduce	VERB
finefocus-4294	130	8	mutations	mutation	NOUN
finefocus-4294	130	9	would	would	AUX
finefocus-4294	130	10	cause	cause	VERB
finefocus-4294	130	11	the	the	DET
finefocus-4294	130	12	structure	structure	NOUN
finefocus-4294	130	13	of	of	ADP
finefocus-4294	130	14	the	the	DET
finefocus-4294	130	15	tdo	tdo	PROPN
finefocus-4294	130	16	active	active	ADJ
finefocus-4294	130	17	site	site	NOUN
finefocus-4294	130	18	to	to	PART
finefocus-4294	130	19	be	be	AUX
finefocus-4294	130	20	altered	alter	VERB
finefocus-4294	130	21	,	,	PUNCT
finefocus-4294	130	22	while	while	SCONJ
finefocus-4294	130	23	retaining	retain	VERB
finefocus-4294	130	24	some	some	DET
finefocus-4294	130	25	cis	cis	NOUN
finefocus-4294	130	26	-	-	PUNCT
finefocus-4294	130	27	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	130	28	activity	activity	NOUN
finefocus-4294	130	29	,	,	PUNCT
finefocus-4294	130	30	it	it	PRON
finefocus-4294	130	31	was	be	AUX
finefocus-4294	130	32	determined	determine	VERB
finefocus-4294	130	33	that	that	SCONJ
finefocus-4294	130	34	the	the	DET
finefocus-4294	130	35	enzyme	enzyme	NOUN
finefocus-4294	130	36	variants	variant	NOUN
finefocus-4294	130	37	should	should	AUX
finefocus-4294	130	38	be	be	AUX
finefocus-4294	130	39	tested	test	VERB
finefocus-4294	130	40	on	on	ADP
finefocus-4294	130	41	a	a	DET
finefocus-4294	130	42	small	small	ADJ
finefocus-4294	130	43	library	library	NOUN
finefocus-4294	130	44	of	of	ADP
finefocus-4294	130	45	diverse	diverse	ADJ
finefocus-4294	130	46	aromatic	aromatic	ADJ
finefocus-4294	130	47	substrates	substrate	NOUN
finefocus-4294	130	48	.	.	PUNCT
finefocus-4294	131	1	these	these	DET
finefocus-4294	131	2	aromatic	aromatic	ADJ
finefocus-4294	131	3	substrates	substrate	NOUN
finefocus-4294	131	4	included	include	VERB
finefocus-4294	131	5	the	the	DET
finefocus-4294	131	6	native	native	ADJ
finefocus-4294	131	7	substrate	substrate	NOUN
finefocus-4294	131	8	(	(	PUNCT
finefocus-4294	131	9	toluene	toluene	NOUN
finefocus-4294	131	10	)	)	PUNCT
finefocus-4294	131	11	,	,	PUNCT
finefocus-4294	131	12	one	one	NUM
finefocus-4294	131	13	polar	polar	ADJ
finefocus-4294	131	14	substrate	substrate	NOUN
finefocus-4294	131	15	for	for	ADP
finefocus-4294	131	16	which	which	PRON
finefocus-4294	131	17	the	the	DET
finefocus-4294	131	18	native	native	ADJ
finefocus-4294	131	19	enzyme	enzyme	NOUN
finefocus-4294	131	20	possesses	possess	VERB
finefocus-4294	131	21	high	high	ADJ
finefocus-4294	131	22	activity	activity	NOUN
finefocus-4294	131	23	(	(	PUNCT
finefocus-4294	131	24	benzyl	benzyl	NOUN
finefocus-4294	131	25	alcohol	alcohol	NOUN
finefocus-4294	131	26	)	)	PUNCT
finefocus-4294	131	27	,	,	PUNCT
finefocus-4294	131	28	one	one	NUM
finefocus-4294	131	29	polar	polar	ADJ
finefocus-4294	131	30	substrate	substrate	NOUN
finefocus-4294	131	31	for	for	ADP
finefocus-4294	131	32	which	which	PRON
finefocus-4294	131	33	the	the	DET
finefocus-4294	131	34	native	native	ADJ
finefocus-4294	131	35	enzyme	enzyme	NOUN
finefocus-4294	131	36	possesses	possess	VERB
finefocus-4294	131	37	moderate	moderate	ADJ
finefocus-4294	131	38	activity	activity	NOUN
finefocus-4294	131	39	(	(	PUNCT
finefocus-4294	131	40	benzyl	benzyl	NOUN
finefocus-4294	131	41	acetate	acetate	NOUN
finefocus-4294	131	42	)	)	PUNCT
finefocus-4294	131	43	,	,	PUNCT
finefocus-4294	131	44	three	three	NUM
finefocus-4294	131	45	polar	polar	ADJ
finefocus-4294	131	46	substrates	substrate	NOUN
finefocus-4294	131	47	for	for	ADP
finefocus-4294	131	48	which	which	PRON
finefocus-4294	131	49	the	the	DET
finefocus-4294	131	50	native	native	ADJ
finefocus-4294	131	51	enzyme	enzyme	NOUN
finefocus-4294	131	52	possess	possess	VERB
finefocus-4294	131	53	little	little	ADJ
finefocus-4294	131	54	or	or	CCONJ
finefocus-4294	131	55	no	no	PRON
finefocus-4294	131	56	activity	activity	NOUN
finefocus-4294	131	57	(	(	PUNCT
finefocus-4294	131	58	methyl	methyl	NOUN
finefocus-4294	131	59	benzoate	benzoate	NOUN
finefocus-4294	131	60	,	,	PUNCT
finefocus-4294	131	61	benzyl	benzyl	NOUN
finefocus-4294	131	62	acetamide	acetamide	NOUN
finefocus-4294	131	63	,	,	PUNCT
finefocus-4294	131	64	and	and	CCONJ
finefocus-4294	131	65	benzylamine	benzylamine	NOUN
finefocus-4294	131	66	)	)	PUNCT
finefocus-4294	131	67	,	,	PUNCT
finefocus-4294	131	68	and	and	CCONJ
finefocus-4294	131	69	two	two	NUM
finefocus-4294	131	70	sterically	sterically	ADV
finefocus-4294	131	71	bulky	bulky	ADJ
finefocus-4294	131	72	substrates	substrate	NOUN
finefocus-4294	131	73	for	for	ADP
finefocus-4294	131	74	which	which	PRON
finefocus-4294	131	75	the	the	DET
finefocus-4294	131	76	native	native	ADJ
finefocus-4294	131	77	enzyme	enzyme	NOUN
finefocus-4294	131	78	possesses	possess	VERB
finefocus-4294	131	79	low	low	ADJ
finefocus-4294	131	80	activity	activity	NOUN
finefocus-4294	131	81	(	(	PUNCT
finefocus-4294	131	82	n	n	CCONJ
finefocus-4294	131	83	-	-	PUNCT
finefocus-4294	131	84	butyl	butyl	NOUN
finefocus-4294	131	85	benzene	benzene	NOUN
finefocus-4294	131	86	and	and	CCONJ
finefocus-4294	131	87	t	t	PROPN
finefocus-4294	131	88	-	-	PUNCT
finefocus-4294	131	89	butyl	butyl	NOUN
finefocus-4294	131	90	benzene	benzene	NOUN
finefocus-4294	131	91	)	)	PUNCT
finefocus-4294	131	92	(	(	PUNCT
finefocus-4294	131	93	figure	figure	NOUN
finefocus-4294	131	94	5	5	NUM
finefocus-4294	131	95	)	)	PUNCT
finefocus-4294	131	96	.	.	PUNCT
finefocus-4294	132	1	by	by	ADP
finefocus-4294	132	2	testing	test	VERB
finefocus-4294	132	3	the	the	DET
finefocus-4294	132	4	activity	activity	NOUN
finefocus-4294	132	5	of	of	ADP
finefocus-4294	132	6	the	the	DET
finefocus-4294	132	7	designed	design	VERB
finefocus-4294	132	8	mutants	mutant	NOUN
finefocus-4294	132	9	across	across	ADP
finefocus-4294	132	10	these	these	DET
finefocus-4294	132	11	substrates	substrate	NOUN
finefocus-4294	132	12	,	,	PUNCT
finefocus-4294	132	13	it	it	PRON
finefocus-4294	132	14	would	would	AUX
finefocus-4294	132	15	be	be	AUX
finefocus-4294	132	16	possible	possible	ADJ
finefocus-4294	132	17	to	to	PART
finefocus-4294	132	18	determine	determine	VERB
finefocus-4294	132	19	whether	whether	SCONJ
finefocus-4294	132	20	the	the	DET
finefocus-4294	132	21	introduced	introduce	VERB
finefocus-4294	132	22	mutations	mutation	NOUN
finefocus-4294	132	23	had	have	VERB
finefocus-4294	132	24	advantageous	advantageous	ADJ
finefocus-4294	132	25	or	or	CCONJ
finefocus-4294	132	26	detrimental	detrimental	ADJ
finefocus-4294	132	27	effects	effect	NOUN
finefocus-4294	132	28	in	in	ADP
finefocus-4294	132	29	the	the	DET
finefocus-4294	132	30	cis	cis	NOUN
finefocus-4294	132	31	-	-	PUNCT
finefocus-4294	132	32	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	132	33	of	of	ADP
finefocus-4294	132	34	the	the	DET
finefocus-4294	132	35	native	native	ADJ
finefocus-4294	132	36	substrate	substrate	NOUN
finefocus-4294	132	37	,	,	PUNCT
finefocus-4294	132	38	as	as	ADV
finefocus-4294	132	39	well	well	ADV
finefocus-4294	132	40	as	as	ADP
finefocus-4294	132	41	in	in	ADP
finefocus-4294	132	42	the	the	DET
finefocus-4294	132	43	cis	cis	NOUN
finefocus-4294	132	44	-	-	PUNCT
finefocus-4294	132	45	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	132	46	of	of	ADP
finefocus-4294	132	47	both	both	DET
finefocus-4294	132	48	sterically	sterically	ADV
finefocus-4294	132	49	bulky	bulky	ADJ
finefocus-4294	132	50	and	and	CCONJ
finefocus-4294	132	51	polar	polar	ADJ
finefocus-4294	132	52	classes	class	NOUN
finefocus-4294	132	53	of	of	ADP
finefocus-4294	132	54	substrates	substrate	NOUN
finefocus-4294	132	55	.	.	PUNCT
finefocus-4294	133	1	upon	upon	SCONJ
finefocus-4294	133	2	testing	test	VERB
finefocus-4294	133	3	the	the	DET
finefocus-4294	133	4	activity	activity	NOUN
finefocus-4294	133	5	of	of	ADP
finefocus-4294	133	6	each	each	DET
finefocus-4294	133	7	designed	design	VERB
finefocus-4294	133	8	tdo	tdo	PROPN
finefocus-4294	133	9	mutant	mutant	NOUN
finefocus-4294	133	10	for	for	ADP
finefocus-4294	133	11	all	all	DET
finefocus-4294	133	12	the	the	DET
finefocus-4294	133	13	designated	designate	VERB
finefocus-4294	133	14	substrates	substrate	NOUN
finefocus-4294	133	15	,	,	PUNCT
finefocus-4294	133	16	it	it	PRON
finefocus-4294	133	17	was	be	AUX
finefocus-4294	133	18	revealed	reveal	VERB
finefocus-4294	133	19	that	that	SCONJ
finefocus-4294	133	20	none	none	NOUN
finefocus-4294	133	21	of	of	ADP
finefocus-4294	133	22	the	the	DET
finefocus-4294	133	23	mutants	mutant	NOUN
finefocus-4294	133	24	designed	design	VERB
finefocus-4294	133	25	in	in	ADP
finefocus-4294	133	26	this	this	DET
finefocus-4294	133	27	study	study	NOUN
finefocus-4294	133	28	possessed	possess	VERB
finefocus-4294	133	29	activity	activity	NOUN
finefocus-4294	133	30	for	for	ADP
finefocus-4294	133	31	any	any	PRON
finefocus-4294	133	32	of	of	ADP
finefocus-4294	133	33	the	the	DET
finefocus-4294	133	34	diverse	diverse	ADJ
finefocus-4294	133	35	substrates	substrate	NOUN
finefocus-4294	133	36	selected	select	VERB
finefocus-4294	133	37	(	(	PUNCT
finefocus-4294	133	38	figure	figure	NOUN
finefocus-4294	133	39	6	6	NUM
finefocus-4294	133	40	)	)	PUNCT
finefocus-4294	133	41	.	.	PUNCT
finefocus-4294	134	1	these	these	DET
finefocus-4294	134	2	results	result	NOUN
finefocus-4294	134	3	revealed	reveal	VERB
finefocus-4294	134	4	the	the	DET
finefocus-4294	134	5	critical	critical	ADJ
finefocus-4294	134	6	role	role	NOUN
finefocus-4294	134	7	played	play	VERB
finefocus-4294	134	8	by	by	ADP
finefocus-4294	134	9	the	the	DET
finefocus-4294	134	10	iron	iron	NOUN
finefocus-4294	134	11	-	-	PUNCT
finefocus-4294	134	12	coordinating	coordinate	VERB
finefocus-4294	134	13	residues	residue	NOUN
finefocus-4294	134	14	of	of	ADP
finefocus-4294	134	15	rieske	rieske	ADJ
finefocus-4294	134	16	dioxygenases	dioxygenase	NOUN
finefocus-4294	134	17	in	in	ADP
finefocus-4294	134	18	their	their	PRON
finefocus-4294	134	19	native	native	ADJ
finefocus-4294	134	20	state	state	NOUN
finefocus-4294	134	21	,	,	PUNCT
finefocus-4294	134	22	as	as	ADP
finefocus-4294	134	23	any	any	DET
finefocus-4294	134	24	alteration	alteration	NOUN
finefocus-4294	134	25	of	of	ADP
finefocus-4294	134	26	these	these	DET
finefocus-4294	134	27	residues	residue	NOUN
finefocus-4294	134	28	,	,	PUNCT
finefocus-4294	134	29	either	either	CCONJ
finefocus-4294	134	30	to	to	ADP
finefocus-4294	134	31	other	other	ADJ
finefocus-4294	134	32	residues	residue	NOUN
finefocus-4294	134	33	with	with	ADP
finefocus-4294	134	34	the	the	DET
finefocus-4294	134	35	potential	potential	NOUN
finefocus-4294	134	36	for	for	ADP
finefocus-4294	134	37	iron	iron	NOUN
finefocus-4294	134	38	-	-	PUNCT
finefocus-4294	134	39	coordination	coordination	NOUN
finefocus-4294	134	40	or	or	CCONJ
finefocus-4294	134	41	to	to	ADP
finefocus-4294	134	42	residues	residue	NOUN
finefocus-4294	134	43	incapable	incapable	ADJ
finefocus-4294	134	44	of	of	ADP
finefocus-4294	134	45	coordinating	coordinate	VERB
finefocus-4294	134	46	iron	iron	NOUN
finefocus-4294	134	47	,	,	PUNCT
finefocus-4294	134	48	resulted	result	VERB
finefocus-4294	134	49	in	in	ADP
finefocus-4294	134	50	complete	complete	ADJ
finefocus-4294	134	51	ablation	ablation	NOUN
finefocus-4294	134	52	of	of	ADP
finefocus-4294	134	53	enzyme	enzyme	NOUN
finefocus-4294	134	54	activity	activity	NOUN
finefocus-4294	134	55	.	.	PUNCT
finefocus-4294	135	1	although	although	SCONJ
finefocus-4294	135	2	the	the	DET
finefocus-4294	135	3	hypothesis	hypothesis	NOUN
finefocus-4294	135	4	that	that	PRON
finefocus-4294	135	5	the	the	DET
finefocus-4294	135	6	mutations	mutation	NOUN
finefocus-4294	135	7	introduced	introduce	VERB
finefocus-4294	135	8	in	in	ADP
finefocus-4294	135	9	this	this	DET
finefocus-4294	135	10	study	study	NOUN
finefocus-4294	135	11	would	would	AUX
finefocus-4294	135	12	significantly	significantly	ADV
finefocus-4294	135	13	alter	alter	VERB
finefocus-4294	135	14	the	the	DET
finefocus-4294	135	15	activity	activity	NOUN
finefocus-4294	135	16	and/or	and/or	CCONJ
finefocus-4294	135	17	substrate	substrate	NOUN
finefocus-4294	135	18	scope	scope	NOUN
finefocus-4294	135	19	of	of	ADP
finefocus-4294	135	20	the	the	DET
finefocus-4294	135	21	enzyme	enzyme	NOUN
finefocus-4294	135	22	was	be	AUX
finefocus-4294	135	23	proven	prove	VERB
finefocus-4294	135	24	correct	correct	ADJ
finefocus-4294	135	25	,	,	PUNCT
finefocus-4294	135	26	these	these	DET
finefocus-4294	135	27	changes	change	NOUN
finefocus-4294	135	28	were	be	AUX
finefocus-4294	135	29	shown	show	VERB
finefocus-4294	135	30	not	not	PART
finefocus-4294	135	31	to	to	PART
finefocus-4294	135	32	be	be	AUX
finefocus-4294	135	33	beneficial	beneficial	ADJ
finefocus-4294	135	34	for	for	ADP
finefocus-4294	135	35	enzyme	enzyme	NOUN
finefocus-4294	135	36	activity	activity	NOUN
finefocus-4294	135	37	.	.	PUNCT
finefocus-4294	136	1	the	the	DET
finefocus-4294	136	2	loss	loss	NOUN
finefocus-4294	136	3	of	of	ADP
finefocus-4294	136	4	activity	activity	NOUN
finefocus-4294	136	5	observed	observe	VERB
finefocus-4294	136	6	with	with	ADP
finefocus-4294	136	7	mutations	mutation	NOUN
finefocus-4294	136	8	to	to	ADP
finefocus-4294	136	9	non	non	ADJ
finefocus-4294	136	10	-	-	ADJ
finefocus-4294	136	11	coordinating	coordinating	ADJ
finefocus-4294	136	12	alanine	alanine	NOUN
finefocus-4294	136	13	likely	likely	ADV
finefocus-4294	136	14	indicates	indicate	VERB
finefocus-4294	136	15	that	that	SCONJ
finefocus-4294	136	16	coordination	coordination	NOUN
finefocus-4294	136	17	by	by	ADP
finefocus-4294	136	18	three	three	NUM
finefocus-4294	136	19	residues	residue	NOUN
finefocus-4294	136	20	is	be	AUX
finefocus-4294	136	21	essential	essential	ADJ
finefocus-4294	136	22	for	for	SCONJ
finefocus-4294	136	23	iron	iron	NOUN
finefocus-4294	136	24	to	to	PART
finefocus-4294	136	25	be	be	AUX
finefocus-4294	136	26	bound	bind	VERB
finefocus-4294	136	27	to	to	ADP
finefocus-4294	136	28	the	the	DET
finefocus-4294	136	29	active	active	ADJ
finefocus-4294	136	30	site	site	NOUN
finefocus-4294	136	31	of	of	ADP
finefocus-4294	136	32	rieske	rieske	ADJ
finefocus-4294	136	33	dioxygenases	dioxygenase	NOUN
finefocus-4294	136	34	in	in	ADP
finefocus-4294	136	35	a	a	DET
finefocus-4294	136	36	catalytically	catalytically	ADV
finefocus-4294	136	37	active	active	ADJ
finefocus-4294	136	38	state	state	NOUN
finefocus-4294	136	39	.	.	PUNCT
finefocus-4294	137	1	the	the	DET
finefocus-4294	137	2	loss	loss	NOUN
finefocus-4294	137	3	of	of	ADP
finefocus-4294	137	4	activity	activity	NOUN
finefocus-4294	137	5	observed	observe	VERB
finefocus-4294	137	6	with	with	ADP
finefocus-4294	137	7	mutations	mutation	NOUN
finefocus-4294	137	8	to	to	PART
finefocus-4294	137	9	alternate	alternate	VERB
finefocus-4294	137	10	iron	iron	NOUN
finefocus-4294	137	11	-	-	PUNCT
finefocus-4294	137	12	coordinating	coordinating	NOUN
finefocus-4294	137	13	resides	reside	VERB
finefocus-4294	137	14	may	may	AUX
finefocus-4294	137	15	indicate	indicate	VERB
finefocus-4294	137	16	that	that	SCONJ
finefocus-4294	137	17	these	these	DET
finefocus-4294	137	18	alterations	alteration	NOUN
finefocus-4294	137	19	result	result	VERB
finefocus-4294	137	20	in	in	ADP
finefocus-4294	137	21	a	a	DET
finefocus-4294	137	22	significant	significant	ADJ
finefocus-4294	137	23	remodeling	remodeling	NOUN
finefocus-4294	137	24	of	of	ADP
finefocus-4294	137	25	the	the	DET
finefocus-4294	137	26	active	active	ADJ
finefocus-4294	137	27	site	site	NOUN
finefocus-4294	137	28	that	that	PRON
finefocus-4294	137	29	prevents	prevent	VERB
finefocus-4294	137	30	iron	iron	NOUN
finefocus-4294	137	31	from	from	ADP
finefocus-4294	137	32	binding	bind	VERB
finefocus-4294	137	33	in	in	ADP
finefocus-4294	137	34	a	a	DET
finefocus-4294	137	35	catalytically	catalytically	ADV
finefocus-4294	137	36	active	active	ADJ
finefocus-4294	137	37	state	state	NOUN
finefocus-4294	137	38	.	.	PUNCT
finefocus-4294	138	1	alternately	alternately	ADV
finefocus-4294	138	2	,	,	PUNCT
finefocus-4294	138	3	these	these	DET
finefocus-4294	138	4	results	result	NOUN
finefocus-4294	138	5	may	may	AUX
finefocus-4294	138	6	indicate	indicate	VERB
finefocus-4294	138	7	that	that	SCONJ
finefocus-4294	138	8	the	the	DET
finefocus-4294	138	9	active	active	ADJ
finefocus-4294	138	10	site	site	NOUN
finefocus-4294	138	11	iron	iron	NOUN
finefocus-4294	138	12	of	of	ADP
finefocus-4294	138	13	rieske	rieske	ADJ
finefocus-4294	138	14	dioxygenases	dioxygenase	NOUN
finefocus-4294	138	15	must	must	AUX
finefocus-4294	138	16	specifically	specifically	ADV
finefocus-4294	138	17	be	be	AUX
finefocus-4294	138	18	bound	bind	VERB
finefocus-4294	138	19	by	by	ADP
finefocus-4294	138	20	two	two	NUM
finefocus-4294	138	21	histidine	histidine	NOUN
finefocus-4294	138	22	residues	residue	NOUN
finefocus-4294	138	23	and	and	CCONJ
finefocus-4294	138	24	one	one	NUM
finefocus-4294	138	25	aspartate	aspartate	NOUN
finefocus-4294	138	26	residue	residue	NOUN
finefocus-4294	138	27	to	to	PART
finefocus-4294	138	28	effectively	effectively	ADV
finefocus-4294	138	29	participate	participate	VERB
finefocus-4294	138	30	in	in	ADP
finefocus-4294	138	31	the	the	DET
finefocus-4294	138	32	catalytic	catalytic	ADJ
finefocus-4294	138	33	mechanism	mechanism	NOUN
finefocus-4294	138	34	.	.	PUNCT
finefocus-4294	139	1	further	further	ADJ
finefocus-4294	139	2	studies	study	NOUN
finefocus-4294	139	3	,	,	PUNCT
finefocus-4294	139	4	including	include	VERB
finefocus-4294	139	5	enzyme	enzyme	NOUN
finefocus-4294	139	6	structure	structure	NOUN
finefocus-4294	139	7	elucidation	elucidation	NOUN
finefocus-4294	139	8	/	/	SYM
finefocus-4294	139	9	homology	homology	NOUN
finefocus-4294	139	10	modeling	modeling	NOUN
finefocus-4294	139	11	,	,	PUNCT
finefocus-4294	139	12	fine	fine	ADJ
finefocus-4294	139	13	focus	focus	NOUN
finefocus-4294	139	14	|	|	ADV
finefocus-4294	139	15	volume	volume	VERB
finefocus-4294	139	16	10102	10102	NUM
finefocus-4294	139	17	docking	docking	NOUN
finefocus-4294	139	18	analysis	analysis	NOUN
finefocus-4294	139	19	,	,	PUNCT
finefocus-4294	139	20	and	and	CCONJ
finefocus-4294	139	21	molecular	molecular	ADJ
finefocus-4294	139	22	dynamics	dynamic	NOUN
finefocus-4294	139	23	simulations	simulation	NOUN
finefocus-4294	139	24	are	be	AUX
finefocus-4294	139	25	required	require	VERB
finefocus-4294	139	26	to	to	PART
finefocus-4294	139	27	precisely	precisely	ADV
finefocus-4294	139	28	elucidate	elucidate	VERB
finefocus-4294	139	29	the	the	DET
finefocus-4294	139	30	cause	cause	NOUN
finefocus-4294	139	31	of	of	ADP
finefocus-4294	139	32	the	the	DET
finefocus-4294	139	33	loss	loss	NOUN
finefocus-4294	139	34	of	of	ADP
finefocus-4294	139	35	activity	activity	NOUN
finefocus-4294	139	36	observed	observe	VERB
finefocus-4294	139	37	from	from	ADP
finefocus-4294	139	38	these	these	DET
finefocus-4294	139	39	alterations	alteration	NOUN
finefocus-4294	139	40	to	to	ADP
finefocus-4294	139	41	the	the	DET
finefocus-4294	139	42	iron	iron	NOUN
finefocus-4294	139	43	-	-	PUNCT
finefocus-4294	139	44	coordinating	coordinate	VERB
finefocus-4294	139	45	residues	residue	NOUN
finefocus-4294	139	46	.	.	PUNCT
finefocus-4294	140	1	these	these	DET
finefocus-4294	140	2	studies	study	NOUN
finefocus-4294	140	3	will	will	AUX
finefocus-4294	140	4	be	be	AUX
finefocus-4294	140	5	performed	perform	VERB
finefocus-4294	140	6	in	in	ADP
finefocus-4294	140	7	due	due	ADJ
finefocus-4294	140	8	course	course	NOUN
finefocus-4294	140	9	.	.	PUNCT
finefocus-4294	141	1	although	although	SCONJ
finefocus-4294	141	2	this	this	DET
finefocus-4294	141	3	study	study	NOUN
finefocus-4294	141	4	did	do	AUX
finefocus-4294	141	5	not	not	PART
finefocus-4294	141	6	succeed	succeed	VERB
finefocus-4294	141	7	in	in	ADP
finefocus-4294	141	8	producing	produce	VERB
finefocus-4294	141	9	novel	novel	ADJ
finefocus-4294	141	10	tdo	tdo	PROPN
finefocus-4294	141	11	variants	variant	NOUN
finefocus-4294	141	12	with	with	ADP
finefocus-4294	141	13	improved	improved	ADJ
finefocus-4294	141	14	or	or	CCONJ
finefocus-4294	141	15	expanded	expand	VERB
finefocus-4294	141	16	activity	activity	NOUN
finefocus-4294	141	17	,	,	PUNCT
finefocus-4294	141	18	the	the	DET
finefocus-4294	141	19	results	result	NOUN
finefocus-4294	141	20	described	describe	VERB
finefocus-4294	141	21	will	will	AUX
finefocus-4294	141	22	serve	serve	VERB
finefocus-4294	141	23	to	to	PART
finefocus-4294	141	24	guide	guide	VERB
finefocus-4294	141	25	future	future	ADJ
finefocus-4294	141	26	studies	study	NOUN
finefocus-4294	141	27	targeting	target	VERB
finefocus-4294	141	28	the	the	DET
finefocus-4294	141	29	engineering	engineering	NOUN
finefocus-4294	141	30	of	of	ADP
finefocus-4294	141	31	rieske	rieske	ADJ
finefocus-4294	141	32	dioxygenases	dioxygenase	NOUN
finefocus-4294	141	33	.	.	PUNCT
finefocus-4294	142	1	with	with	ADP
finefocus-4294	142	2	the	the	DET
finefocus-4294	142	3	increasing	increase	VERB
finefocus-4294	142	4	recognition	recognition	NOUN
finefocus-4294	142	5	of	of	ADP
finefocus-4294	142	6	the	the	DET
finefocus-4294	142	7	need	need	NOUN
finefocus-4294	142	8	to	to	PART
finefocus-4294	142	9	employ	employ	VERB
finefocus-4294	142	10	more	more	ADV
finefocus-4294	142	11	sustainable	sustainable	ADJ
finefocus-4294	142	12	techniques	technique	NOUN
finefocus-4294	142	13	in	in	ADP
finefocus-4294	142	14	the	the	DET
finefocus-4294	142	15	chemical	chemical	NOUN
finefocus-4294	142	16	industry	industry	NOUN
finefocus-4294	142	17	,	,	PUNCT
finefocus-4294	142	18	and	and	CCONJ
finefocus-4294	142	19	to	to	PART
finefocus-4294	142	20	remove	remove	VERB
finefocus-4294	142	21	harmful	harmful	ADJ
finefocus-4294	142	22	pollutants	pollutant	NOUN
finefocus-4294	142	23	in	in	ADP
finefocus-4294	142	24	contaminated	contaminated	ADJ
finefocus-4294	142	25	environments	environment	NOUN
finefocus-4294	142	26	,	,	PUNCT
finefocus-4294	142	27	the	the	DET
finefocus-4294	142	28	field	field	NOUN
finefocus-4294	142	29	of	of	ADP
finefocus-4294	142	30	enzyme	enzyme	NOUN
finefocus-4294	142	31	engineering	engineering	NOUN
finefocus-4294	142	32	will	will	AUX
finefocus-4294	142	33	continue	continue	VERB
finefocus-4294	142	34	to	to	PART
finefocus-4294	142	35	increase	increase	VERB
finefocus-4294	142	36	in	in	ADP
finefocus-4294	142	37	importance	importance	NOUN
finefocus-4294	142	38	.	.	PUNCT
finefocus-4294	143	1	this	this	PRON
finefocus-4294	143	2	is	be	AUX
finefocus-4294	143	3	reflected	reflect	VERB
finefocus-4294	143	4	in	in	ADP
finefocus-4294	143	5	the	the	DET
finefocus-4294	143	6	fact	fact	NOUN
finefocus-4294	143	7	that	that	SCONJ
finefocus-4294	143	8	the	the	DET
finefocus-4294	143	9	engineering	engineering	NOUN
finefocus-4294	143	10	of	of	ADP
finefocus-4294	143	11	rieske	rieske	ADJ
finefocus-4294	143	12	dioxygenases	dioxygenase	NOUN
finefocus-4294	143	13	to	to	PART
finefocus-4294	143	14	improve	improve	VERB
finefocus-4294	143	15	their	their	PRON
finefocus-4294	143	16	utility	utility	NOUN
finefocus-4294	143	17	either	either	CCONJ
finefocus-4294	143	18	as	as	ADP
finefocus-4294	143	19	green	green	ADJ
finefocus-4294	143	20	-	-	PUNCT
finefocus-4294	143	21	chemical	chemical	NOUN
finefocus-4294	143	22	catalysts	catalyst	NOUN
finefocus-4294	143	23	or	or	CCONJ
finefocus-4294	143	24	as	as	ADP
finefocus-4294	143	25	tools	tool	NOUN
finefocus-4294	143	26	for	for	ADP
finefocus-4294	143	27	the	the	DET
finefocus-4294	143	28	bioremediation	bioremediation	NOUN
finefocus-4294	143	29	of	of	ADP
finefocus-4294	143	30	contaminated	contaminated	ADJ
finefocus-4294	143	31	environments	environment	NOUN
finefocus-4294	143	32	continues	continue	VERB
finefocus-4294	143	33	to	to	PART
finefocus-4294	143	34	be	be	AUX
finefocus-4294	143	35	an	an	DET
finefocus-4294	143	36	active	active	ADJ
finefocus-4294	143	37	area	area	NOUN
finefocus-4294	143	38	of	of	ADP
finefocus-4294	143	39	research	research	NOUN
finefocus-4294	143	40	(	(	PUNCT
finefocus-4294	143	41	1	1	NUM
finefocus-4294	143	42	,	,	PUNCT
finefocus-4294	143	43	3	3	NUM
finefocus-4294	143	44	,	,	PUNCT
finefocus-4294	143	45	5	5	NUM
finefocus-4294	143	46	,	,	PUNCT
finefocus-4294	143	47	20	20	NUM
finefocus-4294	143	48	,	,	PUNCT
finefocus-4294	143	49	21	21	NUM
finefocus-4294	143	50	,	,	PUNCT
finefocus-4294	143	51	26	26	NUM
finefocus-4294	143	52	,	,	PUNCT
finefocus-4294	143	53	27	27	NUM
finefocus-4294	143	54	,	,	PUNCT
finefocus-4294	143	55	33	33	NUM
finefocus-4294	143	56	,	,	PUNCT
finefocus-4294	143	57	37	37	NUM
finefocus-4294	143	58	,	,	PUNCT
finefocus-4294	143	59	38	38	NUM
finefocus-4294	143	60	)	)	PUNCT
finefocus-4294	143	61	.	.	PUNCT
finefocus-4294	144	1	metagenomics	metagenomic	NOUN
finefocus-4294	144	2	research	research	NOUN
finefocus-4294	144	3	has	have	AUX
finefocus-4294	144	4	shown	show	VERB
finefocus-4294	144	5	that	that	SCONJ
finefocus-4294	144	6	rieske	rieske	ADJ
finefocus-4294	144	7	dioxygenases	dioxygenase	NOUN
finefocus-4294	144	8	commonly	commonly	ADV
finefocus-4294	144	9	evolve	evolve	VERB
finefocus-4294	144	10	among	among	ADP
finefocus-4294	144	11	soil	soil	NOUN
finefocus-4294	144	12	bacteria	bacteria	NOUN
finefocus-4294	144	13	(	(	PUNCT
finefocus-4294	144	14	17	17	NUM
finefocus-4294	144	15	)	)	PUNCT
finefocus-4294	144	16	,	,	PUNCT
finefocus-4294	144	17	meaning	mean	VERB
finefocus-4294	144	18	that	that	SCONJ
finefocus-4294	144	19	many	many	ADJ
finefocus-4294	144	20	unannotated	unannotate	VERB
finefocus-4294	144	21	rieske	rieske	ADJ
finefocus-4294	144	22	dioxygenases	dioxygenase	NOUN
finefocus-4294	144	23	remain	remain	VERB
finefocus-4294	144	24	to	to	PART
finefocus-4294	144	25	be	be	AUX
finefocus-4294	144	26	studied	study	VERB
finefocus-4294	144	27	in	in	ADP
finefocus-4294	144	28	the	the	DET
finefocus-4294	144	29	context	context	NOUN
finefocus-4294	144	30	of	of	ADP
finefocus-4294	144	31	enzyme	enzyme	NOUN
finefocus-4294	144	32	engineering	engineering	NOUN
finefocus-4294	144	33	.	.	PUNCT
finefocus-4294	145	1	as	as	SCONJ
finefocus-4294	145	2	the	the	DET
finefocus-4294	145	3	field	field	NOUN
finefocus-4294	145	4	of	of	ADP
finefocus-4294	145	5	microbiology	microbiology	NOUN
finefocus-4294	145	6	continues	continue	VERB
finefocus-4294	145	7	to	to	PART
finefocus-4294	145	8	discover	discover	VERB
finefocus-4294	145	9	more	more	ADV
finefocus-4294	145	10	diverse	diverse	ADJ
finefocus-4294	145	11	organisms	organism	NOUN
finefocus-4294	145	12	and	and	CCONJ
finefocus-4294	145	13	the	the	DET
finefocus-4294	145	14	powerful	powerful	ADJ
finefocus-4294	145	15	natural	natural	ADJ
finefocus-4294	145	16	catalysts	catalyst	NOUN
finefocus-4294	145	17	they	they	PRON
finefocus-4294	145	18	produce	produce	VERB
finefocus-4294	145	19	,	,	PUNCT
finefocus-4294	145	20	these	these	DET
finefocus-4294	145	21	new	new	ADJ
finefocus-4294	145	22	catalysts	catalyst	NOUN
finefocus-4294	145	23	will	will	AUX
finefocus-4294	145	24	provide	provide	VERB
finefocus-4294	145	25	valuable	valuable	ADJ
finefocus-4294	145	26	templates	template	NOUN
finefocus-4294	145	27	for	for	ADP
finefocus-4294	145	28	the	the	DET
finefocus-4294	145	29	field	field	NOUN
finefocus-4294	145	30	of	of	ADP
finefocus-4294	145	31	enzyme	enzyme	NOUN
finefocus-4294	145	32	engineering	engineering	NOUN
finefocus-4294	145	33	.	.	PUNCT
finefocus-4294	146	1	in	in	ADP
finefocus-4294	146	2	this	this	DET
finefocus-4294	146	3	way	way	NOUN
finefocus-4294	146	4	,	,	PUNCT
finefocus-4294	146	5	the	the	DET
finefocus-4294	146	6	natural	natural	ADJ
finefocus-4294	146	7	ecological	ecological	ADJ
finefocus-4294	146	8	role	role	NOUN
finefocus-4294	146	9	of	of	ADP
finefocus-4294	146	10	soil	soil	NOUN
finefocus-4294	146	11	organisms	organism	NOUN
finefocus-4294	146	12	can	can	AUX
finefocus-4294	146	13	be	be	AUX
finefocus-4294	146	14	harnessed	harness	VERB
finefocus-4294	146	15	and	and	CCONJ
finefocus-4294	146	16	enhanced	enhance	VERB
finefocus-4294	146	17	to	to	PART
finefocus-4294	146	18	create	create	VERB
finefocus-4294	146	19	a	a	DET
finefocus-4294	146	20	safer	safe	ADJ
finefocus-4294	146	21	and	and	CCONJ
finefocus-4294	146	22	more	more	ADV
finefocus-4294	146	23	sustainable	sustainable	ADJ
finefocus-4294	146	24	future	future	NOUN
finefocus-4294	146	25	.	.	PUNCT
finefocus-4294	147	1	this	this	DET
finefocus-4294	147	2	study	study	NOUN
finefocus-4294	147	3	,	,	PUNCT
finefocus-4294	147	4	by	by	ADP
finefocus-4294	147	5	demonstrating	demonstrate	VERB
finefocus-4294	147	6	the	the	DET
finefocus-4294	147	7	importance	importance	NOUN
finefocus-4294	147	8	of	of	ADP
finefocus-4294	147	9	preserving	preserve	VERB
finefocus-4294	147	10	key	key	ADJ
finefocus-4294	147	11	active	active	ADJ
finefocus-4294	147	12	site	site	NOUN
finefocus-4294	147	13	residues	residue	NOUN
finefocus-4294	147	14	in	in	ADP
finefocus-4294	147	15	the	the	DET
finefocus-4294	147	16	generation	generation	NOUN
finefocus-4294	147	17	of	of	ADP
finefocus-4294	147	18	rieske	rieske	ADJ
finefocus-4294	147	19	dioxygenase	dioxygenase	NOUN
finefocus-4294	147	20	mutant	mutant	NOUN
finefocus-4294	147	21	libraries	library	NOUN
finefocus-4294	147	22	in	in	ADP
finefocus-4294	147	23	the	the	DET
finefocus-4294	147	24	pursuit	pursuit	NOUN
finefocus-4294	147	25	of	of	ADP
finefocus-4294	147	26	enzyme	enzyme	NOUN
finefocus-4294	147	27	engineering	engineering	NOUN
finefocus-4294	147	28	,	,	PUNCT
finefocus-4294	147	29	will	will	AUX
finefocus-4294	147	30	inform	inform	VERB
finefocus-4294	147	31	and	and	CCONJ
finefocus-4294	147	32	expedite	expedite	VERB
finefocus-4294	147	33	these	these	DET
finefocus-4294	147	34	efforts	effort	NOUN
finefocus-4294	147	35	.	.	PUNCT
finefocus-4294	148	1	conclusions	conclusion	NOUN
finefocus-4294	148	2	inspired	inspire	VERB
finefocus-4294	148	3	by	by	ADP
finefocus-4294	148	4	recent	recent	ADJ
finefocus-4294	148	5	reports	report	NOUN
finefocus-4294	148	6	that	that	PRON
finefocus-4294	148	7	have	have	AUX
finefocus-4294	148	8	shown	show	VERB
finefocus-4294	148	9	that	that	SCONJ
finefocus-4294	148	10	the	the	DET
finefocus-4294	148	11	alteration	alteration	NOUN
finefocus-4294	148	12	of	of	ADP
finefocus-4294	148	13	iron	iron	NOUN
finefocus-4294	148	14	-	-	PUNCT
finefocus-4294	148	15	coordinating	coordinate	VERB
finefocus-4294	148	16	residues	residue	NOUN
finefocus-4294	148	17	in	in	ADP
finefocus-4294	148	18	metalloenzymes	metalloenzyme	NOUN
finefocus-4294	148	19	can	can	AUX
finefocus-4294	148	20	alter	alter	VERB
finefocus-4294	148	21	or	or	CCONJ
finefocus-4294	148	22	even	even	ADV
finefocus-4294	148	23	improve	improve	VERB
finefocus-4294	148	24	the	the	DET
finefocus-4294	148	25	activity	activity	NOUN
finefocus-4294	148	26	of	of	ADP
finefocus-4294	148	27	these	these	DET
finefocus-4294	148	28	enzymes	enzyme	NOUN
finefocus-4294	148	29	in	in	ADP
finefocus-4294	148	30	certain	certain	ADJ
finefocus-4294	148	31	contexts	context	NOUN
finefocus-4294	148	32	(	(	PUNCT
finefocus-4294	148	33	29	29	NUM
finefocus-4294	148	34	,	,	PUNCT
finefocus-4294	148	35	40	40	NUM
finefocus-4294	148	36	)	)	PUNCT
finefocus-4294	148	37	,	,	PUNCT
finefocus-4294	148	38	the	the	DET
finefocus-4294	148	39	iron	iron	NOUN
finefocus-4294	148	40	-	-	PUNCT
finefocus-4294	148	41	coordinating	coordinate	VERB
finefocus-4294	148	42	residues	residue	NOUN
finefocus-4294	148	43	of	of	ADP
finefocus-4294	148	44	toluene	toluene	ADJ
finefocus-4294	148	45	dioxygenase	dioxygenase	NOUN
finefocus-4294	148	46	(	(	PUNCT
finefocus-4294	148	47	tdo	tdo	PROPN
finefocus-4294	148	48	)	)	PUNCT
finefocus-4294	148	49	were	be	AUX
finefocus-4294	148	50	comprehensively	comprehensively	ADV
finefocus-4294	148	51	mutated	mutate	VERB
finefocus-4294	148	52	in	in	ADP
finefocus-4294	148	53	this	this	DET
finefocus-4294	148	54	study	study	NOUN
finefocus-4294	148	55	.	.	PUNCT
finefocus-4294	149	1	these	these	DET
finefocus-4294	149	2	residues	residue	NOUN
finefocus-4294	149	3	were	be	AUX
finefocus-4294	149	4	mutated	mutate	VERB
finefocus-4294	149	5	both	both	PRON
finefocus-4294	149	6	to	to	PART
finefocus-4294	149	7	alternate	alternate	VERB
finefocus-4294	149	8	residues	residue	NOUN
finefocus-4294	149	9	that	that	PRON
finefocus-4294	149	10	are	be	AUX
finefocus-4294	149	11	capable	capable	ADJ
finefocus-4294	149	12	of	of	ADP
finefocus-4294	149	13	coordinating	coordinate	VERB
finefocus-4294	149	14	iron	iron	NOUN
finefocus-4294	149	15	and	and	CCONJ
finefocus-4294	149	16	to	to	ADP
finefocus-4294	149	17	a	a	DET
finefocus-4294	149	18	residue	residue	NOUN
finefocus-4294	149	19	that	that	PRON
finefocus-4294	149	20	is	be	AUX
finefocus-4294	149	21	incapable	incapable	ADJ
finefocus-4294	149	22	of	of	ADP
finefocus-4294	149	23	iron	iron	NOUN
finefocus-4294	149	24	coordination	coordination	NOUN
finefocus-4294	149	25	.	.	PUNCT
finefocus-4294	150	1	following	follow	VERB
finefocus-4294	150	2	the	the	DET
finefocus-4294	150	3	confirmation	confirmation	NOUN
finefocus-4294	150	4	of	of	ADP
finefocus-4294	150	5	successful	successful	ADJ
finefocus-4294	150	6	mutagenesis	mutagenesis	NOUN
finefocus-4294	150	7	,	,	PUNCT
finefocus-4294	150	8	these	these	DET
finefocus-4294	150	9	new	new	ADJ
finefocus-4294	150	10	tdo	tdo	PROPN
finefocus-4294	150	11	variants	variant	NOUN
finefocus-4294	150	12	were	be	AUX
finefocus-4294	150	13	tested	test	VERB
finefocus-4294	150	14	for	for	ADP
finefocus-4294	150	15	their	their	PRON
finefocus-4294	150	16	ability	ability	NOUN
finefocus-4294	150	17	to	to	PART
finefocus-4294	150	18	catalyze	catalyze	VERB
finefocus-4294	150	19	the	the	DET
finefocus-4294	150	20	cis	cis	NOUN
finefocus-4294	150	21	-	-	PUNCT
finefocus-4294	150	22	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	150	23	of	of	ADP
finefocus-4294	150	24	a	a	DET
finefocus-4294	150	25	diverse	diverse	ADJ
finefocus-4294	150	26	group	group	NOUN
finefocus-4294	150	27	of	of	ADP
finefocus-4294	150	28	potential	potential	ADJ
finefocus-4294	150	29	aromatic	aromatic	ADJ
finefocus-4294	150	30	substrates	substrate	NOUN
finefocus-4294	150	31	through	through	ADP
finefocus-4294	150	32	a	a	DET
finefocus-4294	150	33	fluorescence	fluorescence	NOUN
finefocus-4294	150	34	-	-	PUNCT
finefocus-4294	150	35	based	base	VERB
finefocus-4294	150	36	assay	assay	NOUN
finefocus-4294	150	37	system	system	NOUN
finefocus-4294	150	38	(	(	PUNCT
finefocus-4294	150	39	30	30	NUM
finefocus-4294	150	40	)	)	PUNCT
finefocus-4294	150	41	.	.	PUNCT
finefocus-4294	151	1	the	the	DET
finefocus-4294	151	2	results	result	NOUN
finefocus-4294	151	3	of	of	ADP
finefocus-4294	151	4	this	this	DET
finefocus-4294	151	5	study	study	NOUN
finefocus-4294	151	6	demonstrated	demonstrate	VERB
finefocus-4294	151	7	the	the	DET
finefocus-4294	151	8	critical	critical	ADJ
finefocus-4294	151	9	role	role	NOUN
finefocus-4294	151	10	played	play	VERB
finefocus-4294	151	11	by	by	ADP
finefocus-4294	151	12	the	the	DET
finefocus-4294	151	13	iron	iron	NOUN
finefocus-4294	151	14	-	-	PUNCT
finefocus-4294	151	15	coordinating	coordinate	VERB
finefocus-4294	151	16	residues	residue	NOUN
finefocus-4294	151	17	of	of	ADP
finefocus-4294	151	18	rieske	rieske	ADJ
finefocus-4294	151	19	dioxygenases	dioxygenase	NOUN
finefocus-4294	151	20	in	in	ADP
finefocus-4294	151	21	their	their	PRON
finefocus-4294	151	22	native	native	ADJ
finefocus-4294	151	23	state	state	NOUN
finefocus-4294	151	24	.	.	PUNCT
finefocus-4294	152	1	these	these	DET
finefocus-4294	152	2	results	result	NOUN
finefocus-4294	152	3	revealed	reveal	VERB
finefocus-4294	152	4	that	that	SCONJ
finefocus-4294	152	5	any	any	DET
finefocus-4294	152	6	alteration	alteration	NOUN
finefocus-4294	152	7	of	of	ADP
finefocus-4294	152	8	these	these	DET
finefocus-4294	152	9	residues	residue	NOUN
finefocus-4294	152	10	,	,	PUNCT
finefocus-4294	152	11	either	either	CCONJ
finefocus-4294	152	12	to	to	ADP
finefocus-4294	152	13	other	other	ADJ
finefocus-4294	152	14	residues	residue	NOUN
finefocus-4294	152	15	with	with	ADP
finefocus-4294	152	16	the	the	DET
finefocus-4294	152	17	potential	potential	NOUN
finefocus-4294	152	18	for	for	ADP
finefocus-4294	152	19	iron	iron	NOUN
finefocus-4294	152	20	-	-	PUNCT
finefocus-4294	152	21	coordination	coordination	NOUN
finefocus-4294	152	22	or	or	CCONJ
finefocus-4294	152	23	to	to	ADP
finefocus-4294	152	24	a	a	DET
finefocus-4294	152	25	residue	residue	NOUN
finefocus-4294	152	26	incapable	incapable	ADJ
finefocus-4294	152	27	of	of	ADP
finefocus-4294	152	28	coordinating	coordinate	VERB
finefocus-4294	152	29	iron	iron	NOUN
finefocus-4294	152	30	,	,	PUNCT
finefocus-4294	152	31	resulted	result	VERB
finefocus-4294	152	32	in	in	ADP
finefocus-4294	152	33	a	a	DET
finefocus-4294	152	34	complete	complete	ADJ
finefocus-4294	152	35	loss	loss	NOUN
finefocus-4294	152	36	of	of	ADP
finefocus-4294	152	37	cis	cis	NOUN
finefocus-4294	152	38	-	-	PUNCT
finefocus-4294	152	39	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	152	40	activity	activity	NOUN
finefocus-4294	152	41	for	for	ADP
finefocus-4294	152	42	any	any	PRON
finefocus-4294	152	43	of	of	ADP
finefocus-4294	152	44	the	the	DET
finefocus-4294	152	45	classes	class	NOUN
finefocus-4294	152	46	of	of	ADP
finefocus-4294	152	47	substrates	substrate	NOUN
finefocus-4294	152	48	tested	test	VERB
finefocus-4294	152	49	in	in	ADP
finefocus-4294	152	50	this	this	DET
finefocus-4294	152	51	study	study	NOUN
finefocus-4294	152	52	.	.	PUNCT
finefocus-4294	153	1	although	although	SCONJ
finefocus-4294	153	2	this	this	DET
finefocus-4294	153	3	study	study	NOUN
finefocus-4294	153	4	did	do	AUX
finefocus-4294	153	5	not	not	PART
finefocus-4294	153	6	produce	produce	VERB
finefocus-4294	153	7	any	any	DET
finefocus-4294	153	8	rieske	rieske	ADJ
finefocus-4294	153	9	dioxygenase	dioxygenase	NOUN
finefocus-4294	153	10	variants	variant	NOUN
finefocus-4294	153	11	with	with	ADP
finefocus-4294	153	12	improved	improved	ADJ
finefocus-4294	153	13	or	or	CCONJ
finefocus-4294	153	14	altered	alter	VERB
finefocus-4294	153	15	cis	cis	NOUN
finefocus-4294	153	16	-	-	PUNCT
finefocus-4294	153	17	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	153	18	activity	activity	NOUN
finefocus-4294	153	19	,	,	PUNCT
finefocus-4294	153	20	the	the	DET
finefocus-4294	153	21	findings	finding	NOUN
finefocus-4294	153	22	of	of	ADP
finefocus-4294	153	23	this	this	DET
finefocus-4294	153	24	study	study	NOUN
finefocus-4294	153	25	will	will	AUX
finefocus-4294	153	26	serve	serve	VERB
finefocus-4294	153	27	to	to	PART
finefocus-4294	153	28	inform	inform	VERB
finefocus-4294	153	29	future	future	ADJ
finefocus-4294	153	30	engineering	engineering	NOUN
finefocus-4294	153	31	studies	study	NOUN
finefocus-4294	153	32	targeting	target	VERB
finefocus-4294	153	33	these	these	DET
finefocus-4294	153	34	enzymes	enzyme	NOUN
finefocus-4294	153	35	.	.	PUNCT
finefocus-4294	154	1	based	base	VERB
finefocus-4294	154	2	on	on	ADP
finefocus-4294	154	3	these	these	DET
finefocus-4294	154	4	results	result	NOUN
finefocus-4294	154	5	,	,	PUNCT
finefocus-4294	154	6	it	it	PRON
finefocus-4294	154	7	is	be	AUX
finefocus-4294	154	8	clear	clear	ADJ
finefocus-4294	154	9	that	that	SCONJ
finefocus-4294	154	10	any	any	DET
finefocus-4294	154	11	attempts	attempt	NOUN
finefocus-4294	154	12	to	to	PART
finefocus-4294	154	13	engineer	engineer	VERB
finefocus-4294	154	14	novel	novel	ADJ
finefocus-4294	154	15	variants	variant	NOUN
finefocus-4294	154	16	of	of	ADP
finefocus-4294	154	17	rieske	rieske	ADJ
finefocus-4294	154	18	dioxygenases	dioxygenase	NOUN
finefocus-4294	154	19	should	should	AUX
finefocus-4294	154	20	make	make	VERB
finefocus-4294	154	21	every	every	DET
finefocus-4294	154	22	effort	effort	NOUN
finefocus-4294	154	23	to	to	PART
finefocus-4294	154	24	preserve	preserve	VERB
finefocus-4294	154	25	the	the	DET
finefocus-4294	154	26	iron	iron	NOUN
finefocus-4294	154	27	-	-	PUNCT
finefocus-4294	154	28	coordinating	coordinate	VERB
finefocus-4294	154	29	residues	residue	NOUN
finefocus-4294	154	30	in	in	ADP
finefocus-4294	154	31	their	their	PRON
finefocus-4294	154	32	native	native	ADJ
finefocus-4294	154	33	state	state	NOUN
finefocus-4294	154	34	.	.	PUNCT
finefocus-4294	155	1	betts	betts	PROPN
finefocus-4294	155	2	&	&	CCONJ
finefocus-4294	155	3	froese	froese	PROPN
finefocus-4294	155	4	|	|	ADV
finefocus-4294	155	5	investigation	investigation	NOUN
finefocus-4294	155	6	of	of	ADP
finefocus-4294	155	7	the	the	DET
finefocus-4294	155	8	effects	effect	NOUN
finefocus-4294	155	9	of	of	ADP
finefocus-4294	155	10	mutating	mutate	VERB
finefocus-4294	155	11	iron	iron	NOUN
finefocus-4294	155	12	-	-	PUNCT
finefocus-4294	155	13	coordinating	coordinate	VERB
finefocus-4294	155	14	residues	residue	NOUN
finefocus-4294	155	15	in	in	ADP
finefocus-4294	155	16	rieske	rieske	ADJ
finefocus-4294	155	17	dioxygenases	dioxygenase	NOUN
finefocus-4294	155	18	103	103	NUM
finefocus-4294	155	19	acknowledgements	acknowledgement	NOUN
finefocus-4294	155	20	this	this	DET
finefocus-4294	155	21	material	material	NOUN
finefocus-4294	155	22	is	be	AUX
finefocus-4294	155	23	based	base	VERB
finefocus-4294	155	24	upon	upon	SCONJ
finefocus-4294	155	25	work	work	NOUN
finefocus-4294	155	26	supported	support	VERB
finefocus-4294	155	27	by	by	ADP
finefocus-4294	155	28	the	the	DET
finefocus-4294	155	29	national	national	PROPN
finefocus-4294	155	30	science	science	PROPN
finefocus-4294	155	31	foundation	foundation	PROPN
finefocus-4294	155	32	under	under	ADP
finefocus-4294	155	33	grant	grant	NOUN
finefocus-4294	155	34	no	no	NOUN
finefocus-4294	155	35	.	.	PROPN
finefocus-4294	155	36	2147098	2147098	NUM
finefocus-4294	155	37	(	(	PUNCT
finefocus-4294	155	38	research	research	NOUN
finefocus-4294	155	39	in	in	ADP
finefocus-4294	155	40	undergraduate	undergraduate	ADJ
finefocus-4294	155	41	institutions	institution	NOUN
finefocus-4294	155	42	)	)	PUNCT
finefocus-4294	155	43	and	and	CCONJ
finefocus-4294	155	44	by	by	ADP
finefocus-4294	155	45	the	the	DET
finefocus-4294	155	46	ball	ball	NOUN
finefocus-4294	155	47	state	state	PROPN
finefocus-4294	155	48	university	university	PROPN
finefocus-4294	155	49	junior	junior	ADJ
finefocus-4294	155	50	faculty	faculty	NOUN
finefocus-4294	155	51	aspire	aspire	NOUN
finefocus-4294	155	52	grant	grant	PROPN
finefocus-4294	155	53	program	program	NOUN
finefocus-4294	155	54	.	.	PUNCT
finefocus-4294	156	1	this	this	DET
finefocus-4294	156	2	work	work	NOUN
finefocus-4294	156	3	was	be	AUX
finefocus-4294	156	4	made	make	VERB
finefocus-4294	156	5	possible	possible	ADJ
finefocus-4294	156	6	in	in	ADP
finefocus-4294	156	7	part	part	NOUN
finefocus-4294	156	8	by	by	ADP
finefocus-4294	156	9	the	the	DET
finefocus-4294	156	10	ball	ball	NOUN
finefocus-4294	156	11	state	state	PROPN
finefocus-4294	156	12	university	university	NOUN
finefocus-4294	156	13	provost	provost	NOUN
finefocus-4294	156	14	start	start	VERB
finefocus-4294	156	15	-	-	PUNCT
finefocus-4294	156	16	up	up	ADP
finefocus-4294	156	17	program	program	NOUN
finefocus-4294	156	18	.	.	PUNCT
finefocus-4294	157	1	author	author	NOUN
finefocus-4294	157	2	correspondence	correspondence	NOUN
finefocus-4294	157	3	correspondence	correspondence	NOUN
finefocus-4294	157	4	concerning	concern	VERB
finefocus-4294	157	5	this	this	DET
finefocus-4294	157	6	article	article	NOUN
finefocus-4294	157	7	should	should	AUX
finefocus-4294	157	8	be	be	AUX
finefocus-4294	157	9	addressed	address	VERB
finefocus-4294	157	10	to	to	ADP
finefocus-4294	157	11	:	:	PUNCT
finefocus-4294	157	12	jordan	jordan	PROPN
finefocus-4294	157	13	t.	t.	PROPN
finefocus-4294	157	14	froese	froese	PROPN
finefocus-4294	157	15	,	,	PUNCT
finefocus-4294	157	16	jtfroese@	jtfroese@	PROPN
finefocus-4294	157	17	bsu.edu	bsu.edu	NUM
finefocus-4294	157	18	.	.	PUNCT
finefocus-4294	157	19	mailto	mailto	PROPN
finefocus-4294	157	20	:	:	PUNCT
finefocus-4294	157	21	jtfroese%40bsu.edu?subject=	jtfroese%40bsu.edu?subject=	PROPN
finefocus-4294	157	22	mailto	mailto	NOUN
finefocus-4294	157	23	:	:	PUNCT
finefocus-4294	157	24	jtfroese%40bsu.edu?subject=	jtfroese%40bsu.edu?subject=	ADJ
finefocus-4294	157	25	fine	fine	ADJ
finefocus-4294	157	26	focus	focus	NOUN
finefocus-4294	157	27	|	|	ADV
finefocus-4294	157	28	volume	volume	NOUN
finefocus-4294	157	29	10104	10104	NUM
finefocus-4294	157	30	references	reference	NOUN
finefocus-4294	157	31	1	1	NUM
finefocus-4294	157	32	.	.	PUNCT
finefocus-4294	158	1	ang	ang	PROPN
finefocus-4294	158	2	,	,	PUNCT
finefocus-4294	158	3	e.	e.	PROPN
finefocus-4294	158	4	l.	l.	PROPN
finefocus-4294	158	5	,	,	PUNCT
finefocus-4294	158	6	obbard	obbard	PROPN
finefocus-4294	158	7	,	,	PUNCT
finefocus-4294	158	8	j.	j.	PROPN
finefocus-4294	158	9	p.	p.	PROPN
finefocus-4294	158	10	,	,	PUNCT
finefocus-4294	158	11	&	&	CCONJ
finefocus-4294	158	12	zhao	zhao	PROPN
finefocus-4294	158	13	,	,	PUNCT
finefocus-4294	158	14	h.	h.	PROPN
finefocus-4294	158	15	m.	m.	PROPN
finefocus-4294	158	16	(	(	PUNCT
finefocus-4294	158	17	2009	2009	NUM
finefocus-4294	158	18	)	)	PUNCT
finefocus-4294	158	19	directed	direct	VERB
finefocus-4294	158	20	evolution	evolution	NOUN
finefocus-4294	158	21	of	of	ADP
finefocus-4294	158	22	aniline	aniline	ADJ
finefocus-4294	158	23	dioxygenase	dioxygenase	NOUN
finefocus-4294	158	24	for	for	ADP
finefocus-4294	158	25	enhanced	enhanced	ADJ
finefocus-4294	158	26	bioremediation	bioremediation	NOUN
finefocus-4294	158	27	of	of	ADP
finefocus-4294	158	28	aromatic	aromatic	ADJ
finefocus-4294	158	29	amines	amine	NOUN
finefocus-4294	158	30	.	.	PUNCT
finefocus-4294	159	1	applied	apply	VERB
finefocus-4294	159	2	microbiology	microbiology	NOUN
finefocus-4294	159	3	and	and	CCONJ
finefocus-4294	159	4	biotechnology	biotechnology	NOUN
finefocus-4294	159	5	,	,	PUNCT
finefocus-4294	159	6	81	81	NUM
finefocus-4294	159	7	,	,	PUNCT
finefocus-4294	159	8	1063	1063	NUM
finefocus-4294	159	9	-	-	SYM
finefocus-4294	159	10	1070	1070	NUM
finefocus-4294	159	11	.	.	PUNCT
finefocus-4294	160	1	https://doi.org/10.1007/s-00253-008-1710-0	https://doi.org/10.1007/s-00253-008-1710-0	NOUN
finefocus-4294	160	2	2	2	NUM
finefocus-4294	160	3	.	.	PUNCT
finefocus-4294	160	4	bagneris	bagneris	PROPN
finefocus-4294	160	5	,	,	PUNCT
finefocus-4294	160	6	c.	c.	NOUN
finefocus-4294	160	7	;	;	PUNCT
finefocus-4294	160	8	cammack	cammack	NOUN
finefocus-4294	160	9	,	,	PUNCT
finefocus-4294	160	10	r.	r.	PROPN
finefocus-4294	160	11	;	;	PUNCT
finefocus-4294	160	12	&	&	CCONJ
finefocus-4294	160	13	mason	mason	PROPN
finefocus-4294	160	14	,	,	PUNCT
finefocus-4294	160	15	j.	j.	PROPN
finefocus-4294	160	16	r.	r.	PROPN
finefocus-4294	160	17	(	(	PUNCT
finefocus-4294	160	18	2005	2005	NUM
finefocus-4294	160	19	)	)	PUNCT
finefocus-4294	160	20	subtle	subtle	ADJ
finefocus-4294	160	21	difference	difference	NOUN
finefocus-4294	160	22	between	between	ADP
finefocus-4294	160	23	benzene	benzene	NOUN
finefocus-4294	160	24	and	and	CCONJ
finefocus-4294	160	25	toluene	toluene	NOUN
finefocus-4294	160	26	dioxygenases	dioxygenase	NOUN
finefocus-4294	160	27	of	of	ADP
finefocus-4294	160	28	pseudomonas	pseudomonas	PROPN
finefocus-4294	160	29	putida	putida	PROPN
finefocus-4294	160	30	.	.	PROPN
finefocus-4294	160	31	applied	apply	VERB
finefocus-4294	160	32	and	and	CCONJ
finefocus-4294	160	33	environmental	environmental	ADJ
finefocus-4294	160	34	microbiology	microbiology	NOUN
finefocus-4294	160	35	,	,	PUNCT
finefocus-4294	160	36	71	71	NUM
finefocus-4294	160	37	,	,	PUNCT
finefocus-4294	160	38	1570	1570	NUM
finefocus-4294	160	39	-	-	SYM
finefocus-4294	160	40	1580	1580	NUM
finefocus-4294	160	41	.	.	PUNCT
finefocus-4294	161	1	https://doi.org/10.1128/aem.71.3.1570-1580.2005	https://doi.org/10.1128/aem.71.3.1570-1580.2005	PRON
finefocus-4294	161	2	3	3	NUM
finefocus-4294	161	3	.	.	PUNCT
finefocus-4294	161	4	bernath	bernath	NOUN
finefocus-4294	161	5	-	-	PUNCT
finefocus-4294	161	6	levin	levin	PROPN
finefocus-4294	161	7	,	,	PUNCT
finefocus-4294	161	8	k.	k.	PROPN
finefocus-4294	161	9	,	,	PUNCT
finefocus-4294	161	10	shainsky	shainsky	PROPN
finefocus-4294	161	11	,	,	PUNCT
finefocus-4294	161	12	j.	j.	PROPN
finefocus-4294	161	13	,	,	PUNCT
finefocus-4294	161	14	sigawi	sigawi	PROPN
finefocus-4294	161	15	,	,	PUNCT
finefocus-4294	161	16	l.	l.	PROPN
finefocus-4294	161	17	,	,	PUNCT
finefocus-4294	161	18	&	&	CCONJ
finefocus-4294	161	19	fishman	fishman	PROPN
finefocus-4294	161	20	,	,	PUNCT
finefocus-4294	161	21	a.	a.	PROPN
finefocus-4294	161	22	(	(	PUNCT
finefocus-4294	161	23	2014	2014	NUM
finefocus-4294	161	24	)	)	PUNCT
finefocus-4294	161	25	directed	direct	VERB
finefocus-4294	161	26	evolution	evolution	NOUN
finefocus-4294	161	27	of	of	ADP
finefocus-4294	161	28	nitrobenzene	nitrobenzene	ADJ
finefocus-4294	161	29	dioxygenase	dioxygenase	NOUN
finefocus-4294	161	30	for	for	ADP
finefocus-4294	161	31	the	the	DET
finefocus-4294	161	32	synthesis	synthesis	NOUN
finefocus-4294	161	33	of	of	ADP
finefocus-4294	161	34	the	the	DET
finefocus-4294	161	35	antioxidant	antioxidant	ADJ
finefocus-4294	161	36	hydroxytyrosol	hydroxytyrosol	NOUN
finefocus-4294	161	37	.	.	PUNCT
finefocus-4294	162	1	applied	apply	VERB
finefocus-4294	162	2	microbiology	microbiology	NOUN
finefocus-4294	162	3	and	and	CCONJ
finefocus-4294	162	4	biotechnology	biotechnology	NOUN
finefocus-4294	162	5	,	,	PUNCT
finefocus-4294	162	6	98	98	NUM
finefocus-4294	162	7	,	,	PUNCT
finefocus-4294	162	8	4975	4975	NUM
finefocus-4294	162	9	-	-	SYM
finefocus-4294	162	10	4985	4985	NUM
finefocus-4294	162	11	.	.	PUNCT
finefocus-4294	163	1	https://doi.org/10.1007/s00253-013-5505-6	https://doi.org/10.1007/s00253-013-5505-6	PROPN
finefocus-4294	163	2	4	4	NUM
finefocus-4294	163	3	.	.	PUNCT
finefocus-4294	163	4	bolden	bolden	PROPN
finefocus-4294	163	5	,	,	PUNCT
finefocus-4294	163	6	a.	a.	PROPN
finefocus-4294	163	7	l.	l.	PROPN
finefocus-4294	163	8	,	,	PUNCT
finefocus-4294	163	9	kwiatkowski	kwiatkowski	PROPN
finefocus-4294	163	10	,	,	PUNCT
finefocus-4294	163	11	c.	c.	PROPN
finefocus-4294	163	12	f.	f.	PROPN
finefocus-4294	163	13	,	,	PUNCT
finefocus-4294	163	14	&	&	CCONJ
finefocus-4294	163	15	colborn	colborn	PROPN
finefocus-4294	163	16	,	,	PUNCT
finefocus-4294	163	17	t.	t.	PROPN
finefocus-4294	163	18	(	(	PUNCT
finefocus-4294	163	19	2015	2015	NUM
finefocus-4294	163	20	)	)	PUNCT
finefocus-4294	163	21	new	new	ADJ
finefocus-4294	163	22	look	look	NOUN
finefocus-4294	163	23	at	at	ADP
finefocus-4294	163	24	btex	btex	NOUN
finefocus-4294	163	25	:	:	PUNCT
finefocus-4294	163	26	are	be	AUX
finefocus-4294	163	27	ambient	ambient	ADJ
finefocus-4294	163	28	levels	level	NOUN
finefocus-4294	163	29	a	a	DET
finefocus-4294	163	30	problem	problem	NOUN
finefocus-4294	163	31	?	?	PUNCT
finefocus-4294	164	1	environmental	environmental	ADJ
finefocus-4294	164	2	science	science	NOUN
finefocus-4294	164	3	and	and	CCONJ
finefocus-4294	164	4	technology	technology	NOUN
finefocus-4294	164	5	,	,	PUNCT
finefocus-4294	164	6	49	49	NUM
finefocus-4294	164	7	,	,	PUNCT
finefocus-4294	164	8	5261	5261	NUM
finefocus-4294	164	9	-	-	SYM
finefocus-4294	164	10	5276	5276	NUM
finefocus-4294	164	11	.	.	PUNCT
finefocus-4294	165	1	https://doi.org/10.1021/es505316f	https://doi.org/10.1021/es505316f	PROPN
finefocus-4294	165	2	5	5	NUM
finefocus-4294	165	3	.	.	PUNCT
finefocus-4294	165	4	brimberry	brimberry	NOUN
finefocus-4294	165	5	,	,	PUNCT
finefocus-4294	165	6	m.	m.	NOUN
finefocus-4294	165	7	,	,	PUNCT
finefocus-4294	165	8	garcia	garcia	PROPN
finefocus-4294	165	9	,	,	PUNCT
finefocus-4294	165	10	a.	a.	NOUN
finefocus-4294	165	11	a.	a.	PROPN
finefocus-4294	165	12	,	,	PUNCT
finefocus-4294	165	13	liu	liu	PROPN
finefocus-4294	165	14	,	,	PUNCT
finefocus-4294	165	15	j.	j.	PROPN
finefocus-4294	165	16	,	,	PUNCT
finefocus-4294	165	17	tian	tian	PROPN
finefocus-4294	165	18	,	,	PUNCT
finefocus-4294	165	19	j.	j.	PROPN
finefocus-4294	165	20	,	,	PUNCT
finefocus-4294	165	21	&	&	CCONJ
finefocus-4294	165	22	bridwell	bridwell	PROPN
finefocus-4294	165	23	-	-	PUNCT
finefocus-4294	165	24	rabb	rabb	PROPN
finefocus-4294	165	25	,	,	PUNCT
finefocus-4294	165	26	j.	j.	PROPN
finefocus-4294	165	27	(	(	PUNCT
finefocus-4294	165	28	2023	2023	NUM
finefocus-4294	165	29	)	)	PUNCT
finefocus-4294	165	30	engineering	engineer	VERB
finefocus-4294	165	31	rieske	rieske	ADJ
finefocus-4294	165	32	oxygenase	oxygenase	NOUN
finefocus-4294	165	33	activity	activity	NOUN
finefocus-4294	165	34	one	one	NUM
finefocus-4294	165	35	piece	piece	NOUN
finefocus-4294	165	36	at	at	ADP
finefocus-4294	165	37	a	a	DET
finefocus-4294	165	38	time	time	NOUN
finefocus-4294	165	39	.	.	PUNCT
finefocus-4294	166	1	current	current	ADJ
finefocus-4294	166	2	opinion	opinion	NOUN
finefocus-4294	166	3	in	in	ADP
finefocus-4294	166	4	chemical	chemical	NOUN
finefocus-4294	166	5	biology	biology	NOUN
finefocus-4294	166	6	,	,	PUNCT
finefocus-4294	166	7	72	72	NUM
finefocus-4294	166	8	,	,	PUNCT
finefocus-4294	166	9	102227	102227	NUM
finefocus-4294	166	10	.	.	PUNCT
finefocus-4294	167	1	https://doi.org/10.1016/j.cbpa.2022.102227	https://doi.org/10.1016/j.cbpa.2022.102227	PROPN
finefocus-4294	167	2	6	6	NUM
finefocus-4294	167	3	.	.	PUNCT
finefocus-4294	168	1	chang	chang	PROPN
finefocus-4294	168	2	,	,	PUNCT
finefocus-4294	168	3	h.	h.	PROPN
finefocus-4294	168	4	k.	k.	PROPN
finefocus-4294	168	5	&	&	CCONJ
finefocus-4294	168	6	zylstra	zylstra	PROPN
finefocus-4294	168	7	,	,	PUNCT
finefocus-4294	168	8	g.	g.	PROPN
finefocus-4294	168	9	j.	j.	PROPN
finefocus-4294	168	10	(	(	PUNCT
finefocus-4294	168	11	1998	1998	NUM
finefocus-4294	168	12	)	)	PUNCT
finefocus-4294	168	13	novel	novel	NOUN
finefocus-4294	168	14	organization	organization	NOUN
finefocus-4294	168	15	of	of	ADP
finefocus-4294	168	16	the	the	DET
finefocus-4294	168	17	genes	gene	NOUN
finefocus-4294	168	18	for	for	ADP
finefocus-4294	168	19	phthalate	phthalate	NOUN
finefocus-4294	168	20	degradation	degradation	NOUN
finefocus-4294	168	21	from	from	ADP
finefocus-4294	168	22	burkholderia	burkholderia	PROPN
finefocus-4294	168	23	cepacia	cepacia	PROPN
finefocus-4294	168	24	dbo1	dbo1	PROPN
finefocus-4294	168	25	.	.	PUNCT
finefocus-4294	169	1	journal	journal	PROPN
finefocus-4294	169	2	of	of	ADP
finefocus-4294	169	3	bacteriology	bacteriology	NOUN
finefocus-4294	169	4	,	,	PUNCT
finefocus-4294	169	5	180	180	NUM
finefocus-4294	169	6	,	,	PUNCT
finefocus-4294	169	7	6529	6529	NUM
finefocus-4294	169	8	-	-	SYM
finefocus-4294	169	9	6537	6537	NUM
finefocus-4294	169	10	.	.	PUNCT
finefocus-4294	170	1	https://doi.org/10.1128/jb.180.24.6529-6537.1998	https://doi.org/10.1128/jb.180.24.6529-6537.1998	PROPN
finefocus-4294	171	1	7	7	X
finefocus-4294	171	2	.	.	PUNCT
finefocus-4294	171	3	cipolatti	cipolatti	PROPN
finefocus-4294	171	4	,	,	PUNCT
finefocus-4294	171	5	e.	e.	PROPN
finefocus-4294	171	6	p.	p.	PROPN
finefocus-4294	171	7	,	,	PUNCT
finefocus-4294	171	8	pinto	pinto	NOUN
finefocus-4294	171	9	,	,	PUNCT
finefocus-4294	171	10	m.	m.	NOUN
finefocus-4294	171	11	c.	c.	PROPN
finefocus-4294	171	12	c.	c.	PROPN
finefocus-4294	171	13	,	,	PUNCT
finefocus-4294	171	14	henriques	henrique	NOUN
finefocus-4294	171	15	,	,	PUNCT
finefocus-4294	171	16	r.	r.	PROPN
finefocus-4294	171	17	o.	o.	PROPN
finefocus-4294	171	18	,	,	PUNCT
finefocus-4294	171	19	pinto	pinto	NOUN
finefocus-4294	171	20	,	,	PUNCT
finefocus-4294	171	21	j.	j.	PROPN
finefocus-4294	171	22	c.	c.	PROPN
finefocus-4294	171	23	c.	c.	PROPN
finefocus-4294	171	24	,	,	PUNCT
finefocus-4294	171	25	castro	castro	PROPN
finefocus-4294	171	26	,	,	PUNCT
finefocus-4294	171	27	a.	a.	NOUN
finefocus-4294	171	28	m.	m.	PROPN
finefocus-4294	171	29	,	,	PUNCT
finefocus-4294	171	30	freire	freire	PROPN
finefocus-4294	171	31	,	,	PUNCT
finefocus-4294	171	32	d.	d.	PROPN
finefocus-4294	171	33	m.	m.	PROPN
finefocus-4294	171	34	g.	g.	PROPN
finefocus-4294	171	35	,	,	PUNCT
finefocus-4294	171	36	&	&	CCONJ
finefocus-4294	171	37	manoel	manoel	PROPN
finefocus-4294	171	38	,	,	PUNCT
finefocus-4294	171	39	e.	e.	PROPN
finefocus-4294	171	40	a.	a.	PROPN
finefocus-4294	171	41	(	(	PUNCT
finefocus-4294	171	42	2019	2019	NUM
finefocus-4294	171	43	)	)	PUNCT
finefocus-4294	171	44	in	in	ADP
finefocus-4294	171	45	advances	advance	NOUN
finefocus-4294	171	46	in	in	ADP
finefocus-4294	171	47	enzyme	enzyme	NOUN
finefocus-4294	171	48	technology	technology	NOUN
finefocus-4294	171	49	(	(	PUNCT
finefocus-4294	171	50	eds	ed	NOUN
finefocus-4294	171	51	.	.	PUNCT
finefocus-4294	171	52	:	:	PUNCT
finefocus-4294	172	1	singh	singh	PROPN
finefocus-4294	172	2	,	,	PUNCT
finefocus-4294	172	3	r.	r.	PROPN
finefocus-4294	172	4	s.	s.	PROPN
finefocus-4294	172	5	;	;	PUNCT
finefocus-4294	172	6	singhania	singhania	PROPN
finefocus-4294	172	7	,	,	PUNCT
finefocus-4294	172	8	r.	r.	PROPN
finefocus-4294	172	9	r.	r.	PROPN
finefocus-4294	172	10	;	;	PUNCT
finefocus-4294	172	11	pandey	pandey	PROPN
finefocus-4294	172	12	,	,	PUNCT
finefocus-4294	172	13	a.	a.	PROPN
finefocus-4294	172	14	;	;	PUNCT
finefocus-4294	172	15	larroche	larroche	PROPN
finefocus-4294	172	16	,	,	PUNCT
finefocus-4294	172	17	c.	c.	PROPN
finefocus-4294	172	18	)	)	PUNCT
finefocus-4294	172	19	amsterdam	amsterdam	PROPN
finefocus-4294	172	20	:	:	PUNCT
finefocus-4294	172	21	elsevier	elsevier	NOUN
finefocus-4294	172	22	,	,	PUNCT
finefocus-4294	172	23	p.	p.	NOUN
finefocus-4294	172	24	137	137	NUM
finefocus-4294	172	25	-	-	SYM
finefocus-4294	172	26	151	151	NUM
finefocus-4294	172	27	.	.	NOUN
finefocus-4294	172	28	8	8	NUM
finefocus-4294	172	29	.	.	X
finefocus-4294	173	1	endoma	endoma	ADJ
finefocus-4294	173	2	,	,	PUNCT
finefocus-4294	173	3	m.	m.	NOUN
finefocus-4294	173	4	a.	a.	PROPN
finefocus-4294	173	5	,	,	PUNCT
finefocus-4294	173	6	bui	bui	NOUN
finefocus-4294	173	7	,	,	PUNCT
finefocus-4294	173	8	v.	v.	PROPN
finefocus-4294	173	9	p.	p.	PROPN
finefocus-4294	173	10	,	,	PUNCT
finefocus-4294	173	11	hansen	hansen	PROPN
finefocus-4294	173	12	,	,	PUNCT
finefocus-4294	173	13	j.	j.	PROPN
finefocus-4294	173	14	,	,	PUNCT
finefocus-4294	173	15	hudlicky	hudlicky	NOUN
finefocus-4294	173	16	,	,	PUNCT
finefocus-4294	173	17	t.	t.	PROPN
finefocus-4294	173	18	(	(	PUNCT
finefocus-4294	173	19	2002	2002	NUM
finefocus-4294	173	20	)	)	PUNCT
finefocus-4294	173	21	medium	medium	ADJ
finefocus-4294	173	22	-	-	PUNCT
finefocus-4294	173	23	scale	scale	NOUN
finefocus-4294	173	24	preparation	preparation	NOUN
finefocus-4294	173	25	of	of	ADP
finefocus-4294	173	26	useful	useful	ADJ
finefocus-4294	173	27	metabolites	metabolite	NOUN
finefocus-4294	173	28	of	of	ADP
finefocus-4294	173	29	aromatic	aromatic	ADJ
finefocus-4294	173	30	compounds	compound	NOUN
finefocus-4294	173	31	via	via	ADP
finefocus-4294	173	32	whole	whole	ADJ
finefocus-4294	173	33	-	-	PUNCT
finefocus-4294	173	34	cell	cell	NOUN
finefocus-4294	173	35	fermentation	fermentation	NOUN
finefocus-4294	173	36	with	with	ADP
finefocus-4294	173	37	recombinant	recombinant	ADJ
finefocus-4294	173	38	organisms	organism	NOUN
finefocus-4294	173	39	.	.	PUNCT
finefocus-4294	174	1	organic	organic	ADJ
finefocus-4294	174	2	process	process	NOUN
finefocus-4294	174	3	research	research	NOUN
finefocus-4294	174	4	and	and	CCONJ
finefocus-4294	174	5	development	development	NOUN
finefocus-4294	174	6	,	,	PUNCT
finefocus-4294	174	7	6	6	NUM
finefocus-4294	174	8	,	,	PUNCT
finefocus-4294	174	9	525	525	NUM
finefocus-4294	174	10	-	-	SYM
finefocus-4294	174	11	532	532	NUM
finefocus-4294	174	12	.	.	PUNCT
finefocus-4294	175	1	https://doi.org/10.1021/op020013s	https://doi.org/10.1021/op020013s	PROPN
finefocus-4294	175	2	9	9	NUM
finefocus-4294	175	3	.	.	PUNCT
finefocus-4294	175	4	friemann	friemann	PROPN
finefocus-4294	175	5	,	,	PUNCT
finefocus-4294	175	6	r.	r.	PROPN
finefocus-4294	175	7	,	,	PUNCT
finefocus-4294	175	8	lee	lee	PROPN
finefocus-4294	175	9	,	,	PUNCT
finefocus-4294	175	10	k.	k.	PROPN
finefocus-4294	175	11	,	,	PUNCT
finefocus-4294	175	12	brown	brown	PROPN
finefocus-4294	175	13	,	,	PUNCT
finefocus-4294	175	14	e.	e.	PROPN
finefocus-4294	175	15	n.	n.	PROPN
finefocus-4294	175	16	,	,	PUNCT
finefocus-4294	175	17	gibson	gibson	PROPN
finefocus-4294	175	18	,	,	PUNCT
finefocus-4294	175	19	d.	d.	PROPN
finefocus-4294	175	20	t.	t.	PROPN
finefocus-4294	175	21	,	,	PUNCT
finefocus-4294	175	22	eklund	eklund	PROPN
finefocus-4294	175	23	,	,	PUNCT
finefocus-4294	175	24	h.	h.	PROPN
finefocus-4294	175	25	,	,	PUNCT
finefocus-4294	175	26	&	&	CCONJ
finefocus-4294	175	27	ramaswamy	ramaswamy	PROPN
finefocus-4294	175	28	,	,	PUNCT
finefocus-4294	175	29	s.	s.	PROPN
finefocus-4294	175	30	(	(	PUNCT
finefocus-4294	175	31	2009	2009	NUM
finefocus-4294	175	32	)	)	PUNCT
finefocus-4294	175	33	structures	structure	NOUN
finefocus-4294	175	34	of	of	ADP
finefocus-4294	175	35	the	the	DET
finefocus-4294	175	36	multicomponent	multicomponent	NOUN
finefocus-4294	175	37	rieske	rieske	ADJ
finefocus-4294	175	38	non	non	ADJ
finefocus-4294	175	39	-	-	ADJ
finefocus-4294	175	40	heme	heme	ADJ
finefocus-4294	175	41	iron	iron	NOUN
finefocus-4294	175	42	toluene	toluene	NOUN
finefocus-4294	175	43	2,3	2,3	NUM
finefocus-4294	175	44	-	-	PUNCT
finefocus-4294	175	45	dioxygenase	dioxygenase	NOUN
finefocus-4294	175	46	enzyme	enzyme	NOUN
finefocus-4294	175	47	system	system	NOUN
finefocus-4294	175	48	.	.	PUNCT
finefocus-4294	176	1	acta	acta	PROPN
finefocus-4294	176	2	crystallographica	crystallographica	PROPN
finefocus-4294	176	3	,	,	PUNCT
finefocus-4294	176	4	d65	d65	PROPN
finefocus-4294	176	5	,	,	PUNCT
finefocus-4294	176	6	24	24	NUM
finefocus-4294	176	7	.	.	PUNCT
finefocus-4294	177	1	https://doi.org/10.1107/s0907444908036524	https://doi.org/10.1107/s0907444908036524	NUM
finefocus-4294	177	2	10	10	NUM
finefocus-4294	177	3	.	.	PUNCT
finefocus-4294	178	1	froese	froese	PROPN
finefocus-4294	178	2	,	,	PUNCT
finefocus-4294	178	3	j.	j.	PROPN
finefocus-4294	178	4	,	,	PUNCT
finefocus-4294	178	5	endoma	endoma	ADJ
finefocus-4294	178	6	-	-	PUNCT
finefocus-4294	178	7	arias	aria	NOUN
finefocus-4294	178	8	,	,	PUNCT
finefocus-4294	178	9	m.-a	m.-a	NOUN
finefocus-4294	178	10	.	.	PUNCT
finefocus-4294	178	11	,	,	PUNCT
finefocus-4294	178	12	hudlicky	hudlicky	NOUN
finefocus-4294	178	13	,	,	PUNCT
finefocus-4294	178	14	t.	t.	PROPN
finefocus-4294	178	15	(	(	PUNCT
finefocus-4294	178	16	2014	2014	NUM
finefocus-4294	178	17	)	)	PUNCT
finefocus-4294	178	18	processing	processing	NOUN
finefocus-4294	178	19	of	of	ADP
finefocus-4294	178	20	o	o	NOUN
finefocus-4294	178	21	-	-	NOUN
finefocus-4294	178	22	halobenzoates	halobenzoate	NOUN
finefocus-4294	178	23	by	by	ADP
finefocus-4294	178	24	toluene	toluene	NOUN
finefocus-4294	178	25	dioxygenase	dioxygenase	NOUN
finefocus-4294	178	26	.	.	PUNCT
finefocus-4294	179	1	the	the	DET
finefocus-4294	179	2	role	role	NOUN
finefocus-4294	179	3	of	of	ADP
finefocus-4294	179	4	the	the	DET
finefocus-4294	179	5	alkoxy	alkoxy	ADJ
finefocus-4294	179	6	functionality	functionality	NOUN
finefocus-4294	179	7	in	in	ADP
finefocus-4294	179	8	the	the	DET
finefocus-4294	179	9	regioselectivity	regioselectivity	NOUN
finefocus-4294	179	10	of	of	ADP
finefocus-4294	179	11	the	the	DET
finefocus-4294	179	12	enzymatic	enzymatic	ADJ
finefocus-4294	179	13	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	179	14	reaction	reaction	NOUN
finefocus-4294	179	15	.	.	PUNCT
finefocus-4294	180	1	organic	organic	ADJ
finefocus-4294	180	2	process	process	NOUN
finefocus-4294	180	3	research	research	NOUN
finefocus-4294	180	4	and	and	CCONJ
finefocus-4294	180	5	development	development	NOUN
finefocus-4294	180	6	,	,	PUNCT
finefocus-4294	180	7	18	18	NUM
finefocus-4294	180	8	,	,	PUNCT
finefocus-4294	180	9	801–809	801–809	NUM
finefocus-4294	180	10	.	.	PUNCT
finefocus-4294	181	1	https://doi.org/10.1021/op400343c	https://doi.org/10.1021/op400343c	PROPN
finefocus-4294	181	2	https://doi.org/10.1007/s-00253-008-1710-0	https://doi.org/10.1007/s-00253-008-1710-0	PROPN
finefocus-4294	181	3	https://doi.org/10.1021/es505316f	https://doi.org/10.1021/es505316f	VERB
finefocus-4294	181	4	https://doi.org/10.1007/s00253-013-5505-6	https://doi.org/10.1007/s00253-013-5505-6	PROPN
finefocus-4294	181	5	https://doi.org/10.1021/es505316f	https://doi.org/10.1021/es505316f	AUX
finefocus-4294	181	6	https://doi.org/10.1021/es505316f	https://doi.org/10.1021/es505316f	VERB
finefocus-4294	181	7	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	VERB
finefocus-4294	181	8	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	181	9	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	PROPN
finefocus-4294	181	10	https://doi.org/10.1021/op400343c	https://doi.org/10.1021/op400343c	PROPN
finefocus-4294	181	11	betts	betts	PROPN
finefocus-4294	181	12	&	&	CCONJ
finefocus-4294	181	13	froese	froese	PROPN
finefocus-4294	182	1	|	|	ADV
finefocus-4294	182	2	investigation	investigation	NOUN
finefocus-4294	182	3	of	of	ADP
finefocus-4294	182	4	the	the	DET
finefocus-4294	182	5	effects	effect	NOUN
finefocus-4294	182	6	of	of	ADP
finefocus-4294	182	7	mutating	mutate	VERB
finefocus-4294	182	8	iron	iron	NOUN
finefocus-4294	182	9	-	-	PUNCT
finefocus-4294	182	10	coordinating	coordinate	VERB
finefocus-4294	182	11	residues	residue	NOUN
finefocus-4294	182	12	in	in	ADP
finefocus-4294	182	13	rieske	rieske	ADJ
finefocus-4294	182	14	dioxygenases	dioxygenase	NOUN
finefocus-4294	182	15	105	105	NUM
finefocus-4294	182	16	11	11	NUM
finefocus-4294	182	17	.	.	PUNCT
finefocus-4294	183	1	a	a	DET
finefocus-4294	183	2	)	)	PUNCT
finefocus-4294	183	3	gally	gally	PROPN
finefocus-4294	183	4	,	,	PUNCT
finefocus-4294	183	5	c.	c.	NOUN
finefocus-4294	183	6	,	,	PUNCT
finefocus-4294	183	7	nestl	nestl	PROPN
finefocus-4294	183	8	,	,	PUNCT
finefocus-4294	183	9	b.	b.	PROPN
finefocus-4294	183	10	m.	m.	PROPN
finefocus-4294	183	11	,	,	PUNCT
finefocus-4294	183	12	&	&	CCONJ
finefocus-4294	183	13	hauer	hauer	PROPN
finefocus-4294	183	14	,	,	PUNCT
finefocus-4294	183	15	b.	b.	PROPN
finefocus-4294	183	16	(	(	PUNCT
finefocus-4294	183	17	2015	2015	NUM
finefocus-4294	183	18	)	)	PUNCT
finefocus-4294	183	19	engineering	engineer	VERB
finefocus-4294	183	20	rieske	rieske	ADJ
finefocus-4294	183	21	non	non	ADJ
finefocus-4294	183	22	-	-	ADJ
finefocus-4294	183	23	heme	heme	ADJ
finefocus-4294	183	24	iron	iron	NOUN
finefocus-4294	183	25	oxygenases	oxygenase	NOUN
finefocus-4294	183	26	for	for	ADP
finefocus-4294	183	27	the	the	DET
finefocus-4294	183	28	asymmetric	asymmetric	ADJ
finefocus-4294	183	29	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	183	30	of	of	ADP
finefocus-4294	183	31	alkenes	alkene	NOUN
finefocus-4294	183	32	.	.	PUNCT
finefocus-4294	184	1	angewandte	angewandte	PROPN
finefocus-4294	184	2	chemie	chemie	PROPN
finefocus-4294	184	3	,	,	PUNCT
finefocus-4294	184	4	international	international	ADJ
finefocus-4294	184	5	edition	edition	NOUN
finefocus-4294	184	6	,	,	PUNCT
finefocus-4294	184	7	54	54	NUM
finefocus-4294	184	8	,	,	PUNCT
finefocus-4294	184	9	12952	12952	NUM
finefocus-4294	184	10	-	-	SYM
finefocus-4294	184	11	12956	12956	NUM
finefocus-4294	184	12	.	.	PUNCT
finefocus-4294	185	1	https://doi.org/10.1002/anie.201506527	https://doi.org/10.1002/anie.201506527	PROPN
finefocus-4294	185	2	;	;	PUNCT
finefocus-4294	185	3	b	b	X
finefocus-4294	185	4	)	)	PUNCT
finefocus-4294	185	5	halder	halder	PROPN
finefocus-4294	185	6	,	,	PUNCT
finefocus-4294	185	7	j.	j.	PROPN
finefocus-4294	185	8	m.	m.	PROPN
finefocus-4294	185	9	,	,	PUNCT
finefocus-4294	185	10	nestl	nestl	PROPN
finefocus-4294	185	11	,	,	PUNCT
finefocus-4294	185	12	b.	b.	PROPN
finefocus-4294	185	13	m.	m.	PROPN
finefocus-4294	185	14	,	,	PUNCT
finefocus-4294	185	15	&	&	CCONJ
finefocus-4294	185	16	hauer	hauer	PROPN
finefocus-4294	185	17	,	,	PUNCT
finefocus-4294	185	18	b.	b.	PROPN
finefocus-4294	185	19	(	(	PUNCT
finefocus-4294	185	20	2018	2018	NUM
finefocus-4294	185	21	)	)	PUNCT
finefocus-4294	185	22	semirational	semirational	ADJ
finefocus-4294	185	23	engineering	engineering	NOUN
finefocus-4294	185	24	of	of	ADP
finefocus-4294	185	25	the	the	DET
finefocus-4294	185	26	naphthalene	naphthalene	NOUN
finefocus-4294	185	27	dioxygenase	dioxygenase	NOUN
finefocus-4294	185	28	from	from	ADP
finefocus-4294	185	29	pseudomonas	pseudomona	NOUN
finefocus-4294	185	30	sp	sp	PROPN
finefocus-4294	185	31	.	.	PUNCT
finefocus-4294	186	1	ncib	ncib	PROPN
finefocus-4294	186	2	9816	9816	NUM
finefocus-4294	186	3	-	-	SYM
finefocus-4294	186	4	4	4	NUM
finefocus-4294	186	5	towards	towards	ADP
finefocus-4294	186	6	selective	selective	ADJ
finefocus-4294	186	7	asymmetric	asymmetric	ADJ
finefocus-4294	186	8	dihydroxylation	dihydroxylation	NOUN
finefocus-4294	186	9	.	.	PUNCT
finefocus-4294	187	1	chemcatchem	chemcatchem	PROPN
finefocus-4294	187	2	,	,	PUNCT
finefocus-4294	187	3	10	10	NUM
finefocus-4294	187	4	,	,	PUNCT
finefocus-4294	187	5	178	178	NUM
finefocus-4294	187	6	.	.	PUNCT
finefocus-4294	187	7	https://doi.org/10.1002/cctc.201701262	https://doi.org/10.1002/cctc.201701262	PROPN
finefocus-4294	187	8	;	;	PUNCT
finefocus-4294	187	9	c	c	X
finefocus-4294	187	10	)	)	PUNCT
finefocus-4294	187	11	heinemann	heinemann	PROPN
finefocus-4294	187	12	,	,	PUNCT
finefocus-4294	187	13	p.	p.	NOUN
finefocus-4294	187	14	m.	m.	NOUN
finefocus-4294	187	15	,	,	PUNCT
finefocus-4294	187	16	armbruster	armbruster	PROPN
finefocus-4294	187	17	,	,	PUNCT
finefocus-4294	187	18	d.	d.	PROPN
finefocus-4294	187	19	,	,	PUNCT
finefocus-4294	187	20	&	&	CCONJ
finefocus-4294	187	21	hauer	hauer	PROPN
finefocus-4294	187	22	,	,	PUNCT
finefocus-4294	187	23	b.	b.	PROPN
finefocus-4294	187	24	(	(	PUNCT
finefocus-4294	187	25	2021	2021	NUM
finefocus-4294	187	26	)	)	PUNCT
finefocus-4294	187	27	active	active	ADJ
finefocus-4294	187	28	-	-	PUNCT
finefocus-4294	187	29	site	site	NOUN
finefocus-4294	187	30	loop	loop	NOUN
finefocus-4294	187	31	variations	variation	NOUN
finefocus-4294	187	32	adjust	adjust	VERB
finefocus-4294	187	33	activity	activity	NOUN
finefocus-4294	187	34	and	and	CCONJ
finefocus-4294	187	35	selectivity	selectivity	NOUN
finefocus-4294	187	36	of	of	ADP
finefocus-4294	187	37	the	the	DET
finefocus-4294	187	38	cumene	cumene	NOUN
finefocus-4294	187	39	dioxygenase	dioxygenase	NOUN
finefocus-4294	187	40	.	.	PUNCT
finefocus-4294	188	1	nature	nature	NOUN
finefocus-4294	188	2	communications	communication	NOUN
finefocus-4294	188	3	,	,	PUNCT
finefocus-4294	188	4	12	12	NUM
finefocus-4294	188	5	,	,	PUNCT
finefocus-4294	188	6	1095	1095	NUM
finefocus-4294	188	7	.	.	PUNCT
finefocus-4294	189	1	https://doi.org/10.1038/s41467-021-21328-8	https://doi.org/10.1038/s41467-021-21328-8	NUM
finefocus-4294	189	2	;	;	PUNCT
finefocus-4294	189	3	d	d	X
finefocus-4294	189	4	)	)	PUNCT
finefocus-4294	189	5	wissner	wissner	NOUN
finefocus-4294	189	6	,	,	PUNCT
finefocus-4294	189	7	j.	j.	PROPN
finefocus-4294	189	8	l.	l.	PROPN
finefocus-4294	189	9	,	,	PUNCT
finefocus-4294	189	10	escobedo	escobedo	PROPN
finefocus-4294	189	11	-	-	PUNCT
finefocus-4294	189	12	hinojosa	hinojosa	PROPN
finefocus-4294	189	13	,	,	PUNCT
finefocus-4294	189	14	w.	w.	PROPN
finefocus-4294	189	15	,	,	PUNCT
finefocus-4294	189	16	vogel	vogel	PROPN
finefocus-4294	189	17	,	,	PUNCT
finefocus-4294	189	18	a.	a.	PROPN
finefocus-4294	189	19	,	,	PUNCT
finefocus-4294	189	20	&	&	CCONJ
finefocus-4294	189	21	hauer	hauer	PROPN
finefocus-4294	189	22	,	,	PUNCT
finefocus-4294	189	23	b.	b.	PROPN
finefocus-4294	189	24	(	(	PUNCT
finefocus-4294	189	25	2021	2021	NUM
finefocus-4294	189	26	)	)	PUNCT
finefocus-4294	189	27	an	an	DET
finefocus-4294	189	28	engineered	engineer	VERB
finefocus-4294	189	29	toluene	toluene	NOUN
finefocus-4294	189	30	dioxygenase	dioxygenase	NOUN
finefocus-4294	189	31	for	for	ADP
finefocus-4294	189	32	a	a	DET
finefocus-4294	189	33	single	single	ADJ
finefocus-4294	189	34	step	step	NOUN
finefocus-4294	189	35	biocatalytical	biocatalytical	ADJ
finefocus-4294	189	36	production	production	NOUN
finefocus-4294	189	37	of	of	ADP
finefocus-4294	189	38	(	(	PUNCT
finefocus-4294	189	39	-)-(1s,2r)-cis-1,2	-)-(1s,2r)-cis-1,2	NUM
finefocus-4294	189	40	-	-	PUNCT
finefocus-4294	189	41	dihydro-1,2	dihydro-1,2	NOUN
finefocus-4294	189	42	-	-	PUNCT
finefocus-4294	189	43	naphthalenediol	naphthalenediol	NOUN
finefocus-4294	189	44	.	.	PUNCT
finefocus-4294	190	1	journal	journal	PROPN
finefocus-4294	190	2	of	of	ADP
finefocus-4294	190	3	biotechnology	biotechnology	NOUN
finefocus-4294	190	4	,	,	PUNCT
finefocus-4294	190	5	326	326	NUM
finefocus-4294	190	6	,	,	PUNCT
finefocus-4294	190	7	37	37	NUM
finefocus-4294	190	8	-	-	SYM
finefocus-4294	190	9	39	39	NUM
finefocus-4294	190	10	.	.	PUNCT
finefocus-4294	191	1	https://doi.org/10.1016/j.jbiotec.2020.12.007	https://doi.org/10.1016/j.jbiotec.2020.12.007	VERB
finefocus-4294	191	2	;	;	PUNCT
finefocus-4294	191	3	e	e	X
finefocus-4294	191	4	)	)	PUNCT
finefocus-4294	191	5	wissner	wissner	NOUN
finefocus-4294	191	6	,	,	PUNCT
finefocus-4294	191	7	j.	j.	PROPN
finefocus-4294	191	8	l.	l.	PROPN
finefocus-4294	191	9	,	,	PUNCT
finefocus-4294	191	10	schelle	schelle	PROPN
finefocus-4294	191	11	,	,	PUNCT
finefocus-4294	191	12	j.	j.	PROPN
finefocus-4294	191	13	t.	t.	PROPN
finefocus-4294	191	14	,	,	PUNCT
finefocus-4294	191	15	escobedo	escobedo	PROPN
finefocus-4294	191	16	-	-	PUNCT
finefocus-4294	191	17	hinojosa	hinojosa	PROPN
finefocus-4294	191	18	,	,	PUNCT
finefocus-4294	191	19	w.	w.	PROPN
finefocus-4294	191	20	,	,	PUNCT
finefocus-4294	191	21	vogel	vogel	PROPN
finefocus-4294	191	22	,	,	PUNCT
finefocus-4294	191	23	a.	a.	PROPN
finefocus-4294	191	24	,	,	PUNCT
finefocus-4294	191	25	&	&	CCONJ
finefocus-4294	191	26	hauer	hauer	PROPN
finefocus-4294	191	27	,	,	PUNCT
finefocus-4294	191	28	b.	b.	PROPN
finefocus-4294	191	29	(	(	PUNCT
finefocus-4294	191	30	2021	2021	NUM
finefocus-4294	191	31	)	)	PUNCT
finefocus-4294	191	32	semi	semi	ADJ
finefocus-4294	191	33	-	-	ADJ
finefocus-4294	191	34	rational	rational	ADJ
finefocus-4294	191	35	engineering	engineering	NOUN
finefocus-4294	191	36	of	of	ADP
finefocus-4294	191	37	toluene	toluene	NOUN
finefocus-4294	191	38	dioxygenase	dioxygenase	NOUN
finefocus-4294	191	39	from	from	ADP
finefocus-4294	191	40	pseudomonas	pseudomona	NOUN
finefocus-4294	191	41	putida	putida	NOUN
finefocus-4294	191	42	f1	f1	NOUN
finefocus-4294	191	43	towards	towards	ADP
finefocus-4294	191	44	oxyfunctionalization	oxyfunctionalization	NOUN
finefocus-4294	191	45	of	of	ADP
finefocus-4294	191	46	bicyclic	bicyclic	NOUN
finefocus-4294	191	47	aromatics	aromatic	NOUN
finefocus-4294	191	48	.	.	PUNCT
finefocus-4294	192	1	advanced	advanced	ADJ
finefocus-4294	192	2	synthesis	synthesis	NOUN
finefocus-4294	192	3	and	and	CCONJ
finefocus-4294	192	4	catalysis	catalysis	NOUN
finefocus-4294	192	5	,	,	PUNCT
finefocus-4294	192	6	363	363	NUM
finefocus-4294	192	7	,	,	PUNCT
finefocus-4294	192	8	37	37	NUM
finefocus-4294	192	9	,	,	PUNCT
finefocus-4294	192	10	4905	4905	NUM
finefocus-4294	192	11	-	-	SYM
finefocus-4294	192	12	4914	4914	NUM
finefocus-4294	192	13	.	.	PUNCT
finefocus-4294	193	1	https://doi.org/10.1002/adsc.202100296	https://doi.org/10.1002/adsc.202100296	NOUN
finefocus-4294	193	2	12	12	NUM
finefocus-4294	193	3	.	.	PUNCT
finefocus-4294	194	1	gibson	gibson	PROPN
finefocus-4294	194	2	,	,	PUNCT
finefocus-4294	194	3	d.	d.	PROPN
finefocus-4294	194	4	t.	t.	PROPN
finefocus-4294	194	5	,	,	PUNCT
finefocus-4294	194	6	koch	koch	PROPN
finefocus-4294	194	7	,	,	PUNCT
finefocus-4294	194	8	j.	j.	PROPN
finefocus-4294	194	9	r.	r.	PROPN
finefocus-4294	194	10	,	,	PUNCT
finefocus-4294	194	11	schuld	schuld	AUX
finefocus-4294	194	12	,	,	PUNCT
finefocus-4294	194	13	c.	c.	PROPN
finefocus-4294	194	14	l.	l.	PROPN
finefocus-4294	194	15	,	,	PUNCT
finefocus-4294	194	16	&	&	CCONJ
finefocus-4294	194	17	kallio	kallio	PROPN
finefocus-4294	194	18	,	,	PUNCT
finefocus-4294	194	19	r.e	r.e	PROPN
finefocus-4294	194	20	.	.	PROPN
finefocus-4294	194	21	(	(	PUNCT
finefocus-4294	194	22	1968	1968	NUM
finefocus-4294	194	23	)	)	PUNCT
finefocus-4294	194	24	oxidative	oxidative	ADJ
finefocus-4294	194	25	degradation	degradation	NOUN
finefocus-4294	194	26	of	of	ADP
finefocus-4294	194	27	aromatic	aromatic	ADJ
finefocus-4294	194	28	hydrocarbons	hydrocarbon	NOUN
finefocus-4294	194	29	by	by	ADP
finefocus-4294	194	30	microorganisms	microorganism	NOUN
finefocus-4294	194	31	.	.	PUNCT
finefocus-4294	195	1	ii	ii	PROPN
finefocus-4294	195	2	.	.	PUNCT
finefocus-4294	196	1	metabolism	metabolism	NOUN
finefocus-4294	196	2	of	of	ADP
finefocus-4294	196	3	halogenated	halogenated	ADJ
finefocus-4294	196	4	aromatic	aromatic	ADJ
finefocus-4294	196	5	hydrocarbons	hydrocarbon	NOUN
finefocus-4294	196	6	.	.	PUNCT
finefocus-4294	197	1	biochemistry	biochemistry	NOUN
finefocus-4294	197	2	,	,	PUNCT
finefocus-4294	197	3	7	7	NUM
finefocus-4294	197	4	,	,	PUNCT
finefocus-4294	197	5	3795	3795	NUM
finefocus-4294	197	6	-	-	SYM
finefocus-4294	197	7	3802	3802	NUM
finefocus-4294	197	8	.	.	PUNCT
finefocus-4294	198	1	https://doi.org/10.1021/bi00851a003	https://doi.org/10.1021/bi00851a003	ADJ
finefocus-4294	198	2	13	13	NUM
finefocus-4294	198	3	.	.	PUNCT
finefocus-4294	198	4	goddard	goddard	PROPN
finefocus-4294	198	5	,	,	PUNCT
finefocus-4294	198	6	t.	t.	PROPN
finefocus-4294	198	7	d.	d.	PROPN
finefocus-4294	198	8	,	,	PUNCT
finefocus-4294	198	9	huang	huang	PROPN
finefocus-4294	198	10	,	,	PUNCT
finefocus-4294	198	11	c.	c.	PROPN
finefocus-4294	198	12	c.	c.	PROPN
finefocus-4294	198	13	,	,	PUNCT
finefocus-4294	198	14	meng	meng	PROPN
finefocus-4294	198	15	,	,	PUNCT
finefocus-4294	198	16	e.	e.	PROPN
finefocus-4294	198	17	c.	c.	PROPN
finefocus-4294	198	18	,	,	PUNCT
finefocus-4294	198	19	pettersen	pettersen	PROPN
finefocus-4294	198	20	,	,	PUNCT
finefocus-4294	198	21	e.	e.	PROPN
finefocus-4294	198	22	f.	f.	PROPN
finefocus-4294	198	23	,	,	PUNCT
finefocus-4294	198	24	couch	couch	NOUN
finefocus-4294	198	25	,	,	PUNCT
finefocus-4294	198	26	g.	g.	PROPN
finefocus-4294	198	27	s.	s.	PROPN
finefocus-4294	198	28	,	,	PUNCT
finefocus-4294	198	29	morris	morris	PROPN
finefocus-4294	198	30	,	,	PUNCT
finefocus-4294	198	31	j.	j.	PROPN
finefocus-4294	198	32	h.	h.	PROPN
finefocus-4294	198	33	,	,	PUNCT
finefocus-4294	198	34	&	&	CCONJ
finefocus-4294	198	35	ferrin	ferrin	PROPN
finefocus-4294	198	36	,	,	PUNCT
finefocus-4294	198	37	t.	t.	PROPN
finefocus-4294	198	38	e.	e.	PROPN
finefocus-4294	198	39	(	(	PUNCT
finefocus-4294	198	40	2018	2018	NUM
finefocus-4294	198	41	)	)	PUNCT
finefocus-4294	198	42	ucsf	ucsf	PROPN
finefocus-4294	198	43	chimerax	chimerax	PROPN
finefocus-4294	198	44	:	:	PUNCT
finefocus-4294	198	45	meeting	meet	VERB
finefocus-4294	198	46	modern	modern	ADJ
finefocus-4294	198	47	challenges	challenge	NOUN
finefocus-4294	198	48	in	in	ADP
finefocus-4294	198	49	visualization	visualization	NOUN
finefocus-4294	198	50	and	and	CCONJ
finefocus-4294	198	51	analysis	analysis	NOUN
finefocus-4294	198	52	.	.	PUNCT
finefocus-4294	199	1	protein	protein	NOUN
finefocus-4294	199	2	science	science	NOUN
finefocus-4294	199	3	,	,	PUNCT
finefocus-4294	199	4	27	27	NUM
finefocus-4294	199	5	,	,	PUNCT
finefocus-4294	199	6	14–25	14–25	NUM
finefocus-4294	199	7	.	.	PUNCT
finefocus-4294	200	1	https://doi.org/10.1002/pro.3235	https://doi.org/10.1002/pro.3235	PROPN
finefocus-4294	200	2	14	14	NUM
finefocus-4294	200	3	.	.	PUNCT
finefocus-4294	201	1	gómez	gómez	NOUN
finefocus-4294	201	2	-	-	PUNCT
finefocus-4294	201	3	gil	gil	PROPN
finefocus-4294	201	4	,	,	PUNCT
finefocus-4294	201	5	l.	l.	PROPN
finefocus-4294	201	6	,	,	PUNCT
finefocus-4294	201	7	kumar	kumar	PROPN
finefocus-4294	201	8	,	,	PUNCT
finefocus-4294	201	9	p.	p.	PROPN
finefocus-4294	201	10	,	,	PUNCT
finefocus-4294	201	11	barriault	barriault	VERB
finefocus-4294	201	12	,	,	PUNCT
finefocus-4294	201	13	d.	d.	PROPN
finefocus-4294	201	14	,	,	PUNCT
finefocus-4294	201	15	bolin	bolin	PROPN
finefocus-4294	201	16	,	,	PUNCT
finefocus-4294	201	17	j.	j.	PROPN
finefocus-4294	201	18	t.	t.	PROPN
finefocus-4294	201	19	,	,	PUNCT
finefocus-4294	201	20	sylvestre	sylvestre	NOUN
finefocus-4294	201	21	,	,	PUNCT
finefocus-4294	201	22	m.	m.	NOUN
finefocus-4294	201	23	,	,	PUNCT
finefocus-4294	201	24	&	&	CCONJ
finefocus-4294	201	25	eltis	eltis	PROPN
finefocus-4294	201	26	,	,	PUNCT
finefocus-4294	201	27	l.	l.	PROPN
finefocus-4294	201	28	d.	d.	PROPN
finefocus-4294	201	29	(	(	PUNCT
finefocus-4294	201	30	2007	2007	NUM
finefocus-4294	201	31	)	)	PUNCT
finefocus-4294	201	32	characterization	characterization	NOUN
finefocus-4294	201	33	of	of	ADP
finefocus-4294	201	34	biphenyl	biphenyl	ADJ
finefocus-4294	201	35	dioxygenase	dioxygenase	NOUN
finefocus-4294	201	36	of	of	ADP
finefocus-4294	201	37	pandoraea	pandoraea	NOUN
finefocus-4294	201	38	pnomenusa	pnomenusa	PROPN
finefocus-4294	201	39	b-356	b-356	NOUN
finefocus-4294	201	40	as	as	ADP
finefocus-4294	201	41	a	a	DET
finefocus-4294	201	42	potent	potent	ADJ
finefocus-4294	201	43	polychlorinated	polychlorinate	VERB
finefocus-4294	201	44	biphenyl	biphenyl	NOUN
finefocus-4294	201	45	-	-	PUNCT
finefocus-4294	201	46	degrading	degrade	VERB
finefocus-4294	201	47	enzyme	enzyme	NOUN
finefocus-4294	201	48	.	.	PUNCT
finefocus-4294	202	1	journal	journal	PROPN
finefocus-4294	202	2	of	of	ADP
finefocus-4294	202	3	bacteriology	bacteriology	NOUN
finefocus-4294	202	4	,	,	PUNCT
finefocus-4294	202	5	189	189	NUM
finefocus-4294	202	6	,	,	PUNCT
finefocus-4294	202	7	5705	5705	NUM
finefocus-4294	202	8	-	-	SYM
finefocus-4294	202	9	5715	5715	NUM
finefocus-4294	202	10	.	.	PUNCT
finefocus-4294	203	1	https://doi.org/10.1128/jb.01476-06	https://doi.org/10.1128/jb.01476-06	ADP
finefocus-4294	203	2	15	15	NUM
finefocus-4294	203	3	.	.	PUNCT
finefocus-4294	203	4	gujral	gujral	NOUN
finefocus-4294	203	5	,	,	PUNCT
finefocus-4294	203	6	s.	s.	PROPN
finefocus-4294	203	7	s.	s.	PROPN
finefocus-4294	203	8	,	,	PUNCT
finefocus-4294	203	9	sheela	sheela	PROPN
finefocus-4294	203	10	,	,	PUNCT
finefocus-4294	203	11	m.	m.	NOUN
finefocus-4294	203	12	a.	a.	PROPN
finefocus-4294	203	13	,	,	PUNCT
finefocus-4294	203	14	khatri	khatri	PROPN
finefocus-4294	203	15	,	,	PUNCT
finefocus-4294	203	16	s.	s.	PROPN
finefocus-4294	203	17	k.	k.	PROPN
finefocus-4294	203	18	,	,	PUNCT
finefocus-4294	203	19	&	&	CCONJ
finefocus-4294	203	20	singla	singla	PROPN
finefocus-4294	203	21	,	,	PUNCT
finefocus-4294	203	22	r.	r.	PROPN
finefocus-4294	203	23	a.	a.	PROPN
finefocus-4294	203	24	(	(	PUNCT
finefocus-4294	203	25	2012	2012	NUM
finefocus-4294	203	26	)	)	PUNCT
finefocus-4294	203	27	focus	focus	NOUN
finefocus-4294	203	28	&	&	CCONJ
finefocus-4294	203	29	review	review	NOUN
finefocus-4294	203	30	on	on	ADP
finefocus-4294	203	31	the	the	DET
finefocus-4294	203	32	advancement	advancement	NOUN
finefocus-4294	203	33	of	of	ADP
finefocus-4294	203	34	green	green	ADJ
finefocus-4294	203	35	chemistry	chemistry	NOUN
finefocus-4294	203	36	.	.	PUNCT
finefocus-4294	204	1	indo	indo	PROPN
finefocus-4294	204	2	global	global	PROPN
finefocus-4294	204	3	journal	journal	PROPN
finefocus-4294	204	4	of	of	ADP
finefocus-4294	204	5	pharmaceutical	pharmaceutical	NOUN
finefocus-4294	204	6	sciences	science	NOUN
finefocus-4294	204	7	,	,	PUNCT
finefocus-4294	204	8	2	2	NUM
finefocus-4294	204	9	,	,	PUNCT
finefocus-4294	204	10	397–408	397–408	NUM
finefocus-4294	204	11	.	.	PUNCT
finefocus-4294	205	1	https://doi.org/10.35652/igjps.2012.46	https://doi.org/10.35652/igjps.2012.46	PROPN
finefocus-4294	205	2	16	16	NUM
finefocus-4294	205	3	.	.	PUNCT
finefocus-4294	206	1	hudlicky	hudlicky	PROPN
finefocus-4294	206	2	,	,	PUNCT
finefocus-4294	206	3	t.	t.	PROPN
finefocus-4294	206	4	,	,	PUNCT
finefocus-4294	206	5	&	&	CCONJ
finefocus-4294	206	6	reed	reed	PROPN
finefocus-4294	206	7	,	,	PUNCT
finefocus-4294	206	8	j.	j.	PROPN
finefocus-4294	206	9	w.	w.	PROPN
finefocus-4294	206	10	(	(	PUNCT
finefocus-4294	206	11	2009	2009	NUM
finefocus-4294	206	12	)	)	PUNCT
finefocus-4294	206	13	celebrating	celebrate	VERB
finefocus-4294	206	14	20	20	NUM
finefocus-4294	206	15	years	year	NOUN
finefocus-4294	206	16	of	of	ADP
finefocus-4294	206	17	synlett	synlett	ADJ
finefocus-4294	206	18	special	special	ADJ
finefocus-4294	206	19	account	account	NOUN
finefocus-4294	206	20	on	on	ADP
finefocus-4294	206	21	the	the	DET
finefocus-4294	206	22	merits	merit	NOUN
finefocus-4294	206	23	of	of	ADP
finefocus-4294	206	24	biocatalysis	biocatalysis	NOUN
finefocus-4294	206	25	and	and	CCONJ
finefocus-4294	206	26	the	the	DET
finefocus-4294	206	27	impact	impact	NOUN
finefocus-4294	206	28	of	of	ADP
finefocus-4294	206	29	arene	arene	ADJ
finefocus-4294	206	30	cis	cis	NOUN
finefocus-4294	206	31	-	-	PUNCT
finefocus-4294	206	32	dihydrodiols	dihydrodiol	NOUN
finefocus-4294	206	33	on	on	ADP
finefocus-4294	206	34	enantioselective	enantioselective	ADJ
finefocus-4294	206	35	synthesis	synthesis	NOUN
finefocus-4294	206	36	.	.	PUNCT
finefocus-4294	207	1	synlett	synlett	NOUN
finefocus-4294	207	2	,	,	PUNCT
finefocus-4294	207	3	5	5	NUM
finefocus-4294	207	4	,	,	PUNCT
finefocus-4294	207	5	685	685	NUM
finefocus-4294	207	6	-	-	SYM
finefocus-4294	207	7	703	703	NUM
finefocus-4294	207	8	.	.	PUNCT
finefocus-4294	208	1	https://doi.org/10.1055/s-0028-1087946	https://doi.org/10.1055/s-0028-1087946	PROPN
finefocus-4294	208	2	17	17	NUM
finefocus-4294	208	3	.	.	PUNCT
finefocus-4294	209	1	iwai	iwai	PROPN
finefocus-4294	209	2	,	,	PUNCT
finefocus-4294	209	3	s.	s.	PROPN
finefocus-4294	209	4	,	,	PUNCT
finefocus-4294	209	5	chai	chai	NOUN
finefocus-4294	209	6	,	,	PUNCT
finefocus-4294	209	7	b.	b.	PROPN
finefocus-4294	209	8	,	,	PUNCT
finefocus-4294	209	9	sul	sul	PROPN
finefocus-4294	209	10	,	,	PUNCT
finefocus-4294	209	11	w.	w.	PROPN
finefocus-4294	209	12	j.	j.	PROPN
finefocus-4294	209	13	,	,	PUNCT
finefocus-4294	209	14	cole	cole	PROPN
finefocus-4294	209	15	,	,	PUNCT
finefocus-4294	209	16	j.	j.	PROPN
finefocus-4294	209	17	r.	r.	PROPN
finefocus-4294	209	18	,	,	PUNCT
finefocus-4294	209	19	hashsham	hashsham	PROPN
finefocus-4294	209	20	,	,	PUNCT
finefocus-4294	209	21	s.	s.	PROPN
finefocus-4294	209	22	a.	a.	PROPN
finefocus-4294	209	23	,	,	PUNCT
finefocus-4294	209	24	&	&	CCONJ
finefocus-4294	209	25	tiedje	tiedje	PROPN
finefocus-4294	209	26	,	,	PUNCT
finefocus-4294	209	27	j.	j.	PROPN
finefocus-4294	209	28	m.	m.	PROPN
finefocus-4294	209	29	(	(	PUNCT
finefocus-4294	209	30	2010	2010	NUM
finefocus-4294	209	31	)	)	PUNCT
finefocus-4294	209	32	gene	gene	NOUN
finefocus-4294	209	33	-	-	PUNCT
finefocus-4294	209	34	targeted	target	VERB
finefocus-4294	209	35	-	-	PUNCT
finefocus-4294	209	36	metagenomics	metagenomic	NOUN
finefocus-4294	209	37	reveals	reveal	VERB
finefocus-4294	209	38	extensive	extensive	ADJ
finefocus-4294	209	39	diversity	diversity	NOUN
finefocus-4294	209	40	of	of	ADP
finefocus-4294	209	41	aromatic	aromatic	ADJ
finefocus-4294	209	42	dioxygenase	dioxygenase	NOUN
finefocus-4294	209	43	genes	gene	NOUN
finefocus-4294	209	44	in	in	ADP
finefocus-4294	209	45	the	the	DET
finefocus-4294	209	46	environment	environment	NOUN
finefocus-4294	209	47	.	.	PUNCT
finefocus-4294	210	1	the	the	DET
finefocus-4294	210	2	isme	isme	PROPN
finefocus-4294	210	3	journal	journal	PROPN
finefocus-4294	210	4	,	,	PUNCT
finefocus-4294	210	5	4	4	NUM
finefocus-4294	210	6	,	,	PUNCT
finefocus-4294	210	7	279	279	NUM
finefocus-4294	210	8	-	-	SYM
finefocus-4294	210	9	285	285	NUM
finefocus-4294	210	10	.	.	PUNCT
finefocus-4294	211	1	https://doi.org/10.1038/ismej.2009.104	https://doi.org/10.1038/ismej.2009.104	NOUN
finefocus-4294	211	2	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	3	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	4	https://doi.org/10.1038/s41467-021-21328-8	https://doi.org/10.1038/s41467-021-21328-8	NUM
finefocus-4294	211	5	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	6	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	7	https://doi.org/	https://doi.org/	NOUN
finefocus-4294	211	8	https://doi.org/	https://doi.org/	NOUN
finefocus-4294	211	9	https://doi.org/10.1128/jb.01476-06	https://doi.org/10.1128/jb.01476-06	ADP
finefocus-4294	211	10	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	11	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	12	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	211	13	fine	fine	ADJ
finefocus-4294	211	14	focus	focus	NOUN
finefocus-4294	211	15	|	|	ADV
finefocus-4294	211	16	volume	volume	VERB
finefocus-4294	211	17	10106	10106	NUM
finefocus-4294	211	18	18	18	NUM
finefocus-4294	211	19	.	.	PUNCT
finefocus-4294	212	1	karlsson	karlsson	PROPN
finefocus-4294	212	2	,	,	PUNCT
finefocus-4294	212	3	a.	a.	PROPN
finefocus-4294	212	4	,	,	PUNCT
finefocus-4294	212	5	parales	parale	NOUN
finefocus-4294	212	6	,	,	PUNCT
finefocus-4294	212	7	j.	j.	PROPN
finefocus-4294	212	8	v.	v.	PROPN
finefocus-4294	212	9	,	,	PUNCT
finefocus-4294	212	10	parales	parale	NOUN
finefocus-4294	212	11	,	,	PUNCT
finefocus-4294	212	12	r.	r.	PROPN
finefocus-4294	212	13	e.	e.	PROPN
finefocus-4294	212	14	,	,	PUNCT
finefocus-4294	212	15	gibson	gibson	PROPN
finefocus-4294	212	16	,	,	PUNCT
finefocus-4294	212	17	d.	d.	PROPN
finefocus-4294	212	18	t.	t.	PROPN
finefocus-4294	212	19	,	,	PUNCT
finefocus-4294	212	20	eklund	eklund	PROPN
finefocus-4294	212	21	,	,	PUNCT
finefocus-4294	212	22	h.	h.	PROPN
finefocus-4294	212	23	,	,	PUNCT
finefocus-4294	212	24	&	&	CCONJ
finefocus-4294	212	25	ramaswamy	ramaswamy	PROPN
finefocus-4294	212	26	,	,	PUNCT
finefocus-4294	212	27	s.	s.	PROPN
finefocus-4294	212	28	(	(	PUNCT
finefocus-4294	212	29	2003	2003	NUM
finefocus-4294	212	30	)	)	PUNCT
finefocus-4294	212	31	crystal	crystal	NOUN
finefocus-4294	212	32	structure	structure	NOUN
finefocus-4294	212	33	of	of	ADP
finefocus-4294	212	34	naphthalene	naphthalene	NOUN
finefocus-4294	212	35	dioxygenase	dioxygenase	NOUN
finefocus-4294	212	36	:	:	PUNCT
finefocus-4294	212	37	side	side	NOUN
finefocus-4294	212	38	-	-	PUNCT
finefocus-4294	212	39	on	on	ADP
finefocus-4294	212	40	binding	binding	NOUN
finefocus-4294	212	41	of	of	ADP
finefocus-4294	212	42	dioxygen	dioxygen	NOUN
finefocus-4294	212	43	to	to	ADP
finefocus-4294	212	44	iron	iron	NOUN
finefocus-4294	212	45	.	.	PUNCT
finefocus-4294	213	1	science	science	NOUN
finefocus-4294	213	2	,	,	PUNCT
finefocus-4294	213	3	299	299	NUM
finefocus-4294	213	4	,	,	PUNCT
finefocus-4294	213	5	1039	1039	NUM
finefocus-4294	213	6	-	-	SYM
finefocus-4294	213	7	1042	1042	NUM
finefocus-4294	213	8	.	.	PUNCT
finefocus-4294	214	1	https://doi.org/10.1126/science.1078020	https://doi.org/10.1126/science.1078020	NOUN
finefocus-4294	214	2	19	19	NUM
finefocus-4294	214	3	.	.	PUNCT
finefocus-4294	215	1	kätelhöhn	kätelhöhn	PROPN
finefocus-4294	215	2	,	,	PUNCT
finefocus-4294	215	3	a.	a.	PROPN
finefocus-4294	215	4	,	,	PUNCT
finefocus-4294	215	5	meys	meys	PROPN
finefocus-4294	215	6	,	,	PUNCT
finefocus-4294	215	7	r.	r.	PROPN
finefocus-4294	215	8	,	,	PUNCT
finefocus-4294	215	9	deutz	deutz	PROPN
finefocus-4294	215	10	,	,	PUNCT
finefocus-4294	215	11	s.	s.	PROPN
finefocus-4294	215	12	,	,	PUNCT
finefocus-4294	215	13	suh	suh	PROPN
finefocus-4294	215	14	,	,	PUNCT
finefocus-4294	215	15	s.	s.	PROPN
finefocus-4294	215	16	,	,	PUNCT
finefocus-4294	215	17	&	&	CCONJ
finefocus-4294	215	18	bardow	bardow	PROPN
finefocus-4294	215	19	,	,	PUNCT
finefocus-4294	215	20	a.	a.	NOUN
finefocus-4294	215	21	(	(	PUNCT
finefocus-4294	215	22	2019	2019	NUM
finefocus-4294	215	23	)	)	PUNCT
finefocus-4294	215	24	climate	climate	NOUN
finefocus-4294	215	25	change	change	NOUN
finefocus-4294	215	26	mitigation	mitigation	NOUN
finefocus-4294	215	27	potential	potential	NOUN
finefocus-4294	215	28	of	of	ADP
finefocus-4294	215	29	carbon	carbon	NOUN
finefocus-4294	215	30	capture	capture	NOUN
finefocus-4294	215	31	and	and	CCONJ
finefocus-4294	215	32	utilization	utilization	NOUN
finefocus-4294	215	33	in	in	ADP
finefocus-4294	215	34	the	the	DET
finefocus-4294	215	35	chemical	chemical	NOUN
finefocus-4294	215	36	industry	industry	NOUN
finefocus-4294	215	37	.	.	PUNCT
finefocus-4294	216	1	proceedings	proceeding	NOUN
finefocus-4294	216	2	of	of	ADP
finefocus-4294	216	3	the	the	DET
finefocus-4294	216	4	national	national	PROPN
finefocus-4294	216	5	academy	academy	PROPN
finefocus-4294	216	6	of	of	ADP
finefocus-4294	216	7	science	science	PROPN
finefocus-4294	216	8	usa	usa	PROPN
finefocus-4294	216	9	,	,	PUNCT
finefocus-4294	216	10	116	116	NUM
finefocus-4294	216	11	,	,	PUNCT
finefocus-4294	216	12	11187	11187	NUM
finefocus-4294	216	13	-	-	SYM
finefocus-4294	216	14	11194	11194	NUM
finefocus-4294	216	15	.	.	PUNCT
finefocus-4294	217	1	https://doi.org/10.1073/pnas.1821029116	https://doi.org/10.1073/pnas.1821029116	PROPN
finefocus-4294	217	2	20	20	NUM
finefocus-4294	217	3	.	.	PUNCT
finefocus-4294	218	1	kim	kim	PROPN
finefocus-4294	218	2	,	,	PUNCT
finefocus-4294	218	3	d.	d.	PROPN
finefocus-4294	218	4	,	,	PUNCT
finefocus-4294	218	5	yoo	yoo	PROPN
finefocus-4294	218	6	,	,	PUNCT
finefocus-4294	218	7	m.	m.	NOUN
finefocus-4294	218	8	,	,	PUNCT
finefocus-4294	218	9	choi	choi	NOUN
finefocus-4294	218	10	,	,	PUNCT
finefocus-4294	218	11	k.	k.	PROPN
finefocus-4294	218	12	y.	y.	PROPN
finefocus-4294	218	13	,	,	PUNCT
finefocus-4294	218	14	kang	kang	PROPN
finefocus-4294	218	15	,	,	PUNCT
finefocus-4294	218	16	b.	b.	PROPN
finefocus-4294	218	17	s.	s.	PROPN
finefocus-4294	218	18	,	,	PUNCT
finefocus-4294	218	19	&	&	CCONJ
finefocus-4294	218	20	kim	kim	PROPN
finefocus-4294	218	21	,	,	PUNCT
finefocus-4294	218	22	e.	e.	PROPN
finefocus-4294	218	23	(	(	PUNCT
finefocus-4294	218	24	2013	2013	NUM
finefocus-4294	218	25	)	)	PUNCT
finefocus-4294	218	26	characterization	characterization	NOUN
finefocus-4294	218	27	and	and	CCONJ
finefocus-4294	218	28	engineering	engineering	NOUN
finefocus-4294	218	29	of	of	ADP
finefocus-4294	218	30	an	an	DET
finefocus-4294	218	31	o	o	ADJ
finefocus-4294	218	32	-	-	NOUN
finefocus-4294	218	33	xylene	xylene	NOUN
finefocus-4294	218	34	dioxygenase	dioxygenase	NOUN
finefocus-4294	218	35	for	for	ADP
finefocus-4294	218	36	biocatalytic	biocatalytic	ADJ
finefocus-4294	218	37	applications	application	NOUN
finefocus-4294	218	38	.	.	PUNCT
finefocus-4294	219	1	bioresource	bioresource	PROPN
finefocus-4294	219	2	technology	technology	NOUN
finefocus-4294	219	3	,	,	PUNCT
finefocus-4294	219	4	145	145	NUM
finefocus-4294	219	5	,	,	PUNCT
finefocus-4294	219	6	123	123	NUM
finefocus-4294	219	7	-	-	SYM
finefocus-4294	219	8	127	127	NUM
finefocus-4294	219	9	.	.	PUNCT
finefocus-4294	220	1	https://doi.org/10.1016/j.biortech.2013.03.034	https://doi.org/10.1016/j.biortech.2013.03.034	NOUN
finefocus-4294	220	2	21	21	NUM
finefocus-4294	220	3	.	.	PUNCT
finefocus-4294	221	1	a	a	DET
finefocus-4294	221	2	)	)	PUNCT
finefocus-4294	221	3	kimura	kimura	NOUN
finefocus-4294	221	4	,	,	PUNCT
finefocus-4294	221	5	n.	n.	NOUN
finefocus-4294	221	6	,	,	PUNCT
finefocus-4294	221	7	nishi	nishi	NOUN
finefocus-4294	221	8	,	,	PUNCT
finefocus-4294	221	9	a.	a.	NOUN
finefocus-4294	221	10	,	,	PUNCT
finefocus-4294	221	11	goto	goto	NOUN
finefocus-4294	221	12	,	,	PUNCT
finefocus-4294	221	13	m.	m.	NOUN
finefocus-4294	221	14	,	,	PUNCT
finefocus-4294	221	15	&	&	CCONJ
finefocus-4294	221	16	furukawa	furukawa	PROPN
finefocus-4294	221	17	,	,	PUNCT
finefocus-4294	221	18	k.	k.	PROPN
finefocus-4294	221	19	(	(	PUNCT
finefocus-4294	221	20	1997	1997	NUM
finefocus-4294	221	21	)	)	PUNCT
finefocus-4294	221	22	functional	functional	ADJ
finefocus-4294	221	23	analyses	analysis	NOUN
finefocus-4294	221	24	of	of	ADP
finefocus-4294	221	25	a	a	DET
finefocus-4294	221	26	variety	variety	NOUN
finefocus-4294	221	27	of	of	ADP
finefocus-4294	221	28	chimeric	chimeric	ADJ
finefocus-4294	221	29	dioxygenases	dioxygenase	NOUN
finefocus-4294	221	30	constructed	construct	VERB
finefocus-4294	221	31	from	from	ADP
finefocus-4294	221	32	two	two	NUM
finefocus-4294	221	33	biphenyl	biphenyl	NOUN
finefocus-4294	221	34	dioxygenases	dioxygenase	NOUN
finefocus-4294	221	35	that	that	PRON
finefocus-4294	221	36	are	be	AUX
finefocus-4294	221	37	similar	similar	ADJ
finefocus-4294	221	38	structurally	structurally	ADV
finefocus-4294	221	39	but	but	CCONJ
finefocus-4294	221	40	different	different	ADJ
finefocus-4294	221	41	functionally	functionally	ADV
finefocus-4294	221	42	.	.	PUNCT
finefocus-4294	222	1	journal	journal	PROPN
finefocus-4294	222	2	of	of	ADP
finefocus-4294	222	3	bacteriology	bacteriology	NOUN
finefocus-4294	222	4	,	,	PUNCT
finefocus-4294	222	5	179	179	NUM
finefocus-4294	222	6	,	,	PUNCT
finefocus-4294	222	7	3936	3936	NUM
finefocus-4294	222	8	-	-	SYM
finefocus-4294	222	9	3943	3943	NUM
finefocus-4294	222	10	.	.	PUNCT
finefocus-4294	223	1	https://doi.org/10.1128/jb.179.12.3936-3943.1997	https://doi.org/10.1128/jb.179.12.3936-3943.1997	PRON
finefocus-4294	223	2	;	;	PUNCT
finefocus-4294	223	3	b	b	X
finefocus-4294	223	4	)	)	PUNCT
finefocus-4294	223	5	kumamaru	kumamaru	NOUN
finefocus-4294	223	6	,	,	PUNCT
finefocus-4294	223	7	t.	t.	PROPN
finefocus-4294	223	8	,	,	PUNCT
finefocus-4294	223	9	suenaga	suenaga	NOUN
finefocus-4294	223	10	,	,	PUNCT
finefocus-4294	223	11	h.	h.	PROPN
finefocus-4294	223	12	,	,	PUNCT
finefocus-4294	223	13	mitsuoka	mitsuoka	PROPN
finefocus-4294	223	14	,	,	PUNCT
finefocus-4294	223	15	m.	m.	NOUN
finefocus-4294	223	16	,	,	PUNCT
finefocus-4294	223	17	watanabe	watanabe	PROPN
finefocus-4294	223	18	,	,	PUNCT
finefocus-4294	223	19	t.	t.	PROPN
finefocus-4294	223	20	,	,	PUNCT
finefocus-4294	223	21	furukawa	furukawa	PROPN
finefocus-4294	223	22	,	,	PUNCT
finefocus-4294	223	23	k.	k.	PROPN
finefocus-4294	223	24	(	(	PUNCT
finefocus-4294	223	25	1998	1998	NUM
finefocus-4294	223	26	)	)	PUNCT
finefocus-4294	223	27	enhanced	enhance	VERB
finefocus-4294	223	28	degradation	degradation	NOUN
finefocus-4294	223	29	of	of	ADP
finefocus-4294	223	30	polychlorinated	polychlorinate	VERB
finefocus-4294	223	31	biphenyls	biphenyls	NOUN
finefocus-4294	223	32	by	by	ADP
finefocus-4294	223	33	directed	direct	VERB
finefocus-4294	223	34	evolution	evolution	NOUN
finefocus-4294	223	35	of	of	ADP
finefocus-4294	223	36	biphenyl	biphenyl	NOUN
finefocus-4294	223	37	dioxygenase	dioxygenase	NOUN
finefocus-4294	223	38	.	.	PUNCT
finefocus-4294	224	1	nature	nature	NOUN
finefocus-4294	224	2	biotechnology	biotechnology	NOUN
finefocus-4294	224	3	,	,	PUNCT
finefocus-4294	224	4	16	16	NUM
finefocus-4294	224	5	,	,	PUNCT
finefocus-4294	224	6	663	663	NUM
finefocus-4294	224	7	-	-	SYM
finefocus-4294	224	8	666	666	NUM
finefocus-4294	224	9	.	.	PUNCT
finefocus-4294	225	1	https://doi.org/10.1038/nbt0798-663	https://doi.org/10.1038/nbt0798-663	PROPN
finefocus-4294	225	2	22	22	NUM
finefocus-4294	225	3	.	.	PUNCT
finefocus-4294	226	1	lessner	lessner	PROPN
finefocus-4294	226	2	,	,	PUNCT
finefocus-4294	226	3	d.	d.	PROPN
finefocus-4294	226	4	j.	j.	PROPN
finefocus-4294	226	5	,	,	PUNCT
finefocus-4294	226	6	johnson	johnson	PROPN
finefocus-4294	226	7	,	,	PUNCT
finefocus-4294	226	8	g.	g.	PROPN
finefocus-4294	226	9	r.	r.	PROPN
finefocus-4294	226	10	,	,	PUNCT
finefocus-4294	226	11	parales	parale	NOUN
finefocus-4294	226	12	,	,	PUNCT
finefocus-4294	226	13	r.	r.	PROPN
finefocus-4294	226	14	e.	e.	PROPN
finefocus-4294	226	15	,	,	PUNCT
finefocus-4294	226	16	spain	spain	PROPN
finefocus-4294	226	17	,	,	PUNCT
finefocus-4294	226	18	j.	j.	PROPN
finefocus-4294	226	19	c.	c.	PROPN
finefocus-4294	226	20	,	,	PUNCT
finefocus-4294	226	21	gibson	gibson	PROPN
finefocus-4294	226	22	,	,	PUNCT
finefocus-4294	226	23	d.	d.	PROPN
finefocus-4294	226	24	t.	t.	PROPN
finefocus-4294	226	25	(	(	PUNCT
finefocus-4294	226	26	2002	2002	NUM
finefocus-4294	226	27	)	)	PUNCT
finefocus-4294	226	28	molecular	molecular	ADJ
finefocus-4294	226	29	characterization	characterization	NOUN
finefocus-4294	226	30	and	and	CCONJ
finefocus-4294	226	31	substrate	substrate	NOUN
finefocus-4294	226	32	specificity	specificity	NOUN
finefocus-4294	226	33	of	of	ADP
finefocus-4294	226	34	nitrobenzene	nitrobenzene	ADJ
finefocus-4294	226	35	dioxygenase	dioxygenase	NOUN
finefocus-4294	226	36	from	from	ADP
finefocus-4294	226	37	comamonas	comamonas	PROPN
finefocus-4294	226	38	sp	sp	PROPN
finefocus-4294	226	39	.	.	PROPN
finefocus-4294	226	40	strain	strain	PROPN
finefocus-4294	226	41	js765	js765	PROPN
finefocus-4294	226	42	.	.	PUNCT
finefocus-4294	227	1	applied	apply	VERB
finefocus-4294	227	2	and	and	CCONJ
finefocus-4294	227	3	environmental	environmental	ADJ
finefocus-4294	227	4	microbiology	microbiology	NOUN
finefocus-4294	227	5	,	,	PUNCT
finefocus-4294	227	6	68	68	NUM
finefocus-4294	227	7	,	,	PUNCT
finefocus-4294	227	8	634	634	NUM
finefocus-4294	227	9	-	-	SYM
finefocus-4294	227	10	641	641	NUM
finefocus-4294	227	11	.	.	PUNCT
finefocus-4294	228	1	https://doi.org/10.1128/aem.68.2.634-641.2002	https://doi.org/10.1128/aem.68.2.634-641.2002	NUM
finefocus-4294	228	2	23	23	NUM
finefocus-4294	228	3	.	.	PUNCT
finefocus-4294	229	1	lewis	lewis	PROPN
finefocus-4294	229	2	,	,	PUNCT
finefocus-4294	229	3	s.	s.	PROPN
finefocus-4294	229	4	e.	e.	PROPN
finefocus-4294	229	5	(	(	PUNCT
finefocus-4294	229	6	2016	2016	NUM
finefocus-4294	229	7	)	)	PUNCT
finefocus-4294	229	8	in	in	ADP
finefocus-4294	229	9	asymmetric	asymmetric	ADJ
finefocus-4294	229	10	dearomatization	dearomatization	NOUN
finefocus-4294	229	11	under	under	ADP
finefocus-4294	229	12	enzymatic	enzymatic	ADJ
finefocus-4294	229	13	conditions	condition	NOUN
finefocus-4294	229	14	(	(	PUNCT
finefocus-4294	229	15	ed	ed	NOUN
finefocus-4294	229	16	.	.	PUNCT
finefocus-4294	230	1	you	you	PRON
finefocus-4294	230	2	,	,	PUNCT
finefocus-4294	230	3	s.-l	s.-l	PROPN
finefocus-4294	230	4	.	.	PUNCT
finefocus-4294	230	5	)	)	PUNCT
finefocus-4294	230	6	,	,	PUNCT
finefocus-4294	230	7	chichester	chichester	NOUN
finefocus-4294	230	8	:	:	PUNCT
finefocus-4294	230	9	wiley	wiley	PROPN
finefocus-4294	230	10	,	,	PUNCT
finefocus-4294	230	11	p.	p.	NOUN
finefocus-4294	230	12	279	279	NUM
finefocus-4294	230	13	-	-	SYM
finefocus-4294	230	14	346	346	NUM
finefocus-4294	230	15	.	.	PUNCT
finefocus-4294	231	1	24	24	NUM
finefocus-4294	231	2	.	.	PUNCT
finefocus-4294	232	1	liu	liu	PROPN
finefocus-4294	232	2	,	,	PUNCT
finefocus-4294	232	3	h.	h.	PROPN
finefocus-4294	232	4	,	,	PUNCT
finefocus-4294	232	5	naismith	naismith	PROPN
finefocus-4294	232	6	,	,	PUNCT
finefocus-4294	232	7	j.	j.	PROPN
finefocus-4294	232	8	h.	h.	PROPN
finefocus-4294	232	9	(	(	PUNCT
finefocus-4294	232	10	2008	2008	NUM
finefocus-4294	232	11	)	)	PUNCT
finefocus-4294	232	12	an	an	DET
finefocus-4294	232	13	efficient	efficient	ADJ
finefocus-4294	232	14	one	one	NUM
finefocus-4294	232	15	-	-	PUNCT
finefocus-4294	232	16	step	step	NOUN
finefocus-4294	232	17	site	site	NOUN
finefocus-4294	232	18	-	-	PUNCT
finefocus-4294	232	19	directed	direct	VERB
finefocus-4294	232	20	deletion	deletion	NOUN
finefocus-4294	232	21	,	,	PUNCT
finefocus-4294	232	22	insertion	insertion	NOUN
finefocus-4294	232	23	,	,	PUNCT
finefocus-4294	232	24	single	single	ADJ
finefocus-4294	232	25	and	and	CCONJ
finefocus-4294	232	26	multiple	multiple	ADJ
finefocus-4294	232	27	-	-	PUNCT
finefocus-4294	232	28	site	site	NOUN
finefocus-4294	232	29	plasmid	plasmid	ADJ
finefocus-4294	232	30	mutagenesis	mutagenesis	NOUN
finefocus-4294	232	31	protocol	protocol	NOUN
finefocus-4294	232	32	.	.	PUNCT
finefocus-4294	233	1	bmc	bmc	PROPN
finefocus-4294	233	2	biotechnology	biotechnology	NOUN
finefocus-4294	233	3	,	,	PUNCT
finefocus-4294	233	4	8	8	NUM
finefocus-4294	233	5	,	,	PUNCT
finefocus-4294	233	6	91	91	NUM
finefocus-4294	233	7	.	.	PUNCT
finefocus-4294	234	1	https://doi.org/10.1186/1472-6750-8-91	https://doi.org/10.1186/1472-6750-8-91	VERB
finefocus-4294	235	1	25	25	NUM
finefocus-4294	235	2	.	.	PUNCT
finefocus-4294	235	3	moretti	moretti	PROPN
finefocus-4294	235	4	,	,	PUNCT
finefocus-4294	235	5	s.	s.	PROPN
finefocus-4294	235	6	,	,	PUNCT
finefocus-4294	235	7	armougom	armougom	PROPN
finefocus-4294	235	8	,	,	PUNCT
finefocus-4294	235	9	f.	f.	PROPN
finefocus-4294	235	10	,	,	PUNCT
finefocus-4294	235	11	wallace	wallace	PROPN
finefocus-4294	235	12	,	,	PUNCT
finefocus-4294	235	13	i.	i.	NOUN
finefocus-4294	235	14	m.	m.	PROPN
finefocus-4294	235	15	,	,	PUNCT
finefocus-4294	235	16	higgins	higgins	PROPN
finefocus-4294	235	17	,	,	PUNCT
finefocus-4294	235	18	d.	d.	PROPN
finefocus-4294	235	19	g.	g.	PROPN
finefocus-4294	235	20	,	,	PUNCT
finefocus-4294	235	21	jongeneel	jongeneel	PROPN
finefocus-4294	235	22	,	,	PUNCT
finefocus-4294	235	23	c.	c.	PROPN
finefocus-4294	235	24	v.	v.	PROPN
finefocus-4294	235	25	,	,	PUNCT
finefocus-4294	235	26	&	&	CCONJ
finefocus-4294	235	27	notredame	notredame	PROPN
finefocus-4294	235	28	,	,	PUNCT
finefocus-4294	235	29	c.	c.	PROPN
finefocus-4294	235	30	(	(	PUNCT
finefocus-4294	235	31	2007	2007	NUM
finefocus-4294	235	32	)	)	PUNCT
finefocus-4294	235	33	the	the	DET
finefocus-4294	235	34	m	m	ADJ
finefocus-4294	235	35	-	-	ADJ
finefocus-4294	235	36	coffee	coffee	NOUN
finefocus-4294	235	37	web	web	NOUN
finefocus-4294	235	38	server	server	NOUN
finefocus-4294	235	39	:	:	PUNCT
finefocus-4294	235	40	a	a	DET
finefocus-4294	235	41	meta	meta	NOUN
finefocus-4294	235	42	-	-	PUNCT
finefocus-4294	235	43	method	method	NOUN
finefocus-4294	235	44	for	for	ADP
finefocus-4294	235	45	computing	compute	VERB
finefocus-4294	235	46	multiple	multiple	ADJ
finefocus-4294	235	47	sequence	sequence	NOUN
finefocus-4294	235	48	alignments	alignment	NOUN
finefocus-4294	235	49	by	by	ADP
finefocus-4294	235	50	combining	combine	VERB
finefocus-4294	235	51	alternative	alternative	ADJ
finefocus-4294	235	52	alignment	alignment	ADJ
finefocus-4294	235	53	methods	method	NOUN
finefocus-4294	235	54	.	.	PUNCT
finefocus-4294	236	1	nucleic	nucleic	ADJ
finefocus-4294	236	2	acids	acid	NOUN
finefocus-4294	236	3	research	research	NOUN
finefocus-4294	236	4	,	,	PUNCT
finefocus-4294	236	5	35	35	NUM
finefocus-4294	236	6	,	,	PUNCT
finefocus-4294	236	7	w645	w645	PROPN
finefocus-4294	236	8	-	-	PUNCT
finefocus-4294	236	9	w648	w648	PROPN
finefocus-4294	236	10	.	.	PUNCT
finefocus-4294	237	1	https://doi.org/10.1093/nar/gkm333	https://doi.org/10.1093/nar/gkm333	PROPN
finefocus-4294	237	2	26	26	NUM
finefocus-4294	237	3	.	.	PUNCT
finefocus-4294	238	1	newman	newman	PROPN
finefocus-4294	238	2	,	,	PUNCT
finefocus-4294	238	3	l.	l.	PROPN
finefocus-4294	238	4	m.	m.	PROPN
finefocus-4294	238	5	,	,	PUNCT
finefocus-4294	238	6	garcia	garcia	PROPN
finefocus-4294	238	7	,	,	PUNCT
finefocus-4294	238	8	h.	h.	PROPN
finefocus-4294	238	9	,	,	PUNCT
finefocus-4294	238	10	hudlicky	hudlicky	NOUN
finefocus-4294	238	11	,	,	PUNCT
finefocus-4294	238	12	t.	t.	PROPN
finefocus-4294	238	13	,	,	PUNCT
finefocus-4294	238	14	&	&	CCONJ
finefocus-4294	238	15	selifonov	selifonov	PROPN
finefocus-4294	238	16	,	,	PUNCT
finefocus-4294	238	17	s.	s.	PROPN
finefocus-4294	238	18	a.	a.	PROPN
finefocus-4294	238	19	(	(	PUNCT
finefocus-4294	238	20	2004	2004	NUM
finefocus-4294	238	21	)	)	PUNCT
finefocus-4294	238	22	directed	direct	VERB
finefocus-4294	238	23	evolution	evolution	NOUN
finefocus-4294	238	24	of	of	ADP
finefocus-4294	238	25	the	the	DET
finefocus-4294	238	26	dioxygenase	dioxygenase	NOUN
finefocus-4294	238	27	complex	complex	NOUN
finefocus-4294	238	28	for	for	ADP
finefocus-4294	238	29	the	the	DET
finefocus-4294	238	30	synthesis	synthesis	NOUN
finefocus-4294	238	31	of	of	ADP
finefocus-4294	238	32	furanone	furanone	NOUN
finefocus-4294	238	33	flavor	flavor	NOUN
finefocus-4294	238	34	compounds	compound	NOUN
finefocus-4294	238	35	.	.	PUNCT
finefocus-4294	239	1	tetrahedron	tetrahedron	NOUN
finefocus-4294	239	2	,	,	PUNCT
finefocus-4294	239	3	60	60	NUM
finefocus-4294	239	4	,	,	PUNCT
finefocus-4294	239	5	729	729	NUM
finefocus-4294	239	6	-	-	SYM
finefocus-4294	239	7	734	734	NUM
finefocus-4294	239	8	.	.	PUNCT
finefocus-4294	240	1	https://doi.org/10.1016/j.tet.2003.10.105	https://doi.org/10.1016/j.tet.2003.10.105	NOUN
finefocus-4294	240	2	27	27	NUM
finefocus-4294	240	3	.	.	PUNCT
finefocus-4294	241	1	osifalujo	osifalujo	PROPN
finefocus-4294	241	2	,	,	PUNCT
finefocus-4294	241	3	e.	e.	PROPN
finefocus-4294	241	4	a.	a.	PROPN
finefocus-4294	241	5	,	,	PUNCT
finefocus-4294	241	6	preston	preston	PROPN
finefocus-4294	241	7	-	-	PROPN
finefocus-4294	241	8	herrera	herrera	PROPN
finefocus-4294	241	9	,	,	PUNCT
finefocus-4294	241	10	c.	c.	PROPN
finefocus-4294	241	11	,	,	PUNCT
finefocus-4294	241	12	betts	betts	PROPN
finefocus-4294	241	13	,	,	PUNCT
finefocus-4294	241	14	p.	p.	PROPN
finefocus-4294	241	15	c.	c.	PROPN
finefocus-4294	241	16	,	,	PUNCT
finefocus-4294	241	17	satterwhite	satterwhite	NOUN
finefocus-4294	241	18	,	,	PUNCT
finefocus-4294	241	19	l.	l.	PROPN
finefocus-4294	241	20	r.	r.	PROPN
finefocus-4294	241	21	,	,	PUNCT
finefocus-4294	241	22	&	&	CCONJ
finefocus-4294	241	23	froese	froese	PROPN
finefocus-4294	241	24	,	,	PUNCT
finefocus-4294	241	25	j.	j.	PROPN
finefocus-4294	241	26	t.	t.	PROPN
finefocus-4294	241	27	(	(	PUNCT
finefocus-4294	241	28	2022	2022	NUM
finefocus-4294	241	29	)	)	PUNCT
finefocus-4294	241	30	improving	improve	VERB
finefocus-4294	241	31	toluene	toluene	ADJ
finefocus-4294	241	32	dioxygenase	dioxygenase	NOUN
finefocus-4294	241	33	activity	activity	NOUN
finefocus-4294	241	34	for	for	ADP
finefocus-4294	241	35	ester	ester	NOUN
finefocus-4294	241	36	-	-	PUNCT
finefocus-4294	241	37	functionalized	functionalize	VERB
finefocus-4294	241	38	substrates	substrate	NOUN
finefocus-4294	241	39	through	through	ADP
finefocus-4294	241	40	enzyme	enzyme	NOUN
finefocus-4294	241	41	engineering	engineering	NOUN
finefocus-4294	241	42	.	.	PUNCT
finefocus-4294	242	1	chemistryselect	chemistryselect	NOUN
finefocus-4294	242	2	,	,	PUNCT
finefocus-4294	242	3	7	7	NUM
finefocus-4294	242	4	,	,	PUNCT
finefocus-4294	242	5	e202200753	e202200753	PROPN
finefocus-4294	242	6	.	.	NOUN
finefocus-4294	243	1	https://doi.org/10.1002/slct.202200753	https://doi.org/10.1002/slct.202200753	PROPN
finefocus-4294	243	2	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	VERB
finefocus-4294	243	3	https://doi.org/10.1073/pnas.1821029116	https://doi.org/10.1073/pnas.1821029116	PRON
finefocus-4294	243	4	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	243	5	https://doi.org/10.1128/jb.179.12.3936-3943.1997	https://doi.org/10.1128/jb.179.12.3936-3943.1997	DET
finefocus-4294	243	6	https://doi.org/10.1038/nbt0798-663	https://doi.org/10.1038/nbt0798-663	NOUN
finefocus-4294	243	7	https://doi.org/10.1128/aem.68.2.634-641.2002	https://doi.org/10.1128/aem.68.2.634-641.2002	NUM
finefocus-4294	243	8	https://doi.org/10.1186/1472-6750-8-91	https://doi.org/10.1186/1472-6750-8-91	NOUN
finefocus-4294	243	9	https://doi.org/10.1002/slct.202200753	https://doi.org/10.1002/slct.202200753	PROPN
finefocus-4294	243	10	https://doi.org/10.1016/j.tet.2003.10.105	https://doi.org/10.1016/j.tet.2003.10.105	PROPN
finefocus-4294	243	11	https://doi.org/10.1002/slct.202200753	https://doi.org/10.1002/slct.202200753	PROPN
finefocus-4294	243	12	betts	betts	PROPN
finefocus-4294	243	13	&	&	CCONJ
finefocus-4294	243	14	froese	froese	PROPN
finefocus-4294	244	1	|	|	ADV
finefocus-4294	244	2	investigation	investigation	NOUN
finefocus-4294	244	3	of	of	ADP
finefocus-4294	244	4	the	the	DET
finefocus-4294	244	5	effects	effect	NOUN
finefocus-4294	244	6	of	of	ADP
finefocus-4294	244	7	mutating	mutate	VERB
finefocus-4294	244	8	iron	iron	NOUN
finefocus-4294	244	9	-	-	PUNCT
finefocus-4294	244	10	coordinating	coordinate	VERB
finefocus-4294	244	11	residues	residue	NOUN
finefocus-4294	244	12	in	in	ADP
finefocus-4294	244	13	rieske	rieske	ADJ
finefocus-4294	244	14	dioxygenases	dioxygenase	NOUN
finefocus-4294	244	15	107	107	NUM
finefocus-4294	244	16	28	28	NUM
finefocus-4294	244	17	.	.	PUNCT
finefocus-4294	245	1	parales	parale	VERB
finefocus-4294	245	2	r.e	r.e	PROPN
finefocus-4294	245	3	.	.	PROPN
finefocus-4294	245	4	,	,	PUNCT
finefocus-4294	245	5	&	&	CCONJ
finefocus-4294	245	6	resnick	resnick	PROPN
finefocus-4294	245	7	s.m	s.m	PROPN
finefocus-4294	245	8	.	.	PROPN
finefocus-4294	246	1	(	(	PUNCT
finefocus-4294	246	2	2007	2007	NUM
finefocus-4294	246	3	)	)	PUNCT
finefocus-4294	246	4	in	in	ADP
finefocus-4294	246	5	biodegradation	biodegradation	NOUN
finefocus-4294	246	6	and	and	CCONJ
finefocus-4294	246	7	bioremediation	bioremediation	NOUN
finefocus-4294	246	8	.	.	PUNCT
finefocus-4294	247	1	soil	soil	NOUN
finefocus-4294	247	2	biology	biology	NOUN
finefocus-4294	247	3	,	,	PUNCT
finefocus-4294	247	4	vol	vol	NOUN
finefocus-4294	247	5	2	2	NUM
finefocus-4294	247	6	.	.	PUNCT
finefocus-4294	247	7	(	(	PUNCT
finefocus-4294	247	8	eds	ed	NOUN
finefocus-4294	247	9	.	.	PUNCT
finefocus-4294	248	1	singh	singh	PROPN
finefocus-4294	248	2	,	,	PUNCT
finefocus-4294	248	3	a.	a.	NOUN
finefocus-4294	248	4	;	;	PUNCT
finefocus-4294	248	5	ward	ward	NOUN
finefocus-4294	248	6	,	,	PUNCT
finefocus-4294	248	7	o.	o.	PROPN
finefocus-4294	248	8	p.	p.	PROPN
finefocus-4294	248	9	)	)	PUNCT
finefocus-4294	249	1	berlin	berlin	PROPN
finefocus-4294	249	2	:	:	PUNCT
finefocus-4294	249	3	springer	springer	NOUN
finefocus-4294	249	4	,	,	PUNCT
finefocus-4294	249	5	p.	p.	NOUN
finefocus-4294	249	6	175	175	NUM
finefocus-4294	249	7	-	-	SYM
finefocus-4294	249	8	195	195	NUM
finefocus-4294	249	9	.	.	NOUN
finefocus-4294	249	10	29	29	NUM
finefocus-4294	249	11	.	.	PUNCT
finefocus-4294	250	1	pott	pott	PROPN
finefocus-4294	250	2	,	,	PUNCT
finefocus-4294	250	3	m.	m.	NOUN
finefocus-4294	250	4	,	,	PUNCT
finefocus-4294	250	5	tinzl	tinzl	NOUN
finefocus-4294	250	6	,	,	PUNCT
finefocus-4294	250	7	m.	m.	NOUN
finefocus-4294	250	8	,	,	PUNCT
finefocus-4294	250	9	hayashi	hayashi	PROPN
finefocus-4294	250	10	,	,	PUNCT
finefocus-4294	250	11	t.	t.	PROPN
finefocus-4294	250	12	,	,	PUNCT
finefocus-4294	250	13	ota	ota	PROPN
finefocus-4294	250	14	,	,	PUNCT
finefocus-4294	250	15	y.	y.	PROPN
finefocus-4294	250	16	,	,	PUNCT
finefocus-4294	250	17	dunkelmann	dunkelmann	PROPN
finefocus-4294	250	18	,	,	PUNCT
finefocus-4294	250	19	d.	d.	PROPN
finefocus-4294	250	20	,	,	PUNCT
finefocus-4294	250	21	mittl	mittl	PROPN
finefocus-4294	250	22	,	,	PUNCT
finefocus-4294	250	23	p.	p.	PROPN
finefocus-4294	250	24	r.	r.	PROPN
finefocus-4294	250	25	e.	e.	PROPN
finefocus-4294	250	26	,	,	PUNCT
finefocus-4294	250	27	&	&	CCONJ
finefocus-4294	250	28	hilvert	hilvert	PROPN
finefocus-4294	250	29	,	,	PUNCT
finefocus-4294	250	30	d.	d.	PROPN
finefocus-4294	250	31	(	(	PUNCT
finefocus-4294	250	32	2021	2021	NUM
finefocus-4294	250	33	)	)	PUNCT
finefocus-4294	250	34	noncanonical	noncanonical	ADJ
finefocus-4294	250	35	heme	heme	NOUN
finefocus-4294	250	36	ligands	ligand	NOUN
finefocus-4294	250	37	steer	steer	VERB
finefocus-4294	250	38	carbene	carbene	NOUN
finefocus-4294	250	39	transfer	transfer	NOUN
finefocus-4294	250	40	reactivity	reactivity	NOUN
finefocus-4294	250	41	in	in	ADP
finefocus-4294	250	42	an	an	DET
finefocus-4294	250	43	artificial	artificial	ADJ
finefocus-4294	250	44	metalloenzyme	metalloenzyme	NOUN
finefocus-4294	250	45	.	.	PUNCT
finefocus-4294	251	1	angewandte	angewandte	PROPN
finefocus-4294	251	2	chemie	chemie	PROPN
finefocus-4294	251	3	international	international	PROPN
finefocus-4294	251	4	edition	edition	PROPN
finefocus-4294	251	5	,	,	PUNCT
finefocus-4294	251	6	27	27	NUM
finefocus-4294	251	7	,	,	PUNCT
finefocus-4294	251	8	15063	15063	NUM
finefocus-4294	251	9	-	-	SYM
finefocus-4294	251	10	15068	15068	NUM
finefocus-4294	251	11	.	.	PUNCT
finefocus-4294	252	1	https://doi.org/10.1002/anie.202103437	https://doi.org/10.1002/anie.202103437	NOUN
finefocus-4294	252	2	30	30	NUM
finefocus-4294	252	3	.	.	PUNCT
finefocus-4294	253	1	preston	preston	PROPN
finefocus-4294	253	2	-	-	PROPN
finefocus-4294	253	3	herrera	herrera	PROPN
finefocus-4294	253	4	,	,	PUNCT
finefocus-4294	253	5	c.	c.	PROPN
finefocus-4294	253	6	,	,	PUNCT
finefocus-4294	253	7	jackson	jackson	PROPN
finefocus-4294	253	8	,	,	PUNCT
finefocus-4294	253	9	a.	a.	PROPN
finefocus-4294	253	10	s.	s.	PROPN
finefocus-4294	253	11	,	,	PUNCT
finefocus-4294	253	12	bachmann	bachmann	PROPN
finefocus-4294	253	13	,	,	PUNCT
finefocus-4294	253	14	b.	b.	PROPN
finefocus-4294	253	15	o.	o.	PROPN
finefocus-4294	253	16	,	,	PUNCT
finefocus-4294	253	17	&	&	CCONJ
finefocus-4294	253	18	froese	froese	PROPN
finefocus-4294	253	19	,	,	PUNCT
finefocus-4294	253	20	j.	j.	PROPN
finefocus-4294	253	21	t.	t.	PROPN
finefocus-4294	253	22	(	(	PUNCT
finefocus-4294	253	23	2021	2021	NUM
finefocus-4294	253	24	)	)	PUNCT
finefocus-4294	253	25	development	development	NOUN
finefocus-4294	253	26	and	and	CCONJ
finefocus-4294	253	27	application	application	NOUN
finefocus-4294	253	28	of	of	ADP
finefocus-4294	253	29	a	a	DET
finefocus-4294	253	30	high	high	ADJ
finefocus-4294	253	31	throughput	throughput	NOUN
finefocus-4294	253	32	assay	assay	NOUN
finefocus-4294	253	33	system	system	NOUN
finefocus-4294	253	34	for	for	ADP
finefocus-4294	253	35	the	the	DET
finefocus-4294	253	36	detection	detection	NOUN
finefocus-4294	253	37	of	of	ADP
finefocus-4294	253	38	rieske	rieske	ADJ
finefocus-4294	253	39	dioxygenase	dioxygenase	NOUN
finefocus-4294	253	40	activity	activity	NOUN
finefocus-4294	253	41	.	.	PUNCT
finefocus-4294	254	1	organic	organic	ADJ
finefocus-4294	254	2	and	and	CCONJ
finefocus-4294	254	3	biomolecular	biomolecular	ADJ
finefocus-4294	254	4	chemistry	chemistry	NOUN
finefocus-4294	254	5	,	,	PUNCT
finefocus-4294	254	6	19	19	NUM
finefocus-4294	254	7	,	,	PUNCT
finefocus-4294	254	8	775	775	NUM
finefocus-4294	254	9	-	-	SYM
finefocus-4294	254	10	784	784	NUM
finefocus-4294	254	11	.	.	PUNCT
finefocus-4294	255	1	https://doi.org/10.1039/	https://doi.org/10.1039/	VERB
finefocus-4294	255	2	d0ob02412k	d0ob02412k	PROPN
finefocus-4294	255	3	31	31	NUM
finefocus-4294	255	4	.	.	PUNCT
finefocus-4294	256	1	robert	robert	PROPN
finefocus-4294	256	2	,	,	PUNCT
finefocus-4294	256	3	x.	x.	PROPN
finefocus-4294	256	4	,	,	PUNCT
finefocus-4294	256	5	&	&	CCONJ
finefocus-4294	256	6	gouet	gouet	PROPN
finefocus-4294	256	7	,	,	PUNCT
finefocus-4294	256	8	p.	p.	NOUN
finefocus-4294	256	9	(	(	PUNCT
finefocus-4294	256	10	2014	2014	NUM
finefocus-4294	256	11	)	)	PUNCT
finefocus-4294	256	12	deciphering	decipher	VERB
finefocus-4294	256	13	key	key	ADJ
finefocus-4294	256	14	features	feature	NOUN
finefocus-4294	256	15	in	in	ADP
finefocus-4294	256	16	protein	protein	NOUN
finefocus-4294	256	17	structures	structure	NOUN
finefocus-4294	256	18	with	with	ADP
finefocus-4294	256	19	the	the	DET
finefocus-4294	256	20	new	new	ADJ
finefocus-4294	256	21	endscript	endscript	NOUN
finefocus-4294	256	22	server	server	NOUN
finefocus-4294	256	23	.	.	PUNCT
finefocus-4294	257	1	nucleic	nucleic	ADJ
finefocus-4294	257	2	acids	acid	NOUN
finefocus-4294	257	3	research	research	NOUN
finefocus-4294	257	4	,	,	PUNCT
finefocus-4294	257	5	42	42	NUM
finefocus-4294	257	6	,	,	PUNCT
finefocus-4294	257	7	w320	w320	PROPN
finefocus-4294	257	8	-	-	PUNCT
finefocus-4294	257	9	w324	w324	PROPN
finefocus-4294	257	10	.	.	PUNCT
finefocus-4294	258	1	https://doi.org/10.1093/nar/gku316	https://doi.org/10.1093/nar/gku316	PROPN
finefocus-4294	258	2	32	32	NUM
finefocus-4294	258	3	.	.	PUNCT
finefocus-4294	259	1	saito	saito	PROPN
finefocus-4294	259	2	,	,	PUNCT
finefocus-4294	259	3	a.	a.	NOUN
finefocus-4294	259	4	,	,	PUNCT
finefocus-4294	259	5	iwabuchi	iwabuchi	NOUN
finefocus-4294	259	6	,	,	PUNCT
finefocus-4294	259	7	t.	t.	PROPN
finefocus-4294	259	8	,	,	PUNCT
finefocus-4294	259	9	harayama	harayama	PROPN
finefocus-4294	259	10	,	,	PUNCT
finefocus-4294	259	11	s.	s.	PROPN
finefocus-4294	259	12	(	(	PUNCT
finefocus-4294	259	13	2000	2000	NUM
finefocus-4294	259	14	)	)	PUNCT
finefocus-4294	259	15	a	a	DET
finefocus-4294	259	16	novel	novel	ADJ
finefocus-4294	259	17	phenanthrene	phenanthrene	NOUN
finefocus-4294	259	18	dioxygenase	dioxygenase	NOUN
finefocus-4294	259	19	from	from	ADP
finefocus-4294	259	20	nocardioides	nocardioide	NOUN
finefocus-4294	259	21	sp	sp	NOUN
finefocus-4294	259	22	.	.	PROPN
finefocus-4294	259	23	strain	strain	PROPN
finefocus-4294	259	24	kp7	kp7	NOUN
finefocus-4294	259	25	:	:	PUNCT
finefocus-4294	259	26	expression	expression	NOUN
finefocus-4294	259	27	in	in	ADP
finefocus-4294	259	28	escherichia	escherichia	NOUN
finefocus-4294	259	29	coli	coli	NOUN
finefocus-4294	259	30	.	.	PUNCT
finefocus-4294	260	1	journal	journal	PROPN
finefocus-4294	260	2	of	of	ADP
finefocus-4294	260	3	bacteriology	bacteriology	NOUN
finefocus-4294	260	4	,	,	PUNCT
finefocus-4294	260	5	182	182	NUM
finefocus-4294	260	6	,	,	PUNCT
finefocus-4294	260	7	2134	2134	NUM
finefocus-4294	260	8	-	-	SYM
finefocus-4294	260	9	2141	2141	NUM
finefocus-4294	260	10	.	.	PUNCT
finefocus-4294	261	1	https://doi.org/10.1128/jb.182.8.2134-2141.2000	https://doi.org/10.1128/jb.182.8.2134-2141.2000	NUM
finefocus-4294	261	2	33	33	NUM
finefocus-4294	261	3	.	.	PUNCT
finefocus-4294	262	1	sakamoto	sakamoto	PROPN
finefocus-4294	262	2	,	,	PUNCT
finefocus-4294	262	3	t.	t.	PROPN
finefocus-4294	262	4	,	,	PUNCT
finefocus-4294	262	5	joern	joern	PROPN
finefocus-4294	262	6	,	,	PUNCT
finefocus-4294	262	7	j.	j.	PROPN
finefocus-4294	262	8	m.	m.	PROPN
finefocus-4294	262	9	,	,	PUNCT
finefocus-4294	262	10	arisawa	arisawa	PROPN
finefocus-4294	262	11	,	,	PUNCT
finefocus-4294	262	12	a.	a.	PROPN
finefocus-4294	262	13	,	,	PUNCT
finefocus-4294	262	14	&	&	CCONJ
finefocus-4294	262	15	arnold	arnold	PROPN
finefocus-4294	262	16	,	,	PUNCT
finefocus-4294	262	17	f.	f.	PROPN
finefocus-4294	262	18	h.	h.	PROPN
finefocus-4294	262	19	(	(	PUNCT
finefocus-4294	262	20	2001	2001	NUM
finefocus-4294	262	21	)	)	PUNCT
finefocus-4294	262	22	laboratory	laboratory	NOUN
finefocus-4294	262	23	evolution	evolution	NOUN
finefocus-4294	262	24	of	of	ADP
finefocus-4294	262	25	toluene	toluene	ADJ
finefocus-4294	262	26	dioxygenase	dioxygenase	NOUN
finefocus-4294	262	27	to	to	PART
finefocus-4294	262	28	accept	accept	VERB
finefocus-4294	262	29	4	4	NUM
finefocus-4294	262	30	-	-	PUNCT
finefocus-4294	262	31	picoline	picoline	NOUN
finefocus-4294	262	32	as	as	ADP
finefocus-4294	262	33	a	a	DET
finefocus-4294	262	34	substrate	substrate	NOUN
finefocus-4294	262	35	.	.	PUNCT
finefocus-4294	263	1	applied	apply	VERB
finefocus-4294	263	2	and	and	CCONJ
finefocus-4294	263	3	environmental	environmental	ADJ
finefocus-4294	263	4	microbiology	microbiology	NOUN
finefocus-4294	263	5	,	,	PUNCT
finefocus-4294	263	6	67	67	NUM
finefocus-4294	263	7	,	,	PUNCT
finefocus-4294	263	8	3882	3882	NUM
finefocus-4294	263	9	-	-	SYM
finefocus-4294	263	10	3887	3887	NUM
finefocus-4294	263	11	.	.	PUNCT
finefocus-4294	264	1	https://doi.org/10.1128/aem.67.9.3882-3887.2001	https://doi.org/10.1128/aem.67.9.3882-3887.2001	NOUN
finefocus-4294	264	2	34	34	NUM
finefocus-4294	264	3	.	.	PUNCT
finefocus-4294	264	4	sharma	sharma	PROPN
finefocus-4294	264	5	,	,	PUNCT
finefocus-4294	264	6	p.	p.	PROPN
finefocus-4294	264	7	,	,	PUNCT
finefocus-4294	264	8	kumar	kumar	PROPN
finefocus-4294	264	9	,	,	PUNCT
finefocus-4294	264	10	m.	m.	NOUN
finefocus-4294	264	11	,	,	PUNCT
finefocus-4294	264	12	sharma	sharma	PROPN
finefocus-4294	264	13	,	,	PUNCT
finefocus-4294	264	14	a.	a.	PROPN
finefocus-4294	264	15	,	,	PUNCT
finefocus-4294	264	16	arora	arora	PROPN
finefocus-4294	264	17	,	,	PUNCT
finefocus-4294	264	18	d.	d.	PROPN
finefocus-4294	264	19	,	,	PUNCT
finefocus-4294	264	20	patial	patial	ADJ
finefocus-4294	264	21	,	,	PUNCT
finefocus-4294	264	22	a.	a.	NOUN
finefocus-4294	264	23	,	,	PUNCT
finefocus-4294	264	24	&	&	CCONJ
finefocus-4294	264	25	rana	rana	PROPN
finefocus-4294	264	26	,	,	PUNCT
finefocus-4294	264	27	m.	m.	NOUN
finefocus-4294	264	28	(	(	PUNCT
finefocus-4294	264	29	2020	2020	NUM
finefocus-4294	264	30	)	)	PUNCT
finefocus-4294	264	31	an	an	DET
finefocus-4294	264	32	overview	overview	NOUN
finefocus-4294	264	33	on	on	ADP
finefocus-4294	264	34	green	green	ADJ
finefocus-4294	264	35	chemistry	chemistry	NOUN
finefocus-4294	264	36	.	.	PUNCT
finefocus-4294	265	1	world	world	PROPN
finefocus-4294	265	2	journal	journal	PROPN
finefocus-4294	265	3	of	of	ADP
finefocus-4294	265	4	pharmacy	pharmacy	NOUN
finefocus-4294	265	5	and	and	CCONJ
finefocus-4294	265	6	pharmaceutical	pharmaceutical	NOUN
finefocus-4294	265	7	sciences	science	NOUN
finefocus-4294	265	8	,	,	PUNCT
finefocus-4294	265	9	8	8	NUM
finefocus-4294	265	10	,	,	PUNCT
finefocus-4294	265	11	202	202	NUM
finefocus-4294	265	12	-	-	SYM
finefocus-4294	265	13	208	208	NUM
finefocus-4294	265	14	.	.	PUNCT
finefocus-4294	266	1	https://doi.org/10.20959/wjpps20195-13602	https://doi.org/10.20959/wjpps20195-13602	NOUN
finefocus-4294	267	1	35	35	NUM
finefocus-4294	267	2	.	.	PUNCT
finefocus-4294	267	3	sheldrake	sheldrake	NOUN
finefocus-4294	267	4	,	,	PUNCT
finefocus-4294	267	5	g.	g.	PROPN
finefocus-4294	267	6	n.	n.	PROPN
finefocus-4294	267	7	(	(	PUNCT
finefocus-4294	267	8	1992	1992	NUM
finefocus-4294	267	9	)	)	PUNCT
finefocus-4294	267	10	in	in	ADP
finefocus-4294	267	11	chirality	chirality	NOUN
finefocus-4294	267	12	in	in	ADP
finefocus-4294	267	13	industry	industry	NOUN
finefocus-4294	267	14	:	:	PUNCT
finefocus-4294	267	15	the	the	DET
finefocus-4294	267	16	commercial	commercial	ADJ
finefocus-4294	267	17	manufacture	manufacture	NOUN
finefocus-4294	267	18	and	and	CCONJ
finefocus-4294	267	19	application	application	NOUN
finefocus-4294	267	20	of	of	ADP
finefocus-4294	267	21	optically	optically	ADV
finefocus-4294	267	22	active	active	ADJ
finefocus-4294	267	23	compounds	compound	NOUN
finefocus-4294	267	24	(	(	PUNCT
finefocus-4294	267	25	ed	ed	NOUN
finefocus-4294	267	26	.	.	PUNCT
finefocus-4294	267	27	a.	a.	PROPN
finefocus-4294	267	28	n.	n.	PROPN
finefocus-4294	267	29	collins	collins	PROPN
finefocus-4294	267	30	,	,	PUNCT
finefocus-4294	267	31	g.	g.	PROPN
finefocus-4294	267	32	n.	n.	PROPN
finefocus-4294	267	33	sheldrake	sheldrake	PROPN
finefocus-4294	267	34	,	,	PUNCT
finefocus-4294	267	35	j.	j.	PROPN
finefocus-4294	267	36	crosby	crosby	PROPN
finefocus-4294	267	37	)	)	PUNCT
finefocus-4294	267	38	chichester	chichester	PROPN
finefocus-4294	267	39	:	:	PUNCT
finefocus-4294	267	40	john	john	PROPN
finefocus-4294	267	41	wiley	wiley	PROPN
finefocus-4294	267	42	&	&	CCONJ
finefocus-4294	267	43	sons	sons	PROPN
finefocus-4294	267	44	ltd	ltd	PROPN
finefocus-4294	267	45	,	,	PUNCT
finefocus-4294	267	46	pp	pp	X
finefocus-4294	267	47	.	.	PUNCT
finefocus-4294	268	1	127–166	127–166	NUM
finefocus-4294	268	2	.	.	PUNCT
finefocus-4294	269	1	36	36	NUM
finefocus-4294	269	2	.	.	PUNCT
finefocus-4294	270	1	van	van	NOUN
finefocus-4294	270	2	geem	geem	PROPN
finefocus-4294	270	3	,	,	PUNCT
finefocus-4294	270	4	k.	k.	PROPN
finefocus-4294	270	5	m.	m.	PROPN
finefocus-4294	270	6	,	,	PUNCT
finefocus-4294	270	7	galvita	galvita	PROPN
finefocus-4294	270	8	,	,	PUNCT
finefocus-4294	270	9	v.	v.	PROPN
finefocus-4294	270	10	v.	v.	CCONJ
finefocus-4294	270	11	,	,	PUNCT
finefocus-4294	270	12	&	&	CCONJ
finefocus-4294	270	13	marin	marin	PROPN
finefocus-4294	270	14	,	,	PUNCT
finefocus-4294	270	15	g.	g.	PROPN
finefocus-4294	270	16	b.	b.	PROPN
finefocus-4294	270	17	(	(	PUNCT
finefocus-4294	270	18	2019	2019	NUM
finefocus-4294	270	19	)	)	PUNCT
finefocus-4294	270	20	making	make	VERB
finefocus-4294	270	21	chemicals	chemical	NOUN
finefocus-4294	270	22	with	with	ADP
finefocus-4294	270	23	electricity	electricity	NOUN
finefocus-4294	270	24	.	.	PUNCT
finefocus-4294	271	1	science	science	NOUN
finefocus-4294	271	2	,	,	PUNCT
finefocus-4294	271	3	364	364	NUM
finefocus-4294	271	4	,	,	PUNCT
finefocus-4294	271	5	734	734	NUM
finefocus-4294	271	6	-	-	SYM
finefocus-4294	271	7	735	735	NUM
finefocus-4294	271	8	.	.	PUNCT
finefocus-4294	271	9	https://doi.org/10.1126/science.aax5179	https://doi.org/10.1126/science.aax5179	NOUN
finefocus-4294	271	10	37	37	NUM
finefocus-4294	271	11	.	.	PUNCT
finefocus-4294	272	1	vila	vila	PROPN
finefocus-4294	272	2	,	,	PUNCT
finefocus-4294	272	3	m.	m.	NOUN
finefocus-4294	272	4	a.	a.	PROPN
finefocus-4294	272	5	,	,	PUNCT
finefocus-4294	272	6	umpierrez	umpierrez	PROPN
finefocus-4294	272	7	,	,	PUNCT
finefocus-4294	272	8	d.	d.	PROPN
finefocus-4294	272	9	,	,	PUNCT
finefocus-4294	272	10	veiga	veiga	ADJ
finefocus-4294	272	11	,	,	PUNCT
finefocus-4294	272	12	n.	n.	NOUN
finefocus-4294	272	13	,	,	PUNCT
finefocus-4294	272	14	seoane	seoane	PROPN
finefocus-4294	272	15	,	,	PUNCT
finefocus-4294	272	16	g.	g.	PROPN
finefocus-4294	272	17	,	,	PUNCT
finefocus-4294	272	18	carrera	carrera	PROPN
finefocus-4294	272	19	,	,	PUNCT
finefocus-4294	272	20	i.	i.	PROPN
finefocus-4294	272	21	,	,	PUNCT
finefocus-4294	272	22	&	&	CCONJ
finefocus-4294	272	23	giordano	giordano	PROPN
finefocus-4294	272	24	,	,	PUNCT
finefocus-4294	272	25	s.	s.	PROPN
finefocus-4294	272	26	r.	r.	PROPN
finefocus-4294	272	27	(	(	PUNCT
finefocus-4294	272	28	2017	2017	NUM
finefocus-4294	272	29	)	)	PUNCT
finefocus-4294	272	30	site	site	NOUN
finefocus-4294	272	31	-	-	PUNCT
finefocus-4294	272	32	directed	direct	VERB
finefocus-4294	272	33	mutagenesis	mutagenesis	NOUN
finefocus-4294	272	34	studies	study	NOUN
finefocus-4294	272	35	on	on	ADP
finefocus-4294	272	36	the	the	DET
finefocus-4294	272	37	toluene	toluene	ADJ
finefocus-4294	272	38	dioxygenase	dioxygenase	NOUN
finefocus-4294	272	39	enzymatic	enzymatic	ADJ
finefocus-4294	272	40	system	system	NOUN
finefocus-4294	272	41	:	:	PUNCT
finefocus-4294	272	42	role	role	NOUN
finefocus-4294	272	43	of	of	ADP
finefocus-4294	272	44	phenylalanine	phenylalanine	NOUN
finefocus-4294	272	45	366	366	NUM
finefocus-4294	272	46	,	,	PUNCT
finefocus-4294	272	47	threonine	threonine	ADJ
finefocus-4294	272	48	365	365	NUM
finefocus-4294	272	49	and	and	CCONJ
finefocus-4294	272	50	isoleucine	isoleucine	NOUN
finefocus-4294	272	51	324	324	NUM
finefocus-4294	272	52	in	in	ADP
finefocus-4294	272	53	the	the	DET
finefocus-4294	272	54	chemo-	chemo-	NOUN
finefocus-4294	272	55	,	,	PUNCT
finefocus-4294	272	56	regio-	regio-	ADJ
finefocus-4294	272	57	,	,	PUNCT
finefocus-4294	272	58	and	and	CCONJ
finefocus-4294	272	59	stereoselectivity	stereoselectivity	NOUN
finefocus-4294	272	60	.	.	PUNCT
finefocus-4294	273	1	advanced	advanced	ADJ
finefocus-4294	273	2	synthesis	synthesis	NOUN
finefocus-4294	273	3	and	and	CCONJ
finefocus-4294	273	4	catalysis	catalysis	NOUN
finefocus-4294	273	5	,	,	PUNCT
finefocus-4294	273	6	359	359	NUM
finefocus-4294	273	7	,	,	PUNCT
finefocus-4294	273	8	2149	2149	NUM
finefocus-4294	273	9	-	-	SYM
finefocus-4294	273	10	2157	2157	NUM
finefocus-4294	273	11	.	.	PUNCT
finefocus-4294	274	1	https://doi.org/10.1002/adsc.201700444	https://doi.org/10.1002/adsc.201700444	NOUN
finefocus-4294	274	2	38	38	NUM
finefocus-4294	274	3	.	.	PUNCT
finefocus-4294	275	1	wang	wang	PROPN
finefocus-4294	275	2	,	,	PUNCT
finefocus-4294	275	3	y.	y.	PROPN
finefocus-4294	275	4	,	,	PUNCT
finefocus-4294	275	5	sun	sun	PROPN
finefocus-4294	275	6	,	,	PUNCT
finefocus-4294	275	7	c.	c.	PROPN
finefocus-4294	275	8	,	,	PUNCT
finefocus-4294	275	9	min	min	PROPN
finefocus-4294	275	10	,	,	PUNCT
finefocus-4294	275	11	j.	j.	PROPN
finefocus-4294	275	12	,	,	PUNCT
finefocus-4294	275	13	li	li	PROPN
finefocus-4294	275	14	,	,	PUNCT
finefocus-4294	275	15	b.	b.	PROPN
finefocus-4294	275	16	,	,	PUNCT
finefocus-4294	275	17	li	li	PROPN
finefocus-4294	275	18	,	,	PUNCT
finefocus-4294	275	19	j.	j.	PROPN
finefocus-4294	275	20	,	,	PUNCT
finefocus-4294	275	21	chen	chen	PROPN
finefocus-4294	275	22	,	,	PUNCT
finefocus-4294	275	23	w.	w.	PROPN
finefocus-4294	275	24	,	,	PUNCT
finefocus-4294	275	25	kong	kong	PROPN
finefocus-4294	275	26	,	,	PUNCT
finefocus-4294	275	27	y.	y.	PROPN
finefocus-4294	275	28	&	&	CCONJ
finefocus-4294	275	29	hu	hu	PROPN
finefocus-4294	275	30	,	,	PUNCT
finefocus-4294	275	31	x.	x.	NOUN
finefocus-4294	275	32	(	(	PUNCT
finefocus-4294	275	33	2021	2021	NUM
finefocus-4294	275	34	)	)	PUNCT
finefocus-4294	275	35	the	the	DET
finefocus-4294	275	36	engineered	engineer	VERB
finefocus-4294	275	37	biphenyl	biphenyl	NOUN
finefocus-4294	275	38	dioxygenases	dioxygenase	NOUN
finefocus-4294	275	39	enhanced	enhance	VERB
finefocus-4294	275	40	the	the	DET
finefocus-4294	275	41	metabolism	metabolism	NOUN
finefocus-4294	275	42	of	of	ADP
finefocus-4294	275	43	dibenzofuran	dibenzofuran	NOUN
finefocus-4294	275	44	.	.	PUNCT
finefocus-4294	276	1	international	international	ADJ
finefocus-4294	276	2	biodeterioration	biodeterioration	NOUN
finefocus-4294	276	3	and	and	CCONJ
finefocus-4294	276	4	biodegradation	biodegradation	NOUN
finefocus-4294	276	5	,	,	PUNCT
finefocus-4294	276	6	161	161	NUM
finefocus-4294	276	7	,	,	PUNCT
finefocus-4294	276	8	105228	105228	NUM
finefocus-4294	276	9	.	.	PUNCT
finefocus-4294	277	1	https://doi.org/10.1016/j.ibiod.2021.105228	https://doi.org/10.1016/j.ibiod.2021.105228	PROPN
finefocus-4294	277	2	https://doi.org/10.1002/slct.202200753	https://doi.org/10.1002/slct.202200753	VERB
finefocus-4294	277	3	https://doi.org/10.1039/d0ob02412k	https://doi.org/10.1039/d0ob02412k	NUM
finefocus-4294	277	4	https://doi.org/10.1039/d0ob02412k	https://doi.org/10.1039/d0ob02412k	PROPN
finefocus-4294	277	5	https://doi.org/10.1039/d0ob02412k	https://doi.org/10.1039/d0ob02412k	PROPN
finefocus-4294	277	6	https://doi.org/10.1128/jb.182.8.2134-2141.2000	https://doi.org/10.1128/jb.182.8.2134-2141.2000	NUM
finefocus-4294	277	7	https://doi.org/10.1128/aem.67.9.3882-3887.2001	https://doi.org/10.1128/aem.67.9.3882-3887.2001	NOUN
finefocus-4294	277	8	https://doi.org/	https://doi.org/	VERB
finefocus-4294	277	9	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	277	10	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	277	11	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	277	12	fine	fine	ADJ
finefocus-4294	277	13	focus	focus	NOUN
finefocus-4294	277	14	|	|	ADV
finefocus-4294	277	15	volume	volume	VERB
finefocus-4294	277	16	10108	10108	NUM
finefocus-4294	277	17	39	39	NUM
finefocus-4294	277	18	.	.	PUNCT
finefocus-4294	278	1	williams	williams	PROPN
finefocus-4294	278	2	,	,	PUNCT
finefocus-4294	278	3	p.	p.	PROPN
finefocus-4294	278	4	a.	a.	PROPN
finefocus-4294	278	5	,	,	PUNCT
finefocus-4294	278	6	&	&	CCONJ
finefocus-4294	278	7	sayers	sayer	NOUN
finefocus-4294	278	8	,	,	PUNCT
finefocus-4294	278	9	j.	j.	PROPN
finefocus-4294	278	10	r.	r.	PROPN
finefocus-4294	278	11	(	(	PUNCT
finefocus-4294	278	12	1994	1994	NUM
finefocus-4294	278	13	)	)	PUNCT
finefocus-4294	278	14	the	the	DET
finefocus-4294	278	15	evolution	evolution	NOUN
finefocus-4294	278	16	of	of	ADP
finefocus-4294	278	17	pathways	pathway	NOUN
finefocus-4294	278	18	for	for	ADP
finefocus-4294	278	19	aromatic	aromatic	ADJ
finefocus-4294	278	20	hydrocarbon	hydrocarbon	NOUN
finefocus-4294	278	21	oxidation	oxidation	NOUN
finefocus-4294	278	22	in	in	ADP
finefocus-4294	278	23	pseudomonas	pseudomonas	PROPN
finefocus-4294	278	24	.	.	PUNCT
finefocus-4294	279	1	biodegradation	biodegradation	NOUN
finefocus-4294	279	2	,	,	PUNCT
finefocus-4294	279	3	5	5	NUM
finefocus-4294	279	4	,	,	PUNCT
finefocus-4294	279	5	195–217	195–217	NUM
finefocus-4294	279	6	.	.	PUNCT
finefocus-4294	280	1	https://doi.org/10.1007/bf00696460	https://doi.org/10.1007/bf00696460	PROPN
finefocus-4294	281	1	40	40	NUM
finefocus-4294	281	2	.	.	PUNCT
finefocus-4294	282	1	yang	yang	PROPN
finefocus-4294	282	2	,	,	PUNCT
finefocus-4294	282	3	y.	y.	PROPN
finefocus-4294	282	4	,	,	PUNCT
finefocus-4294	282	5	&	&	CCONJ
finefocus-4294	282	6	arnold	arnold	PROPN
finefocus-4294	282	7	,	,	PUNCT
finefocus-4294	282	8	f.	f.	PROPN
finefocus-4294	282	9	a.	a.	PROPN
finefocus-4294	282	10	(	(	PUNCT
finefocus-4294	282	11	2021	2021	NUM
finefocus-4294	282	12	)	)	PUNCT
finefocus-4294	283	1	navigating	navigate	VERB
finefocus-4294	283	2	the	the	DET
finefocus-4294	283	3	unnatural	unnatural	ADJ
finefocus-4294	283	4	reaction	reaction	NOUN
finefocus-4294	283	5	space	space	NOUN
finefocus-4294	283	6	:	:	PUNCT
finefocus-4294	283	7	directed	direct	VERB
finefocus-4294	283	8	evolution	evolution	NOUN
finefocus-4294	283	9	of	of	ADP
finefocus-4294	283	10	heme	heme	ADJ
finefocus-4294	283	11	proteins	protein	NOUN
finefocus-4294	283	12	for	for	ADP
finefocus-4294	283	13	selective	selective	ADJ
finefocus-4294	283	14	carbene	carbene	NOUN
finefocus-4294	283	15	and	and	CCONJ
finefocus-4294	283	16	nitrene	nitrene	ADJ
finefocus-4294	283	17	transfer	transfer	NOUN
finefocus-4294	283	18	.	.	PUNCT
finefocus-4294	284	1	accounts	account	NOUN
finefocus-4294	284	2	of	of	ADP
finefocus-4294	284	3	chemical	chemical	NOUN
finefocus-4294	284	4	research	research	NOUN
finefocus-4294	284	5	,	,	PUNCT
finefocus-4294	284	6	5	5	NUM
finefocus-4294	284	7	,	,	PUNCT
finefocus-4294	284	8	1209	1209	NUM
finefocus-4294	284	9	-	-	SYM
finefocus-4294	284	10	1225	1225	NUM
finefocus-4294	284	11	.	.	PUNCT
finefocus-4294	285	1	https://doi.org/10.1021/acs.accounts.0c00591	https://doi.org/10.1021/acs.accounts.0c00591	PROPN
finefocus-4294	285	2	41	41	NUM
finefocus-4294	285	3	.	.	PUNCT
finefocus-4294	286	1	zheng	zheng	PROPN
finefocus-4294	286	2	,	,	PUNCT
finefocus-4294	286	3	l.	l.	PROPN
finefocus-4294	286	4	,	,	PUNCT
finefocus-4294	286	5	baumann	baumann	PROPN
finefocus-4294	286	6	,	,	PUNCT
finefocus-4294	286	7	u.	u.	PROPN
finefocus-4294	286	8	,	,	PUNCT
finefocus-4294	286	9	reymond	reymond	NOUN
finefocus-4294	286	10	,	,	PUNCT
finefocus-4294	286	11	j.	j.	PROPN
finefocus-4294	286	12	l.	l.	PROPN
finefocus-4294	286	13	(	(	PUNCT
finefocus-4294	286	14	2004	2004	NUM
finefocus-4294	286	15	)	)	PUNCT
finefocus-4294	286	16	an	an	DET
finefocus-4294	286	17	efficient	efficient	ADJ
finefocus-4294	286	18	one	one	NUM
finefocus-4294	286	19	-	-	PUNCT
finefocus-4294	286	20	step	step	NOUN
finefocus-4294	286	21	site	site	NOUN
finefocus-4294	286	22	-	-	PUNCT
finefocus-4294	286	23	directed	direct	VERB
finefocus-4294	286	24	and	and	CCONJ
finefocus-4294	286	25	site	site	NOUN
finefocus-4294	286	26	-	-	PUNCT
finefocus-4294	286	27	saturation	saturation	NOUN
finefocus-4294	286	28	mutagenesis	mutagenesis	NOUN
finefocus-4294	286	29	protocol	protocol	NOUN
finefocus-4294	286	30	.	.	PUNCT
finefocus-4294	287	1	nucleic	nucleic	ADJ
finefocus-4294	287	2	acids	acid	NOUN
finefocus-4294	287	3	research	research	NOUN
finefocus-4294	287	4	,	,	PUNCT
finefocus-4294	287	5	32	32	NUM
finefocus-4294	287	6	,	,	PUNCT
finefocus-4294	287	7	e115	e115	PROPN
finefocus-4294	287	8	.	.	PUNCT
finefocus-4294	288	1	https://doi.org/10.1093/nar/gnh110	https://doi.org/10.1093/nar/gnh110	PROPN
finefocus-4294	288	2	42	42	NUM
finefocus-4294	288	3	.	.	PUNCT
finefocus-4294	289	1	zylstra	zylstra	PROPN
finefocus-4294	289	2	,	,	PUNCT
finefocus-4294	289	3	g.	g.	PROPN
finefocus-4294	289	4	,	,	PUNCT
finefocus-4294	289	5	&	&	CCONJ
finefocus-4294	289	6	gibson	gibson	PROPN
finefocus-4294	289	7	,	,	PUNCT
finefocus-4294	289	8	d.t	d.t	PROPN
finefocus-4294	289	9	.	.	PROPN
finefocus-4294	289	10	(	(	PUNCT
finefocus-4294	289	11	1989	1989	NUM
finefocus-4294	289	12	)	)	PUNCT
finefocus-4294	289	13	toluene	toluene	NOUN
finefocus-4294	289	14	degradation	degradation	NOUN
finefocus-4294	289	15	by	by	ADP
finefocus-4294	289	16	pseudomonas	pseudomona	NOUN
finefocus-4294	289	17	putida	putida	PROPN
finefocus-4294	289	18	f1	f1	PROPN
finefocus-4294	289	19	.	.	PUNCT
finefocus-4294	290	1	nucleotide	nucleotide	NOUN
finefocus-4294	290	2	sequence	sequence	NOUN
finefocus-4294	290	3	of	of	ADP
finefocus-4294	290	4	the	the	DET
finefocus-4294	290	5	todc1c2bade	todc1c2bade	NOUN
finefocus-4294	290	6	genes	gene	NOUN
finefocus-4294	290	7	and	and	CCONJ
finefocus-4294	290	8	their	their	PRON
finefocus-4294	290	9	expression	expression	NOUN
finefocus-4294	290	10	in	in	ADP
finefocus-4294	290	11	escherichia	escherichia	NOUN
finefocus-4294	290	12	coli	coli	NOUN
finefocus-4294	290	13	.	.	PUNCT
finefocus-4294	291	1	journal	journal	NOUN
finefocus-4294	291	2	of	of	ADP
finefocus-4294	291	3	biological	biological	ADJ
finefocus-4294	291	4	chemistry	chemistry	NOUN
finefocus-4294	291	5	,	,	PUNCT
finefocus-4294	291	6	264	264	NUM
finefocus-4294	291	7	,	,	PUNCT
finefocus-4294	291	8	14940	14940	NUM
finefocus-4294	291	9	-	-	SYM
finefocus-4294	291	10	14946	14946	NUM
finefocus-4294	291	11	.	.	PUNCT
finefocus-4294	292	1	https://doi.org/10.1016/s0021-9258(18)63793-7	https://doi.org/10.1016/s0021-9258(18)63793-7	PROPN
finefocus-4294	292	2	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	292	3	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	292	4	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN
finefocus-4294	292	5	https://doi.org/10.3390/molecules26113431	https://doi.org/10.3390/molecules26113431	NOUN